Hypoimmune beta cells differentiated from pluripotent stem cells and related uses and methods

Abstract

Provided are modified functional stem cell-derived beta (β) cells (SC-β cells) containing one or more modifications, such as genetic modifications, and related methods of their use and production. In some embodiments, the modified cells are hypoimmunogenic cells. In some embodiments, the modified SC-β cells are cells differentiated in vitro from modified stem cells or hypoimmunogenic pluripotent stem cells containing one or more modifications. In some embodiments, the one or more modifications reduce or eliminate expression of MHC class I and / or MHC class II human leukocyte antigens and further exogenously express one or more tolerogenic factors, such as CD47.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 298,214, filed January 10, 2022, U.S. Provisional Patent Application No. 63 / 320,691, filed March 16, 2022, U.S. Provisional Patent Application No. 63 / 322,208, filed March 21, 2022, U.S. Provisional Patent Application No. 63 / 352,605, filed June 15, 2022, and U.S. Provisional Patent Application No. 63 / 353,534, filed June 17, 2022, the contents of each of which are incorporated herein by reference in their entirety for all purposes.

[0002] Electronic Sequence Listing Reference The contents of the electronic sequence listing (186152006640seq.xml; size: 35,375 bytes; created: January 6, 2023) are incorporated herein by reference in their entirety.

[0003] Field In certain aspects, the present disclosure is directed to modified or engineered stem cell-derived beta (β) cells (SC-β cells) containing one or more genetic modifications, such as genetic alterations, and related methods of their use and production. In some embodiments, the modified cells are hypoimmunogenic cells. In some embodiments, the modified SC-β cells are cells differentiated in vitro from modified stem cells or hypoimmunogenic pluripotent stem cells containing one or more modifications. In some embodiments, the one or more modifications reduce or eliminate expression of MHC class I and / or MHC class II human leukocyte antigens and exogenously express one or more tolerogenic factors, such as CD47. Summary of the Invention

[0004] overview Provided herein are methods for producing modified stem cell-derived beta cells (SC-β cells), the method comprising: (A) providing modified pluripotent stem cells (PSCs), the modified PSCs comprising: (a) modifications that inactivate or disrupt one or more alleles of (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules controlling expression of one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules controlling expression of one or more MHC class II molecules, and (b) modifications that increase expression of one or more tolerogenic factors in the modified PSCs compared to control or wild-type PSCs; and (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells.

[0005] Provided herein are methods for producing modified stem cell-derived beta cells (SC-β cells), comprising: (A) producing modified pluripotent stem cells (PSCs), comprising: (a) introducing into the PSCs one or more modifications that inactivate or disrupt one or more alleles of (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that control the expression of one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that control the expression of one or more MHC class II molecules; and (b) increasing the expression of one or more tolerogenic factors in the PSCs compared to control or wild-type PSCs; and (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells.

[0006] Provided herein are methods for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing modified pluripotent stem cells (PSCs), wherein the modified PSCs have at least one modification selected from the group consisting of: (a) a modification that inactivates or disrupts one or more alleles of (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that control the expression of one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that control the expression of one or more MHC class II molecules, such as a modification that inactivates or disrupts one or more alleles of one or more MHC class II molecules. and (b) providing modified PSCs comprising a modification that increases expression of one or more tolerogenic factors in the modified PSCs compared to a control or wild-type cell of the same cell type that does not contain the modification; (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells; and (C) introducing one or more additional modifications into the modified SC-β cells, wherein the one or more additional modifications include at least one or more other modifications of (a), (b), or (a) and (b) that are not present in the modified PSCs.

[0007] Provided herein are methods for producing modified stem cell-derived beta cells (SC-β cells), comprising: (A) culturing pluripotent stem cells (PSCs) under conditions sufficient for the PSCs to differentiate into SC-β cells; and (B) producing modified SC-β cells, comprising: (a) introducing into the SC-β cells one or more modifications that inactivate or disrupt one or more alleles of (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that control the expression of one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that control the expression of one or more MHC class II molecules; and (b) increasing expression of one or more tolerogenic factors in the SC-β cells compared to control or wild-type SC-β cells.

[0008] Provided herein are methods for producing modified stem cell-derived beta cells (SC-β cells), the method comprising: (A) providing modified pluripotent stem cells (PSCs), the modified PSCs comprising: (a) modifications that reduce expression of one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules in the modified PSCs compared to control or wild-type PSCs, and (b) modifications that increase expression of one or more tolerogenic factors in the modified PSCs compared to control or wild-type PSCs; and (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells.

[0009] Provided herein are methods for producing modified stem cell-derived beta cells (SC-β cells), the method comprising: (A) producing modified pluripotent stem cells (PSCs), the modified PSCs comprising: (a) reducing the expression of one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules in the PSCs compared to control or wild-type PSCs; and (b) increasing the expression of one or more tolerogenic factors in the PSCs compared to control or wild-type PSCs; and (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells.

[0010] In some of any of the provided embodiments, reducing the expression of one or more MHC class I molecules and / or one or more MHC class II molecules in (a) comprises introducing a modification that reduces the expression of one or more MHC class I molecules and / or one or more MHC class II molecules in the modified PSCs compared to control or wild-type PSCs.

[0011] In some of any of the provided embodiments, the control or wild-type PSCs are unmodified PSCs that do not include the modification.

[0012] In some of any of the embodiments provided, the PSC does not include a modification.

[0013] In some of any of the provided embodiments, expression of one or more MHC class I molecules and one or more MHC class II molecules is reduced in the modified PSCs.

[0014] In some of any of the provided embodiments, the modification in (a) reduces protein expression of one or more MHC class I molecules. In some of any of the provided embodiments, the modification in (a) reduces cell surface expression of one or more MHC class I molecules. In some of any of the provided embodiments, the modification in (a) reduces the function of one or more MHC class I molecules. In some embodiments, the function is antigen presentation.

[0015] In some of any of the provided embodiments, the one or more modifications in (a) reduce cell surface transport of one or more MHC class I molecules.

[0016] In some of any of the provided embodiments, the one or more MHC class I molecules are one or more human leukocyte antigen (HLA) class I molecules. In some embodiments, the one or more MHC HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, and HLA-C.

[0017] In some of any of the provided embodiments, the one or more molecules that control cell surface protein expression of one or more MHC class I molecules is B2M. In some embodiments, the modification that reduces expression of the one or more MHC class I molecules reduces expression of the B-2 microglobulin (B2M) gene and / or the ATP-binding cassette transporter subfamily B member 1 (TAP1) gene. In some embodiments, the modification that reduces expression of the one or more MHC class I molecules reduces expression of the B-2 microglobulin (B2M) gene. In some embodiments, the modification that reduces expression of the one or more MHC class I molecules reduces expression of the ATP-binding cassette transporter subfamily B member 1 (TAP1) gene. In some embodiments, the modification reduces expression of the B-2 microglobulin (B2M) gene and the ATP-binding cassette transporter subfamily B member 1 (TAP1) gene. In some embodiments, the modification reduces expression of the B2M gene.

[0018] In some of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules reduces expression of B2M. In some of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules reduces mRNA expression of the B2M gene. In some of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules reduces protein expression of B2M. In some of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules comprises inactivation or disruption of one allele of the B2M gene. In some of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules comprises inactivation or disruption of both alleles of the B2M gene. In some of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules comprises inactivation or disruption of all B2M-encoding alleles in the cell. In some of the provided embodiments, the inactivation or disruption comprises an indel in the B2M gene. In some of the provided embodiments, the inactivation or disruption comprises a frameshift mutation or deletion of a continuous stretch of genomic DNA in the B2M gene. In some embodiments, the B2M gene is knocked out.

[0019] In some of any of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules reduces expression of TAP1. In some of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules reduces mRNA expression of the TAP1 gene. In some embodiments, the modification that reduces expression of one or more MHC class I molecules reduces protein expression of a protein encoded by the TAP1 gene. In some embodiments, the modification comprises inactivation or disruption of one allele of the TAP1 gene. In some embodiments, the modification comprises inactivation or disruption of both alleles of the TAP1 gene. In some embodiments, the modification comprises inactivation or disruption of all coding sequences of the TAP1 gene in the cell. In some embodiments, the inactivation or disruption comprises an indel in one allele of the TAP1 gene. In some embodiments, the inactivation or disruption comprises indels in both alleles of the TAP1 gene. In some embodiments, the one or more modifications that reduce expression comprise a frameshift mutation or deletion of a continuous stretch of genomic DNA of the TAP1 gene. In some embodiments, the TAP1 gene is knocked out.

[0020] In some of any of the provided embodiments, the modification in (a) reduces protein expression of one or more MHC class II molecules. In some of any of the provided embodiments, the modification in (a) reduces cell surface expression of one or more MHC class II molecules. In some of any of the provided embodiments, the modification in (a) reduces the function of one or more MHC class II molecules. In some embodiments, the function is antigen presentation.

[0021] In some of any of the provided embodiments, the one or more modifications in (a) reduce cell surface transport of one or more MHC class II molecules.

[0022] In some of any of the provided embodiments, the one or more MHC class II molecules are one or more human leukocyte antigen (HLA) class II molecules. In some embodiments, the one or more MHC HLA class II molecules are selected from the group consisting of HLA-DP, HLA-DQ, and / or HLA-DR.

[0023] In some of any of the provided embodiments, the one or more molecules that regulate expression of one or more MHC class II molecules are selected from the group consisting of CIITA and CD74. In some embodiments, the modification that reduces expression of one or more MHC class II molecules reduces expression of the CIITA gene and / or the CD74 gene. In some embodiments, the modification is a modification that regulates expression of one or more MHC class II molecules, wherein the modification inactivates or disrupts one or more alleles of CIITA. In some embodiments, the modification that reduces expression of one or more MHC class II molecules reduces expression of the CITTA gene. In some embodiments, the modification that reduces expression of one or more MHC class II molecules reduces expression of the CD74 gene. In some embodiments, the modification reduces expression of the CIITA gene and the CD74 gene.

[0024] In some of any of the provided embodiments, the modification that reduces expression of one or more MHC class II molecules reduces expression of CD74. In some of any of the provided embodiments, the modification that reduces expression of one or more MHC class II molecules reduces mRNA expression of the CD74 gene. In some embodiments, the modification that reduces expression of one or more MHC class II molecules reduces protein expression of a protein encoded by the CD74 gene. In some embodiments, the modification comprises inactivation or disruption of one allele of the CD74 gene. In some embodiments, the modification comprises inactivation or disruption of both alleles of the CD74 gene. In some embodiments, the modification comprises inactivation or disruption of all coding sequences of the CD74 gene in the cell. In some embodiments, the inactivation or disruption comprises an indel in one allele of the CD74 gene. In some embodiments, the inactivation or disruption comprises indels in both alleles of the CD74 gene. In some embodiments, the one or more modifications that reduce expression comprise a frameshift mutation or deletion of a contiguous stretch of genomic DNA of the CD74 gene. In some embodiments, the CD74 gene is knocked out.

[0025] In some of the provided embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises reducing the expression of CIITA. In some of the provided embodiments, the modification that reduces the expression of one or more MHC class II molecules reduces mRNA expression of the CIITA gene. In some of the provided embodiments, the modification that reduces the expression of one or more MHC class II molecules reduces protein expression of CIITA. In some of the provided embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises inactivating or disrupting one allele of the CIITA gene. In some of the provided embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises inactivating or disrupting both alleles of the CIITA gene. In some of the provided embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises inactivating or disrupting all CIITA-encoding alleles in the cell. In some of the provided embodiments, the inactivation or disruption comprises an indel in the CIITA gene. In some of the provided embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA in the CIITA gene. In some embodiments, the CIITA gene is knocked out.

[0026] In some of any of the provided embodiments, expression of all MHC class I molecules and all MHC class II molecules is reduced in the modified PSCs, hi some embodiments, expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified PSCs.

[0027] In some of the provided embodiments, the one or more tolerogenic factors are selected from the group consisting of CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDOL, CTLA4-Ig, Cl inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, and SERPINB9. In some of the provided embodiments, at least one of the one or more tolerogenic factors is CD47. In some of the provided embodiments, the one or more tolerogenic factors is CD47. In some of the provided embodiments, at least one of the one or more tolerogenic factors is PD-L1. In some of the provided embodiments, the one or more tolerogenic factors is PD-L1. In some of the provided embodiments, at least one of the one or more tolerogenic factors is HLA-E. In some of the provided embodiments, the one or more tolerogenic factors is HLA-E. In some of any of the provided embodiments, at least one of the one or more tolerogenic factors is HLA-G. In some of any of the provided embodiments, the one or more tolerogenic factors is HLA-G.

[0028] In some of any of the provided embodiments, increasing the expression of the one or more tolerogenic factors comprises introducing a modification that increases expression of the one or more tolerogenic factors in the modified PSCs relative to control or wild-type PSCs. In some of any of the provided embodiments, the modification to increase expression of the one or more tolerogenic factors comprises an exogenous polynucleotide encoding the one or more tolerogenic factors.

[0029] In some of any of the provided embodiments, the exogenous polynucleotide encoding one or more tolerogenic factors is integrated into the genome of the modified PSC. In some of the provided embodiments, the exogenous polynucleotide is integrated by non-targeted insertion into the genome of the modified PSC. In some embodiments, the non-targeted integration is by introducing the exogenous polynucleotide into the cell using a lentiviral vector. In some of the provided embodiments, the exogenous polynucleotide is integrated by targeted insertion into a target genomic locus of the cell. In some embodiments, the targeted insertion is by nuclease-mediated gene editing via homology-directed repair.

[0030] In some of any of the provided embodiments, increasing the expression of one or more tolerogenic factors comprises introducing a modification that increases expression of one or more tolerogenic factors in the modified SC-β cells relative to control or wild-type β cells. In some of any of the provided embodiments, the modification to increase expression of one or more tolerogenic factors comprises an exogenous polynucleotide encoding the one or more tolerogenic factors.

[0031] In some of any of the provided embodiments, an exogenous polynucleotide encoding one or more tolerogenic factors is integrated into the genome of the modified SC-β cell. In some of the provided embodiments, the exogenous polynucleotide is integrated into the genome of the modified SC-β cell by non-targeted insertion. In some embodiments, the non-targeted integration is by introducing the exogenous polynucleotide into the cell using a lentiviral vector. In some of the provided embodiments, the exogenous polynucleotide is integrated by targeted insertion into a target genomic locus of the cell. In some embodiments, the targeted insertion is by nuclease-mediated gene editing via homology-directed repair.

[0032] Also provided herein are methods of producing modified stem cell-derived beta cells (SC-beta cells), the methods comprising: (A) providing modified pluripotent stem cells (PSCs) that, compared to control or wild-type PSCs, comprise a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding a CD47 protein; and (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-beta cells. In some embodiments, the modified PSCs are B2M インデル / インデル ;CIITA インデル / インデル and have a CD47tg phenotype. In some of any of the embodiments, the modified PSCs further comprise a modification to increase expression of an exogenous suicide gene. In some of any of the embodiments, the modified SC-β cells further comprise a modification to increase expression of an exogenous suicide gene.

[0033] Also provided herein are methods for producing modified stem cell-derived beta cells (SC-β cells), the methods comprising: (A) providing pluripotent stem cells (PSCs); (B) culturing the PSCs under conditions sufficient for the PSCs to differentiate into SC-β cells; and (C) producing modified SC-β cells from the SC-β cells by introducing into the SC-β cells a modification that knocks out the B2M gene and a modification that knocks out the CIITA gene, and by introducing an exogenous polynucleotide encoding a CD47 protein. In some embodiments, the modified SC-β cells are B2M インデル / インデル ;CIITA インデル / インデル ;CD47tg phenotype. In some of any of the embodiments, the modified SC-β cells further comprise a modification to increase expression of an exogenous suicide gene. In some of any of the embodiments, the modified SC-β cells further comprise a modification to increase expression of an exogenous suicide gene.

[0034] Also provided herein are methods of producing modified stem cell-derived beta cells (SC-beta cells), the methods comprising: (A) providing modified pluripotent stem cells (PSCs) that, compared to control or wild-type PSCs, comprise a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding a CD47 protein, and an exogenous polynucleotide encoding a suicide gene; and (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-beta cells. In some embodiments, the modified PSCs are B2M インデル / インデル ;CIITA インデル / インデル ;CD47tg;Has the suicide gene tg phenotype.

[0035] Also provided herein are methods for producing modified stem cell-derived beta cells (SC-β cells), the methods comprising: (A) providing pluripotent stem cells (PSCs); (B) culturing the PSCs under conditions sufficient for the PSCs to differentiate into SC-β cells; and (C) producing modified SC-β cells from the SC-β cells by introducing into the SC-β cells a modification that knocks out the B2M gene and a modification that knocks out the CIITA gene, and introducing an exogenous polynucleotide encoding a CD47 protein and an exogenous polynucleotide encoding a safety switch. In some embodiments, the modified SC-β cells are B2M インデル / インデル ;CIITA インデル / インデル ;CD47tg; safety switch (e.g., suicide gene) transgene phenotype. In some of any of the embodiments provided herein, an exogenous polynucleotide encoding CD47 is integrated by non-targeted insertion into the genome of the modified SC-β cell, optionally by introducing the exogenous polynucleotide into the cell using a lentiviral vector.

[0036] In some embodiments of any of the methods of generating modified SC-β cells herein, the modified SC-β cells comprise an exogenous polynucleotide encoding a suicide gene or suicide switch. In some embodiments, the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, the suicide gene or suicide switch and a gene associated with the suicide gene or safety switch are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some embodiments, the suicide gene or suicide switch and one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some embodiments, the bicistronic cassette is integrated into the genome of the modified SC-β cell by non-targeted insertion. In some embodiments, the bicistronic cassette is integrated into the genome of the modified SC-β cell by targeted insertion into a targeted genomic locus of the modified SC-β cell. In some embodiments, the one or more tolerogenic factors is CD47.

[0037] In some of any of the provided embodiments, the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase9), and rapamycin-activated caspase 9 (rapaCasp9).

[0038] In some of any of the provided embodiments, the suicide gene and one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified PSC. In some embodiments, the one or more tolerogenic factors is or comprises CD47, and the suicide gene and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified PSC. In some of the provided embodiments, the bicistronic cassette is integrated by non-targeted insertion into the genome of the modified PSC. In some embodiments, the non-targeted integration is by introduction of an exogenous polynucleotide into the cell using a lentiviral vector. In some of the provided embodiments, the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the cell. In some embodiments, the targeted insertion is by nuclease-mediated gene editing by homology-directed repair.

[0039] In some of any of the provided embodiments, the safety switch (e.g., suicide gene) and one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified cell. In some embodiments, the safety switch and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified cell. In some of the provided embodiments, the bicistronic cassette is integrated by non-targeted insertion into the genome of the modified SC-β cell. In some embodiments, the non-targeted integration is by introduction of an exogenous polynucleotide into the cell using a lentiviral vector. In some of the provided embodiments, the bicistronic cassette is integrated by targeted insertion into a targeted genomic locus of the cell. In some embodiments, the targeted insertion is by nuclease-mediated gene editing by homology-directed repair.

[0040] In some of the provided embodiments, the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus. In some of the provided embodiments, the safe harbor locus is selected from the group consisting of a CCR5 locus, a CXCR4 locus, a PPP1R12C (also known as AAVS1) gene, an albumin locus, a SHS231 locus, a CLYBL locus, and a ROSA26 locus.

[0041] In some of the provided embodiments, the modified PSCs comprise a modification that reduces expression of CD142 compared to control or wild-type PSCs. In some of the provided embodiments, the modification reduces mRNA expression of the CD142 gene. In some of the provided embodiments, the modification reduces protein expression of CD142. In some of the provided embodiments, the modification comprises inactivation or disruption of one allele of the CD142 gene. In some of the provided embodiments, the modification comprises inactivation or disruption of both alleles of the CD142 gene. In some of the provided embodiments, the modification comprises inactivation or disruption of all CD142-encoding alleles in the cell. In some of the provided embodiments, the inactivation or disruption comprises an indel in the CD142 gene. In some of the provided embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA in the CD142 gene.

[0042] In some of the provided embodiments, the modified PSCs comprise a modification that increases expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35 relative to control or wild-type PSCs. In some of the provided embodiments, the modification to increase expression of the one or more complement inhibitors comprises at least one exogenous polynucleotide selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35. In some of the provided embodiments, the one or more complement inhibitors are CD46 and CD59. In some of the provided embodiments, the one or more complement inhibitors are CD46, CD59, and CD55. In some of the provided embodiments, the at least one exogenous polynucleotide is integrated into the genome of the modified PSCs by non-targeted insertion. In some embodiments, the non-targeted insertion is by introduction of the exogenous polynucleotide into the cells using a lentiviral vector. In some of the provided embodiments, the at least one exogenous polynucleotide is integrated into a target genomic locus of the cell by targeted insertion. In some embodiments, the targeted insertion is by nuclease-mediated gene editing via homology-directed repair. In some of the provided embodiments, the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus. In some of the provided embodiments, the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

[0043] In some of any of the provided embodiments, culturing the PSCs under conditions sufficient to differentiate the PSCs into SC-β cells includes one or more of the following: (i) contacting the PSCs with a TGF-beta / activin agonist and / or a glycogen synthase kinase 3 (GSK) inhibitor and / or a WNT agonist for a time sufficient to form definitive endoderm cells; (ii) contacting the definitive endoderm cells differentiated from the PSCs with an FGFR2b agonist for a time sufficient to form primitive gut cells; (iii) contacting the primitive gut cells differentiated from the PSCs with a retinoic acid receptor (RAR) agonist, a rho-kinase inhibitor, a Smoothened antagonist, an FGFR2b agonist, a protein kinase C activator, and / or a BMP type 1 receptor inhibitor for a time sufficient to form early pancreatic progenitor cells; (iv) incubating the early pancreatic progenitor cells differentiated from the PSCs for at least about 3 days, and incubating the early pancreatic progenitor cells with a rho-kinase inhibitor, a TGF-beta / activin agonist and / or a GSK inhibitor and / or a WNT agonist for a time sufficient to form early pancreatic progenitor cells. (v) contacting the pancreatic progenitor cells differentiated from PSCs with an Alk5 inhibitor / TGF beta receptor inhibitor, a gamma secretase inhibitor, a Smoothened antagonist, an Erbbl (EGFR) or Erbb4 agonist, a thyroid hormone, and / or a RAR agonist for a time sufficient to form endodermal cells, comprising depolymerizing the actin cytoskeleton during at least a portion of the contacting in (v) at a time and for a time sufficient to increase differentiation efficiency; and / or (vi) incubating the endodermal cells differentiated from PSCs in serum-free medium for a time sufficient to form β cells.

[0044] In some of any of the provided embodiments, culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells includes one or more of the following: (i) contacting the modified PSCs with a TGF / activin agonist, or a glycogen synthase kinase 3 (GSK) inhibitor, or a WNT agonist for a time sufficient to form definitive endoderm cells; (ii) contacting the definitive endoderm cells differentiated from the modified PSCs with an FGFR2b agonist for a time sufficient to form primitive gut cells; (iii) contacting the primitive gut cells differentiated from the modified PSCs with an RAR agonist, and optionally with a rho kinase inhibitor, a Smoothened antagonist, an FGFR2b agonist, a protein kinase C activator, or a BMP type 1 receptor inhibitor, for a time sufficient to form early pancreatic progenitor cells; (iv) culturing the early pancreatic progenitor cells differentiated from the modified PSCs for at least about 3 days. and optionally contacting the early pancreatic progenitor cells with a rho kinase inhibitor, a TGF- / activin agonist, a smoothened antagonist, an FGFR2b agonist, or a RAR agonist for a time sufficient to form pancreatic progenitor cells; (v) contacting the pancreatic progenitor cells differentiated from the modified PSCs with an Alk5 inhibitor, a gamma secretase inhibitor, a smoothened antagonist, an Erbbl (EGFR) or Erbb4 agonist, and / or a RAR agonist for a time sufficient to form endodermal cells, comprising depolymerizing the actin cytoskeleton during at least a portion of the contacting in (v) at a time and for a time sufficient to increase differentiation efficiency; and / or (vi) incubating the endodermal cells in serum-free medium for a time sufficient to form beta cells, and modifying the size of the beta cells formed into beta cell clusters within about 24 hours of incubation.

[0045] In some of any of the provided embodiments, culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells includes (i) contacting the modified PSCs with a TGF / activin agonist, or a glycogen synthase kinase 3 (GSK) inhibitor, or a WNT agonist for a time sufficient to form definitive endoderm cells; (ii) contacting the definitive endoderm cells with an FGFR2b agonist for a time sufficient to form primitive gut cells; (iii) contacting the primitive gut cells with an RAR agonist, and optionally a rho kinase inhibitor, a Smoothened antagonist, an FGFR2b agonist, a protein kinase C activator, or a BMP type 1 receptor inhibitor, for a time sufficient to form early pancreatic progenitor cells; (iv) incubating the early pancreatic progenitor cells for at least about 3 days; and optionally (v) contacting the early pancreatic progenitor cells with a rho kinase inhibitor, a TGF- / activin agonist, a Smoothened antagonist, an FGFR2b agonist, or a RAR agonist for a time sufficient to form pancreatic progenitor cells; (v) contacting the pancreatic progenitor cells with an Alk5 inhibitor, a gamma secretase inhibitor, SANT1, an Erbbl (EGFR) or Erbb4 agonist, or a RAR agonist for a time sufficient to form endodermal cells, wherein during at least a portion of the contacting in (v), depolymerizing the actin cytoskeleton at a time and for a time sufficient to increase differentiation efficiency; and (vi) incubating the endodermal cells in serum-free medium for a time sufficient to form beta cells, and modifying the size of the beta cells formed into beta cell clusters within about 24 hours of incubation.

[0046] In some of the provided embodiments, depolymerizing the actin cytoskeleton comprises plating the cells on a stiff or soft substrate or introducing a cytoskeleton modulating agent to the cells. In some of the provided embodiments, the cytoskeleton modulating agent comprises latrunculin A, latrunculin B, nocodazole, cytochalasin D, jasplakinolide, blebbistatin, y-27632, y-15, gdc-0994, or an integrin modulating agent. In some of the provided embodiments, the cytoskeleton modulating agent is latrunculin A. In some of the provided embodiments, depolymerizing the actin cytoskeleton is initiated at the initiation of the contact in (v). In some of the provided embodiments, depolymerizing the actin cytoskeleton comprises adding latrunculin A for at least the first 24 hours or for at least about the first 24 hours at the initiation of the contact. In some of the provided embodiments, altering the size of the beta cell clusters comprises disaggregating and re-aggregating the clusters.

[0047] In some of the provided embodiments, the TGF / activin agonist is activin A. In some of the provided embodiments, the glycogen synthase kinase 3 (GSK) inhibitor or WNT agonist is CHIR. In some of the provided embodiments, the FGFR2b agonist is KGF. In some of the provided embodiments, the Smoothened antagonist is SANT-1. In some of the provided embodiments, the RAR agonist is retinoic acid (RA). In some of the provided embodiments, the protein kinase C activator is TPPB. In some of the provided embodiments, the BMP type 1 receptor inhibitor is LDN. In some of the provided embodiments, the rho kinase inhibitor is Y27632. In some of the provided embodiments, the Alk5 inhibitor is Alk5i. In some of the provided embodiments, the Erbb4 agonist is betacellulin. In some of the provided embodiments, the thyroid hormone is T3. In some of any of the provided embodiments, the gamma secretase inhibitor is XXI.

[0048] In some of any of the provided embodiments, the PSCs are embryonic stem cells. In some of the provided embodiments, the PSCs are induced PSCs (iPSCs). In some embodiments, the iPSCs are patient-derived iPSCs.

[0049] In some of any of the provided embodiments, the modified PSCs express each of the one or more tolerogenic factors at a first level that is greater than or about 5-fold greater than the second level expressed by control or wild-type PSCs. In some of any of the provided embodiments, each of the one or more tolerogenic factors is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than the second level expressed by control or wild-type PSCs.

[0050] In some of any of the provided embodiments, each of the one or more tolerogenic factors is expressed by the modified PSCs at greater than or about 20,000 molecules per cell. In some of any of the provided embodiments, each of the one or more tolerogenic factors is expressed by the modified PSCs at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

[0051] In some of any of the provided embodiments, the one or more tolerogenic factors is or includes CD47, and the modified PSCs express CD47 at a first level that is more than or about 5-fold higher than a second level expressed by control or wild-type PSCs. In some of any of the provided embodiments, CD47 is expressed at a first level that is more than or about 10-fold higher, more than or about 20-fold higher, more than or about 30-fold higher, more than or about 40-fold higher, more than or about 50-fold higher, more than or about 60-fold higher, or more than or about 70-fold higher than the second level expressed by control or wild-type PSCs.

[0052] In some of any of the provided embodiments, the one or more tolerogenic factors are CD47 and CD47 are expressed by the modified PSCs at greater than or greater than about 20,000 molecules per cell. In some of any of the provided embodiments, CD47 is expressed by the modified PSCs at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

[0053] In some of any of the provided embodiments, the modified SC-β cells comprise modifications of modified PSCs.

[0054] In some embodiments of any of the provided methods, the modified SC-β cells comprise (1) modifications that reduce expression of one or more MHC class I molecules and / or one or more MHC class II molecules relative to control or wild-type β cells, and (2) modifications that increase expression of one or more tolerogenic factors relative to control or wild-type β cells. In some of any of the provided embodiments, the control or wild-type SC-β cells are unmodified SC-β cells differentiated from unmodified PSCs that do not contain modifications that reduce expression of one or more MHC class I molecules and / or one or more MHC class II molecules or modifications that increase expression of one or more tolerogenic factors. In some of any of the provided embodiments, the control or wild-type β cells are wild-type primary β cells.

[0055] In some of any of the provided embodiments, expression of one or more MHC class I molecules and one or more MHC class II molecules is reduced in the modified SC-β cells.

[0056] In some of any of the provided embodiments, the modification (1) reduces protein expression of one or more MHC class I molecules in the modified SC-β cells. In some of any of the provided embodiments, the modification (1) reduces cell surface expression of one or more MHC class I molecules in the modified SC-β cells. In some of the provided embodiments, the modification (1) reduces the function of one or more MHC class I molecules in the modified SC-β cells. In some embodiments, the function is antigen presentation.

[0057] In some of any of the provided embodiments, the one or more MHC class I molecules are one or more human leukocyte antigen (HLA) class I molecules. In some of any of the provided embodiments, the one or more MHC HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, and HLA-C.

[0058] In some of any of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules in the modified SC-β cells comprises reducing expression of B2M. In some of any of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules in the modified SC-β cells reduces mRNA expression of the B2M gene. In some of any of the provided embodiments, the modification that reduces expression of one or more MHC class I molecules in the modified SC-β cells reduces protein expression of B2M.

[0059] In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells comprises inactivating or disrupting one allele of the B2M gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells comprises inactivating or disrupting both alleles of the B2M gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells comprises inactivating or disrupting all B2M-encoding alleles in the cells. In some of the embodiments, the inactivation or disruption comprises an indel in the B2M gene. In some of the embodiments, the inactivation or disruption comprises a frameshift mutation or deletion of a continuous stretch of genomic DNA in the B2M gene.

[0060] In some of any of the embodiments, the modification (1) reduces the protein expression of one or more MHC class II molecules in the modified SC-β cells. In some of any of the embodiments, the modification (1) reduces the cell surface expression of one or more MHC class II molecules in the modified SC-β cells. In some of any of the embodiments, the modification (1) reduces the function of one or more MHC class II molecules in the modified SC-β cells. In some embodiments, the function is antigen presentation.

[0061] In some of the optional embodiments, the one or more MHC class II molecules are one or more human leukocyte antigen (HLA) class II molecules, hi some embodiments, the one or more MHC class II molecules are selected from the group consisting of HLA-DP, HLA-DQ, and / or HLA-DR.

[0062] In some embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells comprises reducing the expression of CIITA. In some embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells reduces mRNA expression of the CIITA gene. In some embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells reduces protein expression of CIITA. In some embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises inactivating or disrupting one allele of the CIITA gene. In some embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises inactivating or disrupting both alleles of the CIITA gene. In some embodiments, the modification that reduces the expression of one or more MHC class II molecules comprises inactivating or disrupting all CIITA-encoding alleles in the cell. In some embodiments, the inactivation or disruption comprises an indel in the CIITA gene. In some of any of the embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of the CIITA gene.

[0063] In some of any of the provided embodiments, expression of all MHC class I molecules and all MHC class II molecules is reduced in the modified SC-β cells, hi some embodiments, expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified SC-β cells.

[0064] In some of any of the embodiments, the modified SC-beta cells comprise a modification that reduces expression of CD142. In some of any of the embodiments, the modification reduces mRNA expression of the CD142 gene. In some of any of the embodiments, the modification reduces protein expression of CD142. In some of any of the embodiments, the modification comprises inactivation or disruption of one allele of the CD142 gene. In some of any of the embodiments, the modification comprises inactivation or disruption of both alleles of the CD142 gene. In some of any of the embodiments, the modification comprises inactivation or disruption of all CD142-encoding alleles in the cells. In some of any of the embodiments, the inactivation or disruption comprises an indel in the CD142 gene. In some of any of the embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA in the CD142 gene.

[0065] In some embodiments, the modification to increase expression of one or more tolerogenic factors in the modified SC-β cells comprises an exogenous polynucleotide encoding one or more tolerogenic factors. In some embodiments, the exogenous polynucleotide encoding one or more tolerogenic factors is integrated into the genome of the modified SC-β cells. In some embodiments, the exogenous polynucleotide encoding one or more tolerogenic factors is integrated into a non-target locus in the genome of the modified SC-β cells. In some embodiments, the exogenous polynucleotide encoding one or more tolerogenic factors is integrated into a target genomic locus of the modified SC-β cells. In some embodiments, the tolerogenic factor is CD47. In some embodiments, the modified SC-β cells further comprise a modification for expression of an exogenous suicide gene in the modified SC-β cells.

[0066] In some embodiments, the modified SC-β cells produced by the provided methods comprise a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding an exogenous CD47 protein, compared to control or wild-type β cells. インデル / インデル ;CIITA インデル / インデル ;Has a CD47tg phenotype.

[0067] In some embodiments, the modified SC-β cells produced by the provided methods comprise, relative to control or wild-type β cells, a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding a CD47 protein, and an exogenous polynucleotide encoding a suicide gene. インデル / インデル ;CIITA インデル / インデル ;CD47tg;Has the suicide gene tg phenotype.

[0068] In some of any of the embodiments, the exogenous polynucleotide encoding CD47 is integrated into a non-target locus in the genome of the modified SC-β cell. In some of any of the embodiments, the exogenous polynucleotide encoding CD47 is integrated into a target genomic locus in the modified SC-β cell.

[0069] In some of the embodiments, the exogenous suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9). In some of the embodiments, the suicide gene and one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some of the embodiments, the one or more tolerogenic factors is CD47, and the suicide gene and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some of the embodiments, the bicistronic cassette is integrated into a non-target locus in the genome of the modified SC-β cell. In some of the embodiments, the bicistronic cassette is integrated into a target genomic locus of the cell. In some of the embodiments, the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus. In some of the embodiments, the safe harbor locus is selected from the group consisting of a CCR5 locus, a CXCR4 locus, a PPP1R12C (also known as AAVS1) gene, an albumin locus, a SHS231 locus, a CLYBL locus, and a ROSA26 locus.

[0070] In some of the embodiments, the method produces modified SC-β cells containing modifications that increase expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35 relative to control or wild-type β cells. In some of the embodiments, the modifications to increase expression of one or more complement inhibitors in the modified SC-β cells include at least one exogenous polynucleotide encoding one or more complement inhibitors selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35. In some of the embodiments, the one or more complement inhibitors are CD46 and CD59. In some of the embodiments, the one or more complement inhibitors are CD46, CD59, and CD55.

[0071] In some of any of the embodiments, the reduced expression comprises reduced surface expression. In some of any of the embodiments, the increased expression comprises increased surface expression. In some of any of the embodiments, the level of reduced expression of (1) and increased expression of (2) by the modified SC-β cells is maintained or similar compared to the modified PSCs.

[0072] In some of any of the embodiments, the method produces modified SC-β cells that express one or more tolerogenic factors at a first level that is greater than or about greater than five times higher than a second level expressed by a control or wild-type β cell. In some of any of the embodiments, the control or wild-type β cells are differentiated from unmodified PSCs that do not include a modification that reduces expression of one or more MHC class I molecules and / or one or more MHC class II molecules and a modification that increases expression of one or more tolerogenic factors. In some of any of the embodiments, the modified SC-β cells express each of the one or more tolerogenic factors at a first level that is greater than or about greater than five times higher than the second level expressed by a control or wild-type β cell. In some of any of the embodiments, each of the one or more tolerogenic factors is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by control or wild-type beta cells.

[0073] In some of any of the embodiments, each of the one or more tolerogenic factors is expressed by the modified SC-β cells at greater than or about 20,000 molecules per cell. In some of any of the embodiments, each of the one or more tolerogenic factors is expressed by the modified SC-beta cells at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

[0074] In some of any of the embodiments, the one or more tolerogenic factors is or includes CD47, and the modified SC-β cells express CD47 at a first level that is greater than or about 5-fold greater than a second level expressed by control or wild-type β cells. In some of any of the embodiments, the control or wild-type β cells are differentiated from unmodified PSCs that do not include a modification that reduces expression of one or more MHC class I molecules and / or one or more MHC class II molecules and a modification that increases expression of one or more tolerogenic factors. In some of any of the embodiments, the modified SC-β cells express CD47 at a first level that is greater than or about 5-fold greater than a second level expressed by control or wild-type β cells. In some of any of the embodiments, CD47 is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by control or wild-type beta cells. In some of any of the embodiments, CD47 is expressed by the engineered SC-beta cells at greater than or about 20,000 molecules per cell. In some of any of the embodiments, CD47 is expressed by the modified SC-beta cells at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

[0075] In some of the embodiments, the modified SC-β cells express at least one β cell marker. In some of the embodiments, the at least one β cell marker is selected from the group consisting of INS, CHGA, NKX2-2, PDX1, NKX6-1, MAFB, GCK, and GLUT1. In some of the embodiments, the modified SC-β cells exhibit one or more functions of wild-type or control β cells. In some of the embodiments, the one or more functions are selected from the group consisting of glucose-stimulated insulin secretion (GSIS) in vitro, glucose metabolism, maintenance of fasting blood glucose levels, insulin secretion in response to glucose injection in vivo, and glucose clearance after glucose injection in vivo.

