Polynucleotide Compositions and Uses Thereof

Abstract

The present invention relates to an RNA molecule encoding the E. coli fimbrial H antigen (FimH). The present disclosure further relates to a composition comprising the RNA molecule formulated in a lipid nanoparticle (RNA-LNP). The present disclosure further relates to the use of the RNA molecule, the RNA-LNP and the composition for the prevention of E. coli infections, including urinary tract infections. [Figure 1] TIFF2025503423000033.tif87170

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Provisional Application No. 63 / 290,895, filed December 17, 2021, and U.S. Provisional Application No. 63 / 384,607, filed November 22, 2022, the entire contents of each of which are incorporated herein by reference in their entirety.

[0002] FIELD OF THE INVENTION The present invention relates to ribonucleic acid vaccine compositions comprising polynucleotide molecules encoding one or more Escherichia coli (E. coli) fimbrial antigens, such as the fimbrial H antigen (FimH), and methods for the preparation, production, and therapeutic use of the ribonucleic acid vaccines.

[0003] Sequence Listing Reference This application has been submitted electronically via EFS-Web and contains an electronically submitted Sequence Listing in .txt format. The .txt file contains a Sequence Listing entitled "PC72808-PRV2 Sequence Listing.xml," created on November 21, 2022, and having a size of 121 KB. The Sequence Listing contained in this .xml file is a part of the present specification and is incorporated herein by reference in its entirety. [Background technology]

[0004] Background of the Invention Urinary tract infections (UTIs) affect one in five women at least once during their lifetime, causing significant morbidity and mortality and resulting in a substantial burden on healthcare systems. While several different bacteria can cause UTIs, the most common cause (90–95% of cases) is the Gram-negative bacterium Escherichia coli (E. coli). Most E. coli UTIs are caused by uropathogenic E. coli (UPEC), which colonize the gastrointestinal tract, migrate from fecal flora to the urogenital tract, and adhere to host urothelial cells, establishing a reservoir for ascending infection of the urinary tract. Adhesion is facilitated by fimbriae adhesins, including type 1 fimbriae, that bind to mannosylated glycoproteins in the epithelial layer or are secreted into the urine. Type 1 fimbriae are highly conserved among clinical UPEC isolates and are encoded by a cluster of genes called fim, which encode accessory proteins (FimC, FimD), various structural subunits (FimE, FimF, FimG), and an adhesin called FimH. FimH is essential for all features of UTI infection in a mouse model that mimics aspects of human bladder infection (Hannan et al. PLoS Pathog. 2010 Aug 12;6(8):e1001042;doi:10.1371 / journal.ppat.1001042; Schwartz et al. Infect Immun. 2011 Oct;79(10):4250-9.doi:10.1128 / IAI.05339-11). Small molecule inhibitors that target FimH by mimicking its mannosylated receptor further validate the role of FimH in UTI and show promise as therapeutic agents in animal models (Cusumano CK et al. Sci Transl Med. 2011;3(109):109ra115. doi:10.1126 / scitranslmed.3003021).Additionally, FimH is under positive selection in E. coli human cystitis isolates (Chen SL et al. Proc Natl Acad Sci U S A. 2009 Dec 29;106(52):22439-44. doi:10.1073 / pnas.0902179106), and positively selected residues can affect virulence in a mouse model of cystitis (Schwartz, DJ et al. Proc Natl Acad Sci U S A. 110, 15530-15537. doi:10.1073 / pnas.1315203110(2013)).

[0005] FimH contains a lectin-binding domain (FimH) that is responsible for binding to mannosylated glycoproteins. LD FimH consists of two domains: a β-strand and a pilin domain. The pilin domain serves to link FimH to other structural subunits of the pilus, such as FimG, through a mechanism called donor strand exchange (Le Trong, I et al., J. Struct Biol. 2010 Dec;172(3):380-8. doi:10.1016 / j.jsb.2010.06.002). The FimH pilin domain forms an incomplete immunoglobulin fold, resulting in a groove that provides a binding site for the N-terminal β-strand of FimG, which forms a strong intermolecular link between FimH and FimG. FimH LDAlthough FimH can be expressed in a soluble, stable form, full-length FimH is unstable alone (Vetsch, M. et al. J. Mol. Biol. 322:827-840 (2002); Barnhart, M. et al. Proc. Natl. Acad. Sci. USA (2000) Jul. 5;97(14):7709-14), except when in complex with the chaperone FimC or complemented with the donor strand peptide of FimG in peptide form or as a fusion protein (Barnhart, M. et al. Proc. Natl. Acad. Sci. USA (2000) Jul. 5;97(14):7709-14; Sauer, M. et al. Nat. Commun. (2016) Mar. 7;7:10738; Barnhart, M. et al. J. Bacteriol. 2003 May;185(9):2723-30). The design and expression of a full-length FimH molecule by linking the FimG donor peptide to full-length FimH via a glycine-serine linker has been previously described (PCT International Publication No. WO 2021 / 084429, published May 6, 2021) and is designated FimH-DSG.

[0006] FimH LD is considered to be a poor immunogen in terms of its ability to stimulate functional immunogenicity. Some studies have shown that binding antibody titers are significantly higher with FimH than with adjuvant. LD Studies suggest that FimH can be induced with IgG, but functional neutralizing titers were only observed in the presence of adjuvants (PCT International Publication No. WO 2021 / 084429, published May 6, 2021). Studies suggest that locking FimH in an open conformation, with reduced affinity for mannoside ligands, improves functional immunogenicity (Kisiela, DI et al., Proc Natl Acad Sci USA 110, 19089-19094 (2013)). Summary of the Invention [Problem to be solved by the invention]

[0007] Thus, there is a need for improved immunogenic compositions comprising FimH antigens with reduced affinity for mannoside ligands and improved biochemical properties that result in improved functional immunogenicity compared to wild-type FimH. [Means for solving the problem]

[0008] The present disclosure, as provided herein, among other things, provides an unmet need for improved immunogenic compositions against E. coli infections.

[0009] In one embodiment, the present disclosure provides immunogenic compositions and methods for preventing, treating, or ameliorating an infection, disease, or condition in a subject, comprising administering an RNA molecule, e.g., an immunogenic RNA polynucleotide, encoding an amino acid sequence, e.g., an immunogenic antigen, comprising the Escherichia coli (E. coli) FimH protein ("FimH"), an immunogenic variant thereof, or an immunogenic fragment of the FimH protein or its immunogenic variant, e.g., an antigenic peptide or protein. Thus, the immunogenic antigen comprises an epitope of the FimH protein for inducing an immune response against FimH in a subject. The RNA polynucleotide encoding the immunogenic antigen is administered to provide the antigen (after expression of the polynucleotide by appropriate target cells) for induction, e.g., stimulation, priming, and / or expansion, of an immune response, e.g., antibodies and / or immune effector cells. In one embodiment, the immune response induced in accordance with the present disclosure is both a B cell-mediated immune response, e.g., an antibody-mediated immune response, and a T cell-mediated immune response. In one embodiment, the immune response is an anti-FimH immune response.

[0010] The immunogenic compositions described herein comprise RNA molecules (as active ingredients) containing RNA that can be translated into one or more proteins in the recipient's cells. In addition to a wild-type, codon-optimized, or mutant sequence encoding an antigen sequence, the RNA molecule may contain one or more structural elements (5' cap, 5' UTR, subgenomic promoter, 3' UTR, polyA tail) optimized for maximum RNA efficacy in terms of stability and translation efficiency. In one embodiment, the RNA molecule contains all of these elements. The RNA molecules described herein may be complexed with lipids and / or proteins to generate RNA-particles (e.g., lipid nanoparticles (LNPs)) for administration. In one embodiment, the RNA molecules described herein are complexed with lipids to generate RNA-lipid nanoparticles (e.g., RNA-LNPs) for administration. In one embodiment, the RNA molecules described herein are complexed with proteins for administration. In one embodiment, the RNA molecules described herein are complexed with lipids and proteins for administration. When a combination of different RNA molecules is used, the RNA molecules may be complexed together with lipids and / or proteins to form RNA-particles for administration, or may be complexed separately from lipids and / or proteins.

[0011] The present disclosure provides an RNA molecule and an RNA-LNP comprising at least one open reading frame (ORF) encoding a FimH antigen. In some embodiments, the FimH antigen is a FimH polypeptide. In some embodiments, the FimH polypeptide is a full-length, truncated, fragment, or variant thereof. In some embodiments, the FimH polypeptide comprises at least one mutation.

[0012] The present disclosure provides RNA molecules and RNA-LNPs comprising at least one ORF encoding a FimH polypeptide of Table 1. In some embodiments, the FimH polypeptide comprises an amino acid sequence selected from SEQ ID NOs: 67, 69, 71, or 73. In some embodiments, the FimH polypeptide has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to any of the amino acid sequences of Table 1, e.g., any of SEQ ID NOs: 67, 69, 71, or 73, or has up to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity. In some embodiments, the FimH polypeptide consists of any of the amino acid sequences in Table 1, eg, any of SEQ ID NOs: 67, 69, 71, or 73.

[0013] In another aspect, the present disclosure provides RNA molecules and RNA-LNPs comprising at least one ORF encoding a FimH polypeptide, wherein the FimH polypeptide is FimH-DSG (SEQ ID NO: 59), a FimH-DSG triple mutant (G15A, G16A, V27A) (SEQ ID NO: 62), a FimHLD triple mutant (G15A, G16A, V27A) (SEQ ID NO: 54), an immunogenic fragment thereof, or a combination of any two or more of the above. In some embodiments, the FimH polypeptide has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to any of the amino acid sequences of SEQ ID NOs: 59, 62, or 54, or up to 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity.

[0014] The present disclosure provides RNA molecules and RNA-LNPs comprising at least one ORF transcribed from at least one DNA nucleic acid of Table 2. In some embodiments, the RNA molecule is transcribed from a nucleic acid sequence selected from SEQ ID NOs: 66, 68, 70, or 72. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to any of the nucleic acid sequences of Table 2, e.g., any of SEQ ID NOs: 66, 68, 70, or 72. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence consisting of any of the nucleic acid sequences in Table 2, eg, any of SEQ ID NOs: 66, 68, 70, or 72.

[0015] The present disclosure further provides RNA molecules and RNA-LNPs comprising at least one ORF comprising an RNA nucleic acid sequence of Table 3. In some embodiments, the RNA molecule comprises a nucleic acid sequence selected from SEQ ID NOs: 82-85. In some embodiments, the RNA molecule comprises a nucleic acid sequence having 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any of the nucleic acid sequences of Table 3, e.g., any of SEQ ID NOs: 82-85. In some embodiments, the RNA molecule comprises a nucleic acid sequence consisting of any of the nucleic acid sequences of Table 3, e.g., any of SEQ ID NOs: 82-85. In some embodiments, each uridine in any of SEQ ID NOs: 82-85 is replaced by 1-methyl-3'-pseudouridylyl (Ψ).

[0016] The present disclosure further provides RNA molecules and RNA-LNPs comprising a 5' untranslated region (5'-UTR) and / or a 3' untranslated region (3'-UTR). In some embodiments, the RNA molecule comprises a 5' untranslated region (5'-UTR). In some embodiments, the 5' UTR comprises a sequence selected from either SEQ ID NO: 75 or 77. In some embodiments, the 5' UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher identity to either SEQ ID NO: 75 or 77. In some embodiments, the 5' UTR comprises a sequence selected from either SEQ ID NO: 75 or 77. In some embodiments, the 5' UTR comprises a sequence consisting of either SEQ ID NO: 75 or 77.

[0017] In some embodiments, the RNA molecules and RNA-LNPs comprise a 3' untranslated region (3'-UTR). In some embodiments, the 3' UTR comprises a sequence selected from either SEQ ID NO: 76 or 78. In some embodiments, the 3' UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to either SEQ ID NO: 76 or 78. In some embodiments, the 3' UTR comprises a sequence selected from either SEQ ID NO: 76 or 78. In some embodiments, the 3' UTR comprises a sequence consisting of either SEQ ID NO: 76 or 78.

[0018] The present disclosure further provides RNA molecules and RNA-LNPs that include a 5' cap portion. The present disclosure further provides RNA molecules and RNA-LNPs that include a 3' polyA tail. In some embodiments, the polyA tail includes a sequence having SEQ ID NO: 86.

[0019] In some embodiments, the RNA molecule comprises a 5'UTR and a 3'UTR. In some embodiments, the RNA molecule comprises a 5' cap, a 5'UTR, and a 3'UTR. In some embodiments, the RNA molecule comprises a 5' cap, a 5'UTR, a 3'UTR, and a polyA tail. In some embodiments, the RNA molecule comprises a 5' cap, a 3'UTR, and a polyA tail.

[0020] In some embodiments, the length of the poly-A tail may contain +1 / -1 A. In some embodiments, the uridine is 1-methyl-3'-pseudouridylyl (Ψ).

[0021] The present disclosure further provides an RNA molecule comprising at least one codon-optimized open reading frame.The present disclosure further provides an RNA molecule comprising stabilized RNA.The present disclosure further provides an RNA molecule comprising RNA with at least one modified nucleotide. In some embodiments, the modified nucleotide is pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine. In some embodiments, the modified nucleotide is 1-methyl-3'-pseudouridyl (Ψ).

[0022] The present disclosure further provides an RNA molecule that is a messenger RNA (mRNA), which can be a nucleoside-modified RNA (modRNA). In some embodiments, the RNA is an mRNA. In other embodiments, the RNA is a modRNA.

[0023] The present disclosure further provides an immunogenic composition comprising the RNA molecule described herein.In such immunogenic composition, the RNA molecule can be formulated in, encapsulated in, complexed with, bound to, or adsorbed to lipid nanoparticles (LNPs) (for example, FimH RNA-LNPs).In some embodiments, the lipid nanoparticles comprise at least one of cationic lipids, PEG lipids, and at least one structural lipid (for example, neutral lipids and steroids or steroid analogs).

[0024] In some embodiments, the lipid nanoparticles comprise a cationic lipid. In some embodiments, the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

[0025] In some embodiments, lipid nanoparticles comprise lipids conjugated with polymer.In some embodiments, lipid nanoparticles comprise PEG lipids, also referred to as PEGylated lipids.In some embodiments, PEG lipids include PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (for example, PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA) and glycol lipids including PEG-2000-DMG, PEGylated diacylglycerol (PEG-DAG), for example, 1-(monomethoxy-polyethylene glycol)-2,3-di Myristoylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate, such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate. In some embodiments, the PEG lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

[0026] In some embodiments, the lipid nanoparticles comprise at least one structural lipid, such as a neutral lipid.In some embodiments, the neutral lipid is distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- The neutral lipid is selected from (N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl phosphatidylethanolamine (SOPE), and / or 1,2-dielideyl-sn-glycero-3-phosphoethanolamine (trans-DOPE). In some embodiments, the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0027] In some embodiments, the lipid nanoparticles comprise a second structural lipid, such as a steroid or steroid analog. In some embodiments, the steroid or steroid analog is cholesterol.

[0028] In some embodiments, the lipid nanoparticles have an average diameter of about 1 to about 500 nm.

[0029] In some embodiments, the RNA-LNP immunogenic composition comprises an RNA-LNP immunogen at a concentration of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, encapsulated in LNPs having a lipid composition of cationic lipid at a concentration of 0.8-0.95 mg / mL, PEGylated lipid at a concentration of 0.05-0.15 mg / mL, first structural lipid at a concentration of 0.1-0.25 mg / mL, and second structural lipid at a concentration of 0.3-0.45 mg / mL. A liquid RNA-LNP composition comprising an RNA polynucleotide encoding a FimH polypeptide disclosed herein at a concentration of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, and further comprising a buffer composition comprising a first buffer at a concentration of 0.15-0.3 mg / mL, a second buffer at a concentration of 1.25-1.4 mg / mL, and a stabilizer at a concentration of 95-110 mg / mL.

[0030] In some embodiments, the liquid RNA-LNP immunogenic composition comprises at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, and up to 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, encapsulated in LNPs having a lipid composition of ALC-0315 at a concentration of 0.8-0.95 mg / mL, ALC-0159 at a concentration of 0.05-0.15 mg / mL, DSPC at a concentration of 0.1-0.25 mg / mL, and cholesterol at a concentration of 0.3-0.45 mg / mL. The present invention also includes a Tris buffer composition comprising an RNA polynucleotide encoding a FimH polypeptide disclosed herein at a concentration of 0.60, 0.75, or 0.90 mg / mL, or at or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, and further comprising tromethamine at a concentration of 0.1-0.3 mg / mL, Tris HCl at a concentration of 1.25-1.4 mg / mL, and sucrose at a concentration of 95-110 mg / mL.

[0031] In specific embodiments, the RNA-LNP immunogenic composition is encapsulated in LNPs having a lipid composition of at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, up to 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, encapsulated in LNPs having a lipid composition of cationic lipid at a concentration of 0.8-0.95 mg / mL, PEGylated lipid at a concentration of 0.05-0.15 mg / mL, first structural lipid at a concentration of 0.1-0.25 mg / mL, and second structural lipid at a concentration of 0.3-0.45 mg / mL. A lyophilized RNA-LNP composition comprising an RNA polynucleotide encoding a FimH polypeptide disclosed herein at a concentration of 15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, and further comprising a first buffer at a concentration of 0.01-0.15 mg / mL, a second buffer at a concentration of 0.5-0.65 mg / mL, a stabilizer at a concentration of 35-50 mg / mL, and a salt at a concentration of 5-15 mg / mL. In a specific embodiment, the lyophilized composition is reconstituted in 0.6-0.75 mL of a carrier or diluent. The concentration in the lyophilized RNA-LNP composition is determined after reconstitution.

[0032] In specific embodiments, the lyophilized RNA-LNP composition comprises at least 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, and up to 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, encapsulated in LNPs having a lipid composition of ALC-0315 at a concentration of 0.8-0.95 mg / mL, ALC-0159 at a concentration of 0.05-0.15 mg / mL, DSPC at a concentration of 0.1-0.25 mg / mL, and cholesterol at a concentration of 0.3-0.45 mg / mL. The composition comprises an RNA polynucleotide encoding a FimH polypeptide disclosed herein at a concentration of 0.60, 0.75, or 0.90 mg / mL, or at a concentration of exactly 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, or between any two of 0.01, 0.15, 0.30, 0.45, 0.60, 0.75, or 0.90 mg / mL, and further comprises tromethamine at a concentration of 0.01-0.15 mg / mL, Tris HCl at a concentration of 0.5-0.65 mg / mL, sucrose at a concentration of 35-50 mg / mL, and NaCl at a concentration of 5-15 mg / mL. In a specific embodiment, the lyophilized composition is reconstituted in 0.6-0.75 mL of saline. The concentration in the lyophilized RNA-LNP composition is determined after reconstitution.

[0033] The present disclosure provides RNA molecules, RNA-LNPs and immunogenic compositions that can be administered to a subject at a dose of at least 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, or 90 μg of FimH RNA encapsulated in the LNPs, up to 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, or 90 μg, exactly 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, or 90 μg, or between any two of 1 μg, 15 μg, 30 μg, 45 μg, 60 μg, 75 μg, or 90 μg.

[0034] The present disclosure provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered in a single dose. The present disclosure also provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered twice (e.g., on days 0 and 7, 0 and 14, 0 and 21, 0 and 28, 0 and 60, 0 and 90, 0 and 120, 0 and 150, 0 and 180, 0 and 1 month later, 0 and 2 months later, 0 and 3 months later, 0 and 6 months later, 0 and 9 months later, 0 and 12 months later, 0 and 18 months later, 0 and 2 years later, 0 and 5 years later, or 0 and 10 years later). The present disclosure also provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered twice, at day 0 and 2 months later. The present disclosure also provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered twice, at day 0 and 6 months later. The present disclosure further provides RNA molecules, RNA-LNPs, and immunogenic compositions that can be administered in 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more doses. In some embodiments, periodic boosters at 1-5 year intervals may be desired to maintain protective levels of antibodies.

[0035] The present disclosure provides a method of inducing an immune response in a subject, the method comprising administering to the subject an effective amount of an RNA molecule, RNA-LNP, and / or immunogenic composition described herein. The present disclosure further provides the use of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein in the manufacture of a medicament for use in inducing an immune response in a subject.

[0036] The present disclosure provides a method of inducing an immune response in a subject, the method comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or composition comprising at least one open reading frame encoding a FimH polypeptide described herein.The present disclosure further provides the use of an RNA molecule and / or RNA-LNP or composition comprising at least one open reading frame encoding a FimH polypeptide described herein in the production of a medicament for use in inducing an immune response in a subject.

[0037] The present disclosure provides a method for inducing an immune response in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or composition comprising at least one open reading frame encoding a polypeptide of a gene of interest described herein.The present disclosure further provides the use of an RNA molecule and / or RNA-LNP or composition comprising at least one open reading frame encoding a polypeptide of a gene of interest described herein in the production of a medicament for use in inducing an immune response in a subject.

[0038] The present disclosure provides methods for preventing, treating, or ameliorating an infection, disease, or condition in a subject, comprising administering to the subject an effective amount of an RNA molecule, RNA-LNP, and / or immunogenic composition described herein. The present disclosure further provides use of the RNA molecule, RNA-LNP, and / or immunogenic composition described herein in the production of a medicament for use in preventing, treating, or ameliorating an infection, disease, or condition in a subject. In some embodiments, the infection or condition is associated with Escherichia coli (E. coli) FimH. In some embodiments, the infection, disease, or condition is a urinary tract infection (UTI), urosepsis, cystitis, or pyelonephritis.

[0039] The present disclosure provides methods for preventing, treating, or ameliorating an infection, disease, or condition in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a FimH polypeptide described herein. The present disclosure further provides use of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a FimH polypeptide described herein in the production of a medicament for use in preventing, treating, or ameliorating an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition is associated with Escherichia coli (E. coli) FimH. In some embodiments, the infection, disease, or condition is a urinary tract infection (UTI), urosepsis, cystitis, or pyelonephritis.

[0040] The present disclosure further provides a method for preventing, treating, or alleviating infectious diseases, diseases, or conditions in a subject, comprising administering to the subject an effective amount of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a polypeptide of the gene of interest described herein.The present disclosure further provides the use of an RNA molecule and / or RNA-LNP or immunogenic composition comprising at least one open reading frame encoding a polypeptide of the gene of interest described herein in the production of a medicament for use in preventing, treating, or alleviating infectious diseases, diseases, or conditions in a subject.In some embodiments, infectious diseases, diseases, or conditions are associated with a gene of interest.

[0041] In some embodiments, the subject is, at least, or at most about 1 year old, about 1 year old or older, about 5 years old or older, about 10 years old or older, about 20 years old or older, about 30 years old or older, about 40 years old or older, about 50 years old or older, about 60 years old or older, about 70 years old or older, or older. In some embodiments, the subject is about 50 years old or older. In further embodiments, the subject is 6 months to 1 year old, 1 year to 2 years old, 1 year to 3 years old, 1 year to 4 years old, 1 year to 5 years old, 6 months to 5 years old, or 60 years old or older. The entire birth cohort is included as a relevant population for immunization. This can be done, for example, by starting immunization regimens from birth to 6 months, anywhere from 6 months to 5 years of age, in pregnant women (or women of childbearing age) to protect infants by passive transfer of antibodies, and in subjects over 50 years of age.

[0042] In some embodiments, the subject is a human. In certain embodiments, the human is a child, such as an infant. In certain other embodiments, the human is a woman, particularly a pregnant woman. In some aspects, the subject is immunocompetent. In some aspects, the subject is immunocompromised.

[0043] The present disclosure provides a method or use described herein, wherein the RNA molecule, RNA-LNP and / or immunogenic composition is administered as a vaccine.

[0044] The present disclosure provides a method or use described herein, wherein the RNA molecule, RNA-LNP and / or immunogenic composition is administered by intradermal or intramuscular injection.

[0045] One embodiment of the present invention provides an Escherichia coli (E. coli) vaccine comprising at least one ribonucleic acid polynucleotide having an open reading frame encoding at least one FimH antigen polypeptide (RNA) or an immunogenic fragment thereof, formulated in a lipid nanoparticle.

[0046] In one embodiment of the E. coli vaccine, the RNA further comprises a 5' cap analog. In a preferred embodiment, the 5' cap analog comprises m7G(5')ppp(5')(2'OMeA)pG.

[0047] In another embodiment of the E. coli vaccine, the RNA further comprises modified nucleotides.

[0048] In another embodiment of the E. coli vaccine, the at least one antigenic polypeptide is FimH-DSG (SEQ ID NO: 59), a FimH-DSG triple mutant (G15A, G16A, V27A) (SEQ ID NO: 62), a FimHLD triple mutant (G15A, G16A, V27A) (SEQ ID NO: 54), an immunogenic fragment thereof, or a combination of any two or more of the above.

[0049] In another embodiment of the E. coli vaccine, the vaccine comprises: a) at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding FimH-DSG (SEQ ID NO: 59); b) at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a FimH-DSG triple mutant (G15A, G16A, V27A) (SEQ ID NO: 62); or c) at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a FimHLD triple mutant (G15A, G16A, V27A) (SEQ ID NO: 54).

[0050] In another embodiment of the E. coli vaccine, the RNA encodes FimH fused to a C-terminal membrane targeting domain.

[0051] In another embodiment of the E. coli vaccine, the RNA encodes FimH fused to a C-terminal membrane targeting domain, and they are separated by a linker. In a preferred embodiment of the E. coli vaccine, the encoded linker has the amino acid sequence GGSSGGG (SEQ ID NO:74).

[0052] In another embodiment of the E. coli vaccine, the C-terminal membrane targeting domain is derived from a viral glycoprotein. In another embodiment of the E. coli vaccine, the membrane targeting sequence is derived from HSV gD, SARS-CoV2 spike protein, or human DAF protein GPI sequence, or a synthetic GPI sequence.

[0053] In another embodiment of the E. coli vaccine, FimH is secreted and does not have a C-terminal membrane targeting domain.

[0054] In another embodiment of the E. coli vaccine, the open reading frame encoded by the RNA is codon optimized.

[0055] In another embodiment of the E. coli vaccine, the vaccine further comprises a cationic lipid.

[0056] In another embodiment of the E. coli vaccine, the vaccine comprises lipid nanoparticles that include RNA molecules.

[0057] In another embodiment of the E. coli vaccine, the vaccine comprises: a) lipid nanoparticles comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding FimH-DSG; b) lipid nanoparticles comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding the FimH-DSG triple mutant (G15A, G16A, V27A); or c) at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding the FimHLD triple mutant (G15A, G16A, V27A) (SEQ ID NO: 54).

[0058] In another embodiment of the E. coli vaccine, the lipid nanoparticle size is at least 40 nm. In another embodiment of the E. coli vaccine, the lipid nanoparticle size is at most 180 nm.

[0059] In another embodiment of the E. coli vaccine, at least 80% of the total RNA in the composition is encapsulated.

[0060] In another embodiment of the E. coli vaccine, the vaccine comprises ALC-0315 (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate).

[0061] In another embodiment of the E. coli vaccine, the vaccine comprises ALC-0159 (2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide).

