Postbiotic Compositions and Methods

JP2025504433A5Pending Publication Date: 2026-01-15POSTBIOTICS PLUS RESEARCH LLC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024542246
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-01-14
Filing Date
2023-01-13
Publication Date
2026-01-15

AI Technical Summary

Technical Problem

The prior art cannot effectively address the intestinal microbial disorders caused by antibiotics and chemotherapy treatment and their negative effects on immunotherapy, especially in immunodeficient patients, increasing the risk of infection and drug resistance.

Method used

Using plant-based fermentation matrix compositions, including Astalagas, nocturnal shades, berries of berries of genus genus genus , and chickpeas, epiphyte compositions are prepared through the fermentation process to restore and maintain intestinal microbial balance.

Benefits of technology

Recover and maintain intestinal microbial diversity, reduce the side effects of antibiotics and chemotherapy, enhance the effectiveness of immunotherapy, and reduce the risk of drug resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein is a postbiotic composition prepared using the fermentation and unique herbal matrix composition. Also provided herein is a method for treating or preventing gut microbiota disruption or dysbiosis associated with the administration of antibiotic treatment, chemotherapy treatment, or pharmaceutical or medical treatment that causes dysbiosis, using the postbiotic composition. TIFF2025504433000146.tif208107
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63 / 299,607, filed January 14, 2022, the contents of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted through the Patent Center in XML format and is incorporated by reference in its entirety. The XML copy was created on January 12, 2023, has the name "084487-191310WOPT_SL.xml" and is 147 kilobytes in size.

[0003] Field The present disclosure relates generally to postbiotic compositions and methods of using same. The present disclosure also relates to herbal / botanical / plant-based substrate compositions for use in the preparation of fermented or postbiotic compositions, as well as methods for the treatment of inflammatory conditions in a subject. Antibiotic treatment, chemotherapy treatment, or Administration of a medicine or medical procedure that causes dysbiosis; or Environmental or lifestyle factors The present disclosure also relates to postbiotic compositions and methods for treating or reconstituting or preventing gut microbiota disruption associated with Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis The present disclosure also relates to the treatment or prevention of dysbiosis or dysbacteriosis in subjects receiving immunotherapy. The present disclosure also relates to adjuvant therapy for cancer patients and other patients receiving immunotherapy, in some instances, the immunotherapy being, for example, hematopoietic cell therapy, or chimeric antigen receptor T cell therapy, or immune checkpoint inhibitor therapy. The present disclosure also relates to the prevention or treatment of antimicrobial resistance gene selection. [Background technology]

[0004] background Antibiotics are essential tools to treat and cure microbial infections, especially in immunocompromised patients or in populations whose immune function is suboptimal, such as the elderly and young children. Most antibiotics are derivatives of molecules secreted by microorganisms to kill each other, and microorganisms can easily evolve antimicrobial resistance (AMR) as a defense measure. Treating multidrug-resistant infections is one of the major challenges in modern medicine, and therefore it is crucial to suppress the emergence of resistant strains. Oral antibiotics can by-pass the majority of commensal microorganisms, dramatically reducing the microbial diversity in the intestine, and ultimately causing the expansion and dominance of resistant strains in the intestinal microbiota, the few surviving strains of which may include opportunistic or obligate pathogens.

[0005] Chemotherapy treatment is also known to disrupt gut microbiota. In some cancer treatment examples, antibiotics are administered in conjunction with chemotherapy treatment. For example, patients with blood cancer undergoing hematopoietic cell transplantation (HCT) are treated with high doses of chemotherapy and / or radiation therapy. These treatments reduce the number of white blood cells in patients and destroy the diversity and balance of the patient's gut microbiome, making the patient more susceptible to infection and complications. Many patients also receive prophylactic or empirical administration of high doses of antibiotics, which further disrupt the gut microbiome. It has also been shown that exposure to antibiotic therapy affects the probability of response to immune checkpoint inhibitor (ICPI) therapy, and that the exposure is predictive of shorter patient survival across malignancies. It has also been shown that antibiotics affect the probability of response and positive treatment outcomes of chimeric antigen receptor T cell (CAR T) therapy. It has been shown that loss of anaerobic bacteria is associated with loss of bacterial diversity, and that loss of anaerobic bacteria is associated with a decrease in the probability of response to CAR T therapy.

[0006] Antibiotics, as well as other therapies including chemotherapy and CAR-T therapy, can themselves disrupt the gut ecosystem, causing downstream metabolic changes within the microenvironment, with complex effects on the tumor-host-microbe interface.

[0007] In addition, other therapeutic treatments that may be administered in conjunction with chemotherapy, such as HCT, induce substantial shifts in the microbiota population, and the resulting lower microbiota diversity at the time of neutrophil engraftment in patients undergoing HCT has been shown to be associated with a five-fold increase in transplant-related mortality, thus indicating that microbiota diversity is important for clinical outcomes.

[0008] Furthermore, the administration of many drugs targeted at humans has been associated with unintended dysbiosis or dysbacteriosis in subjects. Such drugs that cause dysbiosis can include: acid blockers, such as proton pump inhibitors (PPIs) and H2 blockers, contraception, steroids, antipsychotics, opioids, metformin, selective serotonin reuptake inhibitors (SSRIs), and nonsteroidal anti-inflammatory drugs (NSAIDs).

[0009] Furthermore, antibiotics have been shown to directly kill and / or interfere with the natural growth of many bacteria of the gut microbiome commonly found in healthy subjects.

[0010] Disruption of the gut microbiota can have serious health consequences, including adverse effects on the immune system, inflammation, secondary infections, and other complications. Therefore, further compositions and methods for preventing or treating disruption of the gut microbiota are desirable. Specifically, a subject is Antibiotic treatment, chemotherapy treatment, and / or Administration of medicines or medical procedures that cause dysbiosis Further compositions and methods are desired for preventing or treating the disruption of the gut microbiome resulting from exposure to, etc. Additionally, compositions and methods are desired for reconstituting a microbiome that has been damaged by one or many of the factors listed above, or by other factors. Summary of the Invention

[0011] overview To enhance the understanding of the present disclosure, a number of examples are provided herein.

[0012] In one aspect, a fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition is described herein. In some embodiments of any aspect, the fermentation substrate is or includes a herbal substrate composition or herbal raw material. In some embodiments of any aspect, the substrate composition or herbal raw material includes at least one of the following: herbs from the Astragalus family, herbs from the Solanaceae or nightshade family, berries from the Sambucus L. genus, and beans from the Lens orientalis or Lens culinaris families. The substrate composition also includes liquid water, for example, liquid water sufficient to suspend or immerse the plant substrate raw material.

[0013] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal raw material including at least one of an herb from the Astragalaceae family, an herb from the Solanaceae family or Solanaceae family, a berry of the genus Sambucus L., and a legume from the family Lens orientalisaceae or Lens carinalis, in combination with sufficient liquid water to suspend or soak the herbal raw material.

[0014] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal raw materials including herbs of the Solanaceae or Solanaceae family and berries of the Sambucus L. genus in combination with sufficient liquid water to suspend or soak the herbal raw materials.

[0015] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal ingredients including ashwagandha root and elderberry in combination with sufficient liquid water to suspend or soak the herbal ingredients.

[0016] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal raw materials including herbs of the Solanaceae or Solanaceae family and berries of the Sambucus L. genus in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and sufficient liquid water to suspend or soak the herbal raw materials.

[0017] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal raw materials including Ashwagandha root and elderberry in combination with at least one Bifidobacterium species and at least one Lactobacillus species, and sufficient liquid water to suspend or soak the herbal raw materials.

[0018] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal raw materials including herbs of the Solanaceae or Solanaceae family and berries of the Sambucus L. genus in combination with at least two of B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei, and sufficient liquid water to suspend or soak the herbal raw materials.

[0019] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal ingredients including Ashwagandha root and elderberry in combination with at least two of B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei, and sufficient liquid water to suspend or soak the herbal ingredients.

[0020] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal raw materials including herbs of the Solanaceae or Solanaceae family and berries of the Sambucus L. genus in combination with B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, and sufficient liquid water to suspend or soak the herbal raw materials.

[0021] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising herbal ingredients including Ashwagandha root and elderberry in combination with B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, and sufficient liquid water to suspend or soak the herbal ingredients.

[0022] In some embodiments of any aspect, the herbal ingredients are provided as a dry powder before being combined with water. In some embodiments of any aspect, the dry powder includes a dry powder of juice.

[0023] In some embodiments of any aspect, the Astragalaceae herb is Astragalus membranaceus. In some embodiments of any aspect, the Astragalaceae herb is the root of Astragalus membranaceus. In some embodiments of any aspect, the herb is provided as a dry powder.

[0024] In some embodiments of any aspect, the Solanaceae or Solanaceae herb is Ashwagandha root. In some embodiments of any aspect, the herb is provided as a dry powder.

[0025] In some embodiments of any aspect, the berry of the genus Sambucus L. is an elderberry. In some embodiments of any aspect, the berry is provided as a dry powder.

[0026] In some embodiments of any aspect, the Lens orientalis family or Lens carinalis family legume is a lentil. In some embodiments of any aspect, the legume is a red lentil. In some embodiments of any aspect, the legume is provided as a dry powder.

[0027] In some embodiments of any aspect, the fermentation substrate includes at least an herb from the Astragalaceae family and an herb from the Solanaceae family or Solanaceae family. In some embodiments of any aspect, the fermentation substrate includes an herb from the Astragalaceae family and a berry from the genus Sambucus L. In some embodiments of any aspect, the fermentation substrate includes an herb from the Astragalaceae family and a legume from the family Lens orientalis or Lens carinalis. In some embodiments of any aspect, the fermentation substrate includes an herb from the Astragalaceae family, an herb from the family Solanaceae or Solanaceae family, and a berry from the genus Sambucus L. In some embodiments of any aspect, the fermentation substrate includes an herb from the Astragalaceae family, an herb from the family Solanaceae or Solanaceae family, and a legume from the family Lens orientalis or Lens carinalis. In some embodiments of any aspect, the fermentation substrate includes an herb from the Astragalaceae family, a berry from the genus Sambucus L., and a bean from the family Lens orientalis or Lens carinalis. In some embodiments of any aspect, the fermentation substrate includes an herb from the family Solanaceae or Solanaceae and a berry from the genus Sambucus L. In some embodiments of any aspect, the fermentation substrate includes an ashwagandha root and an elderberry (e.g., elderberry juice). In some embodiments of any aspect, the fermentation substrate includes an herb from the family Solanaceae or Solanaceae and a bean from the family Lens orientalis or Lens carinalis. In some embodiments of any aspect, the fermentation substrate includes an herb from the family Solanaceae or Solanaceae, a berry from the genus Sambucus L., and a bean from the family Lens orientalis or Lens carinalis. In some embodiments of any aspect, the fermentation substrate includes berries of the genus Sambucus L. and legumes of the family Lens orientalis or Lens carinalis. In some embodiments of any aspect, herbs of the family Astragalaceae, herbs of the family Solanaceae or Solanaceae, berries of the genus Sambucus L., and legumes of the family Lens orientalis or Lens carinalis.

[0028] In some embodiments of any aspect, the fermented substrate comprises astragalus and ashwagandha. In some embodiments of any aspect, the fermented substrate comprises astragalus and elderberry. In some embodiments of any aspect, the fermented substrate comprises astragalus and red lentil. In some embodiments of any aspect, the fermented substrate comprises ashwagandha and elderberry. In some embodiments of any aspect, the fermented substrate comprises elderberry and red lentil. In some embodiments of any aspect, the fermented substrate comprises astragalus, ashwagandha and elderberry. In some embodiments of any aspect, the fermented substrate comprises astragalus, ashwagandha and red lentil. In some embodiments of any aspect, the fermented substrate comprises astragalus, elderberry and red lentil.

[0029] In some embodiments of any aspect, the fermentation substrate further comprises one or more of glucose, sucrose, fructose, honey, and molasses. In some embodiments of any aspect, the fermentation substrate further comprises glucose, sucrose, fructose, honey, or molasses.

[0030] The pH of the fermentation substrate may vary and may change during the course of fermentation. In some embodiments of any aspect, the pH of the fermentation substrate is about 5.0 to about 8.0. In some embodiments of any aspect, the pH of the fermentation is about 5.0 to about 7.5. In some embodiments of any aspect, the pH of the fermentation is about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 8.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 8.0, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, about 6.4 to about 8.0, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 8.0, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0, or about 7.0 to about 7.5. In some embodiments of any aspect, the pH of the fermentation is about 3.5 to 6.7 (e.g., pH during fermentation). In some embodiments of any aspect, the pH of the fermentation is about 3.5 to 4.2 (e.g., pH at the end of fermentation). In some embodiments of any aspect, the pH of the end product of the fermentation process (e.g., postbiotic composition) is 5.0 to 8.0.

[0031] In one aspect, described herein is a fermentation substrate composition for use in a fermentation process to prepare a postbiotic composition, the fermentation substrate comprising at least one herbal ingredient selected from Astragalus membranaceus root, ashwagandha, elderberry, and red lentil in combination with sufficient liquid water to suspend or soak the herbal ingredient.

[0032] In some embodiments of any aspect, the fermentation substrate composition further comprises glucose, sucrose, fructose, honey, or molasses. In some embodiments of any aspect, the fermentation substrate composition further comprises a source of fermentable sugar, such as glucose, sucrose, fructose, malt extract, molasses, honey, or other fermentable sugar.

[0033] In some embodiments of any aspect, the herbal ingredients are provided as a dry powder before being combined with water.

[0034] In some embodiments of any aspect, the fermentation substrate includes Astragalus membranaceus root and Ashwagandha.

[0035] In some embodiments of any aspect, the fermentation substrate includes Astragalus membranaceus root and elderberry.

[0036] In some embodiments of any aspect, the fermentation substrate includes Astragalus membranaceus root and red lentils.

[0037] In some embodiments of any aspect, the fermentation substrate includes ashwagandha and elderberry.

[0038] In some embodiments of any aspect, the fermentation substrate includes elderberries and red lentils.

[0039] In some embodiments of any aspect, the fermentation substrate includes Astragalus membranaceus root, Ashwagandha, and Elderberry.

[0040] In some embodiments of any aspect, the fermentation substrate includes Astragalus membranaceus root, Ashwagandha, and lentil.

[0041] In some embodiments of any aspect, the fermentation substrate includes Astragalus membranaceus root, elderberry, and red lentil.

[0042] In some embodiments of any aspect, the fermentation substrate includes Astragalus membranaceus root, Ashwagandha, elderberry, and red lentil.

[0043] In some embodiments of any aspect, the fermented substrate composition comprises from about 2% by weight to about 10% by weight of herbs from the Astragalaceae family.In some embodiments of any aspect, the substrate composition comprises from about 2.5% by weight to about 5% by weight of herbs from the Astragalaceae family.

[0044] In some embodiments of any aspect, the fermented substrate composition comprises from about 2% by weight to about 10% by weight of Astragalus. In some embodiments of any aspect, the fermented substrate composition comprises from about 2.5% by weight to about 5% by weight of Astragalus.

[0045] In some embodiments of any aspect, the fermented substrate composition includes from about 2% by weight to about 10% by weight of a Solanaceae or Solanaceae herb.In some embodiments of any aspect, the fermented substrate composition includes from about 2.5% by weight to about 5% by weight of a Solanaceae or Solanaceae herb.

[0046] In some embodiments of any aspect, the fermented substrate composition comprises about 2% by weight to about 10% by weight of Ashwagandha.In some embodiments of any aspect, the fermented substrate composition comprises about 2.5% by weight to about 5% by weight of Ashwagandha.

[0047] In some embodiments of any aspect, the fermented substrate composition comprises from about 2% by weight to about 10% by weight of berries of the genus Sambucus L. In some embodiments of any aspect, the fermented substrate composition comprises from about 2% by weight to about 10% by weight of berries of the genus Sambucus L. In some embodiments of any aspect, the fermented substrate composition comprises from about 2% by weight to about 10% by weight of berries of the genus Sambucus L.

