Novel dominant negative fas polypeptides, cells comprising thereof and uses thereof

Dominant-negative Fas polypeptides with specific modifications enhance the efficacy of engineered T cells by increasing surface expression and protecting against apoptosis, addressing the limitations of current adoptive cell therapies for solid malignancies and pathogen infections.

JP2025169261APending Publication Date: 2025-11-12MEMORIAL SLOAN KETTERING CANCER CENT +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025123847
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-01-06
Filing Date
2025-07-24
Publication Date
2025-11-12

AI Technical Summary

Technical Problem

Existing adoptive cell therapies using genetically modified T cells for treating solid malignancies and pathogen infections have shown modest efficacy, necessitating novel strategies to enhance the effectiveness of transferred T cells.

Method used

Development of dominant-negative Fas polypeptides with modifications in the cytoplasmic domain and N-terminal region, integrated with antigen-recognition receptors like CARs or TCRs, to increase surface expression, transduction efficiency, and protect against FasL-induced apoptosis, enhancing the persistence and efficacy of engineered immune cells.

Benefits of technology

The modified T cells demonstrate improved persistence, reduced apoptosis, and enhanced immune response, leading to increased efficacy in treating tumors and pathogen infections.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025169261000001_ABST
    Figure 2025169261000001_ABST
Patent Text Reader

Abstract

To provide novel strategies that enhance the potency of transferred T cells.SOLUTION: The present disclosure provides novel dominant negative Fas polypeptides comprising a first modification in the cytoplasmic domain and a second modification in the N-terminal region of human Fas. The present disclosure also provides cells comprising such novel dominant negative Fas polypeptides and an antigen-recognizing receptor (e.g., a chimeric antigen receptor (CAR) or a T cell receptor (TCR)). Also provided are uses of the cells for treatment, e.g., for treating tumors and pathogen infections.SELECTED DRAWING: Figure 1A-1C
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] [CROSS-REFERENCE TO RELATED APPLICATIONS] This application claims priority to U.S. Provisional Patent Application No. 62 / 957,608, filed January 6, 2020, the entire contents of which are incorporated herein by reference.

[0002] [Sequence table] This application contains a Sequence Listing that has been submitted via EFS-Web in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on January 6, 2021, is named 072734_1188_ST.txt and is 96169 bytes in size.

[0003] [Introduction] The present disclosure provides novel dominant-negative Fas polypeptides comprising a first modification in the cytoplasmic domain of human Fas and a second modification in the N-terminal region. The present disclosure also provides cells comprising such novel dominant-negative Fas polypeptides and an antigen-recognition receptor (e.g., a chimeric antigen receptor (CAR) or a T cell receptor (TCR)). Also provided are therapeutic uses of the cells, e.g., for treating tumors and pathogen infections. [Background technology]

[0004] Adoptive cellular immunotherapy using genetically modified autologous or allogeneic T cells and NK cells has shown evidence of therapeutic efficacy for a range of human cancers, including but not limited to melanoma and various B-cell malignancies. T cells can be engineered to target tumor-associated antigens by introducing genes encoding receptors, e.g., chimeric antigen receptors (CARs) or T cell receptors (TCRs), that convey specificity for antigens expressed by cancer or virus-infected cells. Such engineered immune cells represent a type of targeted immunotherapy that may offer treatment for cancer or infectious diseases.

[0005] Adoptive cell transfer (ACT) using genetically modified T cells has become the standard of care for patients with refractory B-cell malignancies, including pediatric acute lymphoblastic leukemia (1) and adult aggressive B-cell lymphoma (2). The exceptional efficacy of ACT in hematolymphoid malignancies has been consistently observed in clinical trials, regardless of the institution, gene vector, or cell composition (3-8). In contrast, responses to adoptive immunotherapy in patients with solid malignancies, which together represent the leading cause of cancer-related deaths in adults (9), have been relatively modest (10-13). Therefore, there remains a need for novel strategies to enhance the efficacy of transferred T cells. Summary of the Invention

[0006] The presently disclosed subject matter provides novel dominant-negative Fas polypeptides comprising a first modification in the cytoplasmic domain of human Fas and a second modification in the N-terminal region. The presently disclosed subject matter also provides cells comprising such novel dominant-negative Fas polypeptides and an antigen-recognition receptor (e.g., a chimeric antigen receptor (CAR) or a T cell receptor (TCR)). Therapeutic uses of the cells, for example, to treat tumors and pathogen infections, are also provided.

[0007] The presently disclosed subject matter provides dominant-negative Fas polypeptides comprising a first modification in the cytoplasmic death domain of human Fas and a second modification in the N-terminal region. In certain embodiments, the first modification and the second modification are each independently selected from the group consisting of a substitution, a deletion, and an insertion. In certain embodiments, the substitution is a point mutation.

[0008] In certain embodiments, the first modification comprises or consists of a deletion of amino acids 230-314 of human Fas. In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas.

[0009] In certain embodiments, the first modification comprises or consists of a point mutation at human Fas position 260. In certain embodiments, the first modification consists of a point mutation at human Fas position 260. In certain embodiments, the point mutation is D260V.

[0010] In certain embodiments, the second modification is located between the peptide signal region and cysteine-rich domain 1 of human Fas. In certain embodiments, the peptide signal region is encoded by amino acids 1 to 25 of human Fas. In certain embodiments, cysteine-rich domain 1 is encoded by amino acids 48 to 82 of human Fas.

[0011] In certain embodiments, the second modification comprises or consists of a modification of human Fas at position 32. In certain embodiments, the second modification comprises or consists of a deletion of amino acid 32 of human Fas. In certain embodiments, the second modification consists of a deletion of amino acid 32 of human Fas.

[0012] In certain embodiments, the dominant negative Fas polypeptide comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO: 16. In certain embodiments, the dominant negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 16.

[0013] In certain embodiments, the second modification further comprises a second modification at position 31. In certain embodiments, the second modification comprises or consists of a deletion of amino acids 31 and 32 of human Fas. In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:18. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:18.

[0014] In certain embodiments, the second modification further comprises a second modification at position 33. In certain embodiments, the second modification comprises or consists of a deletion of amino acids at positions 32 and 33 of human Fas. In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:20. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:20.

[0015] In certain embodiments, the second modification comprises or consists of a modification at position 33 of human Fas. In certain embodiments, the second modification further comprises a second modification at position 34. In certain embodiments, the second modification comprises or consists of a deletion of amino acids at positions 33 and 34 of human Fas. In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:22. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:22.

[0016] In certain embodiments, the second modification comprises or consists of a point mutation at position 32 of human Fas. In certain embodiments, the second modification comprises or consists of a point mutation S33A of human Fas. In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:24. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:24.

[0017] In certain embodiments, the human Fas comprises or consists of the amino acid sequence set forth in SEQ ID NO:10.

[0018] In certain embodiments, the first modification prevents binding between the dominant negative Fas polypeptide and the FADD polypeptide. In certain embodiments, the second modification increases (a) surface expression of the dominant negative Fas polypeptide by cells, and / or (b) transduction efficiency of the dominant negative Fas polypeptide into cells, and / or (c) protection of the dominant negative Fas polypeptide from FasL-induced apoptosis.

[0019] The presently disclosed subject matter provides cells comprising a) an antigen-recognizing receptor that binds to an antigen; and b) a dominant-negative Fas polypeptide disclosed herein. In certain embodiments, the dominant-negative Fas polypeptide enhances cell persistence. In certain embodiments, the dominant-negative Fas polypeptide reduces cellular apoptosis or anergy. In certain embodiments, the antigen-recognizing receptor is exogenous or endogenous. In certain embodiments, the antigen-recognizing receptor is expressed from a vector. In certain embodiments, the dominant-negative Fas polypeptide is expressed from a vector.

[0020] In certain embodiments, the cell is an immunoresponsive cell. In certain embodiments, the cell is a lymphoid cell or a myeloid cell. In certain embodiments, the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a B cell, a monocyte, and a macrophage. In certain embodiments, the cell is a T cell. In certain embodiments, the T cell is selected from the group consisting of a cytotoxic T lymphocyte (CTL), a regulatory T cell (T reg ), or natural killer T (NKT) cells. In certain embodiments, the cells are NK cells. In certain embodiments, the cells are autologous or allogeneic to the intended recipient.

[0021] In certain embodiments, the antigen is a tumor antigen or a pathogen antigen. In certain embodiments, the antigen is a tumor antigen. In certain embodiments, the antigen is a tumor-specific antigen. In certain embodiments, the antigen is a tumor-associated antigen. In certain embodiments, the tumor antigen is selected from the group consisting of CD19, MUC16, MUC1, CAIX, CEA, CD8, CD7, CD10, CD20, CD22, CD30, CLL1, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD133, CD138, EGP-2, EGP-40, EpCAM, Erb-B2, Erb-B3, Erb-B4, FBP, fetal acetylcholine receptor, folate receptor-α, GD2, GD3, HER-2, hTERT, IL-13R-α2, κ-light chain, KDR, KRAS mutant, HRAS mutant, PIK3CA mutant, IDH mutant, p53 mutant, In certain embodiments, the antigen is selected from the group consisting of variants, NRAS mutants, LeY, L1 cell adhesion molecule, MAGE-A1, mesothelin, MAGEA3, CT83 (also known as KK-LC-1), p53, MART1, GP100, proteinase 3 (PR1), tyrosinase, survivin, hTERT, EphA2, NKG2D ligand, NY-ESO-1, carcinoembryonic antigen (h5T4), PSCA, PSMA, ROR1, TAG-72, VEGF-R2, WT-1, BCMA, CD123, CD44V6, NKCS1, EGF1R, EGFR-VIII, CD99, CD70, ADGRE2, CCR1, LILRB2, PRAME, HPV E6 oncoprotein, HPV E7 oncoprotein, and ERBB. In certain embodiments, the antigen is CD19.

[0022] In certain embodiments, the antigen is a pathogen-associated antigen, hi certain embodiments, the pathogen-associated antigen is a viral antigen present in cytomegalovirus (CMV), a viral antigen present in Epstein-Barr virus (EBV), a viral antigen present in human immunodeficiency virus (HIV), or a viral antigen present in influenza virus.

[0023] In certain embodiments, the antigen-recognizing receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR). In certain embodiments, the antigen-recognizing receptor is a TCR that recognizes a pathogen-associated antigen, and the cell is a pathogen-specific T cell. In certain embodiments, the antigen-recognizing receptor is a TCR that recognizes a tumor antigen, and the cell is a tumor-specific T cell. In certain embodiments, the TCR is an endogenous TCR or a recombinant TCR.

[0024] In certain embodiments, the antigen recognition receptor is a CAR. In certain embodiments, the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain. In certain embodiments, the intracellular signaling domain comprises a native CD3ζ polypeptide. In certain embodiments, the intracellular signaling domain comprises a modified CD3ζ polypeptide. In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM1, an ITAM2 variant comprising two loss-of-function mutations, and an ITAM3 comprising two loss-of-function mutations. In certain embodiments, the intracellular signaling domain further comprises at least one costimulatory signaling region. In certain embodiments, the at least one costimulatory signaling region comprises a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof. In certain embodiments, the at least one costimulatory signaling region comprises a CD28 polypeptide.

[0025] In certain embodiments, the cell further comprises a suicide gene, hi certain embodiments, the suicide gene is herpes simplex virus thymidine kinase (hsv-tk), inducible caspase-9 suicide gene (iCasp-9), or truncated human epidermal growth factor receptor (EGFRt) polypeptide.

[0026] The presently disclosed subject matter further provides nucleic acid compositions comprising (a) a first nucleic acid sequence encoding an antigen-recognizing receptor that binds to an antigen, and (b) a second nucleic acid sequence encoding a dominant-negative Fas polypeptide disclosed herein. In certain embodiments, one or both of the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a promoter element. In certain embodiments, one or both of the first nucleic acid sequence and the second nucleic acid sequence are present on a vector. In certain embodiments, the vector is a retroviral vector. In certain embodiments, the vector is a lentiviral vector. The presently disclosed subject matter further provides cells comprising any of the nucleic acid compositions disclosed herein.

[0027] The presently disclosed subject matter further provides vectors comprising any of the nucleic acid compositions disclosed herein, and cells comprising any of the vectors disclosed herein.

[0028] Additionally, the presently disclosed subject matter provides a pharmaceutical composition comprising an effective amount of any of the cells disclosed herein and a pharmaceutically acceptable excipient.

[0029] In certain embodiments, the pharmaceutical composition is for treating and / or preventing a neoplasm or a pathogen infection.

[0030] The presently disclosed subject matter further provides methods for inducing and / or enhancing an immune response to a target antigen, which in certain embodiments comprise administering to a subject an effective amount of any of the cells or pharmaceutical compositions described herein.

[0031] The presently disclosed subject matter provides methods for reducing tumor burden in a subject. In certain embodiments, the methods comprise administering to the subject an effective amount of a cell disclosed herein or a pharmaceutical composition disclosed herein. In certain embodiments, the methods reduce the number of tumor cells, reduce tumor size, and / or eradicate tumors in the subject.

[0032] The presently disclosed subject matter further provides methods for treating and / or preventing neoplasms. In certain embodiments, the methods comprise administering to a subject an effective amount of any of the cells or pharmaceutical compositions disclosed herein.

[0033] Also provided are methods for prolonging survival of a subject having a neoplasm. In certain embodiments, the method comprises administering to the subject an effective amount of a cell disclosed herein or a pharmaceutical composition disclosed herein. In certain embodiments, the neoplasm is a malignant neoplasm.

[0034] In certain embodiments, the tumor or neoplasm is selected from the group consisting of B-cell leukemia, multiple myeloma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), non-Hodgkin's lymphoma, myeloid leukemia, and myelodysplastic syndrome (MDS). In certain embodiments, the tumor or neoplasm is a solid tumor. In certain embodiments, the solid tumor is a tumor originating from the brain, breast, lung, gastrointestinal tract (including the esophagus, stomach, small intestine, large intestine, and rectum), pancreas, prostate, soft tissue / bone, uterus, cervix, ovary, kidney, skin, thymus, testis, head and neck, or liver.

[0035] The presently disclosed subject matter further provides methods for preventing and / or treating a pathogen infection in a subject. In certain embodiments, the method comprises administering to the subject an effective amount of any of the cells or pharmaceutical compositions disclosed herein. In certain embodiments, the pathogen is selected from the group consisting of a virus, a bacterium, a fungus, a parasite, and a protozoan that can cause disease.

[0036] The presently disclosed subject matter also provides methods for producing antigen-specific cells. In certain embodiments, the methods include introducing into a cell (a) a first nucleic acid sequence encoding an antigen-recognizing receptor that binds to an antigen; and (b) a second nucleic acid sequence encoding a dominant-negative Fas polypeptide disclosed herein. In certain embodiments, one or both of the first and second nucleic acid sequences are operably linked to a promoter element. In certain embodiments, one or both of the first and second nucleic acid sequences are present on a vector. In certain embodiments, the vector is a retroviral vector.

[0037] The presently disclosed subject matter also provides kits comprising a cell disclosed herein, a nucleic acid composition disclosed herein, or a vector disclosed herein. In certain embodiments, the kit further comprises instructions for treating and / or preventing a neoplasm or pathogen infection. [Brief explanation of the drawings]

[0038] The following detailed description, given by way of example and not intended to limit the subject matter of the present disclosure to the particular embodiments described, can be understood in conjunction with the accompanying drawings. [Figures 1A-1C]Figures 1A-1E show the generation and activity of cells containing a chimeric antigen receptor (CAR) and a dominant-negative Fas polypeptide. Figure 1A shows two versions of the human FasDNR construct design. EGFRt represents a truncated EGFR. P2A represents the porcine teschovirus self-cleaving peptide sequence. FasDNR represents a Fas dominant-negative receptor. Ψ represents the retroviral packaging signal. 1928ζ1XXCAR represents an anti-CD19 chimeric antigen receptor containing an intracellular domain containing a modified CD3ζ and a costimulatory signaling region containing a CD28 polypeptide. Figure 1B is a schematic diagram of edited T cells. 1928ζ1XXCAR targeted CD19+ malignant cells. FasDNR protected T cells from FasL-induced apoptosis. When administered with cetuximab, EGFRt can be targeted to induce antibody-dependent cellular cytotoxicity (ADCC) or complement-dependent cytotoxicity. Figure 1C shows human-derived Jurkat cells retrovirally transduced with EGFRt alone or EGFRt / FasDNR. Cells were stained 2 days after transduction. [Figure 1D-1E] Figure 1D shows intracellular staining of TNFα on primary human CD8+ T cells transduced with a TCR targeting the NY-ESO antigen. Cells were exposed to antigen with or without FasDNR for 6 hours before intracellular cytokine staining. Figure 1E shows primary human CD8+ T cells exposed to 100 ng / ml FasL leucine zipper (FasL-lz) at the indicated time points. Activated caspase 3 / 7 and annexin V were used as early apoptosis markers. [Figure 2A-2B]Figures 2A-2C show Fas expression in single clones selected from CRISPR-edited Jurkat cells. Figure 2A shows Jurkat cells electroporated with recombinant Cas9 protein loaded with synthetic guide (sg) RNA targeting exon 2 of the human Fas gene. Fas surface expression was measured in edited T cells after single-cell cloning approximately 3 weeks after electroporation. WT represents the wild-type Fas gene sequence. Figure 2B shows data presented as a comparison of MFI of Fas expression levels; p-values ​​were determined by a paired Student's t-test comparing clones #15 and #17 (***p<0.001). [Figure 2C] Figure 2C shows a summary of the Fas gene sequence for each Jurkat clone. Underlining indicates the guide RNA target sequence. Bold sequences indicate deletions. Figure 2C discloses SEQ ID NOS: 69-74, respectively, in order of appearance. [Figure 3A] Figures 3A and 3B show the response of clone 17 Jurkat cells to FasL stimulation. Figure 3A shows the apoptosis assay of a single clone Jurkat cell after CRISPR editing. Cells were treated with 100 ng / ml FasL-LZ at the indicated time points. Clone #15, wild-type Fas exon 2 sequence. Clone #17, monoallelic 6 bp (2 codons) in-frame deletion. Clone #19, biallelic 19 bp (frameshift) deletion. [Figure 3B] Figure 3B shows triplicate data from the same apoptosis assay. Vertical bars indicate a comparison of clones #15 and #17 at each time point, with p values ​​determined by a paired Student's t-test for each matched sample (***p<0.001, ****p<0.0001). [Figure 4A]Figures 4A and 4B show the protection of Fas knockout clone 19 and FasDNR+ Jurkat cells from FasL-induced apoptosis. Figure 4A shows Jurkat cells exposed to 100 ng / ml FasL-LZ at the indicated time points. Clone #15WT, wild-type Fas exon 2 sequence. Clone #19 indel-19, Fas exon 2 with a 19-bp deletion calculated by ICE sequencing software. EGFRt+ and EGFRt+FasDNR+ represent Jurkat cells gated on EGFRt-positive (control) or EGFRt and FasDNR double-positive cells, respectively. [Figure 4B] FIG. 4B shows triplicate data from the same apoptosis assay as indicated by the early apoptotic markers mentioned above. [Figure 5] Figure 5 shows predicted expression-enhancing mutations in the N-terminal region of human Fas. Summary map of the functional regions of the Fas protein (335 amino acids). PLAD, preligand assembly domain. CRD, cysteine-rich domain. TM, transmembrane domain. DD, death domain. DNR del 222-306 indicates the FasDNR cleavage region. S32 (serine at amino acid 32) is the mutation site predicted to contribute to the phenotype of clone #17. Del32, deletion of S32. Del31-32, deletion of N31 and S32. Del32-33, deletion of S32 and K33. S32A, substitution of amino acid 32 from S to A. [Figure 6A] Figures 6A and 6B show the enhanced Fas transduction efficiency of Fas N-terminal mutants. Clone 19 Fas knockout Jurkat cells were transduced with Fas or FasDNR using S32 mutant retroviral vectors. Cells were stained for Fas expression 3 days after viral transduction. Gray solid line, control cells transduced with Fas WT (Figure 6A) or FasDNR (Figure 6B). Open dashed line, cells transduced with FasS32 mutants. [Figure 6B-1] (the above) [Figure 6B-2] (Continuation of Figure 6B-1) [Figure 7A-1]Figures 7A and 7B show the results of an apoptosis assay in Jurkat cells. Induction of apoptosis was performed using recombinant Fas ligand (CD178) oligomerized via the leucine zipper domain (lz-FASL) to mimic the naturally occurring active form of the ligand. FASL is known to trigger apoptosis by binding to the FAS receptor on responding cells. Cells were transduced with FASDNR with or without the S32 mutation and incubated with recombinant Fas ligand. Figure 7A shows FACS analysis of active caspase 3 and caspase 7 (x-axis) and annexin V staining (annexin V bound to the plasma membrane of cells undergoing apoptosis; y-axis) at various time points. Caspase 3 and caspase 7 are downstream signaling molecules involved in FAS signaling. Activation of caspases 3 and 7 is required for the initiation of apoptosis. [Figure 7A-2] (Continuation of Figure 7A-1) [Figure 7B] FIG. 7B shows a quantitative analysis of apoptosis measurements over time. [Figure 8] FIG. 8 shows Fas expression in human natural killer cells (NK cells) upon activation with human IL-2 and irradiated K562 clone 9 cells. [Figure 9] FIG. 9 shows the expression of Fas in human NK cells transduced with EGFRt / 1928z, EGFRt / 1928z / FasDNR, or EGFRt / 1928z / FasDNR del31-32. [Figure 10] FIG. 10 shows that expression of N-terminal mutant FasDNR in NK cells significantly increased the number of cells compared to FasDNR-modified and unmodified NK cells after exposure to Fas ligand. DETAILED DESCRIPTION OF THE INVENTION

[0039] The presently disclosed subject matter provides novel dominant-negative Fas polypeptides and cells comprising such polypeptides. In certain embodiments, the cells further comprise an antigen-recognition receptor (e.g., a TCR or CAR). The presently disclosed subject matter also provides methods of using such cells to treat and / or prevent neoplasms and pathogen infections. The presently disclosed subject matter is based, at least in part, on the discovery that the presence of modifications in the N-terminal region of a dominant-negative Fas polypeptide increases surface expression of the dominant-negative Fas polypeptide by cells, and / or increases the transduction efficiency of the dominant-negative Fas polypeptide into cells, and / or increases the protection of the dominant-negative Fas polypeptide from FasL-induced apoptosis.

[0040] 1.Definition Unless defined herein, all technical and scientific terms used in this detailed description have the meanings commonly understood by those skilled in the art of immuno-oncology, as reflected in the general definitions of many terms used in the subject matter of this disclosure contained, for example, in one or more of the following: Singleton et al., Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker, ed., 1988); The Glossary of Genetics, 5th ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale and Marham, The Harper Collins Dictionary of Biology (1991).

[0041] As used herein, the term "about" or "approximately" means within an acceptable error range for a particular value, as determined by one of ordinary skill in the art, and will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 3 or more standard deviations, in accordance with practice in the art. Alternatively, "about" can mean within a range of up to 20%, e.g., up to 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude of a value, e.g., within 5-fold or 2-fold of a value.

[0042] By "immunoresponsive cell" is meant a precursor cell or its progeny, including cells that function in an immune response or that initiate, activate, and / or regulate (increase or decrease) an immune response.

[0043] "Activating an immunoresponsive cell" refers to the induction of signal transduction or changes in protein expression in a cell that result in the initiation of an immune response. For example, clustering of CD3 chains in response to ligand binding and immunoreceptor tyrosine-based inhibitory motifs (ITAMs) generates a signaling cascade. In certain embodiments, binding of a TCR or CAR to an antigen leads to the formation of an immune synapse, which involves the clustering of many molecules (e.g., CD4 or CD8, CD3γ / δ / ε / ζ, etc.) near the bound receptor. This clustering of membrane-bound signaling molecules allows for the phosphorylation of ITAM motifs contained within the CD3 chains. This phosphorylation, in turn, initiates the T cell activation pathway, ultimately activating transcription factors such as NF-κB and AP-1. These transcription factors induce expression of all genes in T cells to initiate a T cell-mediated immune response, increasing IL-2 production for proliferation and expression of master regulatory T cell proteins.

[0044] "Stimulating immunoresponsive cells" refers to signals that result in a robust and long-lasting immune response. In various embodiments, this occurs after activation of immune cells (e.g., T cells) or is mediated simultaneously through receptors including, but not limited to, CD28, CD137 (4-1BB), OX40, CD40, and ICOS. While receiving multiple stimulatory signals can be important for initiating a robust and long-lasting T cell-mediated immune response, T cells that receive multiple stimulatory signals can quickly become inhibited and unresponsive to antigen, a state commonly referred to as "exhaustion." While the effects of these costimulatory signals can vary, they generally result in increased gene expression to generate long-lived, proliferative, and anti-apoptotic T cells that robustly respond to antigen for complete and sustained eradication.

[0045] As used herein, the term "antigen-recognizing receptor" refers to a receptor that can activate an immunoresponsive cell (e.g., a T cell) in response to its binding to an antigen. Non-limiting examples of antigen-recognizing receptors include natural or endogenous T cell receptors ("TCRs") and chimeric antigen receptors ("CARs").

[0046] As used herein, the term "antibody" refers not only to intact antibody molecules but also to fragments of antibody molecules that retain antigen-binding ability. Such fragments are also well known in the art and are commonly used both in vitro and in vivo. Thus, as used herein, the term "antibody" refers not only to intact immunoglobulin molecules but also to the well-known active fragments F(ab')2 and Fab. F(ab')2 and Fab fragments, which lack the Fe fragment of intact antibodies, clear more rapidly from the circulation and may have less nonspecific tissue binding than intact antibodies (Wahl et al., J. Nucl. Med. 24:316-325 (1983)). As used herein, the term "antibody" encompasses whole natural antibodies, bispecific antibodies, chimeric antibodies, Fab, Fab', single-chain V-region fragments (scFv), and fusion polypeptides.

[0047] As used herein, the term "complementarity determining region" or "CDR" refers to the hypervariable regions of immunoglobulin heavy and light chain amino acid sequences. See, e.g., Kabat et al., Sequences of Proteins of Immunological Interest, 4th USDapartment of Health and Human Services, National Institutes of Health (1987). Generally, antibodies contain three heavy chain and three light chain CDRs or CDR regions in the variable region. The CDRs provide the majority of contact residues for binding the antibody to its cognate antigen or epitope. In certain embodiments, CDR regions are numbered using the Kabat system (Kabat, EA et al. (1991) Sequences of Proteins of Immunological Interest, 5th ed., USDapartment of Health and Human Services, NIH Publication No. 91-3242).

[0048] As used herein, the term "single-chain variable fragment" or "scFv" refers to a covalently linked V H ::V L Heterodimerizing immunoglobulin heavy chains (V H ) and light chain (V L ) is a fusion protein of the variable region of V H and V L is directly bonded or V H N-terminus of V L and the C-terminus of V H The C-terminus of V LThe scFv protein retains the specificity of the original immunoglobulin despite the removal of the constant region and the introduction of the linker. Single-chain Fv polypeptide antibodies are synthesized by the V-type Fv polypeptide as described by Huston et al. (Proc. Nat. Acad. Sci. USA, 85:5879-5883, 1988). H Coding sequence and V L It can be expressed from a nucleic acid containing the coding sequence. See also U.S. Patent Nos. 5,091,513, 5,132,405, and 4,956,778; and U.S. Patent Application Publication Nos. 20050196754 and 20050196754. Antagonistic scFvs with inhibitory activity have been described (see, e.g., Zhao et al., Hyrbidoma (Larchmt) 2008 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle 2012 August 12; Shieh et al., J Imunol 2009 183(4):2277-85; Giomarelli et al., Thromb Haemost 2007 97(6):955-63; Fife et al., J Clin Invst 2006 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., The Immunol 1995 2(10:31-40)). Agonistic scFvs with stimulatory activity have been described (see, e.g., Peter et al., J Biol Chem 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).

[0049] As used herein, the term "affinity" refers to a measure of binding strength. Affinity may depend on the closeness of the stereochemical fit between the antibody binding site and the antigenic determinant, the size of the contact area between them, and / or the distribution of charged and hydrophobic groups. Methods for calculating the affinity of an antibody for an antigen are known in the art, including, but not limited to, various antigen binding experiments, such as functional assays (e.g., flow cytometry assays).

[0050] As used herein, the term "chimeric antigen receptor" or "CAR" refers to a molecule (e.g., a synthetic receptor) that comprises an extracellular antigen-binding domain fused to an intracellular signaling domain that can activate or stimulate immunoresponsive cells. In certain embodiments, the CAR further comprises a transmembrane domain. In certain embodiments, the extracellular antigen-binding domain of the CAR comprises an scFv. The scFv can be derived from the fusion of the variable heavy and light chain regions of an antibody. In certain embodiments, the scFv can be derived from a Fab (e.g., obtained from a Fab library instead of from an antibody). In certain embodiments, the scFv is fused to a transmembrane domain, which is then fused to an intracellular signaling domain. In certain embodiments, the CAR is selected to have high binding affinity, or avidity, for the antigen.