[0062] In another embodiment of the E. coli vaccine, the vaccine comprises 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0063] In another embodiment of the E. coli vaccine, the RNA polynucleotide comprises a 5' cap, a 5' UTR, a 3' UTR, and a poly A tail.

[0064] In another embodiment of the E. coli vaccine, the 5'UTR comprises the sequence GAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACC (SEQ ID NO: 77).

[0065] In another embodiment of the E. coli vaccine, the 5'UTR comprises the sequence GAAUAAACUAGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC (SEQ ID NO: 75).

[0066] In another embodiment of the E. coli vaccine, the 3'UTR comprises the sequence CΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGACCΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCACΨCACCACCΨCΨGCΨAGΨΨCCAGACA CCΨCCCAAGCACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACACCCΨGGAGCΨAGC (SEQ ID NO: 78).

[0067] In another embodiment of the E. coli vaccine, the 3'UTR comprises the sequence CUCGAGCUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACCCUGGAGCUAGC (SEQ ID NO: 76).

[0068] In another embodiment of the E. coli vaccine, Ψ is 1-methyl-3'-pseudouridylyl.

[0069] In another embodiment of the E. coli vaccine, the polyA tail is 80 nucleotides in length.

[0070] In another embodiment of the E. coli vaccine, the FimH polypeptide comprises serine substitutions at positions N228 and N235.

[0071] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "for example") provided herein is intended merely to further illustrate the present disclosure and does not impose limitations on the scope of the claims. No language in this specification should be construed as indicating any non-claimed element essential to the practice of the present disclosure.

[0072] Several documents are referenced throughout the text of this disclosure. Each of the documents referenced herein (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, is incorporated herein by reference in its entirety. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such disclosure.

[0073] It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the present disclosure, and vice versa. Furthermore, a composition of the present disclosure can be used to achieve a method of the present disclosure.

[0074] Other objects, features, and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating particular embodiments of the present disclosure, are given by way of illustration only, and that various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description. [Brief explanation of the drawings]

[0075] [Figure 1] Figure 1 describes the FimH mRNA construct. Legend: SP, mouse IgG kappa signal peptide; FimHLD, FimH lectin domain; TMD, transmembrane domain; gpi, glycosylphosphatidylinositol anchor. Indicates FimH amino acid substitutions introduced to prevent N-glycosylation (N7S, N70S, N228S, and N235S) or stabilize conformation (G15A, G16A, V27A, or triple mutant "TM"); G, stabilizing donor chain peptide added to the C-terminus of the full-length FimH protein. [Figure 2]Figure 2 lists the FimH gene and protein sequences for the following constructs: FimHLDTMCt60HSVgD (SEQ ID NO:66 and SEQ ID NO:67); FimHLDTMCtΔ5Spike (SEQ ID NO:68 and SEQ ID NO:69); FimHLDTMCtDAFgpI (SEQ ID NO:70 and SEQ ID NO:71); and secreted FimHDSG-TM (N-deglycosylated) (SEQ ID NO:72 and SEQ ID NO:73). Legend: Mouse IgK signal peptide is in italics; interdomain linker is underlined; asterisk is stop codon. [Figure 3] Figure 3 depicts immunofluorescence microscopy imaging of FimH surface expression in HeLa cells. Representative confocal microscopy images of FimH expressed in HeLa cells 24 h after transfection with 50 ng of the indicated mRNA construct. FimH was stained with a monoclonal antibody that recognizes an epitope overlapping the mannoside ligand-binding site. Only nuclear staining (using DAPI) was observed in mock-transfected cells or cells transfected with mRNA encoding the secreted form of FimH-DSG; little or no FimH expression was observed. The percentages of cells showing FimH surface staining using mRNA encoding the HSVgD chimera, SARS-COV2ΔCtD5 chimera, and DAF-GPI chimera were 36% (8 / 20), 12% (3 / 24), and 82% (18 / 22), respectively. [Figure 4] Figures 4A and 4B depict FimH expression in transfected HeLa cells. Quantitative analysis of FimH expression in fixed / permeabilized HeLa cells (total FimH) (Figure 4A) compared to fixed cells (surface FimH) (Figure 4B). Signal was quantified from individual microplate wells using the Opera confocal microscope platform and Harmony® image analysis software. "MFI" = mean fluorescence intensity. [Figure 5]Figures 5A and 5B show the expression of FimH mRNA in Expi293 cells by flow cytometry using the same monoclonal antibody used for immunofluorescence microscopy. FimH expression was detected in permeabilized cells (total FimH; Figure 5A) and non-permeabilized Expi293 cells (surface FimH only; Figure 5B). Cell viability was greater than 90% for all mRNA constructs at all transfected concentrations. The baseline MFI for mock-transfected controls for total- or surface-stained cells is shown as a dotted line (values ​​of 938 and 222, respectively). "MFI" = mean fluorescence intensity. [Figure 6] Figure 6 depicts the titer of secreted FimH-DSG-TM in the supernatant of transfected Expi293 cells. The level of secreted his-tagged FimH antigen was detected in the cell culture supernatant by Octet Biolayer Interferometry. [Figure 7] FIG. 7 describes the flow cytometry gating strategy in Example 2. [Figure 8] Figures 8A and 8B depict total and surface FimH expression in transfected hSkMCs, showing quantitative analysis of FimH expression in fixed / permeabilized primary human skeletal muscle cells (hSkMCs) (Figure 8A, total FimH) compared to fixed cells (Figure 8B, surface FimH). The percentage of cells staining positive for FimH antigen expression was determined for each amount of mRNA 24 hours after transfection with the indicated LNPs. Signal was quantified from individual microplate wells using the Opera confocal microscope platform and Harmony® image analysis software. The method is based on the procedure described in Example 1 for HeLa cell transfection. [Figure 9A]Figure 9A depicts FimH IgG dLIA titers, showing neutralizing antibody titers at PD1 and PD2 time points after immunization of mice. Figure 9A shows anti-FimH IgG at week 3 (PD1). Responses to 1 μg or 10 μg of FimHDSG antigen mRNA LNP were significantly greater than responses to FimHDSG protein antigen with LinA-2 adjuvant (****, p<0.0001; ***, p<0.001; **, p<0.01). The LLOQ, lower limit of quantitation (0.61 μg / mL), was calculated from the standard curve bias. R, responder threshold, was defined as a FimH IgG serum titer greater than 5-fold (3.05 μg / mL) above the LLOQ. [Figure 9B] Figure 9B depicts FimH IgG dLIA titers, showing neutralizing antibody titers at PD1 and PD2 time points after immunization of mice. Figure 9B shows anti-FimH IgG at week 6 (PD2). Responses to 1 μg or 10 μg of FimHDSG antigen mRNA LNP were significantly greater than responses to FimHDSG protein antigen with LinA-2 adjuvant (****, p<0.0001; ***, p<0.001; **, p<0.01). The LLOQ, lower limit of quantitation (0.61 μg / mL), was calculated from the standard curve bias. R, responder threshold, was defined as a FimH IgG serum titer greater than 5-fold (3.05 μg / mL) above the LLOQ. [Figure 10] Figure 10 shows the FimH neutralizing antibody titers at PD1, PD2, and PD3. The response to 1 μg of FimHDSG antigen mRNA LNP at PD2 or PD3 was significantly greater than the response to FimHDSG protein antigen adjuvanted with LiNA-2 (***, p<0.0001). FimHDSG protein antigen was initially administered at 10 μg, followed by two 5 μg booster doses. [Figure 11]Figure 11 depicts representative flow cytometry dot plots illustrating the T cell gating strategy (top row) and antigen-specific stimulation of individual cytokines or surface markers associated with the Th1 or Th2 pathway ("FimH stim" vs. "DMSO"). The data in the plots show that FimH peptide stimulation results in the detection of cytokine-producing FimH-specific CD4+ and CD8+ T cells after immunization. "FimH stim" means stimulated with a FimH (peptide) library. [Figure 12] FIG. 12 depicts that modRNA constructs induce stronger CD8+ T cell responses compared to protein subunits + LiNA-2, especially at higher concentrations. [Figure 13A] FIG. 13A depicts that vaccination with membrane-associated modRNA constructs resulted in increased frequencies of FimH-specific Th1-biased CD4+ T cells compared to FimHDSG (secreted) modRNA and protein subunits + LiNA2. [Figure 13B] FIG. 13B depicts that vaccination with membrane-associated modRNA constructs resulted in increased frequencies of FimH-specific Th1-biased CD4+ T cells compared to FimHDSG (secreted) modRNA and protein subunits + LiNA2. [Figure 13C] FIG. 13C depicts that vaccination with membrane-associated modRNA constructs resulted in increased frequencies of FimH-specific Th1-biased CD4+ T cells compared to FimHDSG (secreted) modRNA and protein subunits + LiNA2. [Figure 13D] 13D depicts that vaccination with membrane-associated modRNA constructs resulted in increased frequencies of FimH-specific Th1-biased CD4+ T cells compared to FimHDSG (secreted) modRNA and protein subunits + LiNA2. [Figure 14A]FIG. 14A depicts that all vaccinations resulted in low Th2 and Th17 cytokine-producing FimH-specific CD4 T cells after three doses. [Figure 14B] FIG. 14B depicts that all vaccinations resulted in low Th2 and Th17 cytokine-producing FimH-specific CD4 T cells after three doses. [Figure 14C] FIG. 14C depicts that all vaccinations resulted in low Th2 and Th17 cytokine-producing FimH-specific CD4 T cells after three doses. DETAILED DESCRIPTION OF THE INVENTION

[0076] Sequence Identifier SEQ ID NO: 1 is the wild-type E. coli FimH LD The amino acid sequence of (FimHLD_WT) is shown below.

[0077] SEQ ID NO: 2 sets forth the amino acid sequence of mutant E. coli FimHLD_G65A_V27A.

[0078] SEQ ID NO: 3 sets forth the amino acid sequence of mutant E. coli FimHLD_F1I.

[0079] SEQ ID NO: 4 sets forth the amino acid sequence of mutant E. coli FimHLD_F1L.

[0080] SEQ ID NO: 5 sets forth the amino acid sequence of mutant E. coli FimHLD_F1V.

[0081] SEQ ID NO: 6 sets forth the amino acid sequence of mutant E. coli FimHLD_F1M.

[0082] SEQ ID NO: 7 sets forth the amino acid sequence of mutant E. coli FimHLD_F1Y.

[0083] SEQ ID NO: 8 sets forth the amino acid sequence of mutant E. coli FimHLD_F1W.

[0084] SEQ ID NO: 9 sets forth the amino acid sequence of mutant E. coli FimHLD_Q133K.

[0085] SEQ ID NO: 10 sets forth the amino acid sequence of mutant E. coli FimHLD_G15A.

[0086] SEQ ID NO: 11 sets forth the amino acid sequence of mutant E. coli FimHLD_G15P.

[0087] SEQ ID NO: 12 sets forth the amino acid sequence of mutant E. coli FimHLD_G16A.

[0088] SEQ ID NO: 13 sets forth the amino acid sequence of mutant E. coli FimHLD_G16P.

[0089] SEQ ID NO: 14 sets forth the amino acid sequence of mutant E. coli FimHLD_G15A_G16A.

[0090] SEQ ID NO: 15 sets forth the amino acid sequence of mutant E. coli FimHLD_R60P.

[0091] SEQ ID NO: 16 sets forth the amino acid sequence of mutant E. coli FimHLD_G65A.

[0092] SEQ ID NO: 17 sets forth the amino acid sequence of mutant E. coli FimHLD_P12C_A18C.

[0093] SEQ ID NO: 18 sets forth the amino acid sequence of mutant E. coli FimHLD_G14C_F144C.

[0094] SEQ ID NO: 19 sets forth the amino acid sequence of mutant E. coli FimHLD_P26C_V35C.

[0095] SEQ ID NO: 20 sets forth the amino acid sequence of mutant E. coli FimHLD_P26C_V154C.

[0096] SEQ ID NO: 21 sets forth the amino acid sequence of mutant E. coli FimHLD_P26C_V156C.

[0097] SEQ ID NO: 22 sets forth the amino acid sequence of mutant E. coli FimHLD_V27C_L34C.

[0098] SEQ ID NO: 23 sets forth the amino acid sequence of mutant E. coli FimHLD_V28C_N33C.

[0099] SEQ ID NO: 24 sets forth the amino acid sequence of mutant E. coli FimHLD_V28C_P157C.

[0100] SEQ ID NO: 25 sets forth the amino acid sequence of mutant E. coli FimHLD_Q32C_Y108C.

[0101] SEQ ID NO: 26 sets forth the amino acid sequence of mutant E. coli FimHLD_N33C_L109C.

[0102] SEQ ID NO: 27 sets forth the amino acid sequence of mutant E. coli FimHLD_N33C_P157C.

[0103] SEQ ID NO: 28 sets forth the amino acid sequence of mutant E. coli FimHLD_V35C_L107C.

[0104] SEQ ID NO: 29 sets forth the amino acid sequence of mutant E. coli FimHLD_V35C_L109C.

[0105] SEQ ID NO: 30 sets forth the amino acid sequence of mutant E. coli FimHLD_S62C_T86C.

[0106] SEQ ID NO: 31 sets forth the amino acid sequence of mutant E. coli FimHLD_S62C_L129C.

[0107] SEQ ID NO: 32 sets forth the amino acid sequence of mutant E. coli FimHLD_Y64C_L68C.

[0108] SEQ ID NO: 33 sets forth the amino acid sequence of mutant E. coli FimHLD_Y64C_A127C.

[0109] SEQ ID NO: 34 sets forth the amino acid sequence of mutant E. coli FimHLD_L68C_F71C.

[0110] SEQ ID NO: 35 sets forth the amino acid sequence of mutant E. coli FimHLD_V112C_T158C.

[0111] SEQ ID NO: 36 sets forth the amino acid sequence of mutant E. coli FimHLD_S113C_G116C.

[0112] SEQ ID NO: 37 sets forth the amino acid sequence of mutant E. coli FimHLD_S113C_T158C.

[0113] SEQ ID NO: 38 sets forth the amino acid sequence of mutant E. coli FimHLD_V118C_V156C.

[0114] SEQ ID NO: 39 sets forth the amino acid sequence of mutant E. coli FimHLD_A119C_V155C.

[0115] SEQ ID NO: 40 sets forth the amino acid sequence of mutant E. coli FimHLD_L34N_V27A.

[0116] SEQ ID NO: 41 sets forth the amino acid sequence of mutant E. coli FimHLD_L34S_V27A.

[0117] SEQ ID NO: 42 sets forth the amino acid sequence of mutant E. coli FimHLD_L34T_V27A.

[0118] SEQ ID NO: 43 sets forth the amino acid sequence of mutant E. coli FimHLD_A119N_V27A.

[0119] SEQ ID NO: 44 sets forth the amino acid sequence of mutant E. coli FimHLD_A119S_V27A.

[0120] SEQ ID NO: 45 sets forth the amino acid sequence of mutant E. coli FimHLD_A119T_V27A.

[0121] SEQ ID NO: 46 sets forth the amino acid sequence of mutant E. coli FimH-DSG_A115V.

[0122] SEQ ID NO: 47 sets forth the amino acid sequence of mutant E. coli FimH-DSG_V163I.

[0123] SEQ ID NO: 48 sets forth the amino acid sequence of mutant E. coli FimH-DSG_V185I.

[0124] SEQ ID NO: 49 sets forth the amino acid sequence of mutant E. coli FimH-DSG_DSG_V3I.

[0125] SEQ ID NO: 50 sets forth the amino acid sequence of mutant E. coli FimHLD_G15A_V27A.

[0126] SEQ ID NO: 51 sets forth the amino acid sequence of mutant E. coli FimHLD_G16A_V27A.

[0127] SEQ ID NO: 52 sets forth the amino acid sequence of mutant E. coli FimHLD_G15P_V27A.

[0128] SEQ ID NO: 53 sets forth the amino acid sequence of mutant E. coli FimHLD_G16P_V27A.

[0129] SEQ ID NO: 54 sets forth the amino acid sequence of mutant E. coli FimHLD_G15A_G16A_V27A.

[0130] SEQ ID NO: 55 sets forth the amino acid sequence of mutant E. coli FimHLD_V27A_R60P.

[0131] SEQ ID NO: 56 sets forth the amino acid sequence of mutant E. coli FimHLD_G65A_V27A.

[0132] SEQ ID NO: 57 sets forth the amino acid sequence of mutant E. coli FimHLD_V27A_Q133K.

[0133] SEQ ID NO: 58 sets forth the amino acid sequence of mutant E. coli FimHLD_G15A_G16A_V27A_Q133K.

[0134] SEQ ID NO: 59 sets forth the amino acid sequence of wild-type E. coli full-length FimH (FimH-DSG_WT), including the donor strand FimG peptide connected through a linker.

[0135] SEQ ID NO: 60 sets forth the amino acid sequence of mutant E. coli FimH-DSG_V27A.

[0136] SEQ ID NO: 61 sets forth the amino acid sequence of mutant E. coli FimH-DSG_G15A_V27A.

[0137] SEQ ID NO: 62 sets forth the amino acid sequence of mutant E. coli FimH DSG_G15A_G16A_V27A.

[0138] SEQ ID NO: 63 sets forth the amino acid sequence of mutant E. coli FimH DSG_V27A_Q133K.

[0139] SEQ ID NO: 64 sets forth the amino acid sequence of mutant E. coli FimH DSG_G15A_G16A_V27A_Q133K.

[0140] SEQ ID NO: 65 sets forth the amino acid sequence of the mouse Ig kappa signal peptide sequence.

[0141] SEQ ID NO: 66 is chimeric FimH LD The nucleic acid sequence of TMCt60HSVgD is set forth.

[0142] SEQ ID NO: 67 is chimeric FimH LD The amino acid sequence of TMCt60HSVgD is shown below.

[0143] SEQ ID NO: 68 is chimeric FimH LD The nucleic acid sequence of TMCtΔ5Spike is set forth below.

[0144] SEQ ID NO: 69 is chimeric FimH LD The amino acid sequence of TMCtΔ5Spike is shown below.

[0145] SEQ ID NO: 70 is chimeric FimH LD The nucleic acid sequence of TMCtDAFgpi is set forth below.

[0146] SEQ ID NO: 71 is chimeric FimH LD The amino acid sequence of TMCtDAFgpi is shown below.

[0147] SEQ ID NO: 72 sets forth the nucleic acid sequence of secreted FimH-DSG-TM (N-deglycosylated).

[0148] SEQ ID NO: 73 sets forth the amino acid sequence of secreted FimH-DSG-TM (N-deglycosylated).

[0149] SEQ ID NO: 74 sets forth the amino acid sequence of the 7 amino acid linker.

[0150] SEQ ID NO: 75 sets forth the nucleic acid sequence of the 5'UTR.

[0151] SEQ ID NO: 76 sets forth the nucleic acid sequence of the 3'UTR.

[0152] SEQ ID NO:77 sets forth the modified nucleic acid sequence of the 5'UTR set forth in SEQ ID NO:75.

[0153] SEQ ID NO:78 sets forth the modified nucleic acid sequence of the 5'UTR set forth in SEQ ID NO:76.

[0154] SEQ ID NO: 79 sets forth the amino acid sequence of the SARS-CoV2 spike protein [UniprotKB:P0DTC2].

[0155] SEQ ID NO: 80 sets forth the amino acid sequence of the C-terminal amino acids that constitute the ER retention motif of the SARS-CoV2 spike protein [UniprotKB:P0DTC2].

[0156] SEQ ID NO: 81 sets forth the amino acid sequence of the conserved charged region of the C-terminal cytoplasmic tail of the SARS-CoV2 spike protein [UniprotKB:P0DTC2].

[0157] SEQ ID NO: 82 sets forth the nucleic acid sequence of chimeric FimHLDTMCt60HSVgD.

[0158] SEQ ID NO: 83 sets forth the nucleic acid sequence of the chimeric FimHLDTMCtΔ5Spike.

[0159] SEQ ID NO: 84 sets forth the nucleic acid sequence of the chimera FimHLDTMCtDAFgpi.

[0160] SEQ ID NO: 85 sets forth the nucleic acid sequence of secreted FimH-DSG-TM (N-deglycosylated).

[0161] SEQ ID NO: 86 sets forth the nucleic acid sequence of the 80A polyA tail.

[0162] Detailed Description of the Invention The present invention can be more readily understood by referring to the following detailed description of the embodiments of the present invention and the examples contained herein. It should be understood that the present invention is not limited to specific manufacturing methods, which may, of course, vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting.

[0163] Exemplary embodiments (E) of the invention provided herein include:

[0164] E1. A ribonucleic acid polynucleotide (RNA) molecule comprising at least one open reading frame (ORF) encoding a FimH antigen polypeptide.

[0165] E2. The RNA molecule of paragraph E1, wherein the FimH antigen polypeptide is full-length, truncated, fragment, or variant thereof.

[0166] E3. The RNA molecule of any one of paragraphs E1-E2, wherein the FimH antigen polypeptide comprises at least one mutation.

[0167] E4. The RNA molecule of any one of paragraphs E1-E3, wherein the FimH antigen polypeptide comprises an amino acid of Table 13, including but not limited to any of SEQ ID NOs: 1-64.

[0168] E5. The RNA molecule of any one of paragraphs E1-E4, wherein the FimH antigen polypeptide comprises FimH-DSG (SEQ ID NO: 59), a FimH-DSG triple mutant (G15A, G16A, V27A) (SEQ ID NO: 62), a FimHLD triple mutant (G15A, G16A, V27A) (SEQ ID NO: 54), or an immunogenic fragment thereof.

[0169] E6. The RNA molecule of any one of paragraphs E1-E5, wherein the FimH polypeptide has at least 90%, 95%, 96%, 97%, 98%, or 99% identity to an amino acid sequence selected from SEQ ID NOs: 1-64.

[0170] E7. The RNA molecule of any one of paragraphs E1-E6, wherein the RNA is fused to a C-terminal membrane targeting domain.

[0171] E8. The RNA molecule of paragraph E7, wherein the RNA molecule and the C-terminal membrane targeting domain are separated by a linker.

[0172] E9. The RNA molecule of item E8, wherein the linker has the amino acid sequence GGSSGGG (SEQ ID NO: 74).

[0173] E10. The RNA molecule of any of paragraphs E7-E9, wherein the C-terminal membrane targeting domain is derived from a viral glycoprotein.

[0174] E11. The RNA molecule of item E10, wherein the viral glycoprotein is selected from the group consisting of HSV gD, SARS-CoV2 spike protein, and human DAFgpi.

[0175] E12. The RNA molecule of paragraph E9, wherein the C-terminal membrane targeting domain is an E. coli G peptide.

[0176] E13. The RNA molecule of any of paragraphs E1-E12, wherein the open reading frame is codon-optimized.

[0177] E14. The RNA molecule of item E11, wherein the FimH antigen polypeptide comprises an amino acid sequence of Table 1, including but not limited to any of SEQ ID NO: 82, SEQ ID NO: 83, and SEQ ID NO: 84.

[0178] E15. The RNA molecule of item E14, wherein the FimH antigen polypeptide comprises an amino acid sequence having SEQ ID NO: 84.

[0179] E16. The RNA molecule of item E12, wherein the FimH antigen polypeptide comprises an amino acid sequence having SEQ ID NO: 85.

[0180] E17. The RNA molecule of any one of items E1-E16, wherein the open reading frame is transcribed from a nucleic acid sequence in Table 2, including but not limited to any of SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, or SEQ ID NO: 72.

[0181] E18. The RNA molecule of any one of items E1-E17, wherein the open reading frame comprises a nucleic acid sequence of Table 3, including but not limited to any of SEQ ID NOs: 82-85.

[0182] E19. The RNA molecule of item E18, wherein each uridine of any of SEQ ID NOs: 82-85 is replaced by 1-methyl-3'-pseudouridylyl (Ψ).

[0183] E20. The RNA molecule of any one of paragraphs E1 to E19, further comprising a 5' untranslated region (5'UTR).

[0184] E21. The RNA molecule of item E21, wherein the 5'UTR comprises nucleotides having SEQ ID NO: 75.

[0185] E22. The RNA molecule of any one of paragraphs E1-E21, further comprising a 3' untranslated region (3'UTR).

[0186] E23. The RNA molecule of item E22, wherein the 3'UTR comprises nucleotides having SEQ ID NO: 76.

[0187] E24. The RNA molecule of any one of paragraphs E1 to E23, comprising a 5' cap portion.

[0188] E25. The RNA molecule of item E24, wherein the 5' cap portion is m7G(5')ppp(5')(2'OMeA)pG.

[0189] E26. The RNA molecule of any one of paragraphs E1 to E25, further comprising a 3' polyA tail.

[0190] E27. The RNA molecule of item E26, wherein the polyA tail comprises a sequence having SEQ ID NO: 86.

[0191] E28. The RNA molecule of any one of paragraphs E1-E27, comprising a 5'UTR and a 3'UTR.

[0192] E29. The RNA molecule of any one of paragraphs E1-E28, comprising a 5' cap, a 5' UTR, and a 3' UTR.

[0193] E30. The RNA molecule of any one of paragraphs E1-E29, comprising a 5' cap, a 5' UTR, a 3' UTR, and a polyA tail.

[0194] E31. The RNA molecule of any of paragraphs E1-E30, comprising a stabilized RNA.

[0195] E32. The RNA molecule of any one of paragraphs E1-E31, wherein the RNA comprises at least one modified nucleotide.

[0196] E33. The RNA molecule of item E32, wherein the modified nucleotide is pseudouridine, 1-methyl-3'-pseudouridyl, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, or 5-methoxyuridine or 2'-O-methyluridine.

[0197] E34. The RNA molecule of item E33, wherein the modified nucleotide is 1-methyl-3'-pseudouridylyl (Ψ).

[0198] E35. The RNA molecule of any one of paragraphs E1-E25, wherein the RNA is mRNA.

[0199] E36. A composition comprising an RNA molecule according to any one of paragraphs E1 to E35, wherein the RNA molecule is formulated in lipid nanoparticles (RNA-LNP).

[0200] E37. The composition of item E36, wherein the lipid nanoparticles comprise at least one of a cationic lipid, a PEG lipid, a neutral lipid, and a steroid or steroid analog.

[0201] E38. The composition of item E36 or E37, wherein the lipid nanoparticles comprise a cationic lipid.

[0202] E39. The composition according to item E38, wherein the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

[0203] E40. The composition of any one of paragraphs E36-E39, wherein the lipid nanoparticles comprise PEG-lipids.

[0204] E41. The PEG lipid is a glycol lipid including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG; PEG-DAG, for example, 1-(mono- The composition according to item E40, which is methoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), PEGylated ceramide (PEG-cer), or PEG dialkoxypropyl carbamate, such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate.

[0205] E42. The composition of item E40 or E41, wherein the PEG lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

[0206] E43. The composition of any one of paragraphs E36-E42, wherein the lipid nanoparticles comprise a neutral lipid.

[0207] E44. Neutral lipids are distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), and dioleoyl-phosphatidylethanolamine 4-(N-maleimide). The composition of item E43, wherein the 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (transDOPE) is 1,2-diphenylphosphatidyl-sn-glycero-3-phosphoethanolamine (transDOPE), ...

[0208] E45. The composition of item E43 or E44, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

[0209] E46. The composition of any one of paragraphs E36-E45, wherein the lipid nanoparticles comprise a steroid or steroid analog.