[0048] In some embodiments of any aspect, the fermented substrate composition comprises from about 2% by weight to about 10% by weight of elderberry. In some embodiments of any aspect, the fermented substrate composition includes from about 2.5% by weight to about 5% by weight of elderberry.

[0049] In some embodiments of any aspect, the fermentation substrate composition includes about 2% by weight to about 10% by weight glucose, sucrose, fructose, honey, or molasses.

[0050] In some embodiments of any aspect, the fermentation substrate composition includes about 2.5% by weight to about 5% by weight glucose, sucrose, fructose, honey, or molasses.

[0051] In some embodiments of any aspect, the fermented substrate composition includes from about 0.5% by weight to about 3% by weight of Lens orientalis family or Lens carinalidae legumes.In some embodiments of any aspect, the fermented substrate composition includes from about 0.5% by weight to about 1.5% by weight of Lens orientalis family or Lens carinalidae legumes.

[0052] In some embodiments of any aspect, the fermented substrate composition comprises from about 0.5% by weight to about 3% by weight of red lentils.In some embodiments of any aspect, the fermented substrate composition comprises from about 0.5% by weight to about 1.5% by weight of red lentils.

[0053] In some embodiments of any aspect, the fermentation substrate composition comprises about 70% water by weight to about 95% water by weight.

[0054] In some embodiments of any aspect, the fermentation substrate composition comprises about 80% water by weight to about 90% water by weight.

[0055] In some embodiments of any aspect, the fermented substrate composition includes: about 2.5% by weight to about 5% by weight astragalus; about 2.5% by weight to about 5% by weight ashwagandha; about 2.5% by weight to about 5% by weight elderberry; about 2.5% by weight to about 5% by weight sucrose or molasses; about 0.5% by weight to about 1.5% by weight red lentils; and about 80% by weight to about 90% by weight water.

[0056] In some embodiments of any aspect, the fermented substrate composition includes: about 2.5% by weight to about 5% by weight ashwagandha; about 2.5% by weight to about 5% by weight elderberry; about 2.5% by weight to about 5% by weight sucrose or molasses; about 0.5% by weight to about 1.5% by weight red lentils; and about 80% by weight to about 90% by weight water.

[0057] In some embodiments of any aspect, the matrix composition includes: about 2.5% by weight to about 5% by weight ashwagandha; about 2.5% by weight to about 5% by weight elderberry; about 2.5% by weight to about 5% by weight sucrose or molasses; and about 80% by weight to about 90% by weight water.

[0058] In some embodiments of any aspect, the substrate composition comprises: about 2.5% by weight to about 5% by weight astragalus; about 2.5% by weight to about 5% by weight ashwagandha; about 2.5% by weight to about 5% by weight elderberry; about 2.5% by weight to about 5% by weight sucrose or molasses; and about 80% by weight to about 90% by weight water.

[0059] In some embodiments of any aspect, the fermentation substrate further comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0060] In some embodiments of any aspect, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof.

[0061] In some embodiments of any aspect, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0062] In some embodiments of any aspect, the fermentation substrate includes at least two (e.g., at least three, at least four, at least five, or six) of the following: B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei.

[0063] In one aspect, a postbiotic composition is described herein, wherein the postbiotic composition is prepared by a process comprising the steps of: (a) preparing a culture of a microorganism; (b) preparing a fermented substrate composition described herein, such as a herb fermented substrate composition described herein; (c) inoculating the fermentation substrate composition with a culture of a microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition.

[0064] In some embodiments of any aspect, the postbiotic composition further comprises a carrier. In some embodiments of any aspect, the carrier is resistant starch or maltodextrin.

[0065] In some embodiments of any aspect described herein, the predetermined period of time for fermentation is about 24 hours to about 10 days. In some embodiments of any aspect, the predetermined period of time is: about 24 hours to about 8 days, about 24 hours to about 7 days, about 24 hours to about 6 days, about 24 hours to about 5 days, about 24 hours to about 4 days, about 24 hours to about 72 hours, about 24 hours to about 48 hours, about 24 hours to about 36 hours, about 36 hours to about 8 days, about 36 hours to about 7 days, about 36 hours to about 6 days, about 36 hours to about 8 ... about 5 days, about 36 hours to about 4 days, about 36 hours to about 72 hours, about 36 hours to about 48 hours, about 48 hours to about 8 days, about 48 hours to about 7 days, about 48 hours to about 6 days, about 48 hours to about 5 days, about 48 hours to about 4 days, about 48 hours to about 72 hours, about 72 hours to about 8 days, about 72 hours to about 7 days, about 72 hours to about 6 days, about 72 hours to about 5 days, or about 72 hours to about 4 days. In some embodiments of any aspect, the microbial culture comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0066] In some embodiments of any aspect, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof.

[0067] In some embodiments of any aspect, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0068] In some embodiments of any aspect, it is contemplated that other immune-supporting bacteria can be used alone or in combination with the organisms described herein to ferment the substrates described herein to provide the postbiotic compositions described herein. Examples are provided, for example, in Schluter et al., Nature 588: 303-307 (2020), the contents of which are incorporated herein by reference in their entirety.

[0069] In some embodiments of any aspect, the culture of the microorganism comprises about 1.0 x 10 8 CFU / mL ~ approx. 1 x 10 12 In some embodiments of any aspect, the culture of the microorganism comprises a concentration of about 1.0 x 10 CFU / mL. 9 CFU / mL ~ approx. 1 x 10 11 Includes microbial concentration in CFU / mL.

[0070] In some embodiments of any aspect, the microbial culture further comprises de Man, Rogosa & Sharpe (MRS) broth. In some embodiments or any aspect, the fermentation substrate or the microbial culture does not comprise MRS broth. In some embodiments or any aspect, the fermentation substrate or the microbial culture does not comprise any animal products.

[0071] In some embodiments of any aspect, the step of fermenting the inoculum composition includes sealing the inoculum composition in a fermentation vat under substantially anaerobic conditions.

[0072] In some embodiments of any aspect, fermenting the inoculum composition further comprises incubating the inoculum composition at a temperature of about 33° C. to about 40° C. In some embodiments of any aspect, fermenting the inoculum composition further comprises incubating the inoculum composition at a temperature of about 33° C. to about 37° C.

[0073] In some embodiments of any aspect, the step of fermenting the inoculum composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained at ≦1.5%.

[0074] In some embodiments of any aspect, the inoculum composition is maintained at a pH of about 5.0 to about 8.0. In some embodiments, the pH of the fermentation is maintained at about 5.0 to about 7.5. In some embodiments, the pH of the fermentation is maintained at about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 8.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8. about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 8.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 8.0, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, about 6.4 to about 8.0, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 8.0, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 8.0, about 6.8 to about 7.5, about 6.8 to about 7.0, about 7.0 to about 8.0, or about 7.0 to about 7.5. In some embodiments of any aspect, the pH of the fermentation is about 3.5 to 6.7 (e.g., pH during fermentation). In some embodiments of any aspect, the pH of the fermentation is about 3.5 to 4.2 (e.g., pH at the end of fermentation). In some embodiments of any aspect, the pH of the end product of the fermentation process (e.g., postbiotic composition) is 5.0 to 8.0.

[0075] In some embodiments of any aspect, the final bacterial content after fermentation is about 1.0 x 10 viable bacteria per milliliter. 8 ~Approx. 1 x 10 11 In some embodiments of any aspect, the final bacterial content after fermentation is about 1.0 x 10 9 ~Approx. 1 x 10 10 In some embodiments of any aspect, the final bacterial content after fermentation is about 1.0 x 10 6 ~Approx. 1.5 x 109 cfu / ml.

[0076] In some embodiments of any aspect, the bacterial content after drying (e.g., spray drying or freeze drying) is about 1 x 10 bacterial cells per gram. 8 active-fluorescent units (afu / g; e.g., using flow cytometry) to approximately 2 x 10 9 afu / g, where the bacterial cells are, for example, viable or non-viable bacterial cells. In some embodiments of any aspect, the bacterial content after drying is about 1 x 10 8 afu / g ~ approx. 1.5 x 10 9 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 1 x 10 8 afu / g ~ approx. 1 x 10 9 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 5 x 10 8 afu / g ~ approx. 2 x 10 9 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 5 x 10 8 afu / g ~ approx. 1.5 x 10 9 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 5 x 10 8 afu / g ~ approx. 1 x 10 9 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 5 x 10 8 afu / g ~ approx. 8.8 x 10 8 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 5 x 10 8 afu / g ~ approx. 8.5 x 10 8 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 5 x 10 8 afu / g ~ approx. 8.2 x 10 8 afu / g. In some embodiments of any aspect, the bacterial content after drying is about 5 x 10 8afu / g ~ approx. 8.0 x 10 8 afu / g.

[0077] In some embodiments of any aspect, the postbiotic composition after drying (e.g., spray drying or freeze drying) comprises non-viable or non-living bacteria. In some embodiments of any aspect, the postbiotic composition after drying (e.g., spray drying or freeze drying) comprises low levels of viable or live bacteria. In embodiments where the postbiotic composition is administered to a subject who is immunocompromised, it is beneficial for the composition to comprise low levels of viable or live bacteria. In embodiments where the postbiotic composition is administered to a subject who is not immunocompromised, the composition may comprise viable or non-viable bacteria.

[0078] In some embodiments of any aspect, the bacterial content after spray drying is about 0 cfu / g of live or viable bacteria. In some embodiments of any aspect, the bacterial content after spray drying is greater than 0 cfu / g of live or viable bacteria. In some embodiments of any aspect, the bacterial content after spray drying is less than 100,000 cfu / g of live or viable bacteria. In some embodiments of any aspect, the bacterial content after spray drying is greater than 100,000 cfu / g of live or viable bacteria. 7 In some embodiments of any aspect, the bacterial content after spray drying is less than 10 live or viable bacteria. 1 <10 cfu / g 2 <10 cfu / g 3 <10 cfu / g 4 <10 cfu / g 5 <10 cfu / g 6 cfu / g or less than 10 7 Less than cfu / g.

[0079] In some embodiments of any aspect, the bacterial content after lyophilization is at most about 10 10 In some embodiments of any aspect, the bacterial content after freeze-drying is 10 1 <10 cfu / g 2 <10 cfu / g 3 <10 cfu / g 4 <10 cfu / g 5 <10 cfu / g 6 cfu / g or less than 10 7 Less than cfu / g.

[0080] In some embodiments of any aspect, the viability of the bacteria in the postbiotic composition after drying (eg, spray drying or freeze drying) is at most 10%. In some embodiments of any aspect, the viability of the bacteria in the postbiotic composition after drying (e.g., spray drying or freeze drying) is at most 0.01%, at most 0.02%, at most 0.03%, at most 0.04%, at most 0.05%, at most 0.06%, at most 0.07%, at most 0.08%, at most 0.09%, at most 0.1%, at most 0.2%, at most 0.3%, at most 0.4%, at most 0.5%, at most 0.6%, at most 0.7%, at most 0.8%, at most 0.9%, at most 1%, at most 2%, at most 3%, at most 4%, at most 5%, at most 6%, at most 7%, at most 8%, at most 9%, or at most 10%.

[0081] In some embodiments of any aspect, the postbiotic composition comprises at least one metabolite selected from Table 2.

[0082] In some embodiments of any aspect, the postbiotic composition includes at least one metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, indole organic acids, or any combination thereof.

[0083] In some embodiments of any aspect, the postbiotic composition comprises at least one metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, fleionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and any combination thereof. The postbiotic composition may also comprise an organic acid produced by fermentation, including, for example, citric acid, succinic acid, lactic acid, glycerol, and acetic acid.

[0084] In some embodiments of any aspect, the postbiotic composition includes each of 3-hydroxybutyric acid, quercetin, floyonolic acid, wedelolactone, luteolin, and N-[(2S)-2-hydroxypropanoyl]-L-leucine, and an indole organic acid.

[0085] In some embodiments of any aspect, the postbiotic composition includes one or more organic acids produced by fermentation selected from citric acid, succinic acid, lactic acid, glycerol, and acetic acid.

[0086] In some embodiments of any aspect, the postbiotic composition includes each of citric acid, succinic acid, lactic acid, glycerol, and acetic acid.

[0087] Exemplary amounts in the final fermentation broth include 0.5-3.0 g / L citric acid, 0.02-0.9 g / L succinic acid, 2.0-20 g / L lactic acid, 0.1-2.5 g / L glycerol, and 1.0-20 g / L acetic acid. An exemplary organic acid profile for the final fermentation broth includes 1.18 g / L citric acid, 0.1 g / L succinic acid, 14.69 g / L lactic acid, 0.55 g / L glycerol, and 7.73 g / L acetic acid. See also examples of organic acid content over the fermentation period in Table 1.

[0088] (Table 1) Organic acid content TIFF2025504433000002.tif35160

[0089] In some embodiments of any aspect, the postbiotic composition includes one or more components selected from 3-hydroxybutyric acid, quercetin, fleionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and indole organic acids. In some embodiments of any aspect, the indole organic acids include indole-3-acetate and / or indole-3-lactate.

[0090] In some embodiments of any aspect, the postbiotic composition comprises at least one metabolite selected from Table 2. Significant increases in the concentration of numerous metabolites were shown in the postbiotic product. Within these categories of increased metabolites, the average increase was calculated to be 5.6-fold. In some embodiments of any aspect, the postbiotic composition comprises at least one metabolite selected from the following: 3-hydroxybutyric acid, 6-methoxysalicylic acid, trans caffeic acid, phloroglucinol carboxylic acid, 1,6,8-trimethyl-alantoate, vitamin C, wedelolactone, 9,10-dihydroxystearic acid, isorhamnetin, pseudopurpurin, quercetin, luteolin, 2-ethylglutaric acid, and phloeonolic acid (see, e.g., Table 2).

[0091] Table 2. Non-limiting examples of metabolites in postbiotic compositions TIFF2025504433000003.tif250170

[0092] In some embodiments of any aspect, the postbiotic composition comprises a metabolite profile exhibiting elevated levels or comprises one or more metabolites selected from the group consisting of 3-hydroxybutyric acid, quercetin, floyonolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, indole organic acids, and any combination thereof.

[0093] In some embodiments of any aspect, the postbiotic composition comprises a nucleic acid comprising a sequence selected from B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei.

[0094] In some embodiments of any aspect, the postbiotic composition comprises at least a portion of a 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. In some embodiments of any aspect, the postbiotic composition comprises a V4 region and / or a V5 region of a 16S rRNA gene sequence from at least one of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. In some embodiments, the V4 region and / or the V5 region are about 250 base pairs in length. In some embodiments of any aspect, the postbiotic composition comprises a nucleic acid that comprises a nucleic acid molecule capable of hybridizing to a primer sequence (e.g., a 16S primer) sequence selected from SEQ ID NOs: 1-13, or that is complementary to at least one of SEQ ID NOs: 1-13: B. lactis: TIFF2025504433000004.tif4128, B. breve: TIFF2025504433000005.tif4128, B. breve: TIFF2025504433000006.tif4128, B. infantis: TIFF2025504433000007.tif4128, B. infantis: TIFF2025504433000008.tif4128, L. plantarum: TIFF2025504433000009.tif4128, L. plantarum: TIFF2025504433000010.tif4128, L. acidophilus: TIFF2025504433000011.tif4128, L. acidophilus: TIFF2025504433000012.tif4128, L. rhamnosus: TIFF2025504433000013.tif4128, L. rhamnosus: TIFF2025504433000014.tif4128, L. paracasei: TIFF2025504433000015.tif4128, or L. paracasei: TIFF2025504433000016.tif4128. In some embodiments, the primer specifically hybridizes to the DNA fragment having the nucleotide sequence (e.g., at least a portion of the 16S rRNA gene sequence) under stringent conditions. As used herein, the term "stringent conditions" refers to conditions under which hybridization occurs only when there is at least 95% identity in nucleotide sequence. In another embodiment, hybridization under "stringent conditions" occurs when there is at least 97% identity between sequences.