[0076] In some embodiments, the modified SC-β cells are capable of glucose-stimulated insulin secretion (GSIS). In some embodiments, the insulin secretion is in a perfusion GSIS assay. In some embodiments, the GSIS is dynamic GSIS, including first and second phases of dynamic insulin secretion. In some embodiments, the GSIS is static GSIS. In some embodiments, the static incubation index is greater than or about 1, greater than or about 2, greater than or about 5, greater than or about 10, or greater than or about 20. In some embodiments, the level of insulin secretion by the modified SC-β cells is at least 20% of that observed in primary beta islets, e.g., cadaveric islets. In some embodiments, the level of insulin secretion by the modified SC-β cells is at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% of that observed in primary pancreatic β-islets, e.g., cadaveric islets. In some embodiments, the total insulin content of the modified SC-β cells is greater than or about 500 μIU insulin per 5000 cells, greater than or about 1000 μIU insulin per 5000 cells, greater than or about 2000 μIU insulin per 5000 cells, greater than or about 3000 μIU insulin per 5000 cells, or greater than or about 4000 μIU insulin per 5000 cells. In some of the optional embodiments, the proinsulin to insulin ratio of the modified SC-beta cells is from at or about 0.02 to at or about 0.1, optionally 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 or about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09 and any value between any of the foregoing.

[0077] In some of the embodiments, the modified SC-β cells exhibit functionality for one day or more after transplantation into a subject. In some of the embodiments, the modified SC-β cells exhibit functionality for more than one week after transplantation into a subject. In some of the embodiments, the functionality is selected from the group consisting of maintaining fasting blood glucose levels, secreting insulin in response to glucose injection in vivo, and clearing glucose after glucose injection in vivo.

[0078] Provided herein are compositions comprising a population of modified SC-β cells produced by any of the methods provided.

[0079] Provided herein are modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), the modified SC-β cells having (1) reduced expression of one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules compared to control or wild-type beta cells, and (2) increased expression of tolerogenic factors compared to control or wild-type beta cells, and the modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS).

[0080] In some of any of the embodiments, the tolerogenic factor is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by control or wild-type beta cells.

[0081] Provided herein are modified stem cell-derived beta cells (SC-beta cells) that comprise one or more of the following modifications: (a) a modification that inactivates or disrupts one or more alleles of (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that control the expression of one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules that control the expression of one or more MHC class II molecules, and / or (b) a modification that increases expression of one or more tolerogenic factors, wherein the increased expression is relative to a control or wild-type beta cell that does not contain the modification. In some embodiments, the modified SC-beta cells exhibit glucose-stimulated insulin secretion (GSIS).

[0082] Provided herein are modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), the modified SC-β cells having (a) modifications that inactivate or disrupt one or more alleles of (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules controlling the expression of one or more MHC class I molecules, and / or (ii) one or more MHC class II molecules or one or more molecules controlling the expression of one or more MHC class II molecules, and (b) modifications that increase the expression of one or more tolerogenic factors compared to control or wild-type beta cells, wherein the modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS).

[0083] Provided herein are modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), wherein the modified SC-β cells (1) do not express one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules, and (2) overexpress a tolerogenic factor at a level greater than or greater than about 5-fold compared to background, and the modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS). In some of any of the embodiments, expression of the tolerogenic factor is determined by flow cytometry using an antibody against the tolerogenic factor, and background is determined by flow cytometry staining with an antibody isotype control. In some of any of the embodiments, the tolerogenic factor is expressed at a level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold compared to background expression.

[0084] Provided herein are modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), the modified SC-β cells (1) do not express one or more major histocompatibility complex (MHC) class I molecules or one or more MHC class II molecules, and (2) overexpress a tolerogenic factor at a first level that is greater than or about five-fold greater than a second level expressed by the unmodified cells, the unmodified cells being unmodified PSCs that do not include modifications to reduce one or more MHC class I molecules and / or one or more MHC class II molecules and modifications to overexpress a tolerogenic factor, or unmodified SC-β cells differentiated from such unmodified PSCs, and the modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS).

[0085] In some of any of the embodiments, the tolerogenic factor is expressed by the modified SC-β cells at greater than or about 20,000 molecules per cell.

[0086] Provided herein are modified stem cell-derived beta cells (SC-beta cells) differentiated in vitro from pluripotent stem cells (PSCs), wherein the modified SC-beta cells (1) do not express one or more major histocompatibility complex (MHC) class I molecules or one or more MHC class II molecules; and (2) overexpress a tolerogenic factor, wherein the tolerogenic factor is expressed at greater than or about 20,000 molecules per cell; and the modified beta cells exhibit glucose-stimulated insulin secretion (GSIS).

[0087] In some of any of the embodiments, the tolerogenic factor is expressed by the modified SC-β at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

[0088] In some of the embodiments, the modified SC-β cells are differentiated from PSCs, and the PSCs are modified PSCs that contain (a) modifications that reduce expression of one or more MHC class I molecules and / or one or more MHC class II molecules relative to control or wild-type PSCs, and (b) modifications that increase expression of a tolerogenic factor relative to control or wild-type PSCs. In some of the embodiments, the control or wild-type PSCs are unmodified PSCs that do not contain the modifications. In some of the embodiments, the modified SC-β cells express a tolerogenic factor at a first level that is greater than or about 5-fold greater than a second level expressed by an unmodified PSC or an unmodified SC-β cell differentiated from the unmodified PSC. In some of any of the embodiments, the tolerogenic factor is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by unmodified PSCs or unmodified SC-β differentiated from unmodified PSCs.

[0089] Provided herein are modified stem cell-derived beta cells (SC-beta cells) differentiated in vitro from modified pluripotent stem cells (PSCs), the modified PSCs comprising (a) modifications that reduce expression of one or more major histocompatibility complex (MHC) class I molecules or one or more MHC class II molecules compared to control or wild-type PSCs, and (b) modifications that increase expression of tolerogenic factors compared to control or wild-type PSCs, and the modified SC-beta cells exhibit glucose-responsive insulin secretion (GSIS).

[0090] In some of any of the embodiments, the control or wild-type PSCs are unmodified PSCs that do not include the modification. In some of any of the embodiments, the modified PSCs express the tolerogenic factor at a first level that is more than or about 5-fold greater than a second level expressed by unmodified PSCs that do not include the modification. In some of the embodiments, the tolerogenic factor is expressed at a first level that is more than or about 10-fold, more than or about 20-fold, more than or about 30-fold, more than or about 40-fold, more than or about 50-fold, more than or about 60-fold, or more than or about 70-fold greater than the second level expressed by unmodified PSCs.

[0091] In some of any of the embodiments, the modified SC-β cells comprise (a) a modification that reduces expression of one or more MHC class I molecules and / or one or more MHC class II molecules compared to unmodified PSCs or unmodified SC-β cells differentiated from unmodified PSCs, and (b) a modification that increases expression of a tolerogenic factor compared to unmodified PSCs or unmodified SC-β cells differentiated from unmodified PSCs. In some of any of the embodiments, the modified SC-β cells express the tolerogenic factor at a first level that is greater than or about 5-fold greater than a second level expressed by the unmodified PSCs or unmodified SC-β cells differentiated from unmodified PSCs. In some of any of the embodiments, the tolerogenic factor is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by unmodified PSCs or unmodified SC-β cells differentiated from unmodified PSCs. In some of any of the embodiments, the tolerogenic factor is expressed by the modified PSCs at greater than or about 20,000 molecules per cell.

[0092] Provided herein are modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from modified pluripotent stem cells (PSCs), the modified PSCs comprising modifications such that the modified PSCs (a) do not express one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules, and (b) express a tolerogenic factor at greater than or greater than about 20,000 molecules per cell, and the modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS).

[0093] In some of any of the embodiments, the tolerogenic factor is expressed by the modified PSCs at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell. In some of any of the embodiments, the modified SC-β cells do not express one or more MHC class I molecules or one or more MHC class II molecules, and express the tolerogenic factor at greater than or about 20,000 molecules per cell. In some of any of the embodiments, the tolerogenic factor is expressed by the modified SC-beta cells at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

[0094] In some of any of the embodiments, the tolerogenic factor is selected from the group consisting of CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDOL, CTLA4-Ig, Cl inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, and SERPINB9, and any combination thereof. In some of any of the embodiments, the tolerogenic factor comprises CD47. In some of any of the embodiments, the tolerogenic factor comprises PD-L1. In some of any of the embodiments, the tolerogenic factor comprises HLA-E. In some of any of the embodiments, the tolerogenic factor comprises HLA-G.

[0095] In some of any of the embodiments, modified SC-β cells are differentiated from modified PSCs, and expression of one or more MHC class I molecules and one or more MHC class II molecules is reduced in the modified PSCs.

[0096] In some of any of the embodiments, the modification in (a) reduces protein expression of one or more MHC class I molecules. In some of any of the embodiments, the modification in (a) reduces cell surface expression of one or more MHC class I molecules. In some of any of the embodiments, the one or more modifications in (a) reduce cell surface transport of one or more MHC class I molecules. In some of any of the embodiments, the modification in (a) reduces a function of one or more MHC class I molecules. In some of the embodiments, the function is antigen presentation.

[0097] In some of the embodiments, the modified SC-beta cells are differentiated from modified PSCs in which the expression of B2M has been reduced by a modification that reduces the expression of one or more MHC class I molecules. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules reduces mRNA expression of the B2M gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules reduces protein expression of B2M. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified PSCs comprises inactivating or disrupting one allele of the B2M gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified PSCs comprises inactivating or disrupting both alleles of the B2M gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified PSCs comprises inactivating or disrupting all B2M-encoding alleles in the cells. In some of the embodiments, the inactivation or disruption comprises an indel in the B2M gene. In some of any of the embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of the B2M gene.

[0098] In some of any of the embodiments, the modification in (a) reduces protein expression of one or more MHC class II molecules. In some of any of the embodiments, the modification in (a) reduces cell surface expression of one or more MHC class II molecules. In some of any of the embodiments, the one or more modifications in (a) reduce cell surface transport of one or more MHC class II molecules. In some of any of the embodiments, the modification in (a) reduces a function of one or more MHC class II molecules. In some of the embodiments, the function is antigen presentation.

[0099] In some embodiments, modified SC-β cells are differentiated from modified PSCs comprising reduced expression of CIITA by modifications that reduce the expression of one or more MHC class II molecules. In some embodiments, the modifications that reduce the expression of one or more MHC class II molecules in the modified PSCs reduce mRNA expression of the CIITA gene. In some embodiments, the modifications that reduce the expression of one or more MHC class II molecules in the modified PSCs reduce protein expression of CIITA. In some embodiments, the modifications that reduce the expression of one or more MHC class II molecules in the modified PSCs comprise inactivation or disruption of one allele of the CIITA gene. In some embodiments, the modifications that reduce the expression of one or more MHC class II molecules in the modified PSCs comprise inactivation or disruption of both alleles of the CIITA gene. In some embodiments, the modifications that reduce the expression of one or more MHC class II molecules in the modified PSCs comprise inactivation or disruption of all CIITA-encoding alleles in the cells. In some embodiments, the inactivation or disruption comprises an indel in the CIITA gene. In some of any of the embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of the CIITA gene.

[0100] In some of any of the provided embodiments, expression of all MHC class I molecules and all MHC class II molecules is reduced in the modified PSCs, hi some embodiments, expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified PSCs.

[0101] In some of the embodiments, the modified SC-beta cells are differentiated from the modified PSCs, and the modified PSCs comprise a modification that reduces expression of CD142. In some of the embodiments, the modification reduces mRNA expression of the CD142 gene. In some of the embodiments, the modification reduces protein expression of CD142. In some of the embodiments, the modification that reduces expression of CD142 in the modified PSCs comprises inactivation or disruption of one allele of the CD142 gene. In some of the embodiments, the modification that reduces expression of CD142 in the modified PSCs comprises inactivation or disruption of both alleles of the CD142 gene. In some of the embodiments, the modification that reduces expression of CD142 in the modified PSCs comprises inactivation or disruption of all CD142-encoding alleles in the cells. In some of the embodiments, the inactivation or disruption comprises an indel in the CD142 gene. In some of the embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA in the CD142 gene.

[0102] In some of the embodiments, the modification to increase expression of a tolerogenic factor in the modified PSC comprises an exogenous polynucleotide encoding the tolerogenic factor. In some of the embodiments, the exogenous polynucleotide encoding the tolerogenic factor is integrated into the genome of the modified PSC. In some of the embodiments, the exogenous polynucleotide is integrated by non-targeted insertion into the genome of the modified PSC. In some of the embodiments, the exogenous polynucleotide is integrated by targeted insertion into a target genomic locus of the modified PSC.

[0103] In some of the embodiments, the modified SC-β cells are differentiated from the modified PSCs, and the modified PSCs further comprise an exogenous polynucleotide encoding a suicide gene, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

[0104] In some of the embodiments, the suicide gene and the tolerogenic factor are expressed from a bicistronic cassette integrated into the genome of the modified PSC. In some of the embodiments, the tolerogenic factor is CD47, and the suicide gene and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified PSC. In some of the embodiments, the bicistronic cassette is integrated by non-targeted insertion into the genome of the modified PSC. In some of the embodiments, the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the modified PSC. In some of the embodiments, the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus. In some of any of the embodiments, the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

[0105] In some of the embodiments, the modified SC-beta cells are differentiated from the modified PSCs, and the modified PSCs comprise a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35 relative to control or wild-type PSCs. In some of the embodiments, the modification to increase the expression of the one or more complement inhibitors comprises at least one exogenous polynucleotide encoding one or more complement inhibitors selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35. In some of the embodiments, the one or more complement inhibitors are CD46 and CD59. In some of the embodiments, the one or more complement inhibitors are CD46, CD59, and CD55. In some of the embodiments, the at least one exogenous polynucleotide is integrated by non-targeted insertion into the genome of the modified PSCs. In some of the embodiments, at least one exogenous polynucleotide is integrated into a target genomic locus of the cell by targeted insertion. In some of the embodiments, the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus. In some of the embodiments, the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

[0106] In some of any of the embodiments, the expression of one or more MHC class I molecules and one or more MHC class II molecules is reduced in the modified SC-β cells.

[0107] In some of any of the embodiments, the modification (1) reduces the protein expression of one or more MHC class I molecules in the modified SC-β cells. In some of any of the embodiments, the modification (1) reduces the cell surface expression of one or more MHC class I molecules in the modified SC-β cells. In some of any of the embodiments, the modification (1) reduces the function of an MHC class I molecule in the modified SC-β cells. In some of the embodiments, the function is antigen presentation. In some of any of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells comprises reducing the expression of B2M. In some of any of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells reduces the mRNA expression of the B2M gene. In some of any of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells reduces the protein expression of B2M. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells comprises inactivating or disrupting one allele of the B2M gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells comprises inactivating or disrupting both alleles of the B2M gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class I molecules in the modified SC-β cells comprises inactivating or disrupting all B2M-encoding alleles in the cells. In some of the embodiments, the inactivation or disruption comprises an indel in the B2M gene. In some of the embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA in the B2M gene.

[0108] In some of any of the embodiments, the modification (1) reduces the protein expression of one or more MHC class II molecules in the modified SC-β cells. In some of any of the embodiments, the modification (1) reduces the cell surface expression of one or more MHC class II molecules in the modified SC-β cells. In some of any of the embodiments, the modification (1) reduces the function of one or more MHC class II molecules in the SC-β cells. In some of the embodiments, the function is antigen presentation. In some of any of the embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells comprises reducing the expression of CIITA. In some of any of the embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells reduces the mRNA expression of the CIITA gene. In some of any of the embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells reduces the protein expression of CIITA. In some of the embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells comprises inactivating or disrupting one allele of the CIITA gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells comprises inactivating or disrupting both alleles of the CIITA gene. In some of the embodiments, the modification that reduces the expression of one or more MHC class II molecules in the modified SC-β cells comprises inactivating or disrupting all CIITA-encoding alleles in the cells. In some of the embodiments, the inactivation or disruption comprises an indel in the CIITA gene. In some of the embodiments, the inactivation or disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA in the CIITA gene.

[0109] In some of any of the provided embodiments, expression of all MHC class I molecules and all MHC class II molecules is reduced in the modified SC-β cells, hi some embodiments, expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified SC-β cells.

[0110] In some of the embodiments, the modified SC-β cells comprise a modification that reduces CD142 expression compared to control or wild-type β cells. In some of the embodiments, the modification reduces mRNA expression of the CD142 gene. In some of the embodiments, the modification reduces protein expression of CD142. In some of the embodiments, the modification that reduces CD142 expression in the modified SC-β cells comprises inactivation or disruption of one allele of the CD142 gene. In some of the embodiments, the modification that reduces CD142 expression in the modified SC-β cells comprises inactivation or disruption of both alleles of the CD142 gene. In some of the embodiments, the modification that reduces CD142 expression in the modified SC-β cells comprises inactivation or disruption of all CD142-encoding alleles in the cells. In some of the embodiments, the inactivation or disruption comprises an indel in the CD142 gene. In some of the embodiments, the inactivation or disruption comprises a frameshift mutation or deletion of a continuous stretch of genomic DNA in the CD142 gene.

[0111] In some of the embodiments, the modification to increase expression of a tolerogenic factor in the modified SC-β cells comprises an exogenous polynucleotide encoding the tolerogenic factor. In some of the embodiments, the exogenous polynucleotide encoding the tolerogenic factor is integrated into the genome of the modified SC-β cells. In some of the embodiments, the exogenous polynucleotide is integrated into a non-target locus in the genome of the modified SC-β cells. In some of the embodiments, the exogenous polynucleotide is integrated into a target genomic locus in the modified SC-β cells.

[0112] In some of the embodiments, the tolerogenic factor is CD47, and the modification to increase CD47 expression in the modified SC-β cells comprises an exogenous polynucleotide encoding CD47. In some of the embodiments, the exogenous polynucleotide encoding CD47 is integrated into the genome of the modified SC-β cells. In some of the embodiments, the exogenous polynucleotide is integrated into a non-target locus in the genome of the modified SC-β cells. In some of the embodiments, the exogenous polynucleotide is integrated into a target genomic locus in the modified SC-β cells.

[0113] Also provided herein are modified stem cell-derived beta cells (SC-beta cells) differentiated in vitro from modified pluripotent stem cells (PSCs), the modified SC-beta cells comprising a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding an exogenous CD47 protein, compared to control or wild-type beta cells. In some embodiments, the modified SC-beta cells comprise a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding an exogenous CD47 protein. インデル / インデル ;CIITA インデル / インデル and have a CD47tg phenotype. In some embodiments, the modified SC-β cells further comprise an exogenous polynucleotide encoding a suicide gene.

[0114] Also provided herein are modified stem cell-derived beta cells (SC-beta cells) differentiated in vitro from modified pluripotent stem cells (PSCs), the modified SC-beta cells comprising a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding a CD47 protein, and an exogenous polynucleotide encoding a suicide gene, compared to control or wild-type beta cells. In some embodiments, the modified SC-beta cells comprise a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding a CD47 protein, and an exogenous polynucleotide encoding a suicide gene. インデル / インデル ;CIITA インデル / インデル ;CD47tg;Has the suicide gene tg phenotype.

[0115] In some of the embodiments, the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9). In some of the embodiments, the suicide gene and the tolerogenic factor are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some of the embodiments, the tolerogenic factor is CD47, and the suicide gene and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some of the embodiments, the bicistronic cassette is integrated into a non-target locus in the genome of the modified SC-β cell. In some of the embodiments, the bicistronic cassette is integrated into a target genomic locus of the cell. In some of the embodiments, the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus. In some of any of the embodiments, the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

[0116] In some of the embodiments, the modified SC-β cells comprise a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35 relative to control or wild-type β cells. In some of the embodiments, the modification to increase the expression of one or more complement inhibitors in the modified SC-β cells comprises at least one exogenous polynucleotide encoding one or more complement inhibitors selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35. In some of the embodiments, the one or more complement inhibitors are CD46 and CD59. In some of the embodiments, the one or more complement inhibitors are CD46, CD59, and CD55.

[0117] In some of any of the embodiments, the modified SC-beta cells express CD47 at a first level that is greater than or about greater than 5-fold greater than a second level expressed by control or wild-type beta cells. In some embodiments, the control or wild-type beta cells are differentiated from unmodified PSCs that do not include a modification that reduces expression of one or more MHC class I molecules and / or one or more MHC class II molecules and a modification that increases expression of one or more tolerogenic factors. In some of any of the embodiments, the modified SC-beta cells express CD47 at a first level that is greater than or about greater than 5-fold greater than a second level expressed by control or wild-type beta cells. In some of any of the embodiments, CD47 is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by control or wild-type beta cells.

[0118] In some of any of the embodiments, CD47 is expressed by the modified SC-β cells at greater than or about 20,000 molecules per cell. In some of any of the embodiments, CD47 is expressed by the modified SC-beta cells at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

[0119] In some embodiments of any of the modified SC-β cells disclosed herein, the modified SC-β cells comprise an exogenous polynucleotide encoding a suicide gene or suicide switch. In some embodiments, the suicide gene or suicide switch is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, the suicide gene or suicide switch and a gene associated with the suicide gene or safety switch are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some embodiments, the suicide gene or suicide switch and one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell. In some embodiments, the bicistronic cassette is integrated into the genome of the modified SC-β cell by non-targeted insertion, optionally by introducing the exogenous polynucleotide into the cell using a lentiviral vector. In some embodiments, the bicistronic cassette is integrated into a target genomic locus of the cell by targeted insertion, optionally by nuclease-mediated gene editing by homology-directed repair. In some embodiments, the one or more tolerogenic factors is CD47.

[0120] In some embodiments, the modified SC-β cells express at least one β cell marker. In some embodiments, the at least one β cell marker is selected from the group consisting of INS, CHGA, NKX2-2, PDX1, NKX6-1, MAFB, GCK, and GLUT1. In some embodiments, the modified SC-β cells exhibit one or more functions of wild-type or control β cells. In some embodiments, the one or more functions are selected from the group consisting of glucose-stimulated insulin secretion (GSIS) in vitro, glucose metabolism, maintenance of fasting blood glucose levels, insulin secretion in response to glucose injection in vivo, and glucose clearance after glucose injection in vivo. In some embodiments, the GSIS is measured in a perfusion GSIS assay. In some embodiments, the GSIS is dynamic GSIS, including first- and second-phase dynamic insulin secretion. In some embodiments, the GSIS is static GSIS. In some embodiments, the static irritation index is greater than or about 1, greater than or about 1.5, greater than or about 2, greater than or about 5, greater than or about 10, greater than or about 15, or greater than or about 20.

[0121] In some of the embodiments, the level of insulin secretion by the modified SC-β cells is at least 20% of that observed in primary pancreatic β islets, e.g., cadaveric islets. In some of the embodiments, the level of insulin secretion by the modified SC-β cells is at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% of that observed in primary pancreatic β islets, e.g., cadaveric islets. In some of any of the embodiments, the total insulin content of the modified SC-beta is greater than or about 500 μIU insulin per 5000 cells, greater than or about 1000 μIU insulin per 5000 cells, greater than or about 2000 μIU insulin per 5000 cells, greater than or about 3000 μIU insulin per 5000 cells, or greater than or about 4000 μIU insulin per 5000 cells. In some of the optional embodiments, the modified SC-β has a proinsulin to insulin ratio of at or about 0.02 to at or about 0.1, optionally 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 or about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09 and any value between any of the foregoing.

[0122] In some of the embodiments, the modified SC-β cells exhibit functionality for one day or more after transplantation into a subject. In some of the embodiments, the modified SC-β cells exhibit functionality for more than one week after transplantation into a subject. In some of the embodiments, the functionality is selected from the group consisting of maintaining fasting blood glucose levels, secreting insulin in response to glucose injection in vivo, and clearing glucose after glucose injection in vivo.

[0123] Provided herein are compositions comprising any of the provided SC-β cells. Also provided herein are compositions comprising populations of any of the provided modified SC-β cells.

[0124] In some embodiments of any of the provided compositions comprising a population of modified SC-β cells, the level of reduced MHC HLA class I and / or MHC HLA class II expression and / or increased tolerogenic factor expression is maintained or similar in at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells in the population compared to modified PSCs. In some embodiments, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells in the population have reduced MHC HLA class I or B2M expression. In some of any of the embodiments, at least 50% or at least about 50%, at least 60% or at least about 60%, at least 70% or at least about 70%, at least 80% or at least about 80%, or at least 90% or at least about 90% of the cells in the population have reduced expression of MHC HLA class II or CIITA.

[0125] In some embodiments of any of the provided compositions comprising a population of modified SC-β cells, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells in the population express a tolerogenic factor at a first level that is greater than or equal to 5-fold, greater than or equal to 10-fold, greater than or equal to 20-fold, greater than or equal to 30-fold, greater than or equal to 40-fold, greater than or equal to 50-fold, greater than or equal to 60-fold, or greater than or equal to 70-fold greater than a second level expressed by control or wild-type β cells. In some embodiments, the control or wild-type β cells are wild-type primary β cells. In some of any of the embodiments, at least or at least about 50%, at least or at least about 60%, at least or at least about 70%, at least or at least about 70%, at least or at least about 80%, or at least about 90% of the cells in the population express the tolerogenic factor at a first level that is greater than or about 5-fold, greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by unmodified PSCs that do not include the modification or unmodified SC-β cells differentiated from the unmodified PSCs.

[0126] In some embodiments of the provided compositions comprising a population of modified SC-β cells, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells in the population have a densitometric value of greater than or about 20,000 molecules per cell, greater than or about 30,000 molecules per cell, greater than or about 5 ... In some embodiments, the tolerogenic factor is expressed at more than or about 50,000 molecules per cell, more than or about 100,000 molecules per cell, more than or about 200,000 molecules per cell, more than or about 300,000 molecules per cell, more than or about 400,000 molecules per cell, more than or about 500,000 molecules per cell, or more than or about 600,000 molecules per cell.

[0127] In some of any of the embodiments of the provided compositions comprising a population of modified SC-β cells, at least 50% or at least about 50%, at least 60% or at least about 60%, at least 70% or at least about 70%, at least 80% or at least about 80%, or at least 90% or at least about 90% of the cells in the population have reduced expression of CD142.

[0128] In some of the embodiments, provided compositions include a pharmaceutically acceptable excipient. In some of the embodiments, provided compositions include a cryoprotectant.

[0129] In some embodiments of any of the compositions disclosed herein, the modified SC-β cells of the population of modified SC-β cells comprise an exogenous polynucleotide encoding a suicide gene or suicide switch. In some embodiments, the suicide gene or suicide switch is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, the suicide gene and a gene associated with the suicide gene or safety switch are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cells of the population of modified SC-β cells. In some embodiments, the suicide gene or suicide switch and exogenous CD47 are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cells. In some embodiments, the bicistronic cassette is integrated by non-targeted insertion into the genome, optionally by introduction of the exogenous polynucleotide into the modified SC-β cells of the population of modified SC-β cells using a lentiviral vector. In some embodiments, the bicistronic cassette is integrated into the population of modified SC-β cells by targeted insertion into a target genomic locus of the modified SC-β cells, optionally by nuclease-mediated gene editing by homology-directed repair.

[0130] Provided herein are methods for treating diabetes in a subject, comprising administering any of the modified SC-β cells or any of the provided compositions to a subject in need of such treatment.

[0131] In some of any of the embodiments, the diabetes is type I diabetes. In some of any of the embodiments, the diabetes is type II diabetes. In some of any of the embodiments, the modified SC-β cells improve glucose tolerance in the subject.

[0132] Provided herein are methods for improving glucose tolerance in a subject, comprising administering any of the provided modified SC-β cells or any of the provided compositions to a subject in need thereof. In some of any of the embodiments, the subject is a diabetic patient. In some of the embodiments, the diabetic patient has type I diabetes or type II diabetes.

[0133] In some of any of the embodiments, glucose tolerance is improved compared to the subject's glucose tolerance before administration of the modified SC-β cells. In some of any of the embodiments, administration of the modified SC-β cells reduces the use of exogenous insulin in the subject. In some of any of the embodiments, glucose tolerance is improved as measured by HbA1c levels. In some of any of the embodiments, the subject is fasting. In some of any of the embodiments, administration of the modified SC-β cells improves insulin secretion in the subject. In some of any of the embodiments, insulin secretion is improved compared to the subject's insulin secretion before administration of the modified SC-β cells.

[0134] In some embodiments, the method further comprises administering one or more immunosuppressants to the subject. In some embodiments, the subject is currently receiving one or more immunosuppressants. In some embodiments, the one or more immunosuppressants are small molecules or antibodies. In some embodiments, the one or more immunosuppressants are selected from the group consisting of cyclosporine, azathioprine, mycophenolic acid, mycophenolate mofetil, corticosteroids, prednisone, methotrexate, gold salts, sulfasalazine, antimalarials, brequinar, leflunomide, mizoribine, 15-deoxyspergualin, 6-mercaptopurine, cyclophosphamide, rapamycin, tacrolimus (FK-506), OKT3, antithymocyte globulin, thymopentin (thymosin-α), and immunosuppressant antibodies. In some embodiments, the one or more immunosuppressants comprise cyclosporine. In some embodiments, the one or more immunosuppressants comprise mycophenolate mofetil. In some embodiments, the one or more immunosuppressants comprise corticosteroids. In some embodiments, the one or more immunosuppressants comprise cyclophosphamide. In some embodiments, the one or more immunosuppressants comprise rapamycin. In some embodiments, the one or more immunosuppressants comprise tacrolimus (FK-506). In some embodiments, the one or more immunosuppressants comprise antithymocyte globulin. In some embodiments, the one or more immunosuppressants are one or more immunomodulatory agents. In some embodiments, the one or more immunomodulatory agents are small molecules or antibodies. In some embodiments, the antibody binds to one or more receptors or ligands selected from the group consisting of p75 of the IL-2 receptor, MHC, CD2, CD3, CD4, CD7, CD28, B7, CD40, CD45, IFN-gamma, TNF-alpha, IL-4, IL-5, IL-6R, IL-6, IGF, IGFR1, IL-7, IL-8, IL-10, CD11a, CD58, and antibodies that bind to any of their ligands.

[0135] In some embodiments, one or more immunosuppressants are or have been administered to the subject prior to administration of the modified SC-β cells. In some embodiments, the one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to administration of the modified SC-β cells. In some embodiments, the one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to administration of the modified SC-β cells. In some embodiments, the one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after administration of the modified SC-β cells. In some embodiments, the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more weeks after administration of the modified SC-β cells, hi some embodiments, the one or more immunosuppressive agents are or have been administered to the subject on the same day as the first administration of the modified SC-β cells.

[0136] In some embodiments, one or more immunosuppressants are or have been administered to the subject after administration of the modified SC-β cells. In some embodiments, one or more immunosuppressants are or have been administered to the subject after administration of the first and / or second administration of modified SC-β cells. In some embodiments, one or more immunosuppressants are or have been administered to the subject before administration of the first and / or second administration of modified SC-β cells. In some embodiments, one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days before administration of the first and / or second administration of modified SC-β cells. In some embodiments, the one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more weeks prior to administration of the first and / or second administration of modified SC-β cells. In some embodiments, the one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after administration of the first and / or second administration of modified SC-β cells. In some embodiments, the one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after administration of the first and / or second administration of modified SC-β cells. In some embodiments, the one or more immunosuppressants are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more weeks after administration of the first and / or second administration of modified SC-β cells. In some embodiments, the one or more immunosuppressants are administered at a lower dosage compared to the dosage of the one or more immunosuppressants administered to reduce immune rejection of immunogenic cells that do not contain the modified SC-β cells.

[0137] In some embodiments, the modified SC-β cells are capable of controlling the death of the modified SC-β cells. In some embodiments, the modified SC-β cells comprise a suicide gene or suicide switch. In some embodiments, the suicide gene or suicide switch induces controlled cell death in the presence of a drug or prodrug or upon activation by a selective exogenous compound. In some embodiments, the suicide gene or suicide switch is an inducible protein capable of inducing apoptosis of the modified SC-β cells. In some embodiments, the inducible protein capable of inducing apoptosis of the modified SC-β cells is a caspase protein. In some embodiments, the caspase protein is caspase 9. In some embodiments, the suicide gene or suicide switch is selected from the group consisting of cytosine deaminase (CyD), herpes virus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9). In some embodiments, after administering one or more immunosuppressants to a subject, the suicide gene or suicide switch is activated to induce controlled cell death. In some embodiments, the suicide gene or suicide switch is activated to induce controlled cell death before administering one or more immunosuppressants to a subject. In some embodiments, the suicide gene or suicide switch is activated to induce controlled cell death after administering modified SC-β cells to a subject. In some embodiments, the suicide gene or suicide switch is activated to induce controlled cell death when cell injury or other negative effects occur to the subject.

[0138] In some embodiments, the method includes administering an agent that allows for depletion of engineered SC-β cells from a population of engineered SC-β cells. In some embodiments, the agent that allows for depletion of engineered SC-β cells is an antibody that recognizes a protein expressed on the surface of engineered SC-β cells. In some embodiments, the antibody is selected from the group consisting of antibodies that recognize CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8. In some embodiments, the antibody is selected from the group consisting of mogamulizumab, AFM13, MOR208, obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-Rllb, tomzotuximab, RO5083945 (GA201), cetuximab, Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-Rllc, and biosimilars thereof. In some embodiments, the method comprises administering an agent that recognizes one or more tolerogenic factors on the surface of the modified SC-β cells. In some embodiments, the modified SC-β cells are engineered to express one or more tolerogenic factors. In some embodiments, the one or more tolerogenic factors is CD47.

[0139] In some embodiments, the method includes administering one or more additional therapeutic agents to the subject. In some embodiments, the subject has been administered one or more additional therapeutic agents.

[0140] In some embodiments, the method includes monitoring the therapeutic effectiveness of the method. In some embodiments, the method includes monitoring the prophylactic effectiveness of the method. In some embodiments, the method is repeated until a desired suppression of one or more disease symptoms occurs. [Brief explanation of the drawings]

[0141] [Figure 1A]Glucose levels measured over time are shown in humanized NSG diabetic mice transplanted with wild-type (WT), B2M indel / indel, CIITA indel / indel, or B2M indel / indel, CIITA indel / indel, CD47tg engineered SC-β cells. [Figure 1B] Serum levels of human c-peptide are shown in humanized NSG diabetic mice transplanted with wild-type (WT), B2M indel / indel, CIITA indel / indel, or B2M indel / indel, CIITA indel / indel, CD47tg engineered SC-β cells and subjected to glucose challenge 1 hour before sacrifice 29 days after transplantation. [Figure 2A] IFN-γ spot frequency quantified using an Elispot plate reader as an assay of TH1 T cell responses in mice treated with wild-type, B2M indel / indel, CIITA indel / indel, or B2M indel / indel, CIITA indel / indel, and CD47tg human SC-β cells is shown. [Figure 2B] Cell suspensions of serum from recipient wild-type, B2M indel / indel, CIITA indel / indel, and B2M indel / indel, CIITA indel / indel, CD47tg human SC-β mice incubated with wild-type, B2M indel / indel, CIITA indel / indel, and B2M indel / indel, CIITA indel / indel, CD47tg human cells were labeled with FITC-conjugated goat anti-IgM and analyzed by flow cytometry. The mean fluorescence intensity (MFI) of cells is shown. [Figure 2C] Comparison of NK cell killing using IL-2 stimulated human NK cells as effectors and wild-type, B2M indel / indel, CIITA indel / indel, or B2M indel / indel, CIITA indel / indel, CD47tg human SC-β cells as target cells is shown. DETAILED DESCRIPTION OF THE INVENTION

[0142] Detailed Description Provided herein are beta cells differentiated from pluripotent stem cells (PSCs), where the resulting beta cells contain one or more modifications that render the resulting differentiated beta cells hypoimmune, reducing or avoiding immune rejection. Modified beta cells differentiated in vitro from PSCs and containing one or more modifications are referred to as modified stem cell-derived beta cells (also referred to as "modified SC-beta cells" or "modified SC-beta cells"). In some cases, at least one or all of the modifications to differentiated beta cells are introduced into the beta cells after differentiation from PSCs. In some cases, PSCs are first modified with one or more modifications, or in some embodiments, with each of the hypoimmune modifications, and then differentiated to generate modified SC-beta cells. For purposes herein, the terms modified SC-beta cells and hypoimmune PSC-derived beta cells (HIP beta cells) may be used interchangeably.

[0143] Provided herein are methods for generating hypoimmune beta cells differentiated in vitro from modified pluripotent stem cells (PSCs) that have been modified to avoid immune rejection. In some embodiments, these modified pluripotent stem cells can also include mesenchymal stem cells (MSCs) and / or embryonic stem cells (ESCs). In some embodiments, the modification resulting in the hypoimmune cells inactivates or destroys one or more alleles (e.g., one or both alleles) of one or more major histocompatibility complex (MHC) human leukocyte antigens (MHC class I antigens) and / or MHC class II antigens in the modified cells, or inactivates or destroys one or more alleles (e.g., one or both alleles) of one or more molecules that control the expression, such as surface expression, of one or more MHC class I and / or class II molecules. Non-limiting examples of modifications that result in avoidance of immune rejection include reducing the expression of major histocompatibility complex (MHC) class I and MHC class II antigens (also called human leukocyte antigen (HLA) class I and HLA class II antigens, respectively) and increasing the expression of one or more tolerogenic factors, such as CD47. In vitro differentiated beta cells differentiated from modified PSCs are an example of modified stem cell-derived beta cells.

[0144] In some embodiments, the cells provided are modified SC-β cells derived from modified PSCs containing (a) modifications that reduce the expression of one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules, and (b) modifications that increase the expression of one or more tolerogenic factors in the modified PSCs compared to control or wild-type PSCs. In some embodiments, the modified SC-β cells are obtained from the modified PSCs by culturing the modified PSCs under conditions sufficient to differentiate them into modified SC-β cells. In some embodiments, the modifications to the modified SC-β cells render the cells hypoimmune, which in some aspects allows the cells to avoid immune rejection compared to control or wild-type β cells, such as primary human β cells. Provided embodiments relate to the demonstration of differentiation of modified functional SC-β cells from hypoimmune PSCs, where the modified SC-β cells retain the hypoimmune modifications of the PSCs and exhibit β cell functions, such as glucose-responsive insulin secretion. These results confirm that the hypoimmune modifications do not affect the differentiation of PSCs into functional β cells.

[0145] The provided embodiments provide a viable source of transplantable beta cells, thus providing an allogeneic cell therapy for improving glucose tolerance in diabetic subjects. Aspects of the modified SC-β cells provided herein attenuate rejection of the cells by the recipient subject's immune system, and the cells are able to engraft and function in the host after their administration, regardless of the subject's genetic makeup or any pre-existing responses in the subject to one or more previous allogeneic transplants. In some embodiments, the modified SC-β cells can persist without immunosuppression. In specific embodiments, the modified SC-β cells can persist without the immunosuppressive courses used in allogeneic islet transplantation. In certain embodiments, the cells are genomically stable with respect to modifications present in the iPSCs from which the modified SC-β cells were differentiated.