[0210] E47. The composition of item E46, wherein the steroid or steroid analog is cholesterol.

[0211] E48. The composition according to any one of paragraphs E36 to E47, wherein the lipid nanoparticles have an average diameter of about 1 to about 500 nm.

[0212] E49. The composition of any one of paragraphs E36 to E48, which is a vaccine.

[0213] E50. The composition of any one of paragraphs E36-E49, wherein the lipid nanoparticle size is at least 40 nm.

[0214] E51. The composition of any one of paragraphs E36-E49, wherein the lipid nanoparticle size is at most 180 nm.

[0215] E52. A method for (i) inducing an immune response to extraintestinal pathogenic Escherichia coli (E. coli) in a subject, or (ii) inducing the production of opsonizing, phagocytic, and / or neutralizing antibodies specific to extraintestinal pathogenic Escherichia coli (E. coli) in a subject, comprising administering to the subject an effective amount of an RNA molecule, RNA-LNP, and / or vaccine described in any one of paragraphs E1-E51.

[0216] E53. The method of item E52, wherein the subject is at risk of developing a urinary tract infection.

[0217] E54. The method of item E52, wherein the subject is at risk of developing bacteremia.

[0218] E55. The method of item E52, wherein the subject is at risk of developing urosepsis.

[0219] E56. The method of item E52, wherein the subject is at risk of developing cystitis.

[0220] E57. Use of the RNA molecule, RNA-LNP and / or composition of any one of paragraphs E1-E56 in the production of a medicament for use in (i) inducing an immune response to extraintestinal pathogenic Escherichia coli (E. coli) in a subject, or (ii) inducing the production of opsonizing phagocytic and / or neutralizing antibodies specific to extraintestinal pathogenic Escherichia coli (E. coli) in a subject.

[0221] E58. The use according to item E57, wherein the infection, disease or condition is a urinary tract infection.

[0222] E59. The use of item E57, wherein the subject is at risk of developing bacteremia.

[0223] E60. The use according to item E57, wherein the subject is at risk of developing sepsis.

[0224] E61. The use according to item E57, wherein the subject is at risk of developing cystitis.

[0225] E62. The method or use of any one of paragraphs E52-E61, wherein the subject is less than about 1 year old, about 1 year old or older, about 5 years old or older, about 10 years old or older, about 20 years old or older, about 30 years old or older, about 40 years old or older, about 50 years old or older, about 60 years old or older, about 70 years old or older, or older.

[0226] E63. The method or use according to any one of items E52-E61, wherein the subject is about 50 years of age or older.

[0227] E64. The method or use according to any one of items E52 to E61, wherein the subject is a pregnant woman.

[0228] E65. The method or use according to any one of paragraphs E52-E64, wherein the RNA molecule or composition is administered as a vaccine.

[0229] E66. The method or use according to any one of paragraphs E52-E65, wherein the RNA molecule or composition is administered by intradermal or intramuscular injection.

[0230] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0231] All references referred to herein, including patent applications, patent publications, and UniProtKB accession numbers, are hereby incorporated by reference to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference in its entirety.

[0232] I. Definition Examples Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those skilled in the art.

[0233] Throughout this application, the term "about" is used in accordance with its plain and ordinary meaning within the art of cell and molecular biology to indicate a deviation of ±10% of the value with which it is placed.

[0234] Recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated herein as if it were individually recited herein.

[0235] The use of the words "a" or "an," when used in conjunction with the term "comprise," can mean "one," but is also consistent with the meanings of "one or more," "at least one," and "one or more."

[0236] The phrase "and / or" means "and" or "or." Illustratively, A, B, and / or C includes A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination, or A, B, and C in combination. In other words, "and / or" functions as an inclusive or.

[0237] The phrase "essentially all" is defined as "at least 95%; if essentially all members of a group have a particular property, then at least 95% of the members of the group have that property. In some embodiments, essentially all means that equal to, at least any one of, or between any two of 95, 96, 97, 98, 99, or 100% of the members of the group have that property.

[0238] The compositions and methods for their use may "comprise," "consist essentially of," or "consist" of any of the components or steps disclosed throughout this specification. Throughout this specification, unless the context requires otherwise, the words "comprising" (and any form of comprising, e.g., "comprise" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "includes" and "include"), or "containing" (and any form of containing, e.g., "contains" and "contain") are understood to be inclusive or open-ended, implying the inclusion of the stated step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements. It is contemplated that embodiments described herein in the context of the term "comprising" can also be implemented in the context of the terms "consisting of" or "consisting essentially of." Compositions and methods "consisting essentially of" any of the disclosed components or steps limit the scope of the claim to the specified materials or steps that do not materially affect the basic and novel characteristics of the claimed disclosure. The word "consisting of" (and any forms of "consisting of," such as "consist of" and "consists of") is meant to include and be limited to everything preceding the word "consisting of." Thus, the word "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present.

[0239] References throughout this specification to "one embodiment," "an embodiment," "a particular embodiment," "a related embodiment," "a particular embodiment," "an additional embodiment," or "a further embodiment," or combinations thereof, mean that the particular feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of these phrases in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0240] The terms "inhibit," "reduce," or "reduce" or any variation of these terms includes any measurable decrease (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease) or complete inhibition to achieve the desired result. The terms "enhance," "promote," or "increase," or any variation of these terms, include any measurable increase (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% increase) to achieve a desired result or production of a protein or molecule.

[0241] As used herein, the term " reference ", " standard " or " control " describes the value that is compared to.For example, the agent, subject, population, sample or value of interest is compared with the agent, subject, population, sample or value of interest that is reference, standard or control.Reference, standard or control can be tested and / or determined substantially simultaneously and / or together with the test or determination of the agent, subject, population, sample or value of interest, and / or can be determined or characterized under the same conditions or circumstances as the agent, subject, population, sample or value of interest that is being evaluated.

[0242] The term "isolated" can refer to a nucleic acid or polypeptide that is substantially free from cellular material, bacterial material, viral material, or culture medium (if produced by recombinant DNA technology) from the source of its origin, or from chemical precursors or other chemicals (if chemically synthesized). Furthermore, an isolated compound refers to a compound that can be administered to a subject as an isolated compound; in other words, a compound may not simply be considered "isolated" when attached to a column or embedded in an agarose gel. Furthermore, an "isolated nucleic acid fragment" or "isolated peptide" is a nucleic acid or protein fragment that does not naturally occur as a fragment and / or is not typically in a functional state and / or has been altered or removed from its natural state through human intervention. For example, DNA naturally occurring in a living animal is not "isolated," but synthetic DNA, or DNA partially or completely separated from materials with which it occurs in its natural state, is "isolated." Isolated nucleic acids may exist in a substantially purified form or may exist in a non-native environment, such as in the cells to which the nucleic acid was delivered.

[0243] As used herein, "nucleic acid" refers to a molecule containing a nucleic acid component, and refers to a DNA or RNA molecule. It may be used interchangeably with the term "polynucleotide." A nucleic acid molecule is a polymer containing or consisting of nucleotide monomers covalently linked to each other by sugar / phosphate backbone phosphodiester bonds. Nucleic acids can also include modified nucleic acid molecules, such as DNA or RNA molecules with base, sugar, or backbone modifications. Nucleic acids can exist in various forms, such as isolated segments and integrated sequences encoding one or both chains of a polypeptide, such as an antigen or antibody, or fragments, derivatives, muteins, or variants thereof, or recombinant vectors of recombinant polynucleotides; polynucleotides sufficient for use as hybridization probes, PCR primers, or sequencing primers for identifying, analyzing, mutating, or amplifying polynucleotides encoding polypeptides; polynucleotides described herein above, mRNA, modified RNA, and antisense nucleic acids for inhibiting expression of complementary sequences. The nucleic acid may also encode an epitope to which an antibody can bind.

[0244] The term "epitope" refers to a portion that is specifically recognized by an immunoglobulin (e.g., antibody or receptor) binding entity. In some embodiments, an epitope is composed of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are surface-exposed when the antigen adopts a relevant three-dimensional conformation. In some embodiments, such chemical atoms or groups are physically close to each other in space when the antigen adopts such a conformation. In some embodiments, at least some of such chemical atoms are physically separated from each other when the antigen adopts an alternative conformation (e.g., linearized).

[0245] Nucleic acids may be single-stranded or double-stranded and may comprise RNA and / or DNA nucleotides, as well as artificial variants thereof (e.g., peptide nucleic acids). In some cases, nucleic acid sequences may encode polypeptide sequences with additional heterologous coding sequences, for example, to enable purification, transport, secretion, post-translational modification, or therapeutic benefit, such as targeting or efficacy, of the polypeptide. Tags or other heterologous polypeptides may be added to the modified polypeptide coding sequence, where "heterologous" refers to a polypeptide that is not the same as the modified polypeptide.

[0246] The term "polynucleotide" refers to a nucleic acid molecule that may be recombinant or that has been isolated from total genomic nucleic acid. Recombinant vectors, including oligonucleotides (nucleic acids of 100 residues or fewer) such as plasmids, cosmids, phages, and viruses, are included in the term "polynucleotide." In certain embodiments, polynucleotides contain regulatory sequences that are substantially isolated from their naturally occurring gene or protein-coding sequences. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be RNA, DNA (genomic, cDNA, or synthetic), analogs thereof, or combinations thereof. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide.

[0247] In certain embodiments, polynucleotide variants having substantial identity to the sequences disclosed herein; at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher percent sequence identity compared to the polynucleotide sequences provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). %, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, or at most 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity, or polynucleotide variants comprising a sequence identity between any two of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher sequence identity. In certain embodiments, the isolated polynucleotide comprises a nucleotide sequence encoding a polypeptide having at least 90% identity to the amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence complementary to the isolated polynucleotide. In some embodiments, the isolated polynucleotide comprises a nucleotide sequence that encodes a polypeptide having at least 95% identity to an amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence that is complementary to the isolated polynucleotide.

[0248] Regardless of the length of the coding sequence itself, nucleic acid segments may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, and other coding segments, so that their overall length may vary considerably. Nucleic acids may be of any length. They may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length, or may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length. 0, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, or up to 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length or a length of 5, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides, , 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, and / or may include one or more additional sequences, e.g., regulatory sequences, and / or may be part of a larger nucleic acid, e.g., a vector.It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol.

[0249] In this regard, the term "gene" is used to refer to a nucleic acid (including any sequences required for proper transcription, post-translational modification, or localization) that encodes a protein, polypeptide, or peptide. As will be understood by those skilled in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express, or can be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of a polypeptide may contain a contiguous nucleic acid sequence that encodes all or part of such a polypeptide. It is also envisioned that a particular polypeptide may be encoded by a nucleic acid containing variations having slightly different nucleic acid sequences, but nonetheless encoding the same or a substantially similar polypeptide.

[0250] As used herein, the term "expression" of a nucleic acid sequence refers to the production of any gene product from a nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence involves one or more of the following: (1) the production of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of an RNA transcript (e.g., by splicing, editing, etc.); (3) the translation of the RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0251] Generally, the term "engineered" refers to an aspect that has been manipulated by the hand of man. For example, a polynucleotide is considered to be "engineered" when it has been manipulated by the hand of man so that two or more sequences that are not naturally linked in that order are directly linked to each other in the engineered polynucleotide, and / or when certain residues in the polynucleotide are caused through the action of the hand of man to be linked to entities or moieties that do not occur in nature and / or are not naturally linked.

[0252] The term "DNA," as used herein, refers to a nucleic acid molecule comprising nucleotides, such as deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate monomers, composed of a sugar moiety (deoxyribose), a base moiety, and a phosphate moiety, polymerized with a characteristic backbone structure. The backbone structure is typically formed by a phosphodiester bond between the sugar moiety, e.g., deoxyribose, of a first nucleotide monomer and the phosphate moiety of a second, adjacent monomer. The specific order of the monomers, e.g., the order of the bases linked to the sugar / phosphate backbone, is referred to as the DNA sequence. DNA may be single-stranded or double-stranded. In the double-stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g., by A / T and G / C base pairing. DNA may contain all or mostly deoxyribonucleotide residues. As used herein, the term "deoxyribonucleotide" refers to a nucleotide lacking a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. Without any limitation, DNA may include double-stranded DNA, antisense DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinantly produced DNA, and modified DNA.

[0253] The term "RNA" as used herein refers to a nucleic acid molecule comprising nucleotides, such as adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate monomers, connected to one another along a so-called backbone. The backbone is formed by a phosphodiester bond between the sugar, e.g., ribose, of a first monomer and the phosphate moiety of a second adjacent monomer. RNA may be obtained, for example, by transcription of a DNA sequence inside a cell. In eukaryotic cells, transcription typically occurs inside the nucleus or mitochondria. In vivo, transcription of DNA can result in a premature RNA that is processed into messenger RNA (mRNA). For example, in eukaryotes, premature RNA processing involves various post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. The mature messenger RNA is processed to provide a nucleotide sequence that can be translated into the amino acid sequence of a peptide or protein. Mature mRNA may include a 5' cap, a 5' UTR, an open reading frame, a 3' UTR, and a poly-A tail sequence. The RNA may contain all or most of ribonucleotide residues. As used herein, the term "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. In one embodiment, the RNA may be messenger RNA (mRNA) for an RNA transcript encoding a peptide or protein. As known to those skilled in the art, mRNA generally contains a 5' untranslated region (5' UTR), a polypeptide coding region, and a 3' untranslated region (3' UTR). Without any limitation, RNA may include double-stranded RNA, antisense RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinantly produced RNA, and modified RNA (modRNA).

[0254] "Isolated RNA" is defined as an RNA molecule that may be recombinant or that has been isolated from total genomic nucleic acid. Isolated RNA molecules or proteins may exist in a substantially purified form or may exist in a non-native environment, such as in a host cell.

[0255] "Modified RNA" or "modRNA" refers to an RNA molecule that has at least one addition, deletion, substitution, and / or alteration of one or more nucleotides compared to naturally occurring RNA. Such alterations can refer to the addition of non-nucleotide material to internal RNA nucleotides or to the 5' and / or 3' ends of the RNA. In one embodiment, such modRNA contains at least one modified nucleotide, e.g., a change to the base of a nucleotide. For example, modified nucleotides may replace one or more uridine and / or cytidine nucleotides. For example, these substitutions may occur for every instance of uridine and / or cytidine in the RNA sequence, or may occur only for select uridine and / or cytidine nucleotides. Such alterations to standard nucleotides in the RNA may include non-standard nucleotides, e.g., chemically synthesized nucleotides or deoxynucleotides. For example, at least one uridine nucleotide may be replaced with N1-methylpseudouridine in the RNA sequence. Other such altered nucleotides are known to those skilled in the art. Such altered RNA molecules are considered analogs of naturally occurring RNA. In some embodiments, RNA is produced by in vitro transcription using DNA template, where DNA refers to the nucleic acid that contains deoxyribonucleotides.In some embodiments, RNA can be replicon RNA (replicon), particularly self-replicating RNA, or self-amplifying RNA (saRNA).

[0256] As contemplated herein, without any limitation, RNA may be used as a therapeutic modality for treating and / or preventing numerous conditions in mammals, including humans. The methods described herein include administering the RNA described herein to a mammal, e.g., a human. For example, in one embodiment, the use of such RNA includes an antigen-encoding RNA vaccine to induce robust neutralizing antibodies and concomitant / concomitant T cell responses to achieve protective immunization. In some embodiments, a minimal vaccine dose is administered to induce robust neutralizing antibodies and concomitant / concomitant T cell responses to achieve protective immunization. In one embodiment, the administered RNA is in vitro transcribed RNA. For example, such RNA may be used to encode at least one antigen intended to generate an immune response in the mammal. The pathogenic antigen is a peptide or protein antigen derived from a pathogen associated with an infectious disease. In a specific embodiment, the pathogenic antigen is a peptide or protein antigen derived from E. coli FimH. Conditions and / or diseases that can be treated using the RNA disclosed herein include, but are not limited to, those caused and / or affected by bacterial infection, including, but not limited to, Escherichia coli (E. coli).

[0257] "Prevent" or "prevention," as used herein in the context of the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing a disease, disorder, and / or condition and / or delaying the onset of one or more characteristics or symptoms of a disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is delayed for a predefined period of time.

[0258] As understood from the context, "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is, at least, or at most 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%. In some embodiments, risk is expressed as a risk relative to the risk associated with a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk of the disease, disorder, condition, and / or event. In some embodiments, the reference sample or group of reference samples is from an individual comparable to the particular individual. In some embodiments, risk may reflect one or more genetic attributes, for example, one or more genetic attributes that may predispose an individual to developing (or not developing) a particular disease, disorder, and / or condition. In some embodiments, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes. Susceptibility: An individual who is "susceptible to" a disease, disorder, and / or condition is an individual who has a higher risk of developing the disease, disorder, and / or condition than members of the general public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition develops the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition does not develop the disease, disorder, and / or condition.

[0259] The terms "protein," "polypeptide," or "peptide" are used synonymously herein and refer to a polymer of amino acid monomers, e.g., a molecule comprising at least two amino acid residues. Polypeptides may include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. Polypeptides may be single molecules or multimolecular complexes, such as dimers, trimers, or tetramers. Proteins may comprise one or more peptides or polypeptides and may be folded into a three-dimensional form that may be required for the protein to perform its biological function.

[0260] As used herein, the term "wild-type" or "WT" or "native" refers to the endogenous version of a molecule that occurs naturally in an organism. In some embodiments, wild-type versions of proteins or polypeptides are used, while in other embodiments of the present disclosure, modified proteins or polypeptides are used to generate an immune response. The above terms may be used interchangeably.

[0261] A "modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, has been altered relative to a wild-type protein or polypeptide. In some embodiments, the modified / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide may have multiple activities or functions). It is specifically contemplated that a modified / variant protein or polypeptide may be altered with respect to one activity or function but retain wild-type activity or function in other respects, e.g., immunogenicity. When a protein is specifically referred to herein, it generally refers to a native (wild-type) or recombinant (modified) protein. The protein may be isolated directly from its native organism, produced by recombinant DNA / exogenous expression methods, solid-phase peptide synthesis (SPPS), or other in vitro methods. In certain embodiments, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding a polypeptide (e.g., an antigen or fragment thereof). The term "recombinant" may be used in conjunction with the name of a polypeptide or a specific polypeptide and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or from the replication products of such a molecule.

[0262] The term "fragment", in reference to an amino acid sequence (peptide or protein), refers to a portion of the amino acid sequence, for example, a sequence representing an amino acid sequence truncated at the N-terminus and / or C-terminus. A fragment truncated at the C-terminus (N-terminal fragment) can be obtained, for example, by translating a truncated open reading frame lacking the 3' end of the open reading frame. A fragment truncated at the N-terminus (C-terminal fragment) can be obtained, for example, by translating a truncated open reading frame lacking the 5' end of the open reading frame, as long as the truncated open reading frame contains an initiation codon that serves to initiate translation. A fragment of an amino acid sequence contains, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% of the amino acid residues from the amino acid sequence. In this disclosure, a fragment of a polypeptide, DNA, nucleic acid, or RNA nucleic acid sequence is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, and at most 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, or 99% identical to, the polypeptide, DNA, nucleic acid, or RNA nucleic acid sequence from which it is derived. "A" refers to a sequence having a sequence identity of 96%, 97%, 98%, or 99%, or exactly 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or between any two of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0263] In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 70% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 80% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 85% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 90% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 95% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 97% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 99% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0264] As used herein in the context of molecules, e.g., nucleic acids, proteins, or small molecules, the term "variant" refers to a molecule that exhibits significant structural identity with a reference molecule but structurally differs from the reference molecule, e.g., in the presence or absence or level of one or more chemical moieties compared to the reference entity. In some embodiments, a variant also differs functionally from its reference molecule. Generally, whether a particular molecule is properly considered a "variant" of a reference molecule is based on the degree of structural identity with the reference molecule. As will be understood by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs from the reference molecule in at least one aspect. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently attached to the polypeptide or nucleic acid backbone (e.g., attached to the polypeptide or nucleic acid backbone). In some embodiments, the variant polypeptide or nucleic acid is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, up to 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, or exactly 85% , 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, or between any two of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the variant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid. In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities.In some embodiments, a variant polypeptide or nucleic acid shares one or more biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid exhibits a reduced level of one or more biological activities compared to a reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid of interest is considered a "variant" of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence identical to the reference amino acid or nucleotide sequence except for a small number of sequence changes at specific positions. Preferably, a variant polypeptide or nucleic acid sequence has at least one modification, e.g., 1 to about 20 modifications, compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 10 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 5 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 4 modifications compared to a reference polypeptide or nucleic acid sequence. Typically, less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in the variant are substituted, inserted, or deleted compared to the reference.In many cases, the variant polypeptide or nucleic acid comprises a very small number (e.g., less than about 5, about 4, about 3, about 2, or about 1) of functional residues (e.g., residues participating in a specific biological activity) substituted, inserted, or deleted compared to the reference.In some embodiments, the variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 residue substitution compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and typically less than about 5, about 4, about 3, or about 2 additions or deletions compared to the reference.In some embodiments, the variant polypeptide or nucleic acid contains no more than about 5, about 4, about 3, about 2, or about 1 additions or deletions compared to the reference, and in some embodiments, no additions or deletions.

[0265] In some embodiments, the reference polypeptide or nucleic acid is a "wild-type" or "WT" or "native" sequence found in nature, including allelic variations. A wild-type polypeptide or nucleic acid sequence has a sequence that has not been intentionally modified. For purposes of this disclosure, a "variant" of an amino acid sequence (peptide, protein, or polypeptide) includes an amino acid insertion variant, an amino acid addition variant, an amino acid deletion variant, and / or an amino acid substitution variant. A "variant" of a nucleotide sequence includes a nucleotide insertion variant, a nucleotide addition variant, a nucleotide deletion variant, and / or a nucleotide substitution variant. The term "variant" includes all mutants, splice variants, post-translational modification variants, conformations, isoforms, allelic variants, species variants, and species homologs, particularly those that occur naturally. The term "variant" particularly includes fragments of an amino acid or nucleic acid sequence.

[0266] Changes may be introduced into a nucleic acid by mutation, which may lead to a change in the amino acid sequence of a polypeptide (e.g., an antigen or an antibody or antibody derivative) that the nucleic acid encodes. Mutations may be introduced using any technique known in the art. In one embodiment, one or more specific amino acid residues are changed, for example, using a site-directed mutagenesis protocol. In another embodiment, one or more randomly selected residues are changed, for example, using a random mutagenesis protocol. In some embodiments, however made, the mutant polypeptide may be expressed and screened for desired properties.

[0267] Mutations can be introduced into nucleic acids without significantly altering the biological activity of the polypeptides encoded by the nucleic acids. For example, nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues can be made. Alternatively, one or more mutations that selectively alter the biological activity of the polypeptides encoded by the nucleic acids can be introduced into the nucleic acids. For example, mutations can change the biological activity quantitatively or qualitatively. Examples of quantitative changes include increasing, reducing, or eliminating the activity. Examples of qualitative changes include changing the antigen specificity of an antibody.

[0268] "Sequence similarity" refers to the percentage of amino acids that are identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences refers to the percentage of nucleotides that are identical between the sequences.

[0269] The terms "% identical," "% identity," or similar terms are intended to specifically refer to the percentage of nucleotides or amino acids that are identical in optimal alignment between the compared sequences. The percentage is purely statistical; the differences between the two sequences may, but need not, be randomly distributed over the entire length of the compared sequences. Comparison of two sequences is usually performed by comparing the sequences after optimal alignment over a segment or "window of comparison" to identify local regions of corresponding sequence. The optimal alignment for comparison can be performed manually or with the aid of the local homology algorithm of Smith and Waterman, 1981, Ads App.Math.2, 482, with the aid of the local homology algorithm of Neddleman and Wunsch, 1970, J.Mol.Biol.48, 443, with the aid of the similarity search algorithm of Pearson and Lipman, 1988, Proc.Natl Acad.Sci.USA 88, 2444, or with the aid of a computer program using the above algorithm (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group). In some embodiments, the percent identity of two sequences is determined using the BLASTN or BLASTP algorithm available on the website of the United States National Center for Biotechnology Information (NCBI).

[0270] The percentage identity is obtained by determining the number of corresponding identical positions in the compared sequences, dividing this number by the number of positions being compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100.

[0271] In some embodiments, the degree of similarity or identity is given for at least about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, up to about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, exactly about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, or for a region that is between any two of about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is provided for at least about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, up to about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or exactly about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or between any two of about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, in some embodiments, consecutive nucleotides. In some embodiments, the degree of similarity or identity is provided for the entire length of the reference sequence.

[0272] Homologous amino acid sequences may exhibit at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of amino acid residues, up to 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, or exactly 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, or between any two of 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 95% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 98% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 99% identity of amino acid residues.

[0273] A fragment or variant of an amino acid sequence (peptide or protein) may be a "functional fragment" or "functional variant." The term "functional fragment" or "functional variant" of an amino acid sequence refers to any fragment or variant that exhibits one or more functional properties identical to or similar to one or more functional properties of the amino acid sequence from which it is derived, e.g., functionally equivalent. With respect to an antigen or antigen sequence, one specific function is one or more immunogenic activities exhibited by the amino acid sequence from which the fragment or variant is derived. The term "functional fragment" or "functional variant," as used herein, specifically refers to a variant molecule or sequence that contains an amino acid sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, and still retains one or more functions of the parent molecule or sequence, such as the ability to induce an immune response. In one embodiment, the alteration in the amino acid sequence of the parent molecule or sequence does not significantly affect or alter the characteristics of the molecule or sequence. The terms "mutant" of a wild-type E. coli FimH protein, "mutant" of an E. coli FimH protein, "E. coli FimH protein mutant," or "modified E. coli FimH protein" refer to a polypeptide that exhibits an introduced mutation compared to the wild-type FimH protein and is immunogenic relative to the wild-type FimH protein.

[0274] An amino acid sequence (peptide, protein, or polypeptide) "derived from" a specified amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the first amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence identical to, essentially identical to, or homologous to the particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant of the particular sequence or a fragment thereof. For example, it will be understood by those skilled in the art that antigens suitable for use herein may be altered in sequence to vary from the naturally occurring or native sequence from which they are derived while retaining the desired activity of the native sequence.

[0275] In this disclosure, a vector refers to a nucleic acid molecule, e.g., an artificial nucleic acid molecule. A vector may be used to incorporate a nucleic acid sequence, e.g., a nucleic acid sequence containing an open reading frame. Vectors include, but are not limited to, storage vectors, expression vectors, cloning vectors, and transfer vectors. A vector may be an RNA vector or a DNA vector. In some embodiments, a vector is a DNA molecule. In some embodiments, a vector is a plasmid vector. In some embodiments, a vector is a viral vector. Typically, an expression vector contains a desired coding sequence and appropriate other sequences necessary for expression of an operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in an in vitro expression system. Cloning vectors are generally used to manipulate and amplify a specific desired fragment (typically a DNA fragment) and may lack functional sequences required for expression of the desired fragment.