[0051] As used herein, the term "nucleic acid molecule" includes any nucleic acid molecule encoding a polypeptide of interest (e.g., a dominant-negative Fas polypeptide or an antigen-recognizing receptor) or a fragment thereof. Such a nucleic acid molecule need not be 100% homologous or identical to an endogenous nucleic acid sequence, but may exhibit substantial identity. A polynucleotide having "substantial identity" or "substantial homology" to an endogenous sequence is typically capable of hybridizing to at least one strand of a double-stranded nucleic acid molecule.

[0052] As used herein, the term "conservative sequence modification" refers to an amino acid modification in a protein in which an amino acid having specific physicochemical properties is replaced with another amino acid having the same physicochemical properties (e.g., replacing one basic amino acid with another). In certain embodiments, such substitutions are unlikely to significantly affect the activity of the protein (e.g., conservative substitutions in antibody CDRs are unlikely to significantly affect or change the binding properties of the protein). Modifications can be introduced into the human scFv of the CAR of the present disclosure by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Amino acids can be classified into groups according to their physicochemical properties, such as charge and polarity. In certain embodiments, conservative modifications are conservative amino acid substitutions. Conservative amino acid substitutions are substitutions in which an amino acid residue is replaced with an amino acid within the same group. For example, amino acids can be classified by charge: positively charged amino acids include lysine, arginine, and histidine, negatively charged amino acids include aspartic acid and glutamic acid, and neutrally charged amino acids include alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. Additionally, amino acids can be classified by polarity: polar amino acids include arginine (basic polar), asparagine, aspartic acid (acidic polar), glutamic acid (acidic polar), glutamine, histidine (basic polar), lysine (basic polar), serine, threonine, and tyrosine; nonpolar amino acids include alanine, cysteine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, and valine. In certain embodiments, conservative substitutions include substitutions within the following group: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.In certain embodiments, one or more amino acid residues within or outside the CDR regions can be replaced with other amino acid residues from the same group, and the altered antibodies can be tested for retained function (i.e., the functions set forth in (c) through (l) above) using the functional assays described herein. In certain embodiments, no more than 1, no more than 2, no more than 3, no more than 4, or no more than 5 residues outside the CDR regions or within the specified sequences of the CDR regions are altered.

[0053] In certain embodiments, the percent homology between two amino acid sequences is equal to the percent identity between the two sequences. The percent identity between two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps and the length of each gap that need to be introduced for optimal alignment of the two sequences (i.e., % homology = # identical positions / total # positions x 100). The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.

[0054] The percent homology or identity between two amino acid sequences can be determined using the E. Meyers and W. Miller (Comput. Appl. Biosci., 4:11-17 (1988)) algorithm incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Additionally, the percent homology between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol. 48:444-453 (1970)) algorithm incorporated into the GAP program in the GCG software package (available at www.gcg.com) using either a Blossum62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0055] In certain embodiments, the amino acid sequences of the presently disclosed subject matter can further be used as a "query sequence" to perform a search against public databases, for example, to identify related sequences. Such searches can be performed using the XBLAST program (version 2.0) of Altschul et al. (1990) J. Mol. Biol. 215:403-10. BLAST protein searches can be performed using the XBLAST program, score=50, wordlength=3, to obtain amino acid sequences homologous to the sequences identified herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0056] Furthermore, sequence identity can be measured by using sequence analysis software (e.g., the BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX programs in the sequence analysis software package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications.

[0057] "Substantially identical" or "substantially homologous" refers to a polypeptide or nucleic acid molecule that exhibits at least about 50% homology or identity to a reference amino acid sequence (e.g., any one of the amino acid sequences set forth herein) or nucleic acid sequence (e.g., any one of the nucleic acid sequences set forth herein). In certain embodiments, such a sequence is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or at least about 100% homologous or identical to the amino acid or nucleic acid sequence used for comparison.

[0058] In an exemplary approach to determining the degree of identity, the BLAST program may be used, with a probability score between e-3 and e-100 indicating closely related sequences.

[0059] "Analog" means a structurally related polypeptide or nucleic acid molecule that has the function of a reference polypeptide or nucleic acid molecule.

[0060] As used herein, the term "ligand" refers to a molecule that binds to a receptor. In certain embodiments, a ligand binds to a receptor on another cell, allowing recognition and / or interaction between the cells.

[0061] As used herein, the term "constitutive expression" or "constitutively expressed" refers to expression or being expressed under all physiological conditions.

[0062] By "disease" is meant any condition, disease or disorder that damages or interferes with the normal function of a cell, tissue or organ, for example, neoplasms and pathogenic infections of cells.

[0063] An "effective amount" (or "therapeutically effective amount") is an amount sufficient to affect a beneficial or desired clinical outcome during treatment. An effective amount can be administered to a subject in one or more doses. In terms of treatment, an effective amount is an amount sufficient to palliate, ameliorate, stabilize, reverse, or slow the progression of, or otherwise reduce the pathological consequences of, the disease. An effective amount is generally determined by a physician on a case-by-case basis and is within the skill of one of ordinary skill in the art. Several factors are typically considered when determining the appropriate dosage to achieve an effective amount. These factors include the age, sex, and weight of the subject, the condition being treated, the severity of the condition, and the form and effective concentration of the immunoresponsive cells administered.

[0064] "Enhancing tolerance" means preventing the activity of autoreactive or immunoresponsive cells that target the transplanted organ or tissue.

[0065] "Endogenous" means a nucleic acid molecule or polypeptide that is normally expressed in a cell or tissue.

[0066] "Exogenous" refers to a nucleic acid molecule or polypeptide that is not endogenously present in a cell. Thus, the term "exogenous" will encompass any recombinant nucleic acid molecule or polypeptide expressed in a cell, including foreign, heterologous, and overexpressed nucleic acid molecules and polypeptides. An "exogenous" nucleic acid refers to a nucleic acid that is not present in a native, wild-type cell; for example, an exogenous nucleic acid can differ from its endogenous counterpart by sequence, position / location, or both. For clarity, an exogenous nucleic acid can have the same or a different sequence compared to its native, endogenous counterpart; it can be introduced into the cell itself or its progenitor cell by genetic engineering and can optionally be linked to alternative regulatory sequences, such as non-native promoters or secretory sequences.

[0067] By "heterologous nucleic acid molecule or polypeptide" is meant a nucleic acid molecule (e.g., a cDNA, DNA, or RNA molecule) or polypeptide that is not normally present in a cell or in a sample obtained from a cell. The nucleic acid may be from another organism or may be, for example, an mRNA molecule that is not normally expressed in the cell or sample.

[0068] By "modulate" is meant to alter, either positively or negatively. Exemplary modulations include changes of about 1%, about 2%, about 5%, about 10%, about 25%, about 50%, about 75%, or about 100%.

[0069] By "increase" is meant a positive change of at least about 5%. The change can be about 5%, about 10%, about 25%, about 30%, about 50%, about 75%, about 100% or more.

[0070] By "reduce" is meant to negatively alter by at least about 5%. The alteration can be about 5%, about 10%, about 25%, about 30%, about 50%, about 75%, or even about 100%.

[0071] By "isolated cells" is meant cells that have been separated from molecules and / or cellular components that naturally accompany the cells.

[0072] The terms "isolated," "purified," or "biologically pure" refer to material that is, to varying degrees, free from components that normally accompany it as found in its native state. "Isolated" indicates a degree of separation from the original source or surroundings. "Purified" indicates a degree of separation greater than isolation. A "purified" or "biologically pure" protein is sufficiently free from other materials so that any impurities do not substantially affect the biological properties of the protein or cause other adverse consequences. That is, a nucleic acid or peptide is purified when it is substantially free of cellular material, viral material, or culture medium if produced by recombinant DNA techniques, or chemical precursors or other chemicals if chemically synthesized. Purity and homogeneity are typically determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high-performance liquid chromatography. The term "purified" can indicate that the nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. In proteins that are subject to modifications, such as phosphorylation or glycosylation, different modifications may result in different isolated proteins that can be purified separately.

[0073] As used herein, the term "antigen-binding domain" refers to a domain that is capable of specifically binding to a particular antigenic determinant or set of antigenic determinants present on a cell.

[0074] As used herein, "linker" is intended to mean a functional group (e.g., a chemical or polypeptide) that covalently joins two or more polypeptides or nucleic acids such that they are linked together. As used herein, a "peptide linker" is a linker that connects two proteins together (e.g., a V H and V L A linker refers to one or more amino acids used to link (connect) domains. In certain embodiments, the linker comprises the sequence set forth in GGGGSGGGSGGGGGS [SEQ ID NO: 1].

[0075] "Neoplasm" refers to a disease characterized by the pathological proliferation of cells or tissues and subsequent migration or invasion of other tissues or organs. Neoplastic growth is typically uncontrolled and progressive, occurring under conditions that would not induce proliferation of normal cells or cause their cessation. Neoplasms can affect a variety of cell types, tissues, or organs, including, but not limited to, organs selected from the group consisting of bladder, bone, brain, breast, cartilage, glia, esophagus, fallopian tubes, gallbladder, heart, intestine, kidney, liver, lung, lymph nodes, nervous tissue, ovaries, pancreas, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testes, thymus, thyroid, trachea, genitourinary tract, ureter, urethra, uterus, and vagina, or tissues or cell types thereof. Neoplasms include cancers such as sarcomas, carcinomas, or plasmacytomas (malignant tumors of plasma cells).

[0076] By "receptor" is meant a polypeptide or portion thereof present on a cell membrane that selectively binds to one or more ligands.

[0077] "Recognize" refers to selective binding to a target. T cells that recognize tumors can express receptors (e.g., TCRs or CARs) that bind to tumor antigens.

[0078] "Reference" or "control" refers to a standard for comparison. For example, the level of scFv-antigen binding by cells expressing a CAR and an scFv can be compared to the level of scFv-antigen binding in corresponding cells expressing the CAR alone.

[0079] By "secreted" is meant a polypeptide that is released from the cell via the secretory pathway through the endoplasmic reticulum, the Golgi apparatus, and as vesicles that transiently fuse with the cell plasma membrane, releasing the protein outside the cell.

[0080] By "signal sequence" or "leader sequence" is meant a peptide sequence (e.g., 5, 10, 15, 20, 25, or 30 amino acids) present at the N-terminus of newly synthesized proteins that directs their entry into the secretory pathway. Exemplary leader sequences include, but are not limited to, the IL-2 signal sequence: MYRMQLLSCIALSLALVTNS [SEQ ID NO:2] (human), MYSMQLASCVTLTLVLLVNS [SEQ ID NO:3] (mouse); kappa leader sequence: METPAQLLFLLLLWLPDTTG [SEQ ID NO:4] (human), METDTLLLWVLLLWVPGSTG [SEQ ID NO:5] (mouse); CD8 leader sequence: MALPVTALLLPLALLLHAARP [SEQ ID NO:6] (human); truncated human CD8 signal peptide: MALPVTALLLPLALLLHA [SEQ ID NO:7] (human); albumin signal sequence: MKWVTFISLLFSSAYS [SEQ ID NO:8] (human); and prolactin signal sequence: MDSKGSSQKGSRLLLLLVVSNLLLCQGVVS [SEQ ID NO:9] (human). "Soluble" refers to a polypeptide that is freely diffusible (e.g., not membrane-bound) in an aqueous environment.

[0081] By "specifically binds" is meant a polypeptide or fragment thereof that recognizes and binds to a biological molecule of interest (e.g., a polypeptide) but does not substantially recognize or bind to other molecules in a sample, e.g., a biological sample, that naturally contains a polypeptide of the present disclosure.

[0082] The term "tumor antigen" as used herein refers to an antigenic substance produced by tumor cells. Tumor antigens can provoke an immune response in the host. As used herein, the term "tumor antigen" includes tumor-specific antigens (TSAs) and tumor-associated antigens (TAAs). TSAs refer to antigens that are uniquely or differentially expressed on tumor cells compared to normal cells, e.g., present only on tumor cells and not on normal cells. In certain embodiments, tumor antigens include any polypeptide expressed by tumors that can activate or induce an immune response via antigen-recognition receptors (e.g., CD19, MUC-16) or suppress an immune response via receptor-ligand binding (e.g., CD47, PD-L1 / L2, B7.1 / 2). TAAs are antigens that are present on some tumor cells and also on some normal cells.

[0083] The terms "comprises" and "comprising" are intended to have the broad meaning ascribed to them in U.S. patent law and may mean "includes," "including," etc.

[0084] As used herein, "treatment" refers to a clinical intervention that seeks to alter the disease course of the individual or cell being treated, and can be performed for prophylaxis or during the course of clinical pathology. The therapeutic effect of treatment includes, but is not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, ameliorating or alleviating the disease state, and remission or improved prognosis. By preventing the progression of a disease or disorder, treatment can prevent progression due to the disorder in an affected or diagnosed subject or a subject suspected of having the disorder, but treatment can also prevent the onset of the disorder or symptoms of the disorder in a subject at risk of or suspected of having the disorder.

[0085] As used herein, an "individual" or "subject" refers to a vertebrate, such as a human or non-human animal, e.g., a mammal. Mammals include, but are not limited to, humans, primates, farm animals, sport animals, rodents, and pets. Non-limiting examples of non-human animal subjects include rodents, such as mice, rats, hamsters, and guinea pigs; pigs; rabbits; dogs; cats; sheep; pigs; goats; cows; horses; and non-human primates, such as apes and monkeys. The term "immunocompromised," as used herein, refers to a subject who is immunocompromised. Subjects are highly vulnerable to opportunistic infections, which are infectious diseases caused by organisms that do not normally cause disease in people with healthy immune systems but can affect people with poorly functioning or suppressed immune systems.

[0086] Other aspects of the presently disclosed subject matter are described in the following disclosure and are within the scope of the presently disclosed subject matter.

[0087] 2. Dominant-negative Fas polypeptide Fas cell surface death receptor (Fas) is also known as APT1; CD95; FAS1; APO-1; FASTM; ALPS1A; TNFRSF6. GenBank ID: 355 (human), 14102 (mouse), 246097 (rat), 282488 (bovine), 486469 (dog). Protein products of Fas include, but are not limited to, NCBI reference sequences NP_000034.1, NP_001307548.1, NP_690610.1, and NP_690611.1.

[0088] Fas is a member of the TNF receptor superfamily and contains a death domain. In human Fas, the death domain is encoded by amino acids 226-319. Fas is involved in the regulation of programmed cell death and has been implicated in the pathogenesis of various malignancies and immune system disorders. The interaction of Fas with its ligands allows the formation of a cell death-inducing signaling complex with other components, such as Fas-associated protein (FADD), which contains a death domain and can induce programmed cell death, also known as apoptosis.

[0089] In certain embodiments, the term "dominant-negative Fas polypeptide" refers to a dominant-negative form of a Fas polypeptide that is the gene product of a dominant-negative mutation of the Fas gene. In certain embodiments, a Fas polypeptide containing a dominant-negative mutation (also called an "antimorph mutation") is an altered gene product that acts antagonistically to a wild-type Fas polypeptide. In certain embodiments, a dominant-negative Fas polypeptide adversely affects a normal, wild-type Fas polypeptide in the same cell. In certain embodiments, a dominant-negative Fas polypeptide interacts with a wild-type Fas polypeptide but blocks its signaling to downstream molecules, e.g., FADD.

[0090] In certain embodiments, the dominant-negative Fas polypeptide comprises a first modification in the intracellular domain of human Fas and a second modification in the N-terminal region. In certain embodiments, the first modification is within the cytoplasmic death domain. In certain embodiments, the first modification prevents binding of Fas to a FADD polypeptide. In certain embodiments, the second modification is located between the peptide signal region and cysteine-rich domain 1 of Fas (e.g., human Fas). In certain embodiments, the peptide signal region of human Fas is encoded by amino acids 1 to 25 of human Fas. In certain embodiments, cysteine-rich domain 1 of human Fas is encoded by amino acids 48 to 82 of human Fas.

[0091] No known function has been described for the region between the peptide signal region and cysteine-rich domain 1 of Fas (e.g., human Fas). Using a CRISPR / Cas9 screen, the inventors discovered that modifications in this region (e.g., truncation of serine 32) enhance Fas cell surface expression. This function is independent of the primary modification and can be combined with dominant-negative Fas polypeptides to further improve their surface expression and dominant-negative function.

[0092] In certain embodiments, human Fas comprises or consists of the amino acid sequence of NCBI Reference No. NP_000034.1 (SEQ ID NO: 10), provided below. In certain embodiments, human Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 10. JPEG2025169261000002.jpg30166

[0093] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:10 is shown in SEQ ID NO:11, provided below. JPEG2025169261000003.jpg68170

[0094] 2.1. First modification In certain embodiments, the first modification is within the cytoplasmic death domain of Fas. In certain embodiments, the first modification is within about amino acids 200 to 320 of human Fas (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:10). In certain embodiments, the first modification is within about amino acids 200 to 319 of human Fas (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:10). In certain embodiments, the first modification is within about amino acids 202 to 319 of human Fas (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:10). In certain embodiments, the first modification is within about amino acids 226 to 319 of human Fas (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:10). The death domain of the Fas protein is disclosed in Tartaglia LA et al. Cell. (1993); 74(5):845-53; Itoh and Nagata. J Biol Chem. (1993); 268(15):10932; Boldin MP et al. J Biol Chem. (1995); 270(14):7795-8; and Huang B et al. Nature (1996); 384(6610):638-41, all of which are incorporated herein by reference.

[0095] In certain embodiments, the first modification is selected from the group consisting of a substitution, a deletion, and an insertion. In certain embodiments, the substitution is a point mutation.

[0096] In certain embodiments, the first modification is a deletion. In certain embodiments, the first modification comprises a partial or complete deletion of the death domain. In certain embodiments, the first modification comprises or consists of a deletion of amino acid residues 230-314 of a human wild-type Fas polypeptide (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:10). In certain embodiments, the first modification consists of a deletion of amino acid residues 230-314 of a human wild-type Fas polypeptide (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:10). In certain embodiments, a dominant-negative polypeptide comprises a first modification consisting of a deletion of amino acid residues 230-314 of a human wild-type Fas polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:10. In certain embodiments, a dominant-negative polypeptide is referred to as "hFas ΔDD In certain embodiments, hFas ΔDD comprises or consists of the amino acid sequence shown in SEQ ID NO: 12. SEQ ID NO: 12 is provided below. JPEG2025169261000004.jpg20168

[0097] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:12 is shown in SEQ ID NO:13, provided below. JPEG2025169261000005.jpg50168

[0098] In certain embodiments, the first modification comprises a point mutation. In certain embodiments, the first modification comprises or consists of a point mutation at position 260 of a human Fas polypeptide (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:10). In certain embodiments, the point mutation comprises D260V. In certain embodiments, the first modification comprises the point mutation D260V of a human wild-type Fas polypeptide. In certain embodiments, a dominant-negative polypeptide comprises a first modification comprising the point mutation D260V of a human wild-type Fas polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:10. In certain embodiments, a dominant-negative polypeptide is referred to as "hFas D260VIn certain embodiments, hFas D260V comprises or consists of the amino acid sequence shown in SEQ ID NO: 14. SEQ ID NO: 14 is provided below. JPEG2025169261000006.jpg24170

[0099] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:14 is shown in SEQ ID NO:15, provided below. JPEG2025169261000007.jpg68170

[0100] Second modification The second modification is in the N-terminal region of the human Fas polypeptide.

[0101] In certain embodiments, the second modification is located between the peptide signal region and cysteine-rich domain 1 of Fas (e.g., human Fas). In certain embodiments, the peptide signal region of human Fas is encoded by amino acids 1 to 25 of human Fas. In certain embodiments, the peptide signal region of human Fas is encoded by amino acids 1 to 25 of SEQ ID NO:10. In certain embodiments, cysteine-rich domain 1 of human Fas is encoded by amino acids 48 to 82 of human Fas. In certain embodiments, cysteine-rich domain 1 of human Fas is encoded by amino acids 48 to 82 of SEQ ID NO:10. In certain embodiments, the second modification is within amino acids 26 to 47 of human Fas. In certain embodiments, the second modification is within amino acids 26 to 47 of SEQ ID NO:10.

[0102] In certain embodiments, the second modification is selected from the group consisting of a substitution, a deletion, and an insertion. In certain embodiments, the substitution is a point mutation. In certain embodiments, the second modification is within amino acids 26 to 36 of SEQ ID NO:10. In certain embodiments, the second modification is within amino acids 26 to 35 of SEQ ID NO:10. In certain embodiments, the second modification comprises one or two point mutations or a single amino acid deletion within amino acids 26 to 36 of SEQ ID NO:10. In certain embodiments, the second modification comprises one or two point mutations or a single amino acid deletion within amino acids 26 to 35 of SEQ ID NO:10. In certain embodiments, the second modification increases surface expression of the dominant negative Fas polypeptide by cells and / or increases the transduction efficiency of the dominant negative Fas polypeptide into cells. In certain embodiments, the second modification increases protection of the dominant negative Fas polypeptide from FasL-induced apoptosis. In certain embodiments, the protection conferred by a dominant negative Fas polypeptide is measured by the viability of cells expressing the dominant negative Fas polypeptide following FasL stimulation.

[0103] In certain embodiments, the second modification comprises or consists of a modification at position 32 of a human dominant-negative Fas polypeptide (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:14). In certain embodiments, the second modification comprises or consists of a modification at position 33 of a human dominant-negative Fas polypeptide (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:14).

[0104] In certain embodiments, the second modification comprises or consists of a deletion. In certain embodiments, the second modification comprises or consists of the deletion of at most 1, at most 2, at most 3, at most 4, or at most 5 amino acids. In certain embodiments, the second modification comprises or consists of the deletion of one amino acid. In certain embodiments, the second modification comprises or consists of the deletion of the amino acid at position 32. In certain embodiments, the second modification comprises or consists of the deletion of the amino acid at position 33.

[0105] In certain embodiments, the second modification consists of a deletion of the amino acid at position 32. In certain embodiments, the deletion consists of a deletion of amino acid 32 of a human dominant-negative Fas polypeptide (e.g., a human dominant-negative Fas polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:14).

[0106] In certain embodiments, the first modification consists of the point mutation D260V in human Fas and the second modification consists of a deletion of amino acid 32 in human Fas.

[0107] In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas, and the second modification consists of a deletion of amino acid 32 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of a first modification consisting of a deletion of amino acid 32 of human wild-type Fas polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:10, and a second modification consisting of a deletion of amino acids 230-314. In certain embodiments, the dominant-negative Fas polypeptide is designated "Fas del S32DNR." In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:16, provided below. JPEG2025169261000008.jpg21169

[0108] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:16 is shown in SEQ ID NO:17, provided below. JPEG2025169261000009.jpg51168

[0109] In certain embodiments, a dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 16. In certain embodiments, a dominant negative Fas polypeptide comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 16 comprises or consists of a first modification consisting of a deletion of amino acids 230-314 and a second modification consisting of a deletion of amino acid 32 of a human wild-type Fas polypeptide (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 10).

[0110] In certain embodiments, the second modification comprises or consists of a deletion of two amino acids. In certain embodiments, the second modification comprises or consists of a deletion of the amino acid at position 32. In certain embodiments, the second modification comprises or consists of a deletion of two amino acids at positions 31 and 32.

[0111] In certain embodiments, the second modification consists of a deletion of two amino acids at positions 31 and 32. In certain embodiments, the deletion is a deletion of amino acids 31 and 32 of a human dominant-negative Fas polypeptide (e.g., a human dominant-negative Fas polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:14).

[0112] In certain embodiments, the first modification consists of the point mutation D260V in human Fas, and the second modification consists of a deletion of amino acids 31 and 32 of human Fas.

[0113] In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas, and the second modification consists of a deletion of amino acids 31 and 32 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of a first modification consisting of a deletion of amino acids 230-314 of human wild-type Fas polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:10, and a second modification consisting of a deletion of amino acids 31 and 32. In certain embodiments, the dominant-negative Fas polypeptide is designated "Fas del N31S32 DNR," "FasDNR del31-32," or "Fas del31-32DNR." In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:18, provided below. JPEG2025169261000010.jpg28169

[0114] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:18 is shown in SEQ ID NO:19, provided below. JPEG2025169261000011.jpg51168

[0115] In certain embodiments, a dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 18. In certain embodiments, a dominant negative Fas polypeptide comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 18 comprises or consists of a first modification consisting of a deletion of amino acids 230-314 and a second modification consisting of a deletion of amino acids 31 and 32 of a human Fas polypeptide (e.g., one comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 10).

[0116] In certain embodiments, the second modification comprises or consists of a deletion of amino acids at positions 32 and 33. In certain embodiments, the deletion is a deletion of amino acids 32 and 33 of a human dominant-negative Fas polypeptide (e.g., a human dominant-negative Fas polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:14).

[0117] In certain embodiments, the first modification consists of the point mutation D260V in human Fas, and the second modification consists of a deletion of amino acids 32 and 33 in human Fas.

[0118] In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas, and the second modification consists of a deletion of amino acids 32 and 33 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of a first modification consisting of a deletion of amino acids 230-314 of human wild-type Fas polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:10, and a second modification consisting of a deletion of amino acids 32 and 33. In certain embodiments, the dominant-negative Fas polypeptide is designated "Fas del S32K33 DNR." In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:20, provided below. JPEG2025169261000012.jpg20169

[0119] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:20 is shown in SEQ ID NO:21, provided below. JPEG2025169261000013.jpg51168

[0120] In certain embodiments, a dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 20. In certain embodiments, a dominant negative Fas polypeptide comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 20 comprises or consists of a first modification consisting of a deletion of amino acids 230-314 and a second modification consisting of a deletion of amino acids 32 and 33 of a human Fas polypeptide (e.g., one comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 10).

[0121] In certain embodiments, the second modification comprises or consists of a deletion of the amino acid at position 33. In certain embodiments, the second modification comprises or consists of a deletion of the amino acids at positions 33 and 34. In certain embodiments, the deletion comprises or consists of a deletion of amino acids 33 and 34 of a human dominant-negative Fas polypeptide (e.g., a human dominant-negative Fas polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:14).

[0122] In certain embodiments, the first modification consists of the point mutation D260V in human Fas, and the second modification consists of a deletion of amino acids 33 and 34 in human Fas.

[0123] In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas, and the second modification consists of a deletion of amino acids 33 and 34 of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of a first modification consisting of a deletion of amino acids 230-314 of human wild-type Fas polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:10, and a second modification consisting of a deletion of amino acids 33 and 34. In certain embodiments, the dominant-negative Fas polypeptide is designated "Fas del K33G34 DNR." In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:22, provided below. JPEG2025169261000014.jpg20170

[0124] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:22 is shown in SEQ ID NO:23, provided below. JPEG2025169261000015.jpg50169

[0125] In certain embodiments, a dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 22. In certain embodiments, a dominant negative Fas polypeptide comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 22 comprises or consists of a first modification consisting of a deletion of amino acids 230-314 and a second modification consisting of a deletion of amino acids 33 and 34 of a human Fas polypeptide (e.g., one comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 10).

[0126] In certain embodiments, the second modification consists of a point mutation. In certain embodiments, the point mutation is at position 32 of the human dominant-negative Fas polypeptide (e.g., a human dominant-negative Fas polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO:12 or SEQ ID NO:14). In certain embodiments, the point mutation is S32A.

[0127] In certain embodiments, the first modification consists of the point mutation D260V in human Fas and the second modification consists of the point mutation S32A in human Fas.

[0128] In certain embodiments, the first modification consists of a deletion of amino acids 230-314 of human Fas, and the second modification consists of the point mutation S32A of human Fas. In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of a first modification consisting of a deletion of amino acids 230-314 of human wild-type Fas polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:10, and a second modification consisting of the point mutation S32A. In certain embodiments, the dominant-negative Fas polypeptide is designated "Fas S32A DNR." In certain embodiments, the dominant-negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:24. SEQ ID NO:24 is provided below. JPEG2025169261000016.jpg20168

[0129] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:24 is shown in SEQ ID NO:25, provided below. JPEG2025169261000017.jpg52168

[0130] In certain embodiments, a dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 24. In certain embodiments, a dominant negative Fas polypeptide comprising or consisting of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 24 comprises or consists of a first modification consisting of a deletion of amino acids 230-314 of a human Fas polypeptide (e.g., comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 10) and a second modification consisting of the point mutation S32A.

[0131] In certain embodiments, the dominant negative Fas polypeptide comprises a heterologous signal peptide, such as the IL-2 signal peptide, the kappa leader sequence, the CD8 leader sequence, or a peptide with essentially equivalent activity.

[0132] 3. Antigen-recognition receptors The present disclosure provides an antigen-recognizing receptor that binds to an antigen. In certain embodiments, the antigen-recognizing receptor is a chimeric antigen receptor (CAR). In certain embodiments, the antigen-recognizing receptor is a T cell receptor (TCR). The antigen-recognizing receptor can bind to a tumor antigen or a pathogen antigen. In certain embodiments, the antigen-recognizing receptor binds to a tumor antigen. In certain embodiments, the tumor antigen is a tumor-specific antigen or a tumor-associated antigen.

[0133] 3.1. Antigen In certain embodiments, the antigen-recognizing receptor binds to a tumor antigen. Any tumor antigen (antigenic peptide) can be used in the tumor-related embodiments described herein. Antigen sources include, but are not limited to, cancer proteins. The antigen can be expressed as a peptide or as an intact protein or portion thereof. The intact protein or portion thereof can be naturally occurring or mutagenized. In certain embodiments, the tumor antigen is a tumor-specific antigen (TSA). In certain embodiments, the tumor antigen is a tumor-associated antigen (TAA).