[0146] The modified cells provided herein, including modified PSCs and modified SC-β cells (e.g., modified SC-β cells obtained by in vitro differentiation from modified PSCs), utilize expression of tolerogenic factors and modulate (e.g., reduce or eliminate) the expression (e.g., surface expression) of one or more MHC class I molecules and / or one or more MHC class II molecules. In some embodiments, the modification that reduces expression of one or more MHC class I molecules is a modification that reduces expression of b-2 microglobulin (B2M). In some embodiments, the modification that reduces expression of one or more MHC class II molecules is a modification that reduces expression of CIITA. In some embodiments, modified SC-β cells comprising the modifications described herein (including those that reduce or eliminate expression of MHC class I molecules or MHC class II molecules and those that increase expression of CD47 or other tolerogenic factors) survive, engraft, persist, and function after transplantation. In some embodiments, the modified SC-β cells exhibit improved survival and / or improved engraftment and / or function for a longer period of time compared to control or wild-type β cells, e.g., unmodified SC-β cells that do not contain a modification, e.g., SC-β cells differentiated from unmodified PSCs that do not contain a modification that renders the cells hypoimmune. In some embodiments, the modified SC-β cells are administered by intravenous infusion, intramuscular injection, or kidney capsule implantation.

[0147] In certain embodiments, provided herein are methods for producing hypoimmune modified SC-β cells, the methods comprising: (1) providing modified PSCs that contain one or more modifications (e.g., genetic modifications) that reduce or eliminate expression of one or more MHC class I molecules (e.g., via reduction or elimination of B2M) and / or reduce or eliminate expression of one or more MHC class II human leukocyte antigens (e.g., via reduction or elimination of CIITA) in the modified PSCs, and increase expression of a tolerogenic factor (e.g., CD47) in the modified PSCs; and (2) differentiating the modified PSCs under differentiation conditions into β islet cells. Accordingly, modified SC-β cells obtained by the method are also provided herein. Also provided herein are modified SC-β cells obtained by in vitro differentiation from modified PSCs having one or more modifications (e.g., genetic modifications) that reduce or eliminate expression of one or more MHC class I molecules and / or one or more MHC class II molecules in the modified PSCs, as well as one or more modifications that increase expression of a tolerogenic factor (e.g., CD47) in the cells. In provided embodiments, the resulting or obtained modified SC-β cells also have reduced or eliminated expression of one or more MHC class I molecules (e.g., via reduction or elimination of B2M) and / or one or more MHC class II molecules (e.g., via reduction or elimination of CIITA), and have increased expression of a tolerogenic factor (e.g., CD47), e.g., compared to unmodified PSCs comprising the starting pluripotent stem cell line, or compared to control or wild-type β cells, such as SC-β cells differentiated from unmodified PSCs. In some embodiments, the modified SC-β cells do not express MHC class I and / or MHC class II molecules and express CD47 at increased levels relative to the starting cell line (e.g., more than 5-fold over background, more than 5-fold over primary β cells, and / or more than 5-fold over unmodified PSCs or unmodified SC-β cells obtained by in vitro differentiation from unmodified PSCs).In some embodiments, the modified SC-β cells express CD47 at levels that exceed those expressed by endogenous iPSCs and / or β cells differentiated therefrom. In some embodiments, the modified PSCs or modified SC-β cells express more than 20,000 molecules of a tolerogenic factor (e.g., CD47) on their surface. Also provided herein are compositions containing the modified SC-β cells, as well as methods and uses thereof for treating diabetic subjects and / or improving glucose tolerance in subjects in need thereof.

[0148] In some embodiments, the modified PSCs (e.g., modified iPSCs) from which the modified SC-β cells are differentiated further comprise reduced or eliminated expression of CD142 (also known as coagulation factor III, tissue factor (TF), thromboplastin, platelet tissue factor, or factor III), a membrane receptor in the blood coagulation pathway that contributes to the initiation of IBMIR. In some embodiments, the modified PSCs comprise reduced or eliminated expression of CD142 and increased expression of one or more tolerogenic factors (e.g., CD47), as well as reduced expression of one or more MHC class I and / or MHC class II molecules as described above. Modified SC-β cells obtained by in vitro differentiation from such modified PSCs are also provided. In some embodiments, modified SC-β cells obtained by in vitro differentiation from modified PSCs have reduced or eliminated expression of CD142, reduced or eliminated expression of MHC class I molecules and / or MHC class II molecules, and increased expression of tolerogenic factors (e.g., CD47), e.g., compared to unmodified PSCs or compared to control or wild-type β cells, such as SC-β cells differentiated from unmodified PSCs.

[0149] In some embodiments, the modified PSCs (e.g., modified iPSCs) from which modified SC-β cells described herein are differentiated further comprise increased expression and / or overexpression of one or more complement inhibitors. In some embodiments, the one or more complement inhibitors are selected from CD46, CD59, CD55, and CD35. In some embodiments, the modified PSCs comprise increased expression of one or more complement inhibitors and increased expression of one or more tolerogenic factors (e.g., CD47), as well as reduced expression of one or more MHC class I and / or MHC class II molecules as described above. In some embodiments, the modified cells comprise increased expression of two or more combined complement inhibitors, such as increased expression of CD46 and CD59 or increased expression of CD46, CD59, and CD55. Modified SC-β cells obtained by in vitro differentiation from such modified PSCs are also provided. Modified SC-β cells obtained by in vitro differentiation from such modified PSCs are also provided. In some embodiments, modified SC-β cells obtained by in vitro differentiation from modified PSCs have reduced or eliminated expression of one or more MHC class I molecules and / or one or more MHC class II molecules, increased expression of tolerogenic factors (e.g., CD47), and increased expression of one or more complement inhibitors: CD46, CD59, CD55, and CD35 (e.g., CD46 and CD59 or CD46, CD59, and CD55), e.g., compared to unmodified PSCs or compared to control or wild-type β cells, such as SC-β cells differentiated from unmodified PSCs.

[0150] In some embodiments, the modified SC-β cells provided herein are protected from complement-mediated cytotoxicity. In some embodiments, modified SC-β cells (e.g., overexpressing one or more complement inhibitors, such as CD46 and CD59) are protected from complement-dependent cytotoxicity (CDC) that occurs as a result of IBMIR. In some embodiments, modified SC-β cells are protected from CDC that occurs independently of IBMIR.

[0151] In any of the provided embodiments, the altered expression is relative to a wild-type cell, the starting cell line in which the alteration is made, or a similar cell that does not contain the alteration, such as an unaltered cell of the same cell type or an otherwise identical cell lacking the alteration. A cell lacking an alteration is understood to be any cell described herein that lacks a modification herein that alters the expression of one or more tolerogenic factors (e.g., CD47), one or more MHC class I molecules and / or one or more MHC class II molecules, CD142, and / or one or more complement inhibitors. Exemplary methods for introducing an expression-altering modification into a cell are described herein. Any of a variety of methods can be used to overexpress or increase gene or protein expression in pluripotent stem cells, such as by introducing or delivering an exogenous polynucleotide encoding the protein (i.e., a transgene or "tg") or by delivering a fusion protein of a DNA-targeting domain and a transcriptional activator that targets the gene. Additionally, any of a variety of methods can be used to reduce or eliminate gene or protein expression in PSCs, including non-gene editing methods such as the introduction or delivery of inhibitory nucleic acids (e.g., RNAi) or gene editing methods involving the introduction or delivery of targeted nuclease systems (e.g., CRISPR / Cas). In some embodiments, the method for reducing or eliminating expression is by nuclease-based gene editing techniques. The PSCs can then be used to differentiate modified SC-β cells, which are also found to contain similar modifications. Thus, it is understood that, by this disclosure, references to editing or modifying cells relate to editing or modifying pluripotent stem cells, and modified SC-β cells are obtained from such modified pluripotent stem cells by in vitro differentiation.

[0152] In some embodiments, genome editing techniques utilizing rare-cutting endonucleases (e.g., CRISPR / Cas, TALEN, zinc finger nucleases, meganucleases, and homing endonuclease systems) are used to reduce or eliminate expression of immune genes described herein, such as genes involved in regulating expression of MHC class I or MHC class II molecules, in the PSCs used to derive the modified SC-β cells (e.g., by deleting the genomic DNA of key immune genes). In certain embodiments, genome editing or other gene regulation techniques are used to insert tolerance-inducing (tolerogenic) factors (e.g., CD47) into targeted genomic loci in the PSCs used to derive the modified SC-β cells, thereby producing modified cells that can avoid immune recognition upon transplantation into a recipient subject. Thus, the modified PSCs and modified SC-β cells provided herein (e.g., modified SC-β cells obtained by in vitro differentiation of modified PSCs) exhibit modulated expression (e.g., reduced or eliminated expression) of one or more genes and factors that affect the expression of MHC class I molecules and / or MHC class II molecules, modulated expression (e.g., reduced or eliminated expression) of tolerogenic factors such as CD47, providing for reduced recognition by the recipient subject's immune system. In some embodiments, the modified cells provided herein also exhibit modulated expression (e.g., reduced expression) of CD142, which in some aspects can be reduced by genome editing techniques (e.g., CRISPR / Cas, TALEN, zinc finger nucleases, meganucleases, and homing endonuclease systems) to reduce or eliminate expression of CD142 (e.g., by deleting genomic DNA of key immune genes) in the modified PSCs used to derive the modified SC-β cells.In some embodiments, the modified SC-beta cells provided herein also exhibit modulated expression (e.g., reduced expression) of CD142, which in some aspects can be reduced by genome editing techniques (e.g., CRISPR / Cas, TALEN, zinc finger nucleases, meganucleases, and homing endonuclease systems) that reduce or eliminate expression of CD142 in the modified SC-beta cells (e.g., by deleting genomic DNA of important immune genes).

[0153] In some embodiments, the modified cells provided herein exhibit modulated expression (e.g., increased expression) of one or more complement inhibitors selected from CD46, CD59, CD55, and CD35, which in some aspects can be increased by genome editing techniques to insert or incorporate exogenous polynucleotides encoding one or more complement inhibitors into the genomic locus of the modified PSCs used to derive the modified SC-β cells. In some embodiments, the modulated expression (e.g., increased expression) of one or more complement inhibitors selected from CD46, CD59, CD55, and CD35 is increased by genome editing techniques to insert or incorporate exogenous polynucleotides encoding one or more complement inhibitors into the genomic locus of the modified SC-β cells.

[0154] In some embodiments, modified SC-β cells exhibit characteristics that allow them to evade immune recognition. In some embodiments, modified SC-β cells provided herein are hypoimmunogenic. In some aspects, modified SC-β cells provided herein are not subject to innate immune cell rejection. In some aspects, modified SC-β cells provided herein exhibit reduced innate immune cell rejection and / or adaptive immune cell rejection (e.g., hypoimmunogenic cells). For example, in some embodiments, modified SC-β cells exhibit reduced susceptibility to NK cell-mediated lysis and / or macrophage phagocytosis. In some embodiments, modified SC-β cells are useful as a source of universally compatible cells or tissues (e.g., universal donor cells or tissues) that can be transplanted into a recipient subject with little or no need for immunosuppressive drugs. Such hypoimmunogenic cells retain cell-specific properties and characteristics after transplantation.

[0155] Also provided herein are methods for treating disorders, including administering modified cells that circumvent immune rejection in an MHC-mismatched allogeneic recipient. In some embodiments, the modified cells produced from any one of the methods described herein circumvent immune rejection when repeatedly administered (e.g., transplanted or grafted) into an MHC-mismatched allogeneic recipient. In certain embodiments, the modified SC-β cells are used in methods for treating diabetic subjects (e.g., type I or type II diabetes), such as improving glucose tolerance in the subject.

[0156] The practice of particular embodiments will employ, unless indicated to the contrary, conventional methods of chemistry, biochemistry, organic chemistry, molecular biology, microbiology, recombinant DNA technology, genetics, immunology, and cell biology that are within the skill of the art, many of which are described below by way of example, and such techniques are explained more fully in the literature.For example, Sambrook, et al., Molecular Cloning: A Laboratory Manual (3rd Edition, 2001); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Maniatis et al., Molecular Cloning: A Laboratory Manual (1982); Ausubel et al., Current Protocols in Molecular Biology (John Wiley and Sons, updated July 2008);Short Protocols in Molecular Biology:A Compendium of Methods from Current Protocols in Molecular Biology,Greene Pub.Associates and Wiley-Interscience;Glover,DNA Cloning:A Practical Approach,vol.I & II(IRL Press,Oxford,1985);Anand,Techniques for the Analysis of Complex Genomes,(Academic Press,New York,1992);Transcription and Translation(B.Hames & S. Higgins, Eds., 1984); Perbal, A Practical Guide to Molecular Cloning (1984); Harlow and Lane, Antibodies, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1998); Current Protocols in Immunology QE Coligan, A. M. Kruisbeek, D. H. Margulies, E. M. Shevach and W. Strober, eds., 1991); Annual Review of Immunology; and research articles in journals such as Advances in Immunology.

[0157] All publications, including patent documents, scientific articles, and databases, referred to in this application are incorporated by reference in their entirety for all purposes as if each individual publication were individually incorporated by reference. To the extent that a definition set forth herein contradicts or otherwise conflicts with a definition set forth in a patent, application, published application, or other publication incorporated herein by reference, the definition set forth herein takes precedence over the definition incorporated herein by reference.

[0158] The section headings used herein are merely organizational and should not be construed as limiting the subject matter described. Those skilled in the art will recognize that several embodiments are possible within the scope and spirit of the present disclosure. The following description is illustrative of the disclosure and, of course, should not be construed as limiting the scope of the invention described herein in any way.

[0159] I. Pluripotent stem cells In some aspects, provided herein are modified stem cell-derived beta cells (SC-beta cells). In some embodiments, the modified SC-beta cells are produced by differentiating stem or progenitor cells (e.g., totipotent, pluripotent, or multipotent stem cells) into SC-beta cells, and then generating modified SC-beta cells from the SC-beta cells. In some embodiments, the modified SC-beta cells are generated from SC-beta cells by introducing one or more of the modifications disclosed herein. In some embodiments, the SC-beta cells are differentiated from stem cells (e.g., PSCs, such as iPSCs) containing one or more modifications, and one or more additional modifications are introduced into the SC-beta cells to generate the modified SC-beta cells. In some embodiments, the modified SC-beta cells are differentiated from stem cells (e.g., PSCs, such as iPSCs) containing the modifications.

[0160] A. Pluripotent Stem Cell (e.g., iPSC) Cells and Methods of Production The modified stem cell-derived beta cells (SC-beta cells) provided herein can be differentiated from stem or progenitor cells. In some embodiments, the stem or progenitor cells are modified. In some embodiments, the stem or progenitor cells do not contain a modification, or one or more modifications are introduced into the SC-beta cells to create the modified SC-beta cells. In some embodiments, the engineered or modified cells are stem or progenitor cells capable of differentiation (e.g., the stem cells are totipotent, pluripotent, or multipotent). In some embodiments, stem cells capable of differentiation (e.g., the stem cells are totipotent, pluripotent, or multipotent) are differentiated into SC-beta cells and then modified. In some embodiments, the cells are isolated from embryonic or neonatal tissue. In some embodiments, the cells are embryonic stem cells. In some embodiments, the cells are induced pluripotent stem cells derived from somatic cells (e.g., skin cells or blood cells) and reprogrammed to an embryonic-like pluripotent state. In some embodiments, the induced pluripotent stem cells are derived from fibroblasts. In some embodiments, the cells modified as provided herein are pluripotent stem cells or cells differentiated from pluripotent stem cells. The cells can be vertebrate cells, for example, mammalian cells such as human cells or mouse cells. The cells can also be vertebrate stem cells, for example, mammalian stem cells such as human stem cells or mouse stem cells. Preferably, the cells or stem cells can be modified. Preferably, the cells or stem cells or cells derived from such stem cells have or are thought to have a therapeutic effect, and the cells or stem cells or cells derived from or differentiated from such stem cells can be used to treat a disease, disorder, defect, or injury in a subject in need of such treatment.

[0161] In some embodiments, the modified SC-β cells are differentiated from pluripotent stem cells, such as induced pluripotent stem cells (iPSCs), optionally modified as disclosed herein. In some embodiments, the iPSCs do not include modifications. In some embodiments, the cells modified as provided herein are modified pluripotent stem cells (e.g., modified iPSCs).

[0162] The generation of mammalian (e.g., mouse and human) pluripotent stem cells (commonly referred to as iPSCs, miPSCs for mouse cells, or hiPSCs for human cells) is generally known in the art. As will be appreciated by those skilled in the art, there are a variety of different methods for generating iPSCs. Originally, iPSCs were derived from mouse embryonic or adult fibroblasts using viral introduction of four transcription factors: Oct3 / 4, Sox2, c-Myc, and Klf4. See Takahashi and Yamanaka Cell 126:663-676 (2006), which is incorporated herein by reference in its entirety, particularly with respect to the techniques outlined therein. Since then, numerous methods have been developed. For reviews, see Seki et al, World J. Stem Cells 7(1):116-125 (2015), and Lakshmipathy and Vermuri, editors, Methods in Molecular Biology: Pluripotent Stem Cells, Methods and Protocols, Springer 2013, both of which are expressly incorporated by reference in their entirety, particularly with respect to methods for generating hiPSCs (see, e.g., Chapter 3 of the latter reference).

[0163] In general, iPSCs are generated by transient expression of one or more reprogramming factors in host cells, usually introduced using an episomal vector. Under these conditions, a small number of cells are induced to become iPSCs (generally, the efficiency of this step is low because no selectable markers are used). Without wishing to be bound by theory, it is believed that once the cells are "reprogrammed" and become pluripotent, they lose the episomal vector(s) and use endogenous genes to produce the factors.

[0164] As will be appreciated by those skilled in the art, the number of reprogramming factors that can be or are used can vary. Generally, when fewer reprogramming factors are used, the efficiency of transformation of cells into a pluripotent state, as well as "pluripotency," decreases; for example, fewer reprogramming factors may result in cells that are not fully pluripotent but may only be capable of differentiating into fewer cell types.

[0165] In some embodiments, a single reprogramming factor, OCT4, is used. In other embodiments, two reprogramming factors, OCT4 and KLF4, are used. In other embodiments, three reprogramming factors, OCT4, KLF4, and SOX2, are used. In other embodiments, four reprogramming factors, OCT4, KLF4, SOX2, and c-Myc, are used. In other embodiments, five, six, or seven reprogramming factors selected from SOKMNLT, i.e., SOX2, OCT4 (POU5F1), KLF4, MYC, NANOG, LIN28, and SV40L T antigen, may be used. Typically, these reprogramming factor genes are provided on episomal vectors, such as those known in the art and commercially available.

[0166] In some embodiments, the host cells used to transfect one or more reprogramming factors are non-pluripotent stem cells. Generally, as known in the art, iPSCs are generated from non-pluripotent cells, such as, but not limited to, blood cells, fibroblasts, etc., by transiently expressing reprogramming factors as described herein. In some embodiments, non-pluripotent cells, such as fibroblasts, are obtained or isolated from one or more individual subjects or donors before reprogramming the cells. In some embodiments, iPSCs are generated from a pool of isolated non-pluripotent stem cells, such as fibroblasts, obtained from one or more (e.g., two or more, three or more, four or more, five or more, ten or more, twenty or more, fifty or more, or one hundred or more) different donor subjects. In some embodiments, non-pluripotent cells such as fibroblasts are isolated or obtained from multiple different donor subjects (e.g., 2 or more, 3 or more, 4 or more, 5 or more, 10 or more, 20 or more, 50 or more, or 100 or more), pooled together in batches, reprogrammed as iPSCs, and optionally modified according to the methods provided. In some embodiments, non-pluripotent cells such as fibroblasts are isolated or obtained from multiple different donor subjects (e.g., 2 or more, 3 or more, 4 or more, 5 or more, 10 or more, 20 or more, 50 or more, or 100 or more), pooled together in batches, reprogrammed as iPSCs, differentiated into SC-β cells, and then modified according to the methods provided.

[0167] In some embodiments, iPSCs are obtained, such as by transiently transfecting one or more reprogramming factors into cells of a pool of non-pluripotent cells (e.g., fibroblasts) derived from one or more donor subjects different from the recipient subject (e.g., the patient to whom the cells are administered). The non-pluripotent cells (e.g., fibroblasts) to be derived into iPSCs can be obtained and pooled together from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, 100, or more donor subjects. The non-pluripotent cells (e.g., fibroblasts) can be obtained and pooled together from 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10, or more than 20, 50, or 100 or more donor subjects. In some embodiments, non-pluripotent cells (e.g., fibroblasts) are harvested from one or more individuals, and in some cases, the non-pluripotent cells (e.g., fibroblasts) or pool of non-pluripotent cells (e.g., fibroblasts) are cultured in vitro and transfected with one or more reprogramming factors that induce the generation of iPSCs. In some embodiments, the non-pluripotent cells (e.g., fibroblasts) or pool of non-pluripotent cells (e.g., fibroblasts) are modified according to the methods provided herein. In some embodiments, the iPSCs (e.g., modified iPSCs) or pool of iPSCs (e.g., pool of modified iPSCs) are then subjected to a differentiation process for differentiation into any cell type of an organism and tissue.

[0168] Any of the pluripotent stem cells described herein can be differentiated into any cell type of an organism and tissue. In one aspect, provided herein are pluripotent stem cells (e.g., modified pluripotent stem cells) differentiated from iPSCs into different cell types for subsequent transplantation into a recipient subject. Differentiation can be assayed as known in the art, generally by assessing the presence of cell-specific markers. As will be understood by those skilled in the art, differentiated SC-β cells generated from PSCs, such as modified (e.g., hypoimmunogenic) pluripotent cell derivatives, can be transplanted using techniques known in the art depending on both the cell type and the ultimate use of these cells. Exemplary differentiated cell types and methods for their production are described below. In some embodiments, iPSCs can be differentiated into any of the cell types described herein. In some embodiments, iPSCs are differentiated into β islet cells. In some embodiments, host cells such as non-pluripotent cells (e.g., fibroblasts) from an individual donor or a pool of individual donors are isolated or obtained, made into iPSCs, and then modified to contain the modifications (e.g., genetic modifications) described herein, and then differentiated into the desired cell type. In some embodiments, host cells such as non-pluripotent cells (e.g., fibroblasts) from an individual donor or a pool of individual donors are isolated or obtained, made into iPSCs, and then differentiated into the desired cell type, and then modified.

[0169] In some embodiments, the cells provided herein are β islet cells derived from iPSCs, for example, modified iPSCs containing modifications (e.g., genetic modifications) described herein are differentiated into β islet cells. As will be understood by those skilled in the art, the method for differentiation will use known techniques and depend on the desired cell type. In some embodiments, cells differentiated into various β islet cells can be used for subsequent transplantation or engraftment into a subject (e.g., a recipient).

[0170] In some embodiments, the pancreatic islet cells are derived from pluripotent cells (e.g., modified pluripotent cells) described herein. Useful methods for differentiating pluripotent stem cells into beta islet cells are described, for example, in U.S. Patent No. 9,683,215; U.S. Patent No. 9,157,062; U.S. Patent No. 8,927,280; U.S. Patent Publication No. 2021 / 0207099; Hogrebe et al., "Targeting the cytoskeleton to direct pancreatic differentiation of human pluripotent stem cells," Nat. Biotechnol., 2020, 38:460-470; and Hogrebe et al., "Generation of insulin-producing pancreatic beta cells from multiple human stem cell lines," Nat. Protoc., 2021, the contents of which are incorporated herein by reference in their entireties.

[0171] In some embodiments, the pluripotent cells (e.g., modified pluripotent cells) described herein are differentiated into transplantable beta-like cells or pancreatic islet organoids to treat type 1 diabetes mellitus (T1DM). Cell lines are a promising method for treating T1DM; see, e.g., Ellis et al., Nat Rev Gastroenterol Hepatol. 2017 Oct; 14(10):612-628, incorporated herein by reference. In addition, Pagliuca et al. (Cell, 2014, 159(2):428-39) reported successful differentiation of hiPSCs into beta cells, the contents of which are incorporated herein by reference in their entirety, particularly for the methods and reagents outlined for large-scale production of functional human beta cells from human pluripotent stem cells. Additionally, Vegas et al. have shown that the production of human beta cells from human pluripotent stem cells followed by encapsulation avoids immune rejection by the host; Vegas et al., Nat Med, 2016, 22(3):306-11; which is incorporated herein by reference in its entirety, particularly for the methods and reagents outlined for the large-scale production of functional human beta cells from human pluripotent stem cells.

[0172] In some embodiments, a method for producing a population of modified pancreatic islet cells from a population of pluripotent cells (e.g., modified pluripotent cells) by in vitro differentiation includes: (a) culturing a population of iPSCs (e.g., modified iPSCs) in a first culture medium containing one or more factors selected from the group consisting of insulin-like growth factor, transforming growth factor, FGF, EGF, HGF, SHH, VEGF, transforming growth factor-b superfamily, BMP2, BMP7, a GSK inhibitor, an ALK inhibitor, a BMP type 1 receptor inhibitor, and retinoic acid to produce a population of immature pancreatic islet cells; and (b) culturing the population of immature pancreatic islet cells in a second culture medium different from the first culture medium to produce a population of pancreatic islet cells (e.g., modified pancreatic islet cells). In some embodiments, the method includes introducing one or more modifications into the pancreatic islet cells. In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a variant thereof. In some cases, the GSK inhibitor is at a concentration ranging from about 2 mM to about 10 mM. In some embodiments, the ALK inhibitor is SB-431542, a derivative thereof, or a variant thereof. In some cases, the ALK inhibitor is at a concentration ranging from about 1 pM to about 10 pM. In some embodiments, the first culture medium and / or the second culture medium does not contain animal serum.

[0173] Differentiation is generally assayed as known in the art by assessing the presence of beta cell-associated or specific markers, including but not limited to insulin. Differentiation can also be measured functionally, such as by measuring glucose metabolism. See generally Muraro et al., Cell Syst. 2016 Oct 26;3(4):385-394.e3, which is incorporated herein by reference in its entirety, particularly for the biomarkers outlined. Once beta cells are produced, they can be transplanted into the portal vein / liver, omentum, gastrointestinal mucosa, bone marrow, muscle, or subcutaneous pouch (either as a cell suspension, cell clusters, or within a permeable or semi-permeable device or gel matrix as discussed herein).

[0174] Further description of pancreatic islet cells, including pancreatic islet cells for use in the present technology, can be found in WO2020 / 018615, the disclosure of which is incorporated herein by reference in its entirety.

[0175] In some embodiments, a population of modified β islet cells, e.g., endothelial cells differentiated from iPSCs derived from one or more individual donors (e.g., healthy donors), are maintained in culture and, in some cases, expanded prior to administration. In certain embodiments, a population of modified β islet cells is cryopreserved prior to administration.

[0176] Exemplary types of pancreatic islet cells include, but are not limited to, pancreatic islet precursor cells, immature pancreatic islet cells, mature pancreatic islet cells, etc. In some embodiments, the pancreatic cells described herein are administered to a subject to treat diabetes.

[0177] In some embodiments, modified pancreatic islet cells disclosed herein, e.g., β islet cells differentiated from iPSCs derived from one or more individual donors (e.g., healthy donors), secrete insulin, hi some embodiments, the pancreatic islet cells exhibit at least two characteristics of endogenous pancreatic islet cells, such as, but not limited to, insulin secretion in response to glucose and expression of β cell markers.

[0178] Exemplary beta cell markers or beta cell precursor markers include, but are not limited to, c-peptide, Pdxl, glucose transporter 2 (Glut2), HNF6, VEGF, glucokinase (GCK), prohormone convertase (PC1 / 3), Cdcpl, NeuroD, Ngn3, Nkx2.2, Nkx6.1, Nkx6.2, Pax4, Pax6, Ptfla, Isll, Sox9, Soxl7, and FoxA2.

[0179] In some embodiments, pancreatic islet cells, e.g., β islet cells differentiated from iPSCs derived from one or more individual donors (e.g., healthy donors), produce insulin in response to glucose. In various embodiments, the pancreatic islet cells secrete insulin in response to increases in glucose. In some embodiments, the cells have a distinct morphology, such as a cobblestone cell morphology and / or a diameter of about 17 pm to about 25 pm.

[0180] In some embodiments, the technology is directed to modified β islet cells, e.g., β islet cells differentiated from iPSCs derived from one or more individual donors (e.g., healthy donors), that overexpress a tolerogenic factor (e.g., CD47), have reduced or absent expression of MHC class I and / or MHC class II human leukocyte antigens, and optionally have reduced CD142 expression. In some embodiments, the β islet cells further express one or more complement inhibitors. In certain embodiments, the modified β islet cells overexpress a tolerogenic factor (e.g., CD47), possess a genomic modification in the B2M gene, and optionally have reduced CD142 expression. In some embodiments, the β islet cells further express one or more complement inhibitors. In some embodiments, the modified β islet cells overexpress a tolerogenic factor (e.g., CD47), possess a genomic modification in the CIITA gene, and optionally have reduced CD142 expression. In some embodiments, the beta islet cells further express one or more complement inhibitors. In some embodiments, the beta islet cells overexpress a tolerogenic factor (e.g., CD47) and carry genomic modifications that disrupt one or more of the following genes: B2M CIITA, and CD142.

[0181] In some embodiments, the modified β islet cells provided evade immune recognition. In some embodiments, the modified β islet cells described herein, e.g., β islet cells differentiated from iPSCs derived from one or more individual donors (e.g., healthy donors), do not activate an immune response in a patient (e.g., a recipient upon administration). Provided are methods of treating disease by administering a population of modified β islet cells described herein to a subject (e.g., a recipient) or patient in need thereof.

[0182] In some embodiments, the number of cells administered is a lower dose than that required for immunogenic cells (e.g., a population of cells of the same or similar cell type or phenotype but that do not contain a modification, e.g., a genetic modification, of the modified cells, e.g., that have endogenous levels of expression of CD142, MHC class I molecules, and / or MHC class II molecules, and that do not have increased (e.g., exogenous) expression of CD47).

[0183] B. Modified Pluripotent Stem Cells (e.g., Modified iPSCs) and Methods of Making In some embodiments, PSCs differentiated into beta cells, such as by the methods described above, are modified pluripotent stem cells or modified PSCs. In some aspects, provided herein are pluripotent stem cells (referred to as "modified pluripotent stem cells") comprising one or more modifications that modulate or control the expression of one or more target polynucleotide sequences involved in evading or attenuating an immune response. In some embodiments, PSCs, such as modified PCSs, are induced pluripotent stem cells (also referred to as "iPSCs," such as "modified iPSCs"). In some embodiments, the one or more modifications modulate or control (e.g., reduce or eliminate) the expression of MHC class I molecules, MHC class II molecules, or MHC class I and MHC class II molecules. In some embodiments, the one or more modifications modulate or control (e.g., increase) the expression of a tolerogenic factor, such as CD47. In some embodiments, the modified pluripotent stem cells may also have one or more other modifications that modulate or control the expression of other immune molecules, for example, a modification that modulates (e.g., reduces or eliminates) the expression of CD142 or a modification that modulates (e.g., increases) the expression of one or more complement inhibitors.

[0184] In some embodiments, the provided modified pluripotent stem cells (e.g., modified iPSCs) may also include modifications to increase expression of one or more tolerogenic factors. In some embodiments, the tolerogenic factors are one or more of DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3, or any combination thereof. In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, the modification to increase expression of the one or more tolerogenic factors is or includes increased expression of CD47. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or comprises increased expression of PD-L1. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or comprises increased expression of HLA-E. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or comprises increased expression of HLA-G. In some embodiments, the modification to increase expression of one or more tolerogenic factors is or comprises increased expression of CCL21, PD-L1, FasL, Serpinb9, H2-M3 (HLA-G), CD47, CD200, and Mfge8.

[0185] In some embodiments, the modified pluripotent stem cells (e.g., modified iPSCs) comprise one or more genomic modifications that reduce expression of an MHC class I molecule and a modification that increases expression of CD47. In other words, the modified pluripotent stem cells comprise exogenous CD47 protein and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells comprise one or more genomic modifications that reduce expression of an MHC class II molecule and a modification that increases expression of CD47. In some cases, the modified cells comprise exogenous CD47 nucleic acids and proteins and exhibit reduced or silenced surface expression of one or more MHC class I molecules. In some embodiments, the cells comprise one or more genomic modifications that reduce or eliminate expression of an MHC class II molecule, one or more genomic modifications that reduce or eliminate expression of an MHC class II molecule, and a modification that increases expression of CD47. In some embodiments, the modified pluripotent stem cells comprise exogenous CD47 protein and exhibit reduced or silenced surface expression of one or more MHC class I molecules and exhibit reduced or absent surface expression of one or more MHC class II molecules. In many embodiments, the cells are B2M indel / indel, CIITA indel / indel, CD47tg cells.

[0186] In certain embodiments, the modified pluripotent stem cells may comprise a modification that regulates or controls the expression of CD142. In some embodiments, the modification reduces or eliminates the expression of CD142. In some embodiments, a modification that reduces the expression of CD142 reduces the protein expression of CD142. In some embodiments, the modification eliminates the activity of the CD142 gene. In some embodiments, the modification comprises inactivation or disruption of both alleles of the CD142 gene. In some embodiments, the modification comprises inactivation or disruption of all CD142 coding sequences in the cell. In some embodiments, the inactivation or disruption comprises an indel in the CD142 gene. In some embodiments, the modification is a frameshift mutation or deletion of a continuous stretch of genomic DNA in the CD142 gene. In some embodiments, the CD142 gene is knocked out.

[0187] In some embodiments, the provided modified pluripotent stem (e.g., modified iPSC) cells may also contain one or more modifications that increase the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, CD35, and combinations thereof. In some embodiments, the modification(s) that increase expression comprise increased surface expression, and / or the modification that decreases expression comprise decreased surface expression. In some embodiments, the modification(s) that increase the expression of one or more complement inhibitors comprise an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and / or an exogenous polynucleotide encoding CD35. In some embodiments, the one or more complement inhibitors are CD46 and CD59, and optionally, the modification comprises an exogenous polynucleotide encoding CD46 and an exogenous polynucleotide encoding CD59. The one or more complement inhibitors are CD46, CD59, and CD55, and optionally, the modification comprises an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding CD55. In some embodiments, the modified cells comprise a multicistronic vector comprising two or more exogenous polypeptides selected from the group consisting of one or more exogenous polynucleotides encoding one or more tolerogenic factors, an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, and an exogenous polynucleotide encoding a CD55 polypeptide. In some embodiments, each of the polynucleotides is separated by an IRES or a self-cleaving peptide.

[0188] In some embodiments, the modulation (e.g., increased expression) of one or more target immune molecules, e.g., tolerogenic factors, and modulation (e.g., reduced or eliminated expression) of MHC class I and / or MHC class II molecules, is relative to the amount of expression of the molecule(s) in pluripotent stem cells that do not include the modification(s) (i.e., unmodified pluripotent stem cells). In some embodiments, the cells are engineered or modified to reduce or increase expression of one or more targets relative to unaltered or unmodified wild-type cells. In some embodiments, the cells are engineered or modified to constitutively reduce or increase expression of one or more targets relative to unaltered or unmodified cells. In some embodiments, the cells are engineered or modified to controllably reduce or increase expression of one or more targets relative to unaltered or unmodified cells. In some embodiments, the cells comprise increased expression of a tolerogenic factor (e.g., CD47) and reduced expression of MHC class I and / or MHC class II molecules relative to wild-type or control cells of the same cell type. Examples of wild-type or control cells include pluripotent cells (e.g., embryonic stem cells or iPSCs). However, by way of example, when used herein in the context of engineered cells, "wild-type" or "control" also refers to engineered cells that may contain nucleic acid changes that reduce expression of MHC I and / or II, but that have not undergone a gene editing procedure that results in overexpression of CD47 protein. In the context of iPSCs or their progeny, "wild-type" or "control" also refers to iPSCs or their progeny that may contain nucleic acid changes that result in pluripotency, but that have not undergone a gene editing procedure of the present disclosure that achieves reduced expression of MHC I and / or II, and / or overexpression of CD47 protein. In some embodiments, wild-type or control cells are the starting material. In some embodiments, the starting material for an iPSC cell line is the starting material that is considered a wild-type or control cell as contemplated herein. In some embodiments, the starting material is otherwise modified or engineered to alter the expression of one or more genes to generate an engineered cell.Thus, it should be understood that reference to an "unmodified cell" may be a control cell that has been manipulated in some manner but does not contain all of the modifications made by the gene editing procedures of the present disclosure to achieve reduced expression of MHC I and / or II and / or overexpression of tolerogenic proteins (e.g., CD47).

[0189] In some embodiments, unmodified or wild-type cells express a tolerogenic factor, an MHC class I molecule, and / or an MHC class II molecule. In some embodiments, unmodified or wild-type cells do not express one or more tolerogenic factors, an MHC class I molecule, and / or an MHC class II molecule. In some embodiments, where unmodified or wild-type cells do not express a tolerogenic factor and are used to generate engineered primary cells, the provided engineered primary cells include a modification that overexpresses one or more tolerogenic factors or increases expression of one or more tolerogenic factors from 0%. Where cells prior to manipulation do not express a detectable amount of a tolerogenic factor, a modification that results in expression of any detectable amount of a tolerogenic factor is understood to be an increase in expression compared to a similar cell that does not contain the modification.

[0190] In some embodiments, the described populations of modified pluripotent stem cells induce reduced levels of immune activation or no immune activation upon administration to a recipient subject. In some embodiments, the cells induce reduced levels of systemic TH1 activation or no systemic TH1 activation in the recipient subject. In some embodiments, the cells induce reduced levels of peripheral blood mononuclear cell (PBMC) immune activation or no PBMC immune activation in the recipient subject. In some embodiments, the cells induce reduced levels of donor-specific IgG antibodies or no donor-specific IgG antibodies against the cells upon administration to a recipient subject. In some embodiments, the cells induce reduced levels of IgM and IgG antibody production or no IgM and IgG antibody production against the cells in the recipient subject. In some embodiments, the cells induce reduced levels of cytotoxic T cell killing against the cells upon administration to a recipient subject.

[0191] In some embodiments, the modified pluripotent stem cells provided herein comprise a "suicide gene" or "suicide switch." The suicide gene or suicide switch can be engineered to function as a "safety switch" that can result in cell death after administration of the modified pluripotent stem cells to a subject, or if the cells grow and divide in an undesirable manner. The suicide gene ablation approach involves including a suicide gene in a gene transfer vector that encodes a protein that causes cell death only when activated by a specific compound. The suicide gene can encode an enzyme that selectively converts non-toxic compounds into highly toxic metabolites, resulting in the specific ablation of cells expressing the enzyme. In some embodiments, the suicide gene is the herpes virus thymidine kinase (HSV-tk) gene and the trigger is ganciclovir. In other embodiments, the suicide gene is a cytosine deaminase (e.g., Escherichia coli cytosine deaminase (EC-CD)) gene and the trigger is 5-fluorocytosine (5-FC) (Barese et al, Mol. Therap. 20(10):1932-1943 (2012); Xu et al, Cell Res. 8:73-8 (1998); both of which are incorporated by reference in their entirety).