[0095] In one aspect, described herein is a postbiotic composition comprising 3-hydroxybutyric acid, quercetin, floyonolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and an indole organic acid.

[0096] In some embodiments of any aspect, the postbiotic composition further comprises bacteria of the genera Bifidobacterium and Lactobacillus.

[0097] In some embodiments of any aspect, the postbiotic composition further comprises a 16S RNA having a nucleic acid sequence at least 90% identical to one of SEQ ID NOs: 14-16 (B. lactis), SEQ ID NOs: 17-20 (B. breve), SEQ ID NOs: 21-26 (B. infantis), SEQ ID NOs: 27-32 (L. plantarum), SEQ ID NOs: 33-39 (L. acidophilus), SEQ ID NOs: 40-44 (L. rhamnosus), SEQ ID NOs: 45-48 (L. paracasei), or SEQ ID NOs: 49-52 (L. casei).

[0098] In some embodiments of any aspect, the postbiotic composition further comprises one or more organic acids selected from citric acid, succinic acid, lactic acid, glycerol, and acetic acid.

[0099] In some embodiments of any aspect, the postbiotic composition includes each of citric acid, succinic acid, lactic acid, glycerol, and acetic acid.

[0100] In one aspect, oral postbiotic formulations are described herein, which include the compositions (e.g., postbiotic compositions) described herein. In one aspect, compositions for oral delivery are described herein, which include the postbiotic compositions described herein that are formulated for oral delivery.

[0101] In some embodiments of any aspect, the oral postbiotic formulation is formulated as a tablet, pill, capsule, or microcapsule.

[0102] In some embodiments of any aspect, the oral postbiotic formulation is formulated for buccal, sublabial, or sublingual administration.

[0103] In some embodiments of any aspect, the oral postbiotic formulation is a liquid suspension. In some embodiments of any aspect, the formulation comprises a liquid suspension.

[0104] In one aspect, described herein is a pharmaceutical composition that includes a composition described herein (eg, a postbiotic composition) and a pharma- ceutically acceptable carrier.

[0105] In some embodiments of any aspect, the oral postbiotic formulation is administered to a subject: Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis The present invention is for the treatment or prevention of gut microbiota disruption associated with

[0106] In some embodiments of any aspect, the oral postbiotic formulation is administered to a subject: Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis The present invention is for the treatment or prevention of dysbiosis or dysbacteriosis associated with

[0107] In some embodiments of any aspect, the oral postbiotic formulation is for the treatment or prevention of gut microbiota disruption associated with chemotherapy treatment in a subject.

[0108] In some embodiments of any aspect, the oral postbiotic formulation is for treating or preventing dysbiosis or dysbacteriosis associated with chemotherapy treatment in a subject.In some embodiments of any aspect, the oral postbiotic formulation is for treating or preventing dysbiosis or dysbacteriosis associated with cancer immunotherapy, where cancer immunotherapy includes but is not limited to: immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy and CAR-T therapy, vaccination (e.g., dendritic cell vaccine), or any other approach that promotes or activates the response of immune cells to cancer.

[0109] In some embodiments of any aspect, the oral postbiotic formulation is for treatment or prevention of gut microbiota disruption associated with administration of a drug that causes dysbiosis in a subject.

[0110] In some embodiments of any aspect, the oral postbiotic formulation is for the treatment or prevention in a subject of dysbiosis or dysbacteriosis associated with administration of a drug that causes dysbiosis.

[0111] In one aspect, in the subject, Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis Described herein are methods for treating or preventing gut microbiota disruption associated with, the methods comprising administering to a subject an amount of a composition described herein (e.g., a postbiotic composition) effective to treat or prevent the disruption.

[0112] In some embodiments of any aspect, the medical treatment comprises cancer immunotherapy.

[0113] In some embodiments of any aspect, the cancer immunotherapy comprises immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy, CAR-T therapy, dendritic cell vaccines, or any other approach that promotes or activates immune cell responses against cancer.

[0114] In some embodiments of any aspect, the medical treatment comprises vaccination.

[0115] In some embodiments of any aspect, the medical treatment comprises treatment with a drug that causes dysbiosis.

[0116] In some embodiments of any aspect, the drug causing dysbiosis is selected from the group consisting of acid blockers, proton pump inhibitors (PPIs), H2 blockers, contraception, steroids, antipsychotics, opioids, metformin, SSRIs, nonsteroidal anti-inflammatory drugs (NSAIDs), and any combination thereof.Metabolic diseases, such as diabetes, may also cause or be associated with dysbiosis, as they may cause or be associated with poor control of blood glucose levels in such conditions.Therefore, insulin may also be considered a drug affecting dysbiosis, and the compositions described herein are particularly intended for use in treating or preventing dysbiosis related to diabetes.

[0117] In one aspect, the present invention provides a method for treating cancer, comprising administering to a subject in need thereof a cancer immunotherapy and administering the composition described herein, wherein said administration is effective for treating cancer.In some embodiments of any aspect, such combination therapy increases the effectiveness of cancer immunotherapy.

[0118] In one aspect, a method for treating cancer is described herein, the method comprises administering to a subject in need thereof a CAR-T therapy and administering a composition as described herein, wherein the administration is effective for treating cancer.In some embodiments of any aspect, such combination therapy increases the effectiveness of CAR-T therapy.

[0119] In one aspect, the present invention provides a method for treating cancer, comprising administering chemotherapy to a subject in need thereof and administering the composition described herein, wherein said administration is effective for treating cancer.In some embodiments of any aspect, such combination therapy increases the effectiveness of chemotherapy.

[0120] In one aspect, a method for treating infection is described herein, the method comprises administering to a subject in need thereof at least one antibiotic and administering the composition described herein, wherein the administration is effective for treating infection.In some embodiments of any aspect, such combination therapy increases the effectiveness of at least one antibiotic.

[0121] In one aspect, a method of increasing neutrophil engraftment is described herein, the method comprising administering to a subject in need thereof an effective amount of a composition described herein.

[0122] In one aspect, described herein is a method of treating or preventing chemotherapy-associated intestinal mucositis, the method comprising administering to a subject in need thereof chemotherapy and a composition described herein, wherein administration is effective to treat intestinal mucositis.

[0123] Mucositis occurs when cancer treatments damage the rapidly dividing epithelial cells that line the gastrointestinal tract. Non-limiting examples of mucositis measurements include: microscopic examination of intestinal biopsies; symptom-based, e.g., vomiting, diarrhea, pain, abdominal complaints, and / or nutritional support-based, patient-reported rating scales (e.g., the National Cancer Institute Common Terminology Criteria for Adverse Events (NCI-CTCAE) scale and the Daily Gut Score (DGS)); and / or biomarkers in blood, stool, breath, or urine samples. Non-limiting examples of such biomarkers or tests for mucositis include: citrulline; proinflammatory cytokines such as TNF-α, IL1-β, or IL-6; C-reactive protein (CRP); intestinal fatty acid binding protein (I-FABP); ileal bile acid binding protein (I-BABP); calprotectin; calgranulin (S100A12); fecal human DNA / total DNA ratio; glucose permeability test; hydrogen breath test; 13C lactose test; 3C sucrose breath test; see, e.g., Kuiken et al., "Biomarkers and non-invasive tests for gastrointestinal mucositis," Support Care Cancer. 2017; 25(9): 2933-2941, the contents of which are incorporated herein by reference in their entirety.

[0124] In some embodiments of any aspect, administration of a composition described herein (e.g., a postbiotic composition; e.g., an oral postbiotic formulation; e.g., in combination with a cancer treatment) is associated with at least one of the following outcomes when compared to a negative control, e.g., a subject not receiving the composition, or a treated subject prior to receiving the composition: reduced cancer recurrence rate (e.g., no recurrence); increased survival from cancer; reduced time to neutrophil engraftment; improved peripheral blood mononuclear cell recovery trajectory (e.g., higher peripheral blood mononuclear cell counts); reduced incidence of febrile neutropenia; reduced incidence of bloodstream infections; and / or reduced 30-day readmission events (see, e.g., Example 6).

[0125] In some embodiments of any aspect, administration of a composition described herein (e.g., a postbiotic composition; e.g., an oral postbiotic formulation; e.g., in combination with chemotherapy) is associated with an improvement in intestinal mucositis (e.g., a decrease in intestinal mucositis) associated with chemotherapy when compared to a negative control, e.g., a subject not receiving the composition, or a treated subject prior to receiving the composition (see, e.g., Example 6).

[0126] In one aspect, a method for preparing a postbiotic composition is described herein, the method comprising the steps of: (a) preparing a culture of a microorganism; (b) preparing a fermented substrate composition described herein, e.g., a herb fermented substrate; (c) inoculating the fermentation substrate composition with a culture of a microorganism to produce an inoculum composition; and (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition.

[0127] In some embodiments of any aspect, the predetermined period of time is from about 24 hours to about 10 days, as described herein above, or any period therebetween.

[0128] In some embodiments of any aspect, the microbial culture comprises at least one Bifidobacterium species and at least one Lactobacillus species.

[0129] In some embodiments of any aspect, the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof.

[0130] In some embodiments of any aspect, the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0131] In some embodiments of any aspect, the culture of the microorganism comprises about 1.0 x 10 8 CFU / mL ~ approx. 1 x 10 12 Includes microbial concentration in CFU / mL.

[0132] In some embodiments of any aspect, the culture of the microorganism comprises about 1.0 x 10 9 CFU / mL ~ approx. 1 x 10 11 Includes microbial concentration in CFU / mL.

[0133] In some embodiments of any aspect, the step of fermenting the inoculum composition includes sealing the inoculum composition in a fermentation vat under substantially anaerobic conditions.

[0134] In some embodiments of any aspect, the step of fermenting the inoculum composition further comprises incubating the inoculum composition at a temperature of about 33°C to about 40°C.

[0135] In some embodiments of any aspect, the step of fermenting the inoculum composition further comprises incubating the inoculum composition at a temperature of about 33°C to about 37°C.

[0136] In some embodiments of any aspect, the step of fermenting the inoculum composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained at ≦1.5%.

[0137] In some embodiments of any aspect, the pH of the fermentation is maintained in the following ranges: about 5.0 to about 7.5, about 5.0 to about 7.0, about 5.0 to about 6.8, about 5.0 to about 6.6, about 5.0 to about 6.4, about 5.0 to about 6.2, about 5.0 to about 6.0, about 5.5 to about 7.5, about 5.5 to about 7.0, about 5.5 to about 6.8, about 5.5 to about 6.6, about 5.5 to about 6.4, about 5.5 to about 6.2, about 5.5 to about 6.0, about 6.0 to about 7.5, about 6.0 to about 7.0, about 6.0 to about 6.8, about 6.0 to about 6.6, about 6.0 to about 6.4, about 6.0 to about 6.2, about 6.2 to about 7.5, about 6.2 to about 7.0, about 6.2 to about 6.8, about 6.2 to about 6.6, about 6.2 to about 6.4, about 6.4 to about 7.5, about 6.4 to about 7.0, about 6.4 to about 6.8, about 6.4 to about 6.6, about 6.6 to about 7.5, about 6.6 to about 7.0, about 6.6 to about 6.8, about 6.8 to about 6.8, about 6.8 to about 7.5, about 6.8 to about 7.0, or about 7.0 to about 7.5. In some embodiments of any aspect, the inoculum composition is maintained at a pH of about 6.0 to about 6.8. In some embodiments of any aspect, the pH of the fermentation is about 3.5 to 6.7 (e.g., pH during fermentation). In some embodiments of any aspect, the pH of the fermentation is about 3.5 to 4.2 (e.g., pH at the end of fermentation). In some embodiments of any aspect, the pH of the end product of the fermentation process (e.g., postbiotic composition) is 5.0 to 8.0.

[0138] In some embodiments of any aspect, the method further comprises freeze-drying the fermented inoculum composition to obtain the postbiotic composition. In some embodiments of any aspect, the method further comprises spray-drying the fermented inoculum composition to obtain the postbiotic composition.

[0139] In some embodiments of any aspect, the method further includes formulating the postbiotic composition for oral delivery.

[0140] In some embodiments of any aspect, the method further includes formulating the postbiotic composition as a tablet, pill, capsule, or microcapsule.

[0141] In some embodiments of any aspect, the method further includes formulating the postbiotic composition in a liquid suspension.

[0142] In one aspect, described herein is a pharmaceutical composition comprising a composition (e.g., a postbiotic composition) prepared by the methods described herein and a pharma- ceutically acceptable carrier.

[0143] In one aspect, in the subject, Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis Described herein are methods for treating or preventing gut microbiota disruption associated with, the methods comprising administering to a subject a pharmacologic effective amount of a composition (e.g., a postbiotic composition) described herein.

[0144] In one aspect, in the subject, Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis Described herein are methods for treating or preventing dysbiosis or dysbacteriosis associated with, the methods comprising administering to a subject a pharmacologic effective amount of a composition (e.g., a postbiotic composition) described herein.

[0145] In one aspect, in the subject, Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis Described herein is a method for treating or preventing gut microbiota disruption associated with, the method comprising administering to a subject a pharmacologic effective amount of an oral postbiotic formulation described herein.

[0146] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with radiation therapy treatment in a subject, the method comprising administering to the subject a pharma- ceutical effective amount of an oral postbiotic formulation described herein.

[0147] In one aspect, described herein is a method of attenuating or preventing antibiotic resistance in a subject undergoing antibiotic treatment, the method comprising administering to the subject a pharma- ceutical effective amount of a composition described herein (e.g., a postbiotic composition), or a pharma- ceutical effective amount of an oral postbiotic formulation described herein.

[0148] In some embodiments of any aspect, administration to a subject includes oral administration in the form of a tablet, pill, capsule, or microcapsule.

[0149] In some embodiments of any aspect, administration to the subject includes buccal administration, sublabial administration, or sublingual administration.

[0150] In some embodiments of any aspect, administering to the subject includes oral administration in the form of a liquid suspension.

[0151] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with chemotherapy treatment in a subject, the method comprising administering to the subject a pharma- tically effective amount of a composition (e.g., a postbiotic composition) described herein.

[0152] In one aspect, described herein is a method of treating or preventing gut microbiota disruption associated with chemotherapy treatment in a subject, the method comprising administering to the subject a pharma- ceutical effective amount of an oral postbiotic formulation described herein.

[0153] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis associated with chemotherapy treatment in a subject, the method comprising administering to the subject a pharma- ceutical effective amount of an oral postbiotic formulation described herein.

[0154] In one aspect, described herein is a method of treating or preventing gut microbiota disruption associated with administration of a drug that causes dysbiosis in a subject, the method comprising administering to the subject a pharma- ceutical effective amount of a composition (e.g., a postbiotic composition) described herein.

[0155] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis in a subject associated with administration of a drug that causes dysbiosis, the method comprising administering to the subject a pharma- ceutical effective amount of a composition (e.g., a postbiotic composition) described herein.

[0156] In one aspect, described herein is a method of treating or preventing gut microbiota disruption associated with administration of a drug that causes dysbiosis in a subject, the method comprising administering to the subject a pharma- ceutical effective amount of an oral postbiotic formulation described herein.

[0157] In one aspect, described herein is a method of treating or preventing dysbiosis or dysbacteriosis in a subject associated with administration of a drug that causes dysbiosis, the method comprising administering to the subject a pharma- ceutical effective amount of an oral postbiotic formulation described herein.

[0158] In some embodiments of any aspect, the drug that causes dysbiosis is selected from the group consisting of acid blocking drugs, proton pump inhibitors (PPIs), SSRIs, H2 blockers, contraception, steroids, antipsychotics, opioids, metformin, nonsteroidal anti-inflammatory drugs (NSAIDs), and any combination thereof.

[0159] In some embodiments of any aspect, administration to a subject includes oral administration in the form of a tablet, pill, capsule, or microcapsule.