[0134] Non-limiting examples of tumor antigens include CD19, MUC16, MUC1, CA1X, CEA, CD8, CD7, CD10, CD20, CD22, CD30, CLL1, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD133, CD138, EGP-2, EGP-40, EpCAM, Erb-B2, Erb-B3, Erb-B4, FBP, fetal acetylcholine receptor, folate receptor-α, GD2, GD3, HER-2, hTERT, IL-13R-α2, κ-light chain, KDR, KRAS mutants (including but not limited to G12V, G12D, G12C), HRAS mutants, PIK3CA mutants (including but not limited to E52K, E545K, H1047R, H1047L), IDH mutants (including but not limited to R132H), p53 mutants (including but not limited to R175H, Y22 0C, G245D, G245S, R248L, R248Q, R248W, R249S, R273C, R273L, R273H and R282W), NRAS mutants (including but not limited to Q61R, Q61K and Q61L), LeY, L1 cell adhesion molecule, MAGE-A1, mesothelin, ERBB2, MAGEA3, CT83 (also known as KK-LC-1), p53, MART1, GP100 , proteinase 3 (PR1), tyrosinase, survivin, hTERT, EphA2, NKG2D ligand, NY-ES0-1, oncofetal antigen (h5T4), PSCA, PSMA, ROR1, TAG-72, VEGF-R2, WT-1, BCMA, CD123, CD44V6, NKCS1, EGF1R, EGFR-VIII, CD99, CD70, ADGRE2, CCR1, LILRB2, PRAME, HPV E6 oncoprotein, HPV E7 oncoprotein, and ERBB. In certain embodiments, the tumor antigen is CD19.

[0135] In certain embodiments, the antigen-recognizing receptor binds to a human CD19 polypeptide. In certain embodiments, the human CD19 polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:26, or a fragment thereof. SEQ ID NO:26 is provided below. JPEG2025169261000018.jpg27168

[0136] In certain embodiments, the antigen recognizing receptor binds to the extracellular domain of the human CD19 protein.

[0137] In certain embodiments, the antigen recognition receptor binds to a pathogen antigen, e.g., for use in the treatment and / or prevention of pathogen infection. Non-limiting examples of pathogens include viruses, bacteria, fungi, parasites, and protozoa that can cause disease.

[0138] Non-limiting examples of pathogenic viruses include Retroviridae (e.g., human immunodeficiency viruses, such as HIV-1 (also referred to as HDLV-III, LAVE, or HTLV-III / LAV, or HIV-III) and other isolates such as HIV-LP); Picornaviridae (e.g., poliovirus, hepatitis A virus; enterovirus, human coxsackievirus, rhinovirus, echovirus); Caliciviridae (e.g., strains that cause gastroenteritis); Togaviridae (e.g., equine encephalitis virus, rubella virus); Flaviviridae (e.g., flu, flu-like virus ... iridae) (e.g., dengue virus, encephalitis virus, yellow fever virus); Coronaviridae (e.g., coronavirus); Rhabdoviridae (e.g., vesicular stomatitis virus, rabies virus); Filoviridae (e.g., Ebola virus); Paramyxoviridae (e.g., parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g., influenza virus); Bungaviridae (e.g., Hantavirus, Bungavirus, Phlebovirus, etc.) Arenaviridae (hemorrhagic fever viruses); Reoviridae (e.g., reovirus, orbivirus, and rotavirus); Birnaviridae; Hepadnaviridae (hepatitis B virus); Parvoviridae (parvovirus); Papovaviridae (papillomavirus, polyomavirus); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpesvirus); Poxvirus Family: Variola virus, Vaccinia virus, Poxvirus; and Iridoviridae (e.g., African swine fever virus); as well as unclassified viruses (e.g., the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), non-A, non-B hepatitis pathogens (Class 1 = internally transmitted; Class 2 = parenterally transmitted (i.e., hepatitis C); Norwalk and related viruses, and astroviruses), human papillomaviruses (i.e., HPV), JC virus, Epstein-Barr virus, Merkel cell polyomavirus).

[0139] Non-limiting examples of pathogenic bacteria include Pasteurella, Staphylococcus, Streptococcus, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include, but are not limited to, Helicobacter pylori, Borrelia burgdorferi, Legionella pneumophila, Mycobacterium species (e.g., Mycobacterium tuberculosis, Mycobacterium avium, Mycobacterium intracellulare, Mycobacterium kansasii, Mycobacterium gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus viridans (Group B Streptococcus), Enterococcus faecalis, Streptococcus bovis, Streptococcus typhimurium, Streptococcus pyogenes ... aerobic species), Streptococcus pneumoniae, pathogenic Campylobacter spp., Enterococcus spp., Haemophilus influenzae, Bacillus anthrax, Corynebacterium diphtheriae, Corynebacterium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, Streptobacillus moniliforme, Treponema pallidum, Treponema pertenue, Leptospira spp., Rickettsia spp., Clostridium difficile, and Actinomyces israelii.

[0140] In certain embodiments, the pathogen antigen is a viral antigen present in cytomegalovirus (CMV), a viral antigen present in Epstein-Barr virus (EBV), a viral antigen present in human immunodeficiency virus (HIV), or a viral antigen present in influenza virus.

[0141] 3.2.T cell receptor (TCR) In certain embodiments, the antigen-recognizing receptor is a TCR. A TCR is a disulfide-linked heterodimeric protein consisting of two variable chains expressed as part of a complex with an invariant CD3 chain molecule. TCRs are found on the surface of T cells and are responsible for recognizing antigens as peptides bound to major histocompatibility complex (MHC) molecules. In certain embodiments, the TCR comprises an alpha chain and a beta chain (encoded by TRA and TRB, respectively). In certain embodiments, the TCR comprises a gamma chain and a delta chain (encoded by TRG and TRD, respectively).

[0142] Each chain of the TCR consists of two extracellular domains, including a variable (V) region and a constant (C) region. The constant region is proximal to the cell membrane and is followed by a transmembrane region and a short cytoplasmic tail that lacks signaling capabilities. The variable region binds to the peptide / MHC complex. The variable domain of each pair of TCR polypeptides (alpha / beta or gamma / delta) contains three complementarity-determining regions (CDRs).

[0143] In certain embodiments, a TCR can form a receptor complex with three dimeric signaling modules, CD3δ / ε, CD3γ / ε, and CD247ζ / ζ or ζ / η. Binding of the TCR complex to its antigen and MHC (peptide / MHC) activates a T cell expressing the TCR complex.

[0144] In certain embodiments, the TCR is an endogenous TCR. In certain embodiments, the TCR recognizes a viral antigen. In certain embodiments, the TCR is expressed in virus-specific T cells. In certain embodiments, the virus-specific T cells are derived from an individual's immunity to a viral infection, e.g., BK virus, human herpesvirus 6, Epstein-Barr virus (EBV), cytomegalovirus, or adenovirus. In certain embodiments, the virus-specific T cells are T cells disclosed in Leen et al., Blood, Vol. 121, No. 26, 2013; Barker et al., Blood, Vol. 116, No. 23, 2010; Tzannou et al., Journal of Clinical Oncology, Vol. 35, No. 31, 2017; or Bollard et al., Blood, Vol. 32, No. 8, 2014, each of which is incorporated by reference in its entirety. In certain embodiments, the TCR recognizes a tumor antigen (including a TAA or TSA). In certain embodiments, the TCR is expressed on tumor-specific T cells. In certain embodiments, the tumor-specific T cells are tumor-infiltrating T cells generated by culturing T cells with tumor, e.g., melanoma or epithelial cancer explants. In certain embodiments, the tumor-specific T cells are T cells disclosed in Stevanovic et al., Science, 356, 200-205, 2017; Dudley et al., Journal of Immunotherapy, 26(4):332-342, 2003; or Goff et al., Journal of Clinical Oncology, Vol. 34, No. 20, 2016, each of which is incorporated by reference in its entirety.

[0145] In certain embodiments, the antigen-recognizing receptor is a recombinant TCR. In certain embodiments, the recombinant TCR differs from any naturally occurring TCR by at least one amino acid residue. In certain embodiments, the non-naturally occurring TCR differs from any naturally occurring TCR by at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more amino acid residues. In certain embodiments, the non-naturally occurring TCR has been modified from a naturally occurring TCR by at least one amino acid residue. In certain embodiments, a non-naturally occurring TCR has at least about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100 or more amino acid residues altered from a naturally occurring TCR.

[0146] 3.3. Chimeric Antigen Receptors (CARs) In certain embodiments, the antigen-recognizing receptor is a CAR. A CAR is an engineered receptor that grafts or confers a desired specificity onto an immune effector cell or immune responsive cell. CARs can be used to confer non-MHC-restricted antigen specificity to T cells. The transfer of their coding sequences is facilitated by retroviral vectors.

[0147] CARs have been developed through a series of significant improvements called "generations." So-called "first-generation" CARs typically consist of an extracellular antigen-binding domain (e.g., a single-chain variable fragment (scFv)) fused to a transmembrane domain fused to a cytoplasmic / intracellular signaling domain. The cytoplasmic / intracellular signaling domain may contain a single activation domain (usually an ITAM derived from CD3 zeta). "First-generation" CARs provide de novo antigen recognition independent of HLA-mediated antigen presentation and bind to CD4 ζ chains through their CD3ζ chain signaling domain in a single fusion molecule.+ T cells and CD8 + The antigen-recognizing receptor can induce both activation and activation of T cells. "Second-generation" CARs add an intracellular signaling domain derived from any one of a variety of costimulatory molecules (e.g., CD28, 4-1BB, ICOS, OX40) to the cytoplasmic tail of the CAR to provide an additional signal to the T cell. "Second-generation" CARs include those that provide both costimulation (e.g., CD28 or 4-1BB) and activation (CD3ζ). "Third-generation" CARs include those that provide multiple costimulation (e.g., CD28 and 4-1BB) and activation (CD3ζ). In certain embodiments, the antigen-recognizing receptor is a first-generation CAR. In certain embodiments, the antigen-recognizing receptor is a second-generation CAR. In certain embodiments, the antigen-recognizing receptor is a third-generation CAR.

[0148] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., embodied in an scFv or analog thereof) is about 2 x 10 -7 The dissociation constant (K d ) binds to the antigen. In certain embodiments, K d is about 2 x 10 -7 M or less, approximately 1×10 -7 M or less, approximately 9 x 10 -8 M or less, approximately 1×10 -8 M or less, approximately 9 x 10 -9 M or less, about 5 x 10 -9 M or less, approximately 4 x 10 -9 M or less, about 3 x 10 -9 Below, approximately 2×10 -9 M or less, or about 1 x 10 -9 In certain embodiments, K d is about 3 x 10 -9 In certain embodiments, K d is approximately 1 x 10 -9 M to approx. 3 x 10 -7 M. In certain embodiments, K d is approximately 1.5 x 10 -9 M to approx. 3 x 10 -7 M. In certain embodiments, K d is approximately 1.5 x 10 -9 M to approximately 2.7 x 10-7 It's M.

[0149] Binding of the extracellular antigen-binding domain (e.g., scFv or analog thereof) can be confirmed, for example, by enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis, bioassay (e.g., growth inhibition), or Western blot assay. Each of these assays generally detects the presence of a protein-antibody complex of particular interest by using a labeled reagent (e.g., antibody or scFv) specific for the complex of interest. For example, scFv can be radioactively labeled and used in a radioimmunoassay (RIA) (see, e.g., Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March, 1986, incorporated herein by reference). Radioisotopes can be detected by means such as the use of a gamma counter or scintillation counter, or by autoradiography. In certain embodiments, the extracellular antigen-binding domain of the CAR is labeled with a fluorescent marker. Non-limiting examples of fluorescent markers include green fluorescent protein (GFP), blue fluorescent protein (e.g., EBFP, EBFP2, Azurite, and mKalama1), cyan fluorescent protein (e.g., ECFP, Cerulean, and CyPet), and yellow fluorescent protein (e.g., YFP, Citrine, Venus, and YPet). Binding of the extracellular antigen-binding domain can also be confirmed by measuring cytokine secretion.

[0150] In accordance with the presently disclosed subject matter, a CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, wherein the extracellular antigen-binding domain specifically binds to an antigen, which may be a tumor antigen (TAA or TSA) or a pathogen antigen.

[0151] In certain embodiments, the CAR comprises an extracellular antigen-binding domain that binds to CD 19. In certain embodiments, the CAR is one described in Kochenderder, JN et al. Blood. 2010 Nov 11;116(19):3875-86, which is incorporated herein by reference in its entirety.

[0152] 3.3.1. Extracellular Antigen-Binding Domain of the CAR In certain embodiments, the extracellular antigen-binding domain specifically binds to an antigen. In certain embodiments, the antigen is a tumor antigen. In certain embodiments, the tumor antigen is a tumor-specific antigen (TSA). In certain embodiments, the tumor antigen is a tumor-associated antigen (TAA). In certain embodiments, the tumor antigen is CD19. In certain embodiments, the extracellular antigen-binding domain is an scFv. In certain embodiments, the scFv is a human scFv. In certain embodiments, the scFv is a humanized scFv. In certain embodiments, the scFv is a murine scFv. In certain embodiments, the extracellular antigen-binding domain is a Fab, which is optionally cross-linked. In certain embodiments, the extracellular antigen-binding domain is a F(ab)2. In certain embodiments, any of the above molecules may be included in a fusion protein with a heterologous sequence to form the extracellular antigen-binding domain. In certain embodiments, the scFv is identified by screening an scFv phage library with an antigen-Fc fusion protein. In certain embodiments, the antigen is a tumor antigen. In certain embodiments, the antigen is a pathogen antigen.

[0153] 3.3.2. CAR Transmembrane Domain In certain embodiments, the transmembrane domain of the CAR comprises a hydrophobic alpha helix that spans at least a portion of the membrane. Different transmembrane domains result in different receptor stabilities. After antigen recognition, the receptors cluster and a signal is transmitted to the cell. In accordance with the subject matter of the present disclosure, the transmembrane domain of the CAR can comprise a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a synthetic peptide (not based on a protein associated with an immune response), or a combination thereof.

[0154] In certain embodiments, the transmembrane domain comprises a CD8 polypeptide. In certain embodiments, the transmembrane domain comprises the transmembrane domain of human CD8 or a portion thereof. In certain embodiments, the CD8 polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_001139345.1 (SEQ ID NO: 27), and / or optionally contains at most one, or at most two, or at most three conservative amino acid substitutions. In certain embodiments, the CD8 polypeptide comprises or consists of an amino acid sequence that is at least 20, or at least 30, or at least 40, or at least 50, and up to 235 amino acids in length, and is a contiguous portion of SEQ ID NO: 27. In certain embodiments, the CD8 polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 235, 1 to 50, 50 to 100, 100 to 150, 137 to 209, 150 to 200, or 200 to 235 of SEQ ID NO:27. In certain embodiments, the CAR comprises the transmembrane domain of CD8 (e.g., human CD8) or a portion thereof. In certain embodiments, the transmembrane domain of the CAR comprises a CD8 polypeptide comprising or consisting of the amino acid sequence of amino acids 137 to 209 of SEQ ID NO:27. SEQ ID NO:27 is provided below. JPEG2025169261000019.jpg26169

[0155] In certain embodiments, the transmembrane domain comprises the transmembrane domain of murine CD8 or a portion thereof. In certain embodiments, the CD8 polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: AAA92533.1 (SEQ ID NO: 28), and / or optionally comprises or consists of at most one, at most two, or at most three conservative amino acid substitutions. In certain embodiments, the CD8 polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, or at least about 60, or at least about 70, or at least about 100, or at least about 200, and is up to 247 amino acids in length. In certain embodiments, the CD8 polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 247, 1 to 50, 50 to 100, 100 to 150, 150 to 200, 151 to 219, or 200 to 247 of SEQ ID NO: 28. In certain embodiments, the transmembrane domain of the CAR comprises or consists of a CD8 polypeptide comprising or consisting of the amino acid sequence of amino acids 151 to 219 of SEQ ID NO: 28. SEQ ID NO: 28 is provided below. JPEG2025169261000020.jpg34164

[0156] In accordance with the subject matter of this disclosure, a "CD8 nucleic acid molecule" refers to a polynucleotide that encodes a CD8 polypeptide.

[0157] In certain embodiments, the transmembrane domain of a CAR of the present disclosure comprises a CD28 polypeptide. In certain embodiments, the transmembrane domain comprises the transmembrane domain of human CD28 or a portion thereof. In certain embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_006130 (SEQ ID NO: 29), and / or optionally contains at most one, at most two, or at most three conservative amino acid substitutions. In certain embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 220 amino acids in length, of SEQ ID NO: 29. In certain embodiments, the CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 114 to 220, 150 to 200, 153 to 179, or 200 to 220 of SEQ ID NO: 29. In certain embodiments, the CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 114 to 220 of SEQ ID NO: 29. In certain embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide comprising or consisting of the amino acid sequence of amino acids 153 to 179 of SEQ ID NO: 29. SEQ ID NO: 29 is provided below. JPEG2025169261000021.jpg28165

[0158] An exemplary nucleic acid sequence encoding amino acids 153 to 179 of SEQ ID NO:29 is shown in SEQ ID NO:30, provided below. JPEG2025169261000022.jpg14168

[0159] In certain embodiments, the transmembrane domain of a CAR of the present disclosure comprises the transmembrane domain of murine CD28 or a fragment thereof. In certain embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_031668.3 (SEQ ID NO: 31), and / or optionally comprises or consists of at most one, at most two, or at most three conservative amino acid substitutions. In certain embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 218 amino acids in length, of SEQ ID NO: 31. In certain embodiments, the CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 218, 1 to 50, 50 to 100, 100 to 150, 114 to 220, 150 to 200, 151 to 177, or 200 to 220 of SEQ ID NO: 31. In certain embodiments, the CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 114 to 220 of SEQ ID NO: 31. In certain embodiments, the transmembrane domain of the CAR comprises or consists of a CD28 polypeptide comprising or consisting of the amino acid sequence of amino acids 151 to 177 of SEQ ID NO: 31. SEQ ID NO: 31 is provided below. JPEG2025169261000023.jpg27163

[0160] According to the subject matter of this disclosure, a "CD28 nucleic acid molecule" refers to a polynucleotide that encodes a CD28 polypeptide.

[0161] In certain embodiments, the CAR further comprises a spacer region linking the extracellular antigen-binding domain to the transmembrane domain. The spacer region can be sufficiently flexible to allow the antigen-binding domain to be oriented in different directions to facilitate antigen recognition. The spacer region can be a hinge region from IgG1, or an immunoglobulin CH2CH3 region, a portion of CD3, a portion of a CD28 polypeptide (e.g., a portion of SEQ ID NO:29 or SEQ ID NO:31), a portion of a CD8 polypeptide (e.g., a portion of SEQ ID NO:27 or a portion of SEQ ID NO:28), a variant thereof that is at least about 80%, at least about 85%, at least about 90%, or at least about 95% homologous or identical to any of the foregoing, or a synthetic spacer sequence.

[0162] 3.3.3. CAR Intracellular Signaling Domain In certain embodiments, the intracellular signaling domain of the CAR comprises a CD3ζ polypeptide that can activate or stimulate a cell (e.g., a cell of the lymphoid system, e.g., a T cell). Wild-type ("native") CD3ζ contains three immunoreceptor tyrosine-based activation motifs (ITAMs) (e.g., ITAM1, ITAM2, and ITAM3) and transmits an activation signal to a cell (e.g., a cell of the lymphoid system, e.g., a T cell) after antigen binding. The intracellular signaling domain of a native CD3ζ polypeptide is the primary transmitter of signals from the endogenous TCR.

[0163] In certain embodiments, the intracellular signaling domain of the CAR comprises a native CD3ζ polypeptide. In certain embodiments, the intracellular signaling domain of the CAR comprises a human CD3ζ polypeptide. In certain embodiments, the CD3ζ polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_932170 (SEQ ID NO: 32), and / or optionally comprises or consists of at most one, at most two, or at most three conservative amino acid substitutions. In certain embodiments, the CD3ζ polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 164 amino acids in length, of SEQ ID NO: 32. In certain embodiments, the CD3ζ polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 164, 1 to 50, 50 to 100, 100 to 150, 52 or 164, or 150 to 164 of SEQ ID NO: 32. In certain embodiments, the intracellular signaling domain of the CAR comprises a CD3ζ polypeptide comprising or consisting of the amino acid sequence of amino acids 52 to 164 of SEQ ID NO: 32. SEQ ID NO: 32 is provided below. JPEG2025169261000024.jpg20161

[0164] In certain embodiments, the intracellular signaling domain of the CAR comprises a murine CD3ζ polypeptide. In certain embodiments, the CD3ζ polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_001106864.2 (SEQ ID NO: 33), and / or optionally comprises or consists of at most one, at most two, or at most three conservative amino acid substitutions. In certain embodiments, the CD3ζ polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, or at least about 90, or at least about 100, and is up to 188 amino acids in length. In certain embodiments, the CD3ζ polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 164, 1 to 50, 50 to 100, 52 to 142, 100 to 150, or 150 to 188 of SEQ ID NO: 33. SEQ ID NO: 33 is provided below. JPEG2025169261000025.jpg27164

[0165] In certain embodiments, the intracellular signaling domain of the CAR comprises a CD3ζ polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 34. SEQ ID NO: 34 is provided below. JPEG2025169261000026.jpg13168

[0166] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified human CD3ζ polypeptide. In certain embodiments, the modified CD3ζ polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, at least about 100% homologous or identical to SEQ ID NO:35, and / or optionally comprises or consists of at most one, at most two, or at most three conservative amino acid substitutions. SEQ ID NO:35 is provided below. JPEG2025169261000027.jpg14162

[0167] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:35 is shown in SEQ ID NO:36, provided below. JPEG2025169261000028.jpg33168

[0168] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising one, two, or three ITAMs. In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM1 comprising or consisting of the amino acid sequence set forth in SEQ ID NO:37. JPEG2025169261000029.jpg7160

[0169] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:37 is shown in SEQ ID NO:38, provided below. JPEG2025169261000030.jpg14169

[0170] In certain embodiments, the modified CD3ζ polypeptide comprises an ITAM1 variant comprising one or more loss-of-function mutations. In certain embodiments, the ITAM1 variant comprises or consists of two loss-of-function mutations. In certain embodiments, each of the one or more (e.g., two) loss-of-function mutations comprises a mutation of a tyrosine residue in ITAM1. In certain embodiments, the ITAM1 variant (e.g., a variant consisting of two loss-of-function mutations) comprises or consists of the amino acid sequence set forth in SEQ ID NO:39, provided below. JPEG2025169261000031.jpg6159

[0171] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:39 is shown in SEQ ID NO:40, provided below. JPEG2025169261000032.jpg13170

[0172] In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM2 comprising or consisting of the amino acid sequence set forth in SEQ ID NO:41, provided below. JPEG2025169261000033.jpg7156

[0173] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:41 is shown in SEQ ID NO:42, provided below. JPEG2025169261000034.jpg13164

[0174] In certain embodiments, the modified CD3ζ polypeptide comprises an ITAM2 variant comprising one or more loss-of-function mutations. In certain embodiments, the ITAM2 variant comprises or consists of two loss-of-function mutations. In certain embodiments, each of the one or more (e.g., two) loss-of-function mutations comprises or consists of a mutation in a tyrosine residue of ITAM2. In certain embodiments, the ITAM2 variant (e.g., a variant consisting of two loss-of-function mutations) comprises or consists of the amino acid sequence set forth in SEQ ID NO:43, provided below. JPEG2025169261000035.jpg8159

[0175] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:43 is shown in SEQ ID NO:44, provided below. JPEG2025169261000036.jpg13164

[0176] In certain embodiments, the modified CD3ζ polypeptide comprises a native ITAM3 comprising or consisting of the amino acid sequence set forth in SEQ ID NO:45, provided below. JPEG2025169261000037.jpg9160

[0177] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:45 is shown in SEQ ID NO:46, provided below. JPEG2025169261000038.jpg13167

[0178] In certain embodiments, the modified CD3ζ polypeptide comprises an ITAM3 variant comprising one or more loss-of-function mutations. In certain embodiments, the ITAM3 variant comprises or consists of two loss-of-function mutations. In certain embodiments, each of the one or more (e.g., two) loss-of-function mutations comprises or consists of a mutation in a tyrosine residue of ITAM3. In certain embodiments, the ITAM3 variant (e.g., a variant consisting of two loss-of-function mutations) comprises or consists of the amino acid sequence set forth in SEQ ID NO:47, provided below. JPEG2025169261000039.jpg7162

[0179] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO:47 is shown in SEQ ID NO:48, provided below. JPEG2025169261000040.jpg14167

[0180] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising or consisting of a native ITAM1, an ITAM2 variant comprising or consisting of one or more loss-of-function mutations, and an ITAM3 variant comprising or consisting of one or more loss-of-function mutations, or a combination thereof. In certain embodiments, the ITAM2 variant comprises or consists of two loss-of-function mutations, and the ITAM3 variant comprises or consists of two loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising or consisting of a native ITAM1, an ITAM2 variant comprising or consisting of two loss-of-function mutations, and an ITAM3 variant comprising or consisting of two loss-of-function mutations. In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide comprising or consisting of a native ITAM1 consisting of the amino acid sequence set forth in SEQ ID NO: 37, an ITAM2 variant consisting of the amino acid sequence set forth in SEQ ID NO: 43, and an ITAM3 variant consisting of the amino acid sequence set forth in SEQ ID NO: 47. In certain embodiments, the CAR binds to CD19 and is designated "1XX." In certain embodiments, the modified CD3ζ polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:35.

[0181] In certain embodiments, the intracellular signaling domain of the CAR comprises a modified CD3ζ polypeptide disclosed in WO 2019 / 133969, which is incorporated herein by reference.

[0182] In certain embodiments, the intracellular signaling domain of the CAR does not include a costimulatory signaling region, i.e., the CAR is a first generation CAR.

[0183] In certain embodiments, the intracellular signaling domain of the CAR further comprises at least a costimulatory signaling region. In certain embodiments, the costimulatory signaling region comprises or consists of at least one costimulatory molecule, or a portion thereof, that can result in optimal lymphocyte activation. As used herein, "costimulatory molecule" refers to a cell surface molecule, other than an antigen receptor or its ligand, that is required for an effective lymphocyte response to an antigen. A costimulatory molecule can result in optimal lymphocyte activation. In certain embodiments, at least one costimulatory signaling region comprises or consists of a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof. In certain embodiments, at least one costimulatory signaling region comprises or consists of a CD28 polypeptide. A costimulatory molecule can bind to a costimulatory ligand, which is a protein expressed on the cell surface that, upon binding to its receptor, generates a costimulatory response, i.e., an intracellular response that results in stimulation when an antigen binds to the CAR molecule. Costimulatory ligands include, but are not limited to, CD80, CD86, CD70, OX40L, and 4-1BBL. In one example, 4-1BB ligand (i.e., 4-1BBL) is used in combination with CAR signaling to stimulate CAR + It can bind to 4-1BB (also known as "CD137") to provide an intracellular signal that induces effector cell function of T cells. CARs containing intracellular signaling domains that include costimulatory signaling regions that include 4-1BB, ICOS, or DAP-10 are disclosed in U.S. Patent No. 7,446,190, the entire contents of which are incorporated herein by reference.

[0184] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises or consists of a CD28 polypeptide. In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises or consists of the intracellular domain of CD28, or a portion thereof. In certain embodiments, the costimulatory signaling region comprises or consists of the intracellular domain of human CD28, or a portion thereof. In certain embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO:29, and / or optionally may comprise or consist of at most one, or at most two, or at most three conservative amino acid substitutions. In certain embodiments, a CD28 polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 220 amino acids in length, of SEQ ID NO:29. In certain embodiments, a CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 114 to 220, 150 to 200, 181 to 220, or 200 to 220 of SEQ ID NO:29. In certain embodiments, a CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 181 to 220 of SEQ ID NO:29.

[0185] In certain embodiments, the costimulatory signaling region comprises or consists of the intracellular domain of mouse CD28, or a portion thereof. In certain embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO:31, and / or optionally contains or consists of at most one, at most two, or at most three conservative amino acid substitutions. In certain embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 218 amino acids in length, of SEQ ID NO:31. In certain embodiments, the CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 218, 1 to 50, 50 to 100, 100 to 150, 114 to 218, 115 to 218, 150 to 200, 178 to 218, or 200 to 218 of SEQ ID NO: 31. In certain embodiments, the CD28 polypeptide comprises or consists of the amino acid sequence of amino acids 115 to 218 of SEQ ID NO: 31.

[0186] According to the subject matter of this disclosure, a "CD28 nucleic acid molecule" refers to a polynucleotide that encodes a CD28 polypeptide.

[0187] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises or consists of the intracellular domains or portions thereof of two costimulatory molecules: the intracellular domain or portion thereof of CD28 and the intracellular domain or portion thereof of 4-1BB, or the intracellular domain or portion thereof of CD28 and the intracellular domain or portion thereof of OX40.