[0192] In some aspects, provided are modified pluripotent stem cells having (1) reduced expression of MHC I and / or MHC II, and (2) a transgene comprising CD47 and a safety switch inserted into a safe harbor locus, wherein the safe harbor locus is selected from the group consisting of the AAVS1, ABO, CCR5, CLYBL, CXCR4, F3, FUT1, HMGB1, KDM5D, LRP1, MICA, MICB, RHD, ROSA26, and SHS231 loci. In some aspects, provided are modified pluripotent stem cells having (1) reduced expression of MHC I and / or MHC II, and (2) a transgene comprising CD47 and HSVtk flanked by CLYBL homology arms, wherein the transgene is inserted into the CLYBL locus. In some embodiments, the modified pluripotent stem cells have a B2M and / or CIITA knockout. In some embodiments, the B2M and / or CIITA knockout occurs in both alleles.

[0193] In other embodiments, the suicide gene is an inducible caspase protein. The inducible caspase protein comprises at least a portion of a caspase protein capable of inducing apoptosis. In a preferred embodiment, the inducible caspase protein is iCasp9. This comprises the sequence of the human FK506-binding protein FKBP12 containing the F36V mutation linked via a series of amino acids to a gene encoding human caspase 9. FKBP12-F36V binds with high affinity to the small molecule dimerizer API903. Therefore, the suicide function of iCasp9 in the present invention is triggered by administration of a dimer-inducing compound (CID). In some embodiments, the CID is the small molecule drug API903. Dimerization leads to rapid induction of apoptosis. (See, e.g., WO2011146862; Stasi et al, N. Engl. J. Med 365;18 (2011); Tey et al, Biol. Blood Marrow Transplant. 13:913-924 (2007), each of which is incorporated by reference in its entirety.

[0194] The incorporation of safety switches or suicide genes allows for controlled cell death in the event of cytotoxicity or other negative effects in the recipient, thus enhancing the safety of cell-based therapies, including those that use tolerogenic factors.

[0195] In some embodiments, a safety switch can be incorporated, e.g., introduced, into the modified pluripotent stem cells provided herein, providing the ability to induce death or apoptosis of the modified cell containing the safety switch, e.g., if the cell grows and divides in an undesirable manner or causes excessive toxicity to the host. Thus, the use of a safety switch allows for the conditional elimination of abnormal cells in vivo, which may be an essential step in the clinical application of cell therapy. Safety switches and their uses are described, for example, in Duzgune, Origins of Suicide Gene Therapy (2019); Duzgune (eds), Suicide Gene Therapy. Methods in Molecular Biology, vol. 1895 (Humana Press, New York, NY) (for HSV-tk, cytosine deaminase, nitroreductase, purine nucleoside phosphorylase, and horseradish peroxidase); Zhou and Brenner, Exp Hematol 44(11):1013-1019 (2016) (for iCaspase9); Wang et al., Blood 18(5):1255-1263 (2001) (for huEGFR); U.S. Patent Application Publication No. 20180002397 (for HER1); and Philip et al. al., Blood 124(8):1277-1287 (2014) (regarding RQR8).

[0196] In some embodiments, the safety switch can effect cell death in a controlled manner, for example, in the presence of a drug or prodrug, or upon activation by a selective exogenous compound. In some embodiments, the safety switch is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), cytosine deaminase (CyD), nitroreductase (NTR), purine nucleoside phosphorylase (PNP), horseradish peroxidase, inducible caspase 9 (iCasp9), rapamycin-activated caspase 9 (rapaCasp9), CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8.

[0197] In some embodiments, the safety switch can be a transgene encoding a product capable of killing a cell when activated by a drug or prodrug, for example, by converting a non-toxic prodrug to a toxic metabolite within the cell. In these embodiments, cell death is activated by contacting the modified cell with the drug or prodrug. In some cases, the safety switch is HSV-tk, which converts ganciclovir (GCV) to GCV-triphosphate, thereby inhibiting DNA synthesis and killing dividing cells. In some cases, the safety switch is CyD or a variant thereof, which converts the antifungal drug 5-fluorocytosine (5-FC) to the cytotoxic 5-fluorouracil (5-FU) by catalyzing the hydrolytic deamination of cytosine to uracil. 5-FU is further converted by intracellular enzymes to potent antimetabolites (5-FdUMP, 5-FdUTP, 5-FUTP). These compounds inhibit thymidylate synthase, inhibiting the production of RNA and DNA, leading to cell death. In some cases, the safety switch is NTR or a variant thereof, which can act on the prodrug CB1954 by reducing the nitro group to a reactive N-hydroxylamine intermediate that is toxic in proliferating and non-proliferating cells. In some cases, the safety switch is PNP or a variant thereof, which can convert the prodrug 6-methylpurine deoxyriboside or fludarabine to a metabolite that is toxic to both proliferating and non-proliferating cells. In some cases, the safety switch is horseradish peroxidase or a variant thereof, which can catalyze indole-3-acetic acid (IAA) to a potent cytotoxin, thereby achieving cell killing.

[0198] In some embodiments, the safety switch can be iCasp9. Caspase-9 is a component of the intrinsic mitochondrial apoptosis pathway, activated by the release of cytochrome c from damaged mitochondria under physiological conditions. Activated caspase-9 then activates caspase-3, which triggers terminal effector molecules leading to apoptosis. iCasp9 can be generated by fusing a truncated caspase-9 (lacking its physiological dimerization or caspase activation domain) to FKBP12-F36V, an FK506-binding protein (FKBP), via a peptide linker. iCasp9 has low dimer-independent basal activity and can be stably expressed in host cells (e.g., human T cells) without impairing the phenotype, function, or antigen specificity of the host cells. However, in the presence of dimer-inducing compounds (CIDs) such as rimiduside (AP1903), AP20187, and rapamycin, iCasp9 can undergo inducible dimerization and activate downstream caspase molecules, resulting in apoptosis of cells expressing iCasp9. See, e.g., PCT Publication No. 2011 / 146862; Stasi et al., N. Engl. J. Med. 365;18 (2011); Tey et al., Biol. Blood Marrow Transplant 13:913-924 (2007). In particular, the rapamycin-inducible caspase 9 variant is referred to as rapaCasp9. See, e.g., Stavrou et al., Mal. Ther. 26(5):1266-1276 (2018). Thus, iCasp9 can be used as a safety switch to achieve controlled killing of host cells.

[0199] In some embodiments, the safety switch can be a membrane-expressed protein, allowing cells to be depleted after administration of a specific antibody against that protein. Safety switches in this category can include, for example, one or more transgenes encoding CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, or RQR8 for their surface expression. These proteins can have surface epitopes that can be targeted by specific antibodies. In some embodiments, the safety switch comprises CCR4 and can be recognized by an anti-CCR4 antibody. Non-limiting examples of suitable anti-CCR4 antibodies include mogamulizumab and its biosimilars. In some embodiments, the safety switch comprises CD16 or CD30 and can be recognized by an anti-CD16 or anti-CD30 antibody. Non-limiting examples of such anti-CD16 or anti-CD30 antibodies include AFM13 and its biosimilars. In some embodiments, the safety switch comprises CD19 and can be recognized by an anti-CD19 antibody. Non-limiting examples of such anti-CD19 antibodies include MOR208 and biosimilars thereof. In some embodiments, the safety switch comprises CD20 and can be recognized by an anti-CD20 antibody. Non-limiting examples of such anti-CD20 antibodies include obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-Rllb, and biosimilars thereof. Thus, cells expressing the safety switch are CD20 positive and can be targeted for killing by administration of an anti-CD20 antibody, as described. In some embodiments, the safety switch comprises EGFR and can be recognized by an anti-EGFR antibody. Non-limiting examples of such anti-EGFR antibodies include tomzotuximab, RO5083945 (GA201), cetuximab, and biosimilars thereof. In some embodiments, the safety switch comprises GD2 and can be recognized by an anti-GD2 antibody. Non-limiting examples of such anti-GD2 antibodies include Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-Rllc, and biosimilars thereof.

[0200] In some embodiments, the safety switch can be an exogenously administered agent that recognizes one or more tolerogenic factors on the surface of the modified cells. In some embodiments, the exogenously administered agent is an antibody against or specific for the tolerogenic factor, e.g., an anti-CD47 antibody. By recognizing and blocking the tolerogenic factor on the modified cells, the exogenously administered antibody can block the immunoinhibitory function of the tolerogenic factor, thereby resensitizing the immune system to the modified cells. For example, in the case of modified cells that overexpress CD47, an exogenously administered anti-CD47 antibody can be administered to a subject, thereby masking CD47 on the modified cells and eliciting an immune response against the modified pluripotent stem cells.

[0201] In some embodiments, the safety switch may include any of the strategies described in WO2021146627A1, which is incorporated herein by reference in its entirety.

[0202] In some embodiments, the method further comprises introducing into the cell an expression vector comprising an inducible suicide switch.

[0203] In some embodiments, the modified pluripotent stem cells are obtained from source cells that already contain one or more of the desired modifications. In some embodiments, in light of the teachings provided herein, one of skill in the art will readily understand how to assess what modifications are necessary to reach the desired final form of the modified pluripotent stem cells, and will readily understand that not all reductions or increases in the levels of target components are achieved by active manipulation. In some embodiments, the modifications to the modified cells can be in any order, and not necessarily in the order listed in the descriptive language provided herein.

[0204] In some embodiments, provided herein are methods of generating modified pluripotent stem cells, the methods comprising: (a) reducing or eliminating expression of MHC class I and / or MHC class II human leukocyte antigens in the cells; and (b) increasing expression of a tolerogenic factor in the cells. In some embodiments, the one or more tolerogenic factors are selected from DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3. In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, the one or more tolerogenic factors is CD47. In some embodiments, the method comprises reducing or eliminating expression of MHC class I and MHC class II human leukocyte antigens. In some embodiments, reducing or eliminating expression comprises making one or more modifications to the cell using guided nucleases (e.g., a CRISPR / Cas system). In some embodiments, the method further comprises introducing into the cell an expression vector comprising an inducible suicide switch. In some embodiments, the method further comprises increasing in the cell the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, and CD55.

[0205] In some embodiments, provided herein are methods of generating modified pluripotent stem cells, the method comprising: (a) increasing expression of CCL21, PD-L1, FASL, SERPINB9, HLA-G, CD47, CD200, and MFGE8 in the cells; and (b) reducing expression of CD142 in the cells. In some embodiments, reducing or eliminating expression comprises making one or more modifications to the cells using guided nucleases (e.g., a CRISPR / Cas system). In some embodiments, the method further comprises introducing into the cells an expression vector comprising an inducible suicide switch. In some embodiments, the method further comprises increasing expression in the cells of one or more complement inhibitors selected from the group consisting of CD46, CD59, and CD55.

[0206] Once modified iPSC cells are generated, they can be assayed for reduced immunogenicity and / or retention of pluripotency, as described in WO2016183041 and WO2018132783. In some embodiments, reduced immunogenicity is assayed using a number of techniques exemplified in Figures 13 and 15 of WO2018132783. These techniques include transplantation into an allogeneic host and monitoring the growth of reduced immunogenic pluripotent cells that evade the host immune system (e.g., teratomas). In some cases, reduced immunogenic pluripotent cell derivatives are transduced to express luciferase and can then be tracked using bioluminescence imaging. Similarly, the T cell and / or B cell response of the host animal to such cells is tested to ensure that the cells do not elicit an immune reaction in the host animal. T cell responses can be assessed by Elispot, ELISA, FACS, PCR, or mass cytometry (CYTOF). B cell or antibody responses are assessed using FACS or Luminex. Additionally or alternatively, cells can be assayed for the ability to evade innate immune responses, e.g., NK cell killing, as generally shown in Figures 14 and 15 of WO2018132783.

[0207] In some embodiments, the immunogenicity of the cells is assessed using T cell immunoassays, such as T cell proliferation assays, T cell activation assays, and T cell killing assays, as recognized by those skilled in the art. In some cases, the T cell proliferation assay involves pre-treating the cells with interferon-gamma, co-culturing the cells with labeled T cells, and assaying for the presence of a T cell population (or a proliferating T cell population) after a preselected period of time. In some cases, the T cell activation assay involves co-culturing the T cells with cells outlined herein and determining the expression level of a T cell activation marker in the T cells.

[0208] In vivo assays can be performed to assess the immunogenicity of the cells outlined herein. In some embodiments, the survival and immunogenicity of modified iPSCs or modified SC-β cells are determined using an allogeneic humanized immunodeficient mouse model. In some cases, modified iPSCs are transplanted into allogeneic humanized NSG-SGM3 mice and assayed for cell rejection, cell survival, and teratoma formation. In some cases, the transplanted modified iPSCs or their differentiated cells exhibit long-term survival in the mouse model.

[0209] Additional techniques for determining immunogenicity, including low immunogenicity, of cells are described, for example, in Deuse et al., Nature Biotechnology, 2019, 37, 252-258 and Han et al., Proc Natl Acad Sci USA, 2019, 116(21), 10441-10446, the disclosures of which, including figures, figure legends, and method descriptions, are incorporated herein by reference in their entirety.

[0210] Similarly, retention of pluripotency can be tested in a number of ways. In one embodiment, pluripotency is assayed by expression of certain pluripotency-specific factors generally described herein and shown in Figure 29 of WO2018132783. Additionally or alternatively, pluripotent cells are differentiated into one or more cell types as an indicator of pluripotency.

[0211] Once modified pluripotent stem cells (modified iPSCs) are produced, they can be maintained in an undifferentiated state, as is known for maintaining iPSCs.For example, cells can be cultured on Matrigel using a culture medium that prevents differentiation and maintains pluripotency.In addition, cells can be present in a culture medium under the conditions that maintain pluripotency.

[0212] Once altered, the presence or absence of expression of any of the molecules described herein can be assayed using known techniques, such as Western blot, ELISA assay, FACS assay, and the like.

[0213] 1. Target gene inactivation or disruption Target gene 1) MHC class I and / or MHC class II In some embodiments, the modified pluripotent stem cells provided comprise modifications (e.g., genetic modifications) of one or more target polynucleotide or protein sequences (interchangeably referred to as target genes) that control (e.g., reduce or eliminate) the expression of MHC class I molecules, MHC class II molecules, or MHC class I and MHC class II molecules. In some embodiments, the modified cells are unmodified cells into which one or more modifications have not previously been introduced. In some embodiments, a gene editing system is used to modify one or more target polynucleotide sequences that control (e.g., reduce or eliminate) the expression of MHC class I molecules, MHC class II molecules, or MHC class I and MHC class II molecules. In certain embodiments, the genome of the cell has been altered to reduce or delete elements necessary or involved in promoting HLA expression, such as the expression of MHC class I and / or MHC class II molecules on the surface of the cell. For example, in some embodiments, expression of beta-2-microglobulin (B2M), a component of MHC class I molecules, is reduced or eliminated in the cells, thereby reducing or eliminating MHC class I protein expression (e.g., cell surface expression) by the modified pluripotent stem cells.

[0214] In some embodiments, any of the described modifications in the modified pluripotent stem cells that control (e.g., reduce or eliminate) expression of one or more target polynucleotides or proteins in the modified pluripotent stem cells can be combined with one or more modifications that overexpress a polynucleotide (e.g., a tolerogenic factor such as CD47).

[0215] In some embodiments, reduction of MHC class I and / or MHC class II expression can be achieved, for example, by one or more of the following: (1) direct targeting of MHC class I genes, such as polymorphic HLA alleles (HLA-A, HLA-B, HLA-C), and / or MHC class II genes, such as HLA-DP, HLA-DQ, and / or HLA-DR; (2) reducing surface trafficking of all MHC class I molecules by ablation of B2M; and / or (3) deleting one or more components of the MHC enhanceosome, e.g., LRC5, RFX-5, RFXANK, RFXAP, IRF1, NF-Y (including NFY-A, NFY-B, NFY-C), and CIITA, which are essential for HLA expression. In some embodiments, reduction of MHC class II can also be achieved by reducing expression, such as by knocking out the gene encoding CD74 in cells involved in MHC class II formation and trafficking.

[0216] In certain embodiments, HLA expression is inhibited. In some embodiments, HLA expression is inhibited by targeting individual HLA (e.g., knocking out the expression of one or more HLA class I molecules such as HLA-A, HLA-B, and / or HLA-C, and / or knocking out the expression of one or more HLA class I molecules such as HLA-DP, HLA-DQ, and / or HLA-DR), targeting a transcriptional regulator of HLA expression (e.g., knocking out the expression of NLRC5, CIITA, RFX5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, and / or IRF-1), blocking the surface transport of MHC class I molecules (e.g., knocking out the expression of B2M and / or TAP1), and / or targeting HLA-Razor (see, e.g., WO2016183041). In some embodiments, reduction of HLA class II can also be achieved by reducing expression, such as by knocking out the gene encoding CD74 in human cells, which is involved in the formation and transport of HLA class II molecules.

[0217] In certain aspects, the modified pluripotent stem cells disclosed herein are characterized by not expressing one or more human leukocyte antigens corresponding to MHC class I (e.g., HLA-A, HLA-B, and / or HLA-C) and / or MHC class II (e.g., HLA-DP, HLA-DQ, and / or HLA-DR), and therefore being hypoimmunogenic. For example, in certain embodiments, the modified pluripotent stem cells disclosed herein have been modified so that any stem cells or cells prepared from such cells, including differentiated stem cells, do not express or exhibit reduced expression of one or more of the following MHC class I molecules: HLA-A, HLA-B, and HLA-C. In some embodiments, one or more of HLA-A, HLA-B, and HLA-C can be "knocked out" from the cell. Cells in which the HLA-A gene, the HLA-B gene, and / or the HLA-C gene have been knocked out can exhibit reduced or eliminated expression of the respective knocked-out gene. In some aspects, the modified pluripotent stem cells disclosed herein are modified such that any stem cell or cell prepared from such a cell, including differentiated stem cells, does not express or exhibits reduced expression of one or more of the following MHC class II molecules: HLA-DP, HLA-DQ, and HLA-DR. In some embodiments, one or more of HLA-DP, HLA-DQ, and HLA-DR can be "knocked out" from the cell. Cells in which the HLA-DP gene, HLA-DQ gene, and / or HLA-DR gene have been knocked out can exhibit reduced or eliminated expression of the respective gene knocked out.

[0218] In certain embodiments, expression of MHC class I and / or MHC class II molecules is modulated by targeting and deleting a continuous stretch of genomic DNA, thereby reducing or eliminating expression of a target gene selected from the group consisting of B2M, CIITA, and NLRC5. In some embodiments, MHC class I molecules can alternatively or additionally be modulated by reducing or eliminating expression of TAP1. In some embodiments, MHC class II molecules can alternatively or additionally be modulated by reducing or eliminating expression of CD74.

[0219] In some embodiments, the modified pluripotent stem cells provided comprise a modification of one or more target polynucleotide sequences regulating MHC class I. Exemplary methods for reducing MHC class I expression are described in the following sections. In some embodiments, the targeting polynucleotide sequence is one or both of B2M and NLRC5. In some embodiments, the cells comprise a gene editing modification (e.g., an indel) to the B2M gene. In some embodiments, the cells comprise a gene editing modification (e.g., an indel) to the NLRC5 gene. In some embodiments, the cells comprise a gene editing modification (e.g., an indel) to the TAP1 gene. In some embodiments, the cells comprise a gene editing modification (e.g., an indel) to the B2M and CIITA genes.

[0220] In some embodiments, the modification that reduces expression of an MHC class I molecule is a modification that reduces expression of B2M. In some embodiments, the modification that reduces expression of B2M reduces expression of B2M mRNA. In some embodiments, the reduced B2M mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, B2M mRNA expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, B2M mRNA expression is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, B2M mRNA expression is reduced by about any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, B2M mRNA expression is eliminated (e.g., 0% expression of B2M mRNA). In some embodiments, a modification that reduces B2M mRNA expression eliminates activity of the B2M gene.

[0221] In some embodiments, the modification that reduces expression of B2M reduces protein expression of B2M. In some embodiments, the reduced protein expression of B2M is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, protein expression of B2M is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, protein expression of B2M is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, protein expression of B2M is reduced by about any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, protein expression of B2M is eliminated (e.g., no detectable expression of B2M protein). In some embodiments, the modification that reduces protein expression of B2M eliminates the activity of the B2M gene.

[0222] In some embodiments, the modification that reduces expression of B2M comprises inactivation or disruption of the B2M gene. In some embodiments, the modification that reduces expression of B2M comprises inactivation or disruption of one allele of the B2M gene. In some embodiments, the modification that reduces expression of B2M comprises inactivation or disruption, including inactivation or disruption of both alleles of the B2M gene.

[0223] In some embodiments, the modification comprises inactivation or disruption of one or more B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all B2M coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the B2M gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion in the genomic DNA of the B2M gene. In some embodiments, the modification is a deletion of a continuous stretch of genomic DNA of the B2M gene. In some embodiments, the B2M gene is knocked out.

[0224] In some embodiments, the modification that reduces expression of an MHC class I molecule is a modification that reduces expression of NLRC5. In some embodiments, reducing or eliminating expression of NLRC5 reduces or eliminates expression of one or more of the following MHC class I molecules: HLA-A, HLA-B, and HLA-C. In some embodiments, the modification that reduces NLRC5 expression reduces expression of NLRC5 mRNA. In some embodiments, reduced NLRC5 mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, NLRC5 mRNA expression is reduced by more than about 5%, for example, by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, NLRC5 mRNA expression is reduced by up to about 100%, for example, by up to about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or less. In some embodiments, NLRC5 mRNA expression is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, NLRC5 mRNA expression is eliminated (e.g., 0% expression of NLRC5 mRNA). In some embodiments, a modification that reduces NLRC5 mRNA expression eliminates the activity of the NLRC5 gene.

[0225] In some embodiments, the modification that reduces NLRC5 expression reduces NLRC5 protein expression. In some embodiments, the reduced NLRC5 protein expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, NLRC5 protein expression is reduced by more than about 5%, for example, by more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, NLRC5 protein expression is reduced by up to about 100%, for example, by up to about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, NLRC5 protein expression is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, NLRC5 protein expression is eliminated (e.g., no detectable expression of NLRC5 protein). In some embodiments, the modification that reduces NLRC5 protein expression eliminates the activity of the NLRC5 gene.

[0226] In some embodiments, the modification that reduces the expression of NLRC5 comprises inactivation or disruption of the NLRC5 gene. In some embodiments, the modification that reduces the expression of NLRC5 comprises inactivation or disruption of one allele of the NLRC5 gene. In some embodiments, the modification that reduces the expression of NLRC5 comprises inactivation or disruption, including inactivation or disruption of both alleles of the NLRC5 gene.

[0227] In some embodiments, the modification comprises inactivation or disruption of one or more NLRC5 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all NLRC5 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the NLRC5 gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the NLRC5 gene. In some embodiments, the modification is a deletion in the genomic DNA of the NLRC5 gene. In some embodiments, the modification is a deletion of a continuous stretch of the genomic DNA of the NLRC5 gene. In some embodiments, the NLRC5 gene is knocked out.

[0228] In some embodiments, the modification that reduces expression of an MHC class I molecule is a modification that reduces expression of TAP1. In some embodiments, reducing or eliminating expression of TAP1 reduces or eliminates expression of one or more of the following MHC class I molecules: HLA-A, HLA-B, and HLA-C. In some embodiments, the modification that reduces TAP1 expression reduces expression of TAP1 mRNA. In some embodiments, reduced TAP1 mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, TAP1 mRNA expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, TAP1 mRNA expression is reduced by up to about 100%, for example, by up to about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, TAP1 mRNA expression is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, TAP1 mRNA expression is eliminated (e.g., 0% expression of TAP1 mRNA). In some embodiments, a modification that reduces TAP1 mRNA expression eliminates the activity of the TAP1 gene.

[0229] In some embodiments, the modification that reduces TAP1 expression reduces TAP1 protein expression. In some embodiments, the reduced TAP1 protein expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, TAP1 protein expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, TAP1 protein expression is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, TAP1 protein expression is reduced by about any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, protein expression of TAP1 is eliminated (e.g., no detectable expression of TAP1 protein). In some embodiments, the modification that reduces protein expression of TAP1 eliminates the activity of the TAP1 gene.

[0230] In some embodiments, the modification that reduces the expression of TAP1 comprises inactivation or disruption of the TAP1 gene. In some embodiments, the modification that reduces the expression of TAP1 comprises inactivation or disruption of one allele of the TAP1 gene. In some embodiments, the modification that reduces the expression of TAP1 comprises inactivation or disruption, including inactivation or disruption of both alleles of the TAP1 gene.

[0231] In some embodiments, the modification comprises inactivation or disruption of one or more TAP1 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all TAP1 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the TAP1 gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the TAP1 gene. In some embodiments, the modification is a deletion in the genomic DNA of the TAP1 gene. In some embodiments, the modification is a deletion of a continuous stretch of genomic DNA of the TAP1 gene. In some embodiments, the TAP1 gene is knocked out.

[0232] In some embodiments, the provided modified pluripotent stem cells comprise modifications of one or more target polynucleotide sequences that control the expression of MHC class II molecules. Exemplary methods for reducing MHC class II expression are described in the following sections. In some embodiments, the cells comprise gene editing modifications to the CIITA gene. In some embodiments, the cells comprise gene editing modifications to the CD74 gene.

[0233] In some embodiments, the modification that reduces expression of an MHC class II molecule reduces expression of CIITA. In some embodiments, the modification that reduces CIITA expression reduces expression of CIITA mRNA. In some embodiments, the reduced mRNA expression of CIITA is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, the mRNA expression of CIITA is reduced by more than about 5%, for example, by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, the mRNA expression of CIITA is reduced by up to about 100%, for example, by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, CIITA mRNA expression is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, CIITA mRNA expression is eliminated (e.g., 0% expression of CIITA mRNA). In some embodiments, the modification that reduces CIITA mRNA expression eliminates the activity of the CIITA gene.

[0234] In some embodiments, the modification that reduces the expression of CIITA reduces the protein expression of CIITA. In some embodiments, the reduced protein expression of CIITA is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, the protein expression of CIITA is reduced by more than about 5%, for example, by more than about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, the protein expression of CIITA is reduced by up to about 100%, for example, by up to about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, the protein expression of CIITA is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, protein expression of CIITA is eliminated (e.g., 0% expression of CIITA protein). In some embodiments, the modification that reduces protein expression of CIITA eliminates the activity of the CIITA gene.

[0235] In some embodiments, the modification that reduces the expression of CIITA comprises inactivation or disruption of the CIITA gene. In some embodiments, the modification that reduces the expression of CIITA comprises inactivation or disruption of one allele of the CIITA gene. In some embodiments, the modification that reduces the expression of CIITA comprises inactivation or disruption, including inactivation or disruption of both alleles of the CIITA gene.

[0236] In some embodiments, the modification comprises inactivation or disruption of one or more CIITA coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all CIITA coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the CIITA gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the CIITA gene. In some embodiments, the modification is a deletion in the genomic DNA of the CIITA gene. In some embodiments, the modification is a deletion of a continuous stretch of the genomic DNA of the CIITA gene. In some embodiments, the CIITA gene is knocked out.

[0237] In some embodiments, the modification that reduces expression of an MHC class II molecule is a modification that reduces expression of CD74. In some embodiments, the modification that reduces expression of CD74 reduces expression of CD74 mRNA. In some embodiments, the reduced mRNA expression of CD74 is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, CD74 mRNA expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, CD74 mRNA expression is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, CD74 mRNA expression is reduced by about any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, CD74 mRNA expression is eliminated (e.g., 0% expression of CD74 mRNA). In some embodiments, a modification that reduces CD74 mRNA expression eliminates the activity of the CD74 gene.

[0238] In some embodiments, the modification that reduces CD74 expression reduces CD74 protein expression. In some embodiments, the reduced CD74 protein expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, CD74 protein expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, CD74 protein expression is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, CD74 protein expression is reduced by about any of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, protein expression of CD74 is eliminated (e.g., 0% expression of CD74 protein). In some embodiments, the modification that reduces protein expression of CD74 eliminates the activity of the CD74 gene.

[0239] In some embodiments, the modification that reduces CD74 expression comprises inactivation or disruption of the CD74 gene. In some embodiments, the modification that reduces CD74 expression comprises inactivation or disruption of one allele of the CD74 gene. In some embodiments, the modification that reduces CD74 expression comprises inactivation or disruption, including inactivation or disruption of both alleles of the CD74 gene.

[0240] In some embodiments, the modification comprises inactivation or disruption of one or more CD74 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all CD74 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the CD74 gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the CD74 gene. In some embodiments, the modification is a deletion in the genomic DNA of the CD74 gene. In some embodiments, the modification is a deletion of a contiguous stretch of genomic DNA of the CD74 gene. In some embodiments, the CD74 gene is knocked out.

[0241] In some embodiments, the modified cells provided comprise modifications of one or more target polynucleotide sequences that control the expression of MHC class I molecules and MHC class II molecules. Exemplary methods for reducing the expression of MHC class I molecules and MHC class II molecules include any of those described in the following sections. In some embodiments, the cells comprise gene editing modifications to the B2M and NLRC5 genes. In some embodiments, the cells comprise gene editing modifications to the CIITA and NLRC5 genes. In some embodiments, the cells comprise gene editing modifications to the B2M and CIITA genes. In certain embodiments, the cells comprise gene editing modifications to the B2M, CIITA, and NLRC5 genes.

[0242] 2) CD142 In certain aspects, the technology disclosed herein modulates (e.g., reduces or eliminates) the expression of CD142 (also known as tissue factor, factor III, and F3). In some embodiments, modulation is achieved using a CRISPR / Cas system.

[0243] In some embodiments, the target polynucleotide sequence is CD142 or a variant of CD142. In some embodiments, the target polynucleotide sequence is a homolog of CD142. In some embodiments, the target polynucleotide sequence is an ortholog of CD142.

[0244] In some embodiments, the cells outlined herein comprise a modification that targets the CD142 gene. In some embodiments, the modification that targets the CD142 gene with a rare-cutting endonuclease comprises a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid (gRNA) sequence for specifically targeting the CD142 gene. Useful methods for identifying gRNA sequences that target CD142 are described below.

[0245] Assays for testing whether the CD142 gene is inactivated are known and are described herein. In one embodiment, CD142 gene alterations and reduced CD142 expression obtained by PCR can be assayed by FACS analysis. In another embodiment, CD142 protein expression is detected using Western blots of cell lysates probed with an antibody against CD142 protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of an inactivating alteration.

[0246] Useful genomic, polynucleotide, and polypeptide information for human CD142 is provided, for example, in GeneCard Identifier GC01M094530, HGNC number 3541, NCBI Gene ID 2152, NCBI reference sequences NM_001178096.1, NM_001993.4, NP_001171567.1, and NP_001984.1, UniProt number P13726, etc.

[0247] 3)PD-1 In some embodiments, the target polynucleotide sequence is PD-1 or a variant of PD-1. In some embodiments, the target polynucleotide sequence is a homolog of PD-1. In some embodiments, the target polynucleotide sequence is an ortholog of PD-1.

[0248] In some embodiments, the cells outlined herein comprise a genetic modification targeting a gene encoding the programmed cell death protein 1 (PD-1) protein or the PDCD1 gene. In certain embodiments, primary T cells comprise a genetic modification targeting the PDCD1 gene. The genetic modification may reduce expression of PD-1 polynucleotides and PD-1 polypeptides in T cells, including primary T cells and CAR-T cells. In some embodiments, the genetic modification targeting the PDCD1 gene with a rare-cutting endonuclease comprises a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid (gRNA) sequence for specifically targeting the PDCD1 gene. Useful methods for identifying gRNA sequences targeting PD-1 are described below.

[0249] Assays for testing whether the PDCD1 gene is inactivated are known and described herein. In some embodiments, the resulting genetic alteration of the PDCD1 gene can be assayed by PCR, and reduced PD-1 expression can be assayed by FACS analysis. In another embodiment, PD-1 protein expression is detected using Western blot of cell lysates probed with an antibody against the PD-1 protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of the inactivating genetic alteration.

[0250] Useful genomic, polynucleotide, and polypeptide information for human PD-1, including the PDCD1 gene, is provided, for example, in Gene Card Identifier GC02M241849, HGNC number 8760, NCBI Gene ID 5133, Uniprot number Q15116, and NCBI reference sequence numbers NM_005018.2 and NP_005009.2.

[0251] b. Methods for inactivating or disrupting genes (e.g., reducing expression) In some embodiments, the cells provided herein are modified (e.g., genetically modified) to inactivate or destroy one or more target polynucleotides or proteins as described. In some embodiments, the cells provided herein are modified (e.g., genetically modified) to reduce expression of one or more target polynucleotides or proteins as described. In some embodiments, the cells modified with one or more modifications that reduce (e.g., eliminate) expression of a polynucleotide or protein are any of the source cells described herein. In certain embodiments, the modified pluripotent stem cells (e.g., differentiated cells such as beta islet cells) disclosed herein contain one or more modifications that reduce expression of one or more target polynucleotides. Non-limiting examples of one or more target polynucleotides include any of the above, such as CIITA, B2M, CD142, NLRC5, HLA-A, HLA-B, HLA-C, LRC5, RFX-ANK, RFX5, RFX-AP, NFY-A, NFY-B, NFY-C, IRF1, and TAP1. In some embodiments, the target polynucleotide can be CD74. In some embodiments, modifications that reduce expression of one or more target polynucleotides are combined with one or more modifications that increase expression of a desired transgene. In some embodiments, the modifications generate modified cells that are immune privileged or hypoimmunogenic. By modulating (e.g., reducing or deleting) the expression of one or more target polynucleotides, such cells exhibit reduced immune activation when engrafted into a recipient subject. In some embodiments, the cells are considered hypoimmunogenic, e.g., in a recipient subject or patient upon administration.

[0252] Any method may be used to reduce expression of a target polynucleotide. In some embodiments, the modification results in a permanent elimination or reduction of expression of the target polynucleotide. For example, in some embodiments, the target polynucleotide or gene is destroyed by introducing a DNA break into the target polynucleotide, e.g., by using a targeting endonuclease. In other embodiments, the modification results in a transient reduction in expression of the target polynucleotide. For example, in some embodiments, gene silencing is achieved by selectively suppressing or repressing expression of a gene using an inhibitory nucleic acid complementary to the target polynucleotide, e.g., by antisense technology, e.g., RNA interference (RNAi), small interfering RNA (siRNA), short hairpin (shRNA), and / or ribozymes.

[0253] In some embodiments, the target polynucleotide sequence is a genomic sequence. In some embodiments, the target polynucleotide sequence is a human genomic sequence. In some embodiments, the target polynucleotide sequence is a mammalian genomic sequence. In some embodiments, the target polynucleotide sequence is a vertebrate genomic sequence.

[0254] In some embodiments, gene disruption is typically achieved by inducing one or more double-strand breaks and / or one or more single-strand breaks in a gene in a targeted manner. In some embodiments, the double-strand or single-strand breaks are created by a nuclease, such as an endonuclease, for example, a gene-targeting nuclease. In some embodiments, the targeting nuclease is selected from RNA-guided nucleases, such as zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and CRISPR-associated nucleases (Cas), which are specifically designed to target the sequence of a gene or a portion thereof. In some embodiments, the targeting nuclease generates double-strand or single-strand breaks, which are then repaired via error-prone non-homologous end joining (NHEJ) or, in some cases, template-based, precise homology-directed repair (HDR). In some embodiments, the targeting nuclease generates a DNA double-strand break (DSB). In some embodiments, the break generation and repair process is typically error-prone, resulting in the insertion and deletion of DNA bases (indels) due to NHEJ repair. In some embodiments, the modification can induce deletion, insertion, or mutation of the nucleotide sequence of the target gene. In some cases, the modification can result in a frameshift mutation, which can lead to a premature stop codon. In the example of nuclease-mediated gene editing, targeted editing occurs on both alleles of the gene, resulting in the disruption or editing of both alleles of the gene. In some embodiments, all alleles of the gene are targeted by gene editing. In some embodiments, modification with a targeted nuclease, for example, using the CRISPR / Cas system, leads to the complete knockout of the gene. In some embodiments, a nuclease, such as a rare-cutting endonuclease, is introduced into cells containing the target polynucleotide sequence. The nuclease can be introduced into the cells in the form of a nucleic acid encoding the nuclease. The process of introducing a nucleic acid into a cell can be achieved by any suitable technique.Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using viral vectors. In some embodiments, the nucleic acid introduced into the cell is DNA. In some embodiments, the nuclease can be introduced into the cell in the form of a protein. For example, in the case of the CRISPR / Cas system, a ribonucleoprotein (RNP) can be introduced into the cell.

[0255] In some embodiments, the modification is carried out using a CRISPR / Cas system. Any CRISPR / Cas system capable of altering a target polynucleotide sequence in a cell can be used. Such CRISPR-Cas systems can utilize a variety of Cas proteins (Haft et al. PLoS Comput Biol. 2005;1(6)e60). The molecular machinery of such Cas proteins that enables the CRISPR / Cas system to modify a target polynucleotide sequence in a cell includes RNA-binding proteins, endonucleases and exonucleases, helicases, and polymerases. In some embodiments, the CRISPR / Cas system is a CRISPR type I system. In some embodiments, the CRISPR / Cas system is a CRISPR type II system. In some embodiments, the CRISPR / Cas system is a CRISPR type V system.

[0256] CRISPR / Cas systems include targeting systems that can be used to alter any target polynucleotide sequence in a cell. In some embodiments, the CRISPR / Cas systems provided herein include a Cas protein and one or more, e.g., at least one or two, ribonucleic acids (e.g., guide RNAs (gRNAs)) that guide the Cas protein to a target motif in the target polynucleotide sequence and are capable of hybridizing thereto.

[0257] In some embodiments, the Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, the one or more amino acid substitutions comprise conservative amino acid substitutions. In some cases, the substitutions and / or modifications may prevent or reduce proteolysis and / or increase intracellular polypeptide half-life. In some embodiments, the Cas protein may comprise peptide bond replacements (e.g., ureas, thioureas, carbamates, sulfonylureas, etc.). In some embodiments, the Cas protein may comprise naturally occurring amino acids. In some embodiments, the Cas protein may comprise alternative amino acids (e.g., D amino acids, beta amino acids, homocysteine, phosphoserine, etc.). In some embodiments, the Cas protein may comprise modifications to include sites (e.g., PEGylation, glycosylation, lipidation, acetylation, end-capping, etc.).

[0258] In some embodiments, the Cas protein comprises a core Cas protein. Exemplary Cas core proteins include, but are not limited to, Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. In some embodiments, the Cas protein comprises an E. coli subtype Cas protein (also known as CASS2). Exemplary E. coli subtype Cas proteins include, but are not limited to, Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein comprises a Ypest subtype Cas protein (also known as CASS3). Exemplary Ypest subtype Cas proteins include, but are not limited to, Csy1, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein comprises an Nmeni subtype Cas protein (also known as CASS4). Exemplary Nmeni subtype Cas proteins include, but are not limited to, Csn1 and Csn2. In some embodiments, the Cas protein comprises a Dvulg subtype Cas protein (also known as CASS1). Exemplary Cas proteins of the Dvulg subtype include Csd1, Csd2, and Cas5d. In some embodiments, the Cas protein comprises a Tneap subtype Cas protein (also known as CASS7). Exemplary Cas proteins of the Tneap subtype include, but are not limited to, Cst1, Cst2, and Cas5t. In some embodiments, the Cas protein comprises an Hmari subtype Cas protein. Exemplary Cas proteins of the Hmari subtype include, but are not limited to, Csh1, Csh2, and Cas5h. In some embodiments, the Cas protein comprises an Apern subtype Cas protein (also known as CASS5). Exemplary Cas proteins of the Apern subtype include, but are not limited to, Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, the Cas protein comprises an Mtube subtype Cas protein (also known as CASS6).Exemplary Cas proteins of the Mtube subtype include, but are not limited to, Csm1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, the Cas protein comprises a RAMP module Cas protein. Exemplary RAMP module Cas proteins include, but are not limited to, Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6. See, e.g., Klompe et al., Nature 571, 219-225 (2019); Strecker et al., Science 365, 48-53 (2019).