[0160] In some embodiments of any aspect, administration to the subject includes buccal administration, sublabial administration, or sublingual administration.

[0161] In some embodiments of any aspect, administering to the subject includes oral administration in the form of a liquid suspension.

[0162] In one aspect, described herein is a combination therapy for reducing or preventing antimicrobial resistance in a subject while administering an antibiotic to a subject in need thereof, the combination therapy comprising: administration to the subject of a therapeutically effective amount of an antibiotic; and administration of a therapeutically effective amount of a composition described herein (e.g., a postbiotic composition), or a therapeutically effective amount of an oral postbiotic formulation described herein.

[0163] In one aspect, a combination therapy is described herein that includes: administration of a therapeutically effective amount of an antibiotic to a subject; administration of a chemotherapy treatment to a subject; and administration of a therapeutically effective amount of a composition described herein (e.g., a postbiotic composition), or a therapeutically effective amount of an oral postbiotic formulation described herein.

[0164] In one aspect, a combination therapy is described herein that includes: administration of immune checkpoint inhibitor (ICPI) therapy to a subject; and administration of a therapeutically effective amount of a composition described herein (e.g., a postbiotic composition), or a therapeutically effective amount of an oral postbiotic formulation described herein.

[0165] In one aspect, a combination therapy is described herein that includes: administering a bone marrow transplant to a subject; and administering a therapeutically effective amount of a composition described herein (e.g., a postbiotic composition), or a therapeutically effective amount of an oral postbiotic formulation described herein.

[0166] In one aspect, a combination therapy is described herein that includes administering a hematopoietic cell transplant (HCT) or a stem cell transplant to a subject; and administering a therapeutically effective amount of a composition described herein (e.g., a postbiotic composition) or a therapeutically effective amount of an oral postbiotic formulation described herein.

[0167] In one aspect, a combination therapy is described herein that includes: administration of a chimeric antigen receptor T cell therapy to a subject; and administration of a therapeutically effective amount of a composition described herein (e.g., a postbiotic composition), or a therapeutically effective amount of an oral postbiotic formulation described herein.

[0168] In some embodiments of any aspect, the combination therapy further comprises administration of a chemotherapy treatment to the subject.

[0169] In one aspect, described herein is a method of treating cancer, the method comprising administering to a subject in need thereof at least one cancer treatment and administering a postbiotic composition, wherein the administration is effective to treat the cancer, and the postbiotic composition is prepared by a process comprising the steps of: (a) preparing a culture of microorganisms including B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei; (b) herbal ingredients including ashwagandha root and elderberry; Enough liquid water to suspend or soak the herbal ingredients preparing a fermentation substrate composition comprising in combination with (c) inoculating the fermentation substrate composition with a culture of a microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition. [Brief description of the drawings]

[0170] For the purpose of describing in an appreciable manner the advantages and features of the present disclosure, reference will be made to embodiments of the disclosure that are illustrated in the accompanying drawings, with the understanding that the drawings depict only exemplary embodiments of the disclosure and therefore should not be considered as limiting the scope of the disclosure, and the principles herein will be described and explained with greater specificity and detail through the use of the accompanying drawings. [Figure 1] FIG. 1 shows diversity score data for stool samples collected from patients treated with a postbiotic composition of the present disclosure compared to patients treated with a conventional probiotic control alone without the postbiotic composition of the present disclosure, as described in Example 5, according to an exemplary embodiment of the present disclosure. [Diagram 2] FIG. 2 shows microbial family abundance data for patients treated with the postbiotic composition of the present disclosure compared to patients treated with a conventional probiotic control without the postbiotic composition of the present disclosure, as described in Example 5, according to an exemplary embodiment of the present disclosure. [Diagram 3] FIG. 3 shows diversity data for stool samples collected from patients who received additional treatment with a postbiotic composition of the present disclosure compared to patients who received treatment only with a conventional probiotic control without the postbiotic composition of the present disclosure, as described in Example 5, according to an exemplary embodiment of the present disclosure. [Figure 4] FIG. 4 shows relative abundance data of microbial phyla for beneficial microbial phyla (left) and harmful microbial phyla (right) for stool samples collected from patients treated with a postbiotic composition of the present disclosure compared to patients treated with a conventional probiotic control without the postbiotic composition of the present disclosure, as described in Example 5, according to an exemplary embodiment of the present disclosure. [Diagram 5] Figure 5 is a schematic diagram showing the experimental design. Postbiotic-001 (PB001) is a postbiotic prepared using strains of Bifidobacterium and Lactobacillus bacteria to ferment red lentils, ashwagandha, astragalus, elderberry, and molasses. See, for example, the exemplary data in Figures 6A-6C, 7A-7B, and 8B. [Figure 6A] Figures 6A-6C show the increase in microbial diversity in subjects after taking the postbiotic PB001. Figure 6A is a bar graph showing the difference in diversity between placebo and PB001. [Figure 6B]Figures 6A-6C show the increase in microbial diversity in subjects after taking the postbiotic PB001. Figure 6B is a line graph of the receiver operating characteristic curve showing the performance of the classification model at all classification thresholds, which shows that the microbiome diversity in subjects taking the postbiotic was significantly improved compared to the control. [Figure 6C] Figures 6A-6C show an increase in microbial diversity in subjects after receiving the postbiotic PB001. Figure 6C is a forest plot of association coefficients between bacterial families and treatment modalities showing that subjects receiving the postbiotic PB001 had more bacterial families associated with good health in their microbiomes, while the abundance of dysbiosis-associated bacteria was reduced. [Figure 7A] Figures 7A-7B compare the microbiomes of the postbiotic group with the control group. Figure 7A is a bar graph showing that gut bacteria associated with good health were significantly enriched with support from the postbiotic product, PB001. [Figure 7B] Figures 7A-7B compare the microbiomes of the postbiotic group with the control group, and Figure 7B is a bar graph showing that elevated blood levels of C-reactive protein, an inflammatory marker, were less frequently observed when the postbiotic PB001 was ingested. [Figure 8A]Figures 8A-8B show that the postbiotics significantly increased genera that support the immune system. Figure 8A shows that Faecalibacterium, Akkermansia, and Ruminococcus 2 were higher in recipients of the postbiotic PB001 compared to placebo recipients; thus, administration of PB001 may support better immunotherapy outcomes and faster immune recovery. In placebo, Scardovia, Escherichia-Shigella, and Streptococcus were higher compared to PB001. [Figure 8B] Figures 8A-8B show that postbiotics significantly increased genera that support the immune system. Figure 8B shows that certain members of the microbiome (e.g., Faecalibacterium, Akkermansia, and Ruminococcus 2) support immune system recovery; Figure 8B is taken from Schluter et al. "The gut microbiota is associated with immune cell dynamics in humans". Nature 588: 303-307 (2020), the contents of which are incorporated herein by reference in their entirety. [Figure 9A] 9A-9B are heat maps showing comparison of metabolite profiles in different in vitro fermentation processes. Untargeted metabolomics (HPLC-MS analysis) for non-proposed fermentation strategies (1-3) were compared with unfermented raw material (Raw), unincubated raw material (Control), and the fermentation process used to make PB001. Shading indicates enrichment of metabolite concentrations (light grey: high, dark grey / black: low); two rows per sample category represent replicate measurements. [Figure 9B] See legend to Figure 9A. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0171] Detailed Description The present disclosure provides methods for preparing postbiotic compositions having unique and beneficial metabolite and secondary metabolite and organic acid levels and having unique and beneficial profiles thereof, and for providing a method for the preparation of postbiotic compositions having unique and beneficial profiles thereof in a subject, Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis or to treat or prevent the disruption of the gut microbiota associated with Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis The present invention provides a method for treating or preventing dysbiosis or dysbacteriosis in a subject undergoing probiotic therapy. Postbiotics are primary and secondary metabolites, membrane-bound or soluble molecular cue products, and secreted molecular cue products produced by probiotic microorganisms that affect the gut microbiome and its host.

[0172] According to at least one aspect of the present disclosure, the method and composition of the present disclosure are effective in protecting the gut microbiota from collateral destruction caused by oral antibiotics. As a result, the opportunity for resistant microorganisms or pathogens to expand in the gut is prevented, the dominance of antimicrobial resistance genes is reduced, and healthy diversity and levels of commensal bacteria are maintained. The postbiotic composition of the present disclosure that protects the gut microbiome can be prepared by a process using fermentation. Specifically, the composition of the present disclosure provides probiotics combined with fermented herbal substrates and compounds derived from microbial activity that protect, stimulate, and stabilize a healthy gut ecosystem, thereby supporting the gut's natural ability to protect and re-establish normal microbiome populations during and after antibiotic challenge. Higher gut microbiota diversity, maintaining diversity, and faster recovery to healthy microbiome population are markers of overall health and can help reduce the negative side effects of antibiotics and other drugs, such as yeast infection, acne, diarrhea, discomfort, and inflammation.It has been surprisingly discovered that fermentation produces a postbiotic composition with a unique metabolite profile.Specifically, fermentation produces a postbiotic composition with elevated beneficial metabolites, such as 3-hydroxybutyric acid, quercetin, furoinolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, organic acids, such as citric acid, succinic acid, lactic acid, glycerol, and acetic acid, and indole organic acids, and vitamin C.

[0173] As used herein, the term "postbiotic" or "postbiotics" is defined as the metabolites, secondary metabolites thereof, in secretion, in membrane proteins, in intracellular and / or extracellular components of a microbial community.

[0174] At least one aspect of the present disclosure provides a method for preparing a postbiotic composition.The method can include preparing a culture of a microorganism and a herb fermentation substrate composition as described herein, such as a herb fermentation substrate as described herein, and can also include a subsequent step of inoculating the herb substrate composition with a culture of a microorganism to produce an inoculum composition.The method can also include fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition.The fermented inoculum composition can be freeze-dried to obtain a postbiotic composition.

[0175] In some embodiments, the postbiotic composition may further comprise a carrier, e.g., a carrier suitable for spray drying and / or freeze drying (also referred to as lyophilization). In some embodiments, the carrier is a resistant starch (e.g., resistant starch). In some embodiments, the carrier comprises maltodextrin. In some embodiments, the carrier comprises resistant maltodextrin (e.g., FIBERSOL). In some embodiments, the carrier comprises at least one prebiotic fiber co-desiccant. The term "excipient" may be used interchangeably with the term "carrier."

[0176] The predetermined period of time may be as described herein above. In at least some examples, the microbial culture comprises at least one microorganism selected from the group consisting of Bifidobacterium and Lactobacillus. In some examples, the microbial culture comprises Bifidobacterium. In some examples, the microbial culture comprises Lactobacillus. The Bifidobacterium may be selected from the group consisting of B. lactis (also referred to as B. animalis subsp. lactis), B. breve, B. infantis, and any combination thereof. The Lactobacillus may be selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof.

[0177] In at least some aspects, the culture of the microorganism comprises at least about 1.0 x 10 8 CFU / mL ~ approx. 1 x 10 12 CFU / mL, or approximately 1.0 x 10 9 CFU / mL ~ approx. 1 x 10 11 CFU / mL, or approximately 1.0 x 10 9 CFU / mL ~ approx. 1 x 10 10 CFU / mL, or approximately 1.0 x 10 8 CFU / mL ~ approx. 1 x 10 11 In some embodiments, the postbiotic composition described herein is prepared by spray drying. In some embodiments, the bacterial content after spray drying is about 0 cfu / g. In some embodiments, the postbiotic composition described herein is prepared by freeze drying. In some embodiments, the bacterial content after freeze drying is up to about 10 10 cfu / g. The fermentation substrate composition may be as described herein above.

[0178] In some embodiments, the postbiotic composition comprises a nucleic acid comprising a sequence from a plant species and / or a bacterial species described herein. In some embodiments, the postbiotic composition comprises a nucleic acid comprising a sequence selected from any of the following bacterial species: B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. Such a nucleic acid may comprise DNA or RNA that indicates any one of those bacterial species. In some embodiments, the postbiotic composition comprises a nucleic acid comprising a sequence selected from any of the following plant genera or species: Astragalaceae, Solanaceae or Solanaceae, Sambucus L. genus, and / or Lens orientalis or Lens carinalis family. In some embodiments, the postbiotic composition comprises a nucleic acid comprising a sequence selected from any of the following plant genera or species: Astragalus membranaceus, Astragalus complanatus, ashwagandha (Withania somnifera species, Solanaceae family), elderberry (Sambucus nigra species), and / or red lentil (L. culinaris species or L. culinaris subsp. orientalis species). Such nucleic acid may comprise DNA or RNA that indicates any one of those plant genera or species.

[0179] In some embodiments, the plant is an Astragalus species, such as Astragalus membranaceus, or Astragalus complanatus (see, e.g., Accession No. NC_065024.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 18S sequence) comprising one of SEQ ID NOs: 53-54, or the plant comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 53-54 or a fragment thereof.

[0180] SEQ ID NO: 53 Astragalus complanatus 18S Accession No. NC_065024.1: TIFF2025504433000017.tif204160

[0181] SEQ ID NO: 54 KY316029.1 Astragalus membranaceus TIFF2025504433000018.tif77160

[0182] In some embodiments, the plant is a Withania species, such as Withania somnifera (see, e.g., Accession No. NC_047245.1). In some embodiments, the plant comprises a nucleic acid sequence (e.g., an 18S sequence) comprising one of SEQ ID NOs: 54-58, or the plant comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 54-58 or a fragment thereof.

[0183] SEQ ID NO: 55 Withania 18S, Accession No. NC_047245.1: TIFF2025504433000019.tif171160

[0184] SEQ ID NO: 56 Withania 18S, Accession No. NC_047245.1: TIFF2025504433000020.tif171160

[0185] SEQ ID NO: 57 Withania 18S, Accession No. NC_047245.1 TIFF2025504433000021.tif10158

[0186] SEQ ID NO: 58 Withania 18S, Accession No. NC_047245.1 TIFF2025504433000022.tif10163

[0187] SEQ ID NO: 59 Withania 18S, Accession No. NC_047245.1 TIFF2025504433000023.tif171160

[0188] In some embodiments, the postbiotic composition comprises at least one compound produced by any of the following plant genera or species: Astragalaceae, Solanaceae or Solanaceae, Sambucus L. genus, and / or Lens orientalis or Lens carinalis family. In some embodiments, the postbiotic composition comprises withanolides (e.g., withaferin A); withanolides may be produced by Ashwagandha root. In some embodiments, the postbiotic composition comprises at least one of the following compounds that may be produced by elderberry: anthocyanins (e.g., cyanidin-3-glucoside; e.g., measured using a pH differential method); anthocyanins (e.g., cyanidin-3-glucoside; e.g., measured using HPLC); polyphenols (e.g., catechins; e.g., measured using Folin-Ciocalteu reagent); and / or polyphenols (e.g., expressed as gallic acid equivalents; e.g., measured using Folin-Ciocalteu reagent).

[0189] In some embodiments, the microorganism is Bifidobacterium lactis (also referred to as Bifidobacterium animalis subsp. lactis), e.g., strain DSM 10140 (for an exemplary genome sequence of B. lactis, see, e.g., NCBI Reference Sequence: NC_012815.1). In some embodiments, the microorganism is B. lactis strain BLC1- (Centro sperimentale del Latte (CSL) / SACCO). In some embodiments, the microorganism is B. lactis strain PBP1418518. In some embodiments, the nucleic acid primers for 16S sequencing of B. lactis are In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) comprising one of SEQ ID NOs: 14-16, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 14-16 or a fragment thereof.

[0190] In some embodiments, the microorganism is Bifidobacterium breve, e.g., strain ATCC 15700 (for an exemplary genomic sequence of B. breve, see, e.g., Reference Sequence: NZ_CP006712.1). In some embodiments, the microorganism is B. breve strain Bbr8 (CSL / SACCO). In some embodiments, the microorganism is B. breve strain PBP2741300. In some embodiments, the nucleic acid primers for 16S sequencing of B. breve are In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) comprising one of SEQ ID NOs: 17-20, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 17-20 or a fragment thereof. For further non-limiting examples of Bifidobacterium-specific primers targeting the 16S rRNA gene, see, e.g., Matsuki et al., Appl Environ Microbiol. 2004 Jan; 70(1): 167-173, the contents of which are incorporated by reference in their entirety (see, e.g., Table 1 in Matsuki 2004).