[0188] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises or consists of a 4-1BB polypeptide. In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises or consists of the intracellular domain of 4-1BB or a portion thereof. In certain embodiments, the costimulatory signaling region comprises or consists of the intracellular domain of human 4-1BB or a portion thereof. 4-1BB can act as a tumor necrosis factor (TNF) ligand and have stimulatory activity. In certain embodiments, the 4-1BB polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_001552 (SEQ ID NO: 49), and / or optionally may comprise or consist of at most one, at most two, or at most three conservative amino acid substitutions. In certain embodiments, the 4-1BB polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 255 amino acids in length, of SEQ ID NO:49. In certain embodiments, the 4-1BB polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 255, 1 to 50, 50 to 100, 100 to 150, 150 to 200, 214-255, or 200 to 255 of SEQ ID NO:49. In certain embodiments, the 4-1BB polypeptide comprises or consists of the amino acid sequence of amino acids 214-255 of SEQ ID NO:49. SEQ ID NO:49 is provided below: JPEG2025169261000041.jpg33165

[0189] According to the presently disclosed subject matter, a "4-1BB nucleic acid molecule" refers to a polynucleotide that encodes a 4-1BB polypeptide.

[0190] In certain embodiments, the costimulatory signaling region comprises the intracellular signaling domain of mouse 4-1BB or a portion thereof.

[0191] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises or consists of an OX40 polypeptide. In certain embodiments, the costimulatory signaling region comprises or consists of the intracellular domain of OX40, or a portion thereof. In certain embodiments, the costimulatory signaling region comprises or consists of the intracellular domain of human OX40, or a portion thereof. In certain embodiments, the OX40 polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_003318 (SEQ ID NO: 50), and / or optionally comprises or consists of at most one, or at most two, or at most three conservative amino acid substitutions. In certain embodiments, the OX40 polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 277 amino acids in length, of SEQ ID NO:50. In certain embodiments, the 4-1BB polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 277, 1 to 50, 50 to 100, 100 to 150, 150 to 200, or 200 to 277 of SEQ ID NO:50. SEQ ID NO:50 is provided below: JPEG2025169261000042.jpg34165

[0192] According to the presently disclosed subject matter, an "OX40 nucleic acid molecule" refers to a polynucleotide that encodes an OX40 polypeptide.

[0193] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region that comprises or consists of an ICOS polypeptide. In certain embodiments, the costimulatory signaling region comprises or consists of the intracellular domain of ICOS, or a portion thereof. In certain embodiments, the costimulatory signaling region comprises or consists of the intracellular domain of human ICOS, or a portion thereof. In certain embodiments, the ICOS polypeptide comprises or consists of an amino acid sequence, or a fragment thereof, that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the sequence having NCBI Reference Number: NP_036224 (SEQ ID NO: 51), and / or optionally comprises or consists of at most one, or at most two, or at most three conservative amino acid substitutions. In certain embodiments, the ICOS polypeptide comprises or consists of an amino acid sequence that is at least about 20, or at least about 30, or at least about 40, or at least about 50, and up to 199 amino acids in length, of SEQ ID NO:51. In certain embodiments, the ICOS polypeptide comprises or consists of the amino acid sequence of amino acids 1 to 277, 1 to 50, 50 to 100, 100 to 150, or 150 to 199 of SEQ ID NO:51. SEQ ID NO:51 is provided below: JPEG2025169261000043.jpg28166

[0194] According to the presently disclosed subject matter, an "ICOS nucleic acid molecule" refers to a polynucleotide that encodes an ICOS polypeptide.

[0195] 3.3.4. Example CAR In certain embodiments, a CAR of the present disclosure comprises or consists of: a) an extracellular antigen-binding domain that binds to a CD19 polypeptide (e.g., a human CD19 polypeptide); b) a transmembrane domain comprising or consisting of a CD28 polypeptide (e.g., the transmembrane domain of human CD28 or a portion thereof); and c) an intracellular signaling domain comprising or consisting of a CD3ζ polypeptide, and a costimulatory signaling region comprising or consisting of a CD28 polypeptide (e.g., the intracellular domain of human CD28 or a portion thereof). In certain embodiments, the CAR is designated as "CD1928ζ." In certain embodiments, the CAR (e.g., CD1928ζ) comprises or consists of the amino acid sequence set forth in SEQ ID NO:52. SEQ ID NO:52 is provided below. JPEG2025169261000044.jpg55170

[0196] An exemplary nucleic acid sequence that encodes the amino acid sequence of SEQ ID NO: 52 is shown in SEQ ID NO: 53. SEQ ID NO: 53 is provided below. JPEG2025169261000045.jpg139169

[0197] In certain embodiments, the cell comprises i) a dominant-negative Fas polypeptide of the present disclosure; and ii) a CAR comprising or consisting of: a) an extracellular antigen-binding domain that binds to CD19 (e.g., human CD19); b) a transmembrane domain comprising or consisting of a CD28 polypeptide (e.g., the transmembrane domain of a human CD28 polypeptide, e.g., CD28 (e.g., human CD28), or a portion thereof), and c) an intracellular signaling domain comprising or consisting of a modified CD3ζ polypeptide comprising or consisting of a native ITAM1 consisting of the amino acid sequence set forth in SEQ ID NO: 37, an ITAM2 variant consisting of the amino acid sequence set forth in SEQ ID NO: 43, and an ITAM3 variant consisting of the amino acid sequence set forth in SEQ ID NO: 47, and a costimulatory signaling region comprising or consisting of a CD28 polypeptide (e.g., the intracellular domain of a human CD28 polypeptide, e.g., CD28 (e.g., human CD28), or a portion thereof). In certain embodiments, the CAR is designated "1928ζ1XX." In certain embodiments, a CAR (e.g., 1928ζ1XX) comprises or consists of an amino acid sequence that is at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 54, provided below. SEQ ID NO: 54 can bind to CD19 (e.g., human CD19). JPEG2025169261000046.jpg56169

[0198] An exemplary nucleic acid sequence encoding the amino acid sequence of SEQ ID NO:54 is shown in SEQ ID NO:55, provided below. JPEG2025169261000047.jpg150170

[0199] 4.Cells The presently disclosed subject matter provides cells comprising a dominant-negative Fas polypeptide disclosed herein. In certain embodiments, the cells further comprise an antigen-recognition receptor (e.g., a CAR or TCR) that binds to an antigen. In certain embodiments, the dominant-negative Fas polypeptide is an exogenous dominant-negative Fas polypeptide. In certain embodiments, the antigen-recognition receptor is capable of activating the cell. In certain embodiments, the dominant-negative Fas polypeptide (e.g., an exogenous dominant-negative Fas polypeptide) can promote the anti-tumor effect of the cell. The cell can be transduced with an antigen-recognition receptor and an exogenous dominant-negative Fas polypeptide such that the cell co-expresses the antigen-recognition receptor and the exogenous dominant-negative Fas polypeptide.

[0200] In certain embodiments, the cell is an immunoresponsive cell. In certain embodiments, the cell is a cell of the lymphoid lineage. Cells of the lymphoid lineage produce antibodies, regulate the cellular immune system, detect foreign pathogens in the blood and cells foreign to the host, etc. Non-limiting examples of cells of the lymphoid lineage include T cells, natural killer (NK) cells, B cells, dendritic cells, and stem cells from which lymphoid cells can be differentiated. In certain embodiments, the stem cell is a pluripotent stem cell (e.g., an embryonic stem cell or an induced pluripotent stem cell).

[0201] In certain embodiments, the cell is a T cell. T cells can be lymphocytes that mature in the thymus and are primarily responsible for cell-mediated immunity. T cells are members of the adaptive immune system. In certain embodiments, T cells provided herein include, but are not limited to, helper T cells, cytotoxic T cells, memory T cells (central memory T cells, stem cell-like memory T cells (or stem-like memory T cells)), and two types of effector memory T cells: e.g., T EM Cells and T EMRA cells, regulatory T cells (suppressor T cells or T regsThe present invention relates to T cells, including any type of T cell, including T cells (also known as T cells), tumor-infiltrating lymphocytes (TILs), natural killer T cells, mucosal-associated invariant T cells, and γδ T cells. Cytotoxic T cells (CTLs or killer T cells) are a subset of T lymphocytes that can induce the death of infected somatic or tumor cells. A patient's own T cells (i.e., autologous T cells) can be genetically modified to target specific antigens by the introduction of an antigen-recognition receptor, e.g., a CAR or TCR. In certain embodiments, the cells are T cells. T cells are CD4 + T cells or CD8 + In certain embodiments, the T cells are CD4 + In certain embodiments, the T cells are CD8 + T cells.

[0202] In certain embodiments, the cell is a virus-specific T cell. In certain embodiments, the virus-specific T cell comprises an endogenous TCR that recognizes a viral antigen. In certain embodiments, the cell is a tumor-specific T cell. In certain embodiments, the tumor-specific T cell comprises an endogenous TCR that recognizes a tumor antigen (TSA or TAA).

[0203] In certain embodiments, the cells are NK cells. Natural killer (NK) cells are lymphocytes that are part of cell-mediated immunity and act during the innate immune response. NK cells do not require prior activation to carry out their cytotoxic effect on target cells.

[0204] The types of human lymphocytes of the presently disclosed subject matter include, but are not limited to, peripheral donor lymphocytes, e.g., Sadelain, M. et al. 2003 Nat Rev Cancer 3:35-45 (disclosing peripheral donor lymphocytes genetically modified to express CARs), Morgan, RA et al. 2006 Science 314:126-129 (disclosing peripheral donor lymphocytes genetically modified to express T cell receptor complexes that recognize full-length tumor antigens, including α and β heterodimers), Panelli, MC et al. 2000 J Immunol 164:495-504; Panelli, MC et al. 2000 J Immunol 164:4382-4392 (disclosing lymphocyte cultures derived from tumor-infiltrating lymphocytes (TILs) in tumor biopsies), and Dupont, J. et al. 2005 Cancer Res 65:5417-5427; Papanicolaou, GA et al. 2003 Blood 102:2498-2505 (disclosing selectively antigen-specific peripheral blood leukocytes expanded in vitro using artificial antigen presenting cells (AAPCs) or pulsed dendritic cells). Immunoresponsive cells (e.g., T cells) can be autologous, non-autologous (e.g., allogeneic), or derived in vitro from modified progenitor or stem cells.

[0205] In certain embodiments, the cells are cells of the myeloid lineage. Non-limiting examples of cells of the myeloid lineage include monocytes, macrophages, basophils, neutrophils, eosinophils, mast cells, erythrocytes, megakaryocytes, platelets, and stem cells from which myeloid cells can be differentiated. In certain embodiments, the stem cells are pluripotent stem cells (e.g., embryonic stem cells or induced pluripotent stem cells).

[0206] The cells of the present disclosure can modulate the tumor microenvironment. Tumors have a microenvironment that is hostile to the host immune response, including a series of mechanisms by malignant cells to protect themselves from immune recognition and elimination. This hostile "tumor microenvironment" includes infiltrating regulatory CD4 +The tumor microenvironment contains a variety of immunosuppressive factors, including T cells (Tregs), myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs), immunosuppressive cytokines including TGF-β, and expression of ligands that target immunoinhibitory receptors (CTLA-4 and PD-1) expressed by activated T cells. These mechanisms of immunosuppression play a role in maintaining tolerance and suppressing inappropriate immune responses, but within the tumor microenvironment, these mechanisms prevent effective antitumor immune responses. Collectively, these immunosuppressive factors can induce either significant anergy or apoptosis of adoptively transferred CAR-modified T cells upon encounter with targeted tumor cells.

[0207] In certain embodiments, the cells of the present disclosure have increased cell persistence, hi certain embodiments, the cells of the present disclosure have reduced apoptosis and / or anergy.

[0208] 5. Compositions and Vectors The presently disclosed subject matter provides compositions comprising a dominant-negative Fas polypeptide disclosed herein (e.g., as disclosed in Section 2) and an antigen-recognizing receptor disclosed herein (e.g., as disclosed in Section 3). Also provided are cells (e.g., immunoresponsive cells) comprising such compositions.

[0209] In certain embodiments, the dominant negative Fas polypeptide is operably linked to a first promoter. In certain embodiments, the antigen recognizing receptor is operably linked to a second promoter.

[0210] Additionally, the presently disclosed subject matter provides nucleic acid compositions comprising a first polynucleotide encoding a dominant-negative Fas polypeptide disclosed herein (e.g., as disclosed in Section 2) and a second polynucleotide encoding an antigen-recognizing receptor disclosed herein (e.g., as disclosed in Section 3). Also provided are cells comprising such nucleic acid compositions.

[0211] In certain embodiments, the nucleic acid composition further comprises a first promoter operably linked to the dominant-negative Fas polypeptide, hi certain embodiments, the nucleic acid composition further comprises a second promoter operably linked to an antigen-recognizing receptor.

[0212] In certain embodiments, one or both of the first and second promoters are endogenous or exogenous. In certain embodiments, the exogenous promoter is selected from the group consisting of an elongation factor (EF)-1 promoter, a CMV promoter, an SV40 promoter, a PGK promoter, a long terminal repeat (LTR) promoter, and a metallothionein promoter. In certain embodiments, one or both of the first and second promoters is an inducible promoter. In certain embodiments, the inducible promoter is selected from the group consisting of an NFAT transcription response element (TRE) promoter, a CD69 promoter, a CD25 promoter, an IL-2 promoter, an IL-12 promoter, a p40 promoter, and a Bcl-xL promoter.

[0213] The presently disclosed subject matter further provides a vector comprising the nucleic acid composition. In certain embodiments, the vector is a retroviral vector. In certain embodiments, the vector is a lentiviral vector.

[0214] Compositions and nucleic acid compositions can be administered to a subject and / or delivered to cells by methods known in the art or as described herein. Genetic modification of cells (e.g., T cells) can be achieved by transducing a substantially homogeneous cell composition with a recombinant DNA construct. In certain embodiments, retroviral vectors (either gammaretroviral or lentiviral vectors) are used to introduce DNA constructs into cells. For example, a first polynucleotide encoding an antigen-recognizing receptor and a second polynucleotide encoding a dominant-negative Fas polypeptide can be cloned into a retroviral vector, and expression can be driven from its endogenous promoter, from a retroviral terminal repeat, or from a promoter specific to the target cell type of interest. Non-viral vectors can also be used.

[0215] For the initial genetic modification of cells to include a dominant-negative Fas polypeptide and an antigen-recognizing receptor (e.g., a CAR or TCR), retroviral vectors are commonly used for transduction, although any other suitable viral vector or non-viral delivery system can be used. The antigen-recognizing receptor and dominant-negative Fas polypeptide can be constructed in a single polycistronic expression cassette, multiple expression cassettes in a single vector, or multiple vectors. Examples of elements that can be used to create polycistronic expression cassettes include, but are not limited to, various viral and non-viral internal ribosome entry sites (IRES, e.g., FGF-1 IRES, FGF-2 IRES, VEGF IRES, IGF-II IRES, NF-κB IRES, RUNX1 IRES, p53 IRES, Hepatitis A IRES, Hepatitis C IRES, Pestivirus IRES, Aphthovirus IRES, Picornavirus IRES, Poliovirus IRES, and Encephalomyocarditis virus IRES), and cleavable linkers (e.g., 2A peptides, e.g., P2A, T2A, E2A, and F2A peptides). Also suitable are combinations of retroviral vectors and appropriate packaging lines, wherein the capsid protein is functional to infect human cells. A variety of amphotropic virus-producing cell lines are known, including, but not limited to, PA12 (Miller et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller et al. (1986) Mol. Cell. Biol. 6:2895-2902); and CRIP (Danos et al. (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464). Non-amphotropic particles, such as those pseudotyped with VSVG, RD114, or GALV envelopes, and any others known in the art, are also suitable.

[0216] Possible methods of transduction also include direct co-cultivation of cells with producer cells, e.g., by the method of Bregni et al. (1992) Blood 80:1418-1422, or by culturing with viral supernatant alone or with concentrated vector stock with or without appropriate growth factors and polycations, e.g., by the method of Xu et al. (1994) Exp. Hemat. 22:223-230; and Hughes et al. (1992) J. Clin. Invest. 89:1817.

[0217] Other transducing viral vectors can be used to modify cells. In certain embodiments, the vector selected exhibits high efficiency of infection and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus, and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus, or herpes viruses such as Epstein-Barr virus (see, e.g., Miller, Human Gene Therapy 15-14, 1990; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques 6:608-614, 1988; Tolstoshev et al., Current Opinion in Biotechnology 1:55-61, 1990; Sharp, The Lancet 337:1277-1278, 1991; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-322, 1987; Anderson, Science 226:401-409, 1984; Moen, Blood Cells 17:407-416, 1991; Miller et al., Biotechnology 7:980-990, 1989; LeGal La Salle et al., Science 259:988-990, 1993; and Johnson, Chest 107:77S-83S, 1995.) Retroviral vectors are particularly well developed and have been used in clinical settings (Rosenberg et al., N. Engl. J. Med 323:370, 1990; Anderson et al., U.S. Pat. No. 5,399,346).

[0218] Non-viral approaches can also be used to genetically modify cells. For example, nucleic acid molecules can be introduced into cells by administering nucleic acids in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), asialoorosomucoid-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990) into immunocompetent cells. Other non-viral means for gene transfer include in vitro transfection using calcium phosphate, DEAE-dextran, electroporation, and protoplast fusion. Liposomes can also be potentially useful for delivering DNA to cells. Transplantation of normal genes into affected tissues of a subject can also be achieved by introducing normal nucleic acids into ex vivo culturable cell types (e.g., autologous or heterologous primary cells or their progeny), and then the cells (or their progeny) are injected into the targeted tissue or systemically. Recombinant receptors can also be induced or obtained using transposases or targeted nucleases (e.g., zinc finger nucleases, meganucleases, or TALE nucleases, CRISPR). Transient expression may be achieved by RNA electroporation.

[0219] Any targeted genome editing method can also be used to deliver the dominant-negative Fas polypeptides and / or antigen-recognition receptors disclosed herein to cells or subjects. In certain embodiments, a CRISPR system is used to deliver the dominant-negative Fas polypeptides and / or antigen-recognition receptors disclosed herein. In certain embodiments, a zinc finger nuclease is used to deliver the dominant-negative Fas polypeptides and / or antigen-recognition receptors disclosed herein. In certain embodiments, a TALEN system is used to deliver the dominant-negative Fas polypeptides and / or antigen-recognition receptors disclosed herein.

[0220] The clustered regularly interspaced short palindromic repeats (CRISPR) system is a genome editing tool discovered in prokaryotic cells. When utilized for genome editing, this system comprises Cas9 (a protein that can modify DNA using crRNA as its guide), CRISPR RNA (crRNA, which contains the RNA used by Cas9 to guide it to the correct part of the host DNA along with a region that binds to tracrRNA (generally in the form of a hairpin loop) that forms an active complex with Cas9), transactivating crRNA (tracrRNA, which binds to crRNA and forms an active complex with Cas9), and an optional portion of DNA repair template (DNA that guides the cellular repair process, allowing for the insertion of a specific DNA sequence). CRISPR / Cas9 often uses a plasmid to transfect target cells. The crRNA is the sequence that Cas9 uses to identify and directly bind to the target DNA in the cell, and therefore must be designed for each application. The repair template carrying the CAR expression cassette must also be designed for each application, as it must overlap with the sequences on either side of the cut and encode the insertion sequence. Multiple crRNAs and tracrRNAs can be packaged together to form single guide RNAs (sgRNAs), which can be joined with the Cas9 gene into a plasmid for transfection into cells.

[0221] Zinc finger nucleases (ZFNs) are artificial restriction enzymes created by combining a zinc finger DNA-binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target specific DNA sequences, allowing the zinc finger nuclease to target desired sequences within the genome. The DNA-binding domain of an individual ZFN typically contains multiple individual zinc finger repeats, each capable of recognizing multiple base pairs. The most common method for creating new zinc finger domains is to combine smaller zinc finger "modules" of known specificity. The most common cleavage domain in ZFNs is the nonspecific cleavage domain derived from the type II restriction endonuclease FokI. Using the endogenous homologous recombination (HR) machinery and a homologous DNA template bearing the CAR expression cassette, ZFNs can be used to insert a CAR expression cassette into a genome. When the targeting sequence is cleaved by the ZFN, the HR machinery searches for homology between the damaged chromosome and the homologous DNA template and then copies the sequence of the template between the two cut ends of the chromosome, thereby integrating the homologous DNA template into the genome.

[0222] Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cleave specific sequences in DNA. TALEN systems operate on much the same principle as ZFNs. They are created by combining a transcription activator-like effector DNA-binding domain with a DNA-cleavage domain. Transcription activator-like effectors (TALEs) contain a repeating motif of 33-34 amino acids with two variable positions that have strong recognition for specific nucleotides. By assembling an array of these TALEs, the TALE DNA-binding domain can be engineered to bind to a desired DNA sequence, thereby directing the nuclease to cleave at specific locations in the genomic DNA sequence.

[0223] Polynucleotide therapeutics can be directed from any suitable promoter (e.g., human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoter) and can be regulated by any suitable mammalian regulatory element or intron (e.g., elongation factor 1a enhancer / promoter / intron structure). For example, if desired, enhancers known to preferentially direct gene expression in particular cell types can be used to direct expression of the nucleic acid. Enhancers used can include, but are not limited to, those characterized as tissue- or cell-specific enhancers. Alternatively, if a genomic clone is used as a therapeutic construct, regulation can be mediated by cognate regulatory sequences or, if desired, by regulatory sequences derived from heterologous sources, including any of the promoters or regulatory elements described above.

[0224] The method for delivering the genome editing agent / system can vary depending on the need. In certain embodiments, the components of the selected genome editing method are delivered as a DNA construct in one or more plasmids. In certain embodiments, the components are delivered via a viral vector. Common delivery methods include, but are not limited to, electroporation, microinjection, gene gun, impale infection, hydrostatic pressure, continuous infusion, sonication, magnetofection, adeno-associated virus, envelope protein pseudotyping of viral vectors, cis- and trans-acting elements of replication-competent vectors, herpes simplex virus, and chemical vehicles (e.g., oligonucleotides, lipoplexes, polymersomes, polyplexes, dendrimers, inorganic nanoparticles, and cell-penetrating peptides).

[0225] The resulting cells can be grown under conditions similar to those for the unmodified cells, allowing the modified cells to be grown and used for a variety of purposes.

[0226] 6. Polypeptides and Analogs Also included within the presently disclosed subject matter are CD19, CD28, 4-1BB, CD8, CD3ζ, and Fas polypeptides or fragments thereof that are modified in a manner that enhances their antineoplastic activity when expressed in immunoresponsive cells. The presently disclosed subject matter provides methods for optimizing amino acid or nucleic acid sequences by making modifications in the sequence. Such modifications can include certain mutations, deletions, insertions, or post-translational modifications. The presently disclosed subject matter further includes analogs of any naturally occurring polypeptides disclosed herein (including, but not limited to, CD19, CD8, 4-1BB, CD28, CD3ζ, and Fas). Analogs can differ from the naturally occurring polypeptides disclosed herein by differences in amino acid sequence, by post-translational modifications, or both. Analogs may exhibit at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more homology or identity to all or a portion of a naturally occurring amino acid sequence of the presently disclosed subject matter. The length of sequence comparison may be at least 5, 10, 15, or 20 amino acid residues, e.g., at least 25, 50, or 75 amino acid residues, or more than 100 amino acid residues. Also, in an exemplary approach to determining the degree of identity, a BLAST program may be used to compare closely related sequences. -3 and e -100A probability score between 0 and 1 may be used. Modifications include in vivo and in vitro chemical derivatization of polypeptides, such as acetylation, carboxylation, phosphorylation, or glycosylation; such modifications can occur during polypeptide synthesis or processing, or after treatment with isolated modifying enzymes. Analogs can also differ from naturally occurring polypeptides by alterations in primary sequence. These include genetic variants, both natural and induced (resulting from random or site-specific mutagenesis, e.g., by exposure to irradiation or ethane methyl sulfate, as described in Sambrook, Fritsch, and Maniatis, Molecular Cloning: A Laboratory Manual (2nd ed.), CSH Press, 1989, or Ausubel et al., supra). Also included are cyclized peptides, molecules, and analogs that include residues other than L-amino acids, e.g., D-amino acids, or non-naturally occurring or synthetic amino acids, e.g., β- or γ-amino acids.

[0227] In addition to full-length polypeptides, the presently disclosed subject matter also provides fragments of any of the polypeptide or peptide domains disclosed herein. As used herein, the term "fragment" means at least 5, 10, 13, or 15 amino acids. In certain embodiments, fragments comprise at least 20 contiguous amino acids, at least 30 contiguous amino acids, or at least 50 contiguous amino acids. In certain embodiments, fragments comprise at least 60 to 80, 100, 200, 300, or more contiguous amino acids. Fragments can be generated by methods known to those of skill in the art or can be derived from normal protein processing (e.g., removal of amino acids from a nascent polypeptide that are not required for biological activity, or removal of amino acids by alternative mRNA splicing or alternative protein processing events).

[0228] Non-protein analogs have chemical structures designed to mimic the functional activity of the proteins disclosed herein (e.g., dominant-negative Fas polypeptides). Such analogs may exceed the physiological activity of the original polypeptide. Methods for analog design are well known in the art, and analog synthesis can be carried out according to such methods by modifying the chemical structure so that the resulting analog increases the antineoplastic activity of the original polypeptide when expressed in immunoresponsive cells. These chemical modifications include, but are not limited to, substituting alternative R groups and changing the degree of saturation of particular carbon atoms of the reference polypeptide. In certain embodiments, protein analogs are relatively resistant to in vivo degradation and produce a longer-lasting therapeutic effect upon administration. Assays for measuring functional activity include, but are not limited to, those described in the Examples below.

[0229] 7. Administration The cells of the present disclosure or compositions comprising same can be provided systemically or directly to a subject to induce and / or enhance an immune response to an antigen and / or to treat and / or prevent a neoplasm and / or pathogen infection. In certain embodiments, the cells of the present disclosure or compositions comprising same are directly injected into an organ of interest (e.g., an organ affected by a neoplasm). Alternatively, the cells of the present disclosure or compositions comprising same are provided indirectly to an organ of interest, for example, by administration into the circulatory system (e.g., tumor vasculature). Growth and differentiation agents can be provided before, during, or after administration of the cells or compositions to increase the in vitro or in vivo production of T cells or NK cells.

[0230] The cells of the present disclosure can be administered in any physiologically acceptable vehicle, usually intravascularly, although the cells may also be introduced into bone or other convenient sites (e.g., the thymus) where the cells may find a suitable site for regeneration and differentiation. Typically, at least about 1 x 10 5 cells were administered, resulting in a final total of approximately 1 × 10 10The cells of the present disclosure may comprise a population of purified cells. One skilled in the art can easily determine the percentage of cells of the present disclosure in a population using various well-known methods, such as fluorescence-activated cell sorting (FACS). Suitable ranges of purity in a population containing cells of the present disclosure are about 50% to about 55%, about 5% to about 60%, and about 65% to about 70%. In certain embodiments, the purity is about 70% to about 75%, about 75% to about 80%, or about 80% to about 85%. In certain embodiments, the purity is about 85% to about 90%, about 90% to about 95%, and about 95% to about 100%. Dosage can be easily adjusted by one skilled in the art (e.g., a decrease in purity may require an increase in dosage). Cells can be introduced by injection, catheter, etc.

[0231] The compositions of the present disclosure can be pharmaceutical compositions comprising the cells of the present disclosure or their progenitor cells and a pharmaceutically acceptable carrier. Administration can be autologous or heterologous. For example, cells or progenitor cells can be obtained from one subject and administered to the same subject or to a different compatible subject. Peripheral blood-derived cells or their progeny (e.g., derived in vivo, ex vivo, or in vitro) can be administered via catheter administration, systemic injection, local injection, intravenous injection, or local injection, including parenteral administration. When administering a therapeutic composition of the present disclosure, it can be formulated into a unit-dosage injectable form (solution, suspension, emulsion).

[0232] 8. Preparation Compositions containing the cells of the present disclosure can be conveniently provided as sterile liquid preparations, such as isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may be buffered to a selected pH. Liquid preparations are generally easier to prepare than gels, other viscous compositions, and solid compositions. In addition, liquid compositions are somewhat more convenient to administer, particularly by injection. On the other hand, viscous compositions can be formulated within an appropriate viscosity range to provide longer contact periods with specific tissues. Liquid or viscous compositions can contain a carrier, which can be a solvent or dispersion medium, including, for example, water, saline, phosphate-buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof.

[0233] Sterile injectable solutions can be prepared by incorporating the genetically modified immunoresponsive cells in the required amount of an appropriate solvent with various amounts of other ingredients, as desired. Such compositions may be in admixture with a suitable carrier, diluent, or additive, such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can also be lyophilized. The compositions may contain auxiliary substances, such as wetting agents, dispersing or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or thickening additives, preservatives, flavoring agents, coloring agents, and the like, depending on the desired route of administration and preparation. Suitable preparations may be prepared without undue experimentation with reference to standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE," 17th Edition, 1985, incorporated herein by reference.

[0234] Various additives can be added to enhance the stability and sterility of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Prevention of microbial activity can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and the like. Prolonged absorption of injectable pharmaceutical forms can be brought about by the use of agents delaying absorption, such as aluminum monostearate and gelatin. However, according to the subject matter of the present disclosure, any vehicle, diluent, or additive used must be compatible with the genetically modified immunoresponsive cells or their precursor cells.