[0259] In some embodiments, the CRISPR system of the present disclosure includes a TnpB polypeptide. In some embodiments, the TnpB polypeptide can include a RuvC-like domain. The RuvC domain can be a split RuvC domain including RuvC-I, RuvC-II, and RuvC-III subdomains. In some embodiments, TnpB can further include one or more of an HTH domain, a bridge helix domain, and a zinc finger domain. The TnpB polypeptide does not include an HNH domain. In some embodiments, the TnpB protein includes, starting from the N-terminus, an HTH domain, a RuvC-I subdomain, a bridge helix domain, a RuvC-II subdomain, a zinc finger domain, and a RuvC-III subdomain. In some embodiments, the RuvC-III subdomain forms the C-terminus of the TnpB polypeptide. In some embodiments, the TnpB polypeptide is derived from an Epsilonproteobacteria bacterium, Actinoplanes lobatus strain DSM 43150, Actinomadura celluolosilytica strain DSM 45823, Actinomadura namibiensis strain DSM 44197, Alicyclobacillus macrosprangiidus strain DSM 17980, Lipingzhangella halophila strain DSM 102030, or Ktedonobacter recemifer. In some embodiments, the TnpB polypeptide is derived from Ktedonobacter racemifer or comprises a conserved RNA region similar to the 5' ITR of the K. racemifer TnpB locus. In some embodiments, TnpB may comprise a Fanzor protein, a TnpB homolog found in eukaryotic genomes. In some embodiments, the CRISPR system comprising TnpB polypeptide binds to the target adjacent motif (TAM) sequence at the 5' side of target polynucleotide.In some embodiments, TAM is a transposon-associated motif.In some embodiments, the TAM sequence comprises TCA.In some embodiments, the TAM sequence comprises TTCAN.In some embodiments, the TAM sequence comprises TTGAT. In some embodiments, the TAM sequence comprises ATAAA.

[0260] In some embodiments, methods for genetically modifying cells to knock out, knock down, or otherwise modify one or more genes include using site-specific nucleases, including, for example, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, transposases, and clustered regularly interspaced short palindromic repeats (CRISPR) / Cas systems.

[0261] ZFNs are fusion proteins containing multiple site-specific DNA-binding domains, adapted from zinc finger-containing transcription factors, linked to the endonuclease domain of the bacterial FokI restriction enzyme. ZFNs can have one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) DNA-binding or zinc finger domains. See, for example, Carroll et al., Genetics Society of America (2011) 188:773-782; Kim et al., Proc. Natl. Acad. Sci. USA (1996) 93:1156-1160. Each zinc finger domain is a small protein structural motif stabilized by one or more zinc ions and typically recognizes a 3-4 bp DNA sequence. Thus, tandem domains may potentially bind to long nucleotide sequences unique within a cell's genome.

[0262] Various zinc fingers with known specificities can be combined to create multi-finger polypeptides that recognize sequences of approximately 6, 9, 12, 15, or 18 bp. To generate zinc fingers (and combinations thereof) that recognize specific sequences, various selection and module assembly techniques are available, including phage display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. Zinc fingers can be engineered to bind to a predetermined nucleic acid sequence. Criteria for engineering zinc fingers that bind to a given nucleic acid sequence are known in the art. See, for example, Sera et al., Biochemistry (2002) 41:7074-7081; Liu et al., Bioinformatics (2008) 24:1850-1857.

[0263] ZFNs containing a FokI nuclease domain or other dimeric nuclease domains function as dimers. Therefore, a pair of ZFNs is required to target non-palindromic DNA sites. Two individual ZFNs must bind to opposite strands of DNA with their nucleases appropriately spaced apart. See Bitinaite et al., Proc. Natl. Acad. Sci. USA (1998) 95:10570-10575. To cleave a specific site in the genome, a pair of ZFNs is designed to recognize two sequences located on either side of the site, one on the forward strand and the other on the reverse strand. When the ZFNs bind on either side of the site, the nuclease domains dimerize and cleave the DNA at the site, creating a DSB with a 5' overhang. HDR can then be used to introduce a specific mutation with the aid of a repair template containing the desired mutation flanked by homologous arms. The repair template is usually an exogenous double-stranded DNA vector introduced into the cell. See Miller et al., Nat. Biotechnol. (2011) 29:143-148; Hockemeyer et al., Nat. Biotechnol. (2011) 29:731-734.

[0264] TALENs are another example of artificial nucleases that can be used to edit target genes. TALENs are derived from a DNA-binding domain called a TALE repeat, which typically contains a tandem array of 10–30 repeats that bind to and recognize long DNA sequences. Each repeat is 33–35 amino acids long, with two adjacent amino acids (called repetitive variable dimers, or RVDs) conferring specificity for one of four DNA base pairs. Thus, there is a one-to-one correspondence between repeats and base pairs in the target DNA sequence.

[0265] TALENs are artificially produced by fusing one or more TALE DNA binding domains (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) to a nuclease domain, such as a FokI endonuclease domain. See Zhang, Nature Biotech. (2011) 29:149-153. Several mutations to FokI have been made for use in TALENs, which improve, for example, cleavage specificity or activity. See Cermak et al., Nucl. Acids Res. (2011) 39:e82; Miller et al., Nature Biotech. (2011) 29:143-148; Hockemeyer et al., Nature Biotech. (2011) 29:731-734; Wood et al., Science (2011) 333:307; Doyon et al., Nature Methods (2010) 8:74-79; Szczepek et al., Nature Biotech (2007) 25:786-793; Guo et al., J. Mol. Biol. (2010) 200:96. The FokI domain functions as a dimer, requiring two constructs with unique DNA-binding domains in the appropriate orientation and spacing for a site in the target genome. Both the number of amino acid residues between the TALE DNA binding domain and the FokI nuclease domain, and the number of bases between two individual TALEN binding sites appear to be important parameters for achieving high levels of activity. Miller et al., Nature Biotech. (2011) 29:143-148.

[0266] By combining engineered TALE repeat with nuclease domain, it can produce site-specific nuclease that is specific to any desired DNA sequence.Similar to ZFN, TALEN can be introduced into cell to generate DSB at desired target site in genome, so that it can be used to knock out gene or knock in mutation through similar HDR-mediated pathway.See Boch, Nature Biotech.(2011)29:135-136;Boch et al., Science(2009)326:1509-1512;Moscou et al., Science(2009)326:3501.

[0267] Meganucleases are enzymes in the endonuclease family characterized by their ability to recognize and cleave large DNA sequences (14-40 base pairs). Meganucleases are grouped into families based on their structural motifs that affect nuclease activity and / or DNA recognition. The most widespread and best-known meganucleases are proteins of the LAGLIDADG family, named after a conserved amino acid sequence. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. On the other hand, GIY-YIG family members have a GIY-YIG module, which is 70-100 residues long and contains four or five conserved sequence motifs with four invariant residues, two of which are required for activity. See Van Roey et al., Nature Struct. Biol. (2002) 9:806-811. Meganucleases of the His-Cys family are characterized by a highly conserved series of histidines and cysteines over a region encompassing several hundred amino acid residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774. Members of the NHN family are defined by a motif containing two pairs of conserved histidines surrounded by asparagine residues. See Chevalier et al., Nucleic Acids Res. (2001) 29(18):3757-3774.

[0268] Because the high specificity requirements make it unlikely to identify a natural meganuclease for a particular target DNA sequence, various methods, including mutagenesis and high-throughput screening, have been used to create meganuclease variants that recognize unique sequences. For example, strategies for engineering meganucleases with altered DNA-binding specificity to bind to predetermined nucleic acid sequences are known in the art. For example, Chevalier et al.,Mol.Cell.(2002)10:895-905;Epinat et al.,Nucleic Acids Res(2003)31:2952-2962;Silva et al.,J Mol.Biol.(2006)361:744-754;Seligman et al.,Nucleic Acids Res(2002)30:3870-3879;Sussman et al.,J Mol Biol(2004)342:31-41;Doyon et al.,J Am Chem Soc(2006)128:2477-2484;Chen et al.,Protein Eng Des Sel(2009)22:249-256;Arnould et al.,J Mol See Biol. (2006) 355:443-458; Smith et al., Nucleic Acids Res. (2006) 363(2):283-294.

[0269] Similar to ZFN and TALEN, meganucleases can create DSBs in genomic DNA, which, if improperly repaired, for example, via NHEJ, can cause frameshift mutations, resulting in reduced expression of target genes in cells. Alternatively, foreign DNA can be introduced into cells along with meganucleases. Depending on the sequence of the foreign DNA and the chromosomal sequence, this process can be used to modify target genes. See Silva et al., Current Gene Therapy (2011) 11:11-27.

[0270] Transposases are enzymes that bind to the ends of transposons and catalyze their movement to other parts of the genome by cut-and-paste or replicative translocation mechanisms. By coupling transposases with other systems, such as the CRISPR / Cas system, new gene editing tools can be developed that enable site-specific insertion or manipulation of genomic DNA. Two known DNA integration methods are transposons that use catalytically inactive Cas effector proteins and Tn7-like transposons. Transposase-dependent DNA integration does not induce DSBs in the genome, ensuring safer and more specific DNA integration.

[0271] The CRISPR system was originally discovered in prokaryotes (e.g., bacteria and archaea) as a system involved in defense against invading phages and plasmids, providing a form of adaptive immunity. It has now been adapted and used as a widespread gene editing tool in research and clinical applications.

[0272] CRISPR / Cas systems generally contain at least two components: one or more guide RNAs (gRNAs) and a Cas protein. The Cas protein is a nuclease that introduces a DSB at the target site. CRISPR-Cas systems fall into two major classes: Class 1 systems use a complex of multiple Cas proteins to degrade nucleic acids, while Class 2 systems use a single large Cas protein for the same purpose. Class 1 systems are divided into types I, III, and IV, while Class 2 systems are divided into types II, V, and VI. Different Cas proteins adapted for gene editing applications include Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, These include, but are not limited to, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, and Mad7. The most widely used Cas protein is type II Cas9, and is described herein as an example. These Cas proteins can originate from different species. For example, Cas9 can be derived from S. pyogenes or S. aureus.

[0273] Within the original microbial genome, the type II CRISPR system integrates sequences from the invading DNA between CRISPR repeat sequences encoded as an array within the host genome. Transcripts from the CRISPR repeat array are processed into CRISPR RNAs (crRNAs), each of which contains not only a portion of the CRISPR repeat but also a variable sequence transcribed from the invading DNA known as a "protospacer" sequence. Each crRNA hybridizes to a second trans-activating CRISPR RNA (tracrRNA), and these two RNAs form a complex with the Cas9 nuclease. The protospacer-encoding portion of the crRNA guides the Cas9 complex to cleave the complementary target DNA sequence, provided it is adjacent to a short sequence known as a "protospacer adjacent motif" (PAM).

[0274] Since its discovery, the CRISPR system has been adapted to induce sequence-specific DSBs and targeted genome editing in a wide range of cells and organisms, from bacteria to eukaryotic cells, including human cells. In gene editing applications, artificially designed synthetic gRNAs are replacing the original crRNA:tracrRNA complex. For example, a gRNA can be a single guide RNA (sgRNA) composed of a crRNA, a tetraloop, and a tracrRNA. The crRNA typically contains a user-designed complementary region (also called a spacer, typically approximately 20 nucleotides long) to recognize the desired target DNA. The tracrRNA sequence contains a scaffold region for Cas nuclease binding. The crRNA and tracrRNA sequences are connected by a tetraloop, and each has a short repeat sequence for hybridization with the other, thereby creating a chimeric sgRNA. The genome target of the Cas nuclease can be altered simply by changing the sequence of the spacer or complementary region present in the gRNA. The complementary region guides the Cas nuclease to the target DNA site by standard RNA-DNA complementary base-pairing rules.

[0275] For Cas nucleases to function, a PAM must be present immediately downstream of the target sequence in genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence and, if a matching sequence is present, result in gRNA-DNA pairing. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease from S. pyogenes recognizes a PAM sequence of 5'-NGG-3' or, less efficiently, 5'-NAG-3', where "N" can be any nucleotide. Other Cas nuclease variants using alternative PAMs have also been characterized and successfully used for genome editing and are summarized in Table 1a below.

[0276] [Table 1a]

[0277] In some embodiments, Cas nucleases may contain one or more mutations to alter their activity, specificity, recognition, and / or other properties. For example, a Cas nuclease may have one or more mutations that alter its fidelity to mitigate off-target effects (e.g., high-fidelity variants of SpCas9, eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9). For another example, a Cas nuclease may have one or more mutations that alter PAM specificity.

[0278] In some embodiments, the Cas protein comprises any one of the Cas proteins described herein or functional portions thereof. As used herein, "functional portion" refers to a portion of a peptide that retains the ability to form a complex with at least one ribonucleic acid (e.g., a guide RNA (gRNA)) and cleave a target polynucleotide sequence. In some embodiments, the functional portion comprises a combination of functional domains of an operably linked Cas9 protein selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional portion comprises a combination of functional domains of an operably linked Cas12a (also known as Cpf1) protein selected from the group consisting of a DNA-binding domain, at least one RNA-binding domain, a helicase domain, and an endonuclease domain. In some embodiments, the functional domains form a complex. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of a RuvC-like domain. In some embodiments, the functional portion of the Cas9 protein comprises a functional portion of an HNH nuclease domain. In some embodiments, the functional portion of a Cas12a protein comprises a functional portion of a RuvC-like domain.

[0279] In some embodiments, suitable Cas proteins include, but are not limited to, Cas0, Cas12a (i.e., Cpf1), Cas12b, Cas12i, CasX, and Mad7.

[0280] In some embodiments, the exogenous Cas protein can be introduced into cells in the form of a polypeptide. In certain embodiments, the Cas protein can be conjugated or fused to a cell-penetrating polypeptide or cell-penetrating peptide. As used herein, "cell-penetrating polypeptide" and "cell-penetrating peptide" refer to a polypeptide or peptide, respectively, that facilitates the uptake of a molecule into a cell. The cell-penetrating polypeptide can contain a detectable label.

[0281] In certain embodiments, the Cas protein may be conjugated or fused to a charged protein (e.g., carrying a positive, negative, or overall neutral charge). Such linkages may be covalent. In some embodiments, the Cas protein may be fused to a superpositively charged GFP to significantly increase the cell penetration ability of the Cas protein (Cronican et al. ACS Chem Biol. 2010;5(8):747-52). In certain embodiments, the Cas protein may be fused to a protein transduction domain (PTD) to facilitate entry into cells. Exemplary PTDs include Tat, oligoarginines, and penetratin. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a cell penetration peptide. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a PTD. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a tat domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to an oligoarginine domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to a penetration domain. In some embodiments, the Cas9 protein comprises a Cas9 polypeptide fused to superpositive GFP. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a cell penetration peptide. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a PTD. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a tat domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to an oligoarginine domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to a penetration domain. In some embodiments, the Cas12a protein comprises a Cas12a polypeptide fused to superpositive GFP.

[0282] In some embodiments, the Cas protein may be introduced into a cell containing a target polynucleotide sequence in the form of a nucleic acid encoding the Cas protein. The process of introducing the nucleic acid into the cell may be accomplished by any suitable technique. Suitable techniques include calcium phosphate or lipid-mediated transfection, electroporation, and transduction or infection using a viral vector. In some embodiments, the nucleic acid comprises DNA. In some embodiments, the nucleic acid comprises modified DNA as described herein. In some embodiments, the nucleic acid comprises mRNA. In some embodiments, the nucleic acid comprises modified mRNA as described herein (e.g., synthetic modified mRNA).

[0283] In provided embodiments, CRISPR / Cas systems generally include two components: one or more guide RNAs (gRNAs) and a Cas protein. In some embodiments, the Cas protein is complexed with one or more, e.g., one to two, ribonucleic acids (e.g., guide RNAs (gRNAs)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein includes a modified nucleic acid (e.g., a modified synthetic mRNA) as described herein.

[0284] In some embodiments, the gRNA is a short synthetic RNA composed of a scaffold sequence for Cas binding and a custom-designed spacer or complementary portion called the crRNA. The cRNA is composed of a crRNA targeting sequence (hereinafter also referred to as the gRNA targeting sequence; typically approximately 20 nucleotides in length) that defines the genomic target to be modified and a region of crRNA repeats (e.g., GUUUUAGAGCUA; SEQ ID NO: 19). The genomic target of the Cas protein can be changed simply by changing the sequence of the complementary portion present in the gRNA (e.g., the gRNA targeting sequence). In some embodiments, the scaffold sequence for Cas binding is composed of a tracrRNA sequence (e.g., UAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU; SEQ ID NO: 20) that hybridizes to the crRNA via its anti-repeat sequence. The crRNA:tracrRNA complex recruits a Cas nuclease (e.g., Cas9) that cleaves upstream of a protospacer adjacent motif (PAM). For the Cas protein to function, a PAM must be present immediately downstream of the target sequence in the genomic DNA. Recognition of the PAM by the Cas protein is thought to destabilize the adjacent genomic sequence, allowing the gRNA to interrogate the sequence and, if a matching sequence is present, result in gRNA-DNA pairing. The specific sequence of the PAM varies depending on the species of the Cas gene. For example, the most commonly used Cas9 nuclease from S. pyogenes recognizes the NGG PAM sequence. Other Cas9 variants and other nucleases with alternative PAMs have also been characterized and successfully used for genome editing. Thus, the CRISPR / Cas system can be used to create targeted DSBs at designated genomic loci that are complementary to a gRNA designed against the target locus. The crRNA and tracrRNA can be linked together through a loop sequence (e.g., a tetraloop; GAAA, SEQ ID NO: 21) to generate a chimeric single guide RNA, the gRNA (sgRNA; Hsu et al. 2013).sgRNAs can be produced by DNA-based expression or chemical synthesis.

[0285] In some embodiments, the complementary subsequence of the gRNA (e.g., the targeting sequence of the gRNA) will vary depending on the target site of interest. In some embodiments, the gRNA comprises a complementary portion specific to the sequence of a gene set forth in Table lb or Table lc. In some embodiments, the genomic locus targeted by the gRNA is located within 4000 bp, 3500 bp, 3000 bp, 2500 bp, 2000 bp, 1500 bp, 1000 bp, or 500 bp of any of the listed loci.

[0286] The methods disclosed herein contemplate the use of any ribonucleic acid that directs a Cas protein to and allows it to hybridize to a target motif in a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises

[0287] In some embodiments, the Cas protein is complexed with one to two ribonucleic acids (e.g., guide RNAs (gRNAs)). In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein comprises a modified nucleic acid as described herein (e.g., a modified synthetic mRNA).

[0288] The methods disclosed herein contemplate the use of any ribonucleic acid that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence. In some embodiments, at least one of the ribonucleic acids comprises a tracrRNA. In some embodiments, at least one of the ribonucleic acids comprises a CRISPR RNA (crRNA). In some embodiments, a single ribonucleic acid comprises a guide RNA that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. In some embodiments, at least one of the ribonucleic acids comprises a guide RNA that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. In some embodiments, both of the one or two ribonucleic acids comprise a guide RNA that guides a Cas protein to and hybridizes with a target motif in a target polynucleotide sequence in a cell. As will be appreciated by those of skill in the art, the ribonucleic acids provided herein can be selected to hybridize with a variety of different target motifs and target polynucleotide sequences depending on the particular CRISPR / Cas system used. The one to two ribonucleic acids may also be selected to minimize hybridization with nucleic acid sequences other than the target polynucleotide sequence. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least two mismatches when compared to all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids hybridize to a target motif that contains at least one mismatch when compared to all other genomic nucleotide sequences in the cell. In some embodiments, the one to two ribonucleic acids are designed to hybridize to a target motif immediately adjacent to a deoxyribonucleic acid motif recognized by a Cas protein. In some embodiments, each of the one to two ribonucleic acids is designed to hybridize to a target motif immediately adjacent to a deoxyribonucleic acid motif recognized by a Cas protein, flanking a mutant allele located between the target motifs.

[0289] In some embodiments, each of the one to two ribonucleic acids comprises a guide RNA that guides the Cas protein to and hybridizes with a target motif in a target polynucleotide sequence within a cell.

[0290] In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on the same strand of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to sequences on opposite strands of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are not complementary to and / or hybridize to sequences on opposite strands of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to overlapping target motifs of a target polynucleotide sequence. In some embodiments, one or two ribonucleic acids (e.g., guide RNAs) are complementary to and / or hybridize to offset target motifs of a target polynucleotide sequence.

[0291] In some embodiments, the nucleic acid encoding the Cas protein and the nucleic acid encoding at least one to two ribonucleic acids are introduced into the cell via viral transduction (e.g., lentiviral transduction). In some embodiments, the Cas protein is complexed with one to two ribonucleic acids. In some embodiments, the Cas protein is complexed with two ribonucleic acids. In some embodiments, the Cas protein is complexed with one ribonucleic acid. In some embodiments, the Cas protein comprises a modified nucleic acid (e.g., a modified synthetic mRNA) as described herein.

[0292] Exemplary gRNA targeting sequences useful for CRISPR / Cas-based targeting of the genes described herein are provided in Table 1b or Table 1c.

[0293] These sequences can be found in WO2016183041, filed May 9, 2016, the disclosure of which, including tables, appendices, and sequence listings, is incorporated herein by reference in its entirety.

[0294] [Table 1b]

[0295] Additional exemplary Cas9 guide RNA sequences useful for CRISPR / Cas-based targeting of genes described herein are provided in Table 1C. One of skill in the art will understand that uracil and thymine can both be represented by a "t" instead of a "u" for uracil and a "t" for thymine. In the context of ribonucleic acids, it will be understood that "t" is used to represent uracil unless otherwise specified.

[0296] [Table 1c]

[0297] In some embodiments, it is within the level of ordinary skill in the art to identify new loci and / or gRNA targeting sequences for use in gene disruption methods to reduce or eliminate expression of the described genes. For example, with respect to CRISPR / Cas systems, if an existing gRNA targeting sequence for a particular locus (e.g., within a target gene, e.g., as defined in Table 1b or Table 1c) is known, additional loci for targeted insertion of transgenes can be identified using an "inchworming" approach by scanning the flanking regions on each side of that locus for PAM sequences, which are typically present approximately every 100 base pairs (bp) across the genome. The PAM sequence will depend on the particular Cas nuclease used, as different nucleases typically have different corresponding PAM sequences. The flanking regions on each side of the locus can be about 500 to 4000 bp in length, for example, about 500 bp, about 1000 bp, about 1500 bp, about 2000 bp, about 2500 bp, about 3000 bp, about 3500 bp, or about 4000 bp. If a PAM sequence is identified within the search range, new guides can be designed for use in gene disruption methods according to the sequence of the locus. While the CRISPR / Cas system is described as an illustrative example, any of the gene editing approaches described, including those using ZFNs, TALENs, meganucleases, and transposases, can be used in this method of identifying new loci.

[0298] In some embodiments, the cells described herein are generated using the Transcription Activator-Like Effector Nuclease (TALEN) approach. By "TALE-nuclease" (TALEN) is intended a fusion protein consisting of a nucleic acid binding domain, typically derived from a Transcription Activator-Like Effector (TALE), and one nuclease catalytic domain for cleaving a nucleic acid target sequence. The catalytic domain is preferably a nuclease domain, more preferably a domain with endonuclease activity, such as I-TevI, ColE7, NucA, and Fok-I. In certain embodiments, the TALE domain can be fused to a meganuclease, such as I-CreI and I-OnuI or functional variants thereof. In a more preferred embodiment, the nuclease is a monomeric TALE nuclease. Monomeric TALE nucleases are TALE nucleases that do not require dimerization for specific recognition and cleavage, such as the fusion of engineered TAL repeats and the catalytic domain of I-TevI ​​described in WO2012138927. Transcription activator-like effectors (TALEs) are proteins derived from the bacterial species Xanthomonas, which contain multiple repeats, each of which contains a dinucleotide repeat domain (RVD) at positions 12 and 13 that is specific for each nucleotide base of a nucleic acid target sequence. A binding domain (MBBBD) with similar modular base-pair-base nucleic acid binding properties can also be derived from a new modular protein in a different bacterial species recently discovered by the applicant. This new modular protein has the advantage of exhibiting greater sequence variability than TAL repeats. Preferably, the RVDs involved in the recognition of the different nucleotides are HD for recognizing C, NG for recognizing T, NI for recognizing A, NN for recognizing G or A, NS for recognizing A, C, G or T, HG for recognizing T, IG for recognizing T, NK for recognizing G, HA for recognizing C, ND for recognizing C, HI for recognizing C, HN for recognizing G, NA for recognizing G, SN for recognizing G or A and YG for recognizing T, TL for recognizing A, VT for recognizing A or G, and SW for recognizing A.In another embodiment, the essential amino acids 12 and 13 can be mutated towards other amino acid residues to modulate, and particularly to enhance, their specificity for the nucleotides A, T, C, and G. TALEN kits are commercially available.

[0299] In some embodiments, cells are engineered using zinc finger nucleases (ZFNs). A "zinc finger binding protein" is a protein or polypeptide that binds to DNA, RNA, and / or proteins, preferably in a sequence-specific manner, as a result of stabilization of the protein structure by the coordination of zinc ions. The term zinc finger binding protein is often abbreviated as zinc finger protein or ZFP. Individual DNA-binding domains are typically referred to as "finger(s)." ZFPs have at least one finger, typically two, three, or six fingers. Each finger binds to two to four base pairs of DNA, typically three or four base pairs. ZFPs bind to nucleic acid sequences called target sites or target segments. Each finger typically contains a zinc-chelating DNA-binding subdomain of approximately 30 amino acids. Studies have demonstrated that this class of single zinc finger consists of an alpha helix containing two invariant histidine residues and a single beta turn coordinated with two cysteine ​​residues for zinc binding (see, e.g., Berg & Shi, Science 271:1081-1085 (1996)).

[0300] In some embodiments, the cells described herein are generated using a homing endonuclease. Such homing endonucleases are well known in the art (Stoddard 2005). Homing endonucleases recognize DNA target sequences and generate single- or double-strand breaks. Homing endonucleases are highly specific and recognize DNA target sites ranging from 12 to 45 base pairs (bp) in length, typically ranging from 14 to 40 bp in length. The homing endonuclease can correspond to, for example, LAGLIDADG endonuclease, HNH endonuclease, or GIY-YIG endonuclease. In some embodiments, the homing endonuclease can be an I-CreI variant.

[0301] In some embodiments, the cells described herein are produced using meganucleases, which by definition are sequence-specific endonucleases that recognize large sequences (Chevalier, BS and BL Stoddard, Nucleic Acids Res., 2001, 29, 3757-3774). They cleave unique sites in living cells, thereby enhancing gene targeting by over 1000-fold in the vicinity of the cleavage site (Puchta et al., Nucleic Acids Res., 1993, 21, 5034-5040; Rouet et al., Mol. Cell. Biol., 1994, 14, 8096-8106; Choulika et al., Mol. Cell. Biol., 1995, 15, 1968-1973; Puchta et al., Proc. Natl. Acad. Sci. USA, 1996, 93, 5055-5060; Sargent et al., Mol. Cell. Biol., 1997, 17, 267-77; Donoho et al., Mol. Cell. Biol., 1998, 18, 4070-4078; Elliott et al., Mol. Cell. Biol., 1998, 18, 93-101, Cohen-Tannoudji et al., Mol. Cell. Biol., 1998, 18, 1444-1448).

[0302] In some embodiments, the cells provided herein are generated using RNA silencing or RNA interference (RNAi) to knock down (e.g., reduce, eliminate, or inhibit) the expression of a polypeptide. Useful RNAi methods include those utilizing synthetic RNAi molecules, small interfering RNAs (siRNAs), PIWI-interacting RNAs (piRNAs), small hairpin RNAs (shRNAs), microRNAs (miRNAs), and other transient knockdown methods recognized by those skilled in the art. RNAi reagents, including sequence-specific shRNAs, siRNAs, miRNAs, and the like, are commercially available. For example, a target polynucleotide, such as any of the above, e.g., CIITA, B2M, or NLRC5, can be knocked down in cells by RNA interference by introducing an inhibitory nucleic acid, e.g., siRNA, complementary to the target motif of the target polynucleotide into cells. In some embodiments, a target polynucleotide, such as any of the above, e.g., CIITA, B2M, or NLRC5, can be knocked down in cells by transducing an shRNA-expressing virus into cells. In some embodiments, RNA interference is employed to reduce or inhibit the expression of at least one selected from the group consisting of CIITA, B2M, and NLRC5.

[0303] c. Exemplary Target Polynucleotides and Methods for Reducing Expression 4) MHC class I In certain embodiments, the modification reduces or eliminates, e.g., knocks out, expression of an MHC class I molecule (e.g., an MHC class I gene encoding an MHC class I molecule) by targeting the accessory chain B2M. In some embodiments, the modification is performed using a CRISPR / Cas system. By reducing or eliminating, e.g., knocking out, expression of B2M, surface trafficking of MHC class I molecules is blocked, and such cells exhibit immune tolerance when transplanted into a recipient subject. In some embodiments, the cells are considered to be hypoimmunogenic, e.g., in a recipient subject or patient, upon administration.

[0304] In some embodiments, the target polynucleotide sequence provided herein is a variant of B2M. In some embodiments, the target polynucleotide sequence is a homolog of B2M. In some embodiments, the target polynucleotide sequence is an ortholog of B2M.

[0305] In some embodiments, reducing or eliminating the expression of B2M reduces or eliminates the expression of one or more of the following MHC class I molecules: HLA-A, HLA-B, and HLA-C.

[0306] In some embodiments, the modified pluripotent stem cells comprise a modification that targets the B2M gene. In some embodiments, the modification that targets B2M is achieved by using a targeting nuclease system comprising a Cas protein or a polynucleotide encoding the Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the B2M gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the B2M gene (e.g., a gRNA targeting sequence) is selected from the group consisting of SEQ ID NOs: 81240-85644 in Appendix 2 or Table 15 of WO2016 / 183041, the disclosure of which is incorporated herein by reference in its entirety.

[0307] In some embodiments, an exogenous nucleic acid or transgene encoding a polypeptide disclosed herein (e.g., a chimeric antigen receptor, CD47, or another tolerogenic factor disclosed herein) is inserted into the B2M gene. Exemplary transgenes for targeted insertion at the B2M locus include any described herein.

[0308] Assays for testing whether the B2M gene is inactivated are known and described herein. In one embodiment, the resulting B2M gene modification can be assayed by PCR, and the reduction in HLA-I expression can be assayed by flow cytometry, e.g., FACS analysis. In another embodiment, B2M protein expression is detected using Western blots of cell lysates probed with antibodies against the B2M protein. In another embodiment, the presence of the inactivating modification is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).

[0309] In some embodiments, the technology disclosed herein regulates (e.g., reduces or eliminates) the expression of MHC-I genes by targeting and modulating (e.g., reducing or eliminating) the expression of NLR family CARD domain-containing 5 / NOD27 / CLR16.1 (NLRC5). In some embodiments, the modulation is achieved using the CRISPR / Cas system. NLRC5 is a key regulator of MHC-I-mediated immune responses, and like CIITA, NLRC5 is highly inducible by IFN-γ and can translocate to the nucleus. NLRC5 activates the promoter of MHC-I genes, inducing the transcription of MHC-I and related genes involved in MHC-I antigen presentation.

[0310] In some embodiments, the target polynucleotide sequence is a variant of NLRC5. In some embodiments, the target polynucleotide sequence is a homolog of NLRC5. In some embodiments, the target polynucleotide sequence is an ortholog of NLRC5.

[0311] In some embodiments, the cells outlined herein comprise a genetic modification targeting the NLRC5 gene. In some embodiments, the genetic modification targeting the NLRC5 gene using a rare-cutting endonuclease comprises a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the NLRC5 gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the NLRC5 gene is selected from the group consisting of SEQ ID NOs: 36353 to 81239 in Appendix 3 or Table 14 of WO2016183041, the disclosure of which is incorporated by reference in its entirety.

[0312] Assays for testing whether the NLRC5 gene is inactivated are known and described herein. In some embodiments, the resulting genetic modification of the NLRC5 gene can be assayed by PCR, and the reduced expression of HLA-I can be assayed by FACS analysis. In another embodiment, NLRC5 protein expression is detected using Western blot of cell lysates probed with an antibody against the NLRC5 protein. In another embodiment, the presence of the inactivating genetic modification is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).

[0313] In some embodiments, reduced MHC class I expression or function (HLA I if the cells are derived from human cells) in the modified cells can be measured using techniques known in the art, such as FACS techniques using labeled antibodies that bind to HLA complexes, e.g., using commercially available HLA-A, B, C antibodies that bind to the alpha chain of human major histocompatibility HLA class I antigens. Additionally, cells can be tested to ensure that HLA I complexes are not expressed on the cell surface. This can be assayed by FACS analysis using antibodies against one or more of the HLA cell surface components discussed above. In addition to reduced HLA I (or MHC class I), the modified pluripotent stem cells provided herein have reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods for assaying the hypoimmunogenic phenotype of modified cells are further described below.

[0314] 5) MHC class II In certain aspects, the modification reduces or eliminates, e.g., knocks out, the expression of MHC class II genes by targeting the expression of class II transactivator (CIITA). In some embodiments, the modification is performed using a CRISPR / Cas system. CIITA is a member of the LR or nucleotide-binding domain (NBD) leucine-rich repeat (LRR) protein family and regulates MHC class II transcription by associating with the MHC enhanceosome. Reducing or eliminating, e.g., knocking out, the expression of CIITA reduces the expression of MHC class II molecules, thereby reducing their surface expression. In some cases, such cells exhibit immune tolerance when transplanted into a recipient subject. In some embodiments, the cells are considered to be hypoimmunogenic, e.g., in a recipient subject or patient, upon administration.

[0315] In some embodiments, the target polynucleotide sequence is a variant of CIITA. In some embodiments, the target polynucleotide sequence is a homolog of CIITA. In some embodiments, the target polynucleotide sequence is an ortholog of CIITA.

[0316] In some embodiments, reducing or eliminating expression of CIITA reduces or eliminates expression of one or more of the following MHC class II: HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, and HLA-DR.

[0317] In some embodiments, the modified cell comprises a modification that targets the CIITA gene. In some embodiments, the modification that targets CIITA is by a targeting nuclease system comprising a Cas protein or a polynucleotide encoding the Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene. In some embodiments, the at least one guide ribonucleic acid sequence for specifically targeting the CIITA gene (e.g., a targeting sequence of a gRNA) is selected from the group consisting of SEQ ID NOs: 5184 to 36352 in Appendix 1 or Table 12 of WO2016183041, the disclosure of which is incorporated by reference in its entirety.

[0318] In some embodiments, an exogenous nucleic acid or transgene encoding a polypeptide disclosed herein (e.g., a chimeric antigen receptor, CD47, or another tolerogenic factor disclosed herein) is inserted into the CIITA gene. Exemplary transgenes for targeted insertion at the B2M locus include any of those described herein.

[0319] Assays for testing whether the CIITA gene is inactivated are known and are described herein. In one embodiment, the resulting CIITA gene alteration can be assayed by PCR, and the reduction in HLA-II expression can be assayed by flow cytometry, e.g., FACS analysis. In another embodiment, CIITA protein expression is detected using Western blot of cell lysates probed with an antibody against CIITA protein. In another embodiment, the presence of an inactivating alteration is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).

[0320] In some embodiments, the reduction in MHC class II expression or function (or HLA II if the cells are derived from human cells) in the modified cells can be measured using techniques known in the art, such as Western blotting using antibodies against the protein, FACS techniques, or RT-PCR techniques. In some embodiments, the modified cells can be tested to confirm that HLA II complexes are not expressed on the cell surface. Methods for assessing surface expression include those known in the art (see, e.g., Figure 21 in WO2018132783) and are typically performed using either Western blot or FACS analysis based on commercially available antibodies that bind to human HLA class II HLA-DR, DP, and most DQ antigens. In addition to the reduction in HLA II (or MHC class II), the modified pluripotent stem cells provided herein have reduced susceptibility to macrophage phagocytosis and NK cell killing. Methods for assaying the hypoimmunogenic phenotype of modified cells are further described below.

[0321] 6) CD142 In certain aspects, the modification reduces or eliminates, e.g., knocks out, expression of CD142. In some embodiments, the modification is performed using a CRISPR / Cas system. CD142, also known as tissue factor (F3), is a membrane-bound protein that initiates blood coagulation by forming a complex with circulating factor VII or factor VIIa. The CD142(TF):VIIa complex activates factor IX or factor X through specific limited proteolysis. CD142(TF) plays a role in normal hemostasis by initiating cell surface assembly and propagation of the coagulation protease cascade. Reducing or eliminating, e.g., knocking out, expression of CD142 reduces expression of MHC class II molecules, thereby reducing surface expression. In some cases, such cells exhibit immune tolerance when transplanted into a recipient subject. In some embodiments, the cells are considered to be hypoimmunogenic, e.g., in a recipient subject or patient, upon administration.

[0322] In some embodiments, the target polynucleotide sequence is a variant of CD142. In some embodiments, the target polynucleotide sequence is a homolog of CD142. In some embodiments, the target polynucleotide sequence is an ortholog of CD142.

[0323] In some embodiments, the modified pluripotent stem cells comprise a modification that targets the CD142 gene. In some embodiments, the modification that targets CD142 is via a targeted nuclease system comprising a Cas protein or a polynucleotide encoding a Cas protein and at least one guide ribonucleic acid sequence for specifically targeting the CD142 gene. In some embodiments, the target polynucleotide sequence is CD142 or a variant of CD142. In some embodiments, the target polynucleotide sequence is a homolog of CD142. In some embodiments, the target polynucleotide sequence is an ortholog of CD142.

[0324] In some embodiments, the cells outlined herein may comprise a modification that targets the CD142 gene. In some embodiments, the modification that targets the CD142 gene with a rare-cutting endonuclease comprises a Cas protein or a polynucleotide encoding the Cas protein and at least one guide ribonucleic acid (gRNA) sequence for specifically targeting the CD142 gene. Useful methods for identifying gRNA sequences that target CD142 are described below.

[0325] Assays for testing whether the CD142 gene is inactivated are known and are described herein. In one embodiment, CD142 gene alterations and reduced CD142 expression obtained by PCR can be assayed by FACS analysis. In another embodiment, CD142 protein expression is detected using Western blots of cell lysates probed with an antibody against the CD142 protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of an inactivating alteration. Useful genomic, polynucleotide, and polypeptide information for human CD142 is provided, for example, in GeneCard Identifier GC01M094530, HGNC number 3541, NCBI Gene ID 2152, NCBI reference sequence numbers NM_001178096.1, NM_001993.4, NP_001171567.1, and NP_001984.1, UniProt number P13726, etc.