[0276] As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers.The pharmaceutical composition may be an immunogenic composition.In some embodiments, the active agent is present in a unit dose amount suitable for administration in a treatment regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population.In some embodiments, the pharmaceutical composition may be specially formulated for parenteral administration, for example, as a sterile solution or suspension, or as a sustained-release formulation, for example, by subcutaneous, intramuscular, intravenous or epidural injection.

[0277] As used herein, the term "vaccination" refers to the administration of an immunogenic composition intended to generate an immune response, for example, against a disease-associated (e.g., disease-causing) agent (e.g., a bacterium). In some embodiments, vaccination may be administered before, during, and / or after exposure to the disease-associated agent, and in certain embodiments, before, during, and / or immediately after exposure to the agent. In some embodiments, vaccination involves multiple administrations of a vaccine composition, appropriately spaced in time. In some embodiments, vaccination generates an immune response against an infectious agent. In some embodiments, vaccination generates an immune response against a tumor; in some such embodiments, vaccination is "personalized" in that it is directed, in part or in whole, to epitopes (which may be or include, for example, one or more neoepitopes) determined to be present in a particular individual's tumor.

[0278] Immune response refers to a humoral response, a cellular response, or both humoral and cellular responses in an organism. Immune response may be measured by assays including, but not limited to, assays that measure the presence or amount of antibodies that specifically recognize proteins or cell surface proteins, assays that measure T cell activation or proliferation, and / or assays that measure modulation in terms of activity or expression of one or more cytokines.

[0279] As used herein, the term "combination therapy" refers to a situation in which a subject is exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents) simultaneously. In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered prior to any dose of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, the "administration" of a combination therapy may involve the administration of one or more agents or modalities to a subject receiving other agents or modalities in combination. For clarity, combination therapy does not require that individual agents be administered together (or necessarily simultaneously) in a single composition, although in some embodiments, two or more agents, or active portions thereof, may be administered together in a combination composition or even in a combination compound (e.g., as part of a single chemical complex or covalent entity).

[0280] Those skilled in the art will understand that the term "dosing regimen" can be used to refer to a set of unit doses (typically more than one) that are typically separated by a time period and individually administered to a subject. In some embodiments, a given therapeutic agent has a recommended dosing regimen, and the dosing regimen may involve one or more doses. In some embodiments, the dosing regimen comprises multiple doses, each of which is separated in time from other doses. In some embodiments, the individual doses are separated from each other by the same length of time period; in some embodiments, the dosing regimen comprises multiple doses and at least two different time periods separating the individual doses. In some embodiments, all doses in the dosing regimen are the same unit dose amount. In some embodiments, different doses in the dosing regimen are different amounts. In some embodiments, the dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is different from the amount of the first dose. In some embodiments, the dosing regimen includes a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is the same as the first dose amount. In some embodiments, the dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (e.g., is a therapeutic dosing regimen).

[0281] II. E. coli Fimbrial Antigen H (FimH) As used herein, the term "FimH antigen polypeptide" includes any FimH polypeptide or immunogenic mutant thereof, including, but not limited to, the FimH polypeptides set forth in SEQ ID NOs: 1-64, 67, 69, 71 or 73.

[0282] As used herein, the term "E. coli polypeptide" includes any E. coli polypeptide. In a preferred embodiment, the E. coli polypeptide is a pilus antigen. In a preferred embodiment, the E. coli pilus antigen is FimH.

[0283] FimH antigen polypeptides are described in PCT Publication No. WO 2022 / 137078, which is incorporated herein by reference in its entirety.

[0284] Embodiments of the present disclosure provide an RNA (e.g., mRNA) vaccine comprising a polynucleotide encoding an E. coli FimH antigen. The E. coli FimH RNA vaccine as provided herein may be used to induce a balanced immune response, including both cellular and humoral immunity.

[0285] Some embodiments provide an Escherichia coli (E. coli) vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a FimH protein, formulated in cationic lipid nanoparticles, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the FimH protein is FimH-DSG, a FimH-DSG triple mutant (G15A, G16A, V27A), or a FimH-DSG triple mutant (G15A, G16A, V27A). LD The triple mutant (G15A, G16A, V27A) is selected.

[0286] As used herein, the term "TM," when used in the context of an antigen, refers to a triple mutant, specifically FimH with mutations at amino acid positions G15A, G16A, and V27A. LD or a triple mutant of the FimH-DSG polypeptide. Thus, the terms "FimH-DSG triple mutant (G15A, G16A, V27A)" and "FimH-DSG TM" are interchangeable. Additionally, the term "FimH LD Triple mutant (G15A, G16A, V27A) and FimH LD TM" is interchangeable.

[0287] As used herein, the abbreviation "Ct" refers to the C-terminal domain of a polypeptide or polynucleotide.

[0288] Some embodiments provide methods of preventing or treating Escherichia coli (E. coli) infection, comprising administering to a subject any of the vaccines described herein. In some embodiments, the antigen-specific immune response comprises a T cell response. In some embodiments, the antigen-specific immune response comprises a B cell response. In some embodiments, the antigen-specific immune response comprises both a T cell response and a B cell response. In some embodiments, the method of generating an antigen-specific immune response involves a single administration of the vaccine. In some embodiments, the vaccine is administered to the subject intradermally, intramuscularly, subcutaneously, intranasally, or orally.

[0289] In some embodiments, the RNA (eg, mRNA) polynucleotide or portion thereof may encode one or more polypeptides of E. coli FimH or fragments thereof as antigens.

[0290] III.RNA molecule In some embodiments, the RNA molecule described herein is a coding RNA molecule. Coding RNA includes functional RNA molecules that can be translated into peptides or polypeptides. In some embodiments, coding RNA molecules include at least one open reading frame (ORF) that encodes at least one peptide or polypeptide. Open reading frame includes the sequence of codons that can be translated into peptides or proteins. Coding RNA molecules can include one (monocistronic), two (bicistronic) or more (multicistronic) ORFs, which can be the sequence of codons that can be translated into polypeptides or proteins of interest.

[0291] Numerous mRNA vaccine platforms are available in the prior art. The basic structure of in vitro transcribed (IVT) mRNA closely resembles "mature" eukaryotic mRNA and consists of (i) a protein-coding open reading frame (ORF), flanked by (ii) 5' and 3' untranslated regions (UTRs), and at the terminus, (iii) a 7-methylguanosine 5' cap structure and (iv) a 3' poly(A) tail. Non-coding structural features play an important role in mRNA pharmacology and can be individually optimized to modulate mRNA stability, translation efficiency, and immunogenicity.

[0292] By incorporating modified nucleosides, mRNA transcripts, referred to as "nucleoside-modified mRNA" or "modRNA," can be produced with reduced immunostimulatory activity and therefore may have an improved safety profile. Additionally, modified nucleosides can circumvent the direct antibacterial pathway induced by type IFN and programmed to degrade and inhibit invasive mRNAs, enabling the design of mRNA vaccines with significantly enhanced stability and translational capacity. For example, replacing uridine with pseudouridine in in vitro transcribed (IVT) mRNA reduces the activity of 2'-5'-oligoadenylate synthetase, which regulates mRNA cleavage by RNase L. Additionally, lower activity is measured for protein kinase R, an enzyme associated with inhibition of the mRNA translation process.

[0293] In addition to incorporating modified nucleotides, other approaches have been tested to increase the translational capacity and stability of mRNA.One example is the development of "sequence-engineered mRNA".Here, mRNA expression can be significantly increased by optimizing the sequence of ORF and UTR of mRNA, for example, by enriching GC content, or by selecting UTR of natural long-lived mRNA molecules.

[0294] In addition, several modifications have been implemented in the terminal structure of mRNA. The anti-reverse cap (ARCA) modification can ensure correct cap orientation at the 5' end, resulting in a nearly complete fraction of mRNAs that can efficiently bind to ribosomes. Other cap modifications, such as phosphorothioate cap analogs, can further improve affinity for eukaryotic translation initiation factor 4E and increase resistance to the RNA decapping complex.

[0295] Conversely, by modifying its structure, the efficacy of mRNA in triggering an innate immune response can be further improved, but translational ability is lost. By stabilizing mRNA using a phosphorothioate backbone or by precipitation with the cationic protein protamine, antigen expression can be reduced, but stronger immunostimulatory ability can be obtained.

[0296] In one aspect, the present invention relates to an immunogenic composition comprising an mRNA molecule encoding one or more polypeptides of E. coli FimH or fragments thereof as antigens. In some embodiments, the mRNA molecule comprises a nucleoside-modified mRNA. The RNA molecule may encode one or more polypeptides of interest, such as one or more antigens, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptides. Alternatively, or in addition, one RNA molecule may also encode more than one polypeptide of interest, such as an antigen, and may be, for example, a bicistronic or tricistronic RNA molecule encoding different or identical antigens.

[0297] The sequence of the RNA molecule may be codon-optimized or deoptimized for expression in a desired host, such as a human cell. In some embodiments, the gene of interest (e.g., antigen) described herein is encoded by a coding sequence that is codon-optimized and / or has an increased guanosine / cytidine (G / C) content compared to a wild-type coding sequence. In some embodiments, one or more sequence regions of the coding sequence are codon-optimized and / or have an increased G / C content compared to the corresponding sequence region of a wild-type coding sequence. In some embodiments, codon optimization and / or increased G / C content do not change the sequence of the encoded amino acid sequence.

[0298] The term "codon-optimized" is understood by those skilled in the art to refer to changing the codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without changing the amino acid sequence encoded by the nucleic acid molecule.In the context of the present disclosure, in some embodiments, the coding region is codon-optimized for optimal expression in a subject treated with the RNA polynucleotide described herein.Codon optimization is based on the discovery that translation efficiency is also determined by the different frequencies of tRNA molecules present in cells.Therefore, the sequence of RNA may be modified so that codons that are available for frequently occurring tRNA molecules are inserted instead of "rare codons".

[0299] In some embodiments, the G / C content of the coding region of an RNA (e.g., the sequence of a gene of interest) is increased compared to the G / C content of the corresponding coding sequence of a wild-type RNA encoding the gene of interest, and in some embodiments, the amino acid sequence encoded by the RNA is not modified compared to the amino acid sequence encoded by the wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for the efficient translation of that mRNA. A sequence with an increased G (guanosine) / C (cytidine) content is more stable than a sequence with an increased A (adenosine) / U (uridine) content. In light of the fact that several codons encode the same amino acid (the so-called degeneracy of the genetic code), the most favorable codon for stability can be determined (the so-called alternative codon usage). Depending on the amino acid encoded by the RNA, there are various possibilities for modifying the RNA sequence compared to its wild-type sequence. In particular, codons containing A and / or U nucleosides may be altered by replacing these codons with other codons that encode the same amino acids but that do not contain A and / or U, or that contain a lower content of A and / or U nucleosides. Thus, in some embodiments, the G / C content of the coding region of the RNA described herein is increased by at least 10%, 20%, 30%, 40%, 50%, 55%, up to 10%, 20%, 30%, 40%, 50%, 55%, exactly 10%, 20%, 30%, 40%, 50%, 55%, or between any two of 10%, 20%, 30%, 40%, 50%, 55%, or even higher percentages compared to the G / C content of the coding region of the wild-type RNA.

[0300] In some embodiments, the RNA molecule is from about 20 to about 100,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30-50,000, 30-70,000, 100-250, 100-500, 100-1,000, 100- 1,500, 100-3,000, 100-5,000, 100-7,000, 100-10,000, 100-25,000, 100-50,000, 100-70,000, 100-100,000, 500-1,000, 500-1,500, 500-2,000, 500-3,000, 500-5,000, 500-7,000, 500-10,000, 500-25,000, 500-50,000 , 500~70,000, 500~100,000, 1,000~1,500, 1,000~2,000, 1,000~3,000, 1,000~5,000, 1,000~7,000, 1,000~10,000, 1,000~25,000, 1,000~50,000, 1,000~70,000, 1,000~100,000, 1,500~3,000, 1,500~5,000, 1,500~7,000 0, 1,500–10,000, 1,500–25,000, 1,500–50,000, 1,500–70,000, 1,500–100,000, 2,000–3,000, 2,000–5,000, 2,000–7,000, 2,000–10,000, 2,000–25,000, 2,000–50,000, 2,000–70,000, and 2,000–100,000 nucleotides).

[0301] In some embodiments, the RNA molecule comprises at least 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000 ,7200,7400,7600,7800,8000,8200,8400,8600,8800,9000,9200,9400,9600,9800,10000,10000,12000,14000,16000,18000,20000,22000,24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 6600 0, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000, up to 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 7 20, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400,3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400 , 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000 , 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 7800 0, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000, exactly 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 9 00, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5 000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 1 0000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000,50,000, 52,000, 54,000, 56,000, 58,000, 60,000, 62,000, 64,000, 66,000, 68,000, 70,000, 72,000, 74,000, 76,000, 78,000, 80,000, 82,000, 84,000, 86,000, 88,000, 90,000, 92,000, 94,000, 96,000, 98,000, or 100,000, or about 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320 , 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 440 0, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 3600 The number of nucleotides may be between any two of 0, 38,000, 40,000, 42,000, 44,000, 46,000, 48,000, 50,000, 52,000, 54,000, 56,000, 58,000, 60,000, 62,000, 64,000, 66,000, 68,000, 70,000, 72,000, 74,000, 76,000, 78,000, 80,000, 82,000, 84,000, 86,000, 88,000, 90,000, 92,000, 94,000, 96,000, 98,000, or 100,000.

[0302] In some embodiments, the RNA molecule comprises at least 100 nucleotides. For example, in some embodiments, the RNA has a length of 100 to 15,000 nucleotides; 7,000 to 16,000 nucleotides; 8,000 to 15,000 nucleotides; 9,000 to 12,500 nucleotides; 11,000 to 15,000 nucleotides; 13,000 to 16,000 nucleotides; or 7,000 to 25,000 nucleotides. In some embodiments, the RNA molecule comprises at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 200 0, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 59 50, 6000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900,7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 10100, 10150, 10200, 10250, 10300, 103 50, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11 400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 1 2450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500 , 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, up to 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050,2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300、11350、11400、11450、11500、11550、11600、11650、11700、11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750 , 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 1380 0, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 148 50, 14900, 14950, or 15000 pieces, exactly 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200 , 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450 , 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700 , 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950 , 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150, 6200,6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450 , 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700 , 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950 , 10000, 10050, 10100, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 1100 0, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12 050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 1 3100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, or about 100, 150,200、250、300、350、400、450、500、550、600、650、700、750、800、850、900、950、1000、1050、1100、1150、1200、1250、1300、1350、1400、1450、1500、155、 0、1600、1650、1700、1750、1800、1850、1900、1950、2000、2050、2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, The number of nucleotides may be between any two of 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000.

[0303] An mRNA useful in the present disclosure typically comprises a first region of linked nucleosides encoding a polypeptide of interest (e.g., a coding region), a first flanking region (e.g., a 5'-UTR) located at the 5' end of the first region, a second flanking region (e.g., a 3'-UTR) located at the 3' end of the first region, at least one 5'-cap region, and a 3'-stabilization region. In some embodiments, the mRNA of the present invention further comprises a polyA region or a Kozak sequence (e.g., in the 5'-UTR). In some cases, the mRNA of the present invention may contain one or more intronic nucleotide sequences capable of being excised from the polynucleotide. In some embodiments, the mRNA of the present invention may comprise a 5'-cap structure, a chain-terminating nucleotide, a stem-loop, a polyA sequence, and / or a polyadenylation signal. Any one of the regions of the nucleic acid may comprise one or more alternative components (e.g., alternative nucleosides). For example, the 3' stabilization region may contain alternative nucleosides, such as L-nucleosides, inverted thymidines, or 2'-0-methyl nucleosides, and / or the coding region, 5'-UTR, 3'-UTR, or cap region may include alternative nucleosides, such as 5-substituted uridines (e.g., 5-methoxyuridine), 1-substituted pseudouridines (e.g., 1-methyl-pseudouridine), and / or 5-substituted cytidines (e.g., 5-methyl-cytidine).

[0304] In some embodiments, the RNA disclosed herein comprises, in a 5' to 3' direction, the following components: a 5' cap comprising a 5' cap disclosed herein; a 5' untranslated region (5'UTR) comprising a cap-proximal sequence, a sequence encoding a payload (e.g., an E. coli FimH protein); a 3' untranslated region (3'UTR); and a polyA sequence.

[0305] In some embodiments, LNPs comprise one or more RNAs, and the one or more RNAs, lipids, and amounts thereof may be selected to provide a specific N:P ratio. The N:P ratio of a composition refers to the molar ratio of nitrogen atoms in the one or more lipids to the number of phosphate groups in the RNA. Generally, lower N:P ratios are preferred. The one or more RNAs, lipids, and amounts thereof may be selected to provide an N:P ratio of about 2:1 to about 30:1, e.g., 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In certain embodiments, the N:P ratio may be about 2:1 to about 8:1. In other embodiments, the N:P ratio is about 5:1 to about 8:1. For example, the N:P ratio may be about 5.0:1, about 5.5:1, about 6.0:1, about 6.5:1, or about 7.0:1.

[0306] A. Modified Nucleobases In the present disclosure, RNA molecule can comprise modified nucleoside and modified nucleic acid base that can be incorporated into nucleotide.In some embodiments, RNA molecule can comprise one or more modified nucleotides.Naturally occurring nucleotide modifications are known in the art.

[0307] The mRNA of the present invention may include one or more naturally occurring components that include any of the canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In one embodiment, all or substantially all of the nucleotides comprising (a) the 5'-UTR, (b) the open reading frame (ORF), (c) the 3'-UTR, (d) the poly-A tail, and any combination (of a, b, c, or d above) include the naturally occurring canonical nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).

[0308] The mRNAs of the present invention may contain one or more alternative components described herein that confer useful properties, including increased stability and / or lack of substantial induction of an innate immune response in cells into which the polynucleotide is introduced. For example, the modRNA may exhibit reduced degradation in cells into which the modRNA is introduced, compared to the corresponding unmodified mRNA. These alternative species may enhance the efficiency of protein production, intracellular retention of the polynucleotide, and / or viability of contacted cells, as well as have reduced immunogenicity.

[0309] The mRNA of the present invention may contain one or more modified (e.g., altered or alternative) nucleobases, nucleosides, nucleotides, or combinations thereof. The mRNA useful in LNPs can contain any useful modification or alteration, for example, to the nucleobase, sugar, or internucleoside linkage (e.g., phosphate linkage / phosphodiester linkage / phosphodiester backbone). In certain embodiments, the alteration (e.g., one or more alterations) occurs in each of the nucleobase, sugar, and internucleoside linkage. The alteration according to the present disclosure may be a ribonucleic acid (RNA) alteration, for example, a substitution of 2'-OH for 2'-H in the ribofuranosyl ring, threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or a hybrid thereof.

[0310] The mRNA of the present invention may or may not be uniformly modified along the entire length of the molecule.For example, one or more or all types of nucleotides (for example, purine or pyrimidine, or any one or more or all of A, G, U, C) may or may not be uniformly modified in mRNA or in its given predetermined sequence region.In some examples, all nucleotides X in mRNA (or in its given sequence region) are modified, and X may be any one of nucleotides A, G, U, C, or any one of combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C.

[0311] Different sugar modifications and / or internucleoside linkages (e.g., backbone structures) may be present at various positions in a polynucleotide. Those skilled in the art will appreciate that nucleotide analogs or other modifications may be placed at any position in a polynucleotide such that the function of the polynucleotide is not substantially diminished. Modifications may also be at the 5' or 3' end. In some embodiments, a polynucleotide includes a modification at the 3' end. Polynucleotides may be from about 1% to about 100% (relative to overall nucleotide content or to one or more types of nucleotides, i.e., any one or more of A, G, U, or C) or any intervening percentage (e.g., 1% to 20%, 1% to 25%, 1% to 50%, 1% to 60%, 1% to 70%, 1% to 80%, 1% to 90%, 1% to 95%, 10% to 20%, 10% to 25%, 10% to 50%, 10% to 60%, 10% to 70%, 10% to 80%, 10% to 90%, 10% to 95%, 10% to 10 ... It may contain alternative nucleotides at 5%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%. It is understood that any remaining percentage is applied to the occurrence of a canonical nucleotide (eg, A, G, U, or C).

[0312] A polynucleotide may contain a minimum of 0 and a maximum of 100% alternative nucleotides, or any intervening percentage, such as at least 5% alternative nucleotides, at least 10% alternative nucleotides, at least 25% alternative nucleotides, at least 50% alternative nucleotides, at least 80% alternative nucleotides, or at least 90% alternative nucleotides. For example, a polynucleotide may contain alternative pyrimidines, such as alternative uracils or cytosines. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in a polynucleotide are replaced with alternative uracils (e.g., 5-substituted uracils). Alternative uracils may be replaced by a compound with a single unique structure, or by multiple compounds with different structures (e.g., 2, 3, 4, or more unique structures). In some cases, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in the polynucleotide are replaced with alternative cytosines (e.g., 5-substituted cytosines). The alternative cytosines can be replaced by a compound with a single unique structure, or by multiple compounds with different structures (e.g., 2, 3, 4, or more unique structures).

[0313] In some cases, the nucleic acid does not substantially induce an innate immune response in a cell into which the polynucleotide (e.g., mRNA) has been introduced. The induced innate immune response is characterized by: 1) increased expression of pro-inflammatory cytokines, 2) activation of intracellular PRRs (e.g., RIG-I, MDA5, etc.), and / or 3) termination or reduction in protein translation.

[0314] In some embodiments, mRNA contains one or more alternative nucleosides or nucleotides. Alternative nucleosides and nucleotides can contain alternative nucleobases. The nucleobases of nucleic acids are organic bases, such as purines or pyrimidines or their derivatives. The nucleobases may be canonical bases (e.g., adenine, guanine, uracil, thymine, and cytosine). These nucleobases can be modified or entirely replaced to provide polynucleotide molecules with enhanced properties, such as increased stability, e.g., resistance to nucleases. Non-canonical or modified bases can contain one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitutions; one or more fused or open rings; oxidation; and / or reduction.

[0315] In some embodiments, the nucleobase is an alternative uracil. Exemplary nucleobases and nucleosides having an alternative uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U), 4-thio-uracil (s 4 U), 4-thiopseudouridine (s4ψ), 2-thiopseudouridine (s2ψ), 5-hydroxyuracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3 U), 5-methoxy-uracil (mo 5 U), uracil 5-hydroxyacetic acid (cmo 5 U), uracil 5-hydroxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nmVu), 5-methylaminomethyl-uracil (mnm 5 U), 5-methylaminomethyl-2-thio-uracil (mnmVu), 5-methylaminomethyl-2-seleno-uracil (mnm 5 se 2 U), 5-carbamoylmethyl-uracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thio-uracil (cmnmVu), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (xm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (xm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., those with the nucleobase deoxythymine), 1-methyl-pseudouridine (mV), 5-methyl-2-thio-uracil (m 5 s 2U), 1-methyl-4-thio-pseudouridine (ms4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m \| / ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m5D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acpU), l-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp ψ), 5-(isopentenylaminomethyl)uracil (inm5U), 5-(isopentenylaminomethyl)-2-thio-uracil (inm5s2U), 5,2'-0-dimethyl-uridine (m5Um), 2-thio-2'-0-methyl-uridine (s2Um), 5-methoxycarbonylmethyl-2'-0-methyl-uridine (mem Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm5Um), 3,2'-O-dimethyl-uridine (mUm), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm5Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(lE-propenylamino)]uracil. Pseudouridine is an example of a modified nucleoside that is an isomer of uridine, in which uracil is attached to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0316] In some embodiments, the nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having alternative cytosines include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C), N4-acetyl-cytosine (ac4C), 5-formyl-cytosine (f5C), N4-methyl-cytosine (m4C), 5-methyl-cytosine (m5C), 5-halo-cytosine (e.g., 5-iodo-cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza- Pseudoisocytidine, Zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, Lysidine (k2C), 5,2'-0-dimethyl-cytidine (m5Cm), N4 -acetyl-2'-0-methyl-cytidine (ac4Cm), N4,2'-0-dimethyl-cytidine (m4Cm), 5-formyl-2'-0-methyl-cytidine (f5Cm), N4,N4,2'-0-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0317] In some embodiments, the nucleobase is an alternative adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (ml A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycinylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine ( m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6,2'-0-dimethyl-adenosine (m6Am), N6,N6,2'-0-trimethyl-adenosine (m62Am), 1,2'-0-dimethyl-adenosine (ml Am), 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0318] In some embodiments, the nucleobase is an alternative guanine. Exemplary nucleobases and nucleosides having an alternative guanine include inosine (I), 1-methyl-inosine (mil), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyobutosine (yW), peroxywyobutosine (o2yW), hydroxywyobutosine (OHyW), undermodified hydroxywyobutosine (OHyW*), 7-deaza-guanine, quenosine (Q ), epoxyquenosine (oQ), galactosyl-quenosine (galQ), mannosyl-quenosine (manQ), 7-cyano-7-deaza-guanine (preQO), 7-aminomethyl-7-deaza-guanine (preQl), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6-thio-7-methyl N-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2-dimethyl These include 1-methyl-6-thio-guanine, N2-methyl-2'-0-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-0-methyl-guanosine (m22Gm), 1-methyl-2'-0-methyl-guanosine (mlGm), N2,7-dimethyl-2'-0-methyl-guanosine (m2,7Gm), 2'-0-methyl-inosine (Im), 1,2'-0-dimethyl-inosine (mllm), 1-thio-guanine, and O-6-methyl-guanine.

[0319] Alternative nucleobases of a nucleotide can independently be a purine, a pyrimidine, or a purine or pyrimidine analog. For example, the nucleobase can be alternatives of adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, nucleobases also include, for example, pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines. and guanine, 5-halo, especially 5-bromo, 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazinone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine; or 1,3,5 triazine. When nucleotides are depicted using the abbreviations A, G, C, T, or U, each letter refers to a representative base and / or its derivatives, e.g., A includes adenine or an adenine analog, e.g., 7-deazaadenine.

[0320] In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by a pseudouridine. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by a pseudouridine. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by a pseudouridine. ,57%,58%,59%,60%,61%,62%,63%,64%,65%,66%,67%,68%,69%,70%,71%,72%,73%,74%,75%,76%,77%,78%,79%,80%,81%,82%,83%,84%,85%,86%,87%,88%,89%,90%,91%,92%,93%,94%,95%,96%,97%,98%,or 99%,at most 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%,1 7%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 6%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, exactly 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 0%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. 5%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68% , 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the uridines are replaced by pseudouridines. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which all uridines are replaced by pseudouridines.

[0321] B. 5' Cap The mRNA may contain a 5' cap structure. The 5' cap structure of a polynucleotide is involved in nuclear export and increased polynucleotide stability, and binds to mRNA cap-binding protein (CBP), which contributes to polynucleotide stability and translation competency in cells through its association with poly(A)-binding protein to form mature circular mRNA species. The cap further assists in the removal of the 5' proximal intron during mRNA splicing.

[0322] Endogenous polynucleotide molecules may be 5'-end capped to generate a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue and the transcribed sense nucleotide at the 5' end of the polynucleotide. This 5'-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar at the terminal of the polynucleotide and / or the anteterminal transcribed nucleotide at the 5' end may also optionally be 2'-0-methylated. 5' decapping through hydrolysis and cleavage of the guanylate cap structure can target polynucleotide molecules, such as mRNA molecules, for degradation.