[0235] The compositions may be isotonic, i.e., they may have the same osmotic pressure as blood and tears. The desired isotonicity of the composition may be achieved using sodium chloride or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol, or other inorganic or organic solutes. Sodium chloride may be used, particularly for buffers containing sodium ions.

[0236] The viscosity of the composition can be maintained at a selected level, if desired, using a pharmaceutically acceptable thickening agent. For example, methylcellulose is readily and economically available and easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, and the like. The concentration of the thickening agent can depend on the drug selected. The key is to use an amount that achieves the selected viscosity. Obviously, the selection of appropriate carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is formulated as a solution, suspension, gel, or another liquid form, e.g., sustained-release form or liquid-filled form).

[0237] The amount of cells administered will vary depending on the subject being treated. In one embodiment, about 10 4 from about 10 10 Between about 10 5 from about 10 9Between, or about 10 6 from about 10 8 Between about 1 x 10 cells of the present disclosure are administered to a human subject. More effective cells may be administered in even smaller numbers. In certain embodiments, at least about 1 x 10 cells are administered. 8 pieces, approximately 2×10 8 pieces, about 3 x 10 8 pieces, about 4×10 8 or approximately 5 x 10 8 The cells of the present disclosure are administered to a human subject. The precise determination of what is considered an effective dose can be based on individual factors for each subject, including the size, age, sex, weight, and condition of the particular subject. Dosages can be readily ascertained by one skilled in the art from this disclosure and knowledge in the art.

[0238] Those skilled in the art can easily determine the amount of cells and optional additives, vehicles, and / or carriers in the compositions and administered in the methods. Typically, any additives (in addition to active cells and / or drugs) are present in an amount of 0.001 to 50% (by weight) solution in phosphate-buffered saline, and the active ingredient is present in amounts on the order of micrograms to milligrams, e.g., about 0.0001 to about 5% by weight, about 0.0001 to about 1% by weight, about 0.0001 to about 0.05% by weight, or about 0.001 to about 20% by weight, about 0.01 to about 10% by weight, or about 0.05 to about 5% by weight. For any composition administered to animals or humans, the following can be determined: toxicity, such as by determining the lethal dose (LD) and LD50 in an appropriate animal model, e.g., rodents such as mice; the dosage of the composition, the concentration of components therein, and the timing of administering the composition that will elicit an appropriate response. Such determinations do not require undue experimentation from the knowledge of one of ordinary skill in the art, this disclosure, and the documents cited herein, and the time for sequential administration can be ascertained without undue experimentation.

[0239] 9.Treatment method The presently disclosed subject matter provides methods for inducing and / or increasing an immune response in a subject in need thereof. The cells of the present disclosure and compositions comprising them can be used to treat and / or prevent a neoplasm in a subject. The cells of the present disclosure and compositions comprising them can be used to prolong the survival of a subject suffering from a neoplasm. The cells of the present disclosure and compositions comprising them can also be used to treat and / or prevent a neoplasm in a subject. The cells of the present disclosure and compositions comprising them can also be used to reduce tumor burden in a subject. The cells of the present disclosure and compositions comprising them can also be used to treat and / or prevent pathogen infection or other infectious disease in a subject, e.g., an immunocompromised human subject. Such methods include administering the cells of the present disclosure or a composition comprising them (e.g., a pharmaceutical composition) in an amount effective to achieve the desired effect, which is the alleviation of an existing condition or the prevention of recurrence. For treatment, the amount administered is an amount effective to produce the desired effect. An effective amount can be provided in a single or series of administrations. An effective amount can be provided by bolus or continuous perfusion.

[0240] In adoptive immunotherapy using antigen-specific T cells, typically about 10 6 -10 11 pieces (e.g., about 10 9 A cell dose in the range of 1000 to 10000 cells is injected. Upon administration of the cells of the present disclosure to a host and subsequent differentiation, T cells specifically directed against a specific antigen are induced. The modified cells can be administered by any method known in the art, including, but not limited to, intravenous, subcutaneous, intranodal, intratumoral, intrathecal, intrapleural, intraperitoneal, intramedullary, and directly into the thymus.

[0241] The presently disclosed subject matter provides methods for treating and / or preventing a neoplasm in a subject. In certain embodiments, the methods comprise administering to a subject having a neoplasm an effective amount of a cell of the present disclosure or a composition comprising the same.

[0242] In certain embodiments, the neoplasm is a malignant neoplasm. In certain embodiments, the neoplasm or tumor is a cancer with increased FASLG RNA expression relative to matched normal tissue of origin. See Yamamoto et al., J Clin Invest. (2019); 129(4):1551-1565, incorporated herein by reference.

[0243] Non-limiting examples of neoplasms (e.g., malignant neoplasms) include blood cancers (e.g., leukemia, lymphoma, and myeloma), ovarian cancer, breast cancer, bladder cancer, brain cancer, colon cancer, intestinal cancer, liver cancer, lung cancer, pancreatic cancer, prostate cancer, skin cancer, gastric cancer, glioblastoma, pharyngeal cancer, melanoma, neuroblastoma, adenocarcinoma, glioma, soft tissue sarcoma, and various carcinomas (including prostate cancer and small cell lung cancer). Suitable carcinomas include, but are not limited to, astrocytoma, fibrosarcoma, myxosarcoma, liposarcoma, oligodendroglioma, ependymoma, medulloblastoma, primitive neuroectodermal tumor (PNET), chondrosarcoma, osteogenic sarcoma, pancreatic ductal adenocarcinoma, small cell and large cell lung adenocarcinoma, chordoma, angiosarcoma, endothelial sarcoma, squamous cell carcinoma, bronchoalveolar carcinoma, epithelial adenocarcinoma and its liver metastases, lymphangiosarcoma, lymphangioendothelial sarcoma, hepatocellular carcinoma, cholangiocellular carcinoma, synovioma, mesothelioma, Ewing's tumor, rhabdomyosarcoma, colon carcinoma, basal cell carcinoma, sweat gland carcinoma, papillary carcinoma, sebaceous gland carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Further included are any known in the field of oncology, including Wilms' tumor, testicular tumor, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, leukemia, multiple myeloma, Waldenstrom's macroglobulinemia, and heavy chain disease, breast tumors such as ductal and lobular adenocarcinoma, squamous cell and adenocarcinoma of the cervix, epithelial carcinoma of the uterus and ovary, prostate adenocarcinoma, transitional squamous cell carcinoma of the bladder, B and T cell lymphoma (nodular and scattered), plasmacytoma, acute and chronic leukemia, malignant melanoma, soft tissue sarcoma, and leiomyosarcoma. In certain embodiments, the neoplasm (e.g., malignant neoplasm) is selected from the group consisting of hematological cancer (e.g., leukemia, lymphoma, and myeloma), ovarian cancer, prostate cancer, breast cancer, bladder cancer, brain cancer, colon cancer, intestinal cancer, liver cancer, lung cancer, pancreatic cancer, prostate cancer, skin cancer, gastric cancer, glioblastoma, and pharyngeal cancer. In certain embodiments, the immunoresponsive cells of the present disclosure and compositions comprising same can be used to treat and / or prevent hematological cancer (e.g., leukemia, lymphoma, and myeloma) or ovarian cancer that are refractory to typical therapeutic interventions.

[0244] In certain embodiments, the neoplasm is a solid cancer or solid tumor, hi certain embodiments, the solid tumor or solid cancer is selected from the group consisting of glioblastoma, prostate adenocarcinoma, papillary cell renal carcinoma, sarcoma, ovarian cancer, pancreatic adenocarcinoma, rectal adenocarcinoma, colon adenocarcinoma, esophageal cancer, uterine endometrioid carcinoma, breast cancer, cutaneous melanoma, lung adenocarcinoma, gastric adenocarcinoma, cervical cancer, renal clear cell carcinoma, testicular germ cell tumor, and aggressive B-cell lymphoma.

[0245] The subject may have an advanced form of the disease, in which case the treatment objectives may include slowing or reversing disease progression and / or ameliorating side effects. The subject may have a history of a condition that has already been treated, in which case the treatment objectives typically include reducing or delaying the risk of recurrence.

[0246] Human subjects suitable for treatment typically comprise two treatment groups that can be distinguished by clinical criteria. Subjects with "advanced disease" or "high tumor burden" are those with clinically measurable tumors. Clinically measurable tumors are those that can be detected based on tumor burden (e.g., by palpation, CAT scan, sonogram, mammogram, or X-ray; positive biochemical or histopathological markers alone are insufficient to identify this population). Pharmaceutical compositions are administered to these subjects to elicit an anti-tumor response with the goal of alleviating the subject's condition. Ideally, a reduction in tumor burden occurs as a result, although any clinical improvement constitutes benefit. Clinical improvement includes a reduction in the risk or rate of tumor progression or a reduction in the pathological consequences of the tumor.

[0247] A second group of suitable subjects is known in the art as the "adjuvant group." These are individuals who have a history of neoplasia but have responded to other treatment modalities. Previous treatments may include, but are not limited to, surgical resection, radiation therapy, and traditional chemotherapy. As a result, these individuals do not have clinically measurable tumors. However, they are suspected of being at risk for disease progression near the original tumor site or through metastasis. This group can be further subdivided into high-risk and low-risk individuals. The subdivision is based on characteristics observed before and after initial treatment. These characteristics are known in the clinical field and are appropriately defined for each different neoplasm. Typical characteristics for the high-risk subgroup are tumor invasion into adjacent tissues or lymph node involvement.

[0248] Another group has a genetic predisposition to neoplasia but does not yet have documented clinical signs of the neoplasia. For example, a woman who tests positive for a genetic mutation associated with breast cancer but is still of childbearing age may wish to receive one or more of the immunoresponsive cells described herein in a prophylactic treatment to prevent the development of a neoplasia until it is appropriate to perform prophylactic surgery.

[0249] As a result of surface expression of an antigen-recognizing receptor that binds to a tumor antigen and a dominant-negative Fas polypeptide (e.g., an exogenous dominant-negative Fas polypeptide) that enhances the antitumor effect of cells containing the antigen-recognizing receptor and the dominant-negative Fas polypeptide, adoptively transferred T or NK cells are endowed with enhanced selective cytolytic activity at the tumor site. Furthermore, after their localization to the tumor or viral infection and their proliferation, T cells transform the tumor or viral infection site into a highly conducive environment for a wide range of immune cells (tumor-infiltrating lymphocytes, NK cells, NKT cells, dendritic cells, and macrophages) that participate in physiological antitumor or antiviral responses.

[0250] Additionally, the presently disclosed subject matter provides methods for treating and / or preventing a pathogen infection (e.g., a viral infection, a bacterial infection, a fungal infection, a parasitic infection, or a protozoan infection) in a subject, e.g., in an immunocompromised subject. The methods can include administering an effective amount of a cell of the present disclosure or a composition comprising the same to a subject having a pathogen infection. Exemplary viral infections amenable to treatment include, but are not limited to, cytomegalovirus (CMV), Epstein-Barr virus (EBV), human immunodeficiency virus (HIV), and influenza virus infections.

[0251] Further modifications can be introduced into the cells (e.g., T cells) of the present disclosure to avoid or minimize the risk of immunological complications (known as "malignant T cell transformation"), such as graft-versus-host disease (GvHD), or when healthy tissue expresses the same target antigen as tumor cells, resulting in outcomes similar to GvHD. A potential solution to this problem is to engineer a suicide gene into the cells of the present disclosure. Suitable suicide genes include, but are not limited to, herpes simplex virus thymidine kinase (hsv-tk), inducible caspase-9 suicide gene (iCasp-9), and truncated human epidermal growth factor receptor (EGFRt) polypeptide. In certain embodiments, the suicide gene is an EGFRt polypeptide. The EGFRt polypeptide can enable T cell elimination by administering an anti-EGFR monoclonal antibody (e.g., cetuximab). The EGFRt can be covalently linked upstream of the antigen-recognition receptor. The suicide gene can be included in a vector containing a nucleic acid encoding a CAR of the present disclosure. In this manner, administration of a prodrug (e.g., a prodrug (e.g., AP1903, which can activate iCasp-9) designed to activate a suicide gene during malignant T cell transformation (e.g., GVHD) triggers apoptosis in suicide gene-activating receptor-expressing (e.g., CAR-expressing) T cells. The incorporation of a suicide gene into an antigen recognition receptor (e.g., CAR) of the present disclosure provides an additional level of safety due to its ability to eliminate large numbers of receptor-expressing (e.g., CAR-expressing) T cells in a very short period of time. Cells (e.g., T cells) of the present disclosure that have an incorporated suicide gene can be preemptively eliminated at a given time point after T cell infusion or eradicated at the earliest sign of toxicity.

[0252] 10. Kit The presently disclosed subject matter provides kits for inducing and / or enhancing an immune response and / or treating and / or preventing a neoplasm or pathogen infection in a subject. In certain embodiments, the kits include an effective amount of the cells of the present disclosure or a pharmaceutical composition comprising the same. In certain embodiments, the kits include a sterile container; such a container may be a box, an ampoule, a bottle, a vial, a tube, a bag, a sachet, a blister pack, or any other suitable container format known in the art. Such a container may be made of plastic, glass, laminated paper, metal foil, or other material suitable for holding pharmaceuticals. In certain embodiments, the kits include a nucleic acid molecule encoding an antigen-recognition receptor (e.g., a CAR or TCR) directed against an antigen of interest and a nucleic acid molecule encoding an expressible form of a dominant-negative Fas polypeptide, optionally present on one or more vectors.

[0253] If desired, the cells and / or nucleic acid molecules are provided with instructions for administering the cells or nucleic acid molecules to a subject having or at risk of developing a neoplasm, pathogen, or immune disorder. The instructions generally include information about using the composition for the treatment and / or prevention of a neoplasm or pathogen infection. In certain embodiments, the instructions include at least one of the following: a description of the therapeutic agent; dosing schedules and administration for the treatment or prevention of a neoplasm, pathogen infection, or immune disorder, or symptoms thereof; cautions; warnings; indications; contraindications; overdose information; adverse reactions; animal pharmacology; clinical studies; and / or references. The instructions may be printed directly on the container (if present), as a label affixed to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container. [Example]

[0254] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are well within the skill of those in the art. Such techniques are explained fully in the literature, e.g., "Molecular Cloning: A Laboratory Manual," 2nd ed. (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Methods in Enzymology" and "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Protocols in Molecular Biology" (Ausubel, 1987); "PCR: The Polymerase Chain Reaction" (Mullis, 1994); and "Current Protocols in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides disclosed herein and thus may be considered in making and practicing the presently disclosed subject matter. Techniques particularly useful for particular embodiments are discussed in the sections that follow.

[0255] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the cells and compositions of the present disclosure, and are not intended to limit the scope of what the inventors regard as their invention.

[0256] Example 1 - T cells modified with N-terminally mutated Fas DNR [Methods and Materials] Cell Culture: Jurkat76 and Platinum-GP retroviral packaging cells (Cell Biolabs) were cultured in RPMI supplemented with 10% fetal bovine serum, 10 mM HEPES (Gibco), and 25 units / ml PenStrep (Gibco). Primary T cells were cultured in RPMI supplemented with 10% heat-inactivated human serum, 25 mM HEPES (Gibco), and 50 units / ml PenStrep (Gibco). Single-clone selection of Fas CRISPR-edited Jurkat cells was performed by seeding 100 μl of cells per well in 96-well plates at a density of 0.5 cells per well. Cells were cultured for 3 weeks, and Fas surface expression was measured by flow cytometry.

[0257] Isolation and Expansion of Human T Cells. Buffy coats were obtained from healthy donors at the New York Blood Donation Center. Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation using Lymphocyte Separation Medium (Corning). CD8+ T cells were isolated using the EasySep Human CD8+ T Cell Isolation Kit (Stemcell). CD8+ T cells were activated with 5 μg / ml anti-CD3 (Miltenyi Biotec) antibody-coated plates and 1 μg / ml soluble anti-CD28 (Miltenyi Biotec). For viral transduction, T cells were treated with 50 IU / ml IL-2 (PeproTech) for 2 days prior to transduction.

[0258] [Plasmid Design and Viral Transduction] All plasmids for viral packaging were designed based on the SFGγ retroviral vector. The feline endogenous retroviral envelope RD114 was used for cotransduction of Platinum-GP cells with the SFGγ vector. Lipofectamine 3000 (ThermoFisher) was used for cotransduction of Platinum-GP cells. Jurkat cells and primary T cells were transduced with viral supernatant on Retronectin (Takara)-coated plates. Briefly, plates were coated with 20 μg / ml Retronectin overnight at 4°C and then blocked with 2% FBS in PBS for 30 minutes at room temperature. The plates were washed with PBS and loaded with viral supernatant. Centrifugation was performed at 2000 g for 2 hours at 32°C. The supernatant was aspirated, and cells were loaded into each well. The plates were again centrifuged at 1200 rpm for 5 minutes at 32°C and incubated at 37°C for 2 days.

[0259] [CRISPR editing] Single guide RNA (sgRNA) targeting Fas exon 2 was synthesized by Synthego using the 20-nt target sequence: GUGACUGACAUCAACUCCAA (SEQ ID NO: 66) (chemically modified). Briefly, 2 μl of 50 μM sgRNA was mixed with 1 μl of 20 μM recombinant Cas9 protein (Synthego) at room temperature for 10 minutes. One million Jurkat cells were resuspended in 17 μl of Nucleofector solution P3 (Lonza) and mixed with the sgRNA / Cas9 complex. Electroporation was performed using a Lonza 4D Nucleofector with AXP-1004 16-well strips (Lonza). The electroporation program was set as follows: Cell type: T cell human stimulation using code EC115. Fas expression after CRISPR editing was measured by flow cytometry 4 days after electroporation.

[0260] Sanger sequencing and sequence analysis: CRISPR editing efficiency was confirmed by analyzing sequence data from PCR amplicons using PCR primers: 5'-TCTATCATTCATGGTGCTGTTTC-3' (SEQ ID NO: 67) and 5'-AGGGGAACCAAAAACTGTAAAA-3' (SEQ ID NO: 68). KOD Hot Start Master Mix (EMD Millipore) was used for PCR products. PCR amplicon purification and sequencing services were provided by Genwiz. CRISPR-edited sequences were compared with wild-type control sequences using ICE sequencing software (Synthego).

[0261] [Flow cytometry and intracellular staining] Conjugated antibodies used for flow cytometry include Brilliant Violet 421. TM Antibodies used included anti-human EGFR (AY13, Biolegend), PE / Cy5 anti-human CD95 Fas (DX2, Biolegend), APC / Cyanine7 anti-human CD95 Fas (DX2, Biolegend), and PerCP / Cyanine5.5 anti-human TNF-α (Mab11, Biolegend). For NY-ESO targeting TCR, PE anti-TCRVβ13.1 (IMMU222, Beckman Coulter) was used. For CAR staining, Alexa Fluor 647 AffiniPure F(ab')2 fragment goat anti-mouse IgG, F(ab')2 antibody (Jackson ImmunoResearch) was used. Cell viability was assessed using LIVE / DEAD antibodies. TM The Fixable Aqua Dead Cell Stain kit (ThermoFisher) was used. For intracellular staining, Cytofix / Cytoperm TM A fixation / permeabilization solution kit (BD Biosciences) was used according to standard commercially available protocols.

[0262] FasL Apoptosis Assays: A soluble form of FasL oligomerized via the leucine zipper motif (FasL-LZ) was used at 100 ng / ml for all apoptosis assays. Cells were treated with FasL-LZ at designated time points at 37°C. Cells were washed and stained for surface antibodies. Cells were incubated in a CellEvent TM Cells were stained with Caspase-3 / 7 Green detection reagent (ThermoFisher) for 25 minutes at 37°C and washed twice. Cells were then stained with APC Annexin V (Biolegend) in Annexin V binding buffer (Biolegend) for 25 minutes at room temperature. Cells were washed twice and resuspended in Annexin V binding buffer for flow cytometry.

[0263] Statistical Analysis: All statistical analyses were performed using Prism7 (GraphPad) software. No statistical methods were used to predetermine sample size. All analyses were performed on triplicate samples. Statistical comparisons between two groups were calculated by the matched-sample paired Student's t-test. P<0.05 was considered statistically significant.

[0264] [result] The functionality of T cells modified with both FasDNR and CAR was evaluated. Two versions of the human FasDNR construct (see Figure 1A) were generated: a modular version and a combined version. Figure 1B demonstrates the activity of T cells containing the FasDNR construct. As shown in Figure 1B, 1928ζ1XXCAR inhibited the CD19 + FasDNR targeted malignant cells. FasDNR could protect T cells containing CAR and FasDNR from FasL-induced apoptosis. When administered together with cetuximab, it could target EGFRt and induce antibody-dependent cellular cytotoxicity (ADCC) or complement-dependent cytotoxicity.

[0265] Human Jurkat cells were retrovirally transduced with EGFRt alone or EGFRt / FasDNR. Cells were stained 2 days after transduction. As shown in Figure 1C, FasDNR and EGFRt expression were proportional in the transduced cells at a ratio of approximately 1:1.

[0266] Primary human CD8 + T cells were co-transduced with a TCR targeting the NY-ESO antigen. Cells with or without FasDNR were exposed to antigen for 6 hours before intracellular cytokine staining. The results of intracellular staining for TNFα are shown in Figure 1D. As shown in Figure 1D, FasDNR-transduced CD8 + Antigen-specific TNFα expression in T cells was not inferior to that in control cells not modified with FasDNR, a finding indicating that FasDNR does not reduce TNFα secretion in antigen-activated T cells.

[0267] Primary human CD8 + T cells were exposed to 100 ng / ml of FasL leucine zipper (FasL-lz) for the indicated time points. Activated caspase 3 / 7 and annexin V were used as early apoptosis markers. The results are shown in Figure 1E. As shown in Figure 1E, FasL stimulation induced apoptosis in 70% of cells without FasDNR, whereas <20% of cells underwent apoptosis in FasDNR-positive cells. This result suggests that FasDNR stimulates human CD8 + To confirm that T cells are protected from FasL-induced apoptotic signaling.

[0268] In summary, FasDNR protected cells from FasL-induced apoptosis without affecting T cell tumor-targeting function.

[0269] Using a CRISPR / Cas9 approach, a series of mutations were generated in the N-terminal region of Fas, and three major distinct T cell clones were identified: clone 15, which contained the wild-type Fas exon 2 sequence (having the amino acid sequence shown in SEQ ID NO: 10); clone 17, which contained a deletion of N31 and S32 in the N-terminal region compared to wild-type Fas (e.g., clone 15); and clone 19, which contained a biallelic 19-base frameshift deletion. See Figure 2C.

[0270] Jurkat cells were electroporated with recombinant Cas9 protein loaded with synthetic guide (sg) RNA targeting exon 2 of the human Fas gene. Approximately 3 weeks after electroporation, single-cell cloning was performed, and Fas surface expression was measured in the edited T cells. The results are shown in Figure 2A. As shown in Figure 2A, clone #15 (gray) represents unedited wild-type Fas cell surface expression. Clone #17 (open) showed a higher Fas expression level than the wild-type, while clone #19 (black) showed the lowest level of Fas. Figure 2B shows the average Fas expression levels from Figure 2A across triplicate samples. Clone #17 showed significantly higher Fas expression than clone #15.

[0271] In summary, clones 15, 17, and 19 showed different Fas expression levels. For example, the Fas expression level of clone 17 was higher than that of clones 15 and 19.

[0272] Next, the responsiveness of Jurkat cells containing clones 15, 17, or 19 to FasL stimulation was evaluated. The results are shown in Figures 3A and 3B. As shown in Figures 3A and 3B, clone 17 showed a sensitive response to FasL stimulation.

[0273] Jurkat cells were exposed to 100 ng / ml FasL-LZ for the indicated time points. Apoptosis was assessed. The results are shown in Figures 4A and 4B. As shown in Figures 4A and 4B, clone #15, which had unedited wild-type Fas, underwent apoptosis after FasL stimulation. Fas knockout clone #19 was resistant to apoptosis. In addition, clone #19 cells transduced with FasDNR were also protected from FasL-induced apoptosis.

[0274] In summary, Fas knockout clone #19 and FasDNR-transduced cells were protected from FasL-induced apoptosis.

[0275] As shown in Figure 5, a number of N-terminal mutants were constructed. Fas del32DNR consists of a deletion of amino acids at positions 32 and 230-314, and has the amino acid sequence shown in SEQ ID NO: 16. Fas del31-32DNR consists of a deletion of amino acids at positions 31 and 32 and 230-314, and has the amino acid sequence shown in SEQ ID NO: 18. Fas del32-33DNR consists of a deletion of amino acids at positions 32 and 33 and 230-314, and has the amino acid sequence shown in SEQ ID NO: 20. Fas S32A DNR consists of a deletion of amino acids at position 32 and 230-314, and has the amino acid sequence shown in SEQ ID NO: 24.

[0276] Fas del32 consists of the amino acid sequence shown in SEQ ID NO:56, provided below. JPEG2025169261000048.jpg25169

[0277] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:56 is shown in SEQ ID NO:57, provided below. JPEG2025169261000049.jpg68168

[0278] Fas del31-32 consists of the amino acid sequence shown in SEQ ID NO:58, provided below. JPEG2025169261000050.jpg25169

[0279] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:58 is shown in SEQ ID NO:59, provided below. JPEG2025169261000051.jpg68168

[0280] Fas del32-33 consists of the amino acid sequence shown in SEQ ID NO:60, provided below. JPEG2025169261000052.jpg25169

[0281] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:60 is shown in SEQ ID NO:61, provided below. JPEG2025169261000053.jpg69169

[0282] Fas S32A consists of the amino acid sequence shown in SEQ ID NO:62, provided below. JPEG2025169261000054.jpg25169

[0283] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:62 is shown in SEQ ID NO:63, provided below. JPEG2025169261000055.jpg69168

[0284] Fas del33-34 was also generated (not shown in Figure 5), and consists of the amino acid sequence shown in SEQ ID NO:64, provided below. JPEG2025169261000056.jpg25168

[0285] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:64 is shown in SEQ ID NO:65, provided below. JPEG2025169261000057.jpg69168

[0286] The transduction efficiency of clone #19 Fas knockout Jurkat cells with various Fas constructs was evaluated. Clone #19 Fas knockout Jurkat cells were transduced with Fas or FasDNR containing different N-terminal mutants and stained for Fas expression 3 days after test transduction. The results are shown in Figures 6A and 6B. As shown in Figures 6A and 6B, the Fas N-terminal mutants increased the Fas transduction efficiency.

[0287] Example 2 - Sensitivity of cells expressing FasDNR with S32 or N31S32 deletions to FasL-induced apoptosis [Methods and Materials] Human-derived Jurkat cells were retrovirally transduced with EGFRt / 1928z with or without Fas mutation. Using the Stemcell EasySep Human PE Positive Selection Kit II and a PE anti-human EGFR antibody (Biolegend, clone AY13), cells from the EGFRt-positive population were isolated 2 days post-transduction. On day 8 post-transduction, FasL-LZ (100 ng / ml) was used for apoptosis assays at designated time points at 37°C. Cells were washed twice with FACS buffer and stained for surface antibodies. Cells were incubated for 25 minutes at 37°C in CellEvent™ in FACS buffer. TM After staining with Caspase-3 / 7 Green detection reagent (ThermoFisher) and washing twice, cells were then stained with APC Annexin V (Biolegend) in Annexin V binding buffer (Biolegend) for 25 minutes at room temperature. Cells were washed twice and resuspended in Annexin V binding buffer for flow cytometry.

[0288] [result] Jurkat cells were treated with FasL on day 8 after transduction. As shown in Figures 7A and 7B, cells expressing FasD31DNR and FasD3132DNR were better protected from FasL-induced apoptosis (as indicated by the percentage of active caspase 3 / 7 and annexin V double-positive cells) than cells expressing FasDNR without the N-terminal mutation. p values ​​were determined by unpaired Student's t-test ( ** p<0.01, *** p<0.001).

[0289] Example 3 - Human natural killer cells modified with N-terminally mutated FasDNR The utility and utility of N-terminal mutant FasDNR expression in human NK cells was investigated. Human NK cells were negatively isolated from human umbilical cord blood using magnetic beads. NK cells were cocultured with irradiated K562 (clone 9) feeder cells at a 1:2 ratio (NK cells vs. feeder cells). Medium supplemented with 200 IU / ml recombinant human IL-2 was added at activation and replaced every other day. Fas expression was determined by flow cytometry 5 days after activation. Upon activation, Fas expression was upregulated in human NK cells (see Figure 8). Results from triplicate cultures at rest and activation are shown as bar graphs + / - SEM. *** =P<0.001.

[0290] Fas expression levels were examined in human NK cells transduced with CAR, CAR-Fas DNR, or CAR-N-terminal mutant Fas DNR. The N-terminal mutant Fas DNR (designated "Fas DNR del31-32" or "Fas del31-32 DNR") contains deletions of amino acids 31 and 32 and 230-314, and is represented by the amino acid sequence shown in SEQ ID NO: 18. Human NK cells activated for 5 days were transduced with DMEM medium (untransduced control) or viral supernatant on retronectin-coated plates at 20 μg / ml to generate NK cells transduced with EGFRt / 1928z, EGFRt / 1928z / Fas DNR, or EGFRt / 1928z / Fas DNR del31-32. Excess irradiated feeder cells were replaced every other day. Cells were harvested 4 days after viral transduction for flow cytometry staining. *** =P<0.001. Figure 9 shows that human NK cells can be effectively transduced with FasDNR and N-terminal mutant FasDNR. Figure 10 shows that N-terminal mutant FasDNR-modified human NK cells significantly enhanced NK cell survival when exposed to recombinant FasL compared with FasDNR and unmodified NK cells.