[0326] In some embodiments, an exogenous nucleic acid or transgene encoding a polypeptide disclosed herein (e.g., a chimeric antigen receptor, CD46, CD59, CD55, or CD47, or another tolerogenic factor disclosed herein) is inserted into the CD142 gene. Exemplary transgenes for targeted insertion at the CD142 locus include any of those described herein.

[0327] In some embodiments, reduced CD142 expression or function in modified cells can be measured using techniques known in the art, such as Western blotting using antibodies against the protein, FACS techniques, or RT-PCR techniques. In some embodiments, modified cells can be tested to confirm that CD142 is not expressed on the cell surface. Methods for assessing surface expression include those known in the art (see, for example, Figure 21 in WO2018132783) and are typically performed using either Western blot or FACS analysis based on commercially available antibodies that bind to human CD142. In addition to reduced CD142, the modified cells provided herein have reduced susceptibility to IBMIR. Methods for assaying the hypoimmunogenic phenotype of modified cells are further described below.

[0328] In some embodiments, the modification that reduces CD142 expression reduces CD142 mRNA expression. In some embodiments, the reduced CD142 mRNA expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, CD142 mRNA expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, CD142 mRNA expression is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, CD142 mRNA expression is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, CD142 mRNA expression is eliminated (e.g., 0% expression of CD142 mRNA). In some embodiments, a modification that reduces CD142 mRNA expression eliminates the activity of the CD142 gene.

[0329] In some embodiments, the modification that reduces CD142 expression reduces CD142 protein expression. In some embodiments, the reduced CD142 protein expression is compared to unmodified or wild-type cells of the same cell type that do not contain the modification. In some embodiments, CD142 protein expression is reduced by more than about 5%, e.g., by more than about any of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. In some embodiments, CD142 protein expression is reduced by up to about 100%, e.g., by up to about any of 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5% or less. In some embodiments, CD142 protein expression is reduced by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%. In some embodiments, CD142 protein expression is eliminated (e.g., 0% expression of CD142 protein). In some embodiments, the modification that reduces CD142 protein expression eliminates the activity of the CD142 gene.

[0330] In some embodiments, the modification that reduces expression of CD142 comprises inactivation or disruption of the CD142 gene. In some embodiments, the modification that reduces expression of CD142 comprises inactivation or disruption of one allele of the CD142 gene. In some embodiments, the modification that reduces expression of CD142 comprises inactivation or disruption, including inactivation or disruption of both alleles of the CD142 gene.

[0331] In some embodiments, the modification comprises inactivation or disruption of one or more CD142 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption of all CD142 coding sequences in the cell. In some embodiments, the modification comprises inactivation or disruption, including an indel in the CD142 gene. In some embodiments, the modification is a frameshift mutation in the genomic DNA of the CD142 gene. In some embodiments, the modification is a deletion in the genomic DNA of the CD142 gene. In some embodiments, the modification is a deletion of a continuous stretch of genomic DNA of the CD142 gene.

[0332] Exemplary guide target sequences for CD142 are known, for example: TIFF2025504392000005.tif104165

[0333] 2. Polynucleotide overexpression In some embodiments, the modified pluripotent stem cells provided herein are genetically modified, such as by introducing one or more modifications into the cells that cause the cells to overexpress a desired polynucleotide. In some embodiments, the modified cells are unmodified cells into which one or more modifications have not previously been introduced. In some embodiments, the modified pluripotent stem cells provided herein are genetically modified to include one or more exogenous polynucleotides (the term "transgene" is also used interchangeably) encoding exogenous proteins. As described, in some embodiments, the cells are modified to increase the expression of specific genes that are tolerogenic (e.g., immune) factors that affect immune recognition and tolerance in the recipient. In some embodiments, the modified cells provided, e.g., T cells or NK cells, also express a chimeric antigen receptor (CAR). One or more polynucleotides, e.g., exogenous polynucleotides, can be expressed (e.g., overexpressed) in the modified pluripotent stem cells along with one or more genetic modifications that reduce the expression of an MHC class I and / or MHC class II molecule or a target polynucleotide, such as CD142, as described above. In some embodiments, the modified pluripotent stem cells provided do not elicit or activate an immune response upon administration to a recipient subject.

[0334] In some embodiments, the modified pluripotent stem cells comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different overexpressed polynucleotides. In some embodiments, the overexpressed polynucleotides are exogenous polynucleotides. In some embodiments, the modified pluripotent stem cells comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more different exogenous polynucleotides. In some embodiments, the overexpressed polynucleotides are exogenous polynucleotides that are episomally expressed in the cell. In some embodiments, the overexpressed polynucleotides are exogenous polynucleotides that are inserted or integrated into one or more genomic loci of the modified cell.

[0335] In some embodiments, expression of a polynucleotide is increased using a fusion protein containing a DNA targeting domain and a transcriptional activator, i.e., the polynucleotide is overexpressed. Targeting methods for increasing expression using transcriptional activator domains are known to those of skill in the art.

[0336] In some embodiments, the modified pluripotent stem cells contain one or more exogenous polynucleotides, and the one or more exogenous polynucleotides are inserted or integrated into the genomic locus of the cell by a non-targeted insertion method, for example, by transduction with a lentiviral vector. In some embodiments, the one or more exogenous polynucleotides are inserted or integrated into the genome of the cell by a targeted insertion method, for example, by using homology-directed repair (HDR). Any suitable method can be used to insert an exogenous polynucleotide into a genomic locus of a modified cell by HDR, including the gene editing methods described herein (e.g., the CRISPR / Cas system). In some embodiments, the one or more exogenous polynucleotides are inserted into one or more genomic loci, for example, any genomic locus described herein (e.g., Table 2). In some embodiments, the exogenous polynucleotides are inserted into the same genomic locus. In some embodiments, the exogenous polynucleotides are inserted into different genomic loci. In some embodiments, two or more of the exogenous polynucleotides are inserted at the same genomic locus, e.g., any genomic locus described herein (e.g., Table 2). In some embodiments, two or more exogenous polynucleotides are inserted at different genomic loci, e.g., two or more genomic loci described herein (e.g., Table 2).

[0337] Exemplary polynucleotides or overexpressors, and methods for overexpressing them, are described in the subsections below.

[0338] d. target gene 7) Tolerogenic factors In some embodiments, the expression of a tolerogenic factor in the cells is overexpressed or increased. In some embodiments, the modified pluripotent stem cells comprise increased expression, i.e., overexpression, of at least one tolerogenic factor. In some embodiments, the tolerogenic factor is any factor that promotes or contributes to the promotion or induction of tolerance by the immune system (e.g., the innate immune system or the adaptive immune system) to the modified cells. In some embodiments, the tolerogenic factor is DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3. In some embodiments, the tolerogenic factor is CD47, PD-L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200 or Mfge8, or any combination thereof. In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. In some embodiments, the cells comprise at least one exogenous polynucleotide comprising a polynucleotide encoding a tolerogenic factor. For example, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide encoding CD47. Provided herein are cells that do not elicit or activate an immune response upon administration to a recipient subject.As noted above, in some embodiments, the cells are modified to increase expression of genes and tolerogenic (eg, immune) factors that affect immune recognition and tolerance in the recipient.

[0339] In some embodiments, the present disclosure provides cells or populations thereof that have been modified to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the disclosure provides methods for modifying the genome of a cell to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the modified cell expresses an exogenous tolerogenic factor (e.g., an immunomodulatory polypeptide), such as exogenous CD47. In some cases, overexpression or increased expression of an exogenous polynucleotide is achieved by introducing into the cell (e.g., transducing the cell) an expression vector comprising a nucleotide sequence encoding a human CD47 polypeptide. In some embodiments, the expression vector may be a viral vector, such as a lentiviral vector, or a non-viral vector. In some embodiments, the cell is modified to contain one or more exogenous polynucleotides, wherein at least one of the exogenous polynucleotides comprises a polynucleotide encoding a tolerogenic factor. In some of the optional embodiments, the tolerogenic factors are DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3. In some embodiments, the tolerogenic factors are selected from CD47, PD-L1, HLA-E or HLA-G, CCL21, FasL, Serpinb9, CD200 or Mfge8, or any combination thereof (e.g., all of them).In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. For example, in some embodiments, at least one of the exogenous polynucleotides is a polynucleotide encoding CD47.

[0340] In some embodiments, the tolerogenic factor is CD47. In some embodiments, the modified pluripotent stem cells contain an exogenous polynucleotide encoding CD47, such as human CD47. In some embodiments, CD47 is overexpressed in the cells. In some embodiments, CD47 expression in the modified cells is overexpressed or increased compared to a reference cell or unmodified cell, such as a similar cell of the same cell type that has not been modified with the modification, e.g., a cell that has not been modified with an exogenous polynucleotide encoding CD47. CD47 is a leukocyte surface antigen that plays a role in cell adhesion and regulation of integrins. CD47 is normally expressed on the surface of cells and signals circulating macrophages not to engulf the cells. Useful genome, polynucleotide, and polypeptide information for human CD47 is provided, for example, in NP_001768.1, NP_942088.1, NM_001777.3, and NM_198793.2.

[0341] In some embodiments, the modified pluripotent stem cells comprise increased expression, i.e., overexpression, of at least one tolerogenic factor. In some embodiments, the cells comprise at least one exogenous polynucleotide comprising a polynucleotide encoding a tolerogenic factor. In some embodiments, the tolerogenic factors comprise DUX4, B2M-HLA-E, CD16, CD52, CD47, CD27, CD200, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, PD-L1, IDO1, CTLA4-Ig, Cl inhibitor, IL-10, IL-35, FASL, CCL21, MFGE8, SERPINB9, CD35, IL-39, CD16 Fc receptor, IL15-RF, and H2-M3, or any combination thereof. In some embodiments, the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF. For example, in some embodiments, at least one of the overexpressed (e.g., exogenous) polynucleotides is a polynucleotide encoding CD47.

[0342] In some embodiments, the present disclosure provides cells or populations thereof that have been modified to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the present disclosure provides methods for modifying the genome of a cell to express a tolerogenic factor (e.g., an immunomodulatory polypeptide), such as CD47. In some embodiments, the modified pluripotent stem cells express an exogenous tolerogenic factor (e.g., an immunomodulatory polypeptide), such as exogenous CD47. In some cases, the cells express an expression vector comprising a nucleotide sequence encoding a human CD47 polypeptide.

[0343] In some embodiments, the modified pluripotent stem cells contain an overexpressed polynucleotide encoding CD47, such as human CD47. In some embodiments, the modified pluripotent stem cells contain an exogenous polynucleotide encoding CD47, such as human CD47. In some embodiments, CD47 is overexpressed in the cells. In some embodiments, expression of CD47 in the modified pluripotent stem cells is increased compared to a similar reference cell or unmodified cell (including any other modifications), except that the reference cell or unmodified cell does not contain an exogenous polynucleotide encoding CD47.

[0344] In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the sequence set forth in NCBI reference numbers NM_001777.3 and NM_198793.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 set forth in NCBI reference numbers NM_001777.3 and NM_198793.21.

[0345] In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells outlined herein comprise an exogenous nucleotide sequence encoding a CD47 polypeptide having the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 having at least 85% sequence identity (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) to the sequence set forth in NCBI reference numbers NM_001777.3 and NM_198793.2. In some embodiments, the cells comprise an exogenous nucleotide sequence for CD47 set forth in NCBI reference numbers NM_001777.3 and NM_198793.21.

[0346] In some embodiments, the cells comprise an exogenous CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1. In some embodiments, the cells outlined herein comprise an exogenous CD47 polypeptide having the amino acid sequence set forth in NCBI reference SEQ ID NOs: NP_001768.1 and NP_942088.1.

[0347] In some embodiments, the cell comprises an overexpressed polynucleotide encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an exogenous polynucleotide encoding a CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an overexpressed polynucleotide encoding a CD47 polypeptide having an amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the cell comprises an exogenous polynucleotide encoding a CD47 polypeptide having an amino acid sequence set forth in SEQ ID NO: 1.

[0348] In some embodiments, the cell comprises an overexpressed CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an exogenous CD47 polypeptide having at least 95% sequence identity (e.g., 95%, 96%, 97%, 98%, 99%, or more) to the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an overexpressed CD47 polypeptide having the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the cell comprises an exogenous CD47 polypeptide having the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the exogenous nucleotide sequence encoding a CD59 polypeptide is operably linked to a sequence encoding a heterologous signal peptide. In some embodiments, the exogenous polynucleotide encoding CD47 is integrated into the genome of the cell by targeted or non-targeted insertion methods, such as those described further below. In some embodiments, the targeted insertion is by homology-dependent insertion into a target locus, e.g., insertion into any one of the loci shown in Table 2, e.g., the B2M gene or the CIITA gene. In some embodiments, the targeted insertion is by homology-independent insertion, e.g., insertion into a safe harbor locus. In some cases, a polynucleotide encoding CD47 is inserted into a safe harbor locus, e.g., a locus selected from, but not limited to, AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, a polynucleotide encoding CD47 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus.

[0349] In some embodiments, all or a functional portion of CD47 can be linked to other components, such as a signal peptide, a leader sequence, a secretion signal, a label (e.g., a reporter gene), or any combination thereof. In some embodiments, the nucleic acid sequence encoding the signal peptide of CD47 is replaced with a nucleic acid sequence encoding a signal peptide from a heterologous protein. The heterologous protein can be, for example, CD8α, CD28, tissue plasminogen activator (tPA), growth hormone, granulocyte-macrophage colony-stimulating factor (GM-CSF), GM-CSF receptor (GM-CSFRα), or an immunoglobulin (e.g., IgE or IgK). In some embodiments, the signal peptide is a signal peptide derived from an immunoglobulin (such as an IgG heavy chain or an IgG-kappa light chain), a cytokine (such as interleukin-2 (IL-2) or CD33), a serum albumin protein (e.g., HSA or albumin), a human azurocidin preprotein signal sequence, luciferase, trypsinogen (e.g., chymotrypsinogen or trypsinogen), or other signal peptide capable of efficiently expressing a protein by or on a cell.

[0350] In certain embodiments, the exogenous polynucleotide encoding CD47 is operably linked to a promoter.

[0351] In some embodiments, an exogenous polynucleotide encoding CD47 is inserted into any one of the loci shown in Table 2. In some cases, an exogenous polynucleotide encoding CD47 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, an exogenous polynucleotide encoding CD47 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, an exogenous polynucleotide encoding CD47 is inserted into the B2M locus, the CIITA locus, or the CD142 locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of a polynucleotide encoding CD47 into a genomic locus of a cell.

[0352] In some embodiments, CD47 protein expression is detected using Western blots of cell lysates probed with antibodies against CD47 protein, hi another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of exogenous CD47 mRNA.

[0353] In some embodiments, the modified pluripotent stem cells contain an exogenous polynucleotide encoding CD200, such as human CD200. In some embodiments, CD200 is overexpressed in the cells. In some embodiments, expression of CD200 in the modified cells is increased compared to a similar reference cell or unmodified cell (including any other modifications), except that the reference cell or unmodified cell does not contain an exogenous polynucleotide encoding CD200. Useful genomic, polynucleotide, and polypeptide information for human CD200 is provided, for example, in GeneCard Identifier GC03P112332, HGNC number 7203, NCBI Gene ID 4345, Uniprot number P41217, and NCBI reference sequence numbers NP_001004196.2, NM_001004196.3, NP_001305757.1, NM_001318828.1, NP_005935.4, NM_005944.6, XP_005247539.1, and XM_005247482.2. In certain embodiments, the polynucleotide encoding CD200 is operably linked to a promoter.

[0354] In some embodiments, the polynucleotide encoding CD200 is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding CD200 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding CD200 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding CD200 is inserted into the B2M locus, the CIITA locus, or the CD142 locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding CD200 into a genomic locus of the cell.

[0355] In some embodiments, CD200 protein expression is detected using Western blots of cell lysates probed with antibodies against CD200 protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of exogenous CD200 mRNA.

[0356] In some embodiments, the modified pluripotent stem cells contain an exogenous polynucleotide encoding HLA-E, such as human HLA-E. In some embodiments, HLA-E is overexpressed in the cells. In some embodiments, expression of HLA-E in the modified pluripotent stem cells is increased compared to a similar reference cell or unmodified cell (including any other modifications), except that the reference cell or unmodified cell does not contain an exogenous polynucleotide encoding HLA-E. Useful genome, polynucleotide, and polypeptide information for human HLA-E is provided, for example, in GeneCard Identifier GC06P047281, HGNC number 4962, NCBI Gene ID 3133, Uniprot number P13747, and NCBI reference sequence numbers NP_005507.3 and NM_005516.5. In certain embodiments, the polynucleotide encoding HLA-E is operably linked to a promoter.

[0357] In some embodiments, a polynucleotide encoding HLA-E is inserted into any one of the loci shown in Table 2. In some cases, a polynucleotide encoding HLA-E is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, a polynucleotide encoding HLA-E is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, a polynucleotide encoding HLA-E is inserted into the B2M locus, the CIITA locus, or the CD142 locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of a polynucleotide encoding HLA-E into a genomic locus of a cell.

[0358] In some embodiments, HLA-E protein expression is detected using Western blots of cell lysates probed with antibodies against HLA-E protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of exogenous HLA-E mRNA.

[0359] In some embodiments, the modified pluripotent stem cells contain an exogenous polynucleotide encoding HLA-G, such as human HLA-G. In some embodiments, HLA-G is overexpressed in the cells. In some embodiments, expression of HLA-G in the modified pluripotent stem cells is increased compared to a similar reference cell or unmodified cell (including any other modifications), except that the reference cell or unmodified cell does not contain an exogenous polynucleotide encoding HLA-G. Useful genome, polynucleotide, and polypeptide information for human HLA-G is provided, for example, in GeneCard Identifier GC06P047256, HGNC number 4964, NCBI Gene ID 3135, Uniprot number P17693, and NCBI reference sequence numbers NP_002118.1 and NM_002127.5. In certain embodiments, the polynucleotide encoding HLA-G is operably linked to a promoter.

[0360] In some embodiments, the polynucleotide encoding HLA-G is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding HLA-G is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In particular embodiments, the polynucleotide encoding HLA-G is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding HLA-G is inserted into the B2M locus, the CIITA locus, or the CD142 locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding HLA-G into a genomic locus of a cell.

[0361] In some embodiments, HLA-G protein expression is detected using Western blots of cell lysates probed with antibodies against HLA-G protein. In another embodiment, the presence of exogenous HLA-G mRNA is confirmed using reverse transcriptase polymerase chain reaction (RT-PCR).

[0362] In some embodiments, the modified pluripotent stem cells contain an exogenous polynucleotide encoding PD-L1, such as human PD-L1. In some embodiments, PD-L1 is overexpressed in the cells. In some embodiments, expression of PD-L1 in the modified cells is increased compared to a similar reference cell or unmodified cell (including any other modifications), except that the reference cell or unmodified cell does not contain the exogenous polynucleotide encoding PD-L1. Useful genomic, polynucleotide, and polypeptide information for human PD-L1 or CD274 is provided, for example, in the GeneCard Identifier GC09P005450, HGNC Number 17635, NCBI Gene ID 29126, Uniprot Number Q9NZQ7, and NCBI Reference SEQ ID NOs: NP_001254635.1, NM_001267706.1, NP_054862.1, and NM_014143.3. In certain embodiments, the polynucleotide encoding PD-L1 is operably linked to a promoter.

[0363] In some embodiments, the polynucleotide encoding PD-L1 is inserted into any one of the loci shown in Table 2. In some cases, the polynucleotide encoding PD-L1 is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, the polynucleotide encoding PD-L1 is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, the polynucleotide encoding PD-L1 is inserted into the B2M locus, the CIITA locus, or the CD142 locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of the polynucleotide encoding PD-L1 into a genomic locus of the cell.

[0364] In some embodiments, PD-L1 protein expression is detected using Western blots of cell lysates probed with an antibody against PD-L1 protein, hi another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) is used to confirm the presence of exogenous PD-L1 mRNA.

[0365] In some embodiments, the modified pluripotent stem cells contain an exogenous polynucleotide encoding FasL, such as human FasL. In some embodiments, FasL is overexpressed in the cells. In some embodiments, expression of FasL in the modified pluripotent stem cells is increased compared to a similar reference cell or unmodified cell (including any other modifications), except that the reference cell or unmodified cell does not contain the exogenous polynucleotide encoding FasL. Useful genomic, polynucleotide, and polypeptide information for human Fas Ligand (also known as FasL, FASLG, CD178, TNFSF6, etc.) is provided, for example, in GeneCard Identifier GC01P172628, HGNC Number 11936, NCBI Gene ID 356, Uniprot Number P48023, and NCBI Reference SEQ ID NOs: NP_000630.1, NM_000639.2, NP_001289675.1, and NM_001302746.1. In certain embodiments, the polynucleotide encoding Fas-L is operably linked to a promoter.

[0366] In some embodiments, a polynucleotide encoding Fas-L is inserted into any one of the loci shown in Table 2. In some cases, a polynucleotide encoding Fas-L is inserted into a safe harbor locus, such as, but not limited to, a locus selected from AAVS1, CCR5, CLYBL, ROSA26, and SHS231. In specific embodiments, a polynucleotide encoding Fas-L is inserted into the CCR5 locus, the PPP1R12C (also known as AAVS1) locus, or the CLYBL locus. In some embodiments, a polynucleotide encoding Fas-L is inserted into the B2M locus, the CIITA locus, or the CD142 locus. In some embodiments, a suitable gene editing system (e.g., a CRISPR / Cas system or any of the gene editing systems described herein) is used to facilitate insertion of a polynucleotide encoding Fas-L into a genomic locus of a cell.

[0367] In some embodiments, Fas-L protein expression is detected using Western blots of cell lysates probed with an antibody against Fas-L protein. In another embo...

Claims

1. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing modified pluripotent stem cells (PSCs), (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of (b) a modification that increases the expression of one or more tolerogenic factors in the modified PSCs relative to control or wild-type PSCs. providing the modified PSCs, comprising: (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into the modified SC-β cells; The method comprising:

2. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) generating modified pluripotent stem cells (PSCs), (a) to the PSC: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules introducing one or more modifications that inactivate or disrupt one or more alleles of (b) increasing the expression of one or more tolerogenic factors in said PSCs relative to control or wild-type PSCs. generating the modified PSCs, comprising: (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells; The method comprising:

3. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing modified pluripotent stem cells (PSCs), comprising at least one modification selected from the group consisting of: (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of (b) a modification that increases the expression of one or more tolerogenic factors in the modified PSCs relative to a control or wild-type cell of the same cell type that does not contain the modification. providing the modified PSCs, comprising: (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells; (C) introducing one or more additional modifications into the modified SC-β cells; Including, The one or more additional modifications are and at least one other modification of (a), (b), or (a) and (b) that is not present in the modified PSC. Including, The method.

4. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) culturing pluripotent stem cells (PSCs) under conditions sufficient for the PSCs to differentiate into SC-β cells; (B) producing modified SC-β cells, (a) injecting the SC-β cells into the SC-β cells; (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules introducing one or more modifications that inactivate or disrupt one or more alleles of (b) increasing the expression of one or more tolerogenic factors in said SC-β cells relative to control or wild-type SC-β cells. producing the modified SC-β cells, The method comprising:

5. 5. The method of any one of claims 1 to 4, wherein the modification in (a) reduces the expression of the one or more MHC class I molecules and / or the one or more MHC class II molecules in the modified cells compared to a control or wild-type cell of the same cell type.

6. The method of any one of claims 1 to 5, wherein the control or wild-type cells are cells of the same cell type that do not contain the modification.

7. 7. The method of any one of claims 1 to 3 and 5 to 6, wherein expression of the one or more MHC class I molecules and the one or more MHC class II molecules is reduced in the modified PSCs compared to the control or wild-type PSCs.

8. 8. The method of any one of claims 1 to 7, wherein expression of the one or more MHC class I molecules and the one or more MHC class II molecules is reduced in the modified SC-β cells compared to the control or wild-type SC-β cells.

9. the one or more modifications in (a) reduce the function of the one or more MHC class I molecules; Optionally, the function is antigen presentation. The method according to any one of claims 1 to 8.

10. The method according to any one of claims 1 to 9, wherein the one or more MHC class I molecules are one or more human leukocyte antigen (HLA) class I molecules.

11. The method of any one of claims 1 to 10, wherein the one or more MHC HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, and HLA-C.

12. The method according to any one of claims 1 to 11, wherein the one or more molecules that control the expression of the one or more MHC class I molecules are selected from the group consisting of B2M, NLRC5, and TAP1.

13. The method according to any one of claims 1 to 12, wherein the one or more molecules that control the expression of the one or more MHC class I molecules control the cell surface protein expression of the one or more MHC class I molecules.

14. 14. The method of any one of claims 1 to 13, wherein the one or more modifications in (a) reduce cell surface protein expression of the one or more MHC class I molecules.

15. The method of any one of claims 1 to 14, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class I molecules.

16. The method of claim 14 or claim 15, wherein the one or more molecules that control cell surface protein expression of the one or more MHC class I molecules are B2M.

17. the one or more modifications include modifications that regulate cell surface protein expression of the one or more MHC class I molecules; the modification inactivates or disrupts one or more alleles of B2M; The method according to any one of claims 1 to 16.

18. 18. The method of any one of claims 1 to 17, wherein cell surface transport of the one or more MHC class I molecules is reduced in the modified SC-β cells compared to the control or wild-type SC-β cells.

19. The method of any one of claims 12 to 18, wherein the modification that inactivates or disrupts one or more alleles of B2M reduces mRNA expression of the B2M gene.

20. The method of any one of claims 12 to 19, wherein the modification that inactivates or disrupts one or more alleles of B2M reduces protein expression of B2M.

21. The modification that inactivates or disrupts one or more alleles of B2M is inactivation or disruption of one allele of the B2M gene; Inactivation or disruption of both alleles of the B2M gene; or Inactivation or disruption of all B2M coding alleles in the cell The method according to any one of claims 12 to 20, comprising:

22. 22. The method of any one of claims 12 to 21, wherein the inactivation or disruption comprises an indel in the B2M gene.

23. 23. The method of any one of claims 12 to 22, wherein said inactivation or said disruption comprises a frameshift mutation or deletion of a continuous stretch of genomic DNA of said B2M gene.

24. 24. The method of any one of claims 1 to 23, wherein the one or more modifications in (a) reduce cell surface protein expression of the one or more MHC class II molecules.

25. 25. The method of any one of claims 1 to 24, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class II molecules.

26. the one or more modifications in (a) reduce the function of the one or more MHC class II molecules; Optionally, the function is antigen presentation. The method according to any one of claims 1 to 25.

27. 27. The method of any one of claims 1 to 26, wherein the one or more MHC class II molecules are one or more human leukocyte antigen (HLA) class II molecules.

28. 28. The method of any one of claims 1 to 27, wherein the one or more MHC HLA class II molecules are selected from the group consisting of HLA-DP, HLA-DQ, and / or HLA-DR.

29. The method of any one of claims 1 to 28, wherein the one or more molecules that control the expression of the one or more MHC class II molecules are selected from the group consisting of CIITA and CD74.

30. the modification regulates the expression of the one or more MHC class II molecules; the modification inactivates or disrupts one or more alleles of CIITA; 30. The method according to any one of claims 1 to 29.

31. 31. The method of claim 30, wherein the modification that inactivates or disrupts one or more alleles of CIITA reduces mRNA expression of the CIITA gene.

32. 32. The method of claim 30 or 31, wherein the modification that inactivates or disrupts one or more alleles of CIITA reduces the protein expression of CIITA.

33. The modification that inactivates or disrupts one or more alleles of CIITA is inactivation or disruption of one allele of the CIITA gene; Inactivation or disruption of both alleles of the CIITA gene; or Inactivation or disruption of all CIITA-coding alleles in the cell The method of any one of claims 30 to 32, comprising:

34. 34. The method of any one of claims 30 to 33, wherein the inactivation or disruption comprises an indel in the CIITA gene.

35. 35. The method of any one of claims 30 to 34, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CIITA gene.

36. 36. The method of any one of claims 1 to 3 and 5 to 35, wherein expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified PSCs.

37. 37. The method of any one of claims 1 to 36, wherein expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified SC-β cells.

38. 38. The method of any one of claims 1 to 37, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

39. The method of any one of claims 1 to 38, wherein at least one of the one or more tolerogenic factors is CD47.

40. The method of any one of claims 1 to 39, wherein the one or more tolerogenic factors is CD47.

41. 40. The method of any one of claims 1 to 39, wherein at least one of the one or more tolerogenic factors is PD-L1.

42. 42. The method of any one of claims 1 to 39 and 41, wherein at least one of the one or more tolerogenic factors is HLA-E.

43. The method of any one of claims 1 to 39 and 41 to 42, wherein at least one of the one or more tolerogenic factors is HLA-G.

44. 33. The method of any one of claims 2 and 5-32, wherein increasing the expression of the one or more tolerogenic factors comprises introducing a modification that increases expression of the one or more tolerogenic factors in the modified PSCs compared to the control or wild-type PSCs.

45. 45. The method of any one of claims 1 to 44, wherein the modification that increases expression of the one or more tolerogenic factors comprises an exogenous polynucleotide encoding the one or more tolerogenic factors.

46. 46. ​​The method of claim 45, wherein the exogenous polynucleotides encoding the one or more tolerogenic factors are integrated into the genome of the modified PSC.

47. 46. ​​The method of claim 45, wherein the exogenous polynucleotides encoding the one or more tolerogenic factors are integrated into the genome of the modified SC-β cells.

48. 48. The method of claim 46 or claim 47, wherein the exogenous polynucleotide encoding the one or more tolerogenic factors is integrated by non-targeted insertion into the genome of the modified cell, optionally by introducing the exogenous polynucleotide into the cell using a lentiviral vector.

49. the exogenous polynucleotide encoding the one or more tolerogenic factors is integrated by targeted insertion into a target genomic locus of the cell; Optionally, the targeted insertion is by nuclease-mediated gene editing by homology directed repair.

50. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing a modified pluripotent stem cell (PSC) comprising a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding a CD47 protein; (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into the modified SC-β cells; Including, Optionally, the modified PSC is B2M インデル／インデル ;CIITA インデル／インデル having a CD47tg phenotype; The method.

51. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing pluripotent stem cells (PSCs); (B) culturing the PSCs under conditions sufficient for the PSCs to differentiate into SC-β cells; (C) producing modified SC-β cells from the SC-β cells by introducing into the SC-β cells a modification to knock out the B2M gene and a modification to knock out the CIITA gene, and by introducing an exogenous polynucleotide encoding a CD47 protein. The method comprising:

52. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing modified pluripotent stem cells (PSCs) comprising one or more modifications selected from the group consisting of a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding a CD47 protein; (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells; (C) introducing one or more additional modifications into the modified SC-β cells; Including, The one or more additional modifications are At least one other modification selected from the group consisting of a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding a CD47 protein, which is not present in the modified PSCs. Including, The method.

53. The modified SC-β cells are B2M インデル／インデル ;CIITA インデル／インデル ; The method of claim 50 or claim 52, wherein the cell has a CD47tg phenotype.

54. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing modified pluripotent stem cells (PSCs) comprising a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding a CD47 protein, and an exogenous polynucleotide encoding a safety switch; (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into the modified SC-β cells; The method comprising:

55. The modified PSC is B2M インデル／インデル ;CIITA インデル／インデル 55. The method of claim 54, having a phenotype of ;CD47tg; safety switch transgene.

56. 56. The method of any one of claims 50 to 55, wherein the exogenous polynucleotide encoding CD47 is integrated by non-targeted insertion into the genome of the modified cell, optionally by introducing the exogenous polynucleotide into the cell using a lentiviral vector.

57. wherein the exogenous polynucleotide encoding CD47 is integrated by targeted insertion into a target genomic locus of the cell; 57. The method of any one of claims 50 to 56, wherein optionally the targeted insertion is by nuclease-mediated gene editing by homology directed repair.

58. 58. The method of any one of claims 1 to 57, wherein the modified PSC further comprises a modification to increase expression of an exogenous safety switch.

59. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing pluripotent stem cells (PSCs); (B) culturing the PSCs under conditions sufficient for the PSCs to differentiate into SC-β cells; (C) producing modified SC-β cells from the SC-β cells by introducing into the SC-β cells a modification to knock out the B2M gene and a modification to knock out the CIITA gene, and by introducing an exogenous polynucleotide encoding a CD47 protein and an exogenous polynucleotide encoding a safety switch; The method comprising:

60. 1. A method for producing modified stem cell-derived beta cells (SC-beta cells), comprising: (A) providing modified pluripotent stem cells (PSCs) comprising one or more modifications selected from the group consisting of a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding a CD47 protein, and an exogenous polynucleotide encoding a safety switch; (B) culturing the modified PSCs under conditions sufficient to differentiate the modified PSCs into modified SC-β cells; (C) introducing one or more additional modifications into the modified SC-β cells; Including, The one or more additional modifications are At least one or more other modifications selected from the group consisting of a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding CD47, and an exogenous polynucleotide encoding a safety switch, which are not present in the modified PSCs. Including, The method.

61. The modified SC-β cells are B2M インデル／インデル ;CIITA インデル／インデル 61. The method of claim 59 or claim 60, wherein the mouse has a phenotype of: ;CD47tg; safety switch transgene.

62. 62. The method of any one of claims 50-61, wherein the exogenous polynucleotide encoding CD47 is integrated by non-targeted insertion into the genome of the modified SC-β cell, optionally by introducing the exogenous polynucleotide into the cell using a lentiviral vector.

63. wherein the exogenous polynucleotide encoding CD47 is integrated by targeted insertion into a target genomic locus of the cell; Optionally, the targeted insertion is by nuclease-mediated gene editing by homology-directed repair.

62. The method of any one of claims 50 to 61.

64. 54. The method of any one of claims 1 to 53, wherein the modified SC-β cells further comprise a modification to increase expression of an exogenous safety switch.

65. The safety switch a system in which, upon activation, the cells downregulate the expression of said one or more tolerogenic factors and / or upregulate the expression of one or more immune signaling molecules, thereby marking said cells for elimination by the host immune system.

54. The method of claim 53, wherein:

66. 66. The method of claim 65, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

67. 67. The method of claim 65 or claim 66, wherein the one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

68. 65. The method of claim 64, wherein the safety switch is a suicide gene.

69. 69. The method of claim 68, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

70. 69. The method of claim 67 or claim 68, wherein the safety switch and the one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified cell.

71. 71. The method of any one of claims 64 to 70, wherein the safety switch and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified cell.

72. 72. The method of Claim 70 or Claim 71, wherein the bicistronic cassette is integrated by non-targeted insertion into the genome of the modified cell, optionally by introduction of the exogenous polynucleotide into the cell using a lentiviral vector.

73. the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the cell; Optionally, the targeted insertion is by nuclease-mediated gene editing by homology-directed repair.

72. The method of claim 70 or claim 71.

74. 74. The method of claim 63 or claim 73, wherein the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus.

75. 75. The method of claim 74, wherein the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

76. 76. The method of any one of claims 1 to 75, wherein the modified PSCs comprise a modification that inactivates or disrupts one or more alleles of CD142.

77. 77. The method of claim 76, wherein the modification reduces mRNA expression of the CD142 gene.

78. The method of claim 76 or claim 77, wherein the modification reduces the protein expression of CD142.

79. the modification that inactivates or disrupts one or more alleles of CD142 is inactivation or disruption of one allele of the CD142 gene; inactivation or disruption of both alleles of the CD142 gene; Inactivation or destruction of all CD142-coding alleles in said cells 79. The method of any one of claims 76 to 78, comprising:

80. 80. The method of any one of claims 76 to 79, wherein said inactivation or said disruption comprises an indel in said CD142 gene.

81. 81. The method of any one of claims 76 to 80, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CD142 gene.

82. 82. The method of any one of claims 1-81, wherein the modified PSCs comprise a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35 compared to the control or wild-type PSCs.

83. 83. The method of any one of claims 1 to 82, wherein the modified SC-β cells comprise a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35, relative to the control or wild-type SC-β cells.

84. 84. The method of claim 82 or claim 83, wherein the modification to increase expression of the one or more complement inhibitors comprises at least one exogenous polynucleotide selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35.

85. 85. The method of any one of claims 82 to 84, wherein the one or more complement inhibitors are CD46 and CD59.

86. 60. The method of any one of claims 82 to 84 or claim 59, wherein the one or more complement inhibitors are CD46, CD59 and CD55.

87. 87. The method of any one of claims 84 to 86, wherein the at least one exogenous polynucleotide is integrated by non-targeted insertion into the genome of the modified PSC, optionally by introducing the exogenous polynucleotide into the cell using a lentiviral vector.

88. the at least one exogenous polynucleotide is integrated by targeted insertion into a target genomic locus of the cell; 88. The method of any one of claims 84-87, optionally wherein the targeted insertion is by nuclease-mediated gene editing by homology directed repair.

89. 89. The method of claim 88, wherein the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus.

90. 90. The method of claim 89, wherein the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

91. Culturing the PSCs under conditions sufficient for the PSCs to differentiate into the SC-β cells, (i) contacting the PSCs with a TGFbeta / activin agonist and / or a glycogen synthase kinase 3 (GSK) inhibitor and / or a WNT agonist for a time sufficient to form definitive endoderm cells; (ii) contacting definitive endoderm cells differentiated from said PSCs with an FGFR2b agonist for a time sufficient to form primitive gut cells; (iii) contacting the differentiated primitive intestinal cells from the PSCs with a retinoic acid receptor (RAR) agonist, a rho-kinase inhibitor, a smoothened antagonist, an FGFR2b agonist, a protein kinase C activator, and / or a BMP type 1 receptor inhibitor for a time sufficient to form early pancreatic progenitor cells; (iv) incubating the early pancreatic progenitor cells differentiated from the PSCs for at least about 3 days, contacting the early pancreatic progenitor cells with a rho-kinase inhibitor, a TGFbeta / activin agonist, a Smoothened antagonist, an FGFR2b agonist, an RAR agonist, a protein kinase C activator, and / or a BMP type 1 receptor inhibitor for a time sufficient to form pancreatic progenitor cells, wherein the RAR agonist concentration is less than the RAR agonist concentration in step (iii); (v) contacting pancreatic progenitor cells differentiated from said PSCs with an Alk5 inhibitor / TGF beta receptor inhibitor, a gamma secretase inhibitor, a Smoothened antagonist, an Erbbl (EGFR) or Erbb4 agonist, a thyroid hormone, and / or an RAR agonist for a time sufficient to form endoderm cells, said contacting comprising depolymerizing the actin cytoskeleton during at least a portion of said contacting in (v) at a time and for a time sufficient to enhance differentiation efficiency; and / or (vi) incubating the endoderm cells differentiated from the PSCs in serum-free medium for a time sufficient to form β cells.