[0191] In some embodiments, the microorganism is Bifidobacterium infantis (also referred to as Bifidobacterium longum subsp. infantis), e.g., strain ATCC 15697 (see, e.g., Reference Sequence: NC_015052.1 for an exemplary genomic sequence of B. infantis). In some embodiments, the microorganism is B. infantis strain SP 37 (CSL / SACCO). In some embodiments, the microorganism is B. infantis strain PBP234451. In some embodiments, the nucleic acid primers for 16S sequencing of B. infantis are TIFF2025504433000026.tif4170. In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) comprising one of SEQ ID NOs: 21-26, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 21-26 or a fragment thereof.

[0192] In some embodiments, the microorganism is Lactobacillus plantarum (also referred to as Lactiplantibacillus plantarum), e.g., Korean Agricultural Culture Collection (KACC) strain 11451 (for an exemplary genome sequence of L. plantarum, see, e.g., Reference Sequence: NZ_CP030105.1). In some embodiments, the nucleic acid primers for sequencing L. plantarum are TIFF2025504433000027.tif4170. In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) comprising one of SEQ ID NOs: 27-32, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 27-32 or a fragment thereof. For further non-limiting examples of Lactobacillus-specific primers targeting the 16S rRNA gene, see, e.g., Kim et al., BMC Microbiology Vol. 20, Paper No. 96 (2020), the entire contents of which are incorporated by reference herein (see, e.g., Table 1 in Kim 2020).

[0193] In some embodiments, the microorganism is Lactobacillus acidophilus, e.g., strain KACC 12419 (for an exemplary genomic sequence of L. acidophilus, see, e.g., Reference Sequence: NC_021181.2). In some embodiments, the nucleic acid primer for sequencing the 16S-23S region of L. acidophilus is TIFF2025504433000028.tif11170. In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) comprising one of SEQ ID NOs: 33-39, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 33-39 or a fragment thereof.

[0194] In some embodiments, the microorganism is Lactobacillus rhamnosus (also referred to as Lacticaseibacillus rhamnosus), e.g., Korean Collection for Type Cultures (KCTC) strain 3237 (for exemplary genomic sequences of L. rhamnosus, see, e.g., Reference Sequences: NZ_CP086326.1, NZ_LR134331.1, or ASM284801v1). In some embodiments, the microorganism is L. rhamnosus strain CRL1505 (CSL / SACCO). In some embodiments, the microorganism is L. rhamnosus strain PBP4542118. In some embodiments, the nucleic acid primers for sequencing the 16S-23S region of L. rhamnosus are In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) comprising one of SEQ ID NOs: 40-43, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 40-43 or a fragment thereof.

[0195] In some embodiments, the microorganism is Lactobacillus paracasei (also referred to as Lacticaseibacillus paracasei), e.g., strain KACC 12361 (see, e.g., Reference Sequence: NC_014334.2 for an exemplary genome sequence of L. paracasei). In some embodiments, the microorganism is strain IMC502 (CSL / SACCO) of L. paracasei. In some embodiments, the microorganism is strain PBP5197148 of L. paracasei. In some embodiments, the nucleic acid primers for sequencing L. paracasei are In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) comprising one of SEQ ID NOs: 45-48, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 45-48.

[0196] In some embodiments, the microorganism is Lactobacillus casei, e.g., strain BGP 93 (CSL / SACCO) (for exemplary genomic sequences of L. casei, see, e.g., reference sequences NZ_AP012544.1 or CP017065; see, e.g., Kang et al., Front Immunol. 2017; 8: 413, the contents of which are incorporated by reference herein in their entirety). In some embodiments, the microorganism is L. casei strain PBP4157051. In some embodiments, the microorganism is L. casei strain DSM 20011, strain JCM 1134, strain ATCC 393, or strain LC5. In some embodiments, the microorganism comprises a nucleic acid sequence (e.g., a 16S sequence) that includes one of SEQ ID NOs: 49-52, or the microorganism comprises a nucleic acid sequence that is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% or more identical to one of SEQ ID NOs: 49-52.

[0197] In some embodiments of any aspect, the bacterial strain is selected from Table 3. Although specific strains of bacteria are mentioned herein, it is intended to be performed in a similar manner with other strains of those species. As a non-limiting example, to determine whether a given strain of a species is effective, the given strain can be replaced with another strain of the same species in the fermentation process of the fermentation substrate composition to prepare the postbiotic composition. The postbiotic composition prepared with the replacement strain can be compared to the postbiotic composition prepared with the original strain to test its effectiveness. Non-limiting examples of effectiveness testing include cell or animal models or human clinical trials for diseases and disorders, such as dysbiosis, pharmaceutical or medical treatments that cause dysbiosis, antibiotic treatments, chemotherapy treatments, cancer immunotherapy, or intestinal mucositis.

[0198] Table 3: Exemplary strains of bacteria (GENBANK accession numbers and positions of sequences of genes of interest, e.g., 16S) TIFF2025504433000031.tif204167TIFF2025504433000032.tif249167TIFF2025504433000033.tif249167TIFF2025504433000034.t if249167TIFF2025504433000035.tif244167TIFF2025504433000036.tif249167TIFF2025504433000037.tif249167TIFF2025504433 000038.tif249167TIFF2025504433000039.tif249167TIFF2025504433000040.tif249167TIFF2025504433000041.tif249167TIFF20 25504433000042.tif249167TIFF2025504433000043.tif249167TIFF2025504433000044.tif249167TIFF2025504433000045.tif23167

[0199] Exemplary sequences of B. lactis SEQ ID NO: 14, B. lactis 16S, 1538 nucleotides (nt) TIFF2025504433000046.tif171160

[0200] SEQ ID NO: 15, B. lactis, Accession number: CP001853.168853.171909 Bifidobacterium; Bifidobacterium animalis subsp. lactis. Sequence: TIFF2025504433000047.tif17159TIFF2025504433000048.tif244160TIFF2025504433000049.tif90160

[0201] SEQ ID NO: 16, B. lactis, Accession number: CP001892.1476835.1479961 Bifidobacterium; Bifidobacterium animalis subsp. lactis. Sequence: TIFF2025504433000050.tif137159TIFF2025504433000051.tif224160

[0202] Exemplary sequences of B. breve SEQ ID NO: 17, B. breve 16S sequence, 1531 nt (see, e.g., NCBI reference numbers B7017_RS06345 or B7017_RS09250, 16S ribosomal RNA, Bifidobacterium breve JCM 7017, NCBI gene ID: 56564913 or 56565465) TIFF2025504433000052.tif171160

[0203] SEQ ID NO: 18, B. breve, Accession number: BCXW01000037.1900.4963 Bifidobacterium; Bifidobacterium breve. Sequence: TIFF2025504433000053.tif50160TIFF2025504433000054.tif244160TIFF2025504433000055.tif57160

[0204] SEQ ID NO: 19, B. breve, Accession number: CP021558.1782121.1785182 Bifidobacterium; Bifidobacterium breve. Sequence: TIFF2025504433000056.tif171160TIFF2025504433000057.tif184160

[0205] SEQ ID NO: 20, B. breve, Accession number: CP021388.2282979.2286039 Bifidobacterium; Bifidobacterium breve. Sequence: TIFF2025504433000058.tif43160TIFF2025504433000059.tif244160TIFF2025504433000060.tif64160

[0206] Exemplary sequences of B. infantis SEQ ID NO: 21, B. infantis 16S sequence, 1526 nt (see, e.g., NCBI gene ID: 66505550) TIFF2025504433000061.tif171160

[0207] SEQ ID NO: 22, B. infantis, Accession number: AP010889.2757707.2760771 Bifidobacterium; Bifidobacterium longum subsp. infantis. Sequence: TIFF2025504433000062.tif218160TIFF2025504433000063.tif137160

[0208] SEQ ID NO: 23, B. infantis, Accession number: AP010889.2751543.2754607 Bifidobacterium; Bifidobacterium longum subsp. infantis. Sequence: TIFF2025504433000064.tif90160TIFF2025504433000065.tif244160TIFF2025504433000066.tif17160

[0209] SEQ ID NO: 24, B. infantis, Accession number: CP001095.2539820.2542677 Bifidobacterium; Bifidobacterium longum subsp. infantis ATCC 15697 = JCM 1222 = DSM 20088. Sequence: TIFF2025504433000067.tif204160TIFF2025504433000068.tif151160

[0210] SEQ ID NO: 25, B. infantis, Accession number: BCYG01000038.1.1181 Bifidobacterium; Bifidobacterium longum subsp. infantis. Sequence: TIFF2025504433000069.tif137160

[0211] SEQ ID NO: 26, B. infantis, Accession number: BCYF01000054.143.3206 Bifidobacterium; Bifidobacterium longum subsp. infantis. Sequence: TIFF2025504433000070.tif171160TIFF2025504433000071.tif184160

[0212] Exemplary sequences of L. plantarum SEQ ID NO: 27, L. plantarum 16S sequence, 1474 nt (see, e.g., Lactobacillus plantarum strain NRRL B-14768 16S ribosomal RNA, partial sequence, NCBI reference sequence: NR_042394.1) TIFF2025504433000072.tif164159

[0213] SEQ ID NO: 28, L. plantarum, Accession number: CP026743.575947.578869 Lactiplantibacillus; Lactobacillus plantarum. Sequence: TIFF2025504433000073.tif97160TIFF2025504433000074.tif244160

[0214] SEQ ID NO: 29, L. plantarum, Accession number: CP020816.489843.492761 Lactiplantibacillus; Lactobacillus plantarum. Sequence: TIFF2025504433000075.tif231160TIFF2025504433000076.tif110160

[0215] SEQ ID NO: 30, L. plantarum, Accession number: CP025412.483014.485936 Lactiplantibacillus; Lactobacillus plantarum. Sequence: TIFF2025504433000077.tif117160TIFF2025504433000078.tif224160

[0216] SEQ ID NO: 31, L. plantarum, Accession number: CP029349.2063132.2066054 Lactibranchibacillus; Lactobacillus plantarum. Sequence: TIFF2025504433000079.tif3158TIFF2025504433000080.tif244160TIFF2025504433000081.tif90160

[0217] SEQ ID NO: 32, L. plantarum, Accession number: LUXF01000016.189.3109 Lactiplantibacillus; Lactobacillus plantarum. Sequence: TIFF2025504433000082.tif137160TIFF2025504433000083.tif204160

[0218] Exemplary sequences of L. acidophilus SEQ ID NO: 33, L. acidophilus 16S sequence, 1564 nt (see, e.g., NCBI reference number LA14_RS08025 16S ribosomal RNA Lactobacillus acidophilus La-14, NCBI gene ID: 56943192) TIFF2025504433000084.tif177160

[0219] SEQ ID NO: 34, L. acidophilus, Accession number: CP000033.60957.64007 Lactobacillus; Lactobacillus acidophilus. Sequence: TIFF2025504433000085.tif64159TIFF2025504433000086.tif244160TIFF2025504433000087.tif43160

[0220] SEQ ID NO: 35, L. acidophilus, Accession number: CP010432.436310.439215 Lactobacillus; Lactobacillus acidophilus. Sequence: TIFF2025504433000088.tif184159TIFF2025504433000089.tif151160

[0221] SEQ ID NO: 36, L. acidophilus, Accession number: LWSH01000065.1.1873 Lactobacillus; Lactobacillus acidophilus. Sequence: TIFF2025504433000090.tif218160

[0222] SEQ ID NO: 37, L. acidophilus, Accession number: CBLR010000038.101.3004 Lactobacillus; Lactobacillus acidophilus. Sequence: TIFF2025504433000091.tif90160TIFF2025504433000092.tif244160

[0223] SEQ ID NO: 38, L. acidophilus, Accession number: KC161284.1.671 Lactobacillus; Lactobacillus acidophilus. Sequence: TIFF2025504433000093.tif77159

[0224] SEQ ID NO: 39, L. acidophilus, Accession number: NXEY01000033.151.1480 Salmonella; Lactobacillus acidophilus. Sequence: TIFF2025504433000094.tif157160

[0225] Exemplary sequences of L. rhamnosus SEQ ID NO: 40, L. rhamnosus 16S sequence, 1521 nt (see, e.g., Lactobacillus rhamnosus strain JCM 1136 16S ribosomal RNA, partial sequence, NCBI reference sequence: NR_043408.1) TIFF2025504433000095.tif171160

[0226] SEQ ID NO: 41, L. rhamnosus, Accession number: JUPX01000234.110.2909 Lacticaseibacillus; Lactobacillus rhamnosus. Sequence: TIFF2025504433000096.tif17158TIFF2025504433000097.tif244160TIFF2025504433000098.tif57160

[0227] SEQ ID NO: 42, L. rhamnosus, Accession number: JTIN01000086.137.3056 Lacticaceibacillus; Lactobacillus rhamnosus. Sequence: TIFF2025504433000099.tif171160TIFF2025504433000100.tif171160

[0228] SEQ ID NO: 43, L. rhamnosus, Accession number: CP014201.1702655.1705574 Lacticaceae Bacillus; Lactobacillus rhamnosus. Sequence: TIFF2025504433000101.tif57160TIFF2025504433000102.tif244160TIFF2025504433000103.tif37158

[0229] SEQ ID NO: 44, L. rhamnosus, Accession number: AFYD01000005.110.1639 Lacticaceibacillus; Lactobacillus rhamnosus. Sequence: TIFF2025504433000104.tif177160

[0230] Exemplary sequences of L. paracasei SEQ ID NO: 45, L. paracasei 16S sequence, 1522 nt (see, e.g., Lactobacillus paracasei strain R094 16S ribosomal RNA gene, partial sequence, NCBI reference sequence: NR_025880.1). TIFF2025504433000105.tif171160

[0231] SEQ ID NO: 46, L. paracasei, Accession number: CP002391.1862810.1865725 Lacticaceae Bacillus; Lactobacillus paracasei. Sequence: TIFF2025504433000106.tif43159TIFF2025504433000107.tif244160TIFF2025504433000108.tif43160

[0232] SEQ ID NO: 47, L. paracasei, Accession number: CP016355.2612922.2615840 Lacticaceae Bacillus; Lactobacillus paracasei. Sequence: TIFF2025504433000109.tif184160TIFF2025504433000110.tif157160

[0233] SEQ ID NO: 48, L. paracasei, Accession number: ANKB01000105.125.3044 Lacticaceae Bacillus; Lactobacillus paracasei. Sequence: TIFF2025504433000111.tif70160TIFF2025504433000112.tif244160TIFF2025504433000113.tif23158

[0234] Exemplary sequences of L. casei SEQ ID NO: 49, L. casei 16S, Lacticaseibacillus casei DSM 20011 = JCM 1134 = ATCC 393 16S ribosomal RNA, partial sequence, 1517 nucleotides (nt) TIFF2025504433000114.tif177160

[0235] SEQ ID NO: 50, L. casei, Accession number: AB092640.223.705 Lacticaceae Bacillus; Lactobacillus casei. Sequence: TIFF2025504433000115.tif57160

[0236] SEQ ID NO: 51, L. casei, Accession number: AY221478.1.556 Lacticaceae Bacillus; Lactobacillus casei. Sequence: TIFF2025504433000116.tif64160

[0237] SEQ ID NO: 52, L. casei, Accession number: FM177140.909841.912756 Lacticaceae Bacillus; Lactobacillus casei. Sequence: TIFF2025504433000117.tif104160TIFF2025504433000118.tif231160

[0238] It has been surprisingly discovered that the postbiotic composition prepared by the method of the present disclosure has a unique metabolite profile and beneficial properties.In at least some examples, the postbiotic composition of the present disclosure has a metabolite profile that shows elevated levels or has one or more beneficial metabolites selected from the group consisting of 3-hydroxybutyric acid, quercetin, furoinolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, organic acids including citric acid, succinic acid, lactic acid, glycerol, and acetic acid, and indole organic acids, vitamin C, and any combination thereof.