[0291] [References] 1. SL Maude et al., Tisagenlecleucel in Children and Young Adults with B-Cell Lymphoblastic Leukemia. N Engl J Med 378, 439-448 (2018). 2. SSNeelapu et al., Axicabtagene Ciloleucel CAR T-Cell Therapy in Refractory Large B-Cell Lymphoma. N Engl J Med 377, 2531-2544 (2017). 3. D.W. Lee et al., T cells expressing CD19 chimeric antigen receptors for acute lymphoblastic leukaemia in children and young adults: a phase 1 dose-escalation trial. Lancet 385, 517-528 (2015). 4. D.L. Porter et al., Chimeric antigen receptor T cells persist and induce sustained remissions in relapsed refractory chronic lymphocytic leukemia. Sci Transl Med 7, 303ra139 (2015). 5. C.J. Turtle et al., Immunotherapy of non-Hodgkin’s lymphoma with a defined ratio of CD8+ and CD4+ CD19-specific chimeric antigen receptor-modified T cells. Sci Transl Med 8, 355ra116 (2016). 6. C.A. Ramos et al., Clinical and immunological responses after CD30-specific chimeric antigen receptor-redirected lymphocytes. J Clin Invest 127, 3462-3471 (2017). 7. J.H. Park et al., Long-Term Follow-up of CD19 CAR Therapy in Acute Lymphoblastic Leukemia. N Engl J Med 378, 449-459 (2018). 8. T.J. Fry et al., CD22-targeted CAR T cells induce remission in B-ALL that is naive or resistant to CD19-targeted CAR immunotherapy. Nat Med, (2017). 9. R.L. Siegel, K.D. Miller, A. Jemal, Cancer statistics, 2018. CA Cancer J Clin 68, 7-30 (2018). 10. C.U. Louis et al., Antitumor activity and long-term fate of chimeric antigen receptor-positive T cells in patients with neuroblastoma. Blood 118, 6050-6056 (2011). 11. M.R. Parkhurst et al., T cells targeting carcinoembryonic antigen can mediate regression of metastatic colorectal cancer but induce severe transient colitis. Mol Ther 19, 620-626 (2011). 12. N. Ahmed et al., Human Epidermal Growth Factor Receptor 2 (HER2)-Specific Chimeric Antigen Receptor-Modified T Cells for the Immunotherapy of HER2-Positive Sarcoma. J Clin Oncol 33, 1688-1696 (2015). 13. Y.C. Lu et al., Treatment of Patients With Metastatic Cancer Using a Major Histocompatibility Complex Class II-Restricted T-Cell Receptor Targeting the Cancer Germline Antigen MAGE-A3. J Clin Oncol 35, 3322-3329 (2017). 14. C.A. Klebanoff, S.A. Rosenberg, N.P. Restifo, Prospects for gene-engineered T cell immunotherapy for solid cancers. Nat Med 22, 26-36 (2016). 15. M.V. Maus, C.H. June, Making Better Chimeric Antigen Receptors for Adoptive T-cell Therapy. Clin Cancer Res 22, 1875-1884 (2016). 16. L. Gattinoni, C.A. Klebanoff, N.P. Restifo, Paths to stemness: building the ultimate antitumour T cell. Nat Rev Cancer 12, 671-684 (2012). 17. J. Zhu et al., Resistance to cancer immunotherapy mediated by apoptosis of tumor-infiltrating lymphocytes. Nat Commun 8, 1404 (2017). 18. S.A. Rosenberg et al., Durable complete responses in heavily pretreated patients with metastatic melanoma using T-cell transfer immunotherapy. Clin Cancer Res 17, 4550-4557 (2E1). It should be noted that there seems to be a minor error in the original text where "45504557" in item 10 should likely be "4550-4557", and this has been corrected in the translation.19. S. Stevanovic et al., Landscape of immunogenic tumor antigens in successful immunotherapy of virally induced epithelial cancer. Science 356, 200 - 205 (2017). 20. A. Heczey et al., CAR T Cells Administered in Combination with Lymphodepletion and PD - 1 Inhibition to Patients with Neuroblastoma. Mol Ther 25, 2214 - 2224 (2017). 21. E. A. Chong et al., PD - 1 blockade modulates chimeric antigen receptor (CAR) - modified T cells: refueling the CAR. Blood 129, 1039 - 1041 (2017). 22. G. P. Adams et al., High affinity restricts the localization and tumor penetration of single - chain fv antibody molecules. Cancer Res 61, 4750 - 4755 (2001). 23. M. A. Postow, R. Sidlow, M. D. Hellmann, Immune - Related Adverse Events Associated with Immune Checkpoint Blockade. N Engl J Med 378, 158 - 168 (2018). 24. D. Aran et al., Comprehensive analysis of normal adjacent to tumor transcriptomes. Nat Commun 8, 1077 (2017). 25. G. T. Consortium, The Genotype - Tissue Expression (GTEx) project. Nat Genet 45, 580 - 585 (2013). 26. B. Li, C. N. Dewey, RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 12, 323 (2011). 27. A. Subramanian et al., Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102, 15545 - 15550 (2005). 28. D. Hamann et al., Phenotypic and functional separation of memory and effector human CD8+ T cells. J Exp Med 186, 1407 - 1418 (1997). 29. L. Gattinoni et al., A human memory T cell subset with stem cell-like properties. Nat Med 17, 1290 - 1297 (2011). 30. K. E. Pauken et al., Epigenetic stability of exhausted T cells limits durability of reinvigoration by PD-1 blockade. Science 354, 1160 - 1165 (2016). 31. C. L. Mackall et al., Distinctions between CD8+ and CD4+ T-cell regenerative pathways result in prolonged T-cell subset imbalance after intensive chemotherapy. Blood 89, 3700 - 3707 (1997). 32. D. Kagi et al., Fas and perforin pathways as major mechanisms of T cell-mediated cytotoxicity. Science 265, 528 - 530 (1994). 33. Z. Hao, T. W. Mak, Type I and type II pathways of Fas-mediated apoptosis are differentially controlled by XIAP. J Mol Cell Biol 2, 63 - 64 (2010). 34. A. S. Mohamood et al., Protection from autoimmune diabetes and T-cell lymphoproliferation induced by FasL mutation are differentially regulated and can be uncoupled pharmacologically. Am J Pathol 171, 97 - 106 (2007). 35. R. M. Siegel et al., Fas preassociation required for apoptosis signaling and dominant inhibition by pathogenic mutations. Science 288, 2354 - 2357 (2000). 36. M. P. Boldin et al., A novel protein that interacts with the death domain of Fas / APO1 contains a sequence motif related to the death domain. J Biol Chem 270, 7795 - 7798 (1995). 37. A.M. Chinnaiyan, K. O’Rourke, M. Tewari, V.M. Dixit, FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 81, 505-512 (1995). 38. J.P. Medema et al., FLICE is activated by association with the CD95 death-inducing signaling complex (DISC). EMBO J 16, 2794-2804 (1997). 39. F.C. Kischkel et al., Cytotoxicity-dependent APO-1(Fas / CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J 14, 5579-5588 (1995). 40. C.H. June, B.R. Blazar, J.L. Riley, Engineering lymphocyte subsets: tools, trials and tribulations. Nat Rev Immunol 9, 704-716 (2009). 41. R. Watanabe-Fukunaga, C.I. Brannan, N.G. Copeland, N.A. Jenkins, S. Nagata, Lymphoproliferation disorder in mice explained by defects in Fas antigen that mediates apoptosis. Nature 356, 314-317 (1992). 42. M. Eberstadt, B. Huang, E. T. Olejniczak, S. W. Fesik, The lymphoproliferation mutation in Fas locally unfolds the Fas death domain. Nat Struct Biol 4, 983-985 (1997). 43. M. Ramaswamy et al., Specific elimination of effector memory CD4+ T cells due to enhanced Fas signaling complex formation and association with lipid raft microdomains. Cell Death Differ 18, 712-720 (2011). 44. J. R. Veatch et al., Tumor infiltrating BRAFV600E-specific CD4 T cells correlated with complete clinical response in melanoma. J Clin Invest, (2018). 45. S. S. Chandran et al., Treatment of metastatic uveal melanoma with adoptive transfer of tumour-infiltrating lymphocytes: a single-centre, two-stage, single-arm, phase 2 study. Lancet Oncol 18, 792-802 (2017). 46. A. G. Chapuis et al., T-Cell Therapy Using Interleukin-21-Primed Cytotoxic T-Cell Lymphocytes Combined With Cytotoxic T-Cell Lymphocyte Antigen-4 Blockade Results in Long-Term Cell Persistence and Durable Tumor Regression. J Clin Oncol 34, 37873795 (2016). 47. P.L. Cohen, R.A. Eisenberg, Lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease. Annu Rev Immunol 9, 243 - 269 (1991). 48. V.K. Rao, J.B. Oliveira, How I treat autoimmune lymphoproliferative syndrome. Blood 118, 5741 - 5751 (2011). 49. H.C. Morse, 3rd et al., Abnormalities induced by the mutant gene Ipr: expansion of a unique lymphocyte subset. J Immunol 129, 2612 - 2615 (1982). 50. S. Izui et al., Induction of various autoantibodies by mutant gene lpr in several strains of mice. J Immunol 133, 227 - 233 (1984). 51. C.A. Klebanoff et al., Memory T cell - driven differentiation of naive cells impairs adoptive immunotherapy. J Clin Invest 126, 318 - 334 (2016). 52. A.C. Cruz et al., Fas / CD95 prevents autoimmunity independently of lipid raft localization and efficient apoptosis induction. Nat Commun 7, 13895 (2016). 53. C.A. Klebanoff et al., Central memory self / tumor-reactive CD8+ T cells confer superior antitumor immunity compared with effector memory T cells. Proc Natl Acad Sci U S A 102, 9571-9576 (2005). 54. D. Sommermeyer et al., Chimeric antigen receptor-modified T cells derived from defined CD8+ and CD4+ subsets confer superior antitumor reactivity in vivo. Leukemia 30, 492-500 (2016). 55. J.N. Kochenderfer et al., Lymphoma Remissions Caused by Anti-CD19 Chimeric Antigen Receptor T Cells Are Associated With High Serum Interleukin-15 Levels. J Clin Oncol 35, 1803-1813 (2017). 56. D.A. Martin et al., Defective CD95 / APO-1 / Fas signal complex formation in the human autoimmune lymphoproliferative syndrome, type Ia. Proc Natl Acad Sci U S A 96, 4552-4557 (1999). 57. C.E. Jackson et al., Autoimmune lymphoproliferative syndrome with defective Fas: genotype influences penetrance. Am J Hum Genet 64, 1002-1014 (1999). 58. B.L. Horton, J.B. Williams, A. Cabanov, S. Spranger, T.F. Gajewski, Intratumoral CD8(+) T-cell Apoptosis Is a Major Component of T-cell Dysfunction and Impedes Antitumor Immunity. Cancer Immunol Res 6, 14 - 24 (2018). 59. M.A. Lakins, E. Ghorani, H. Munir, C.P. Martins, J.D. Shields, Cancer-associated fibroblasts induce antigen-specific deletion of CD8(+) T Cells to protect tumour cells. Nat Commun 9, 948 (2018). 60. S. Kleber et al., Yes and PI3K bind CD95 to signal invasion of glioblastoma. Cancer Cell 13, 235 - 248 (2008). 61. M.E. Peter et al., The role of CD95 and CD95 ligand in cancer. Cell Death Differ 22, 549 - 559 (2015). 62. G.T. Motz et al., Tumor endothelium FasL establishes a selective immune barrier promoting tolerance in tumors. Nat Med 20, 607 - 615 (2014). 63. C.M. Bollard et al., Tumor-Specific T-Cells Engineered to Overcome Tumor Immune Evasion Induce Clinical Responses in Patients With Relapsed Hodgkin Lymphoma. J Clin Oncol, JCO2017743179 (2018). 64. L. Cherkassky et al., Human CAR T cells with cell-intrinsic PD-1 checkpoint blockade resist tumor-mediated inhibition. J Clin Invest 126, 3130-3144 (2016). 65. G. Dotti et al., Human cytotoxic T lymphocytes with reduced sensitivity to Fas-induced apoptosis. Blood 105, 4677-4684 (2005). 66. X. Wang et al., A transgene-encoded cell surface polypeptide for selection, in vivo tracking, and ablation of engineered cells. Blood 118, 1255-1263 (2011). 67. W.W. Overwijk et al., Tumor regression and autoimmunity after reversal of a functionally tolerant state of self-reactive CD8+ T cells. J Exp Med 198, 569-580 (2003). 68. S.P. Kerkar et al., Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. J Immunother 34, 343-352 (2011). 69. P.F. Robbins et al., Tumor regression in patients with metastatic synovial cell sarcoma and melanoma using genetically engineered lymphocytes reactive with NY-ESO-1. J Clin Oncol 29, 917-924 (2011). 70. R. Eil et al., Ionic immune suppression within the tumour microenvironment limits T cell effector function. Nature 537, 539 - 543 (2016). 71. J. N. Kochendelfer et al., Adoptive transfer of syngeneic T cells transduced with a chimeric antigen receptor that recognizes murine CD19 can eradicate lymphoma and normal B cells. Blood. 2010;116(19):3875 - 3886. 72. Y. Yang et al., TCR engagement negatively affect CD8 but not CD4 CAR T cell expansion and leukemic clearance. Sci Transl Med. 2017;9(417):eaag1209. 73. H. Z. Imtiyaz et al., Structural requirements for signal-induced target binding of FADD determined by functional reconstitution of FADD deficiency. J Biol Chem. 2005;280(36):31360 - 31367. 74. J. D. Mountz et al., Defective clonal deletion and anergy induction in TCR transgenic lpr / lpr mice. Semin Immunol. 1994;6(1):27 - 37. 75. G. G. Singer et al., Apoptosis, Fas and systemic autoimmunity: the MRL-lpr / lpr model. Curr Opin Immunol. 1994;6(6):913 - 920. 76. CYSlaney et al., Dual-specific chimeric antigen receptor T cells and an indirect vaccine eradicate a variety of large solid tumors in an immune-competent, self-antigen setting. Clin Cancer Res. 2017;23(10):2478-2490. 77. Z. Hao et al., T cell-specific ablation of Fas leads to Fas ligand-mediated lymphocyte depletion and inflammatory pulmonary fibrosis. J Exp Med. 2004;199(10):1355-1365. 78. E. Jacoby et al., Murine allogeneic CD19 CAR T cells harbor potent antileukemic activity but have the potential to mediate lethal GVHD.Blood.2016;127(10):1361-1370. 79. Z. Zheng et al., Protein L:a novel reagent for the detection of chimeric antigen receptor (CAR) expression by flow cytometry.J Transl Med.2012;10-29. 80. G. Li et al., 4-1BB enhancement of CAR T function requires NF-κB and TRAFs.JCI Insight.2018;3(18):121322.

[0292] [Embodiments of the presently disclosed subject matter] From the foregoing description, it will be apparent that variations and modifications may be made to the subject matter of the present disclosure to adapt it to various usages and conditions. Such embodiments also fall within the scope of the following claims.

[0293] The recitation of a list of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of the listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiment or portion thereof.