91. The method of any one of claims 1 to 90, comprising one or more of:

92. culturing the PSCs under conditions sufficient for the PSCs to differentiate into the SC-β cells; (i) contacting the PSCs with a TGFbeta / activin agonist and / or a glycogen synthase kinase 3 (GSK) inhibitor and / or a WNT agonist for a time sufficient to form definitive endoderm cells; (ii) contacting definitive endoderm cells differentiated from said PSCs with an FGFR2b agonist for a time sufficient to form primitive gut cells; (iii) contacting the differentiated primitive intestinal cells from the PSCs with a retinoic acid receptor (RAR) agonist, a rho-kinase inhibitor, a smoothened antagonist, an FGFR2b agonist, a protein kinase C activator, and / or a BMP type 1 receptor inhibitor for a time sufficient to form early pancreatic progenitor cells; (iv) incubating the early pancreatic progenitor cells differentiated from the PSCs for at least about 3 days, contacting the early pancreatic progenitor cells with a rho-kinase inhibitor, a TGFbeta / activin agonist, a Smoothened antagonist, an FGFR2b agonist, an RAR agonist, a protein kinase C activator, and / or a BMP type 1 receptor inhibitor for a time sufficient to form pancreatic progenitor cells, wherein the RAR agonist concentration is less than the RAR agonist concentration in step (iii); (v) contacting pancreatic progenitor cells differentiated from said PSCs with an Alk5 inhibitor / TGF beta receptor inhibitor, a gamma secretase inhibitor, a Smoothened antagonist, an Erbbl (EGFR) or Erbb4 agonist, a thyroid hormone, and / or an RAR agonist for a time sufficient to form endoderm cells, said contacting comprising depolymerizing the actin cytoskeleton during at least a portion of said contacting in (v) at a time and for a time sufficient to enhance differentiation efficiency; and (vi) incubating the endoderm cells differentiated from the PSCs in serum-free medium for a time sufficient to form β cells.

91. The method of any one of claims 1 to 90, comprising:

93. 93. The method of claim 91 or 92, comprising a step of aggregating the beta cells formed in step (vi) into clusters.

94. 94. The method of any one of claims 91 to 93, wherein the actin cytoskeleton depolymerizing step comprises plating the cells on a stiff or soft substrate and / or introducing a cytoskeleton modulating agent into the cells.

95. 95. The method of claim 94, wherein the cytoskeleton modulating agent comprises latrunculin A, latrunculin B, nocodazole, cytochalasin D, jasplakinolide, blebbistatin, y-27632, y-15, gdc-0994, and / or an integrin modulating agent.

96. 96. The method of claim 94 or claim 95, wherein the cytoskeleton modulating agent is latrunculin A.

97. 97. The method of any one of claims 91 to 96, wherein the actin cytoskeleton depolymerization step is initiated at the beginning of the contacting step in (v).

98. 98. The method of any one of claims 91 to 97, wherein the actin cytoskeleton depolymerizing step comprises adding latrunculin A at the start of the contacting step for at least the first 24 hours or for at least about the first 24 hours.

99. 99. The method of any one of claims 91-98, wherein altering the size of the beta cell clusters comprises disaggregating and re-aggregating the clusters.

100. the TGF / activin agonist is activin A; the glycogen synthase kinase 3 (GSK) inhibitor or the WNT agonist is CHIR99021; the FGFR2b agonist is KGF; the smoothened antagonist is SANT-1; the RAR agonist is retinoic acid (RA); the protein kinase C activator is TPPB; The BMP1 type receptor inhibitor is LDN193189, the rho kinase inhibitor is Y27632; the Alk5 inhibitor is Alk5iII; the Erbb4 agonist is betacellulin; the thyroid hormone is T3, and / or The gamma secretase inhibitor is XXI.

99. The method of any one of claims 91 to 99.

101. 101. The method of any one of claims 91 to 100, wherein the concentration of the RAR agonist in step (iv) is at least 5-fold, at least 10-fold, or at least 20-fold lower than the concentration of the RAR agonist in step (iii).

102. 102. The method of any one of claims 1 to 101, wherein the PSCs are embryonic stem cells.

103. 102. The method of any one of claims 1 to 101, wherein the PSCs are induced PSCs (iPSCs), optionally patient-derived iPSCs.

104. 104. The method of any one of claims 1-3 and 5-103, wherein the modified PSCs express each of the one or more tolerogenic factors at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type PSCs.

105. 105. The method of claim 104, wherein each of the one or more tolerogenic factors is expressed by the modified PSCs at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold higher than a second level expressed by the control or wild-type PSCs.

106. each of the one or more tolerogenic factors is expressed by the modified PSCs at greater than or greater than about 20,000 molecules per cell; Optionally, each of the one or more tolerogenic factors is expressed by the modified PSCs at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell. The method according to any one of claims 1 to 3 and 5 to 105.

107. the one or more tolerogenic factors include CD47, and the modified PSCs express CD47 at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type PSCs; Optionally, CD47 is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by said control or wild-type PSCs. The method according to any one of claims 1 to 3 and 5 to 106.

108. the one or more tolerogenic factors include CD47, and CD47 is expressed by the modified PSCs at greater than or greater than about 20,000 molecules per cell; Optionally, CD47 is expressed by the modified PSCs at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell. The method according to any one of claims 1 to 3 and 5 to 108.

109. 109. The method of any one of claims 1 to 108, wherein the modification in (a) reduces expression of one or more MHC class I molecules and / or one or more MHC class II molecules in the modified SC-β cells compared to control or wild-type beta cells, and the modified SC-β cells have increased expression of one or more tolerogenic factors in the modified SC-β cells compared to the control or wild-type beta cells.

110. 110. The method of claim 109, wherein the control or wild-type beta cells are unmodified SC-beta cells differentiated from PSCs that do not contain the modification.

111. The method of claim 109 or claim 110, wherein the expression of one or more MHC class I molecules and one or more MHC class II molecules is reduced in the modified SC-β cells.

112. 112. The method of any one of claims 1 to 3 and 5 to 111, wherein the modified SC-β cells comprise the modification of the modified PSCs.

113. wherein the one or more modifications in (a) reduce cell surface protein expression of the one or more MHC class I molecules; Optionally, the one or more modifications in (a) reduce cell surface transport of the one or more MHC class I molecules.

113. The method of any one of claims 1 to 112.

114. the one or more modifications in (a) reduce the function of the one or more MHC class I molecules; Optionally, the function is antigen presentation.

114. The method of any one of claims 1 to 113.

115. the one or more modifications include modifications that regulate cell surface protein expression of the one or more MHC class I molecules; the modification inactivates or disrupts one or more alleles of B2M; 115. The method of any one of claims 1 to 114.

116. The method of any one of claims 1 to 114, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class I molecules.

117. 117. The method of any one of claims 115 to 116, wherein the modification that inactivates or disrupts one or more alleles of B2M reduces mRNA expression of the B2M gene, and / or the modification that inactivates or disrupts one or more alleles of B2M reduces protein expression of B2M.

118. The modification that inactivates or disrupts one or more alleles of B2M is inactivation or disruption of one allele of the B2M gene; Inactivation or disruption of both alleles of the B2M gene; or Inactivation or disruption of all B2M coding alleles in the cell The method of any one of claims 115 to 117, comprising:

119. 119. The method of any one of claims 115 to 118, wherein said inactivation or disruption comprises an indel in said B2M gene.

120. 120. The method of any one of claims 115 to 119, wherein said inactivation or said disruption comprises a frameshift mutation or deletion of a continuous stretch of genomic DNA of said B2M gene.

121. 121. The method of any one of claims 1 to 120, wherein the one or more modifications in (a) reduce cell surface protein expression of the one or more MHC class II molecules.

122. 122. The method of any one of claims 1 to 121, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class II molecules.

123. the modification in (a) reduces the function of the one or more MHC class II molecules; Optionally, the function is antigen presentation.

123. The method of any one of claims 1 to 122.

124. the one or more modifications include modifications that regulate expression of the one or more MHC class II molecules; the modification inactivates or disrupts one or more alleles of CIITA; 124. The method of any one of claims 1 to 123.

125. The method of claim 124, wherein the modification that inactivates or disrupts one or more alleles of CIITA reduces mRNA expression of the CIITA gene, or the modification that inactivates or disrupts one or more alleles of one or more molecules that control the expression of the one or more MHC class II molecules in the modified SC-β cells reduces protein expression of CIITA.

126. The modification that inactivates or disrupts one or more alleles of CIITA is inactivation or disruption of one allele of the CIITA gene; Inactivation or disruption of both alleles of the CIITA gene; or Inactivation or disruption of all CIITA-coding alleles in the cell The method of any one of claims 124 to 125, comprising:

127. 127. The method of any one of claims 124 to 126, wherein the inactivation or disruption comprises an indel in the CIITA gene.

128. 128. The method of any one of claims 124 to 127, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CIITA gene.

129. 129. The method of any one of claims 1 to 128, wherein expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified SC-β cells.

130. The method of any one of claims 1 to 129, wherein the modified SC-β cells comprise a modification that inactivates or disrupts one or more alleles of CD142.

131. The method of claim 130, wherein the modification reduces mRNA expression of the CD142 gene.

132. The method of claim 130 or claim 131, wherein the modification reduces the protein expression of CD142.

133. the modification that inactivates or disrupts one or more alleles of CD142 is inactivation or disruption of one allele of the CD142 gene; Inactivation or disruption of both alleles of the CD142 gene; or Inactivation or destruction of all CD142 coding alleles in said cells The method of any one of claims 130 to 132, comprising:

134. 134. The method of any one of claims 130 to 133, wherein said inactivation or said disruption comprises an indel in said CD142 gene.

135. 135. The method of any one of claims 130 to 134, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CD142 gene.

136. 136. The method of any one of claims 1-135, wherein said inactivation or said disruption of said one or more alleles is by one or more gene editing.

137. The method of any one of claims 1 to 136, wherein the cell contains a genome editing complex.

138. The method of claim 136 or claim 137, wherein the one or more gene edits are performed by a genome editing complex.

139. The method of claim 138, wherein the genome editing complex comprises a genome targeting entity and a genome modifying entity.

140. the genome targeting entity localizes the genome editing complex to the one or more alleles that have been inactivated or disrupted; Optionally, the genome targeting entity is a nucleic acid-guided targeting entity. The method of claim 139.

141. 141. The method of Claim 139 or Claim 140, wherein the genome targeting entity is selected from the group consisting of a sequence-specific nuclease, a nucleic acid programmable DNA binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZF) nucleic acid binding entity, a transcription activator-like effector (TALE) nucleic acid binding entity, a meganuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient Cas protein, an enzyme-inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, or a functional portion thereof.

142. The genome targeting entity is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr1, Cmr2, Cmr 3, Cmr4, Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse2, Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Csn2, Cst1, Cst2, Cas5t, Csh1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4, Mad7, SpCas9, high-fidelity variants of SpCas9 eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and e The method of any one of claims 139 to 141, wherein the causative agent is selected from the group consisting of voSpCas9, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12bv4, TnpB, dCas(D10A), dCas(H840A), dCas13a, dCas13b, or a functional portion thereof.

143. 142. The method of any one of claims 139-141, wherein the genome-modifying entity cleaves, deaminates, nicks, polymerizes, interrogates, integrates, excises, unwinds, breaks, alters, methylates, demethylates, or otherwise destabilizes the target locus.

144. 144. The method of any one of claims 139-143, wherein the genome-modifying entity comprises a recombinase, integrase, transposase, endonuclease, exonuclease, nickase, helicase, DNA polymerase, RNA polymerase, reverse transcriptase, deaminase, flippase, methylase, demethylase, acetylase, nucleic acid-modifying protein, RNA-modifying protein, DNA-modifying protein, Argonaute protein, epigenetic-modifying protein, histone-modifying protein, or a functional portion thereof.

145. The method of any one of claims 139 to 144, wherein the genome-modifying entity is selected from the group consisting of a sequence-specific nuclease, a nucleic acid-programmable DNA-binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a meganuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient Cas protein, an enzyme-inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, base editing, prime editing, programmable addition of site-specific targeting elements (PASTE), or a functional portion thereof.

146. The genome modification entity is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, C mr1, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse2, Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Csn2, Cst1, Cst2, Cas5t, Csh1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4, Mad7, SpCas9, high-fidelity variant of SpCas9, eSpCas9, SpCas9-H F1, HypaSpCas9, HeFSpCas9, and evoSpCas9, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12bv4, TnpB, FokI, dCas(D10A), dCas(H840A), dCas13a, dCas13b, base editors, prime editors (e.g., target prime reverse transcription (TPRT) editors), APOBEC1, cytidine deaminase, adenosine deaminase, uracil glycosylase inhibitors (UGI), adenine base editor (ABE), cytosine base editor (CBE), reverse transcriptase, serine integrase, recombinase, transposase, polymerase, adenine-thymine or "ATBE" (or thymine-adenine or "TABE") transversion base editor, 10-11 translocation methylcytosine dioxygenase (TET), TET1, TET3, TET1CD, histone acetyltransferase p300, histone methyltransferase SMYD3, histone methyltransferase PRDM9,The method according to any one of claims 139 to 145, wherein the target gene is selected from the group consisting of H3K79 methyltransferase DOT1L, a transcriptional repressor, or a functional portion thereof.

147. 147. The method of any one of claims 139 to 146, wherein the genome targeting entity and the genome modifying entity are different domains of a single polypeptide.

148. The method of any one of claims 139 to 147, wherein the genome editing entity and the genome modification entity are two different polypeptides that are operably linked.

149. The method of any one of claims 139 to 147, wherein the genome editing entity and the genome modification entity are two different unlinked polypeptides.

150. the genome editing complex comprises a guide nucleic acid having a targeting domain complementary to at least one target locus; 148. The method of any one of claims 139 to 147, wherein optionally the guide nucleic acid is a guide RNA (gRNA).

151. The method of any one of claims 139 to 150, wherein the one or more modifications are made by the genome editing complex.

152. 152. The method of Claim 151, wherein the one or more modifications made by the genome editing complex are made by a sequence-specific nuclease, a nucleic acid-programmable DNA-binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a meganuclease, a Cas nuclease, a core Cas protein, a TnpB nuclease, a homing endonuclease, an endonuclease-deficient Cas protein, an enzyme-inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, base editing, prime editing, or programmable addition of site-specific targeting elements (PASTE).

153. The one or more modifications made by the genome editing complex are selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, and Cas13. d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, CRISPR-associated transposases, base editing, prime editing, or programmable addition of site-specific targeting elements (PASTE).

154. 154. The method of any one of claims 151 to 153, wherein the modification made by the genome editing complex is made using a guide RNA (gRNA) having a targeting domain complementary to at least one target site.

155. The method of any one of claims 137 to 138, wherein the genome editing complex is an RNA-guided nuclease.

156. 156. The method of Claim 155, wherein the RNA-guided nuclease comprises a Cas nuclease and a guide RNA (CRISPR-Cas combination).

157. 157. The method of Claim 156, wherein the CRISPR-Cas combination is a ribonucleoprotein (RNP) complex comprising the gRNA and the Cas nuclease.

158. The method of claim 156 or claim 157, wherein the Cas nuclease is a type II or type V Cas protein.

159. The genome modification protein is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, and C 159. The method of any one of claims 156 to 158, wherein the nucleotide sequence is selected from the group consisting of as13d, C2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and CRISPR-associated transposases, or homologs of any of the foregoing.

160. 160. The method of any one of claims 1-159, wherein the modification that increases expression of the one or more tolerogenic factors in the modified SC-β cells comprises an exogenous polynucleotide encoding the one or more tolerogenic factors.

161. 161. The method of claim 160, wherein the exogenous polynucleotide encoding the one or more tolerogenic factors is integrated into the genome of the modified SC-β cell.

162. 162. The method of claim 161, wherein the exogenous polynucleotide is integrated into a non-target locus in the genome of the modified SC-β cell.

163. 162. The method of claim 161, wherein the exogenous polynucleotide is integrated into a targeted genomic locus in the modified SC-β cell.

164. 164. The method of any one of claims 1-163, wherein the modified SC-β cells further comprise a modification for expression of an exogenous safety switch.

165. The safety switch a system in which, upon activation, the cells downregulate the expression of said one or more tolerogenic factors and / or upregulate the expression of one or more immune signaling molecules, thereby marking said cells for elimination by the host immune system. The method of claim 164, wherein

166. 166. The method of claim 165, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

167. 167. The method of claim 165 or claim 166, wherein the one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

168. 165. The method of claim 164, wherein the safety switch is a suicide gene.

169. 169. The method of claim 168, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

170. 170. The method of any one of claims 164-169, wherein the safety switch and the one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

171. 171. The method of claim 170, wherein the bicistronic cassette is integrated into a non-target locus in the genome of the modified SC-β cell.

172. 171. The method of claim 170, wherein the bicistronic cassette is integrated into a target genomic locus of the cell.

173. The method of claim 163 or claim 172, wherein the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus.

174. 174. The method of claim 173, wherein the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

175. 175. The method of any one of claims 1-174, wherein the modified SC-beta cells comprise a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35, relative to the control or wild-type beta cells.

176. 176. The method of claim 175, wherein the modification to increase expression of the one or more complement inhibitors in the modified SC-β cells comprises at least one exogenous polynucleotide encoding one or more complement inhibitors selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35.

177. The method of claim 175 or claim 176, wherein the one or more complement inhibitors are CD46 and CD59.

178. 177. The method of any one of claims 175 or 176, wherein the one or more complement inhibitors are CD46, CD59 and CD55.

179. 179. The method of any one of claims 5 to 178, wherein said reduced expression comprises reduced cell surface expression.

180. 180. The method of any one of claims 1 to 179, wherein said increased expression comprises increased cell surface expression.

181. 180. The method of any one of claims 1-3 and 5-180, wherein the level of reduction in expression of (a) and increase in expression of (b) by the modified SC-β cells is maintained or similar compared to the modified PSCs.

182. the modified SC-β cells express the one or more tolerogenic factors at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type β cells; Optionally, the control or wild type beta cells are: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of Modifications that increase the expression of one or more tolerogenic factors are differentiated from PSCs that do not contain 182. The method of any one of claims 1 to 181.

183. 183. The method of any one of claims 1-182, wherein the modified SC-beta cells express each of the one or more tolerogenic factors at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type beta cells.

184. 184. The method of claim 183, wherein each of the one or more tolerogenic factors is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by the control or wild-type beta cells.

185. 185. The method of any one of claims 1-184, wherein each of the one or more tolerogenic factors is expressed by the modified SC-β cells at greater than or about 20,000 molecules per cell.

186. 186. The method of claim 185, wherein each of the one or more tolerogenic factors is expressed by the modified SC-beta cells at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

187. the one or more tolerogenic factors include CD47; the modified SC-β cells express CD47 at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type β cells; Optionally, the control or wild type beta cells are: (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of Modifications that increase the expression of one or more tolerogenic factors differentiated from control or wild-type PSCs that do not contain 187. The method of any one of claims 1 to 186.

188. the one or more tolerogenic factors include CD47; the modified SC-β cells express CD47 at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type β cells; 188. The method of any one of claims 1 to 187.

189. 189. The method of claim 188, wherein CD47 is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by said control or wild-type beta cells.

190. the one or more tolerogenic factors include CD47; CD47 is expressed by the modified SC-β cells at greater than or greater than about 20,000 molecules per cell.

190. The method of any one of claims 1 to 189.

191. 191. The method of claim 190, wherein CD47 is expressed by the modified SC-beta cells at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

192. the modified SC-β cells express at least one β cell marker; Optionally, the at least one beta cell marker is selected from the group consisting of INS, CHGA, NKX2-2, PDX1, NKX6-1, MAFB, GCK, and GLUT1.

192. The method of any one of claims 1 to 191.

193. the modified SC-β cells exhibit one or more functions of wild-type or control β cells; Optionally, the one or more functions are selected from the group consisting of glucose-stimulated insulin secretion (GSIS) in vitro, glucose metabolism, maintenance of fasting blood glucose levels, insulin secretion in response to glucose injection in vivo, and glucose clearing after glucose injection in vivo.

193. The method of any one of claims 1 to 192.

194. the modified SC-β cells are capable of glucose-stimulated insulin secretion (GSIS); Optionally, the insulin secretion is in a perfusion GSIS assay.

194. The method of any one of claims 1 to 193.

195. 195. The method of claim 194, wherein the GSIS is a dynamic GSIS comprising first and second phase dynamic insulin secretion.

196. the GSIS is a static GSIS; Optionally, the static incubation index is greater than or greater than about 1, greater than or greater than about 2, greater than or greater than about 5, greater than or greater than about 10, or greater than or greater than about 20; The method of claim 194.

197. 200. The method of any one of claims 1 to 196, wherein the level of insulin secretion by the modified SC-β cells is at least 20% of the level observed in primary pancreatic β islets, optionally cadaveric pancreatic islets.

198. 200. The method of claim 197, wherein the level of insulin secretion by the modified SC-β cells is at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% of the level observed in primary pancreatic β islets, optionally cadaveric pancreatic islets.

199. 200. The method of any one of claims 1-198, wherein the modified SC-beta cells have a total insulin content of greater than or about 500 μIU insulin per 5000 cells, greater than or about 1000 μIU insulin per 5000 cells, greater than or about 2000 μIU insulin per 5000 cells, greater than or about 3000 μIU insulin per 5000 cells, or greater than or about 4000 μIU insulin per 5000 cells.

200. 200. The method of any one of claims 1-199, wherein the modified SC-β cells have a proinsulin to insulin ratio of at or about 0.02 to at or about 0.1, optionally 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 or about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09 and any value between any of the foregoing.

201. The method of any one of claims 1 to 200, wherein the modified SC-β cells are functional for one or more days after transplantation into the subject.

202. The method of any one of claims 1 to 201, wherein the modified SC-β cells exhibit functionality for more than one week after transplantation into the subject.

203. The method of claim 201 or claim 202, wherein the functionality is selected from the group consisting of maintaining fasting blood glucose levels, secreting insulin in response to glucose injection in vivo, and clearing glucose after glucose injection in vivo.

204. A composition comprising a population of modified SC-β cells produced by the method of any one of claims 1-203.

205. Modified stem cell-derived beta cells (SC-beta cells) comprising one or more of the following modifications: (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and / or (b) a modification that increases the expression of one or more tolerogenic factors; Including, the increased expression is compared to control or wild-type beta cells that do not contain the modification; The modified SC-β cells.

206. 206. The modified SC-β cell of claim 205, which exhibits glucose-stimulated insulin secretion (GSIS).

207. Modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of (b) a modification that increases the expression of one or more tolerogenic factors relative to control or wild-type beta cells; and exhibit glucose-stimulated insulin secretion (GSIS), The modified SC-β cells.

208. 208. The modified SC-beta cell of any one of claims 205-207, wherein the tolerogenic factor is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by the control or wild-type beta cell.

209. Modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), (1) does not express one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules; (2) overexpressing a tolerogenic factor at a level greater than or greater than about 5-fold compared to expression of said tolerogenic factor by control or wild-type beta cells; exhibit glucose-stimulated insulin secretion (GSIS), The modified SC-β cells.

210. 210. The modified SC-beta cell of claim 209, wherein expression of the tolerogenic factor is determined by flow cytometry using an antibody to the tolerogenic factor, and background is determined by flow cytometry staining with an isotype control of the antibody.

211. 211. The modified SC-beta cell of claim 209 or claim 210, wherein the tolerogenic factor is expressed at a level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold compared to expression of the tolerogenic factor by a control or wild-type beta cell.

212. 1. A modified stem cell-derived beta cell (SC-β cell) differentiated in vitro from a pluripotent stem cell (PSC), the modified SC-β cell comprising: (1) does not express one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules; (2) overexpressing the tolerogenic factor at a first level that is greater than or about 5-fold greater than a second level expressed by a control or wild-type cell; the control or wild-type cells are control or wild-type PSCs that do not contain a modification to reduce one or more MHC class I molecules and / or one or more MHC class II molecules and a modification to overexpress the tolerogenic factor, or control or wild-type SC-β cells differentiated from such control or wild-type PSCs; The modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS). The modified SC-β cells.

213. 213. The modified SC-beta cell of any one of claims 205-212, wherein the tolerogenic factor is expressed by the modified SC-beta cell at greater than or about 20,000 molecules per cell.

214. Modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), (1) does not express one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules; (2) overexpressing a tolerogenic factor, wherein the tolerogenic factor is expressed at greater than or about greater than 20,000 molecules per cell; exhibit glucose-stimulated insulin secretion (GSIS), The modified SC-β cells.

215. 215. The modified SC-beta cell of any one of claims 205-214, wherein the tolerogenic factor is expressed by the modified SC-beta cell at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

216. The PSC is (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of (b) Modifications that increase the expression of tolerogenic factors relative to control or wild-type PSCs. one or more modifications selected from the group consisting of A modified PSC comprising: The modified SC-β cell of any one of claims 205 to 215.

217. 217. The modified SC-β cell of claim 216, wherein the control or wild-type PSC is a PSC that does not contain the one or more modifications.

218. 218. The modified SC-β cell of any one of claims 205-207 and 214-217, wherein the modified SC-β cell expresses the tolerogenic factor at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type PSC or a control or wild-type SC-β cell differentiated from the control or wild-type PSC.

219. 219. The modified SC-β cell of claim 218, wherein the tolerogenic factor is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by the control or wild-type PSC or control or wild-type SC-β differentiated from the control or wild-type PSC.

220. 1. A modified stem cell-derived beta cell (SC-β cell) differentiated in vitro from a modified pluripotent stem cell (PSC), the modified PSC comprising: (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of (b) Modifications that increase the expression of tolerogenic factors relative to control or wild-type PSCs. one or more modifications selected from the group consisting of Including, The modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS). The modified SC-β cells.

221. The modified SC-β cell of claim 220, wherein the control or wild-type PSC is a PSC that does not contain the modification.

222. the modified PSCs express the tolerogenic factor at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type PSCs that do not contain the one or more modifications; Optionally, the tolerogenic factor is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by said control or wild-type PSCs that do not contain said one or more modifications. The modified SC-β cell of any one of claims 216 to 221.

223. below: (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules and a modification that inactivates or destroys one or more alleles of (b) a modification that increases the expression of a tolerogenic factor relative to control or wild-type beta cells; The modified SC-β cell of any one of claims 216 to 222, comprising:

224. The modified SC-β cell of claim 223, wherein the tolerogenic factor is expressed at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type PSC or a control or wild-type SC-β cell differentiated from the control or wild-type PSC.

225. 225. The modified SC-beta cell of claim 224, wherein the tolerogenic factor is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by the control or wild-type PSC or a control or wild-type SC-beta cell differentiated from the control or wild-type PSC.

226. The modified SC-β of any one of claims 216 to 225, wherein the tolerogenic factor is expressed by the modified PSC at greater than or about 20,000 molecules per cell.

227. A modified stem cell-derived beta cell (SC-β cell) differentiated in vitro from a modified pluripotent stem cell (PSC), the modified PSC comprising: (a) does not express one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules; (b) expressing the tolerogenic factor at greater than or about greater than 20,000 molecules per cell; including such modifications, The modified SC-β cells exhibit glucose-stimulated insulin secretion (GSIS). The modified SC-β cells.

228. Modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), wherein the modified SC-β cells (a) does not express one or more major histocompatibility complex (MHC) class I molecules and / or one or more MHC class II molecules; (b) expressing the tolerogenic factor at greater than or about greater than 20,000 molecules per cell; Such modifications Including, exhibit glucose-stimulated insulin secretion (GSIS), The modified SC-β cells.

229. 228. The modified SC-beta cell of any one of claims 226-227, wherein the tolerogenic factor is expressed by the modified PSC at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

230. 230. The modified SC-beta cell of any one of claims 226-229, wherein the tolerogenic factor is expressed by the modified SC-beta cell at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

231. 231. The modified SC-beta cell of any one of claims 216-230, which does not express MHC class I or MHC class II molecules and expresses the tolerogenic factor at greater than or about 20,000 molecules per cell.

232. 232. The modified SC-beta cell of claim 231, wherein the tolerogenic factor is expressed by the modified SC-beta cell at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

233. The tolerogenic factor is selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, and CD16.

233. The modified SC-beta cell of any one of claims 205-232, wherein the SC-beta cell is selected from the group consisting of an Fc receptor, IL15-RF, H2-M3 (HLA-G), A20 / TNFAIP3, CR1, HLA-F, MANF, and any combination thereof.

234. The modified SC-β cell of any one of claims 205 to 233, wherein the tolerogenic factor comprises CD47.

235. The modified SC-β cell of any one of claims 205 to 233, wherein the tolerogenic factor comprises PD-L1.

236. The modified SC-β cell of any one of claims 205 to 233, wherein the tolerogenic factor comprises HLA-E.

237. The modified SC-β cell of any one of claims 205 to 233, wherein the tolerogenic factor comprises HLA-G.

238. The modified SC-β cell of any one of claims 216 to 237, wherein the modification in (a) reduces the expression of one or more MHC class I molecules and / or one or more MHC class II molecules.

239. The modified SC-β cell of any one of claims 216 to 237, wherein expression of one or more MHC class I molecules and one or more MHC class II molecules is reduced in the modified PSC.

240. The modified SC-β cell of any one of claims 216 to 237, wherein the modification in (a) reduces the protein expression of one or more MHC class I molecules.

241. the modification in (a) reduces the function of the one or more MHC class I molecules; Optionally, the function is antigen presentation. The modified SC-β cell of any one of claims 216 to 240.

242. The modified SC-β cell of any one of claims 216 to 241, wherein the one or more MHC class I molecules are one or more human leukocyte antigen (HLA) class I molecules.

243. The modified SC-β cell of any one of claims 216 to 242, wherein the one or more MHC HLA class I molecules are selected from the group consisting of HLA-A, HLA-B, and HLA-C.

244. The modified SC-β cell of any one of claims 216 to 243, wherein the one or more molecules that control the expression of the one or more MHC class I molecules are selected from the group consisting of B2M, NLRC5, and TAP1.

245. The method of any one of claims 216 to 244, wherein the one or more molecules that control the expression of the one or more MHC class I molecules control the cell surface protein expression of the one or more MHC class I molecules.

246. 246. The method of claim 245, wherein the one or more molecules that control cell surface protein expression of the one or more MHC class I molecules are B2M.

247. the one or more modifications include a modification that controls expression of the one or more MHC class I molecules; the modification inactivates or disrupts one or more alleles of B2M; 247. The method of any one of claims 216 to 246.

248. The method of any one of claims 216 to 247, wherein the one or more modifications in (a) reduce cell surface protein expression of the one or more MHC class I molecules.

249. The method of any one of claims 216 to 248, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class I molecules.

250. 250. The method of any one of claims 216-249, wherein cell surface transport of the one or more MHC class I molecules and the one or more MHC class II molecules is reduced in the modified SC-β cells compared to the control or wild-type SC-β cells.

251. The modified SC-β cell of any one of claims 216 to 250, wherein the one or more molecules that control the expression of the one or more MHC class I molecules control cell surface protein expression of the one or more MHC class I molecules.

252. 252. The modified SC-beta cell of any one of claims 244-251, wherein said modification that inactivates or disrupts one or more alleles of B2M reduces mRNA expression of the B2M gene.

253. 253. The modified SC-beta cell of any one of claims 244-252, wherein said modification that inactivates or disrupts one or more alleles of B2M reduces protein expression of B2M.

254. The modification that inactivates or disrupts one or more alleles of B2M is inactivation or disruption of one allele of the B2M gene; Inactivation or disruption of both alleles of the B2M gene; or Inactivation or disruption of all B2M coding alleles in the cell The modified SC-β cell of any one of claims 244 to 253, comprising:

255. The modified SC-β cell of any one of claims 244-254, wherein said inactivation or disruption comprises an indel in said B2M gene.

256. The modified SC-β cell of any one of claims 244 to 255, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said B2M gene.

257. The modified SC-β cell of any one of claims 205-256, wherein the modification in (a) reduces protein expression of the one or more MHC class II molecules.

258. The modified SC-β cell of any one of claims 205-257, wherein the modification in (a) reduces cell surface expression of the one or more MHC class II molecules.

259. The method of any one of claims 205-258, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class II molecules.

260. the modification in (a) reduces the function of the one or more MHC class II molecules; Optionally, the function is antigen presentation. The modified SC-β cell of any one of claims 205 to 259.

261. The modified SC-β cell of any one of claims 205 to 260, wherein the one or more MHC class II molecules are one or more human leukocyte antigen (HLA) class II molecules.

262. 262. The modified SC-β cell of any one of claims 205-261, wherein the one or more MHC HLA class II molecules are selected from the group consisting of HLA-DP, HLA-DQ, and / or HLA-DR.

263. The modified SC-β cell of any one of claims 205 to 262, wherein the one or more molecules that control the expression of the one or more MHC class II molecules are selected from the group consisting of CIITA and CD74.

264. the one or more modifications include modifications that regulate expression of the one or more MHC class II molecules; the modification inactivates or disrupts one or more alleles of CIITA; The modified SC-β cell of any one of claims 205 to 263.

265. 265. The modified SC-beta cell of any one of claims 263-264, wherein the modification that inactivates or disrupts one or more alleles of CIITA reduces mRNA expression of the CIITA gene, and / or the modification that inactivates or disrupts one or more alleles of one or more molecules that control the expression of the one or more MHC class II molecules reduces protein expression of CIITA.

266. The modification that inactivates or disrupts one or more alleles of CIITA is inactivation or disruption of one allele of the CIITA gene; Inactivation or disruption of both alleles of the CIITA gene; or Inactivation or disruption of all CIITA-coding alleles in the cell The modified SC-β cell of any one of claims 263 to 265, comprising:

267. The modified SC-β cell of any one of claims 263 to 266, wherein said inactivation or disruption comprises an indel in said CIITA gene.

268. The modified SC-β cell of any one of claims 263 to 267, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CIITA gene.

269. The modified SC-β cell of any one of claims 216 to 268, wherein expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified PSC.

270. 270. The modified SC-beta cell of any one of claims 216-269, wherein the modified PSC comprises a modification that inactivates or disrupts one or more alleles of CD142.

271. The modified SC-β cell of any one of claims 205 to 270, wherein expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified SC-β cell.

272. 272. The modified SC-beta cell of any one of claims 205-271, comprising a modification that inactivates or disrupts one or more alleles of CD142.

273. The modified SC-β cell of any one of claims 270 to 272, wherein the modification reduces mRNA expression of the CD142 gene.

274. The modified SC-β cell of any one of claims 270 to 273, wherein the modification reduces the protein expression of CD142.

275. the modification that inactivates or disrupts one or more alleles of CD142 is inactivation or disruption of one allele of the CD142 gene; Inactivation or disruption of both alleles of the CD142 gene; or Inactivation or destruction of all CD142 coding alleles in said cells The modified SC-β cell of any one of claims 270 to 274, comprising:

276. The modified SC-β cell of any one of claims 270 to 275, wherein said inactivation or said disruption comprises an indel in said CD142 gene.

277. The modified SC-β cell of any one of claims 270 to 276, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CD142 gene.

278. The modified SC-β cell of any one of claims 205 to 277, wherein the modification to increase expression of the tolerogenic factor comprises an exogenous polynucleotide encoding the tolerogenic factor.

279. The modified SC-β cell of claim 278, wherein the exogenous polynucleotide encoding the tolerogenic factor is integrated into the genome of the modified PSC.

280. 280. The modified SC-β cell of claim 279, wherein the exogenous polynucleotide encoding the tolerogenic factor is integrated by non-targeted insertion into the genome of the modified PSC.

281. 280. The modified SC-β cell of claim 279, wherein the exogenous polynucleotide encoding the tolerogenic factor is integrated by targeted insertion into a targeted genomic locus of the modified PSC.

282. 279. The modified SC-β cell of claim 278, wherein the exogenous polynucleotide encoding the tolerogenic factor is integrated into the genome of the modified SC-β cell.

283. 283. The modified SC-β cell of claim 282, wherein the exogenous polynucleotide encoding the tolerogenic factor is integrated by non-targeted insertion into the genome of the modified SC-β cell.

284. 283. The modified SC-beta cell of claim 282, wherein the exogenous polynucleotide encoding the tolerogenic factor is integrated by targeted insertion into a targeted genomic locus of the modified SC-beta cell.

285. Modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), A knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding an exogenous CD47 protein. The modified SC-β cells.

286. 286. The modified SC-beta cell of claim 285, wherein the PSC comprises one or more modifications selected from the group consisting of a knockout of the B2M gene, a knockout of the CIITA gene, and an exogenous polynucleotide encoding an exogenous CD47 protein.

287. The modified SC-β cell of claim 285, wherein the PSC does not comprise a knockout of the B2M gene, a knockout of the CIITA gene, or an exogenous polynucleotide encoding an exogenous CD47 protein.

288. B2M インデル／インデル ;CIITA インデル／インデル 300. The modified SC-β cell of any one of claims 285 to 287, having a CD47tg phenotype.

289. Modified stem cell-derived beta cells (SC-β cells) differentiated in vitro from pluripotent stem cells (PSCs), A knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding a CD47 protein, and an exogenous polynucleotide encoding a safety switch. The modified SC-β cells.

290. 290. The modified SC-beta cell of claim 289, wherein the PSC comprises one or more modifications selected from the group consisting of a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding an exogenous CD47 protein, and an exogenous polynucleotide encoding a safety switch.

291. 290. The modified SC-beta cell of claim 289, wherein the PSC does not comprise a knockout of the B2M gene, a knockout of the CIITA gene, an exogenous polynucleotide encoding an exogenous CD47 protein, or an exogenous polynucleotide encoding a safety switch.

292. B2M インデル／インデル ;CIITA インデル／インデル ;CD47tg; safety switch transgene phenotype.

293. The modified SC-β cell of any one of claims 290 to 292, wherein the exogenous polynucleotide encoding CD47 is integrated by non-targeted insertion into the genome of the modified PSC.

294. 293. The modified SC-beta cell of any one of claims 285-292, wherein the exogenous polynucleotide encoding CD47 is integrated by non-targeted insertion into the genome of the modified SC-beta cell.

295. 295. The modified SC-beta cell of any one of claims 285-294, wherein the exogenous polynucleotide encoding CD47 is integrated by targeted insertion into a targeted genomic locus of the cell.

296. 296. The modified SC-β cell of any one of claims 216-284, 294 and 295, wherein the modified PSC comprises an exogenous polynucleotide encoding a safety switch.

297. 300. The modified SC-β cell of claim 296, wherein the safety switch and the tolerogenic factor are expressed from a bicistronic cassette integrated into the genome of the modified PSC.

298. The modified SC-β cell of claim 296 or claim 297, wherein the safety switch and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified PSC.

299. The modified SC-β cell of claim 297 or claim 298, wherein the bicistronic cassette is integrated by non-targeted insertion into the genome of the modified PSC.

300. The modified SC-β cell of claim 297 or claim 298, wherein the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the modified PSC.

301. 296. The modified SC-β cell of any one of claims 205-284, 294 and 295, comprising an exogenous polynucleotide encoding a safety switch.