[0239] Another aspect of the present disclosure provides an oral postbiotic formulation comprising the postbiotic composition of the present disclosure. The oral postbiotic formulation can be formulated as a tablet, pill, capsule, or microcapsule. In other examples, the oral postbiotic formulation can be formulated for buccal administration, sublabial administration, or sublingual administration. In yet other examples, the oral postbiotic formulation can be a liquid suspension. The oral postbiotic formulation can be useful for treating or preventing the disruption of gut microbiota associated with antibiotic treatment in a subject. The oral postbiotic formulation can also be useful for treating or preventing dysbiosis or dysbacteriosis associated with antibiotic treatment in a subject.

[0240] Another aspect of the present disclosure provides a method for treating or preventing the disruption of gut microbiota associated with antibiotic treatment in a subject.The method comprises administering to the subject a pharmacologic effective amount of any one of the postbiotic compositions or postbiotic formulations of the present disclosure prepared by the method and process of the present disclosure.Administering to the subject can include oral administration in the form of tablet, pill, capsule or microcapsule.Alternatively, administering to the subject can include oral administration in the form of buccal, sublabial or sublingual administration, or liquid suspension.

[0241] Another aspect of the present disclosure provides a method for treating or preventing dysbiosis or dysbacteriosis associated with antibiotic treatment in a subject.The method includes administering to the subject a pharmacologic effective amount of any one of the postbiotic compositions or postbiotic formulations of the present disclosure prepared by the method and process of the present disclosure.Administering to the subject can include oral administration in the form of a tablet, pill, capsule, or microcapsule.Alternatively, administering to the subject can include oral administration in the form of a buccal, sublabial, or sublingual administration, or liquid suspension.

[0242] Another aspect of the present disclosure provides a method for reducing or preventing antibiotic resistance in a subject undergoing antibiotic treatment.The method comprises administering to the subject a pharmacologic effective amount of any one of the postbiotic compositions or postbiotic formulations of the present disclosure prepared by the method and process of the present disclosure.Administering to the subject can include oral administration in the form of tablet, pill, capsule or microcapsule.Alternatively, administering to the subject can include oral administration in the form of buccal, sublabial or sublingual administration, or liquid suspension.

[0243] Another aspect of the present disclosure provides a combination therapy for reducing or preventing antimicrobial resistance in a subject while administering antibiotics to the subject in need thereof.The combination therapy may include administering a therapeutically effective amount of an antibiotic to the subject and administering a therapeutically effective amount of one of the postbiotic compositions or postbiotic formulations of the present disclosure prepared by the method and process of the present disclosure.Administering to the subject may include oral administration in the form of a tablet, pill, capsule, or microcapsule.Alternatively, administering to the subject may include oral administration in the form of buccal, sublabial, or sublingual administration, or liquid suspension.

[0244] cancer As used herein, the term "cancer" generally refers to a class of diseases or conditions in which abnormal cells divide uncontrollably and can invade nearby tissues. Cancer cells can also spread to other parts of the body through the blood and lymphatic system. There are several main types of cancer. Carcinoma is cancer that develops in the skin or in tissues that line or cover internal organs. Sarcoma is cancer that develops in bone, cartilage, fat, muscle, blood vessels, or other connective or supporting tissues. Leukemia is cancer that develops in blood-forming tissues, such as bone marrow, and causes the production of large numbers of abnormal blood cells and their entry into the blood. Lymphoma and multiple myeloma are cancers that develop in cells of the immune system. Central nervous system cancer is cancer that develops in tissues of the brain and spinal cord.

[0245] In some embodiments of any aspect, the cancer is a primary cancer. In some embodiments of any aspect, the cancer is a malignant cancer. As used herein, the term "malignant" refers to a cancer in which a group of tumor cells exhibit one or more of the following: uncontrolled proliferation (i.e., division beyond normal limits), invasion (i.e., invasion and destruction of adjacent tissues), and metastasis (i.e., spread to other locations in the body via lymph or blood). As used herein, the term "metastasizing" refers to the spread of cancer from one part of the body to another. A tumor formed by the spread cells is called a "metastatic tumor" or "metastasis". A metastatic tumor contains cells that resemble cells in the original tumor (primary tumor). As used herein, the term "benign" or "non-malignant" refers to a tumor that may grow larger but does not spread to other parts of the body. Benign tumors are self-limited and typically do not invade or metastasize.

[0246] "Cancer cell" or "tumor cell" refers to an individual cell of a cancerous growth or cancerous tissue. A tumor generally refers to a swelling or lesion formed by abnormal proliferation of cells, which may be benign, premalignant, or malignant. Most cancer cells form tumors, but some, such as leukemia, do not necessarily form tumors. With respect to those cancer cells that form tumors, the terms cancer (cancer cell) and tumor (tumor cell) are used interchangeably.

[0247] As used herein, the term "neoplasm" refers to any new and abnormal growth of tissue, for example, an abnormal mass of tissue whose growth exceeds and is uncoordinated with the growth of normal tissue. Thus, a neoplasm can be a benign neoplasm, a premalignant neoplasm, or a malignant neoplasm.

[0248] A subject with cancer or tumor is a subject with objectively measurable cancer cells present in the subject's body. The definition includes malignant and actively growing cancers, as well as potentially dormant tumors or micrometastases. Cancer that migrates from its original location and disseminates to other vital organs can ultimately cause the death of the subject by impairing the function of the affected organ.

[0249] In some embodiments of any aspect, the cancer is any cancer that can be treated with chemotherapy or immunotherapy. Examples of cancer include, but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, leukemia, basal cell carcinoma, biliary tract cancer; bladder cancer; bone cancer; brain and CNS cancer; breast cancer; peritoneal cancer; cervical cancer; choriocarcinoma; colorectal cancer; connective tissue cancer; digestive system cancer; endometrial cancer; esophageal cancer; eye cancer; head and neck cancer; gastric cancer (including gastrointestinal cancer); glioblastoma (GBM); liver cancer; hepatoma; intraepithelial neoplasia; kidney cancer. or renal cancer; laryngeal cancer; leukemia; liver cancer; lung cancer (e.g., small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma); lymphoma, including Hodgkin's lymphoma and non-Hodgkin's lymphoma; melanoma; myeloma; neuroblastoma; oral cancer (e.g., lip, tongue, mouth, and pharynx); ovarian cancer; pancreatic cancer; prostate cancer; retinoblastoma; rhabdomyosarcoma; rectal cancer; respiratory system cancer; salivary gland cancer; sarcoma; skin cancer; tonsillitis Squamous cell carcinoma; stomach cancer; testicular cancer; thyroid cancer; uterine or endometrial cancer; urinary system cancer; vulvar cancer; other carcinomas and other sarcomas; and B-cell lymphomas (low-grade / follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate-grade / follicular NHL; intermediate-grade diffuse NHL; high-grade immunoblastic NHL; high-grade lymphoblastic NHL; high-grade small noncleaved cell NHL; B-cell lymphomas (low-grade / follicular NHL; ... These include: Luke's syndrome; NHL; mantle cell lymphoma; AIDS-related lymphoma; and Waldenstrom's macroglobulinemia; chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); hairy cell leukemia; chronic myeloblastic leukemia; and post-transplant lymphoproliferative disorders (PTLD), as well as abnormal vascular proliferation associated with nevus syndrome, edema (e.g., associated with brain tumors), and Meigs syndrome.

[0250] A "cancer cell" is a cancerous, precancerous, or transformed cell, either in vivo, ex vivo, or in tissue culture, that has a spontaneous or induced phenotypic change, where the change does not necessarily involve the incorporation of new genetic material. Transformation can occur from infection with a transforming virus and integration of new genomic nucleic acid, or from the incorporation of foreign nucleic acid, but transformation can also occur spontaneously or after exposure to a carcinogen, thereby mutating endogenous genes. Transformation / cancer is associated, for example, with morphological changes, cellular immortalization, abnormal growth control, foci formation, anchorage independence, malignant potential, loss of contact inhibition of growth and loss of density limit of growth, growth factor or serum independence, tumor-specific markers, invasion or metastasis, and tumor growth in suitable animal hosts, such as nude mice.

[0251] In some embodiments of any aspect, the methods described herein can further include administering a cancer therapy, for example as part of a combinatorial therapy. Non-limiting examples of cancer therapies may be selected from the group consisting of: radiation therapy, surgery, gemcitabine, cisplatin, paclitaxel, carboplatin, bortezomib, AMG479, vorinostat, rituximab, temozolomide, rapamycin, ABT-737, PI-103; alkylating agents such as thiotepa and CYTOXAN® cyclophosphamide; alkylsulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; ethylenimines and methylmelamines including altretamine, triethylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimethylolmelamine; acetogenins (particularly bullatacin and bullatacinone); camptothecins (synthetic acetogens, such as acetogens, acetogens, and acetogens). topotecan, an analogue of the statin; bryostatin; kallistatin; CC-1065 (including its synthetic analogues adozelesin, carzelesin, and bizelesin); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatins; duocarmycins (including the synthetic analogues KW-2189 and CB1-TM1); eleutherobin; pancratistan; sarcodictiin; spongistatin; nitrogen Mustards, such as chlorambucil, chlornaphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, nobuenbiquine, phenesterine, prednimustine, trofosfamide, uracil mustard; nitrosoureas, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimustine;Antibiotics, such as enediyne antibiotics (e.g., the calicheamicins, particularly calicheamicin γ1I and calicheamicin ω11 (see, e.g., Agnew, Chem. Intl. Ed. Engl., 33: 183-186 (1994)); the dynemicins, including dynemicin A; bisphosphonates, such as clodronate; esperamicin; and neocarzinostatin chromophore and related chromoprotein enediyne antibiotic chromophores), aclacinomycin, actinomycin, autramycin, azaserine, bleomycin, cactinomycin, carabicin, caminomycin, ), carzinophilin, chromomycin, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, ADRIAMYCIN® doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcelomycin, mitomycins, such as mitomycin C, mycophenolic acid, Antibiotics such as nogalamycin, olivomycin, peplomycin, potfiromycin, puromycin, quelamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, zorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, methotrexate, purine analogues such as fludarabine, 6-mercaptopurine, thiamiprine, thioguanine; pyrimidine analogues such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, floxuridine; androgens such as calsterone, dromostanolone propionate, epithiostanol, mepitiostane, testolactone;Antiadrenal drugs such as aminoglutethimide, mitotane, trilostane; folic acid supplements such as florinic acid acid);aceglatone;aldophosphamide glycosides;aminolevulinic acid;eniluracil;amsacrine;bestrabucil;bisantrene;edatraxate;defofamine;demecolcine;diazicon;elformithine;elliptinium acetate;epothilone;etoglucide;gallium nitrate;hydroxyurea;lentinan;lonidainine;maytansinoids such as maytansine and ansamitocins;mitoguazone;mitoxantrone;mopidanmol;nitraerine;pentostatin;phenamet;pirarubicin;rosoxantrone;podophyllic acid;2-ethylhydrazide;procarbazine;PSK® polysaccharide complex (JHS Natural Products, Eugene, OR); razoxane; rhizoxin; sizofuran; spirogermanium; tenuazonic acid; triazicon; 2,2',2''-trichlorotriethylamine; trichothecenes (particularly T-2 toxin, verracurin A, roridin A, and anguidine); urethane; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; thiotepa; taxoids such as TAXOL® paclitaxel (Bristol-Myers Squibb Oncology, Princeton, NJ), ABRAXANE® Cremophor-free albumin engineered paclitaxel nanoparticle formulation (American Pharmaceutical Partners, Schaumburg, Illinois), and TAXOTERE® docetaxel (Rhone-Poulenc Rorer, Antony, France); chlorambucil; GEMZAR® gemcitabine; 6-thioguanine; mercaptopurine; methotrexate;Platinum analogs, such as cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; NAVELBINE® vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (Camptosar, CPT-11) (including treatment regimens with irinotecan with 5-FU and leucovorin); topoisomerase inhibitors RFS 2000; difluoromethylornithine (DMFO); retinoids, such as retinoic acid; capecitabine; combretastatin; leucovorin (LV); oxaliplatin, including oxaliplatin treatment regimens (FOLFOX); lapatinib (Tykerb®); PKC-alpha inhibitors, Raf inhibitors, H-Ras inhibitors, EGFR inhibitors (e.g. erlotinib (Tarceva®)), and VEGF-A inhibitors that reduce cell proliferation; and pharmaceutically acceptable salts, acids, or derivatives of any of the above.;

[0252] Those skilled in the art can readily identify chemotherapeutic agents to use (see, for example, "Physicians' Cancer Chemotherapy Drug Manual 2014", Edward Chu, Vincent T. DeVita Jr., Jones & Bartlett Learning; "Harrison's Principles of Internal Medicine", 18th Edition, Chapter 85, "Principles of Cancer Therapy"; "Abeloff's Clinical Oncology", 2013 Elsevier, Chapters 28-29, "Therapeutic Targeting of Cancer Cells: Era of Molecularly Targeted Agents" and "Cancer Pharmacology"; and Fischer DS (ed.): "The Cancer Chemotherapy Handbook", 4th Edition, St. Louis, Mosby-Year Book, 2003).

[0253] In addition, the treatment methods may further include the use of radiation or radiation therapy. Additionally, the treatment methods may further include the use of surgical procedures.

[0254] In some embodiments of any aspect, the methods described herein may further include administering an immune checkpoint inhibitor, e.g., as part of a combinatorial therapy. Non-limiting examples of immune checkpoint inhibitors (ICIs) include: pembrolizumab (Keytruda®), nivolumab (Opdivo®), cemiplimab (Libtayo®), spartalizumab, camrelizumab (AiRuiKa™), sintilimab (TYVYT®), tislelizumab, toripalimab (Tuoyi™), dostallimab (JEMPERLI), INCMGA000. 12, AMP-224, AMP-514 (MEDI0608), atezolizumab (Tecentriq®), avelumab (Bavencio®), embafolimab (KN035), cosibelimab (CK-301), AUNP12, CA-170, BMS-986189, BMS-936559 (MDX-1105), durvalumab (IMFINZI®), tremelimumab, and ipilimumab (Yervoy®). See, for example, U.S. Patent Nos. 5,811,097, 5,855,887, 6,051,227, 6,682,736, 6,984,720, 7,595,048, 7,605,238, 7,943,743, 8,008,449, 8,217,149, 8,354,509, 8,383,796, 8,728,474, 8,735,553, and 8,7791. Nos. 05, 8779108, 8907053, 8900587, 8952136, 9067999, 9073994, 9683048, 9987500, 10160736, 10316089, 10441655, 10590199, 11225522, U.S. Patent Application Publication No. 2014341917; Storz et al., MAbs. 2016 Jan; 8(1): 10-26; the contents of each of which are incorporated by reference herein in their entirety.

[0255] definition For convenience, the meanings of some terms and expressions used in the present specification, examples, and the appended claims are provided below. Unless otherwise specified or implied from the context, the following terms and expressions include the meanings provided below. The definitions are provided to assist in the description of certain embodiments, and are not intended to limit the invention described in the claims, since the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the present invention belongs. In the event of an apparent discrepancy between the usage of a term in the art and its definition provided herein, the definition provided herein shall prevail.

[0256] As used herein, the term "dysbiosis" (also referred to as "dysbacteriosis" or "disruption of gut microbiota") refers to the disruption of the homeostasis of the microflora caused by a disturbance in the balance of the microflora, by changes in their functional composition and metabolic activity, or by changes in their local distribution. The term is for a disturbance in the balance of microorganisms or for microbial maladaptation, such as a malfunctioning microbiota, on or in the body. For example, a part of the human microbiota, such as the skin flora, intestinal flora, or vaginal flora, may become perturbed, such that normally dominant species become minority, and normally outcompeted or suppressed species increase to fill the space. Dysbiosis is most commonly reported as a pathology in the gastrointestinal tract, but it applies to other niches as well. As a non-limiting example, dysbiosis can be: Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis It can be caused by.