[0294] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each individual patent or publication was specifically and individually indicated to be incorporated by reference. SEQUENCE LISTING <110> MEMORIAL SLOAN-KETTERING CANCER CENTER <120> NOVEL DOMINANT NEGATIVE FAS POLYPEPTIDES, CELLS COMPRISING THEREOF AND USES THEREOF <130> 072734.1188 <140> <141> <150> 62 / 957,608 <151> 2020-01-06 <160> 74 <170> PatentIn version 3.5 <210> 1 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 1 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 2 <211> 20 <212> PRT <213> Homo sapiens <400> 2 Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu 1 5 10 15 Val Thr Asn Ser 20 <210> 3 <211> 20 <212> PRT <213> Mus musculus <400> 3 Met Tyr Ser Met Gln Leu Ala Ser Cys Val Thr Leu Thr Leu Val Leu 1 5 10 15 Leu Val Asn Ser 20 <210> 4 <211> 20 <212> PRT <213> Homo sapiens <400> 4 Met Glu Thr Pro Ala Gln Leu Leu Phe Leu Leu Leu Leu Trp Leu Pro 1 5 10 15 Asp Thr Thr Gly 20 <210> 5 <211> 20 <212> PRT <213> Mus musculus <400> 5 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly 20 <210> 6 <211> 21 <212> PRT <213> Homo sapiens <400> 6 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 7 <211> 18 <212> PRT <213> Homo sapiens <400> 7 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala <210> 8 <211> 16 <212> PRT <213> Homo sapiens <400> 8 Met Lys Trp Val Thr Phe Ile Ser Leu Leu Phe Ser Ser Ala Tyr Ser 1 5 10 15 <210> 9 <211> 30 <212> PRT <213> Homo sapiens <400> 9 Met Asp Ser Lys Gly Ser Ser Gln Lys Gly Ser Arg Leu Leu Leu Leu 1 5 10 15 Leu Val Val Ser Asn Leu Leu Leu Cys Gln Gly Val Val Ser 20 25 30 <210> 10 <211> 335 <212> PRT <213> Homo sapiens <400> 10 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser 20 25 30 Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn 35 40 45 Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro 50 55 60 Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro 65 70 75 80 Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His 85 90 95 Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly 100 105 110 Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg 115 120 125 Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp 130 135 140 Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr 145 150 155 160 Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp 165 170 175 Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg 180 185 190 Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly 195 200 205 Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu 210 215 220 Ser Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met 225 230 235 240 Thr Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu 245 250 255 Only Lys With Asp Glu Only With Lys Asn Asp Asn Val Gln Asp Thr Only Glu 260 265 270 Gln Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys 275 280 285 Glu With Tyr Asp Thr With Lys Asp With Lys With Asn With Cys 290,295,300 Thr Only Glu Lys and Gln Thr and Leu Lys Asp Thr Ser 305 310 315 320 Asp Ser Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 325 330 335 <210> 11 <211> 1005 <212> DNA <213> Homo sapiens <400> 11 atgctgggca tctggaccct cctaccctg gttcttacgt ctgttgctag attatcgtcc 60 aaagtgtta atgcccaagt gactgacatc aactcaagg gattggaatt gaggagact 120 gttactacag ttgagactca gaacttggaa ggcctgcatc atgatggcca attctgccat 180 aagccctgtc ctccaggtga aaggaaagct agggactgca cagtcaatgg ggatgaacca 240 gactgcgtgc cctgccaaga agggaaggag tacacagaca aagcccattt ttcttccaaa 300 360 cggacccaga ataccaagtg cagatgtaaa ccaaactttt tttgtaactc tactgtatgt 420 480 agcaacacca agtgcaaaga ggaggatcc agatctaact tggggtggct ttgtcttctt 540 cttttgccaa ttccactaat tgtttgggtg aagagaaagg aagtacaga aacatgcaga 600 aagcacagaa aggaaaacca aggttctcat gaatctccaa ccttaaatcc tgaaacagtg 660 720 acactaagtc aagttaaagg ctttgttcga aagaatggtg tcaatgaagc caaatagat 780 gagatcaat atgacaatgt ccagacaca gcagacaca aagttcaact gcttcgtaat 840 tggcatcaac ttcatggaaa gaagaagcg tatgacacat tgattaaga tctcaaaaaa 900 gccaatcttt gtactcttgc agagaaaatt cagactatca tcctcagga cattactagt 960 gactcagaaa attcaactt cagaaatgaa atccaagct tggtc 1005 <210> 12 <211> 250 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 12 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser 20 25 30 Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn 35 40 45 Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro 50 55 60 Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro 65 70 75 80 Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His 85 90 95 Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly 100 105 110 Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg 115 120 125 Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp 130 135 140 Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr 145 150 155 160 Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp 165 170 175 Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg 180 185 190 Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly 195 200 205 Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu 210 215 220 Ser Asp Val Asp Leu Leu Lys Asp Ile Thr Ser Asp Ser Glu Asn Ser 225 230 235 240 Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 245 250 <210> 13 <211> 750 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 13 atgctgggca tctggaccct cctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aactccaagg gattggaatt gaggaagact 120 gttactacag ttgagactca gaacttggaa ggcctgcatc atgatggcca attctgccat 180 aagccctgtc ctccaggtga aaggaaagct agggactgca cagtcaatgg ggatgaacca 240 gactgcgtgc cctgccaaga agggaaggag tacacagaca aagcccattt ttcttccaaa 300 360 cggacccaga ataccaagtg cagatgtaaa ccaaactttt tttgtaactc tactgtatgt 420 480 agcaacacca agtgcaaaga ggaaggttcc agatctaact tggggtggct ttgtcttctt 540 cttttgccaa ttccactaat tgtttgggtg aagagaaagg aagtacaga aacatgcaga 600 aagcacagaa aggaaacca aggttcat gatctccaa ccttaatcc tgaacagtg 660 gcataaatt tatctgatgt tgacttgctc aaggacatta ctagtgactc agaaaattca 720 aacttcagaa atgaatcca aagcttggtc 750 <210> 14 <211> 335 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 14 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser 20 25 30 Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn 35 40 45 Leu Glu Gly Leu His Asp Gly Gln Phe Cys His Lys Pro Cys Pro 50 55 60 Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro 65 70 75 80 Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His 85 90 95 Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly 100 105 110 Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg 115 120 125 Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp 130 135 140 Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr 145 150 155 160 Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp 165 170 175 Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg 180 185 190 Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly 195 200 205 Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu 210 215 220 Ser Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met 225 230 235 240 Thr Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu 245 250 255 Ala Lys Ile Val Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu 260 265 270 Gln Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys 275 280 285 Glu Ala Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys 290 295 300 Thr Leu Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser 305 310 315 320 Asp Ser Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 325 330 335 <210> 15 <211> 1005 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 15 atgctgggca tctggaccct ctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aactccaagg gattggaatt gaggaagact 120 gttactacag ttgagactca gaacttggaa ggcctgcatc atgatggcca attctgccat 180 aagccctgtc ctccaggtga aaggaaagct agggactgca cagtcaatgg ggatgaacca 240 gactgcgtgc cctgccaaga agggaaggag tacacagaca aagcccattt ttcttccaaa 300 tgcagaagat gtagattgtg tgatgaagga catggcttag aagtggaaat aaactgcacc 360 cggacccaga ataccaagtg cagatgtaaa ccaaactttt tttgtaactc tactgtatgt 420 gaacactgtg acccttgcac caaatgtgaa catggaatca tcaaggaatg cacactcacc 480 agcaacacca agtgcaaaga ggaaggatcc agatctaact tggggtggct ttgtcttctt 540 cttttgccaa ttccactaat tgtttgggtg aagagaaagg aagtacagaa aacatgcaga 600 aagcacagaa aggaaaacca aggttctcat gaatctccaa ccttaaatcc tgaaacagtg 660 720 acactaagtc aagttaaagg ctttgttcga aagaatggtg tcaatgaagc caaaatagtt 780 gagatcaaga atgacaatgt ccaagacaca gcagaacaga aagttcaact gcttcgtaat 840 tggcatcaac ttcatggaaa gaaagaagcg tatgacacat tgattaaaga tctcaaaaaa 900 gccaatcttt gtactcttgc agagaaaatt cagactatca tcctcaagga cattactagt 960 gactcagaaa attcaaactt cagaaatgaa atccaaagct tggtc 1005 <210> 16 <211> 249 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 16 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Lys 20 25 30 Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu 35 40 45 Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro 50 55 60 Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp 65 70 75 80 Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe 85 90 95 Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu 100 105 110 Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys 115 120 125 Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro 130 135 140 Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser 145 150 155 160 Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu 165 170 175 Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys 180 185 190 Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser 195 200 205 His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser 210 215 220 Asp Val Asp Leu Leu Lys Asp Ile Thr Ser Asp Ser Glu Asn Ser Asn 225 230 235 240 Phe Arg Asn Glu Ile Gln Ser Leu Val 245 <210> 17 <211> 747 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 17 atgctgggca tctggaccct ctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aacaagggat tggaattgag gaagactgtt 120 actacagttg agactcagaa cttggaaggc ctgcatcatg atggccaatt ctgccataag 180 ccctgtcctc caggtgaaag gaaagctagg gactgcacag tcaatgggga tgaaccagac 240 tgcgtgccct gccaagaagg gaaggagtac acagacaag cccattttc ttccaatgc 300 agagatgta gattgtgtga tgaggacat ggcttagaag tggaataaa ctgcacccgg 360 acccagaata ccaagtgcag atgtaaacca aactttttt gtaactctac tgtatgtgaa 420 cactgtgacc cttgcaccaa atgtgaacat ggaatcatca aggaatgcac actcaccacc 480 aacaccaagt gcaagagga aggttccaga tctacttg ggtggctttg tcttctctt 540 ttgccaattc cactattgt ttgggtgaag agaaaggaag tacagaaac atgcagaaag 600 cacagaaagg aaaaccaagg ttctcatgaa tctcaacct taatcctga aacagtggca 660 aaatttat ctgatgttga ctgctcaag gatacta gtgactcaga aattcaaac 720 ttcagaatg aaatccaaag cttggtc 747 <210> 18 <211> 248 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 18 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Lys Gly 20 25 30 Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu Glu 35 40 45 Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro Gly 50 55 60 Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp Cys 65 70 75 80 Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe Ser 85 90 95 Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu Glu 100 105 110 Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys Lys 115 120 125 Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro Cys 130 135 140 Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser Asn 145 150 155 160 Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu Cys 165 170 175 Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys Glu 180 185 190 Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser His 195 200 205 Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser Asp 210 215 220 Val Asp Leu Leu Lys Asp Ile Thr Ser Asp Ser Glu Asn Ser Asn Phe 225 230 235 240 Arg Asn Glu Ile Gln Ser Leu Val 245 <210> 19 <211> 744 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 19 atgctgggca tctggaccct ctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aagggattgg aattgaggaa gactgttact 120 acagttgaga ctcagaactt ggaaggcctg catcatgatg gccaattctg cataagccc 180 tgtcctccag gtgaaaggaa agctagggac tgcacagtca atggggatga accagactgc 240 gtgccctgcc aagaagggaa ggagtacaca gacaaagccc atttttcttc caaatgcaga 300 agatgtagat tgtgtgatga aggacatggc ttagaagtgg aaataaactg cacccggacc 360 cagaatacca agtgcagatg taaaccaaac tttttttgta actctactgt atgtgaacac 420 tgtgaccctt gcaccaaatg tgaacatgga atcatcaagg aatgcacact caccagcaac 480 accaagtgca aagaggaagg ttccagatct aacttggggt ggctttgtct tcttctttg 540 ccaattccac taattgtttg ggtgaagaga aaggaagtac agaaaacatg cagaaagcac 600 agaaaggaaa accaaggttc tcatgaatct ccaaccttaa atcctgaaac agtggcaata 660 aatttatctg atgttgactt gctcaaggac attactagtg actcagaaaa ttcaaacttc 720 agaaatgaaa tccaaagctt ggtc 744 <210> 20 <211> 248 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 20 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Gly 20 25 30 Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu Glu 35 40 45 Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro Gly 50 55 60 Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp Cys 65 70 75 80 Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe Ser 85 90 95 Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu Glu 100 105 110 Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys Lys 115 120 125 Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro Cys 130 135 140 Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser Asn 145 150 155 160 Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu Cys 165 170 175 Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys Glu 180 185 190 Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser His 195 200 205 Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser Asp 210 215 220 Val Asp Leu Leu Lys Asp Ile Thr Ser Asp Ser Glu Asn Ser Asn Phe 225 230 235 240 Arg Asn Glu Ile Gln Ser Leu Val 245 <210> 21 <211> 744 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 21 atgctgggca tctggaccct cctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aacggattgg aattgaggaa gactgttact 120 acagttgaga ctcagaactt ggaaggcctg catcatgatg gccaattctg ccataagccc 180 tgtcctccag gtgaaaggaa agctagggac tgcacagtca atggggatga accagactgc 240 gtgccctgcc aagaagggaa ggagtacaca gacaaagccc atttttcttc caaatgcaga 300 agatgtagat tgtgtgatga aggacatggc ttagaagtgg aaataaactg cacccggacc 360 cagaatacca agtgcagatg taaaccaaac tttttttgta actctactgt atgtgaacac 420 tgtgaccctt gcaccaaatg tgaacatgga atcatcaagg aatgcacact caccagcaac 480 accaagtgca aagaggaagg ttccagatct aacttggggt ggctttgtct tcttcttttg 540 ccaattccac taattgttg ggtgaagaga aaggaagtac agaaaacatg cagaaagcac 600 agaaaggaaa accaaggttc tcatgaatct ccaccttaa atcctgaaac agtggcaata 660 aatttatctg atgttgactt gctcaggac attackagtg actcagaaa ttcaacttc 720 agaaatgaaa tccaagctt ggtc 744 <210> 22 <211> 248 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 22 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser 20 25 30 Leu Glu Leu Arg Lys Thr Val Thr Val Glu Thr Gln Asn Leu Glu 35 40 45 Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro Gly 50 55 60 Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp Cys 65 70 75 80 Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe Ser 85 90 95 Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu Glu 100 105 110 Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys Lys 115 120 125 Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro Cys 130 135 140 Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser Asn 145 150 155 160 Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu Cys 165 170 175 Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys Glu 180 185 190 Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser His 195 200 205 Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser Asp 210 215 220 Val Asp Leu Leu Lys Asp Ile Thr Ser Asp Ser Glu Asn Ser Asn Phe 225 230 235 240 Arg Asn Glu Ile Gln Ser Leu Val 245 <210> 23 <211> 744 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 23 atgctgggca tctggaccct cctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aactcattgg aattgaggaa gactgttact 120 acagttgaga ctcagaactt ggaaggcctg catcatgatg gccaattctg ccataagccc 180 240 300 agatgtagat tgtgtgatga aggacatggc ttagaagtgg aaataactg cacccggacc 360 cagaatacca agtgcagatg taaaccaaac tttttttgta actctactgt atgtgaacac 420 tgtgaccctt gcaccaaatg tgacatgga atcatcaagg aatgcacact caccagcaac 480 accaagtgca aaggaagg ttccagatct aacttggggt ggctttgtct tcttcttttg 540 ccaattccac taattgtttg ggtgaagaga aaagaagtac agaaaacatg cagaaagcac 600 agaaaggaaa accaaggttc tcatgaatct ccaaccttaa atcctgaaac agtggcaata 660 aatttatctg atgttgactt gctcaaggac attactagtg actcagaaaa ttcaaacttc 720 agaaatgaaa tccaaagctt ggtc 744 <210> 24 <211> 250 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 24 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ala 20 25 30 Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn 35 40 45 Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro 50 55 60 Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro 65 70 75 80 Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His 85 90 95 Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly 100 105 110 Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg 115 120 125 Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp 130 135 140 Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr 145 150 155 160 Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp 165 170 175 Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg 180 185 190 Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly 195 200 205 Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu 210 215 220 Ser Asp Val Asp Leu Leu Lys Asp Ile Thr Ser Asp Ser Glu Asn Ser 225 230 235 240 Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 245 250 <210> 25 <211> 750 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 25 atgctgggca tctggaccct cctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aacgccaagg gattggaatt gaggaagact 120 gttactacag ttgagactca gaacttggaa ggcctgcatc atgatggcca attctgccat 180 aagccctgtc ctccaggtga aaggaaagct agggactgca cagtcaatgg ggatgaacca 240 gactgcgtgc cctgccaaga agggaaggag tacacagaca aagcccattt ttcttccaaa 300 360 cggacccaga ataccaagtg cagatgtaaa ccaaactttt tttgtaactc tactgtatgt 420 480 agcaacacca agtgcaaaga ggaaggttcc agatctaact tggggtggct ttgtcttctt 540 cttttgccaa ttccactaat tgtttgggtg aagagaaagg aagtacaga aacatgcaga 600 aagcacagaa aggaaaacca aggttctcat gaatctccaa ccttaaatcc tgaaacagtg 660 gcaataatt tatctgatgt tgacttgctc areacatta ctagtgactc agaaaattca 720 aacttcagaa atgaaatcca aagcttggtc 750 <210> 26 <211> 272 <212> PRT <213> Homo sapiens <400> 26 Pro Glu Glu Pro Leu Val Val Lys Val Glu Glu Gly Asp Asn Ala Val 1 5 10 15 Leu Gln Cys Leu Lys Gly Thr Ser Asp Gly Pro Thr Gln Gln Leu Thr 20 25 30 Trp Ser Arg Glu Ser Pro Leu Lys Pro Phe Leu Lys Leu Ser Leu Gly 35 40 45 Leu Pro Gly Leu Gly Ile His Met Arg Pro Leu Ala Ile Trp Leu Phe 50 55 60 Ile Phe Asn Val Ser Gln Gln Met Gly Gly Phe Tyr Leu Cys Gln Pro 65 70 75 80 Gly Pro Pro Ser Glu Lys Ala Trp Gln Pro Gly Trp Thr Val Asn Val 85 90 95 Glu Gly Ser Gly Glu Leu Phe Arg Trp Asn Val Ser Asp Leu Gly Gly 100 105 110 Leu Gly Cys Gly Leu Lys Asn Arg Ser Ser Glu Gly Pro Ser Ser Pro 115 120 125 Ser Gly Lys Leu Met Ser Pro Lys Leu Tyr Val Trp Ala Lys Asp Arg 130 135 140 Pro Glu Ile Trp Glu Gly Glu Pro Pro Cys Leu Pro Pro Arg Asp Ser 145 150 155 160 Leu Asn Gln Ser Leu Ser Gln Asp Leu Thr Met Ala Pro Gly Ser Thr 165 170 175 Leu Trp Leu Ser Cys Gly Val Pro Pro Asp Ser Val Ser Arg Gly Pro 180 185 190 Leu Ser Trp Thr His Val His Pro Lys Gly Pro Lys Ser Leu Leu Ser 195 200 205 Leu Glu Leu Lys Asp Asp Arg Pro Ala Arg Asp Met Trp Val Met Glu 210 215 220 Thr Gly Leu Leu Leu Pro Arg Ala Thr Ala Gln Asp Ala Gly Lys Tyr 225 230 235 240 Tyr Cys His Arg Gly Asn Leu Thr Met Ser Phe His Leu Glu Ile Thr 245 250 255 Ala Arg Pro Val Leu Trp His Trp Leu Leu Arg Thr Gly Gly Trp Lys 260 265 270 <210> 27 <211> 235 <212> PRT <213> Homo sapiens <400> 27 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Ser Gln Phe Arg Val Ser Pro Leu Asp Arg Thr 20 25 30 Trp Asn Leu Gly Glu Thr Val Glu Leu Lys Cys Gln Val Leu Leu Ser 35 40 45 Asn Pro Thr Ser Gly Cys Ser Trp Leu Phe Gln Pro Arg Gly Ala Ala 50 55 60 Ala Ser Pro Thr Phe Leu Leu Tyr Leu Ser Gln Asn Lys Pro Lys Ala 65 70 75 80 Ala Glu Gly Leu Asp Thr Gln Arg Phe Ser Gly Lys Arg Leu Gly Asp 85 90 95 Thr Phe Val Leu Thr Leu Ser Asp Phe Arg Arg Glu Asn Glu Gly Tyr 100 105 110 Tyr Phe Cys Ser Ala Leu Ser Asn Ser Ile Met Tyr Phe Ser His Phe 115 120 125 Val Pro Val Phe Leu Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg 130 135 140 Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg 145 150 155 160 Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly 165 170 175 Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr 180 185 190 Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Asn His 195 200 205 Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val Val Lys Ser 210 215 220 Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val 225 230 235 <210> 28 <211> 247 <212> PRT <213> Mus musculus <400> 28 Met Ala Ser Pro Leu Thr Arg Phe Leu Ser Leu Asn Leu Leu Leu Met 1 5 10 15 Gly Glu Ser Ile Ile Leu Gly Ser Gly Glu Ala Lys Pro Gln Ala Pro 20 25 30 Glu Leu Arg Ile Phe Pro Lys Lys Met Asp Ala Glu Leu Gly Gln Lys 35 40 45 Val Asp Leu Val Cys Glu Val Leu Gly Ser Val Ser Gln Gly Cys Ser 50 55 60 Trp Leu Phe Gln Asn Ser Ser Ser Lys Leu Pro Gln Pro Thr Phe Val 65 70 75 80 Val Tyr Met Ala Ser Ser His Asn Lys Ile Thr Trp Asp Glu Lys Leu 85 90 95 Asn Ser Ser Lys Leu Phe Ser Ala Val Arg Asp Thr Asn Asn Lys Tyr 100 105 110 Val Leu Thr Leu Asn Lys Phe Ser Lys Glu Asn Glu Gly Tyr Tyr Phe 115 120 125 Cys Ser Val Ile Ser Asn Ser Val Met Tyr Phe Ser Ser Val Val Pro 130 135 140 Val Leu Gln Lys Val Asn Ser Thr Thr Thr Lys Pro Val Leu Arg Thr 145 150 155 160 Pro Ser Pro Val His Pro Thr Gly Thr Ser Gln Pro Gln Arg Pro Glu 165 170 175 Asp Cys Arg Pro Arg Gly Ser Val Lys Gly Thr Gly Leu Asp Phe Ala 180 185 190 Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Ile Cys Val Ala Pro 195 200 205 Leu Leu Ser Leu Ile Ile Thr Leu Ile Cys Tyr His Arg Ser Arg Lys 210 215 220 Arg Val Cys Lys Cys Pro Arg Pro Leu Val Arg Gln Glu Gly Lys Pro 225 230 235 240 Arg Pro Ser Glu Lys Ile Val 245 <210> 29 <211> 220 <212> PRT <213> Homo sapiens <400> 29 Met Leu Arg Leu Leu Leu Ala Leu Asn Leu Phe Pro Ser Ile Gln Val 1 5 10 15 Thr Gly Asn Lys Ile Leu Val Lys Gln Ser Pro Met Leu Val Ala Tyr 20 25 30 Asp Asn Ala Val Asn Leu Ser Cys Lys Tyr Ser Tyr Asn Leu Phe Ser 35 40 45 Arg Glu Phe Arg Ala Ser Leu His Lys Gly Leu Asp Ser Ala Val Glu 50 55 60 Val Cys Val Val Tyr Gly Asn Tyr Ser Gln Gln Leu Gln Val Tyr Ser 65 70 75 80 Lys Thr Gly Phe Asn Cys Asp Gly Lys Leu Gly Asn Glu Ser Val Thr 85 90 95 Phe Tyr Leu Gln Asn Leu Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys 100 105 110 Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser 115 120 125 Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro 130 135 140 Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly 145 150 155 160 Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile 165 170 175 Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met 180 185 190 Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro 195 200 205 Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser 210 215 220 <210> 30 <211> 81 <212> DNA <213> Homo sapiens <400> 30 ttttgggtgc tggtggtggt tggtggagtc ctggcttgct atagcttgct agtaacagtg 60 gccttatta ttttctgggt g 81 <210> 31 <211> 218 <212> PRT <213> Mus musculus <400> 31 Met Thr Leu Arg Leu Leu Phe Leu Ala Leu Asn Phe Phe Ser Val Gln 1 5 10 15 Val Thr Glu Asn Lys Ile Leu Val Lys Gln Ser Pro Leu Leu Val Val 20 25 30 Asp Ser Asn Glu Val Ser Leu Ser Cys Arg Tyr Ser Tyr Asn Leu Leu 35 40 45 Ala Lys Glu Phe Arg Ala Ser Leu Tyr Lys Gly Val Asn Ser Asp Val 50 55 60 Glu Val Cys Val Gly Asn Gly Asn Phe Thr Tyr Gln Pro Gln Phe Arg 65 70 75 80 Ser Asn Ala Glu Phe Asn Cys Asp Gly Asp Phe Asp Asn Glu Thr Val 85 90 95 Thr Phe Arg Leu Trp Asn Leu His Val Asn His Thr Asp Ile Tyr Phe 100 105 110 Cys Lys Ile Glu Phe Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Arg 115 120 125 Ser Asn Gly Thr Ile Ile His Ile Lys Glu Lys His Leu Cys His Thr 130 135 140 Gln Ser Ser Pro Lys Leu Phe Trp Ala Leu Val Val Val Ala Gly Val 145 150 155 160 Leu Phe Cys Tyr Gly Leu Leu Val Thr Val Ala Leu Cys Val Ile Trp 165 170 175 Thr Asn Ser Arg Arg Asn Arg Leu Leu Gln Ser Asp Tyr Met Asn Met 180 185 190 Thr Pro Arg Arg Pro Gly Leu Thr Arg Lys Pro Tyr Gln Pro Tyr Ala 195 200 205 Pro Ala Arg Asp Phe Ala Ala Tyr Arg Pro 210 215 <210> 32 <211> 164 <212> PRT <213> Homo sapiens <400> 32 Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu 1 5 10 15 Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys 20 25 30 Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala 35 40 45 Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr 50 55 60 Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg 65 70 75 80 Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met 85 90 95 Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn 100 105 110 Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met 115 120 125 Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly 130 135 140 Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala 145 150 155 160 Leu Pro Pro Arg <210> 33 <211> 188 <212> PRT <213> Mus musculus <400> 33 Met Lys Trp Lys Val Ser Val Leu Ala Cys Ile Leu His Val Arg Phe 1 5 10 15 Pro Gly Ala Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys 20 25 30 Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Ile Thr Ala 35 40 45 Leu Tyr Leu Arg Ala Lys Phe Ser Arg Ser Ala Glu Thr Ala Ala Asn 50 55 60 Leu Gln Asp Pro Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg 65 70 75 80 Glu Glu Tyr Asp Val Leu Glu Lys Lys Arg Ala Arg Asp Pro Glu Met 85 90 95 Gly Gly Lys Gln Arg Arg Arg Asn Pro Gln Glu Gly Val Tyr Asn Ala 100 105 110 Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Thr Lys 115 120 125 Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Asp Ser 130 135 140 His Phe Gln Ala Val Gln Phe Gly Asn Arg Arg Glu Arg Glu Gly Ser 145 150 155 160 Glu Leu Thr Arg Thr Leu Gly Leu Arg Ala Arg Pro Lys Ala Cys Arg 165 170 175 His Lys Lys Pro Leu Ser Leu Pro Ala Ala Val Ser 180 185 <210> 34 <211> 112 <212> PRT <213> Homo sapiens <400> 34 Arg Val Lys Phe Ser Arg Ser Ala Glu Pro Pro Ala Tyr Gln Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys 50 55 60 Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105 110 <210> 35 <211> 112 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 35 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Phe Asn Glu Leu Gln Lys 50 55 60 Asp Lys Met Ala Glu Ala Phe Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Phe Gln Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Phe Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105 110 <210> 36 <211> 336 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 36 agagtgaagt tcagcaggag cgcagacgcc cccgcgtacc agcagggcca gaaccagctc 60 tataacgagc tcaatctagg acgaagagag gagtacgatg ttttggacaa gagacgtggc 120 cgggaccctg agatgggggg aaagccgaga aggaagaacc ctcaggaagg cctgttcaat 180 gaactgcaga aagataagat ggcggaggcc ttcagtgaga ttgggatgaa aggcgagcgc 240 cggaggggca aggggcacga tggccttttc caggggctca gtacagccac caaggacacc 300 ttcgacgccc ttcacatgca ggccctgccc cctcgc 336 <210> 37 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 37 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 1 5 10 15 Asp Val Leu Asp Lys Arg 20 <210> 38 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 38 cagaaccagc tctataacga gctcaatcta ggacgaagag aggagtacga tgttttggac 60 aagaga 66 <210> 39 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 39 Gln Asn Gln Leu Phe Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Phe 1 5 10 15 Asp Val Leu Asp Lys Arg 20 <210> 40 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 40 cagaaccagc tctttaacga gctcaatcta ggacgaagag aggagttcga tgttttggac 60 aagaga 66 <210> 41 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 41 Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 1 5 10 15 Tyr Ser Glu Ile Gly Met Lys 20 <210> 42 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 42 caggaaggcc tgtacaatga actgcagaaa gataagatgg cggaggccta cagtgagatt 60 gggatgaaa 69 <210> 43 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 43 Gln Glu Gly Leu Phe Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 1 5 10 15 Phe Ser Glu Ile Gly Met Lys 20 <210> 44 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 44 caggaaggcc tgttcaatga actgcagaaa gataagatgg cggaggcctt cagtgagatt 60 gggatgaaa 69 <210> 45 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 45 His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr 1 5 10 15 Asp Ala Leu His Met Gln 20 <210> 46 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 46 cacgatggcc tttaccaggg tctcagtaca gccaccaagg acacctacga cgcccttcac 60 atgcag 66 <210> 47 <211> 22 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 47 His Asp Gly Leu Phe Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Phe 1 5 10 15 Asp Ala Leu His Met Gln 20 <210> 48 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 48 cacgatggcc ttttccaggg gctcagtaca gccaccaagg acaccttcga cgcccttcac 60 atgcag 66 <210> 49 <211> 255 <212> PRT <213> Homo sapiens <400> 49 Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu 1 5 10 15 Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro 20 25 30 Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys 35 40 45 Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile 50 55 60 Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser 65 70 75 80 Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly 85 90 95 Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu 100 105 110 Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln 115 120 125 Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys 130 135 140 Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro 145 150 155 160 Ser Pro Ala Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala 165 170 175 Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu 180 185 190 Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu 195 200 205 Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe 210 215 220 Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly 225 230 235 240 Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 245 250 255 <210> 50 <211> 277 <212> PRT <213> Homo sapiens <400> 50 Met Cys Val Gly Ala Arg Arg Leu Gly Arg Gly Pro Cys Ala Ala Leu 1 5 10 15 Leu Leu Leu Gly Leu Gly Leu Ser Thr Val Thr Gly Leu His Cys Val 20 25 30 Gly Asp Thr Tyr Pro Ser Asn Asp Arg Cys Cys His Glu Cys Arg Pro 35 40 45 Gly Asn Gly Met Val Ser Arg Cys Ser Arg Ser Gln Asn Thr Val Cys 50 55 60 Arg Pro Cys Gly Pro Gly Phe Tyr Asn Asp Val Val Ser Ser Lys Pro 65 70 75 80 Cys Lys Pro Cys Thr Trp Cys Asn Leu Arg Ser Gly Ser Glu Arg Lys 85 90 95 Gln Leu Cys Thr Ala Thr Gln Asp Thr Val Cys Arg Cys Arg Ala Gly 100 105 110 Thr Gln Pro Leu Asp Ser Tyr Lys Pro Gly Val Asp Cys Ala Pro Cys 115 120 125 Pro Pro Gly His Phe Ser Pro Gly Asp Asn Gln Ala Cys Lys Pro Trp 130 135 140 Thr Asn Cys Thr Leu Ala Gly Lys His Thr Leu Gln Pro Ala Ser Asn 145 150 155 160 Ser Ser Asp Ala Ile Cys Glu Asp Arg Asp Pro Pro Ala Thr Gln Pro 165 170 175 Gln Glu Thr Gln Gly Pro Pro Ala Arg Pro Ile Thr Val Gln Pro Thr 180 185 190 Glu Ala Trp Pro Arg Thr Ser Gln Gly Pro Ser Thr Arg Pro Val Glu 195 200 205 Val Pro Gly Gly Arg Ala Val Ala Ala Ile Leu Gly Leu Gly Leu Val 210 215 220 Leu Gly Leu Leu Gly Pro Leu Ala Ile Leu Leu Ala Leu Tyr Leu Leu 225 230 235 240 Arg Arg Asp Gln Arg Leu Pro Pro Asp Ala His Lys Pro Pro Gly Gly 245 250 255 Gly Ser Phe Arg Thr Pro Ile Gln Glu Glu Gln Ala Asp Ala His Ser 260 265 270 Thr Leu Ala Lys Ile 275 <210> 51 <211> 199 <212> PRT <213> Homo sapiens <400> 51 Met Lys Ser Gly Leu Trp Tyr Phe Phe Leu Phe Cys Leu Arg Ile Lys 1 5 10 15 Val Leu Thr Gly Glu Ile Asn Gly Ser Ala Asn Tyr Glu Met Phe Ile 20 25 30 Phe His Asn Gly Gly Val Gln Ile Leu Cys Lys Tyr Pro Asp Ile Val 35 40 45 Gln Gln Phe Lys Met Gln Leu Leu Lys Gly Gly Gln Ile Leu Cys Asp 50 55 60 Leu Thr Lys Thr Lys Gly Ser Gly Asn Thr Val Ser Ile Lys Ser Leu 65 70 75 80 Lys Phe Cys His Ser Gln Leu Ser Asn Asn Ser Val Ser Phe Phe Leu 85 90 95 Tyr Asn Leu Asp His Ser His Ala Asn Tyr Tyr Phe Cys Asn Leu Ser 100 105 110 Ile Phe Asp Pro Pro Pro Phe Lys Val Thr Leu Thr Gly Gly Tyr Leu 115 120 125 His Ile Tyr Glu Ser Gln Leu Cys Cys Gln Leu Lys Phe Trp Leu Pro 130 135 140 Ile Gly Cys Ala Ala Phe Val Val Val Cys Ile Leu Gly Cys Ile Leu 145 150 155 160 Ile Cys Trp Leu Thr Lys Lys Lys Tyr Ser Ser Ser Val His Asp Pro 165 170 175 Asn Gly Glu Tyr Met Phe Met Arg Ala Val Asn Thr Ala Lys Lys Ser 180 185 190 Arg Leu Thr Asp Val Thr Leu 195 <210> 52 <211> 484 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 52 Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His 1 5 10 15 Ala Glu Val Lys Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro Gly 20 25 30 Ser Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ala Phe Ser Ser 35 40 45 Tyr Trp Met Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu Trp 50 55 60 Ile Gly Gln Ile Tyr Pro Gly Asp Gly Asp Thr Asn Tyr Asn Gly Lys 65 70 75 80 Phe Lys Gly Gln Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr Ala 85 90 95 Tyr Met Gln Leu Ser Gly Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe 100 105 110 Cys Ala Arg Lys Thr Ile Ser Ser Val Val Asp Phe Tyr Phe Asp Tyr 115 120 125 Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly Ser 130 135 140 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Glu Leu Thr Gln 145 150 155 160 Ser Pro Lys Phe Met Ser Thr Ser Val Gly Asp Arg Val Ser Val Thr 165 170 175 Cys Lys Ala Ser Gln Asn Val Gly Thr Asn Val Ala Trp Tyr Gln Gln 180 185 190 Lys Pro Gly Gln Ser Pro Lys Pro Leu Ile Tyr Ser Ala Thr Tyr Arg 195 200 205 Asn Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp 210 215 220 Phe Thr Leu Thr Ile Thr Asn Val Gln Ser Lys Asp Leu Ala Asp Tyr 225 230 235 240 Phe Cys Gln Gln Tyr Asn Arg Tyr Pro Tyr Thr Ser Gly Gly Gly Thr 245 250 255 Lys Leu Glu Ile Lys Arg Ala Ala Ala Ile Glu Val Met Tyr Pro Pro 260 265 270 Pro Tyr Leu Asp Asn Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys 275 280 285 Gly Lys His Leu Cys Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro 290 295 300 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu 305 310 315 320 Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser 325 330 335 Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly 340 345 350 Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala 355 360 365 Ala Tyr Arg Ser Arg Val Lys Phe Ser Arg Ser Ala Glu Pro Pro Ala 370 375 380 Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg 385 390 395 400 Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu 405 410 415 Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn 420 425 430 Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met 435 440 445 Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly 450 455 460 Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala 465 470 475 480 Leu Pro Pro Arg <210> 53 <211> 1452 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 53 gctctcccag tgactgccct actgcttccc ctagcgcttc tcctgcatgc agaggtgaag 60 ctgcagcagt ctggggctga gctggtgagg cctgggtcct cagtgaagat ttcctgcaag 120 gcttctggct atgcattcag tagctactgg atgaactggg tgaagcagag gcctggacag 180 ggtcttgagt ggattggaca gatttatcct ggagatggtg atactaacta caatggaaag 240 ttcaagggtc aagccacact gactgcagac aaatcctcca gcacagccta catgcagctc 300 agcggcctaa catctgagga ctctgcggtc tatttctgtg caagaaagac cattagttcg 360 gtagtagatt tctactttga ctactggggc caagggacca cggtcaccgt ctcctcaggt 420 ggaggtggat caggtggagg tggatctggt ggaggtggat ctgacattga gctcacccag 480 tctccaaaat tcatgtccac atcagtagga gacagggtca gcgtcacctg caaggccagt 540 cagaatgtgg gtactaatgt agcctggtat caacagaaac caggacaatc tcctaaacca 600 ctgatttact cggcaaccta ccggaacagt ggagtccctg atcgcttcac aggcagtgga 660 tctgggacag atttcactct caccatcact aacgtgcagt ctaaagactt ggcagactat 720 ttctgtcaac aatataacag gtatccgtac acgtccggag gggggaccaa gctggagatc 780 aaacgggcgg ccgcaattga agttatgtat cctcctcctt acctagacaa tgagaagagc 840 aatggaacca ttatccatgt gaaagggaaa cacctttgtc caagtcccct atttcccgga 900 ccttctaagc ccttttgggt gctggtggtg gttggtggag tcctggcttg ctatagcttg 960 ctagtaacag tggcctttat tattttctgg gtgaggagta agaggagcag gctcctgcac 1020 agtgactaca tgaacatgac tccccgccgc cccgggccca cccgcaagca ttaccagccc 1080 tatgccccac cacgcgactt cgcagcctat cgctccagag tgaagttcag caggagcgca 1140 gagccccccg cgtaccagca gggccagaac cagctctata acgagctcaa tctaggacga 1200 agagaggagt acgatgtttt ggacaagaga cgtggccggg accctgagat ggggggaaag 1260 ccgagaagga agaaccctca ggaaggcctg tacaatgaac tgcagaaaga taagatggcg 1320 gaggcctaca gtgagattgg gatgaaaggc gagcgccgga ggggcaaggg gcacgatggc 1380 cttaccagg gtctcagtac agccaccaag gacacctacg acgcccttca catgcaggcc 1440 ctgccccctc gc 1452 <210> 54 <211> 485 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 54 Put Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Wing Leu Leu Leu 1 5 10 15 His Ala Glu Val Lys Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Pro 20 25 30 Gly Ser Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Ala Phe Ser 35 40 45 Ser Tyr Trp Met Asn Trp Val Lys Gln Arg Pro Gly Gln Gly Leu Glu 50 55 60 Trp Ile Gly Gln Ile Tyr Pro Gly Asp Gly Asp Thr Asn Tyr Asn Gly 65 70 75 80 Lys Phe Lys Gly Gln Ala Thr Leu Thr Ala Asp Lys Ser Ser Ser Thr 85 90 95 Ala Tyr Met Gln Leu Ser Gly Leu Thr Ser Glu Asp Ser Ala Val Tyr 100 105 110 Phe Cys Ala Arg Lys Thr Ile Ser Ser Val Val Asp Phe Tyr Phe Asp 115 120 125 Tyr Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Glu Leu Thr 145 150 155 160 Gln Ser Pro Lys Phe Met Ser Thr Ser Val Gly Asp Arg Val Ser Val 165 170 175 Thr Cys Lys Ala Ser Gln Asn Val Gly Thr Asn Val Ala Trp Tyr Gln 180 185 190 Gln Lys Pro Gly Gln Ser Pro Lys Pro Leu Ile Tyr Ser Ala Thr Tyr 195 200 205 Arg Asn Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Leu Thr Ile Thr Asn Val Gln Ser Lys Asp Leu Ala Asp 225 230 235 240 Tyr Phe Cys Gln Gln Tyr Asn Arg Tyr Pro Tyr Thr Ser Gly Gly Gly 245 250 255 Thr Lys Leu Glu Ile Lys Arg Ala Ala Ala Ile Glu Val Met Tyr Pro 260 265 270 Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn Gly Thr Ile Ile His Val 275 280 285 Lys Gly Lys His Leu Cys Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys 290 295 300 Pro Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser 305 310 315 320 Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg 325 330 335 Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro 340 345 350 Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe 355 360 365 Ala Ala Tyr Arg Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro 370 375 380 Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly 385 390 395 400 Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro 405 410 415 Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Phe 420 425 430 Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Phe Ser Glu Ile Gly 435 440 445 Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Phe Gln 450 455 460 Gly Leu Ser Thr Ala Thr Lys Asp Thr Phe Asp Ala Leu His Met Gln 465 470 475 480 Ala Leu Pro Pro Arg 485 <210> 55 <211> 1458 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 55 atggctctcc cagtgactgc cctactgctt cccctagcgc ttctcctgca tgcagaggtg 60 aagctgcagc agtctggggc tgagctggtg aggcctgggt cctcagtgaa gatttcctgc 120 aaggcttctg gctatgcatt cagtagctac tggatgaact gggtgaagca gaggcctgga 180 cagggtcttg agtggattgg acagatttat cctggagatg gtgatactaa ctacaatgga 240 aagttcaagg gtcaagccac actgactgca gacaaatcct ccagcacagc ctacatgcag 300 ctcagcggcc taacatctga ggactctgcg gtctatttct gtgcaagaaa gaccattagt 360 tcggtagtag atttctactt tgactactgg ggccaaggga ccacggtcac cgtctcctca 420 ggtggaggtg gatcaggtgg aggtggatct ggtggaggtg gatctgacat tgagctcacc 480 cagtctccaa aattcatgtc cacatcagta ggagacaggg tcagcgtcac ctgcaaggcc 540 agtcagaatg tgggtactaa tgtagcctgg tatcaacaga aaccaggaca atctcctaaa 600 ccactgattt actcggcaac ctaccggaac agtggagtcc ctgatcgctt cacaggcagt 660 ggatctggga cagatttcac tctcaccatc actaacgtgc agtctaaaga cttggcagac 720 tatttctgtc aacaatataa caggtatccg tacacgtccg gaggggggac caagctggag 780 atcaaacggg cggccgcaat tgaagttatg tatcctcctc cttacctaga caatgagaag 840 agcaatggaa ccattatcca tgtgaaaggg aaacacctttt gtccaagtcc cctatttccc 900 ggaccttcta agccctttg ggtgctggtg gtggttggtg gagtcctggc ttgctatagc 960 ttgctagtaa cagtggcctt tattattttc tgggtgagga gtaagaggag caggctcctg 1020 cacagtgact acatgaacat gactccccgc cgccccgggc ccacccgcaa gcattaccag 1080 ccctatgcc caccacgcga cttcgcagcc tatcgctcca gagtgaagtt cagcaggagc 1140 gcagacgccc ccgcgtacca gcagggccag aaccagctct ataacgagct caatctagga 1200 cgaagagagg agtacgatgt tttggacaag agacgtggcc gggaccctga gatgggggga 1260 aagccgagaa ggaagaaccc tcaggaaggc ctgttcaatg aactgcagaa agataagatg 1320 gcggaggcct tcagtgagat tgggatgaaa ggcgagcgcc ggaggggcaa ggggcacgat 1380 ggccttttcc aggggctcag tacagccacc aaggacacct tcgacgccct tcacatgcag 1440 gccctgcccc ctcgctaa 1458 <210> 56 <211> 334 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 56 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Lys 20 25 30 Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu 35 40 45 Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro 50 55 60 Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp 65 70 75 80 Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe 85 90 95 Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu 100 105 110 Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys 115 120 125 Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro 130 135 140 Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser 145 150 155 160 Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu 165 170 175 Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys 180 185 190 Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser 195 200 205 His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser 210 215 220 Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met Thr 225 230 235 240 Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu Ala 245 250 255 Lys Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu Gln 260 265 270 Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys Glu 275 280 285 Ala Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys Thr 290 295 300 Leu Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser Asp 305 310 315 320 Ser Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 325 330 <210> 57 <211> 1002 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 57 atgctgggca tctggaccct ctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aacaagggat tggaattgag gaagactgtt 120 actacagttg agactcagaa cttggaaggc ctgcatcatg atggccaatt ctgccataag 180 ccctgtcctc caggtgaaag gaaagctagg gactgcacag tcaatgggga tgaaccagac 240 tgcgtgccct gccaagaagg gaaggagtac acagacaag cccattttc ttccaatgc 300 agagatgta gattgtgtga tgaggacat ggcttagaag tggaataaa ctgcacccgg 360 acccagaata ccaagtgcag atgtaaacca aactttttt gtaactctac tgtatgtgaa 420 cactgtgacc cttgcaccaa atgtgaacat ggaatcatca aggaatgcac actcaccacc 480 aacaccaagt gcaagagga aggatccaga tctacttgg ggtggctttg tcttctctt 540 ttgccaattc cactattgt ttgggtgaag agaaaggaag tacagaaac atgcagaaag 600 cacagaaagg aaaaccaagg ttctcatgaa tctcaacct taatcctga aacagtggca 660 aaatttat ctgatgttga cttgagtaaa tatatcacca ctattgctgg agtcatgaca 720 ctaagtcaag ttaaaggctt tgttcgaaag aatggtgtca atgaagccaa atagatgag 780 atcaagaatg acatgtcca agacacagca gaacagaaag ttcaactgct tcgtaattgg 840 catcaacttc atggaaagaa agaagcgtat gacacattga ttaaagatct caaaaaagcc 900 aatctttgta ctcttgcaga gaaaattcag actatcatcc tcaaggacat tactagtgac 960 tcagaaaatt caaacttcag aaatgaaatc caaagcttgg tc 1002 <210> 58 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 58 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Lys Gly 20 25 30 Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu Glu 35 40 45 Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro Gly 50 55 60 Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp Cys 65 70 75 80 Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe Ser 85 90 95 Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu Glu 100 105 110 Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys Lys 115 120 125 Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro Cys 130 135 140 Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser Asn 145 150 155 160 Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu Cys 165 170 175 Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys Glu 180 185 190 Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser His 195 200 205 Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser Asp 210 215 220 Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met Thr Leu 225 230 235 240 Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu Ala Lys 245 250 255 Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu Gln Lys 260 265 270 Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys Glu Ala 275 280 285 Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys Thr Leu 290 295 300 Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser Asp Ser 305 310 315 320 Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 325 330 <210> 59 <211> 999 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 59 atgctgggca tctggaccct ctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aagggattgg aattgaggaa gactgttact 120 acagttgaga ctcagaactt ggaaggcctg catcatgatg gccaattctg cataagccc 180 tgtcctccag gtgaaaggaa agctagggac tgcacagtca atggggatga accagactgc 240 gtgccctgcc aagaagggaa ggagtacaca gacaaagccc atttttcttc caaatgcaga 300 agatgtagat tgtgtgatga aggacatggc ttagaagtgg aaataaactg cacccggacc 360 cagaatacca agtgcagatg taaaccaaac tttttttgta actctactgt atgtgaacac 420 tgtgaccctt gcaccaaatg tgacatgga atcatcaagg aatgcacact caccagcaac 480 accaagtgca aaggaagg atccagatct aacttggggt ggctttgtct tcttcttttg 540 ccaattccac taattgtttg ggtgaagaga aaagaagtac agaaaacatg cagaaagcac 600 agaaaggaaa accaaggttc tcatgaatct ccaaccttaa atcctgaaac agtggcaata 660 aatttatctg atgttgactt gagtaaatat atcaccacta ttgctggagt catgacacta 720 agtcaagtta aaggctttgt tcgaaagaat ggtgtcaatg aagccaaaat agatgagatc 780 840 caacttcatg gaagaaaga agcgtatgac acattgatta aagatctcaa aaaagccaat 900 ctttgtactc ttgcagagaa aattcagact atcatcctca aggacattac tagtgactca 960 gaaaattcaa acttcagaaa tgaaatccaa agcttggtc 999 <210> 60 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 60 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Gly 20 25 30 Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu Glu 35 40 45 Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro Gly 50 55 60 Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp Cys 65 70 75 80 Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe Ser 85 90 95 Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu Glu 100 105 110 Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys Lys 115 120 125 Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro Cys 130 135 140 Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser Asn 145 150 155 160 Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu Cys 165 170 175 Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys Glu 180 185 190 Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser His 195 200 205 Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser Asp 210 215 220 Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met Thr Leu 225 230 235 240 Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu Ala Lys 245 250 255 Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu Gln Lys 260 265 270 Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys Glu Ala 275 280 285 Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys Thr Leu 290 295 300 Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser Asp Ser 305 310 315 320 Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 325 330 <210> 61 <211> 999 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 61 atgctgggca tctggaccct cctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aacggattgg aattgaggaa gactgttact 120 acagttgaga ctcagaactt ggaaggcctg catcatgatg gccaattctg ccataagccc 180 tgtcctccag gtgaaaggaa agctagggac tgcacagtca atggggatga accagactgc 240 gtgccctgcc aagaagggaa ggagtacaca gacaaagccc atttttcttc caaatgcaga 300 agatgtagat tgtgtgatga aggacatggc ttagaagtgg aaataaactg cacccggacc 360 cagaatacca agtgcagatg taaaccaaac tttttttgta actctactgt atgtgaacac 420 tgtgaccctt gcaccaaatg tgaacatgga atcatcaagg aatgcacact caccagcaac 480 accaagtgca aagaggaagg atccagatct aacttggggt ggctttgtct tcttcttttg 540 ccaattccac taattgtttg ggtgaagaga aaggaagtac agaaaacatg cagaaagcac 600 agaaaggaaa accaaggttc tcatgaatct ccaaccttaa atcctgaaac agtggcaata 660 aatttatctg atgttgactt gagtaaatat atcaccacta ttgctggagt catgacacta 720 agtcaagtta aaggctttgt tcgaaagaat ggtgtcaatg aagccaaaat agatgagatc 780 aagaatgaca atgtccaaga cacagcagaa cagaaagttc aactgcttcg taattggcat 840 caacttcatg gaaagaaaga agcgtatgac acattgatta aagatctcaa aaaagccaat 900 ctttgtactc ttgcagagaa aattcagact atcatcctca aggacattac tagtgactca 960 gaaaattcaa acttcagaaa tgaaatccaa agcttggtc 999 <210> 62 <211> 335 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 62 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ala 20 25 30 Lys Gly Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn 35 40 45 Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro 50 55 60 Pro Gly Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro 65 70 75 80 Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His 85 90 95 Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly 100 105 110 Leu Glu Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg 115 120 125 Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp 130 135 140 Pro Cys Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr 145 150 155 160 Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp 165 170 175 Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg 180 185 190 Lys Glu Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly 195 200 205 Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu 210 215 220 Ser Asp Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met 225 230 235 240 Thr Leu Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu 245 250 255 Ala Lys Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu 260 265 270 Gln Lys Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys 275 280 285 Glu Ala Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys 290 295 300 Thr Leu Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser 305 310 315 320 Asp Ser Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 325 330 335 <210> 63 <211> 1005 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 63 atgctgggca tctggaccct cctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aacgccaagg gattggaatt gaggaagact 120 gttactacag ttgagactca gaacttggaa ggcctgcatc atgatggcca attctgccat 180 aagccctgtc ctccaggtga aaggaaagct agggactgca cagtcaatgg ggatgaacca 240 gactgcgtgc cctgccaaga agggaaggag tacacagaca aagcccattt ttcttccaaa 300 360 cggacccaga ataccaagtg cagatgtaaa ccaaactttt tttgtaactc tactgtatgt 420 480 agcaacacca agtgcaaaga ggaggatcc agatctaact tggggtggct ttgtcttctt 540 cttttgccaa ttccactaat tgtttgggtg aagagaaagg aagtacaga aacatgcaga 600 aagcacagaa aggaaacca aggttcat gatctccaa ccttaatcc tgaacagtg 660 gcaataaatt tatctgatgt tgacttgagt aaatatatca ccactattgc tggatcatg 720 acactaagtc aagttaaagg ctttgttcga aagaatggtg tcaatgaagc caaatagat 780 gagatcaat atgacaatgt ccagacaca gcagacaca aagttcaact gcttcgtaat 840 tggcatcaac ttcatggaaa gaagaagcg tatgacacat tgattaaga tctcaaaaaa 900 gccaatcttt gtactcttgc agagaaaatt cagactatca tcctcagga cattactagt 960 gactcagaaa atcaactt cagaaatgaa atccaagct tggtc 1005 <210> 64 <211> 333 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 64 Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val Leu Thr Ser Val Ala 1 5 10 15 Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser 20 25 30 Leu Glu Leu Arg Lys Thr Val Thr Thr Val Glu Thr Gln Asn Leu Glu 35 40 45 Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys Pro Pro Gly 50 55 60 Glu Arg Lys Ala Arg Asp Cys Thr Val Asn Gly Asp Glu Pro Asp Cys 65 70 75 80 Val Pro Cys Gln Glu Gly Lys Glu Tyr Thr Asp Lys Ala His Phe Ser 85 90 95 Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly Leu Glu 100 105 110 Val Glu Ile Asn Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg Cys Lys 115 120 125 Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His Cys Asp Pro Cys 130 135 140 Thr Lys Cys Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr Ser Asn 145 150 155 160 Thr Lys Cys Lys Glu Glu Gly Ser Arg Ser Asn Leu Gly Trp Leu Cys 165 170 175 Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg Lys Glu 180 185 190 Val Gln Lys Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly Ser His 195 200 205 Glu Ser Pro Thr Leu Asn Pro Glu Thr Val Ala Ile Asn Leu Ser Asp 210 215 220 Val Asp Leu Ser Lys Tyr Ile Thr Thr Ile Ala Gly Val Met Thr Leu 225 230 235 240 Ser Gln Val Lys Gly Phe Val Arg Lys Asn Gly Val Asn Glu Ala Lys 245 250 255 Ile Asp Glu Ile Lys Asn Asp Asn Val Gln Asp Thr Ala Glu Gln Lys 260 265 270 Val Gln Leu Leu Arg Asn Trp His Gln Leu His Gly Lys Lys Glu Ala 275 280 285 Tyr Asp Thr Leu Ile Lys Asp Leu Lys Lys Ala Asn Leu Cys Thr Leu 290 295 300 Ala Glu Lys Ile Gln Thr Ile Ile Leu Lys Asp Ile Thr Ser Asp Ser 305 310 315 320 Glu Asn Ser Asn Phe Arg Asn Glu Ile Gln Ser Leu Val 325 330 <210> 65 <211> 999 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 65 atgctgggca tctggaccct cctacctctg gttcttacgt ctgttgctag attatcgtcc 60 aaaagtgtta atgcccaagt gactgacatc aactcattgg aattgaggaa gactgttact 120 acagttgaga ctcagaactt ggaaggcctg catcatgatg gccaattctg ccataagccc 180 240 300 agatgtagat tgtgtgatga aggacatggc ttagaagtgg aaataactg cacccggacc 360 cagaatacca agtgcagatg taaaccaaac tttttttgta actctactgt atgtgaacac 420 tgtgaccctt gcaccaaatg tgacatgga atcatcaagg aatgcacact caccagcaac 480 accaagtgca aaggaagg atccagatct aacttggggt ggctttgtct tcttcttttg 540 ccaattccac taattgtttg ggtgaagaga aaagaagtac agaaaacatg cagaaagcac 600 agaaaggaaa accaaggttc tcatgaatct ccaaccttaa atcctgaaac agtggcaata 660 aatttatctg atgttgactt gagtaaatat atcaccacta ttgctggagt catgacacta 720 agtcaagtta aaggctttgt tcgaaagaat ggtgtcaatg aagccaaaat agatgagatc 780 aagaatgaca atgtccaaga cacagcagaa cagaaagttc aactgcttcg taattggcat 840 caacttcatg gaaagaaaga agcgtatgac acattgatta aagatctcaa aaaagccaat 900 ctttgtactc ttgcagagaa aattcagact atcatcctca aggacattac tagtgactca 960 gaaaattcaa acttcagaaa tgaaatccaa agcttggtc 999 <210> 66 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 66 gugacugaca ucaacuccaa 20 <210> 67 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 67 tctatcattc atggtgctgt ttc 23 <210> 68 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic primer <400> 68 aggggaacca aaaactgtaa aa 22 <210> 69 <211> 33 <212> DNA <213> Homo sapiens <400> 69 caagtgactg acatcaactc caagggattg gaa 33 <210> 70 <211> 11 <212> PRT <213> Homo sapiens <400> 70 Gln Val Thr Asp Ile Asn Ser Lys Gly Leu Glu 1 5 10 <210> 71 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> misc_feature <222> (18)..(23) <223> This region may or may not be present <400> 71 caagtgactg acatcaactc caagggattg gaa 33 <210> 72 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <220> <221> MISC_FEATURE <222> (6)..(7) <223> This region may or may not be present <400> 72 Gln Val Thr Asp Ile Asn Ser Lys Gly Leu Glu 1 5 10 <210> 73 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> misc_feature <222> (7)..(25) <223> This region may or may not be present <400> 73 caagtgactg acatcaactc caagggattg gaa 33 <210> 74 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 74 Gln Val Asp Trp Asn 1 5