[0323] Modifications to polynucleotides can generate non-hydrolyzable cap structures to prevent decapping and therefore increase polynucleotide half-life. Because hydrolysis of the cap structure requires cleavage of the 5'-ppp-5' phosphorodiester linkage, alternative nucleotides can be used during the capping reaction. For example, vaccinia capping enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to create phosphorothioate linkages in the 5'-ppp-5' cap.

[0324] Additional alternative guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, may also be used. Additional modifications include, but are not limited to, 2'-0-methylation of the ribose sugar of the 5'-terminus and / or penultimate nucleotide of the polynucleotide (as described above) on the 2'-hydroxy group of the sugar. Multiple distinct 5'-cap structures can be used to generate the 5'-cap of an mRNA molecule.

[0325] A cap analog, also referred to herein as a synthetic cap analog, chemical cap, chemical cap analog, or structural or functional cap analog, differs in chemical structure from a natural (i.e., endogenous, wild-type, or physiological) 5' cap while retaining cap function. Cap analogs may be synthesized chemically (i.e., non-enzymatically) or enzymatically and linked to a polynucleotide. For example, an anti-reverse cap analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, with one guanosine containing a 3'-0-methyl group in addition to the N7-methyl group (i.e., N7'-0-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7G-3'mppp-G, which may equivalently be referred to as 3'0-Me-m7G(5')ppp(5')G). The 3'-0 atom of the otherwise unmodified guanosine is linked to the 5'-terminal nucleotide of the capped polynucleotide (e.g., mRNA). The N7- and 3'-0-methylated guanosine provide the terminal portion of the capped polynucleotide (e.g., mRNA). Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-0-methyl group on the guanosine (i.e., N7,2'-0-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G).

[0326] The cap may be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog may be modified with boranophosphate or phosphoroselenoate groups at different phosphate positions, such as the dinucleotide cap analogs described in U.S. Patent No. 8,519,110, the cap structures of which are incorporated herein by reference.

[0327] Alternatively, the cap analog may be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5)ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5)ppp(5')G cap analogs (see, e.g., Kore et al., Bioorganic & Medicinal Chemistry 2013 21:4570-4574, whose cap structures are incorporated herein by reference, for various cap analogs and methods of synthesizing cap analogs). In another example, a cap analog useful in the polynucleotides of the present disclosure is a 4-chloro / bromophenoxyethyl analog.

[0328] Although cap analogs allow for concomitant capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. Besides this, the structural differences of cap analogs from the endogenous 5' cap structure of polynucleotides produced by the endogenous cellular transcription machinery can lead to reduced translational competency and reduced cellular stability.

[0329] Alternative polynucleotides may also be post-transcriptionally capped using enzymes to generate more authentic 5' cap structures. As used herein, the phrase "more authentic" refers to features that closely mirror or mimic, either structurally or functionally, endogenous or wild-type features. That is, a "more authentic" feature is more representative of an endogenous, wild-type, native, or physiological cellular function and / or structure compared to a prior art synthetic feature or analog, or surpasses the corresponding endogenous, wild-type, native, or physiological feature in one or more respects. Non-limiting examples of more authentic 5' cap structures useful in the polynucleotides of the present disclosure are those that have, among other things, enhanced binding of cap-binding proteins, increased half-life, reduced susceptibility to 5'-endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures (or wild-type, native, or physiological 5' cap structures) known in the art. For example, recombinant vaccinia virus capping enzyme and recombinant 2'-0-methyltransferase enzyme can create a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, where the cap guanosine contains N7-methylation and the 5'-terminal nucleotide of the polynucleotide contains 2'-0-methyl. Such a structure is called a CapI structure. This cap results in higher translational competence, cellular stability, and reduced activation of cellular pro-inflammatory cytokines, for example, compared to other 5'-cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0330] Because the alternative polynucleotides can be capped post-transcriptionally, and because this process is more efficient, nearly 100% of the mRNA can be capped, as opposed to approximately 80% when the cap analog is ligated to the polynucleotide during an in vitro transcription reaction.

[0331] The 5'-end cap may comprise an endogenous cap or a cap analog. The 5'-end cap may comprise a guanosine analog. Useful guanosine analogs include inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine. In some cases, the polynucleotide contains a modified 5'-cap. Modifications to the 5'-cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and increase the polynucleotide translation efficiency. The modified 5' cap may include, but is not limited to, one or more of the following modifications: a modification at the 2' and / or 3' position of the capped guanosine triphosphate (GTP), replacement of the sugar ring oxygen (to create a carbocyclic ring) with a methylene moiety (CH2), a modification in the triphosphate bridge portion of the cap structure, or a modification in the nucleobase (G) portion.

[0332] C. Untranslated region (UTR) A 5'UTR is a regulatory region located at the 5' end of a protein open reading frame that is transcribed into mRNA but not translated into an amino acid sequence, or the corresponding region in an RNA polynucleotide, such as an mRNA molecule. Untranslated regions (UTRs) may be present 5' (upstream) of an open reading frame (5'UTR) and / or 3' (downstream) of an open reading frame (3'UTR).

[0333] In some embodiments, UTRs are derived from mRNAs that are naturally abundant in the specific tissues (e.g., lymphoid tissues) where mRNA expression is targeted. In some embodiments, UTRs increase protein synthesis. Without being bound by mechanism or theory, UTRs may increase protein synthesis by increasing the time that mRNA remains in translation polysomes (message stability) and / or the rate at which ribosomes begin translation on messages (message translation efficiency). Thus, UTR sequences may prolong protein synthesis in a tissue-specific manner.

[0334] In some embodiments, the 5'UTR and 3'UTR sequences are derived by computer. In some embodiments, the 5'UTR and 3'UTR are derived from mRNA that is naturally abundant in tissue. The tissue may be, for example, liver, stem cell, or lymphoid tissue. The lymphoid tissue may include, for example, any one of lymphocytes (e.g., B lymphocytes, helper T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or natural killer cells), macrophages, monocytes, dendritic cells, neutrophils, eosinophils, and reticulocytes. In some embodiments, the 5'UTR and 3'UTR are derived from an alphavirus. In some embodiments, the 5'UTR and 3'UTR are from a wild-type alphavirus.

[0335] In some embodiments, the RNA disclosed herein comprises 5'UTR.If present, 5'UTR is located at the 5' end and starts with the transcription start site upstream of the start codon of the protein coding region.5'UTR is downstream of 5'cap (if present), for example, directly adjacent to 5'cap.5'UTR may contain various regulatory elements, for example, 5'cap structure, stem-loop structure, and internal ribosome entry site (IRES), which may play a role in regulating translation initiation.

[0336] In some embodiments, the 5'UTR disclosed herein comprises a cap-proximal sequence, e.g., as disclosed herein. In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5' cap. In some embodiments, the cap-proximal sequence comprises nucleotides at positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0337] The 5'-UTR may serve as a flanking region for the mRNA. The 5'-UTR may be homologous or heterologous to the coding region found in the polynucleotide. Multiple 5'-UTRs may be included in the flanking region, and may be the same or different sequences. Any portion of the flanking region, including none, may be codon-optimized, and any may independently contain one or more different structural or chemical modifications before and / or after codon optimization.

[0338] The 5'UTR heterologous to the coding region of mRNA may be engineered to change one or more properties of mRNA.The mRNA may then be administered to cells, tissues, or organisms, and outcomes, such as protein level, localization, and / or half-life, may be measured to evaluate the beneficial effect that the heterologous 5'UTR may have on mRNA.Variant 5'UTRs may be used in which one or more nucleotides, including A, T, C, or G, are added or removed at the end.The 5'UTR may also be codon-optimized or modified in any manner described herein.

[0339] In some embodiments, the RNA molecule comprises a 5' untranslated region (5'-UTR). In some embodiments, the 5' UTR comprises a sequence selected from either SEQ ID NO: 75 or 77. In some embodiments, the 5' UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to either SEQ ID NO: 75 or 77. In some embodiments, the 5' UTR comprises a sequence selected from either SEQ ID NO: 75 or 77. In some embodiments, the 5' UTR comprises a sequence consisting of either SEQ ID NO: 75 or 77.

[0340] In some embodiments, the RNA disclosed herein comprises a 3'UTR. If present, the 3'UTR is located downstream of the protein coding sequence open reading frame, for example, downstream of the stop codon of the protein coding region. The 3'UTR is typically the part of the mRNA located between the protein coding sequence and the polyA tail of the mRNA. Therefore, in some embodiments, the 3'UTR is located upstream of the polyA sequence (if present), for example, directly adjacent to the polyA sequence. The 3'UTR may be involved in regulatory processes, including transcript cleavage, stability and polyadenylation, translation, and mRNA localization.

[0341] The 3'UTR may also contain elements that are not encoded in the template from which the RNA is transcribed, but are added during post-transcriptional maturation, such as a polyA tail. The 3'UTR of an mRNA is not translated into an amino acid sequence. In some embodiments, the RNA disclosed herein comprises a 3'UTR that includes an F element and / or an I element. In some embodiments, the 3'UTR or a proximal sequence thereof comprises a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an XhoI site.

[0342] In some embodiments, the RNA molecules and RNA-LNPs comprise a 3' untranslated region (3'-UTR). In some embodiments, the 3' UTR comprises a sequence selected from either SEQ ID NO: 76 or 78. In some embodiments, the 3' UTR comprises a sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or higher percent identity to either SEQ ID NO: 76 or 78. In some embodiments, the 3' UTR comprises a sequence selected from either SEQ ID NO: 76 or 78. In some embodiments, the 3' UTR comprises a sequence consisting of either SEQ ID NO: 76 or 78.

[0343] The mRNA may comprise a stem loop, for example, but not limited to, a histone stem loop. The stem loop may be a nucleotide sequence of about 25 or about 26 nucleotides in length. The histone stem loop may be located 3' to the coding region (e.g., at the 3' end of the coding region). As a non-limiting example, the stem loop may be located at the 3' end of a polynucleotide described herein. In some cases, the mRNA comprises more than one stem loop (e.g., two stem loops). The stem loop may be located in the second terminal region of the polynucleotide. As a non-limiting example, the stem loop may be located within an untranslated region (e.g., the 3'-UTR) in the second terminal region. In some cases, an mRNA comprising a histone stem loop may be stabilized by the addition of a 3' stabilization region (e.g., a 3' stabilization region comprising at least one chain-terminating nucleoside). Without wishing to be bound by theory, the addition of at least one chain-terminating nucleoside may slow the degradation of the polynucleotide, thereby increasing the half-life of the polynucleotide. In other cases, mRNAs containing histone stem loops may be stabilized by modifications to the 3' region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U). In still other cases, mRNAs containing histone stem loops may be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methylnucleosides, 3-O-ethylnucleosides, 3'-arabinosides, and other alternative nucleosides known in the art and / or described herein. In some instances, the mRNAs of the present disclosure may include a histone stem loop, a polyA tract, and / or a 5' cap structure. The histone stem loop may precede and / or follow the polyA tract. Polynucleotides comprising histone stem loop and poly A region sequences may comprise chain-terminating nucleosides as described herein. In other examples, polynucleotides of the present disclosure may comprise histone stem loop and 5' cap structures.The 5' cap structure may include, but is not limited to, those described herein and / or known in the art. In some cases, the conserved stem-loop region may include the miR sequence described herein. As a non-limiting example, the stem-loop region may include the seed sequence of the miR sequence described herein. In another non-limiting example, the stem-loop region may include the miR-122 seed sequence.

[0344] The mRNA may include at least one histone stem loop and polyA region or polyadenylation signal. In certain cases, the polynucleotide encoding the histone stem loop and polyA region or polyadenylation signal may encode a pathogen antigen or a fragment thereof. In other cases, the polynucleotide encoding the histone stem loop and polyA region or polyadenylation signal may encode a therapeutic protein. In some cases, the polynucleotide encoding the histone stem loop and polyA region or polyadenylation signal may encode a tumor antigen or a fragment thereof. In other cases, the polynucleotide encoding the histone stem loop and polyA region or polyadenylation signal may encode an allergy-inducing antigen or an autoimmune autoantigen.

[0345] D. Open Reading Frame (ORF) The 5' and 3' UTRs may be operably linked to an open reading frame (ORF), which may be a sequence of codons capable of being translated into a polypeptide of interest. The open reading frame may be a sequence of several DNA or RNA nucleotide triplets that can be translated into a peptide or protein. The ORF may begin with an initiation codon at its 5' end, for example, a combination of three consecutive nucleotides (ATG or AUG) that usually encodes the amino acid methionine, and a subsequent region that usually has a length of several 3 nucleotides. The open reading frame may end with at least one stop codon, including but not limited to TAA, TAG, TGA or UAA, UAG or UGA, or any combination thereof. In some embodiments, the open reading frame may end with one, two, three, four, or more stop codons known in the art. The open reading frame may be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame may also be referred to as a "(protein) coding region" or "coding sequence."

[0346] As described herein, an RNA molecule may contain one (monocistronic), two (bicistronic) or more (multicistronic) open reading frames.

[0347] The present disclosure provides RNA molecules comprising at least one open reading frame encoding an E. coli FimH polypeptide as described herein, in some embodiments, an RNA molecule comprising at least one open reading frame encoding an E. coli FimH protein as described herein.

[0348] E. Gene of Interest The RNA molecule described herein may comprise a gene of interest.The gene of interest encodes a polypeptide of interest.Non-limiting examples of polypeptides of interest include, for example, biologics, antibodies, vaccines, therapeutic polypeptides or peptides, cell-penetrating peptides, secreted polypeptides, plasma membrane polypeptides, cytoplasmic or cytoskeletal polypeptides, intracellular membrane-bound polypeptides, nuclear polypeptides, polypeptides associated with human diseases, targeting moieties, polypeptides encoded by the human genome that have not yet been identified as therapeutic indications but are nevertheless useful in the fields of research and drug discovery, or combinations thereof.The sequence of a particular gene of interest can be easily identified by those skilled in the art using public and private databases, for example, GENBANK®.

[0349] In some embodiments, the RNA molecule comprises a coding region for a gene of interest. In some embodiments, the gene of interest is or comprises an antigen polypeptide or its immunogenic variant or immunogenic fragment. In some embodiments, the antigen polypeptide comprises one epitope from an antigen. In some embodiments, the antigen polypeptide comprises multiple distinct epitopes from an antigen. In some embodiments, the antigen polypeptide comprising multiple distinct epitopes from an antigen is a polyepitope. In some embodiments, the antigen polypeptide comprises an antigen polypeptide from an allergen, a virus antigen polypeptide, a bacterial antigen polypeptide, a fungus antigen polypeptide, a parasite antigen polypeptide, an antigen polypeptide from an infectious agent, an antigen polypeptide from a pathogen, a tumor antigen polypeptide, or an autoantigen polypeptide.

[0350] The term "antigen" can refer to a substance capable of being recognized by the immune system, e.g., the adaptive immune system, and capable of eliciting an antigen-specific immune response, e.g., by the formation of antibodies and / or antigen-specific T cells as part of the adaptive immune response. An antigen may be or include a peptide or protein that can be presented to T cells by MHC. An antigen may also be the product of translation of a provided nucleic acid molecule, e.g., an RNA molecule comprising at least one coding sequence described herein. Additionally, fragments, variants, and derivatives of an antigen, e.g., a peptide or protein, comprising at least one epitope, are understood as antigens.

[0351] In some embodiments, RNA encoding the gene of interest (for example, antigen) is expressed in the cells of the subject to be treated to provide the gene of interest (for example, antigen).In some embodiments, RNA is transiently expressed in the cells of the subject.In some embodiments, the gene of interest (for example, antigen) is expressed on the cell surface.In some embodiments, the gene of interest (for example, antigen) is expressed and presented in the context of MHC.In some embodiments, the gene of interest (for example, antigen) is expressed in the extracellular space, for example, the antigen is secreted.

[0352] In some embodiments, the RNA molecule comprises a coding region for a gene of interest, e.g., an antigen. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, e.g., an antigen derived from a pathogen associated with an infectious disease. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, e.g., an antigen derived from an E. coli fimbrial antigen (FimH).

[0353] In some embodiments, the RNA polynucleotide described herein or a composition or pharmaceutical preparation comprising the same comprises a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence having at least 80% identity to a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence encoding a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some embodiments, the RNA polynucleotide described herein or a composition or pharmaceutical preparation comprising the same is transcribed from a DNA template. In some embodiments, the DNA template used to transcribe the RNA polynucleotide described herein comprises a sequence complementary to the RNA polynucleotide. In some embodiments, the gene of interest described herein is encoded by the RNA polynucleotide described herein comprising a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide encodes a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some embodiments, the polypeptide described herein is encoded by an RNA polynucleotide transcribed from a DNA template comprising a sequence complementary to the RNA polynucleotide.

[0354] In some embodiments, the RNA molecule encodes a FimH protein comprising the sequence of any one of SEQ ID NOs: 67, 69, 71 or 73, or a fragment or variant thereof.

[0355] In some embodiments, the RNA molecule encodes an E. coli FimH protein, or a fragment or variant thereof, synthesized from a nucleic acid sequence comprising any one of SEQ ID NOs: 66, 68, 70, 72, or 82-85.

[0356] F. Poly A tail In some embodiments, the RNA molecules disclosed herein comprise a polyadenylate (polyA) sequence, e.g., as described herein. In some embodiments, the polyA sequence is located downstream of the 3'UTR, e.g., adjacent to the 3'UTR. A "polyA tail" or "polyA sequence" refers to a stretch of consecutive adenine residues that may be attached to the 3' end of an RNA molecule. PolyA sequences are known to those skilled in the art and may follow the 3'UTR in the RNA molecules described herein. A polyA tail may increase the half-life of an RNA molecule.

[0357] The mRNA may contain a polyA sequence and / or a polyadenylation signal. The polyA sequence may be composed entirely or mostly of adenine nucleotides or their analogs or derivatives. The polyA sequence may be a tail located adjacent to the 3' untranslated region of the nucleic acid. During RNA processing, a long chain of adenosine nucleotides (polyA tract) is typically added to messenger RNA (mRNA) molecules to increase the stability of the molecule. Immediately after transcription, the 3' end of the transcript is cleaved to a free 3'-hydroxyl group. PolyA polymerase then adds a chain of adenosine nucleotides to the RNA. A process called polyadenylation adds a polyA tract ranging from 100 to 250 residues in length. The length of the unique polyA tract may provide certain advantages to alternative polynucleotides of the present disclosure. Generally, the length of the polyA tract of the present disclosure is at least 30 nucleotides. In another embodiment, the polyA tract is at least 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides.In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides. In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In some instances, the polyA region may be 80, 120, or 160 nucleotides in length on alternative polynucleotide molecules described herein. In other instances, the polyA region may be 20, 30, 40, 80, 100, 120, 140, or 160 nucleotides in length on alternative polynucleotide molecules described herein. In some instances, the polyA region is designed relative to the overall length of the alternative polynucleotide. This design may be based on the length of the coding region of the alternative polynucleotide, the length of a particular feature or region of the alternative polynucleotide (e.g., mRNA), or the length of the final product expressed from the alternative polynucleotide.When compared to any feature of the alternative polynucleotide (e.g., other than the mRNA portion containing the polyA region), the polyA region may be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the additional feature. The polyA region may also be designated as a proportion of the alternative polynucleotide to which it belongs. In this context, the polyA region may be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct excluding the polyA region.

[0358] In certain cases, engineered binding sites and / or conjugation of mRNA to polyA-binding proteins may be used to enhance expression. The engineered binding site may be a sensor sequence that can function as a binding site for ligands in the local microenvironment of the mRNA. As a non-limiting example, the mRNA may contain at least one engineered binding site to alter the binding affinity of polyA-binding protein (PABP) and its analogs. The incorporation of at least one engineered binding site may increase the binding affinity of PABP and its analogs.

[0359] Additionally, multiple separate mRNAs may be linked together through their 3' ends to PABP (polyA-binding protein) using alternative nucleotides at the 3' end of the polyA region. Transfection experiments can be performed in relevant cell lines, and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 ​​hours, 72 hours, and 7 days after transfection. As a non-limiting example, transfection experiments can be used to evaluate the effect on the binding affinity of PABP or its analogs as a result of the addition of at least one engineered binding site. In certain cases, polyA regions may be used to modulate translation initiation. Without wishing to be bound by theory, polyA regions may recruit PABP, which can then interact with the translation initiation complex and thus may be essential for protein synthesis. In some cases, polyA regions may also be used in the present disclosure to protect against 3'-5'-exonuclease digestion. In some instances, mRNAs may contain polyAG quartets. A G-quartet is a cyclic, hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of a polyA tract. The resulting mRNA can be assayed for stability, protein production, and other parameters, including half-life, at various time points. PolyAG quartets have been found to result in protein production at least 75% equivalent to that seen using a 120-nucleotide polyA tract alone. In some cases, the mRNA can include a polyA tract and can be stabilized by the addition of a 3' stabilization region. An mRNA with a polyA tract can further include a 5' cap structure. In other cases, the mRNA can include a polyAG quartet. An mRNA with a polyAG quartet can further include a 5' cap structure. In some cases, the 3' stabilization region that can be used to stabilize the mRNA includes a polyA tract or a polyAG quartet.In other cases, 3' stabilization regions that may be used in the present disclosure include chain-terminating nucleosides, such as 3'-deoxyadenosine (chodycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides, or O-methylnucleosides. In other cases, mRNAs containing polyA tracts or polyAG quartets may be stabilized by modifications to the 3' region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U). In yet other examples, mRNAs containing poly-A tracts or poly-AG quartets may be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other alternative nucleosides known in the art and / or described herein.

[0360] In one embodiment, the RNA disclosed herein comprises a poly-A tail comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 86. In one embodiment, the poly-A tail comprises the sequence of SEQ ID NO:86.

[0361] IV. RNA transcription In some embodiments, the RNA disclosed herein is produced by in vitro transcription or chemical synthesis.In the context of this disclosure, the term "transcription" refers to the process in which the genetic code in DNA sequence is transcribed into RNA.Then, RNA can be translated into peptide or protein.

[0362] According to the present disclosure, "transcription" includes "in vitro transcription" or "IVT," which refers to a process in which transcription occurs in a non-cellular system in vitro to produce synthetic RNA products for use in various applications, including, for example, the production of proteins or polypeptides. Cloning vectors may be used to generate transcripts. These cloning vectors are commonly referred to as transcription vectors and are encompassed by the term "vector" according to the present invention. According to a specific embodiment, the RNA used is in vitro transcribed RNA (IVT-RNA), which may be obtained by in vitro transcription of a suitable DNA template. The promoter for controlling transcription may be any promoter for any RNA polymerase. Specific examples of RNA polymerases are T7, T3, and SP6 RNA polymerases. Preferably, in vitro transcription according to the present invention is controlled by a T7 or SP6 promoter. A DNA template for in vitro transcription may be obtained by cloning a nucleic acid, particularly a cDNA, and introducing it into a suitable vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA.

[0363] Synthetic IVT RNA products can be translated in vitro or directly introduced into cells and translated in cells.With respect to RNA, the term "expression" or "translation" refers to the process in cellular ribosomes in which a chain of mRNA directs the assembly of a sequence of amino acids to make peptides or proteins.Such synthetic RNA products include, but are not limited to, mRNA molecules, saRNA molecules, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNA molecules (e.g., for CRISPR), ribosomal RNA molecules, small nuclear RNA molecules, and small nucleolar RNA molecules.IVT reactions typically utilize the DNA template (e.g., linear DNA template), ribonucleotides (e.g., unmodified ribonucleotide triphosphates or modified ribonucleotide triphosphates) and suitable RNA polymerase described and / or utilized herein.

[0364] In some embodiments, mRNA is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid containing deoxyribonucleotides. In some embodiments, the RNA disclosed herein is in vitro transcribed RNA (IVT-RNA), which may be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription may be any promoter for any RNA polymerase. The DNA template for in vitro transcription may be obtained by cloning a nucleic acid, particularly cDNA, and introducing it into an appropriate vector for in vitro transcription. cDNA may also be obtained by reverse transcription of RNA.

[0365] In some embodiments, the starting materials for IVT may include a linearized DNA template, nucleotides, RNase inhibitors, pyrophosphatase, and / or T7 RNA polymerase. In some embodiments, the IVT process is carried out in a bioreactor. The bioreactor may include a mixer. In some embodiments, nucleotides may be added to the bioreactor throughout the IVT process.

[0366] In some embodiments, one or more post-IVT additives are added to the IVT mixture containing RNA in the bioreactor after the IVT process. Exemplary post-IVT additives may include DNAse I, configured to digest the linearized DNA template, and proteinase K, configured to digest DNAse I and T7 RNA polymerase. In some embodiments, the post-IVT additives are incubated with the mixture in the bioreactor after IVT.In some embodiments, the bioreactor comprises at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500, up to 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500, exactly 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500, or 60, 70, 80, 90, 100, 110, The IVT mixture may contain between any two or more of the following liters: 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500.The IVT mixture should be at least 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL. 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL, respectively. 5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL, or 3.3, 3.4, 3.5, 3.6, 3.7, The RNA may have an RNA concentration of between or greater than any two of 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL of RNA.

[0367] In some embodiments, the IVT mixture may include residual spermidine, residual DNA, residual proteins, peptides, HEPES, EDTA, ammonium sulfate, cations (e.g., Mg2+, Na+, Ca2+), RNA fragments, residual nucleotides, free phosphate, or any combination thereof.

[0368] In some embodiments, at least a portion of the IVT mixture is filtered. The IVT mixture may be filtered via ultrafiltration and / or diafiltration to remove at least some impurities from the IVT mixture and / or to change the buffer solution for at least a portion of the IVT mixture to produce a concentrated RNA solution as a retentate.