302. The safety switch a system in which, upon activation, the cells downregulate the expression of said one or more tolerogenic factors and / or upregulate the expression of one or more immune signaling molecules, thereby marking said cells for elimination by the host immune system. The modified SC-β cell of any one of claims 289 to 301,

303. 303. The modified SC-beta cell of claim 302, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

304. 304. The modified SC-beta cell of claim 302 or claim 303, wherein the one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

305. The modified SC-β cell of any one of claims 289 to 301, wherein the safety switch is a suicide gene.

306. The modified SC-β cell of claim 305, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

307. The modified SC-β cell of any one of claims 301 to 306, wherein the safety switch and the tolerogenic factor are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

308. The modified SC-β cell of any one of claims 301 to 307, wherein the safety switch and CD47 are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

309. The modified SC-β cell of claim 307 or claim 308, wherein said bicistronic cassette is integrated by non-targeted insertion into the genome of said modified SC-β cell.

310. The modified SC-β cell of claim 307 or claim 308, wherein said bicistronic cassette is integrated by targeted insertion into a targeted genomic locus of said modified SC-β cell.

311. The modified SC-β cell of claim 281, claim 284, claim 295, claim 300, or claim 310, wherein the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus.

312. 312. The modified SC-beta cell of claim 311, wherein the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

313. 313. The modified SC-β cell of any one of claims 216-312, wherein the modified PSC comprises a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35, relative to the control or wild-type PSC.

314. 314. The modified SC-beta cell of any one of claims 205-313, comprising a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35, relative to the control or wild-type SC-beta cell.

315. 315. The modified SC-beta cell of claim 313 or claim 314, wherein the modification to increase expression of one or more complement inhibitors comprises at least one exogenous polynucleotide encoding one or more complement inhibitors selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35.

316. The modified SC-β cell of any one of claims 313 to 315, wherein the one or more complement inhibitors are CD46 and CD59.

317. The modified SC-β cell of any one of claims 313 to 315, wherein the one or more complement inhibitors are CD46, CD59, and CD55.

318. The modified SC-β cell of any one of claims 315 to 317, wherein the at least one exogenous polynucleotide encoding the one or more complement inhibitors is integrated by non-targeted insertion into the genome of the modified PSC.

319. The modified SC-β cell of any one of claims 315 to 317, wherein the at least one exogenous polynucleotide encoding the one or more complement inhibitors is integrated by non-targeted insertion into the genome of the modified SC-β cell.

320. 320. The modified SC-β cell of any one of claims 315-319, wherein the at least one exogenous polynucleotide encoding the one or more complement inhibitors is integrated by targeted insertion into a targeted genomic locus of the cell.

321. The modified SC-β cell of claim 320, wherein the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus.

322. 322. The modified SC-beta cell of claim 321, wherein the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

323. The modified SC-β cell of any one of claims 205 to 322, wherein the modification in (a) reduces the expression of one or more MHC class I molecules and / or one or more MHC class II molecules.

324. The modified SC-β cell of any one of claims 205 to 323, wherein expression of the one or more MHC class I molecules and the one or more MHC class II molecules is reduced in the modified SC-β cell.

325. The modified SC-β cell of any one of claims 205 to 324, wherein the modification in (a) reduces cell surface protein expression of the one or more MHC class I molecules in the modified SC-β cell.

326. The method of any one of claims 205 to 324, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class I molecules.

327. the modification in (a) reduces the function of the one or more MHC class I molecules in the modified SC-β cells; Optionally, the function is antigen presentation. The modified SC-β cell of any one of claims 205 to 326.

328. the one or more modifications include a modification that controls expression of the one or more MHC class I molecules; the modification inactivates or disrupts one or more alleles of B2M in the modified SC-β cells; The modified SC-β cell of any one of claims 205 to 327.

329. 329. The modified SC-beta cell of claim 328, wherein the modification that inactivates or disrupts one or more alleles of B2M in the modified SC-beta cell reduces mRNA expression of the B2M gene.

330. 330. The modified SC-beta cell of claim 328 or claim 329, wherein the modification that inactivates or disrupts one or more alleles of B2M in the modified SC-beta cell reduces protein expression of B2M.

331. the modification that inactivates or disrupts one or more alleles of B2M in the modified SC-β cells, inactivation or disruption of one allele of the B2M gene; Inactivation or disruption of both alleles of the B2M gene; or Inactivation or disruption of all B2M coding alleles in the cell The modified SC-β cell of any one of claims 328 to 330, comprising:

332. The modified SC-β cell of any one of claims 328-331, wherein said inactivation or disruption comprises an indel in said B2M gene.

333. The modified SC-β cell of any one of claims 328 to 332, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said B2M gene.

334. The modified SC-β cell of any one of claims 205-333, wherein the one or more modifications in (a) reduce cell surface expression of the one or more MHC class II molecules.

335. The method of any one of claims 205-334, wherein the one or more modifications in (a) reduce cell surface transport of the one or more MHC class II molecules.

336. the one or more modifications in (a) reduce the function of the one or more MHC class II molecules; Optionally, the function is antigen presentation. The modified SC-β cell of any one of claims 205 to 335.

337. the one or more modifications include modifications that regulate expression of the one or more MHC class II molecules; the modification inactivates or disrupts one or more alleles of CIITA; The modified SC-β cell of any one of claims 205 to 336.

338. The modified SC-beta cell of claim 337, wherein the modification that inactivates or disrupts one or more alleles of CIITA in the modified SC-beta cell reduces mRNA expression of the CIITA gene, or the modification that inactivates or disrupts one or more alleles of one or more molecules that control the expression of the one or more MHC class II molecules in the modified SC-beta cell reduces protein expression of CIITA.

339. the modification inactivating or disrupting one or more alleles of one or more MHC class II molecules or one or more molecules controlling the expression of said one or more MHC class II molecules, inactivation or disruption of one allele of the CIITA gene; Inactivation or disruption of both alleles of the CIITA gene; or Inactivation or disruption of all CIITA-coding alleles in the cell The modified SC-β cell of any one of claims 337 to 338, comprising:

340. The modified SC-β cell of any one of claims 337 to 339, wherein said inactivation or disruption comprises an indel in said CIITA gene.

341. The modified SC-β cell of any one of claims 337 to 340, wherein said inactivation or said disruption is a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CIITA gene.

342. The modified SC-β cell of any one of claims 205 to 341, wherein expression of HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLA-DR is reduced in the modified SC-β cell.

343. The modified SC-β cell of any one of claims 205-342, comprising a modification that inactivates or disrupts an allele of CD142.

344. The modified SC-beta cell of claim 343, wherein said modification reduces mRNA expression of the CD142 gene compared to control or wild-type beta cells.

345. The modified SC-beta cell of claim 343 or claim 344, wherein said modification reduces protein expression of CD142 compared to control or wild-type beta cells.

346. the modification that inactivates or disrupts one or more alleles of CD142 in the modified SC-β cells, inactivation or disruption of one allele of the CD142 gene; Inactivation or disruption of both alleles of the CD142 gene; or Inactivation or destruction of all CD142 coding alleles in said cells The modified SC-β cell of any one of claims 343 to 345, comprising:

347. The modified SC-β cell of any one of claims 343 to 346, wherein said inactivation or said disruption comprises an indel in said CD142 gene.

348. The modified SC-β cell of any one of claims 343 to 347, wherein said inactivation or said disruption comprises a frameshift mutation or deletion of a continuous stretch of genomic DNA of said CD142 gene.

349. The modified SC-β cell of any one of claims 205 to 348, wherein the modification to increase expression of the tolerogenic factor in the modified SC-β cell comprises an exogenous polynucleotide encoding the tolerogenic factor.

350. The modified SC-β cell of claim 349, wherein the exogenous polynucleotide encoding the tolerogenic factor is integrated into the genome of the modified SC-β cell.

351. The modified SC-β cell of claim 350, wherein the exogenous polynucleotide is integrated into a non-target locus in the genome of the modified SC-β cell.

352. The modified SC-β cell of claim 350, wherein the exogenous polynucleotide is integrated into a targeted genomic locus in the modified SC-β cell.

353. 353. The modified SC-beta cell of any one of claims 205-352, further comprising a modification for expression of an exogenous suicide gene selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase (iCaspase9), and rapamycin-activated caspase 9 (rapaCasp9).

354. The modified SC-β cell of claim 353, wherein the suicide gene and the tolerogenic factor are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

355. The modified SC-β cell of claim 354, wherein said bicistronic cassette is integrated into a non-target locus in the genome of said modified SC-β cell.

356. The modified SC-β cell of claim 354, wherein the bicistronic cassette is integrated into a targeted genomic locus in the cell.

357. The modified SC-β cell of claim 352 or claim 356, wherein the target genomic locus is a safe harbor locus, a B2M locus, a CIITA locus, or a CD142 locus.

358. 358. The modified SC-beta cell of claim 357, wherein the safe harbor locus is selected from the group consisting of the CCR5 locus, the CXCR4 locus, the PPP1R12C (also known as AAVS1) gene, the albumin locus, the SHS231 locus, the CLYBL locus, and the ROSA26 locus.

359. 359. The modified SC-beta cell of any one of claims 205-358, comprising a modification that increases the expression of one or more complement inhibitors selected from the group consisting of CD46, CD59, CD55, and CD35 relative to a control or wild-type beta cell.

360. 360. The modified SC-beta cell of claim 359, wherein the modification to increase expression of the one or more complement inhibitors in the modified SC-beta cell comprises at least one exogenous polynucleotide encoding one or more complement inhibitors selected from the group consisting of an exogenous polynucleotide encoding CD46, an exogenous polynucleotide encoding CD59, an exogenous polynucleotide encoding CD55, and an exogenous polynucleotide encoding CD35.

361. The modified SC-β cell of claim 359 or claim 360, wherein the one or more complement inhibitors are CD46 and CD59.

362. The modified SC-β cell of claim 359 or claim 360, wherein the one or more complement inhibitors are CD46, CD59, and CD55.

363. the tolerogenic factor is CD47; the modified SC-β cells express CD47 at a first level that is greater than or about 5-fold greater than a second level expressed by the control or wild-type β cells; The modified SC-β cell of any one of claims 205 to 362.

364. 364. The modified SC-beta cell of claim 363, wherein CD47 is expressed at a first level that is greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by said control or wild-type beta cell.

365. the tolerogenic factor is CD47; CD47 is expressed by the modified SC-β cells at greater than or greater than about 20,000 molecules per cell. The modified SC-β cell of any one of claims 205 to 364.

366. 366. The modified SC-beta cell of claim 365, wherein CD47 is expressed by the modified SC-beta cell at greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

367. the control or wild-type beta cells (a) (i) one or more major histocompatibility complex (MHC) class I molecules or one or more molecules that regulate the expression of said one or more MHC class I molecules; and / or (ii) one or more MHC class II molecules or one or more molecules that regulate the expression of said one or more MHC class II molecules (i) a modification that inactivates or destroys one or more alleles of (b) a modification that increases the expression of the tolerogenic factor; SC-β cells differentiated from control or wild-type PSCs not containing The modified SC-β cell of any one of claims 205 to 366.

368. the modified SC-β cells express at least one β cell marker; Optionally, the beta cell marker is selected from the group consisting of INS, CHGA, NKX2-2, PDX1, NKX6-1, MAFB, GCK, and GLUT1. The modified SC-β cell of any one of claims 205 to 367.

369. the modified SC-β cells exhibit one or more functions of wild-type or control β cells; Optionally, the one or more functions are selected from the group consisting of glucose-stimulated insulin secretion (GSIS) in vitro, glucose metabolism, maintenance of fasting blood glucose levels, insulin secretion in response to glucose injection in vivo, and glucose clearing after glucose injection in vivo. The modified SC-β cell of any one of claims 205 to 368.

370. The modified SC-β cell of any one of claims 205 to 369, wherein the GSIS is measured in a perfusion GSIS assay.

371. The modified SC-β cell of any one of claims 205 to 370, wherein the GSIS is a dynamic GSIS comprising first and second phase dynamic insulin secretion.

372. the GSIS is a static GSIS; optionally, a static irritation index of greater than or about 1, greater than or about 1.5, greater than or about 2, greater than or about 5, greater than or about 10, greater than or about 15, or greater than or about 20; The modified SC-β cell of any one of claims 205 to 371.

373. The modified SC-β cell of any one of claims 205 to 372, wherein the level of insulin secretion by the modified SC-β cell is at least 20% of the level observed in primary pancreatic β islets, optionally cadaveric pancreatic islets.

374. The modified SC-β cell of any one of claims 205 to 373, wherein the level of insulin secretion by the modified SC-β cell is at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70% of the level observed in primary pancreatic β islets, optionally cadaveric pancreatic islets.

375. 375. The modified SC-beta cell of any one of claims 205-374, wherein the modified SC-beta cell has a total insulin content of greater than or about 500 μIU insulin per 5000 cells, greater than or about 1000 μIU insulin per 5000 cells, greater than or about 2000 μIU insulin per 5000 cells, greater than or about 3000 μIU insulin per 5000 cells, or greater than or about 4000 μIU insulin per 5000 cells.

376. 376. The modified SC-beta cell of any one of claims 205-375, wherein the modified SC-beta has a proinsulin to insulin ratio of at or about 0.02, to at or about 0.1, optionally 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 or about 0.03, about 0.04, about 0.05, about 0.06, about 0.07, about 0.08, about 0.09, and any value between any of the foregoing.

377. The modified SC-β cell of any one of claims 205 to 376, which exhibits functionality for one or more days after transplantation into a subject.

378. The modified SC-β cells of any one of claims 205 to 377, which are functional for more than one week after transplantation into a subject.

379. The modified SC-β cell of claim 377 or claim 378, wherein the functionality is selected from the group consisting of maintaining fasting blood glucose levels, secreting insulin in response to glucose injection in vivo, and clearing glucose after glucose injection in vivo.

380. A composition comprising the modified SC-β cells of any one of claims 205-379.

381. A composition comprising a population of modified SC-β cells according to any one of claims 205-380.

382. The composition of claim 204 or claim 381, wherein the level of expression of the MHC class I molecules and / or MHC class II molecules and / or the level of increased expression of the tolerogenic factor among the cells in the population is maintained or is similar in at least 50% or at least about 50%, at least 60% or at least about 60%, at least 70% or at least about 70%, at least 80% or at least about 80%, or at least 90% or at least about 90% of the cells in the population compared to the modified PSCs.

383. The composition of claim 204, claim 381 or claim 382, ​​wherein at least 50% or at least about 50%, at least 60% or at least about 60%, at least 70% or at least about 70%, at least 80% or at least about 80%, or at least 90% or at least about 90% of the cells in the population have reduced expression of one or more MHC class I molecules and / or B2M expression.

384. The composition of any one of claims 204 or 381-383, wherein at least 50% or at least about 50%, at least 60% or at least about 60%, at least 70% or at least about 70%, at least 80% or at least about 80%, or at least 90% or at least about 90% of the cells in the population have reduced expression of one or more MHC class II molecules and / or expression of CIITA.

385. The composition of Claim 204, claims 381-384, wherein at least or at least about 50%, at least 60%, at least 70%, at least 80%, or at least about 80%, or at least 90% of the cells in said population comprise inactivated or disrupted one or more alleles of one or more MHC class I molecules and / or B2M.

386. 386. The composition of any one of claims 204 or 381-385, wherein at least or at least about 50%, at least 60%, at least 70%, at least 80%, or at least about 80%, or at least 90% of the cells in said population comprise inactivated or disrupted one or more alleles of one or more MHC class II molecules and / or CIITA.

387. at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells in the population express the tolerogenic factor at a first level that is greater than or about 5 times, greater than or about 10 times, greater than or about 20 times, greater than or about 30 times, greater than or about 40 times, greater than or about 50 times, greater than or about 60 times, or greater than or about 70 times higher than a second level expressed by the control or wild-type beta cells; Optionally, the control or wild-type beta cells are wild-type primary beta cells. The composition of any one of claims 204 or 381-386.

388. 388. The composition of any one of claims 204 or 381-387, wherein at least or at least about 50%, at least or at least about 60%, at least 70% or at least about 70%, at least 80% or at least about 80%, or at least 90% or at least about 90% of the cells in said population express the tolerogenic factor at a first level that is greater than or about 5-fold, greater than or about 10-fold, greater than or about 20-fold, greater than or about 30-fold, greater than or about 40-fold, greater than or about 50-fold, greater than or about 60-fold, or greater than or about 70-fold greater than a second level expressed by control or wild-type PSCs that do not comprise said modification or by control or wild-type SC-beta cells differentiated from said control or wild-type PSCs.

389. At least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells in the population have greater than or about 20,000 molecules per cell, greater than or about 30,000 molecules per cell, greater than or about 50,000 molecules per cell, greater than or about 10 ...

389. The composition of any one of claims 204 or 381-388, wherein the composition expresses the tolerogenic factor at greater than or about 100,000 molecules per cell, greater than or about 200,000 molecules per cell, greater than or about 300,000 molecules per cell, greater than or about 400,000 molecules per cell, greater than or about 500,000 molecules per cell, or greater than or about 600,000 molecules per cell.

390. The composition of any one of claims 204 or 381-389, wherein at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% of the cells in said population comprise one or more modifications that inactivate or disrupt CD142.

391. 389. The modified SC-β cell of any one of claims 205-380 or the composition of any one of claims 204 and 381-389, wherein said inactivation or said disruption is by one or more gene editing.

392. The modified SC-β cell or composition of claim 391, wherein the cell comprises a genome editing complex.

393. The modified SC-β cell or composition of claim 391, wherein the one or more gene edits are performed by a genome editing complex.

394. The modified SC-β cell or composition of claim 392 or claim 393, wherein the genome editing complex comprises a genome targeting entity and a genome modifying entity.

395. the genome targeting entity localizes the genome editing complex to the one or more alleles that have been inactivated or disrupted; Optionally, the genome targeting entity is a nucleic acid-guided targeting entity. The modified SC-β cell or composition of claim 394.

396. 396. The modified SC-beta cell or composition of Claim 394 or Claim 395, wherein the genome targeting entity is selected from the group consisting of a sequence-specific nuclease, a nucleic acid programmable DNA binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZF) nucleic acid binding entity, a transcription activator-like effector (TALE) nucleic acid binding entity, a meganuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient Cas protein, an enzyme-inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, or a functional portion thereof.

397. The genome targeting entity is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas1 2i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, Cmr1, Cmr2, Cmr3, Cmr4 , Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse2, Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Cs n2, Cst1, Cst2, Cas5t, Csh1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4, Mad7, SpCas9, high-fidelity variants of SpCas9 eSpCas9, SpCas9-HF1, HypaSpCas9, HeFSpCas9, and evoSpCas9, Sa 397. The modified SC-β cell or composition of any one of claims 394-396, wherein the modified SC-β cell or composition is selected from the group consisting of Cas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12bv4, TnpB, dCas(D10A), dCas(H840A), dCas13a, dCas13b, or a functional portion thereof.

398. 398. The modified SC-beta cell or composition of any one of claims 394-397, wherein the genome-modifying entity cleaves, deaminates, nicks, polymerizes, interrogates, integrates, cuts, unwinds, breaks, alters, methylates, demethylates, or otherwise destabilizes the target locus.

399. 400. The modified SC-beta cell or composition of any one of claims 394-398, wherein the genome-modifying entity comprises a recombinase, integrase, transposase, endonuclease, exonuclease, nickase, helicase, DNA polymerase, RNA polymerase, reverse transcriptase, deaminase, flippase, methylase, demethylase, acetylase, nucleic acid-modifying protein, RNA-modifying protein, DNA-modifying protein, Argonaute protein, epigenetic-modifying protein, histone-modifying protein, or a functional portion thereof.

400. The genome-modifying entity may be a sequence-specific nuclease, a nucleic acid programmable DNA-binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a meganuclease, 400. The modified SC-beta cell or composition of any one of Claims 394-399, wherein the modified SC-beta cell or composition is selected from the group consisting of a Cas nuclease, a Cas nuclease, a core Cas protein, a homing endonuclease, an endonuclease-deficient Cas protein, an enzyme-inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, base editing, prime editing, programmable addition with site-specific targeting elements (PASTE), or a functional portion thereof.

401. The genome modification entity is selected from the group consisting of Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, C2c8, C2c9, C mr1, Cmr2, Cmr3, Cmr4, Cmr5, Cmr6, Csd1, Csd2, Cas5d, Cse1, Cse2, Cse3, Cse4, Cas5e, Csf1, Csm1, Csm2, Csm3, Csm4, Csm5, Csn1, Csn2, Cst1, Cst2, Cas5t, Csh1, Csh2, Cas5h, Csa1, Csa2, Csa3, Csa4, Csa5, Cas5a, Csx10, Csx11, Csy1, Csy2, Csy3, Csy4, Mad7, SpCas9, high-fidelity variant of SpCas9, eSpCas9, SpCas9-H F1, HypaSpCas9, HeFSpCas9, and evoSpCas9, SaCas9, NmeCas9, CjCas9, StCas9, TdCas9, LbCas12a, AsCas12a, AacCas12b, BhCas12bv4, TnpB, FokI, dCas(D10A), dCas(H840A), dCas13a, dCas13b, base editors, prime editors (e.g., target prime reverse transcription (TPRT) editors), APOBEC1, cytidine deaminase, adenosine deaminase, uracil glycosylase inhibitors (UGI), adenine base editor (ABE), cytosine base editor (CBE), reverse transcriptase, serine integrase, recombinase, transposase, polymerase, adenine-thymine or "ATBE" (or thymine-adenine or "TABE") transversion base editor, 10-11 translocation methylcytosine dioxygenase (TET), TET1, TET3, TET1CD, histone acetyltransferase p300, histone methyltransferase SMYD3, histone methyltransferase PRDM9,The modified SC-β cell or composition of any one of claims 394 to 400, wherein the modified SC-β cell or composition is selected from the group consisting of H3K79 methyltransferase DOT1L, a transcriptional repressor, or a functional portion thereof.

402. The modified SC-β cell or composition of any one of claims 394-401, wherein the genome targeting entity and the genome modifying entity are different domains of a single polypeptide.

403. The modified SC-β cell or composition of any one of claims 394 to 402, wherein the genome editing entity and the genome modification entity are two different polypeptides that are operably linked.

404. The modified SC-β cell or composition of any one of claims 394 to 402, wherein the genome editing entity and the genome modification entity are two different, unlinked polypeptides.

405. the genome editing complex comprises a guide nucleic acid having a targeting domain complementary to at least one target locus; Optionally, the guide nucleic acid is a guide RNA (gRNA). The modified SC-β cell or composition of any one of claims 394 to 402.

406. The modified SC-β cell or composition of any one of claims 394 to 402, wherein the one or more modifications are made by the genome editing complex.

407. The one or more modifications made by the genome editing complex may be modified by a sequence-specific nuclease, a nucleic acid programmable DNA binding protein, an RNA-guided nuclease, an RNA-guided nuclease comprising a Cas nuclease and a guide RNA (CRISPR-Cas combination), a ribonucleoprotein (RNP) complex comprising a gRNA and a Cas nuclease, a homing endonuclease, a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease, or a transcription factor-like effector nuclease.

407. The modified SC-beta cell or composition of claim 406, wherein the modification is made by a TALEN, a meganuclease, a Cas nuclease, a core Cas protein, a TnpB nuclease, a homing endonuclease, an endonuclease-deficient Cas protein, an enzyme-inactive Cas protein, a CRISPR-associated transposase (CAST), a type II or type V Cas protein, base editing, prime editing, or programmable addition of site-specific targeting elements (PASTE).

408. The one or more modifications made by the genome editing complex are selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, C2c4, 408. The modified SC-beta cell or composition of claim 406 or claim 407, wherein the modification is achieved by C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, CRISPR-associated transposases, base editing, prime editing, or programmable addition of site-specific targeting elements (PASTE).

409. The modified SC-β cell or composition of any one of claims 406 to 408, wherein the modification made by the genome editing complex is made using a guide RNA (gRNA) having a targeting domain complementary to at least one target site.

410. The modified SC-β cell or composition of any one of claims 391 to 393, wherein the genome editing complex is an RNA-guided nuclease.

411. The modified SC-β cell or composition of claim 410, wherein the RNA-guided nuclease comprises a Cas nuclease and a guide RNA (CRISPR-Cas combination).

412. The modified SC-β cell or composition of claim 411, wherein the CRISPR-Cas combination is a ribonucleoprotein (RNP) complex comprising the gRNA and the Cas nuclease.

413. The modified SC-β cell or composition of claim 411 or claim 412, wherein the Cas nuclease is a type II or type V Cas protein.

414. The genome modification protein is selected from the group consisting of Cas3, Cas4, Cas5, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas12, Cas12a (Cpf1), Cas12b (C2c1), Cas12c (C2c3), Cas12d (CasY), Cas12e (CasX), Cas12f (C2c10), Cas12g, Cas12h, Cas12i, Cas12k (C2c5), Cas13, Cas13a (C2c2), Cas13b, Cas13c, Cas13d, and C 2c4, C2c8, C2c9, Cmr5, Cse1, Cse2, Csf1, Csm2, Csn2, Csx10, Csx11, Csy1, Csy2, Csy3, Mad7, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, and CRISPR-associated transposases, or homologs of any of the foregoing.

415. The composition of any one of claims 204 and 381-414, comprising a pharmaceutically acceptable excipient.

416. The composition of any one of claims 204 and 381-415, comprising a cryoprotectant.

417. 1. A method of treating diabetes in a subject, comprising: Administering the modified SC-β cells of any one of claims 205 to 380 or the composition of any one of claims 204 and 381 to 416 to a subject in need thereof. The method comprising:

418. The method of claim 417, wherein the diabetes is type I diabetes.

419. The method of claim 418, wherein the diabetes is type II diabetes.

420. The method of any one of claims 417 to 419, wherein the modified SC-β cells improve glucose tolerance in the subject.

421. 1. A method for improving glucose tolerance in a subject, comprising: Administering the modified SC-β cells of any one of claims 205 to 380 or the composition of any one of claims 204 and 381 to 416 to a subject in need thereof. The method comprising:

422. The method of any one of claims 417 to 421, wherein the subject is a diabetic patient.

423. 423. The method of claim 422, wherein the diabetic patient has type I diabetes or type II diabetes.

424. The method of any one of claims 417 to 423, wherein glucose tolerance is improved compared to the glucose tolerance of the subject prior to administration of the modified SC-β cells.

425. The method of any one of claims 417 to 424, wherein administration of the modified SC-β cells reduces exogenous insulin usage in the subject.

426. 426. The method of any one of claims 417 to 425, wherein glucose tolerance as measured by HbA1c levels is improved.

427. The method of any one of claims 417 to 426, wherein the subject is hungry.

428. The method of any one of claims 417 to 427, wherein administration of the modified SC-β cells improves insulin secretion in the subject.

429. The method of claim 428, wherein insulin secretion is improved compared to insulin secretion in the subject prior to administration of the modified SC-β cells.

430. 430. The method of any one of claims 417 to 429, further comprising administering to the subject one or more immunosuppressive agents.

431. The method of any one of claims 417 to 429, wherein the subject is receiving one or more immunosuppressive agents.

432. The method of claim 430 or 431, wherein the one or more immunosuppressive agents is a small molecule or an antibody.

433. 433. The method of any one of claims 430-432, wherein the one or more immunosuppressive agents are selected from the group consisting of cyclosporine, azathioprine, mycophenolic acid, mycophenolate mofetil, corticosteroids, prednisone, methotrexate, gold salts, sulfasalazine, antimalarials, brequinar, leflunomide, mizoribine, 15-deoxyspergualin, 6-mercaptopurine, cyclophosphamide, rapamycin, tacrolimus (FK-506), OKT3, antithymocyte globulin, thymopentin (thymosin-α), and immunosuppressive antibodies.

434. 434. The method of any one of claims 430-433, wherein the one or more immunosuppressive agents comprises cyclosporine.

435. 434. The method of any one of claims 430-433, wherein the one or more immunosuppressive agents comprises mycophenolate mofetil.

436. 434. The method of any one of claims 430-433, wherein the one or more immunosuppressive agents comprises a corticosteroid.

437. 434. The method of any one of claims 430-433, wherein the one or more immunosuppressive agents comprises cyclophosphamide.

438. 434. The method of any one of claims 430-433, wherein the one or more immunosuppressive agents comprises rapamycin.

439. The method of any one of claims 430 to 433, wherein the one or more immunosuppressants comprises tacrolimus (FK-506).

440. 434. The method of any one of claims 430-433, wherein the one or more immunosuppressive agents comprises antithymocyte globulin.

441. 434. The method of any one of claims 430-433, wherein the one or more immunosuppressive agents comprise one or more immunomodulatory agents.

442. The method of claim 441, wherein the one or more immunomodulatory agents are small molecules or antibodies.

443. 443. The method of claim 432 or claim 442, wherein the antibody binds to one or more of a receptor or ligand selected from the group consisting of antibodies that bind to p75 of the IL-2 receptor, MHC, CD2, CD3, CD4, CD7, CD28, B7, CD40, CD45, IFN-gamma, TNF-alpha, IL-4, IL-5, IL-6R, IL-6, IGF, IGFR1, IL-7, IL-8, IL-10, CD11a, CD58, and any of their ligands.

444. The method of any one of claims 430-443, wherein the one or more immunosuppressive agents are or have been administered to the subject prior to administration of the modified SC-β cells.

445. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to administration of the modified SC-β cells.

446. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents is or has been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks prior to administration of the modified SC-β cells.

447. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after administration of the modified SC-β cells.

448. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks after administration of the modified SC-β cells.

449. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject on the same day as the first administration of the modified SC-β cells.

450. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject after administration of the modified SC-β cells.

451. The method of any one of claims 430 to 444, wherein the one or more immunosuppressive agents are or have been administered to the subject after administration of the first and / or second administration of modified SC-β cells.

452. The method of any one of claims 430 to 444, wherein the one or more immunosuppressive agents are or have been administered to the subject prior to administration of the first and / or second administration of modified SC-β cells.

453. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days prior to administration of the first and / or second administration of modified SC-β cells.

454. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks prior to administration of the first and / or second administration of modified SC-β cells.

455. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days after administration of the first and / or second administration of modified SC-β cells.

456. The method of any one of claims 430-444, wherein the one or more immunosuppressive agents are or have been administered to the subject at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more weeks after administration of the first and / or second administration of modified SC-β cells.

457. The method of any one of claims 430-456, wherein the one or more immunosuppressants are administered at a lower dosage compared to a dosage of one or more immunosuppressants administered to reduce immune rejection of immunogenic cells that do not contain the modification of the modified SC-β cells.

458. The method of any one of claims 430 to 457, wherein the modified SC-β cells are capable of controlling the death of the modified SC-β cells.

459. The method of any one of claims 430-458, wherein the modified SC-β cells comprise a safety switch.

460. 460. The method of claim 459, wherein the safety switch induces controlled cell death in the presence of a drug or prodrug or upon activation by a selective exogenous compound.

461. The safety switch a system in which, upon activation, the cells downregulate the expression of said one or more tolerogenic factors and / or upregulate the expression of one or more immune signaling molecules, thereby marking said cells for elimination by the host immune system. The method according to any one of claims 459 to 460,

462. 462. The method of claim 461, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

463. 463. The method of claim 461 or claim 462, wherein said one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

464. The method of claim 459 or claim 460, wherein the safety switch is an inducible protein capable of inducing apoptosis of the modified SC-β cells.

465. 465. The method of claim 464, wherein the inducible protein capable of inducing apoptosis of the modified SC-β cells is a caspase protein.

466. The method of claim 465, wherein the caspase protein is caspase 9.

467. 461. The method of any one of claims 459 to 460, wherein the safety switch is a suicide gene.

468. The method of claim 467, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

469. The method of claim 467, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

470. 469. The method of any one of claims 459 to 469, wherein the safety switch is activated to induce controlled cell death after administering the one or more immunosuppressive agents to the subject.

471. 469. The method of any one of claims 459 to 469, wherein the safety switch is activated to induce controlled cell death prior to administering the one or more immunosuppressive agents to the subject.

472. The method of any one of claims 459 to 471, wherein the safety switch is activated to induce controlled cell death after administering the modified SC-β cells to the subject.

473. 473. The method of any one of claims 459 to 472, wherein the safety switch is activated to induce controlled cell death if cell injury or other negative effect occurs to the subject.

474. The method of any one of claims 459 to 473, comprising administering an agent that allows for depletion of modified SC-β cells from the population of modified SC-β cells.

475. The method of claim 474, wherein the agent that enables depletion of the modified SC-β cells is an antibody that recognizes a protein expressed on the surface of the modified SC-β cells.

476. The method of claim 475, wherein the antibody is selected from the group consisting of antibodies that recognize CCR4, CD16, CD19, CD20, CD30, EGFR, GD2, HER1, HER2, MUC1, PSMA, and RQR8.

477. 476. The method of claim 475, wherein the antibody is selected from the group consisting of mogamulizumab, AFM13, MOR208, obinutuzumab, ublituximab, ocaratuzumab, rituximab, rituximab-R11b, tomzotuximab, RO5083945 (GA201), cetuximab, Hul4.18K322A, Hul4.18-IL2, Hu3F8, dinituximab, c.60C3-R11c, and biosimilars thereof.

478. The method of any one of claims 417-429 and 474-477, comprising administering an agent that recognizes the one or more tolerogenic factors on the surface of the modified SC-β cells.

479. The method of claim 478, wherein said modified SC-β cells are engineered to express said one or more tolerogenic factors.

480. The method of claim 478 or claim 479, wherein the one or more tolerogenic factors is CD47.

481. 481. The method of any one of claims 417 to 480, further comprising administering to the subject one or more additional therapeutic agents.

482. The method of any one of claims 417 to 481, wherein the subject is receiving one or more additional therapeutic agents.

483. 483. The method of any one of claims 417 to 482, further comprising monitoring the therapeutic effectiveness of said method.

484. 484. The method of any one of claims 417 to 483, further comprising monitoring the prophylactic effectiveness of said method.

485. 485. The method of any one of claims 417-484, which is repeated until a desired suppression of one or more disease symptoms occurs.

486. The modified SC-β cell of any one of claims 205 to 380, comprising an exogenous polynucleotide encoding a safety switch.

487. The safety switch a system in which, upon activation, the cells downregulate the expression of said one or more tolerogenic factors and / or upregulate the expression of one or more immune signaling molecules, thereby marking said cells for elimination by the host immune system. The modified SC-β cell of claim 486,

488. 488. The modified SC-beta cell of claim 487, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

489. 489. The modified SC-beta cell of claim 487 or claim 488, wherein the one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

490. The modified SC-β cell of any one of claims 487 to 489, wherein the safety switch is a suicide gene.

491. The modified SC-β cell of claim 490, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

492. The modified SC-β cell of any one of claims 486 to 491, wherein the safety switch and the gene associated with the safety switch are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

493. The modified SC-β cell of any one of claims 486 to 491, wherein the safety switch and the one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

494. The modified SC-β cell of Claim 492 or Claim 493, wherein said bicistronic cassette is integrated into the genome of said modified SC-β cell by non-targeted insertion, optionally by introduction of said exogenous polynucleotide into said cell using a lentiviral vector.

495. the bicistronic cassette is integrated by targeted insertion into a target genomic locus of the cell; Optionally, the targeted insertion is by nuclease-mediated gene editing by homology-directed repair. The modified SC-β cell of claim 492 or 493.

496. The modified SC-β cell of any one of claims 487-495, wherein the one or more tolerogenic factors is CD47.

497. 204. The method of any one of claims 1 to 203, wherein the modified SC-β cells comprise an exogenous polynucleotide encoding a safety switch.

498. The safety switch a system in which, upon activation, the cells downregulate the expression of said one or more tolerogenic factors and / or upregulate the expression of one or more immune signaling molecules, thereby marking said cells for elimination by the host immune system.

98. The method of claim 97, wherein:

499. 99. The method of claim 98, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

500. 99. The method of claim 97 or claim 98, wherein the one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

501. 98. The method of claim 97, wherein the safety switch is a suicide gene.

502. The method of claim 501, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

503. The method of any one of claims 497 to 502, wherein the safety switch and the gene associated with the safety switch are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

504. 503. The method of any one of claims 497-502, wherein the safety switch and the one or more tolerogenic factors are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

505. The method of claim 503 or claim 504, wherein said bicistronic cassette is integrated by non-targeted insertion into the genome of said modified SC-β cell.

506. The method of claim 503 or claim 504, wherein said bicistronic cassette is integrated by targeted insertion into a target genomic locus of said modified SC-β cell.

507. The method of any one of claims 498-506, wherein said one or more tolerogenic factors is CD47.

508. The composition of any one of claims 204 and 381-416, wherein the modified SC-β cells of the population of modified SC-β cells comprise an exogenous polynucleotide encoding a safety switch.

509. The safety switch a system in which, upon activation, the cells downregulate the expression of said one or more tolerogenic factors and / or upregulate the expression of one or more immune signaling molecules, thereby marking said cells for elimination by the host immune system. The composition of claim 508, wherein:

510. 510. The composition of claim 509, wherein the one or more tolerogenic factors are selected from the group consisting of CD16, CD24, CD35, CD39, CD46, CD47, CD52, CD55, CD59, CD64, CD200, CCL22, CTLA4-Ig, C1 inhibitor, FASL, IDO1, HLA-C, HLA-E, HLA-E heavy chain, HLA-G, IL-10, IL-35, PD-L1, SERPINB9, CCL21, MFGE8, DUX4, B2M-HLA-E, CD27, IL-39, CD16 Fc receptor, IL15-RF, H2-M3(HLA-G), A20 / TNFAIP3, CR1, HLA-F, and MANF.

511. The composition of claim 509 or claim 510, wherein the one or more immune signaling molecules are selected from the group consisting of B2M, HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, RFXANK, CIITA, CTLA-4, PD-1, RAET1E / ULBP4, RAET1G / ULBP5, RAET1H / ULBP2, RAET1 / ULBP1, RAET1L / ULBP6, RAET1N / ULBP3, and other ligands of NKG2D.

512. The composition of claim 508, wherein the safety switch is a suicide gene.

513. The composition of claim 512, wherein the suicide gene is selected from the group consisting of cytosine deaminase (CyD), herpesvirus thymidine kinase (HSV-Tk), inducible caspase 9 (iCaspase 9), and rapamycin-activated caspase 9 (rapaCasp9).

514. The composition of any one of claims 508-513, wherein the safety switch and the gene associated with the safety switch are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cells of the population of modified SC-β cells.

515. The composition of any one of claims 508-513, wherein the safety switch and the exogenous CD47 are expressed from a bicistronic cassette integrated into the genome of the modified SC-β cell.

516. The composition of any one of claims 508-515, wherein the bicistronic cassette is integrated by non-targeted insertion into the genome, optionally by introduction of the exogenous polynucleotide into modified SC-β cells of the population of modified SC-β cells using a lentiviral vector.

517. the bicistronic cassette is integrated by targeted insertion into a target genomic locus of modified SC-β cells of the population of modified SC-β cells; Optionally, the targeted insertion is by nuclease-mediated gene editing by homology-directed repair. The composition of any one of claims 508 to 515.

Images