[0257] The terms "reduce", "reduced", "reduction" or "inhibit" are all used herein to mean a statistically significant amount of reduction.In some embodiments, "reduce", "reduction" or "reduce" or "inhibit" typically means at least 10% reduction compared to reference level (e.g., in the absence of a given treatment or a given agent), and can include, for example, at least about 10% reduction, at least about 20% reduction, at least about 25% reduction, at least about 30% reduction, at least about 35% reduction, at least about 40% reduction, at least about 45% reduction, at least about 50% reduction, at least about 55% reduction, at least about 60% reduction, at least about 65% reduction, at least about 70% reduction, at least about 75% reduction, at least about 80% reduction, at least about 85% reduction, at least about 90% reduction, at least about 95% reduction, at least about 98% reduction, at least about 99% reduction, or further reduction. As used herein, "reduction" or "inhibition" does not include complete inhibition or reduction when compared to a reference level. "Complete inhibition" is 100% inhibition compared to a reference level. The reduction can be preferably down to a level that is accepted as being within the normal range, for example, to a level that is accepted for an individual without a given disorder.

[0258] The terms "increased", "increase", "enhance", or "activate" are all used herein to mean a statically significant amount of increase. In some embodiments, the terms "increased", "increase", "enhance", or "activate" can mean an increase of at least 10% compared to a reference level, for example, an increase of at least about 20%, or an increase of at least about 30%, or an increase of at least about 40%, or an increase of at least about 50%, or an increase of at least about 60%, or an increase of at least about 70%, or an increase of at least about 80%, or an increase of at least about 90%, or an increase of 100% or less, or any increase between 10-100%, or the terms can mean an increase of at least about 2-fold, or an increase of at least about 3-fold, or an increase of at least about 4-fold, or an increase of at least about 5-fold, or an increase of at least about 10-fold, or any increase between 2-fold and 10-fold or more compared to a reference level. In the context of a marker or condition, an "increase" is a statistically significant increase in their levels.

[0259] As used herein, "subject" refers to a human or animal. In general, an animal is a vertebrate, such as a primate, rodent, domestic animal, or game animal. Primates include chimpanzees, cynomolgus monkeys, spider monkeys, and macaques, such as rhesus monkeys. Rodents include mice, rats, woodchucks, ferrets, rabbits, and hamsters. Domestic and game animals include cattle, horses, pigs, deer, bison, buffalo, feline species, such as domestic cats, canine species, such as dogs, foxes, wolves, bird species, such as chickens, emus, ostriches, and fish, such as trout, catfish, and salmon. In some embodiments, the subject is a mammal, such as a primate, such as a human. The terms "individual," "patient," and "subject" are used interchangeably herein.

[0260] Preferably, the subject is a mammal. The mammal may be, but is not limited to, a human, a non-human primate, a mouse, a rat, a dog, a cat, a horse, or a cow. A non-human mammal may be advantageously used as a subject to be an animal model of dysbiosis (e.g., dysbiosis after antibiotic treatment, chemotherapy treatment, or administration of a drug or medical treatment that causes dysbiosis). The subject may be male or female.

[0261] The subject may be a subject who has been previously diagnosed or confirmed to suffer from or have a condition requiring treatment (e.g., dysbiosis) or one or more complications related to such a condition, and optionally the subject has already undergone treatment for dysbiosis or one or more complications related to dysbiosis. Alternatively, the subject may also be a subject who has not previously been diagnosed as having dysbiosis or one or more complications related to dysbiosis. For example, the subject may be a subject who exhibits one or more risk factors for dysbiosis or one or more risk factors for one or more complications related to dysbiosis, or the subject may be a subject who does not exhibit risk factors. In some embodiments of any aspect, the subject is immunocompromised, for example, an immunocompromised resulting from a medical treatment such as chemotherapy or immunotherapy.

[0262] A "subject in need" of treatment for a particular condition can be a subject who has the condition, a subject who has been diagnosed with the condition, or a subject who is at risk of developing the condition.

[0263] A variant amino acid sequence or a variant DNA sequence may be at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more identical to a native or reference sequence. The degree of homology (percent identity) between a native sequence and a variant sequence can be determined, for example, by comparing the two sequences using freely available computer programs (e.g., BLASTp or BLASTn using default settings) that are commonly used for this purpose on the World Wide Web.

[0264] A variant amino acid sequence may be at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more similar to a natural or reference sequence. As used herein, "similarity" refers to identical or conservatively substituted amino acids as described herein. Thus, the percentage of "sequence similarity" is the percentage of amino acids that are either identical or conservatively changed; for example, "sequence similarity" = (% sequence identity) + (% conservative change). It should be understood that a sequence with a certain percentage similarity to a reference sequence necessarily includes a sequence with the same specific percentage identity to the reference sequence. Those skilled in the art will be aware of the various computer programs available for determining the identity or homology between two sequences, which use different mathematical algorithms. For example, it is possible to use computer programs utilizing the Needleman and Wunsch algorithm (Needleman et al. (1970)); the GAP program in the Accelrys GCG software package (Accelerys Inc., San Diego, USA); the E. Meyers and W. Miller algorithm (Meyers et al. (1989)), which is incorporated into the ALIGN program (version 2.0); or, more preferably, BLAST (Basic Local Alignment Tool using default parameters); see, for example, U.S. Pat. No. 10,023,890, the contents of which are incorporated herein by reference in their entirety.

[0265] In some embodiments, the sequencing includes 16S rRNA gene sequencing, which may also be referred to as "16S ribosomal RNA sequencing", "16S rDNA sequencing", or "16s rRNA sequencing". The 16S rRNA gene is highly conserved among various species of bacteria, but is absent in eukaryotic species, and thus sequencing of the gene can be used for genetic studies. In addition to highly conserved regions, the 16S rRNA gene also contains nine hypervariable regions (V1-V9) that vary between species. 16S rRNA gene sequencing, as described herein, typically involves using multiple universal primers that bind to conserved regions of the 16S rRNA gene, PCR amplifying regions of the bacterial 16S rRNA gene (including hypervariable regions), and sequencing the amplified 16S rRNA gene using next-generation sequencing techniques (see, e.g., U.S. Pat. Nos. 5,654,418; 6,344,316; and 8,889,358; and U.S. Patent Application Publication Nos. 2013 / 0157265 and 2018 / 0195111, which are incorporated by reference in their entireties).

[0266] As used herein, the terms "treat", "treatment", "treating" or "amelioration" refer to therapeutic treatments whose purpose is to reverse, alleviate, improve, inhibit, slow or stop the progression or severity of a condition associated with a disease or disorder, such as a condition associated with dysbiosis. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with dysbiosis. A treatment is generally "effective" if one or more symptoms or one or more clinical markers are reduced. Alternatively, a treatment is "effective" if the progression of the disease is reduced or stopped. That is, "treatment" includes not only the improvement of symptoms or markers, but also the halting or at least slowing of the progression or worsening of symptoms compared to what would be expected in the absence of treatment. Beneficial or desired clinical results, whether detectable or undetectable, include, but are not limited to, alleviation of one or more symptoms, reduction in the extent of the disease, stabilization of the disease state (i.e., not worsening), delay or slowing of the progression of the disease, improvement or mitigation of the disease state, remission (whether partial or complete), and / or reduction in mortality. The term "treatment" of a disease also includes providing relief from the symptoms of the disease or side effects of the disease (including palliative treatment).

[0267] As used herein, the term "pharmaceutical composition" refers to an active agent combined with a pharmaceutically acceptable carrier, which is, for example, a carrier commonly used in the pharmaceutical industry. The term "pharmaceutically acceptable" is used herein to refer to a compound, material, composition, and / or dosage form that is, within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio, and suitable for use in contact with human and animal tissues without excessive toxicity, irritation, allergic response, or other problems or complications. In some embodiments of any aspect, the pharmaceutically acceptable carrier can be a carrier other than water. In some embodiments of any aspect, the pharmaceutically acceptable carrier can be a cream, emulsion, gel, liposome, nanoparticle, and / or ointment. In some embodiments of any aspect, the pharmaceutically acceptable carrier can be an artificial or engineered carrier, which is, for example, a carrier in which the active ingredient would not be found to occur in nature.

[0268] As used herein, the term "administration" refers to placing the compounds disclosed herein into a subject by a method or route that causes at least partial delivery of the agent to a desired site. The pharmaceutical compositions comprising the compounds disclosed herein can be administered by any suitable route that results in effective treatment in the subject. In some embodiments, administration includes human physical activity, such as injection, ingesting, applying, and / or operating a delivery device or delivery instrument. Such activity can be performed, for example, by a medical professional and / or by the subject receiving treatment.

[0269] As used herein, "contact" refers to any suitable means for delivering or exposing an agent to at least one cell.Exemplary delivery methods include, but are not limited to, direct delivery into cell culture medium, transfection, transduction, perfusion, injection, or other delivery methods known to those skilled in the art.In some embodiments, contact includes human physical activity, such as injection; dispensing, mixing, and / or decanting; and / or operating a delivery device or delivery equipment.

[0270] In some embodiments of any aspect, the cells (e.g., bacterial cells) can be maintained in culture. As used herein, "maintaining" refers to sustaining the viability of a cell or a cell population. A maintained cell population has at least a subpopulation of metabolically active cells.

[0271] The terms "statistically significant" or "significantly" refer to statistical significance, and generally mean a difference of 2 standard deviations (2 SD) or greater.

[0272] Except where otherwise specified in the operating examples, all numerical values ​​expressing amounts of ingredients or reaction conditions used herein should be understood to be modified in all contexts by the term "about." When used in reference to percentages, the term "about" can mean ±1%.

[0273] As used herein, the term "comprises" means that in addition to the defined elements that are present, other elements may also be present. The use of "comprises" indicates inclusion rather than limitation.

[0274] The term "consisting of" refers to compositions, methods, and individual components thereof described herein, excluding any element not recited in the description of that embodiment.

[0275] As used herein, the term "consisting essentially of" refers to those elements necessary for a given embodiment. The term permits the presence of additional elements that are characteristic of that embodiment of the invention and do not materially affect the basic and novel or functional characteristics.

[0276] The singular terms "a," "an," and "the" include plural referents unless the context clearly indicates otherwise. Similarly, the word "or" is intended to include "and" unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The abbreviation "eg" is derived from the Latin "exempli gratia," and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg" is synonymous with the term "for example."

[0277] Grouping of optional elements or aspects of the invention disclosed herein should not be interpreted as limiting. Each member of a group can be referred to and claimed individually, or each member of a group can be referred to and claimed in any combination with other members of the group or with other elements found herein. One or more of the members of a group may be included in or deleted from a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is deemed to include the modified group, and thus the specification fulfills the description for all Markush groups used in the appended claims.

[0278] Unless otherwise defined herein, scientific and technical terms used in connection with this application shall have the meanings commonly understood by those skilled in the art to which this disclosure belongs. It should be understood that the present invention is not limited to the specific methodology, specific protocols, and specific reagents, etc. described herein, and may vary accordingly. The terms used herein are for the purpose of describing specific embodiments only, and are not intended to limit the scope of the present invention, which is defined only by the claims. Definitions of common terms in cell biology, immunology, and molecular biology can be found in: "The Merck Manual of Diagnosis and Therapy" 20th Edition, published by Merck Sharp & Dohme Corp., 2018 (ISBN 0911910190, 978-0911910421); Robert S. Porter et al. (eds.) "The Encyclopedia of Molecular Cell Biology and Molecular Medicine", published by Blackwell Science Ltd., 1999-2012 (ISBN 9783527600908); and Robert A. Meyers (ed.) "Molecular Biology and Biotechnology: a Comprehensive Desk Reference", published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8); "Immunology" Werner Luttmann, published by Elsevier, 2006; "Janeway's Immunobiology", Kenneth Murphy, Allan Mowat, Casey Weaver (eds.) WWNorton & Company, 2016 (ISBN 0815345054, 978-0815345053);"Lewin's Genes XI", published by Jones & Bartlett Publishers, 2014 (ISBN-1449659055);Michael Richard Green and Joseph Sambrook, "Molecular Cloning: A Laboratory Manual" 4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) (ISBN 1936113414);Davis et al., "Basic Methods in Molecular Biology", Elsevier Science Publishing, Inc., New York, USA (2012) (ISBN 044460149X);"Laboratory Methods in Enzymology: DNA", Jon Lorsch(ed.) Elsevier, 2013 (ISBN 0124199542); "Current Protocols in Molecular Biology" (CPMB), Frederick M. Ausubel (ed.) John Wiley and Sons, 2014 (ISBN 047150338X, 9780471503385); "Current Protocols in Protein Science" (CPPS), John E. Coligan (ed.) John Wiley and Sons, Inc., 2005; and "Current Protocols in Immunology" (CPI) (John E. Coligan, ADA M Kruisbeek, David H Margulies, Ethan M Shevach, Warren Strobe (eds.) John Wiley and Sons, Inc., 2003 (ISBN 0471142735, 9780471142737), the contents of all of which are incorporated herein by reference in their entireties.

[0279] Other terms are defined herein within the descriptions of various aspects of the invention.

[0280] All patents and other publications cited throughout this application, including literature references, issued patents, published patent applications, and co-pending patent applications, are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that may be used in connection with the technology described herein. These publications are merely provided for their disclosure prior to the filing date of this application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by reason of prior invention or for any other reason. Any statements about the dates of these documents or descriptions of the contents of these documents are based on the information available to the applicants and are not intended to constitute any admission as to the accuracy of the dates or contents of these documents.

[0281] The description of the aspects of the present disclosure is not intended to be exhaustive or to limit the present disclosure to the precise form disclosed. Although certain aspects and examples of the present disclosure are described herein for illustrative purposes, those skilled in the relevant art will recognize that various equivalent modifications are possible within the scope of the present disclosure. For example, while steps or functions of a method are presented in a given order, in alternative embodiments, the functions may be performed in a different order or substantially simultaneously. The teachings of the disclosure provided herein can be applied to other procedures or other methods as appropriate. The various aspects described herein can be combined to provide further aspects. If necessary, aspects of the present disclosure can be modified using the compositions, functions, and concepts of the above references and applications to provide still further aspects of the present disclosure. These and other modifications can be made to the present disclosure in light of the detailed description. All such modifications are intended to be encompassed within the scope of the appended claims.