[0369] In some embodiments, both "ultrafiltration" and "diafiltration" refer to membrane filtration processes. Ultrafiltration is performed to reduce the particle size to at least 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1 μm, and up to 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1 μm, and to exactly 0.001, 0.0 Typically use the membrane with pore size between any two of the following: 0.02, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 and 0.1 μ m, or 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 and 0.1 μ m. In some embodiments, ultrafiltration membrane is typically classified by molecular weight cut-off (MWCO) instead of pore size. For example, the MWCO may be at least 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 110 kDa, 120 kDa, 130 kDa, 140 kDa, 150 kDa, 160 kDa, 170 kDa, 180 kDa, 190 kDa, 200 kDa, 210 kDa, 220 kDa, 230 kDa, 240 kDa, 250 kDa, 260 kDa, 270 kDa, 280 kDa, 290 kDa, 300 kDa, 310 kDa, 320 kDa, 330 kDa, 340 kDa, 350 kDa, 360 kDa, 370 kDa, 380 kDa, 390 kDa, 400 kDa, 410 kDa, 420 kDa, 430 kDa, 440 kDa, 450 kDa, 460 kDa, 470 kDa, 480 kDa, 490 kDa, 500 kDa, 510 kDa, 520 kDa, 530 kDa, 540 kDa, 550 kDa, 560 kDa, 570 kDa, 580 kDa, 590 kDa, 600 kDa, 610 kDa, 620 kDa, 630 kDa, 640 kDa, 650 kDa, 66 kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 500kDa, 600kDa, 700kDa, 800kDa, 900kDa, 1000kDa, 2000kDa, 3000kDa, 4000kDa, 5000kDa, 6000kDa, 7000kDa, 8000kDa, 9000kDa, and 10000kDa, up to 30kDa, 40kDa, 50kDa,60kDa, 70kDa, 80kDa, 90kDa, 100kDa, 110kDa, 120kDa, 130kDa, 140kDa, 150kDa, 160kDa, 170kDa, 180kDa, 190kDa, 200kDa, 210kDa, 220kDa, 230kDa, 24 0kDa,250kDa,260kDa,270kDa,280kDa,290kDa,300kDa,310kDa,320kDa,330kDa,340kDa,350kDa,360kDa,370kDa,380kDa,390kDa,400kDa,500kDa,6 00kDa, 700kDa, 800kDa, 900kDa, 1000kDa, 2000kDa, 3000kDa, 4000kDa, 5000kDa, 6000kDa, 7000kDa, 8000kDa, 9000kDa, and 10000kDa, exactly 30kDa, 40kDa, 50kDa, 60kDa, 70kDa, 80kDa, 90kDa, 100kDa, 110kDa, 120kDa, 130kDa, 140kDa, 150kDa, 160kDa, 170kDa, 180kDa, 190kDa, 200kDa, 210kDa, 220kDa, 230kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 410kDa, 420kDa, 430kDa, 440kDa, 450kDa, 460kDa, 470kDa, 480kDa, 490kDa, 500kDa, 510kDa, 5 0kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 500kDa, 600kDa, 700kDa, 800kDa, 900kDa, 1000kDa, 2000kDa, 3000kDa, 4000kDa, 5000kDa, 6000kDa, 7000kDa, 8000kDa, 9000kDa, and 10000kDa, or 30kDa, 40kDa, 50kDa, 60kDa, 70kDa, 80kDa, 90kDa, 100kDa, 110kDa, 120kDa, 130kDa, 140kDa, 150kDa, 160kDa, 170kDa, 180kDa, 190kDa, 200kDa, 210kDa, 220kDa, 230kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 410kDa, 420kDa, 430kDa, 440kDa, 450kDa, 460kDa, 470kDa, 480kDa, 490kDa, 500kDa, 20kDa, 230kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa,The filtration membrane may be between any two of the following: 400 kDa, 500 kDa, 600 kDa, 700 kDa, 800 kDa, 900 kDa, 1000 kDa, 2000 kDa, 3000 kDa, 4000 kDa, 5000 kDa, 6000 kDa, 7000 kDa, 8000 kDa, 9000 kDa, and 10000 kDa. Those skilled in the art will appreciate that the filtration membrane may be made of different suitable materials, including, for example, polymers, cellulose, ceramics, etc., depending on the application. In some embodiments, membrane filtration may be more desirable for large-volume purification processes.

[0370] In some embodiments, ultrafiltration and diafiltration of IVT mixtures to purify RNA may include (1) direct flow filtration (DFF), also known as "dead-end" filtration, in which the feed stream is applied perpendicular to the membrane surface and attempts to pass 100% of the fluid through the membrane, and / or (2) tangential flow filtration (TFF), also known as cross-flow filtration, in which the feed stream is passed parallel to the membrane surface, with one portion passing through the membrane (permeate) and the remaining portion (retentate) being retained and / or recycled to the feed tank.

[0371] In some embodiments, the filtration of IVT mixture is carried out through TFF, which comprises ultrafiltration, first diafiltration and second diafiltration.In some embodiments, the first diafiltration is carried out in the presence of ammonium sulfate.The first diafiltration can be configured to remove most of the impurities from the IVT mixture.In some embodiments, the second diafiltration is carried out without ammonium sulfate.The second diafiltration can be configured to transfer RNA into DS buffer formulation.

[0372] A filtration membrane with an appropriate MWCO can be selected for ultrafiltration in the TFF process.The MWCO of the TFF membrane determines which solutes can pass through the membrane and enter into filtrate, and which will be retained in retentate.The MWCO of the TFF membrane can be selected so that substantially all of the solutes of interest (such as desired synthesized RNA species) remain in retentate, while undesired components (such as excess ribonucleotides, small nucleic acid fragments, such as digested or hydrolyzed DNA templates, peptide fragments, such as digested proteins and / or other impurities) pass through into filtrate.In some embodiments, the retentate containing desired synthesized RNA species can be recycled to feed reservoir and re-filtered in additional cycles. In some embodiments, the TFF membrane may have a MWCO of at least 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, at most 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, exactly 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, or between any two of 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa or a greater kDa. In some embodiments, the TFF membrane may have a MWCO of at least 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, at most 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, exactly 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, or between or greater than any two of 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa. In some embodiments, the TFF membrane may have a MWCO of about 250-350 kDa. In some embodiments, the TFF membrane (e.g., a cellulose-based membrane) may have a MWCO of about 30-300 kDa; in some embodiments, about 50-300 kDa, about 100-300 kDa, or about 200-300 kDa.

[0373] Diafiltration may be performed discontinuously, or alternatively, continuously. For example, in continuous diafiltration, the diafiltration solution may be added to the sample feed reservoir at the same rate as the filtrate is produced. In this way, the volume in the sample reservoir remains constant, but small molecules (e.g., salts, solvents, etc.) that can freely permeate the membrane are removed. Using solvent removal as an example, each additional diafiltration volume (DV) further reduces the solvent concentration. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting volume. This process is then repeated until the desired concentration of small molecules (e.g., salts, solvents, etc.) remaining in the reservoir is reached. Each additional diafiltration volume (DV) further reduces the small molecule (e.g., solvent) concentration. Continuous diafiltration typically requires a minimum volume for a given reduction in the molecules being filtered. Discontinuous diafiltration, on the other hand, allows for rapid changes in retentate conditions, such as pH, salt content, etc. In some embodiments, the first diafiltration step is carried out for diavolumes equal to at least 2, 3, 4, 5, 6, 7, 8, 9, 10, at most 2, 3, 4, 5, 6, 7, 8, 9, 10, exactly 2, 3, 4, 5, 6, 7, 8, 9, 10, or between any two of 2, 3, 4, 5, 6, 7, 8, 9, 10 or a larger volume. In some embodiments, the second diafiltration step is carried out at a diavolume equal to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or between or greater than any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. In some embodiments, the first diafiltration step is carried out at 5 diavolumes and the second diafiltration step is carried out at 10 diavolumes.

[0374] In some embodiments, for ultrafiltration and / or diafiltration, the IVT mixture is at least 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 5000, 6000, 7000, 1050, 1100, 1200, 1300, 1400, 0, 800, 900, or 1000 L / m², up to 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m², accurate 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m² or 100, 110, 120, 130, 140, 150 , 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m2 or a rate equal to the greater of L / m2 of filter area per hour.The concentrated RNA solution may contain at least 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL, at most 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL, exactly 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL, or between any two of 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL single-stranded RNA.

[0375] In some embodiments, the bioburden of the RNA solution concentrated through filtration to obtain an RNA product solution may also be reduced. Filtration to reduce bioburden may be performed using one or more filters. The one or more filters may include filters with pore sizes of at least 0.2 μm, 0.45 μm, 0.65 μm, or 0.8 μm, up to 0.2 μm, 0.45 μm, 0.65 μm, or 0.8 μm, or exactly 0.2 μm, 0.45 μm, 0.65 μm, or 0.8 μm, or between any two of 0.2 μm, 0.45 μm, 0.65 μm, and 0.8 μm, or any other pore size configured to remove bioburden.

[0376] As one example, bioburden reduction may include draining a retentate tank containing retentate obtained from ultrafiltration and / or diafiltration to obtain a retentate. Bioburden reduction may include flushing a filtration system for ultrafiltration and / or diafiltration with a wash buffer solution to obtain a wash pool solution containing residual RNA remaining in the filtration system. The retentate may be filtered to obtain a filtered retentate. The wash pool solution may be filtered using a first 0.2 μm filter to obtain a filtered wash pool solution. The retentate may be filtered using the first 0.2 μm filter or another 0.2 μm filter.

[0377] The filtered wash pool solution and the filtered retentate may be combined to form a combined pool solution, which may be filtered using a second 0.2 μm filter to obtain a filtered combined pool solution, and the filtered combined pool solution is further filtered using a third 0.2 μm filter to produce an RNA product solution.

[0378] V. RNA encapsulation The RNA in the RNA product solution may be encapsulated, and the RNA solution may further comprise at least one encapsulating agent. In one embodiment, the encapsulating agent comprises a lipid, a lipid nanoparticle (LNP), a lipoplex, a polymer particle, a polyplex, and a monolithic delivery system, and combinations thereof.

[0379] Lipid nanoparticles may include a lipid component and one or more additional components, such as therapeutic and / or prophylactic agents. LNPs may be designed for one or more specific applications or targets. Elements of an LNP may be selected based on a particular application or target and / or based on the efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more elements. Similarly, a particular formulation of an LNP may be selected for a particular application or target, for example, according to the efficacy and toxicity of a particular combination of elements. The efficacy and tolerability of an LNP formulation may be affected by the stability of the formulation.

[0380] Lipid nanoparticles may be designed for one or more specific applications or targets. For example, LNPs may be designed to deliver therapeutic and / or prophylactic agents, such as RNA, to specific cells, tissues, organs, or systems or groups in the mammalian body.

[0381] The physiochemical properties of lipid nanoparticles may be modified to increase selectivity for specific bodily targets. For example, particle size may be adjusted based on the fenestration size of different organs. The therapeutic and / or prophylactic agents included in the LNPs may also be selected based on one or more desired delivery targets. For example, therapeutic and / or prophylactic agents may be selected for a particular symptom, condition, disease, or disorder and / or for delivery to a particular cell, tissue, organ, or system (e.g., localized or specific delivery). In certain embodiments, the LNPs may contain mRNA encoding a polypeptide of interest that is capable of being translated intracellularly to manufacture the polypeptide of interest. Such compositions may be designed for specific delivery to a particular organ. In some embodiments, the composition may be designed for specific delivery to the liver of a mammal. In some embodiments, the composition may be designed for specific delivery to a lymph node. In some embodiments, the composition may be designed for specific delivery to the spleen of a mammal.

[0382] In one embodiment, the encapsulating agent is a lipid, and lipid nanoparticles (LNPs) containing RNA are produced. Without intending to be bound by any theory, it is believed that cationic or cationically ionizable lipids or lipid-like materials and / or cationic polymers combine with nucleic acids to form aggregates, which result in colloidally stable particles. The lipids may be naturally occurring or synthetic. However, lipids are usually biological substances. Biological lipids are well known in the art and include, for example, neutral lipids, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glucolipids, sulfatides, lipids with ether- and ester-linked fatty acids, and polymerizable lipids, as well as combinations thereof. Lipids are substances that are insoluble in water and extractable with organic solvents. Compounds other than those specifically described herein are understood by those skilled in the art as lipids and are encompassed by the compositions and methods of the present disclosure. The lipid components and non-lipids may be attached to each other either covalently or non-covalently.

[0383] In some embodiments, LNPs can be designed to protect RNA molecules (e.g., mRNA) from extracellular RNase and / or can be engineered for systemic delivery of RNA to target cells.In some embodiments, such LNPs can be particularly useful for delivering RNA molecules (e.g., mRNA, modRNA) when the RNA molecule is administered intravenously to the subject in need thereof.In some embodiments, such LNPs can be particularly useful for delivering RNA molecules (e.g., mRNA) when the RNA molecule is administered intramuscularly to the subject in need thereof.

[0384] In one embodiment, the RNA in the RNA solution is at a concentration of less than 1 mg / mL. In another embodiment, the RNA is at a concentration of at least about 0.05 mg / mL. In another embodiment, the RNA is at a concentration of at least about 0.5 mg / mL. In another embodiment, the RNA is at a concentration of at least about 1 mg / mL. In another embodiment, the RNA concentration is from about 0.05 mg / mL to about 0.5 mg / mL. In another embodiment, the RNA is at a concentration of at least 10 mg / mL. In another embodiment, the RNA is at a concentration of at least 50 mg / mL. In some embodiments, the RNA is at least 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, and up to 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or exactly 0. 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or between any two of about 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or a higher concentration.

[0385] The present disclosure provides an RNA solution and its lipid preparation mixture or composition, comprising at least one RNA, for example, encoding an antigen (e.g., Escherichia coli (E. coli) FimH protein), complexed with one or more lipids, encapsulated in one or more lipids, and / or formulated with one or more lipids, forming a lipid nanoparticle (LNP), liposome, lipoplex, and / or nanoliposome. In some embodiments, the composition comprises a lipid nanoparticle.

[0386] Lipid nanoparticles or LNPs refer to any form of particle that is produced when cationic lipids and optionally one or more additional lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. In some embodiments, lipid nanoparticles are included in a formulation that can be used to deliver active agents or therapeutic agents, such as nucleic acids (e.g., mRNA, modRNA), to target sites of interest (e.g., cells, tissues, organs, tumors, etc.). In some embodiments, the lipid nanoparticles of the present disclosure contain nucleic acids. Such lipid nanoparticles typically contain cationic lipids and one or more excipients, such as one or more neutral lipids, charged lipids, steroids, lipids conjugated to polymers, or combinations thereof. In some embodiments, active agents or therapeutic agents, such as nucleic acids (e.g., mRNA, modRNA), can be encapsulated in the lipid portion of the lipid nanoparticle or in the aqueous space surrounded by part or all of the lipid portion of the lipid nanoparticle, thereby protecting them from enzymatic degradation or other undesirable effects induced by the host organism or cellular mechanisms, such as harmful immune responses. Nucleic acids (e.g., mRNA, modRNA) or portions thereof may also be associated and complexed with lipid nanoparticles, which may comprise any lipid capable of forming particles to which nucleic acids may be attached or in which one or more nucleic acids are encapsulated.

[0387] In some embodiments, the provided RNA molecules (e.g., mRNA, modRNA) may be formulated using LNPs. In some embodiments, the lipid nanoparticles may have an average diameter of about 1 to 500 nm. In some embodiments, the lipid nanoparticles may have an average diameter of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 nm to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or at least 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 110 nm, 120 nm, 130 nm, 140 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, 360 nm, 370 nm, 380 nm, 390 nm, 400 nm, 410 nm, 420 nm, 430 nm, 440 nm, 450 nm, 460 nm, 470 nm, nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm, up to 30nm, 35nm, 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm, exactly 30nm, 35nm, 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm 45 nm, or 150 nm, or between any two of 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm, and are substantially non-toxic.The term "average diameter" refers to the average hydrodynamic diameter of particles as measured by dynamic laser light scattering (DLS) in conjunction with data analysis using the so-called cumulant algorithm, which results in the so-called Z-average, which has the dimension of length, and the polydispersity index (PI), which is dimensionless (Koppel, D., J. Chem. Phys. 57, 1972, pp. 4814-4820, ISO 13321). Herein, the terms "average diameter," "diameter," "size," or "average size" of particles are used synonymously with this value of the Z-average.

[0388] The LNPs described herein may exhibit a polydispersity index of less than about 0.5, less than about 0.4, less than about 0.3, or about 0.2 or less. For example, LNP is at least 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0. .5, up to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5, exactly 0.1. , 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5 ... 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5.The polydispersity index is in some embodiments calculated based on dynamic light scattering measurements by so-called cumulant analysis, which is mentioned in the definition of "mean diameter." Under certain conditions, it may be taken as an indicator of the size distribution of an ensemble of nanoparticles.

[0389] Lipid nanoparticles may be characterized by various methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) may be used to examine the morphology and size distribution of LNPs. Dynamic light scattering or potentiometry (e.g., potentiometric titration) may be used to measure zeta potential. Dynamic light scattering may also be used to determine particle size. Instruments such as Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) may also be used to measure multiple characteristics of LNPs, such as particle size, polydispersity index, and zeta potential.

[0390] The average size of the LNPs can be tens to hundreds of nanometers, as measured, for example, by dynamic light scattering (DLS). For example, the average size can be about 40 nm to about 150 nm, e.g., about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average size of the LNPs may be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In certain embodiments, the average size of the LNPs may be about 70 nm to about 100 nm. In certain embodiments, the average size may be about 80 nm. In other embodiments, the average size may be about 100 nm.

[0391] The LNPs may be relatively homogeneous. The polydispersity index may be used to indicate the homogeneity of the LNPs, e.g., the particle size distribution of the lipid nanoparticles. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow particle size distribution. The LNPs may have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of the LNPs may be about 0.10 to about 0.20.

[0392] The zeta potential of LNP can be used to indicate the electrokinetic potential of the composition.For example, zeta potential can describe the surface charge of LNP.Lipid nanoparticles with relatively low positive or negative charge are generally desirable, and more highly charged species may have undesirable interactions with cells, tissues and other elements in the body. In some embodiments, the zeta potential of the LNP may be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0393] In certain embodiments, nucleic acids (e.g., RNA molecules) are resistant to degradation by nucleases in aqueous solution when present in the provided LNP. In some embodiments, LNP is a liver-targeting lipid nanoparticle. In some embodiments, LNP is a cationic lipid nanoparticle that comprises one or more cationic lipids (e.g., those described herein). In some embodiments, cationic LNP can comprise at least one cationic lipid, at least one lipid conjugated to a polymer, and at least one helper lipid (e.g., at least one neutral lipid).

[0394] In certain embodiments, the RNA solution and its lipid preparation mixture or composition may be 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, approximately 38%, approximately 39%, approximately 40%, approximately 41%, approximately 42%, approximately 43%, approximately 44%, approximately 45%, approximately 46%, approximately 47%, approximately 48%, approximately 49%, approximately 50%, approximately 51%, approximately 52%, approximately 53%, approximately 54%, approximately 55%, approximately 56%, approximately 57%, approximately 58%, approximately 59%, approximately 60%, approximately 61%, approximately 62%, approximately 63%, approximately 64%, approximately 65%, approximately 66%, approximately 67%, approximately 68 %, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of a particular lipid, lipid type, or non-lipid component, such as a lipid-like material and / or cationic polymer or adjuvant, antigen, peptide, polypeptide, sugar, nucleic acid, or other material as disclosed herein or known to one of skill in the art, or may have at least 1%, about 2%, about 3%, about 4%Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 3 0%, approximately 31%, approximately 32%, approximately 33%, approximately 34%, approximately 35%, approximately 36%, approximately 37%, approximately 38%, approximately 39%, approximately 40%, approximately 41%, approximately 42%, approximately 43%, approximately 44%, approximately 45%, approximately 46%, approximately 47%, approximately 48%, approximately 49%, approximately 50%, approximately 51%, approximately 52%, approximately 53%, approximately 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, up to about 1%, about 2%, about 3%, about 4% Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 3 0%, approximately 31%, approximately 32%, approximately 33%, approximately 34%, approximately 35%, approximately 36%, approximately 37%, approximately 38%, approximately 39%, approximately 40%, approximately 41%, approximately 42%, approximately 43%, approximately 44%, approximately 45%, approximately 46%, approximately 47%, approximately 48%, approximately 49%, approximately 50%, approximately 51%, approximately 52%, approximately 53%, approximately 54%, About 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, exactly 1%, about 2%, about 3%, about 4%Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 30 %,approximately 31%,approximately 32%,approximately 33%,approximately 34%,approximately 35%,approximately 36%,approximately 37%,approximately 38%,approximately 39%,approximately 40%,approximately 41%,approximately 42%,approximately 43%,approximately 44%,approximately 45%,approximately 46%,approximately 47%,approximately 48%,approximately 49%,approximately 50%,approximately 51%,approximately 52%,approximately 53%,approximately 54%,approximately 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, or about 1%, about 2%, about 3%, or about 4%Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 30%, approximately 31%, approximately 32%, approximately 33%, approximately 34%, approximately 35%, Approximately 36%, approximately 37%, approximately 38%, approximately 39%, approximately 40%, approximately 41%, approximately 42%, approximately 43%, approximately 44%, approximately 45%, approximately 46%, approximately 47%, approximately 48%, approximately 49%, approximately 50%, approximately 51%, approximately 52%, approximately 53%, approximately 54%, approximately 55%, approximately 56%, approximately 57%, approximately 58%, approximately 59%, approximately 60%, approximately 61%, approximately 62%, approximately 63%, approximately 64%, approximately 65%, approximately The composition may have between any two of the following: 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% of a particular lipid, lipid type, or non-lipid component, such as a lipid-like material and / or cationic polymer or adjuvant, antigen, peptide, polypeptide, sugar, nucleic acid, or other material as disclosed herein or known to one of skill in the art.

[0395] The LNPs described herein may be prepared using a wide variety of methods, including obtaining a colloid from at least one cationic or cationically ionizable lipid or lipid-like material and / or at least one cationic polymer, and mixing the colloid with nucleic acid to obtain nucleic acid particles. The term "colloid," as used herein, refers to a type of homogeneous mixture in which the dispersed particles do not settle. The insoluble particles in the mixture are microscopic, having a particle size of 1 to 1,000 nanometers. The mixture may be referred to as a colloid or colloidal suspension. Sometimes, the term "colloid" refers only to the particles in the mixture, rather than the entire suspension.

[0396] For the preparation of colloids containing at least one cationic or cationically ionizable lipid or lipid-like material and / or at least one cationic polymer, methods conventionally used to prepare liposome vesicles and appropriately adapted thereto can be applied herein. The most commonly used methods for preparing liposome vesicles share the following basic stages: (i) dissolving lipids in an organic solvent, (ii) drying the resulting solution, and (iii) hydrating the dried lipids (using various aqueous media). In the film hydration method, lipids are first dissolved in a suitable organic solvent and dried down to form a thin film on the bottom of a flask. The resulting lipid film is hydrated using a suitable aqueous medium to produce a liposome dispersion. Furthermore, an additional downsizing step may be included.

[0397] Reverse phase evaporation is an alternative method to film hydration for preparing liposomal vesicles, which involves the formation of a water-in-oil emulsion between an aqueous phase and a lipid-containing organic phase. Brief sonication of this mixture is required to homogenize the system. Removal of the organic phase under reduced pressure results in a milky gel that subsequently becomes a liposomal suspension.

[0398] The term "ethanol injection technique" refers to a process in which an ethanol solution containing lipids is rapidly injected into an aqueous solution through a needle. This action disperses the lipids throughout the solution and promotes lipid structure formation, such as lipid vesicle formation, e.g., liposome formation. Generally, the RNA lipoplex particles described herein can be obtained by adding RNA to a colloidal liposome dispersion. Using the ethanol injection technique, such a colloidal liposome dispersion is formed in some embodiments as follows: an ethanol solution containing lipids, e.g., cationic lipids and additional lipids, is injected into an aqueous solution under stirring. In some embodiments, the RNA lipoplex particles described herein can be obtained without an extrusion step.

[0399] The term "extrude" or "extrusion" refers to the creation of particles with a fixed cross-sectional profile. In particular, it refers to the downsizing of particles in which the particles are forced through a filter with defined pores.

[0400] Other methods that have organic solvent-free characteristics may also be used in accordance with the present disclosure to prepare colloids.

[0401] In some embodiments, RNA encapsulated in LNPs may be produced by rapid mixing of an RNA solution (e.g., an RNA product solution) described herein and a lipid preparation (e.g., comprising at least one cationic lipid and optionally one or more other lipid components in an organic solvent) described herein under conditions that trigger a sudden change in the solubility of the lipid components, driving the lipids toward self-assembly in the form of LNPs. In some embodiments, suitable buffering agents include tris, histidine, citrate, acetate, phosphate, or succinate. The pH of the liquid formulation is related to the pKa of the encapsulating agent (e.g., cationic lipid). The pH of the acidifying buffer may be at least half a pH scale lower than the pKa of the encapsulating agent (e.g., cationic lipid), and the pH of the final buffer may be at least half a pH scale higher than the pKa of the encapsulating agent (e.g., cationic lipid). In some embodiments, the properties of the cationic lipid are selected so that de novo formation of particles occurs by association with the oppositely charged backbone of the nucleic acid (e.g., RNA). In this way, particles are formed around the nucleic acid, which, for example, in some embodiments, can result in much higher encapsulation efficiencies than would be achieved in the absence of an interaction between the nucleic acid and at least one of the lipid components.

[0402] The encapsulation efficiency of a therapeutic and / or prophylactic agent describes the amount of therapeutic and / or prophylactic agent encapsulated or otherwise associated with the LNP after preparation compared to the initial amount provided. The encapsulation efficiency is desirably high (e.g., approaching 100%). The encapsulation efficiency may be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing lipid nanoparticles before and after disrupting the lipid nanoparticles with one or more organic solvents or detergents. Fluorescence may be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in solution. For the lipid nanoparticles described herein, the encapsulation efficiency of a therapeutic and / or prophylactic agent may be at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency may be at least 80%. In certain embodiments, the encapsulation efficiency may be at least 90%.

[0403] LNPs may optionally include one or more coatings. For example, LNPs may be formulated in capsules, films, or tablets with coatings. Capsules, films, or tablets containing the compositions described herein may have any useful size, tensile strength, hardness, or density.

[0404] Formulations comprising amphiphilic polymers and lipid nanoparticles may be formulated, in whole or in part, as pharmaceutical compositions. Pharmaceutical compositions may comprise one or more amphiphilic polymers and one or more lipid nanoparticles. For example, pharmaceutical compositions may comprise one or more lipid nanoparticles containing one or more amphiphilic polymers and one or more different therapeutic and / or prophylactic agents. Pharmaceutical compositions may further comprise one or more pharmaceutically acceptable excipients or accessory components, such as those described herein. General guidelines for the formulation and production of pharmaceutical compositions and agents are available, for example, in Remington's The Science and Practice of Pharmacy, 21st Edition, A.R. Gennaro; Lippincott, Williams & Wilkins, Baltimore, MD, 2006. Conventional excipients and accessory components may be used in any pharmaceutical composition, except insofar as they may be incompatible with one or more components of the LNPs or one or more amphiphilic polymers in the formulations of the present disclosure. An excipient or accessory component may be incompatible with a component or amphiphilic polymer of the LNP of the formulation if its combination with the component or amphiphilic polymer may result in any undesirable biological or other adverse effects.

[0405] In some embodiments, one or more excipients or accessory ingredients may comprise more than 50% of the total mass or volume of a pharmaceutical composition comprising an LNP. For example, one or more excipients or accessory ingredients may comprise 50%, 60%, 70%, 80%, 90%, or more of the pharmaceutical composition. In some embodiments, a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% pure. In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient meets the standards of the United States Pharmacopoeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia. The relative amounts of one or more amphiphilic polymers, one or more lipid nanoparticles, one or more pharmaceutically acceptable excipients, and / or any additional components in a pharmaceutical composition according to the present disclosure will vary depending on the identity, size, and / or condition of the subject being treated, as well as the route by which the composition is administered. As an example, the pharmaceutical composition may contain 0.1% to 100% (wt wt) of one or more lipid nanoparticles. As another example, the pharmaceutical composition may contain 0.1% to 15% (wt / vol) of one or more amphiphilic polymers (e.g., 0.5%, 1%, 2.5%, 5%, 10%, or 12.5% ​​w / v).