Claims

1. A dominant-negative Fas polypeptide comprising a first modification in the cytoplasmic death domain of human Fas and a second modification in the N-terminal region.

2. 2. The dominant-negative Fas polypeptide of claim 1, wherein the first modification and the second modification are each independently selected from the group consisting of a substitution, a deletion, and an insertion.

3. 3. The dominant-negative Fas polypeptide of claim 2, wherein the substitution is a point mutation.

4. 4. The dominant-negative Fas polypeptide of claim 1, wherein the first modification comprises or consists of a deletion of amino acids 230-314 of human Fas.

5. 4. The dominant-negative Fas polypeptide of claim 1, wherein the first modification comprises or consists of a point mutation at position 260 of human Fas.

6. 6. The dominant-negative Fas polypeptide of claim 5, wherein the point mutation is D260V.

7. 7. The dominant-negative Fas polypeptide of claim 1, wherein the second modification is located between the peptide signal region and cysteine-rich domain 1 of human Fas.

8. 8. The dominant-negative Fas polypeptide of claim 7, wherein the peptide signal region is encoded by amino acids 1 to 25 of human Fas.

9. 8. The dominant-negative Fas polypeptide of claim 7, wherein cysteine-rich domain 1 is encoded by amino acids 48 to 82 of human Fas.

10. 10. The dominant-negative Fas polypeptide of claim 1, wherein the second modification comprises or consists of a modification at position 32 of human Fas.

11. 11. The dominant-negative Fas polypeptide of claim 1, wherein the second modification comprises or consists of a deletion of amino acid 32 of human Fas.

12. 12. The dominant-negative Fas polypeptide of claim 1, wherein the second modification consists of a deletion of amino acid 32 of human Fas.

13. 13. The dominant-negative Fas polypeptide of claim 12, wherein the first modification consists of a deletion of amino acids 230-314 of human Fas.

14. 14. The dominant negative Fas polypeptide of claim 13, wherein the dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:

16.

15. 15. The dominant negative Fas polypeptide of claim 13 or 14, wherein the dominant negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:

16.

16. 12. The dominant-negative Fas polypeptide of claim 1, wherein the second modification comprises or consists of a deletion of amino acids 31 and 32 of human Fas.

17. 17. The dominant-negative Fas polypeptide of claim 16, wherein the first modification consists of a deletion of amino acids 230-314 of human Fas.

18. 18. The dominant negative Fas polypeptide of claim 17, wherein the dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:

18.

19. 19. The dominant negative Fas polypeptide of claim 17 or 18, wherein the dominant negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:

18.

20. 12. The dominant-negative Fas polypeptide of claim 1, wherein the second modification comprises or consists of a deletion of amino acids 32 and 33 of human Fas.

21. 21. The dominant-negative Fas polypeptide of claim 20, wherein the first modification consists of a deletion of amino acids 230-314 of human Fas.

22. 22. The dominant negative Fas polypeptide of claim 21, wherein the dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:

20.

23. 23. The dominant negative Fas polypeptide of claim 21 or 22, wherein the dominant negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:

20.

24. 10. The dominant-negative Fas polypeptide of claim 1, wherein the second modification comprises or consists of a modification at position 33 of human Fas.

25. 25. The dominant-negative Fas polypeptide of claim 24, wherein the second modification comprises or consists of a deletion of amino acids 33 and 34 of human Fas.

26. 26. The dominant-negative Fas polypeptide of claim 25, wherein the first modification consists of a deletion of amino acids 230-314 of human Fas.

27. 27. The dominant negative Fas polypeptide of claim 26, wherein the dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:

22.

28. 28. The dominant negative Fas polypeptide of claim 26 or 27, wherein the dominant negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:

22.

29. 11. The dominant-negative Fas polypeptide of claim 1, wherein the second modification comprises or consists of a point mutation at position 32 of human Fas.

30. 11. The dominant-negative Fas polypeptide of claim 1, wherein the second modification comprises or consists of the point mutation S32A of human Fas.

31. 31. The dominant-negative Fas polypeptide of claim 30, wherein the first modification consists of a deletion of amino acids 230-314 of human Fas.

32. 32. The dominant negative Fas polypeptide of claim 31, wherein the dominant negative Fas polypeptide comprises or consists of an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% identical to the amino acid sequence set forth in SEQ ID NO:

24.

33. 33. The dominant negative Fas polypeptide of claim 31 or 32, wherein the dominant negative Fas polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO:

24.

34. 34. The dominant-negative Fas polypeptide of any one of claims 1 to 33, wherein the human Fas comprises or consists of the amino acid sequence set forth in SEQ ID NO:

10.

35. 35. The dominant negative Fas polypeptide of claim 1, wherein the first modification prevents binding between the dominant negative Fas polypeptide and a FADD polypeptide.

36. 36. The dominant negative Fas polypeptide of any one of claims 1 to 35, wherein the second modification increases (a) surface expression of the dominant negative Fas polypeptide by the cell, and / or (b) transduction efficiency of the dominant negative Fas polypeptide into the cell, and / or (c) protection of the dominant negative Fas polypeptide from FasL-induced apoptosis.

37. A cell comprising: a) an antigen-recognizing receptor that binds to an antigen; and b) a dominant-negative Fas polypeptide according to any one of claims 1 to 36.

38. 38. The cell of claim 37, wherein the dominant-negative Fas polypeptide enhances the persistence of the cell.

39. 39. The cell of claim 37 or 38, wherein the dominant-negative Fas polypeptide reduces apoptosis or anergy of the cell.

40. 40. The cell of any one of claims 37 to 39, wherein the antigen-recognizing receptor is exogenous or endogenous.

41. 41. The cell of any one of claims 37 to 40, wherein the antigen-recognizing receptor is expressed from a vector.

42. 42. The cell of any one of claims 37 to 41, wherein the dominant negative Fas polypeptide is expressed from a vector.

43. 43. The cell of any one of claims 37 to 42, wherein the cell is an immunoresponsive cell.

44. 44. The cell of any one of claims 37 to 43, wherein the cell is a lymphoid cell or a myeloid cell.

45. 45. The cell of any one of claims 37 to 44, wherein the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a B cell, a monocyte, and a macrophage.

46. 46. ​​The cell of any one of claims 37 to 45, wherein the cell is a NK cell.

47. 46. ​​The cell of any one of claims 37 to 45, wherein the cell is a T cell.

48. T cells are cytotoxic T lymphocytes (CTL), regulatory T cells (T reg ), or a natural killer T (NKT) cell.

49. 49. The cell of any one of claims 37 to 48, wherein the cell is autologous or allogeneic to the intended recipient.

50. 50. The cell of any one of claims 37 to 49, wherein the antigen is a tumor antigen or a pathogen antigen.

51. 51. The cell of any one of claims 37 to 50, wherein the antigen is a tumor antigen.

52. 52. The cell of claim 50 or 51, wherein the tumor antigen is a tumor-specific antigen (TSA) or a tumor-associated antigen (TAA).

53. Tumor antigens include CD19, MUC16, MUC1, CAIX, CEA, CD8, CD7, CD10, CD20, CD22, CD30, CLL1, CD33, CD34, CD38, CD41, CD44, CD49f, CD56, CD74, CD133, CD138, EGP-2, EGP-40, EpCAM, Erb-B2, Erb-B3, Erb-B4, FBP, fetal acetylcholine receptor, folate receptor-α, GD2, GD3, HER-2, hTERT, IL-13R-α2, κ-light chain, KDR, KRAS mutant, HRAS mutant, PIK3CA mutant, IDH mutant, p53 mutant, NRAS mutant, LeY, L1 cell adhesion molecule, MAGE-A1, mesothelin, MAGEA3, CT83, p53, MART1, GP100, proteinase 3 (PR1), tyrosinase, survivin, hTERT, EphA2, NKG2D ligand, NY-ESO-1, carcinoembryonic antigen (h5T4), PSCA, PSMA, ROR1, TAG-72, VEGF-R2, WT-1, BCMA, CD123, CD44V6, NKCS1, EGF1R, EGFR-VIII, CD99, CD70, ADGRE2, CCR1, LILRB2, PRAME, HPV 53. The cell of any one of claims 50 to 52, wherein the cell is selected from the group consisting of E6 oncoprotein, HPV E7 oncoprotein, and ERBB.

54. The cell of claim 53, wherein the antigen is CD19.

55. 51. The cell of any one of claims 37 to 50, wherein the antigen is a pathogen-associated antigen.

56. 56. The cell of claim 55, wherein the pathogen-associated antigen is a viral antigen present in cytomegalovirus (CMV), a viral antigen present in Epstein-Barr virus (EBV), a viral antigen present in human immunodeficiency virus (HIV), or a viral antigen present in influenza virus.

57. 57. The cell of any one of claims 37 to 56, wherein the antigen-recognizing receptor is a T cell receptor (TCR) or a chimeric antigen receptor (CAR).

58. 58. The cell of any one of claims 37 to 57, wherein the antigen-recognizing receptor is a TCR that recognizes a pathogen-associated antigen, and the cell is a pathogen-specific T cell.

59. The cell of any one of claims 37 to 58, wherein the antigen-recognizing receptor is a TCR that recognizes a tumor antigen, and the cell is a tumor-specific T cell.

60. 60. The cell of any one of claims 56 to 59, wherein the TCR is an endogenous TCR or a recombinant TCR.

61. The cell of any one of claims 37 to 57, wherein the antigen recognition receptor is a CAR.

62. 62. The cell of claim 61 , wherein the CAR comprises an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain.

63. The cell of claim 62, wherein the intracellular signaling domain comprises a native CD3ζ polypeptide.

64. The cell of claim 62, wherein the intracellular signaling domain comprises a modified CD3ζ polypeptide.

65. The cell described in claim 64, wherein the modified CD3ζ polypeptide comprises a native ITAM1, an ITAM2 variant consisting of two loss-of-function mutations, and an ITAM3 consisting of two loss-of-function mutations.

66. 66. The cell of any one of claims 62 to 65, wherein the intracellular signaling domain further comprises at least one costimulatory signaling region.

67. 67. The cell of claim 66, wherein the at least one costimulatory signaling region comprises a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof.

68. The cell of claim 66 or 67, wherein at least one costimulatory signaling region comprises a CD28 polypeptide.

69. 69. The cell of any one of claims 37 to 68, further comprising a suicide gene.

70. 70. The cell of claim 69, wherein the suicide gene is herpes simplex virus thymidine kinase (hsv-tk), inducible caspase-9 suicide gene (iCasp-9), or truncated human epidermal growth factor receptor (EGFRt) polypeptide.

71. 37. A nucleic acid composition comprising: (a) a first nucleic acid sequence encoding an antigen-recognizing receptor that binds to an antigen; and (b) a second nucleic acid sequence encoding a dominant-negative Fas polypeptide of any one of claims 1 to 36.

72. 72. The nucleic acid composition of claim 71, wherein one or both of the first nucleic acid sequence and the second nucleic acid sequence is operably linked to a promoter element.

73. 73. The nucleic acid composition of claim 71 or 72, wherein one or both of the first nucleic acid sequence and the second nucleic acid sequence are present on a vector.

74. 74. The nucleic acid composition of claim 73, wherein the vector is a retroviral vector.

75. 74. The nucleic acid composition of claim 73, wherein the vector is a lentiviral vector.

76. 76. A cell comprising the nucleic acid composition of any one of claims 71 to 75.

77. 76. A vector comprising the nucleic acid composition of any one of claims 71 to 75.

78. A cell comprising the vector of claim 77.

79. 80. A pharmaceutical composition comprising an effective amount of the cells of any one of claims 37 to 70, 76, and 78, and a pharmaceutically acceptable excipient.

80. 80. The pharmaceutical composition of claim 79 for treating and / or preventing a neoplasm or a pathogen infection.

81. A method for inducing and / or enhancing an immune response to a target antigen, comprising administering to a subject an effective amount of a cell described in any one of claims 37 to 70, 76, and 78, or a pharmaceutical composition described in claim 79 or 80.

82. 81. A method for reducing tumor burden in a subject, comprising administering to the subject an effective amount of a cell described in any one of claims 37 to 70, 76, and 78, or a pharmaceutical composition described in claim 79 or 80.

83. 83. The method of claim 82, wherein the method reduces the number of tumor cells, reduces tumor size, and / or eradicates tumors in a subject.

84. A method for treating and / or preventing a neoplasm, comprising administering to a subject an effective amount of a cell described in any one of claims 37 to 70, 76, and 78, or a pharmaceutical composition described in claim 79 or 80.

85. A method for prolonging the survival of a subject having a neoplasm, comprising administering to the subject an effective amount of a cell described in any one of claims 37 to 70, 76, and 78, or a pharmaceutical composition described in claim 79 or 80.

86. 86. The method of claim 84 or 85, wherein the neoplasm is a malignant neoplasm.

87. 87. The method of any one of claims 82 to 86, wherein the tumor or neoplasm is selected from the group consisting of B-cell leukemia, multiple myeloma, acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), non-Hodgkin's lymphoma, myeloid leukemia, and myelodysplastic syndrome (MDS).

88. 88. The method of any one of claims 82 to 87, wherein the tumor or neoplasm is a solid tumor.

89. 89. The method of claim 88, wherein the solid tumor is a tumor originating from the brain, breast, lung, gastrointestinal tract (including the esophagus, stomach, small intestine, large intestine, and rectum), pancreas, prostate, soft tissue / bone, uterus, cervix, ovary, kidney, skin, thymus, testis, head and neck, or liver.

90. A method for preventing and / or treating a pathogen infection in a subject, comprising administering to the subject an effective amount of a cell described in any one of claims 37 to 70, 76, and 78, or a pharmaceutical composition described in claim 79 or 80.

91. 91. The method of claim 90, wherein the pathogen is selected from the group consisting of a virus, a bacterium, a fungus, a parasite, and a protozoan that can cause disease.

92. 37. A method for producing an antigen-specific cell, comprising introducing into a cell: (a) a first nucleic acid sequence encoding an antigen-recognizing receptor that binds to the antigen; and (b) a second nucleic acid sequence encoding a dominant-negative Fas polypeptide of any one of claims 1 to 36.

93. 93. The method of claim 92, wherein one or both of the first nucleic acid sequence and the second nucleic acid sequence are operably linked to a promoter element.

94. 94. The method of claim 92 or 93, wherein one or both of the first nucleic acid sequence and the second nucleic acid sequence are present on a vector.

95. 95. The method of claim 94, wherein the vector is a retroviral vector.

96. 78. A kit comprising a cell according to any one of claims 37 to 70, 76, and 78, a nucleic acid composition according to any one of claims 71 to 75, or a vector according to claim 77.

97. 97. The kit of claim 96, further comprising instructions for treating and / or preventing a neoplasm or pathogen infection.