[0406] In certain embodiments, the lipid nanoparticles and / or pharmaceutical compositions of the present disclosure are refrigerated or frozen for storage and / or transport (e.g., stored at 4°C or lower, e.g., about -150°C to about 0°C or about -80°C to about -20°C (e.g., about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C, or -150°C)). For example, a pharmaceutical composition comprising one or more amphiphilic polymers and one or more lipid nanoparticles is a solution or solid (e.g., via lyophilization) that is refrigerated for storage and / or transport, e.g., at about -20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or -80°C. In certain embodiments, the present disclosure also relates to methods for increasing the stability of lipid nanoparticles by adding an effective amount of an amphiphilic polymer and storing the lipid nanoparticles and / or pharmaceutical compositions thereof at a temperature of 4°C or lower, such as from about -150°C to about 0°C or from about -80°C to about -20°C, e.g., from about -5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C or -150°C.

[0407] The chemical properties of the LNPs, LNP suspensions, lyophilized LNP compositions, or LNP formulations of the present disclosure may be characterized by various methods. In some embodiments, electrophoresis (e.g., capillary electrophoresis) or chromatography (e.g., reverse-phase liquid chromatography) may be used to examine mRNA integrity.

[0408] In some embodiments, the LNP integrity of the LNPs, LNP suspensions, lyophilized LNP compositions, or LNP formulations of the present disclosure is about 20% or higher, about 25% or higher, about 30% or higher, about 35% or higher, about 40% or higher, about 45% or higher, about 50% or higher, about 55% or higher, about 60% or higher, about 65% or higher, about 70% or higher, about 75% or higher, about 80% or higher, about 85% or higher, about 90% or higher, about 95% or higher, about 96% or higher, about 97% or higher, about 98% or higher, or about 99% or higher.

[0409] In some embodiments, the LNP integrity of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation of the present disclosure is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, or about 2-fold or more than the LNP integrity of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation produced by a comparable method. greater than, about 3 times or more, about 4 times or more, about 5 times or more, about 10 times or more, about 20 times or more, about 30 times or more, about 40 times or more, about 50 times or more, about 100 times or more, about 200 times or more, about 300 times or more, about 400 times or more, about 500 times or more, about 1000 times or more, about 2000 times or more, about 3000 times or more, about 4000 times or more, about 5000 times or more, or about 10000 times or more higher.

[0410] In some embodiments, the Txo% of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation of the present disclosure is about 12 months or longer, about 15 months or longer, about 18 months or longer, about 21 months or longer, about 24 months or longer, about 27 months or longer, about 30 months or longer, about 33 months or longer, about 36 months or longer, about 48 months or longer, about 60 months or longer, about 72 months or longer, about 84 months or longer, about 96 months or longer, about 108 months or longer, or about 120 months or longer.

[0411] In some embodiments, the Txo% of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation of the present disclosure is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, or about 5-fold or more longer than the Txo% of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation produced by a comparable method.

[0412] In some embodiments, the T1 / 2 of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation of the present disclosure is about 12 months or longer, about 15 months or longer, about 18 months or longer, about 21 months or longer, about 24 months or longer, about 27 months or longer, about 30 months or longer, about 33 months or longer, about 36 months or longer, about 48 months or longer, about 60 months or longer, about 72 months or longer, about 84 months or longer, about 96 months or longer, about 108 months or longer, or about 120 months or longer.

[0413] In some embodiments, the T1 / 2 of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation of the present disclosure is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, or about 5-fold or more longer than the T1 / 2 of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation produced by a comparable method.

[0414] As used herein, "Tx" refers to the amount of time allowed for the nucleic acid integrity (e.g., mRNA integrity) of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation to deteriorate to about X of the initial integrity of the nucleic acid (e.g., mRNA) used to prepare the LNP, LNP suspension, lyophilized LNP composition, or LNP formulation. For example, "T80%" refers to the amount of time allowed for the nucleic acid integrity (e.g., mRNA integrity) of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation to deteriorate to about 80% of the initial integrity of the nucleic acid (e.g., mRNA) used to prepare the LNP, LNP suspension, lyophilized LNP composition, or LNP formulation. For another example, "T1 / 2" refers to the amount of time it takes for the nucleic acid integrity (e.g., mRNA integrity) of an LNP, LNP suspension, lyophilized LNP composition, or LNP formulation to deteriorate to about 1 / 2 of the initial integrity of the nucleic acid (e.g., mRNA) used to prepare the LNP, LNP suspension, lyophilized LNP composition, or LNP formulation.

[0415] In certain embodiments, nucleic acid is resistant to nuclease degradation in aqueous solution when present in lipid nanoparticles.The lipid nanoparticles that contain nucleic acid and their preparation method are disclosed in, for example, US Patent Application Publication No. 2004 / 0142025, US Patent Application Publication No. 2007 / 0042031 and PCT International Publication No. 2013 / 016058 and PCT International Publication No. 2013 / 086373, the entire disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0416] Some embodiments described herein relate to compositions, methods, and uses involving more than one nucleic acid species, for example, two, three, four, five, six, or even more nucleic acid species, such as RNA species. In an LNP formulation, each nucleic acid species can be formulated separately as an individual LNP formulation. In that case, each individual LNP formulation contains one nucleic acid species. The individual LNP formulations may exist as separate entities, for example, in separate containers. Such formulations can be obtained by providing each nucleic acid species separately (typically each in the form of a nucleic acid-containing solution) with suitable cationic or cationically ionizable lipids or lipid-like materials and cationic polymers that allow the formation of LNPs. Each particle exclusively contains the unique nucleic acid species provided when the particle is formed (individual particulate formulation).

[0417] In some embodiments, a composition, for example, a pharmaceutical composition, comprises more than one individual LNP formulation. Each pharmaceutical composition is referred to as a mixed LNP formulation. The mixed LNP formulation according to the present invention can be obtained by forming each individual LNP formulation separately as described above, and then mixing the individual LNP formulations. The mixing step can result in a formulation comprising a mixed population of nucleic acid-containing LNPs. The individual LNP populations can be together in one container, comprising a mixed population of individual LNP formulations.

[0418] Alternatively, different nucleic acid species can be formulated together as a combined LNP preparation.This preparation can be obtained by providing a combined preparation (typically a combined solution) of different RNA species together with suitable cationic or cationically ionizable lipid or lipid-like material and cationic polymer that allows LNP formation.In contrast to mixed LNP preparations, combined LNP preparations typically comprise LNPs that contain more than one RNA species.In combined LNP compositions, different RNA species are typically present together in a single particle.

[0419] The lipid component of the LNP may include, for example, a cationic lipid, a phospholipid (e.g., an unsaturated lipid, such as DOPE or DSPC), a PEG lipid, and a structural lipid. The elements of the lipid component may be provided in a specific ratio.

[0420] In some embodiments, the LNP further comprises a phospholipid, a PEG lipid, a structured lipid, or any combination thereof. Suitable phospholipids, PEG lipids, and structured lipids for the methods of the present disclosure are further disclosed herein.

[0421] In some embodiments, the lipid component of the LNP comprises a cationic lipid, a phospholipid, a PEG lipid, and a structural lipid. In certain embodiments, the lipid component of the lipid nanoparticle comprises about 30 mol% to about 60 mol% of a cationic lipid, about 0 mol% to about 30 mol% of a phospholipid, about 18.5 mol% to about 48.5 mol% of a structural lipid, and about 0 mol% to about 10 mol% of a PEG lipid, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the lipid nanoparticle comprises about 35 mol% to about 55 mol% of a cationic lipid compound, about 5 mol% to about 25 mol% of a phospholipid, about 30 mol% to about 40 mol% of a structural lipid, and about 0 mol% to about 10 mol% of a PEG lipid. In certain embodiments, the lipid component comprises about 50 mol% of the cationic lipid, about 10 mol% of a phospholipid, about 38.5 mol% of a structural lipid, and about 1.5 mol% of a PEG lipid. In another specific embodiment, the lipid component comprises about 40 mol% of the cationic lipid, about 20 mol% of phospholipid, about 38.5 mol% of structural lipid, and about 1.5 mol% of PEG lipid.In some embodiments, the phospholipid can be DOPE or DSPC.In other embodiments, the PEG lipid can be PEG-DMG, and / or the structural lipid can be cholesterol.

[0422] The amount of therapeutic and / or prophylactic agent in an LNP may depend on the size, composition, desired target and / or application, or other properties of the lipid nanoparticle, as well as the characteristics of the therapeutic and / or prophylactic agent. For example, the amount of RNA useful in an LNP may depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and / or prophylactic agent (i.e., pharmaceutical agent) and other elements (e.g., lipids) in the LNP may also vary. In some embodiments, the wt / wt ratio of lipid component to therapeutic and / or prophylactic agent in an LNP may be from about 5:1 to about 60:1, e.g., 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. For example, the wt / wt ratio of lipid component to therapeutic and / or prophylactic agent can be about 10:1 to about 40:1. In certain embodiments, the wt / wt ratio is about 20:1. The amount of therapeutic and / or prophylactic agent in the LNP can be measured, for example, using absorption spectroscopy (e.g., UV-visible spectroscopy).

[0423] A. Cationic polymer materials Given their high degree of chemical flexibility, polymeric materials are commonly used for nanoparticle-based delivery. Typically, cationic materials are used to electrostatically condense negatively charged nucleic acids into nanoparticles. These positively charged groups are often composed of amines that change protonation state in the pH range of 5.5 to 7.5, which is thought to lead to an ionic imbalance resulting in endosomal rupture. In addition to polymers such as poly-L-lysine, polyamidoamine, protamine, and polyethyleneimine, naturally occurring polymers such as chitosan have all been applied to nucleic acid delivery and are suitable as cationic materials useful in some embodiments herein. Additionally, some researchers have synthesized polymeric materials specifically for nucleic acid delivery. Poly(P-amino esters), in particular, have gained widespread use in nucleic acid delivery due to their ease of synthesis and biodegradability. In some embodiments, such synthetic materials may be suitable for use as cationic materials herein.

[0424] As used herein, "polymeric material" is given its ordinary meaning, e.g., a molecular structure comprising one or more repeating units (monomers) connected by covalent bonds. In some embodiments, all of these repeating units may be identical; alternatively, in some cases, more than one type of repeating unit may be present in the polymeric material. In some cases, the polymeric material is biologically derived, e.g., a biopolymer, e.g., a protein. In some cases, additional moieties may also be present in the polymeric material, such as targeting moieties, e.g., the targeting moieties described herein.

[0425] Those skilled in the art will recognize that when more than one type of repeat unit is present within a polymer (or polymer portion), the polymer (or polymer portion) is said to be a "copolymer." In some embodiments, a polymer (or polymer portion) utilized in accordance with the present disclosure may be a copolymer. The repeat units forming the copolymer may be arranged in any manner. For example, in some embodiments, the repeat units may be arranged in random order; alternatively or additionally, in some embodiments, the repeat units may be arranged in alternating order, or as a "block" copolymer, including, for example, one or more regions (e.g., first blocks) each comprising a first repeat unit and one or more regions (e.g., second blocks) each comprising a second repeat unit. A block copolymer may have two (diblock copolymer), three (triblock copolymer), or more distinct blocks.

[0426] In certain embodiments, the polymeric material for use according to the present disclosure is biocompatible.A biocompatible material is a material that does not typically result in significant cell death at moderate concentrations.In certain embodiments, the biocompatible material is biodegradable, for example, can be degraded chemically and / or biologically in a physiological environment, for example, in the body.In certain embodiments, the polymeric material can be or include protamine or polyalkyleneimine, particularly protamine.

[0427] As those skilled in the art will recognize, the term "protamine" is often used to refer to any of a variety of relatively low molecular weight, strongly basic proteins that are rich in arginine and are found in the sperm cells of various animals (e.g., fish) in particular in association with DNA instead of somatic histones. In particular, the term "protamine" is often used to refer to a protein found in fish sperm that is strongly basic, soluble in water, heat-resistant, and hydrolyzes to yield mainly arginine. In purified form, they are used in long-acting formulations of insulin and to neutralize the anticoagulant effect of heparin.

[0428] In some embodiments, the term "protamine," as used herein, refers to a polypeptide that is artificial and specifically designed for a specific purpose and cannot be isolated from a native or biological source (synthetic), as well as a protamine amino acid sequence obtained or derived from a natural or biological source, including fragments of the amino acid sequence and / or multimeric forms of the amino acid sequence or fragments thereof.

[0429] In some embodiments, the polyalkyleneimine comprises polyethyleneimine and / or polypropyleneimine. In some embodiments, the polyalkyleneimine is polyethyleneimine (PEI). In some embodiments, the polyalkyleneimine is a linear polyalkyleneimine, for example, linear polyethyleneimine (PEI).

[0430] Cationic materials (e.g., polymeric materials, including polycationic polymers) contemplated for use herein include those that can electrostatically bind to nucleic acids. In some embodiments, cationic polymeric materials contemplated for use herein include any cationic polymeric material with which nucleic acids can be associated, for example, by forming a complex with the nucleic acid or by forming vesicles in which the nucleic acid is surrounded or encapsulated.

[0431] In some embodiments, the particles described herein may include polymers other than cationic polymers, such as non-cationic and / or anionic polymeric materials. Collectively, anionic and neutral polymeric materials are referred to herein as non-cationic polymeric materials.

[0432] B. Lipids & Lipid-Like Materials The terms "lipid" and "lipid-like material" are used herein to refer to molecules that contain one or more hydrophobic moieties or groups, and optionally also contain one or more hydrophilic moieties or groups. According to the present disclosure, lipids and lipid-like materials may be cationic, anionic, or neutral. Neutral lipids or lipid-like materials exist in uncharged or neutral zwitterionic form at a selected pH.

[0433] The term "lipid" refers to a group of organic compounds characterized by being insoluble in water but soluble in many organic solvents. Generally, lipids can be divided into eight categories: fatty acids and their derivatives (including tri-, di-, and monoglycerides, and phospholipids), glycerolipids, glycerophospholipids, sphingolipids, glycolipids, polyketides, sterol lipids as well as sterol-containing metabolites, such as cholesterol, and prenol lipids. Examples of fatty acids include, but are not limited to, fatty esters and fatty amides. Examples of glycerolipids include, but are not limited to, glycosylglycerol and glycerophospholipids (e.g., phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine). Examples of sphingolipids include, but are not limited to, ceramide sphingophospholipids (e.g., sphingomyelin, phosphocholine), and glycosphingolipids (e.g., cerebrosides, gangliosides). Examples of sterol lipids include, but are not limited to, cholesterol and its derivatives and tocopherol and its derivatives.

[0434] The term " lipid-like material ", " lipid-like compound " or " lipid-like molecule " refers to a substance that is structurally and / or functionally related to lipid, but may not be considered as lipid in the strict sense.For example, this term includes compounds that can form amphiphilic layers when present in vesicles, multilamellar / unilamellar liposomes, or membranes in aqueous environments, and also includes surfactants or synthetic compounds that have both hydrophilic and hydrophobic parts.Generally, this term refers to molecules that contain hydrophilic and hydrophobic parts with different structural organization, which may or may not be similar to that of lipid.

[0435] In some embodiments, the RNA solution and its lipid preparation mixture or composition may contain cationic lipids, neutral lipids, cholesterol, and / or lipids conjugated with polymers (e.g., polyethylene glycol) to form lipid nanoparticles that contain RNA molecules. Thus, in some embodiments, the LNP may contain cationic lipids and one or more excipients, such as one or more neutral lipids, charged lipids, steroids or steroid analogs (e.g., cholesterol), lipids conjugated to polymers (e.g., PEG lipids), or combinations thereof. In some embodiments, the LNP contains or encapsulates nucleic acid molecules.

[0436] i. Cationic lipids Cationic or cationically ionizable lipid or lipid-like material refers to a lipid or lipid-like material that has the ability to be positively charged and can electrostatically bind to nucleic acid.As used herein, "cationic lipid" or "cationic lipid-like material" refers to a lipid or lipid-like material that has a net positive charge.Cationic lipid or lipid-like material binds to negatively charged nucleic acid through electrostatic interaction.Generally, cationic lipids have a lipophilic portion, such as a sterol, an acyl chain, a diacyl or more acyl chain, and the head group of the lipid typically has a positive charge.Exemplary cationic lipids contain one or more amine groups that are positively charged.Cationic lipids can also encapsulate negatively charged RNA.

[0437] In some embodiments, cationic lipid can be ionized, so that it can exist in positively charged or neutral form depending on pH.The ionization of cationic lipid affects the surface charge of lipid nanoparticles under different pH conditions.Without wanting to be bound by theory, it is believed that this ionizable behavior enhances efficacy by aiding in endosomal escape and reducing toxicity compared with particles that remain cationic at physiological pH.For the purpose of the present disclosure, such " cationically ionizable " lipid or lipid-like material is included in the term " cationic lipid " or " cationic lipid-like material ", unless the context is inconsistent.

[0438] In some embodiments, the cationic lipid may comprise about 10 mol% to about 100 mol%, about 20 mol% to about 100 mol%, about 30 mol% to about 100 mol%, about 40 mol% to about 100 mol%, or about 50 mol% to about 100 mol% of the total lipid present in the particle. In some embodiments, the cationic lipid may be at least 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, or 100 mol%, up to 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, or 100 mol%, exactly 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, or 100 mol%, or between any two of 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, 90 mol%, or 100 mol%, or any range or value derivable therein of the total lipid present in the particle.

[0439] Examples of cationic lipids include ((4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate); 1,2-dioleoyl-3-trimethylammonium propane (DOTAP); N,N-dimethyl-2,3-dioleyloxypropylamine (DODMA), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethyldioctadecylammonium (DDAB), and dimethyldioctadecylammonium (DDAB). ); 1,2-dioleoyl-3-dimethylammonium-propane (DODAP); 1,2-diacyloxy-3-dimethylammonium propane; 1,2-dialkyloxy-3-dimethylammonium propane; dioctadecyldimethylammonium chloride (DODAC), 1,2-distearyloxy-N,N-dimethyl-3-aminopropane (DSDMA), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazanium (DMRIE), 1,2-dimyristoyl-sn-glycero-3-ethylphosphocholine ( DMEPC), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), and 2,3-dioleoyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-l-propanaminium trifluoroacetate (DOSPA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N,N-dimethylaminopropane (DLenD). MA), dioctadecylamidoglycylspermine (DOGS), 3-dimethylamino-2-(cholest-5-ene-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane (CLinDMA), 2-[5'-(cholest-5-ene-3-beta-oxy)-3'-oxapentoxy)-3-dimethyl-l-(cis,cis-9',12'-octadecadienoxy)propane (CpLinDMA), N,N-dimethyl-3,4-dioleyloxybenzylamine (DMOBA), 1,2-N,N'-Dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), 2,3-Dilinoleoyloxy-N,N-dimethylpropylamine (DLinDAP), 1,2-N,N'-Dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), 1,2-Dilinoleoylcarbamyl-3-dimethylaminopropane (DLinCDAP), 2,2-Dilinoleyl-4-dimethylaminomethyl-[ 1,3]-dioxolane (DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-K-XTC2-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl-4-(dimethylamino)butanoate (DLin-MC3-DM A), N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (DMRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(cis-9-tetradecenyloxy)-1-propanaminium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(dodecyloxy)-1-propanaminium bromide (GAP-DLRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-l-propanaminium bromide (GAP- DMRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanaminium bromide (bAE-DMRIE), N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propanamin-1-aminium (DOBAQ), 2-({8-[(3b)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), 1,2-dimyristoyl-3-dimethylammonium-propane (DMDAP), 1,2-Dipalmitoyl-3-dimethylammonium-propane (DPDAP), N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-amino-propyl)amino]butylcarboxamido)ethyl]-3,4-di[oleyloxy]-benzamide (MVL5), 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (DOEPC), 2,3-bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N-dimethylpropane -1-ammonium bromide (DLRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)propan-1-aminium bromide (DMORIE), di((Z)-non-2-en-l-yl)8,8'-((((2(dimethylamino)ethyl)thio)carbonyl)azanediyl)dioctanoate (ATX), N,N-dimethyl-2,3-bis(dodecyloxy)propan-1-amine (DLDMA), N,N-dimethyl-2,3- Bis(tetradecyloxy)propan-1-amine (DMDMA), di((Z)-non-2-en-l-yl)-9-((4-(dimethylaminobutanoyl)oxy)heptadecanedioate (L319), N-dodecyl-3-((2-dodecylcarbamoyl-ethyl)-{2-[(2-dodecylcarbamoyl-ethyl)-2-{(2-dodecylcarbamoyl-ethyl)-[2-(2-dodecylcarbamoyl-ethylamino)-ethyl]-amino}-ethylamino)propionate onamide (Lipidoid 98N12-5), 1-[2-[bis(2-hydroxydodecyl)amino]ethyl-[2-[4-[2-[bis(2hydroxydodecyl)amino]ethyl]piperazin-1-yl]ethyl]amino]dodecan-2-ol (Lipidoid 02-200); or heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102).

[0440] In some embodiments, the lipid nanoparticles comprise one or more cationic lipids. In one embodiment, the lipid nanoparticles have the formula:

[0441] [ka] Cationic lipids include (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315), which has the formula: Cationic lipids are disclosed, for example, in U.S. Pat. No. 10,166,298, the entire disclosure of which is incorporated herein by reference in its entirety for all purposes. Representative cationic lipids include:

[0442] [Table 1-1]

[0443] [Table 1-2]

[0444] [Table 1-3]

[0445] [Table 1-4]

[0446] [Table 1-5]

[0447] [Table 1-6]

[0448] In some embodiments, RNA-LNPs comprise cationic lipids, RNA molecules as described herein, and one or more of neutral lipids, steroids, PEGylated lipids, or combinations thereof.If more than one cationic lipid is incorporated into the LNP, such percentages apply to the combined cationic lipids.In one embodiment, the cationic lipids are, for example, at least 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 mole percent, and up to 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 mole percent, respectively. , 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 mole percent, or an amount between any two of about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 mole percent.

[0449] In some embodiments of the present disclosure, the LNPs comprise a combination or mixture of any of the lipids described above.

[0450] ii. Polymer-conjugated lipids In some embodiments, the LNP comprises a lipid conjugated to a polymer. The term "lipid conjugated to a polymer" refers to a molecule comprising both a lipid portion and a polymer portion. An example of a lipid conjugated to a polymer is a PEGylated lipid. The term "PEGylated lipid" refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. PEGylated lipids are known in the art and include 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-s-DMG) and 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, etc.

[0451] In certain embodiments, the LNP contains an additional stabilizing lipid, which is a polyethylene glycol lipid (PEGylated lipid). A polymer-conjugated lipid (e.g., a PEG lipid) refers to a molecule containing both a lipid portion and a polymer portion. An example of a polymer-conjugated lipid is a PEG lipid. A PEG lipid refers to a molecule containing both a lipid portion and a polyethylene glycol portion. PEG lipids include, but are not limited to, PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, PEG-modified diacylglycerol, and PEG-modified dialkylglycerol. Representative polyethylene glycol lipids include PEG-c-DOMG, PEG-c-DMA, and PEG-s-DMG. In one embodiment, the polyethylene glycol lipid is N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA). In one embodiment, the polyethylene glycol lipid is PEG-2000-DMG. In one embodiment, the polyethylene glycol lipid is PEG-c-DOMG. In other embodiments, the LNP comprises a PEGylated diacylglycerol (PEG-DAG), such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG), a PEGylated phosphatidylethanolamine (PEG-PE), a PEG succinate diacylglycerol (PEG-S-DAG), such as 4-O-(2',3'-di(tetradecanoyloxy)propyl-1-O-((o-methoxy(polyethoxy)ethyl)butanedioate (PEG-S-DMG), a PEGylated ceramide (PEG-cer), or a PEG dialkoxypropyl carbamate, such as co-methoxy(polyethoxy)ethyl-N-(2,3-di(tetradecanoyloxy)propyl)carbamate or 2,3-di(tetradecanoyloxy)propyl-N-(u>-methoxy(polyethoxy)ethyl)carbamate.PEG lipids are disclosed, for example, in US Pat. No. 9,737,619, the entire disclosure of which is incorporated herein by reference in its entirety for all purposes.

[0452] In some embodiments, the lipid nanoparticles comprise a lipid conjugated to a polymer. In one embodiment, the lipid nanoparticles have the formula:

[0453] [ka] The compound includes 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159), having the formula:

[0454] In another aspect, the polymer may be selected from, but is not limited to, polyamines, polyethers, polyamides, polyesters, polycarbamates, polyureas, polycarbonates, polystyrenes, polyimides, polysulfones, polyurethanes, polyacetylenes, polyethylenes, polyethyleneimines, polyisocyanates, polyacrylates, polymethacrylates, polyacrylonitriles, and polyarylates. For example, polymers may be poly(caprolactone) (PCL), ethylene vinyl acetate polymer (EVA), poly(lactic acid) (PLA), poly(L-lactic acid) (PLLA), poly(glycolic acid) (PGA), poly(lactic-co-glycolic acid) (PLGA), poly(L-lactic-co-glycolic acid) (PLLGA), poly(D,L-lactide) (PDLA), poly(L-lactide) (PLLA), poly(D,L-lactide-co-caprolactone), poly(D,L-lactide-co-caprolactone-co-glycolide), poly(D,L-lactide-co-PEO-co-D,L-lact ...).L-lactide), polyalkyl cyanoacrylates, polyurethanes, poly-L-lysine (PLL), hydroxypropyl methacrylate (HPMA), polyethylene glycol, poly-L-glutamic acid, poly(hydroxy acids), polyanhydrides, polyorthoesters, poly(ester amides), polyamides, poly(ester ethers), polycarbonates, polyalkylenes such as polyethylene and polypropylene, polyalkylene glycols such as poly(ethylene glycol) (PEG), polyalkylene oxides (PEO), polyalkylene terephthalates such as poly(ethylene terephthalate), polyvinyl alcohol (PVA), polyvinyl ethers, polyvinyl esters such as poly(vinyl acetate), polyvinyl halides such as poly(vinyl chloride) (PVC), polyvinylpyrrolidone (PVP), polysiloxanes, polystyrene, polyurethanes, derivatized celluloses such as alkyl celluloses, hydroxyalkyl celluloses, cellulose ethers, cellulose esters, nitrocellulose, hydroxypropyl cellulose, carboxymethyl Cellulose, polymers of acrylic acid, such as poly(methyl (meth)acrylate) (PMMA), poly(ethyl (meth)acrylate), poly(butyl (meth)acrylate), poly(isobutyl (meth)acrylate), poly(hexyl (meth)acrylate), poly(isodecyl (meth)acrylate), poly(lauryl (meth)acrylate), poly(phenyl (meth)acrylate), poly(methyl acrylate), poly(isopropyl acrylate), poly(isobutyl acrylate), poly(octadecyl acrylate) and copolymers and mixtures thereof, polydioxanone and its copolymers, polyhydroxyalkanoates, polypropylene fumarates, polyoxymethylene, poloxamers, poloxamines, poly(ortho)esters, poly(butyric acid), poly(valeric acid), poly(lactide-co-caprolactone), trimethylene carbonate, poly(N-acryloylmorpholine) (PAcM), poly(2-methyl-2-oxazoline) (PMOX), poly(2-ethyl-2-oxazoline) (PEOZ), and polyglycerol.

[0455] In various embodiments, the molar ratio of cationic lipid to PEGylated or polymeric lipid is from about 100:1 to about 20:1, e.g., about 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, 55:1, 60:1, 65:1, 70:1, 75:1, 80:1, 85:1, 90:1, 95:1, or 100:1, or any range or value derivable therein.

[0456] In certain embodiments, the PEG-lipid or polymeric lipid is present in the LNP in an amount of about 1 to about 10 mole percent (mol%) (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mol%, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mol%, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mol%, or between any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mol%) relative to the total lipid content of the nanoparticle.

[0457] iii. Additional lipids In certain embodiments, LNP comprises one or more additional lipids or lipid-like materials that stabilize the formation of particles during their formation.Suitable stabilizing or structural lipids include non-cationic lipids, such as neutral lipids and anionic lipids.Without being bound by any theory, optimizing the formulation of LNP by adding other hydrophobic moieties, such as cholesterol and lipids, in addition to ionizable / cationic lipids or lipid-like materials can enhance particle stability and the effectiveness of nucleic acid delivery.

[0458] As used herein, " anionic lipid " refers to any lipid that is negatively charged at selected pH. The term " neutral lipid " refers to any one of a number of lipid species that exist in either uncharged or neutral zwitterionic form at physiological pH. In some embodiments, the additional lipid comprises one of the following neutral lipid components: (1) phospholipid, (2) cholesterol or its derivative; or (3) a mixture of phospholipid and cholesterol or its derivative.

[0459] Representative neutral lipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidic acid, phosphatidylserine, ceramide, sphingomyelin, dihydro-sphingomyelin, cephalin, and cerebrosides.Exemplary phospholipids include, for example, phosphatidylcholines, e.g., diacylphosphatidylcholines, such as distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), dipentadecanoylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), diarachidoylphosphatidylcholine (DPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), diarachidoylphosphatidylcholine (DPC), dioleoylphosphatidylcholine (DPPG), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DPPG), dioleoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dioleoylphosphatidylglycerol (DPPG), dioleoylphosphatidylcholine (DPPC ... phatidylcholine (DAPC), dibehenoylphosphatidylcholine (DBPC), ditricosanoylphosphatidylcholine (DTPC), dilignoceroylphatidylcholine (DLPC), palmitoyloleoyl-phosphatidylcholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 diether PC), l-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), and 1-hexadecyl-sn-glycero-3-phosphocholine (OChemsPC). C16 lyso-PC); and phosphatidylethanolamines, such as diacylphosphatidylethanolamines, such as dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE) ), dimyristoylphosphoethanolamine (DMPE), dilauroyl-phosphatidylethanolamine (DLPE), distearoyl-phosphatidylethanolamine (DSPE), diphytanoyl-phosphatidylethanolamine (DpyPE), 16-O-monomethylPE, 16-O-dimethylPE, 18-1-transPE, 1-stearoyl-2-oleoylphosphatidylethanolamine (SOPE), and 1,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (transDOPE). In one embodiment, the neutral lipid is of the formula:

[0460] [ka] The compound is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), having the formula:

[0461] In some embodiments, the LNP comprises a neutral lipid, and the neutral lipid comprises one or more of DSPC, DPPC, DMPC, DOPC, POPC, DOPE, or SM.

[0462] In various embodiments, the LNP further comprises a steroid or steroid analog. A "steroid" is a compound having the following carbon skeleton:

[0463] [ka] It is a compound comprising:

[0464] In certain embodiments, steroid or steroid analogue is cholesterol.Examples of cholesterol derivatives include but are not limited to cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2'-hydroxyethyl ether, cholesteryl-4'-hydroxybutyl ether, tocopherol and their derivatives, and their mixtures.In one embodiment, cholesterol is represented by the formula:

[0465] [ka] It has.

[0466] Without being bound by any theory, the amount of at least one cationic lipid relative to the amount of at least one additional lipid can affect important nucleic acid particle characteristics, such as nucleic acid charge, particle size, stability, tissue selectivity, and biological activity.Thus, in some embodiments, the molar ratio of cationic lipid to neutral lipid is within the range of about 2:1 to about 8:1, or about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1.

[0467] In some embodiments, non-cationic lipids, e.g., neutral lipids (e.g., one or more phospholipids and / or cholesterol), may comprise from about 0 mol% to about 90 mol%, from about 0 mol% to about 80 mol%, from about 0 mol% to about 70 mol%, from about 0 mol% to about 60 mol%, or from about 0 mol% to about 50 mol% of the total lipid present in the particle. In some embodiments, non-cationic lipids, e.g., neutral lipids (e.g., one or more phospholipids and / or cholesterol), may represent at least 0 mol%, 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, or 90 mol%, up to 0 mol%, 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, or 90 mol%, exactly 0 mol%, 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, or 90 mol%, or between any two of 0 mol%, 10 mol%, 20 mol%, 30 mol%, 40 mol%, 50 mol%, 60 mol%, 70 mol%, 80 mol%, or 90 mol% of the total lipids present in the particle.

[0468] C. Other Materials Surface-modifying agents may include, but are not limited to, anionic proteins (e.g., bovine serum albumin), surfactants (e.g., cationic surfactants, such as dimethyldioctadecyl-ammonium bromide), sugars or sugar derivatives (e.g., cyclodextrin), nucleic acids, polymers (e.g., heparin, polyethylene glycol, and poloxamer), mucolytic agents (e.g., acetylcysteine, artemisia princeps, bromelain, papain, clerodendrum, bromhexine, carbocysteine, eprazinone, mesna, ambroxol, sobrerol, domiodol, letosteine, stepronin, tiopronin, gelsolin, thymosin β4, dornase alfa, neltenexin, and erdosteine), and DNase (e.g., rhDNase). Surface-modifying agents may be disposed within the nanoparticle and / or on the surface of the LNP (e.g., by coating, adsorption, covalent linkage, or other process).

[0469] LNPs may also contain one or more functionalized lipids. For example, lipids may be functionalized with alkyne groups that can undergo cycloaddition when exposed to azide under appropriate reaction conditions. In particular, lipid bilayers may be functionalized in this manner with one or more groups useful for membrane permeabilization, cell recognition, or imaging. The surface of LNPs may also be conjugated with one or more useful antibodies. Functional groups and conjugates useful for targeted cell delivery, imaging, and membrane permeabilization are well known in the art.

[0470] In addition to these components, lipid nanoparticles may contain any substance useful in pharmaceutical compositions.For example, lipid nanoparticles may contain one or more pharmaceutically acceptable excipients or accessory components, such as, but not limited to, one or more solvents, dispersion media, diluents, dispersion aids, suspension aids, surfactants, buffers, preservatives, and other species.

[0471] Surfactants and / or emulsifiers include natural emulsifiers (e.g., acacia, alginic acid, sodium alginate, cholesterol, and lecithin), sorbitan fatty acid esters (e.g., polyoxyethylene sorbitan monolaurate [TWEEN® 20], polyoxyethylene sorbitan [TWEEN® 60], polyoxyethylene sorbitan monooleate [TWEEN® 80], sorbitan monopalmitate [SPAN® 40], sorbitan monostearate [SPAN® 60], sorbitan tristearate [SPAN® 65], glyceryl monooleate, sorbitan monooleate [SPAN® 80]), polyoxyethylene esters of fatty acids ... monolaurate [TWEEN® 60], polyoxyethylene sorbitan monooleate [TWEEN® 80]), polyoxyethylene sorbitan monolaurate [TWEEN® 80], polyoxyethylene sorbitan monopalmitate [SPAN® 40], polyoxyethylene sorbitan monostearate [SPAN® 60], polyoxyethylene sorbitan tristearate [SPAN® 65], glyceryl monooleate, sorbitan monooleate The cosmetic compositions may include, but are not limited to, oleic acid, cetearyl alcohol, PEG-40 oleic acid ...

[0472] Examples of preservatives may include, but are not limited to, antioxidants, chelating agents, free radical scavengers, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and / or other preservatives. Examples of antioxidants include, but are not limited to, alpha-tocopherol, ascorbic acid, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and / or sodium sulfite. Examples of chelating agents include ethylenediaminetetraacetic acid (EDTA), citric acid monohydrate, disodium edetate, dipotassium edetate, edetic acid, fumaric acid, malic acid, phosphoric acid, sodium edetate, tartaric acid, and / or trisodium edetate. Examples of antimicrobial preservatives include, but are not limited to, benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and / or thimerosal. Examples of antifungal preservatives include, but are not limited to, butylparaben, methylparaben, ethylparaben, propylparaben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and / or sorbic acid. Examples of alcohol preservatives include, but are not limited to, ethanol, polyethylene glycol, benzyl alcohol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoates, and / or phenylethyl alcohol. Examples of acidic preservatives include, but are not limited to, vitamin A, vitamin C, vitamin E, beta-carotene, citric acid, acetic acid, dehydroascorbic acid, ascorbic acid, sorbic acid, and / or phytic acid.Other preservatives include, but are not limited to, tocopherol, tocopheryl acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, GLYDANT PLUS®, PHENONIP®, methylparaben, GERMALL® 115, GERMABEN® II, NEOLONE™, KATHON™, and / or EUXYL®. Exemplary free radical scavengers include butylated hydroxytoluene (BHT or butylhydroxytoluene) or deferoxamine.

[0473] Examples of buffering agents include, but are not limited to, citrate buffer solution, acetate buffer solution, phosphate buffer solution, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, d-gluconic acid, calcium glycerophosphate, calcium lactate, calcium lactobionate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, amino-sulfonate buffers (e.g., HEPES), magnesium hydroxide, aluminum hydroxide, alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, and / or combinations thereof.

[0474] In some embodiments, formulations comprising LNPs may further comprise a salt, e.g., a chloride salt. In some embodiments, formulations comprising LNPs may further comprise a sugar, e.g., a disaccharide. In some embodiments, the formulation further comprises a sugar but does not comprise a salt, e.g., a chloride salt. In some embodiments, LNPs may further comprise one or more small hydrophobic molecules, such as a vitamin (e.g., vitamin A or vitamin E) or a sterol. Carbohydrates may include monosaccharides (e.g., glucose) and polysaccharides (e.g., glycogen and its derivatives and analogs).

[0475] The characteristics of LNP may depend on its components. For example, LNP containing cholesterol as a structural lipid may have different characteristics from LNP containing a different structural lipid. As used herein, the term "structured lipid" refers to sterol and also refers to lipids containing a sterol moiety. As defined herein, "sterol" is a subgroup of steroids consisting of steroid alcohols. In some embodiments, the structured lipid is a steroid. In some embodiments, the structured lipid is cholesterol. In some embodiments, the structured lipid is a cholesterol analog. In some embodiments, the structured lipid is alpha-tocopherol.

[0476] In some embodiments, the characteristics of LNP may depend on the absolute or relative amount of its components.For example, LNP that contains a higher molar fraction of phospholipids may have different characteristics from LNP that contains a lower molar fraction of phospholipids.The characteristics may also vary depending on the method and conditions of preparation of lipid nanoparticles.Generally, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.

[0477] The phospholipid moiety can be selected from the non-limiting group consisting of, for example, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.The fatty acid moiety can be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.Certain phospholipids can promote membrane fusion.In some embodiments, cationic phospholipids can interact with one or more negatively charged phospholipids in membranes (e.g., cell or intracellular membranes). The fusion of phospholipids to the membrane can allow one or more elements (e.g., therapeutic agents) of a lipid-containing composition (e.g., LNP) to pass through the membrane, enabling, for example, delivery of one or more elements to a target tissue. Non-natural phospholipid species, including natural species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes, are also contemplated. In some embodiments, phospholipids can be functionalized with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds) or crosslinked to one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, the alkyne group can undergo copper-catalyzed cycloaddition upon exposure to azide. Such reactions can be useful for functionalizing the lipid bilayer of nanoparticle compositions to facilitate membrane permeation or cellular recognition, or for conjugating nanoparticle compositions to useful components, such as targeting or imaging moieties (e.g., dyes). Phospholipids include, but are not limited to, glycerophospholipids, such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Phospholipids also include sphingophospholipids, such as sphingomyelin.In some embodiments, phospholipids useful or potentially useful in the present invention are analogs or variants of DSPC.

[0478] VI. Characterization and Analysis of RNA Molecules The RNA molecules described herein may be analyzed and characterized using various methods. Analysis may be performed before or after capping. Alternatively, analysis may be performed before or after polyA capture-based affinity purification. In another embodiment, analysis may be performed before or after additional purification steps, such as anion exchange chromatography. For example, RNA template quality may be determined using a Bioanalyzer chip-based electrophoresis system. In other embodiments, RNA template purity is analyzed using analytical reverse-phase HPLC, respectively. Capping efficiency may be analyzed, for example, using total nuclease digestion followed by MS / MS quantification of dinucleotide-capped species versus uncapped GTP species. In vitro efficacy may be analyzed, for example, by transfecting the RNA molecules into human cell lines. Protein expression of the polypeptide of interest may be quantified using methods such as ELISA or flow cytometry. Immunogenicity may be analyzed, for example, by transfecting the RNA molecules into cell lines indicative of innate immune stimulation, such as PBMCs. Cytokine induction may be analyzed, for example, using methods such as ELISA to quantify cytokines, such as interferon-α. Biodistribution may be analyzed, for example, by bioluminescence measurements.

[0479] In some embodiments, the RNA polynucleotides disclosed herein are characterized in that, when evaluated in an organism administered a composition or pharmaceutical preparation comprising the RNA polynucleotide, increased expression of a gene of interest (e.g., an antigen); increased duration of expression (e.g., prolonged expression) of the gene of interest (e.g., an antigen); increased expression and increased duration of expression (e.g., prolonged expression) of the gene of interest (e.g., an antigen); decreased interaction of the RNA polynucleotide with IFIT1; increased translation of the RNA polynucleotide is observed compared to a suitable reference.

[0480] In some embodiments, the reference includes an organism administered a similar RNA polynucleotide except that it lacks the m7(3'OMeG)(5')ppp(5')(2'OMeAi)pG2 cap. In some embodiments, the reference includes an organism administered a similar RNA polynucleotide except that it lacks the cap-proximal sequence disclosed herein. In some embodiments, the reference includes an organism administered a similar RNA polynucleotide except that it has a self-hybridizing sequence.

[0481] In some embodiments, the increased expression is determined at least 24 hours, at least 48 hours, at least 72 hours, at least 96 hours, or at least 120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, the increased expression is determined at least 24 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, the increased expression is determined at least 48 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, the increased expression is determined at least 72 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, the increased expression is determined at least 96 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide. In some embodiments, the increased expression is determined at least 120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide.

[0482] In some embodiments, the increased expression is determined about 24 to 120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide, hi some embodiments, the increased expression is determined about 24 to 110 hours, about 24 to 100 hours, about 24 to 90 hours, about 24 to 80 hours, about 24 to 70 hours, about 24 to 60 hours, about 24 to 50 hours, about 24 to 40 hours, about 24 to 30 hours, about 30 to 120 hours, about 40 to 120 hours, about 50 to 120 hours, about 60 to 120 hours, about 70 to 120 hours, about 80 to 120 hours, about 90 to 120 hours, about 100 to 120 hours, or about 110 to 120 hours after administration of a composition or pharmaceutical preparation comprising the RNA polynucleotide.

[0483] In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 2-fold to at least 10-fold. In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 2-fold. In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 3-fold. In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 4-fold. In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 6-fold. In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 8-fold. In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 10-fold.

[0484] In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is about 2-fold to about 50-fold. In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is about 2-fold to about 45-fold, about 2-fold to about 40-fold, about 2-fold to about 30-fold, about 2-fold to about 25-fold, about 2-fold to about 20-fold, about 2-fold to about 15-fold, about 2-fold to about 10-fold, about 2-fold to about 8-fold, about 2-fold to about 5-fold, about 5-fold to about 50-fold, about 10-fold to about 50-fold, about 15-fold to about 50-fold, about 20-fold to about 50-fold, about 25-fold to about 50-fold, about 30-fold to about 50-fold, about 40-fold to about 50-fold, or about 45-fold to about 50-fold.In some embodiments, the increase in expression of the gene of interest (e.g., antigen) is at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 41-fold, 42-fold, 43-fold, 44-fold, 45-fold, 46-fold, 47-fold , 48x, 49x, or 50x, up to 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 11x, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x, 20x, 21x, 22x, 23x, 24x, 25x, 26x, 27x, 28x, 29x, 30x, 31x, 32x, 33x, 34x, 35x, 36x, 37x, 38x, 39x, 40x, 41x, 42x, 43x, 44x, 45x, 46x, 47x, 48x, 49x, or 50x, exactly 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 11x, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x, 20x, 21x, 22x, 23x, 24x, 25x, 26x, 27x, 28x, 29x, 30x, 31x, 32x, 33x, 34x, 35x, 36x, 37x, 38x, 39x, 40x, 41x, 42x, 43x, 44x, 45x, 46x, 47x, 48x, 49x, or 50x, or 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, 10x, 11x, 12x, 13x, 14x, 15x, 16x, 17x, 18x, 19x, 20x, 21x, 22x, 23x, 24x, 25x, 26x, 27x, 28x, 29x, 30x, 31x, 32x, 33x, 34x, 35x, 36x, 37x, 38x, 39x, 40x, 41x, 42x, 43x, 44x, 45x, 46x, 47x, 48x, 49x, or 50x, or any range or value derivable therein.

[0485] In some embodiments, the increased expression (e.g., increased duration of expression) of the gene of interest (e.g., antigen) persists for at least 24 hours, 48 ​​hours, 72 hours, 96 hours, or 120 hours, up to 24 hours, 48 ​​hours, 72 hours, 96 hours, or 120 hour...

Claims

1. A ribonucleic acid polynucleotide (RNA) molecule comprising at least one open reading frame (ORF) encoding a FimH antigen polypeptide.

2. The RNA molecule of claim 1 , wherein the FimH antigen polypeptide is full-length, truncated, fragment or variant thereof.

3. The RNA molecule according to any one of claims 1 to 2, wherein the FimH antigen polypeptide comprises at least one mutation.

4. The RNA molecule of any one of claims 1 to 3, wherein the FimH antigen polypeptide comprises an amino acid sequence of Table 13, including but not limited to any of SEQ ID NOs: 1-64.

5. 5. The RNA molecule of any one of claims 1 to 4, wherein the FimH antigen polypeptide comprises FimH-DSG (SEQ ID NO:59), FimH-DSG triple mutant (G15A, G16A, V27A) (SEQ ID NO:62), FimHLD triple mutant (G15A, G16A, V27A) (SEQ ID NO:54), or an immunogenic fragment thereof.

6. The RNA molecule of any one of claims 1 to 5, wherein the FimH polypeptide has at least 90%, 95%, 96%, 97%, 98% or 99% identity to an amino acid sequence selected from SEQ ID NOs: 1 to 64.

7. The RNA molecule of any one of claims 1 to 6, wherein the RNA is fused to a C-terminal membrane targeting domain.

8. The RNA molecule of claim 7 , wherein the RNA molecule and the C-terminal membrane targeting domain are separated by a linker.

9. The RNA molecule of claim 8 , wherein the linker has the amino acid sequence GGSSGGG (SEQ ID NO: 74).

10. The RNA molecule according to any one of claims 7 to 9, wherein the C-terminal membrane targeting domain is derived from a viral glycoprotein.

11. The RNA molecule of claim 10, wherein the viral glycoprotein is selected from the group consisting of HSV gD, SARS-CoV2 spike protein, and human DAFgpi.

12. The RNA molecule of claim 9, wherein the C-terminal membrane targeting domain is an E. coli G peptide.

13. The RNA molecule of any one of claims 1 to 12, wherein the open reading frame is codon-optimized.

14. 12. The RNA molecule of claim 11, wherein the FimH antigen polypeptide comprises an amino acid sequence of Table 1, including but not limited to any of SEQ ID NO:82, SEQ ID NO:83, and SEQ ID NO:

84.

15. 15. The RNA molecule of claim 14, wherein the FimH antigen polypeptide comprises an amino acid sequence having SEQ ID NO:

84.

16. The RNA molecule of claim 12 , wherein the FimH antigen polypeptide comprises an amino acid sequence having SEQ ID NO:

85.

17. 17. The RNA molecule of any one of claims 1 to 16, wherein the open reading frame is transcribed from a nucleic acid sequence in Table 2, including but not limited to any of SEQ ID NO:66, SEQ ID NO:68, SEQ ID NO:70 or SEQ ID NO:

72.

18. 18. The RNA molecule of any one of claims 1 to 17, wherein the open reading frame comprises a nucleic acid sequence of Table 3, including but not limited to any of SEQ ID NOs: 82 to 85.

19. The RNA molecule of claim 18, wherein each uridine of any of SEQ ID NOs: 82 to 85 is replaced by 1-methyl-3'-pseudouridylyl (Ψ).

20. The RNA molecule of any one of claims 1 to 19, further comprising a 5' untranslated region (5'UTR).

21. The RNA molecule of claim 21 , wherein the 5′UTR comprises a nucleotide having SEQ ID NO:

75.

22. The RNA molecule of any one of claims 1 to 21, further comprising a 3' untranslated region (3'UTR).

23. The RNA molecule of claim 22, wherein the 3'UTR comprises a nucleotide having SEQ ID NO:

76.

24. 24. The RNA molecule of any one of claims 1 to 23, comprising a 5' cap portion.

25. 25. The RNA molecule of claim 24, wherein the 5' cap portion is m7G(5')ppp(5')(2'OMeA)pG.

26. 26. The RNA molecule of any one of claims 1 to 25, further comprising a 3' poly A tail.

27. 27. The RNA molecule of claim 26, wherein the polyA tail comprises a sequence having SEQ ID NO:

86.

28. 28. The RNA molecule of any one of claims 1 to 27, comprising a 5'UTR and a 3'UTR.

29. 29. The RNA molecule of any one of claims 1 to 28, comprising a 5' cap, a 5' UTR, and a 3' UTR.

30. 30. The RNA molecule of any one of claims 1 to 29, comprising a 5' cap, a 5' UTR, a 3' UTR, and a poly A tail.

31. 31. The RNA molecule of any one of claims 1 to 30, comprising stabilized RNA.

32. The RNA molecule of any one of claims 1 to 31, wherein the RNA comprises at least one modified nucleotide.

33. 33. The RNA molecule of claim 32, wherein the modified nucleotide is pseudouridine, 1-methyl-3'-pseudouridylyl, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, or 5-methoxyuridine or 2'-O-methyluridine.

34. The RNA molecule of claim 33, wherein the modified nucleotide is 1-methyl-3'-pseudouridylyl (Ψ).

35. The RNA molecule of any one of claims 1 to 25, wherein the RNA is mRNA.

36. A composition comprising an RNA molecule according to any one of claims 1 to 35, wherein the RNA molecule is formulated in a lipid nanoparticle (RNA-LNP).

37. 37. The composition of claim 36, wherein the lipid nanoparticle comprises at least one of a cationic lipid, a PEG lipid, a neutral lipid, and a steroid or steroid analog.

38. 38. The composition of claim 36 or 37, wherein the lipid nanoparticle comprises a cationic lipid.

39. 39. The composition of claim 38, wherein the cationic lipid is (4-hydroxybutyl)azanediyl)bis(hexane-6,1-diyl)bis(2-hexyldecanoate) (ALC-0315).

40. The composition of any one of claims 36 to 39, wherein the lipid nanoparticles comprise PEG lipids.

41. PEG lipids include PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, glycol lipids including 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide, PEG-c-DOMG, PEG-c-DMA, PEG-s-DMG, N-[(methoxypolyethylene glycol)2000)carbamyl]-1,2-dimyristyloxypropyl-3-amine (PEG-c-DMA), and PEG-2000-DMG, PEGylated diacylglycerols (PEG-DAGs), such as 1-(mono 41. The composition of claim 40, which is a PEG- ...

42. The composition of claim 40 or 41, wherein the PEG lipid is 2-[(polyethylene glycol)-2000]-N,N-ditetradecylacetamide (ALC-0159).

43. The composition of any one of claims 36 to 42, wherein the lipid nanoparticles comprise a neutral lipid.

44. Neutral lipids include distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4-(N-maleimide).

44. The composition of claim 43, wherein the glycerol is selected from the group consisting of 1-stearoyl-2-oleoyl phosphatidylethanolamine (SOPE), 1,2-dielideyl-sn-glycero-3-phosphoethanolamine (transDOPE), 1,2-diethyl-2-stearoyl-sn-glyceroyl ...

45. The composition of claim 43 or 44, wherein the neutral lipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC).

46. The composition of any one of claims 36 to 45, wherein the lipid nanoparticle comprises a steroid or a steroid analogue.

47. 47. The composition of claim 46, wherein the steroid or steroid analog is cholesterol.

48. 48. The composition of any one of claims 36 to 47, wherein the lipid nanoparticles have an average diameter of about 1 to about 500 nm.

49. The composition of any one of claims 36 to 48, which is a vaccine.

50. 50. The composition of any one of claims 36 to 49, wherein the lipid nanoparticle size is at least 40 nm.

51. 50. The composition of any one of claims 36 to 49, wherein the lipid nanoparticle size is up to 180 nm.

52. A method for (i) inducing an immune response against extraintestinal pathogenic E. coli in a subject, or (ii) inducing the production of opsonizing phagocytic and / or neutralizing antibodies specific for extraintestinal pathogenic E. coli in a subject, comprising administering to the subject an effective amount of an RNA molecule, RNA-LNP and / or vaccine described in any one of claims 1 to 51.

53. 53. The method of claim 52, wherein the subject is at risk of developing a urinary tract infection.

54. 53. The method of claim 52, wherein the subject is at risk of developing bacteremia.

55. 53. The method of claim 52, wherein the subject is at risk of developing urosepsis.

56. 53. The method of claim 52, wherein the subject is at risk of developing cystitis.

57. Use of the RNA molecule, RNA-LNP and / or composition of any one of claims 1 to 56 in the manufacture of a medicament for use in (i) inducing an immune response against extraintestinal pathogenic E. coli in a subject, or (ii) inducing the production of opsonizing phagocytic and / or neutralizing antibodies specific for extraintestinal pathogenic E. coli in a subject.

58. 58. The use of claim 57, wherein the infection, disease or condition is a urinary tract infection.

59. 58. The use of claim 57, wherein the subject is at risk of developing bacteremia.

60. 58. The use of claim 57, wherein the subject is at risk of developing sepsis.

61. 58. The use of claim 57, wherein the subject is at risk of developing cystitis.

62. 62. The method or use of any one of claims 52 to 61, wherein the subject is less than about 1 year old, about 1 year or older, about 5 years old or older, about 10 years old or older, about 20 years old or older, about 30 years old or older, about 40 years old or older, about 50 years old or older, about 60 years old or older, about 70 years old or older, or older.

63. 62. The method or use of any one of claims 52 to 61, wherein the subject is about 50 years of age or older.

64. 62. The method or use according to any one of claims 52 to 61, wherein the subject is a pregnant woman.

65. The method or use according to any one of claims 52 to 64, wherein the RNA molecule or composition is administered as a vaccine.

66. 66. The method or use according to any one of claims 52 to 65, wherein the RNA molecule or composition is administered by intradermal or intramuscular injection.

Images