[0282] Certain elements of any of the above-described aspects may be combined with or substituted for elements in other aspects. Additionally, although advantages associated with certain aspects of the disclosure are described in the context of those aspects, other aspects may also have such advantages, and not all aspects need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0283] Some aspects of the technology described herein may be defined by any of the following numbered paragraphs: 1. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: A herbal ingredient comprising at least one of herbs from the Astragalus family, herbs from the Solanaceae or nightshade family, berries from the Sambucus L. genus, and beans from the Lens orientalis or Lens culinaris families, Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 2. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: A herbal ingredient including herbs of the Solanaceae or Solanaceae family and berries of the genus Sambucus L. Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 3. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: Herbal ingredients include ashwagandha root and elderberry. Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 4. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: A herbal ingredient including herbs of the Solanaceae or Solanaceae family and berries of the genus Sambucus L. at least one Bifidobacterium species and at least one Lactobacillus species, and Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 5. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: Herbal ingredients include ashwagandha root and elderberry. at least one Bifidobacterium species and at least one Lactobacillus species, and Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 6. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: A herbal ingredient including herbs of the Solanaceae or Solanaceae family and berries of the genus Sambucus L. At least two of B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei, and Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 7. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: Herbal ingredients include ashwagandha root and elderberry. At least two of B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei, and Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 8. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: A herbal ingredient including herbs of the Solanaceae or Solanaceae family and berries of the genus Sambucus L. B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, as well as Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 9. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: Herbal ingredients include ashwagandha root and elderberry. B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei, as well as Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 10. The fermentation substrate of any one of the preceding paragraphs, further comprising one or more of glucose, sucrose, fructose, honey, and molasses. 11. The fermentation substrate of any one of the preceding paragraphs, wherein the herbal ingredients are provided as a dry powder prior to being combined with water. 12. A fermentation substrate according to any one of the preceding paragraphs, comprising an herb from the Astragalaceae family and an herb from the Solanaceae family or the Solanaceae family. 13. A fermentation substrate according to any one of the preceding paragraphs, comprising herbs of the Astragalaceae family and berries of the genus Sambucus L. 14. A fermentation substrate according to any one of the preceding paragraphs, comprising an herb of the Astragalaceae family and a legume of the Lens orientalis family or Lens carinalis family. 15. A fermentation substrate according to any one of the preceding paragraphs, comprising herbs of the Astragalaceae family, herbs of the Solanaceae family or the Solanaceae family, and berries of the genus Sambucus L. 16. A fermentation substrate of any one of the preceding paragraphs comprising an herb of the Astragalaceae family, an herb of the Solanaceae family or Solanaceae family, and a legume of the Lens orientalis family or Lens carinalis family. 17. A fermentation substrate of any one of the preceding paragraphs comprising herbs of the Astragalaceae family, berries of the genus Sambucus L., and legumes of the families Lens orientalisaceae or Lens carinalisaceae. 18. A fermentation substrate according to any one of the preceding paragraphs, comprising herbs of the Solanaceae or Solanaceae families and berries of the genus Sambucus L. 19. A fermentation substrate of any one of the preceding paragraphs comprising an herb of the Solanaceae or Solanaceae family and a legume of the Lens orientalis family or Lens carinalis family. 20. A fermentation substrate according to any one of the preceding paragraphs, comprising herbs of the Solanaceae or Solanaceae families, berries of the Sambucus L. genus, and legumes of the Lens orientalis family or Lens carinalis family. 21. A fermentation substrate according to any one of the preceding paragraphs, comprising berries of the genus Sambucus L. and legumes of the family Lens orientalis or Lens carinalis. 22. A fermentation substrate of any one of the preceding paragraphs, comprising herbs of the Astragalaceae family, herbs of the Solanaceae family or Solanaceae family, berries of the genus Sambucus L., and legumes of the Lens orientalis family or Lens carinalis family. 23. The fermentation substrate of any one of the preceding paragraphs, wherein the herb of the Astragalaceae family is the root of Astragalus membranaceus. 24. The fermentation substrate of any one of the preceding paragraphs, wherein the herb of the Solanaceae or Solanaceae family is Ashwagandha root. 25. The fermentation substrate of any one of the preceding paragraphs, wherein the berry of the genus Sambucus L. is an elderberry. 26. The fermentation substrate of any one of the preceding paragraphs, wherein the legume of the family Lens orientalis or Lens carinalis is lentil. 27. The fermentation substrate of any one of the preceding paragraphs, wherein the legumes are red lentils. 28. A fermentation substrate composition for use in a fermentation process for preparing a postbiotic composition, the fermentation substrate comprising: At least one herbal ingredient selected from Astragalus membranaceus root, Ashwagandha, Elderberry, and Red Lentil, Sufficient liquid water to suspend or immerse the herbal material in combination with said fermentation substrate composition. 29. The fermentation substrate of any one of the preceding paragraphs, further comprising one or more of glucose, sucrose, fructose, honey, and molasses. 30. The fermentation substrate of any one of the preceding paragraphs, wherein the herbal ingredients are provided as a dry powder prior to being combined with water. 31. A fermented substrate of any one of the preceding paragraphs comprising Astragalus membranaceus root and Ashwagandha. 32. A fermentation substrate according to any one of the preceding paragraphs, comprising Astragalus membranaceus root and elderberry. 33. A fermentation substrate according to any one of the preceding paragraphs, comprising Astragalus membranaceus root and red lentils. 34. A fermentation substrate of any one of the preceding paragraphs comprising ashwagandha and elderberry. 35. The fermentation substrate of any one of the preceding paragraphs, comprising elderberries and red lentils. 36. A fermented substrate of any one of the preceding paragraphs comprising Astragalus membranaceus root, ashwagandha, and elderberry. 37. A fermented substrate of any one of the preceding paragraphs comprising Astragalus membranaceus root, Ashwagandha, and red lentils. 38. A fermentation substrate according to any one of the preceding paragraphs, comprising Astragalus membranaceus root, elderberries and red lentils. 39. A fermented substrate of any one of the preceding paragraphs comprising Astragalus membranaceus root, ashwagandha, elderberry, and red lentil. 40. A fermentation substrate according to any one of the preceding paragraphs, comprising between about 2% by weight and about 10% by weight of Astragalus membranaceus root. 41. A fermentation substrate according to any one of the preceding paragraphs, comprising from about 2% by weight to about 10% by weight of ashwagandha. 42. A fermentation substrate according to any one of the preceding paragraphs, comprising between about 2% by weight and about 10% by weight of elderberries. 43. A fermentation substrate according to any one of the preceding paragraphs, comprising between about 0.5% by weight and about 3% by weight of red lentils. 44. A fermentation substrate according to any one of the preceding paragraphs, comprising between about 2% by weight and about 10% by weight of glucose, sucrose, fructose, honey, or molasses. 45. A fermentation substrate according to any one of the preceding paragraphs, comprising between about 70% by weight and about 95% by weight water. 46. ​​A fermentation substrate of any one of the preceding paragraphs, comprising about 2.5% by weight to about 5% by weight of astragalus, about 2.5% by weight to about 5% by weight of ashwagandha, about 2.5% by weight to about 5% by weight of elderberry, about 2.5% by weight to about 5% by weight of sucrose or molasses, and about 80% by weight to about 90% by weight of water. 47. A fermentation substrate of any one of the preceding paragraphs, comprising about 2.5% by weight to about 5% by weight of astragalus, about 2.5% by weight to about 5% by weight of ashwagandha, about 2.5% by weight to about 5% by weight of elderberry, about 0.5% by weight to about 1.5% by weight of red lentils, about 2.5% by weight to about 5% by weight of sucrose or molasses, and about 80% by weight to about 90% by weight of water. 48. The fermentation substrate of any one of the preceding paragraphs, further comprising at least one Bifidobacterium species and at least one Lactobacillus species. 49. The fermentation substrate of any one of the preceding paragraphs, wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. 50. The fermentation substrate of any one of the preceding paragraphs, wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof. 51. A fermentation substrate according to any one of the preceding paragraphs, comprising at least two of B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei. 52. A postbiotic composition prepared by a process comprising: (a) preparing a culture of a microorganism; (b) preparing a fermentation substrate composition according to any one of the preceding paragraphs; (c) inoculating the fermentation substrate composition with a culture of a microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain a postbiotic composition. 53. The postbiotic composition of any one of the preceding paragraphs, further comprising a carrier. 54. The postbiotic composition of any one of the preceding paragraphs, wherein the carrier is resistant starch or maltodextrin. 55. The postbiotic composition of any one of the preceding paragraphs, wherein the predetermined period of time for fermentation is from about 24 hours to about 10 days. 56. The postbiotic composition of any one of the preceding paragraphs, wherein the microbial culture comprises at least one Bifidobacterium species and at least one Lactobacillus species. 57. The postbiotic composition of any one of the preceding paragraphs, wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. 58. The postbiotic composition of any one of the preceding paragraphs, wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof. 59. The culture of the microorganism is about 1.0 x 10 8 CFU / mL ~ approx. 1 x 10 12 The postbiotic composition of any one of the preceding paragraphs, comprising a microbial concentration in CFU / mL. 60. The postbiotic composition of any one of the preceding paragraphs, wherein the step of fermenting the inoculum composition comprises sealing the inoculum composition in a fermentation vat under substantially anaerobic conditions. 61. The postbiotic composition of any one of the preceding paragraphs, wherein the step of fermenting the inoculum composition further comprises incubating the inoculum composition at a temperature of about 33°C to about 40°C. 62. The postbiotic composition of any one of the preceding paragraphs, wherein the step of fermenting the inoculum composition further comprises purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained at ≦1.5%. 63. The postbiotic composition of any one of the preceding paragraphs, wherein the inoculum composition is maintained at a pH of about 5.0 to about 8.0. 64. The final bacterial content after fermentation is approximately 1.0 x 10 8 ~Approx. 1 x 10 11 The postbiotic composition of any one of the preceding paragraphs, wherein the 65. Bacterial content after drying is about 0 cfu / g to about 10 x 10 10 The postbiotic composition of any one of the preceding paragraphs, wherein the cfu / g. 66. The postbiotic composition of any one of the preceding paragraphs, wherein the bacterial content after spray drying is about 0 cfu / g. 67. The bacterial content after freeze-drying is up to about 10 10 The postbiotic composition of any one of the preceding paragraphs, wherein the cfu / g. 68. The postbiotic composition of any one of the preceding paragraphs, comprising at least one metabolite selected from Table 2. 69. The postbiotic composition of any one of the preceding paragraphs, comprising at least one metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, indole organic acids, or any combination thereof. 70. The postbiotic composition of any one of the preceding paragraphs, comprising each of 3-hydroxybutyric acid, quercetin, fleionolic acid, wedelolactone, luteolin, and N-[(2S)-2-hydroxypropanoyl]-L-leucine, and an indole organic acid. 71. The postbiotic composition of any one of the preceding paragraphs, comprising one or more organic acids produced by fermentation, the one or more organic acids being selected from citric acid, succinic acid, lactic acid, glycerol, and acetic acid. 72. The postbiotic composition of any one of the preceding paragraphs, comprising each of citric acid, succinic acid, lactic acid, glycerol, and acetic acid. 73. The postbiotic composition of any one of the preceding paragraphs, comprising a nucleic acid comprising a sequence selected from B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei. 74. B. lactis: TIFF2025504433000119.tif4128, B. breve: TIFF2025504433000120.tif4128, B. breve: TIFF2025504433000121.tif4128, B. infantis: TIFF2025504433000122.tif4128, B. infantis: TIFF2025504433000123.tif4128, L. plantarum: TIFF2025504433000124.tif4128, L. plantarum: TIFF2025504433000125.tif4128, L. acidophilus: TIFF2025504433000126.tif4128, L. acidophilus: TIFF2025504433000127.tif4128, L. rhamnosus: TIFF2025504433000128.tif4128, L. rhamnosus: TIFF2025504433000129.tif4128, L. paracasei: TIFF2025504433000130.tif4128, or L. paracasei: The postbiotic composition of any one of the preceding paragraphs, comprising a nucleic acid molecule capable of hybridizing to a primer sequence selected from TIFF2025504433000131.tif4128. 75. A postbiotic composition comprising 3-hydroxybutyric acid, quercetin, fleionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, and an indole organic acid. 76. The postbiotic composition of any one of the preceding paragraphs, further comprising bacteria of the genera Bifidobacterium and Lactobacillus. 77. The postbiotic composition of any one of the preceding paragraphs, further comprising a 16S RNA having a nucleic acid sequence at least 90% identical to one of SEQ ID NOs: 14-16 (B. lactis), SEQ ID NOs: 17-20 (B. breve), SEQ ID NOs: 21-26 (B. infantis), SEQ ID NOs: 27-32 (L. plantarum), SEQ ID NOs: 33-39 (L. acidophilus), SEQ ID NOs: 40-44 (L. rhamnosus), SEQ ID NOs: 45-48 (L. paracasei), or SEQ ID NOs: 49-52 (L. casei). 78. The postbiotic composition of any one of the preceding paragraphs, further comprising one or more organic acids selected from citric acid, succinic acid, lactic acid, glycerol, and acetic acid. 79. The postbiotic composition of any one of the preceding paragraphs, comprising each of citric acid, succinic acid, lactic acid, glycerol, and acetic acid. 80. A composition for oral delivery comprising the postbiotic composition of any one of the preceding paragraphs, formulated for oral delivery. 81. The composition of any one of the preceding paragraphs formulated as a tablet, pill, capsule, or microcapsule. 82. The composition of any one of the preceding paragraphs, wherein the formulation comprises a liquid suspension. 83. A pharmaceutical composition comprising any one of the compositions of the preceding paragraphs and a pharma- ceutically acceptable carrier. 84. In the subject, Antibiotic treatment, chemotherapy treatment, or Administration of medicines or medical procedures that cause dysbiosis 1. A method for treating or preventing gut microbiota disruption associated with administering to the subject an amount of a composition according to any one of the preceding paragraphs effective to treat or prevent said disruption. The method. 85. The method of any one of the preceding paragraphs, wherein the medical treatment comprises cancer immunotherapy. 86. The method of any one of the preceding paragraphs, wherein the cancer immunotherapy includes immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy, CAR-T therapy, dendritic cell vaccine, or any other approach that enhances or activates immune cell responses against cancer. 87. The method of any one of the preceding paragraphs, wherein the medical treatment comprises vaccination. 88. The method of any one of the preceding paragraphs, wherein the medical treatment includes treatment with a drug that causes dysbiosis. 89. The method of any one of the preceding paragraphs, wherein the drug that causes dysbiosis is selected from the group consisting of acid blocking drugs, proton pump inhibitors (PPIs), H2 blockers, contraception, steroids, antipsychotics, opioids, metformin, SSRIs, nonsteroidal anti-inflammatory drugs (NSAIDs), and any combination thereof. 90. A method of treating cancer, comprising administering to a subject in need thereof a cancer immunotherapy and administering a composition of any one of the preceding paragraphs, wherein the administering is effective to treat the cancer. 91. A method of treating cancer, comprising administering to a subject in need thereof a CAR-T therapy and administering a composition of any one of the preceding paragraphs, wherein the administering is effective to treat the cancer. 92. A method of treating cancer, comprising administering to a subject in need thereof chemotherapy and administering a composition of any one of the preceding paragraphs, wherein the administering step is effective to treat the cancer. 93. A method of treating an infection comprising administering to a subject in need thereof at least one antibiotic and administering a composition of any one of the preceding paragraphs, wherein the administering step is effective to treat the infection. 94. A method for increasing neutrophil engraftment, comprising administering to a subject in need thereof an effective amount of the composition of any one of the preceding paragraphs. 95. A method for treating or preventing chemotherapy-associated intestinal mucositis, comprising administering to a subject in need thereof chemotherapy and administering a composition according to any one of the preceding paragraphs, wherein the administering step is effective to treat the intestinal mucositis. 96. The step of administering the composition results in the following outcomes, as compared to a negative control, e.g., a subject not receiving the composition, or a treated subject prior to receiving the composition: Decreased cancer recurrence rate (e.g., recurrence-free); increased cancer survival; decreased time to neutrophil engraftment; improved peripheral blood mononuclear cell recovery trajectory (e.g., higher peripheral blood mononuclear cell counts); decreased incidence of febrile neutropenia; decreased incidence of bloodstream infections; and / or decreased 30-day readmission events. Any one of the methods in the preceding paragraphs, accompanied by at least one of the following: 97. The method of any one of the preceding paragraphs, wherein administering the composition in combination with chemotherapy is accompanied by an improvement in intestinal mucositis associated with the chemotherapy, as compared to a negative control, e.g., a subject not administered the composition, or a treated subject prior to administration of the composition. 98. A method for preparing a postbiotic composition, comprising the steps of: (a) preparing a culture of a microorganism; (b) preparing a fermentation substrate composition according to any one of the preceding paragraphs; (c) inoculating the fermentation substrate composition with a culture of the microorganism to produce an inoculum composition; and (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition. 99. The method of any one of the preceding paragraphs, wherein the predetermined period of time is from about 24 hours to about 10 days. 100. The method of any one of the preceding paragraphs, wherein the microbial culture comprises at least one Bifidobacterium species and at least one Lactobacillus species. 101. The method of any one of the preceding paragraphs, wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof. 102. The method of any one of the preceding paragraphs, wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof. 103. The culture of the microorganism is about 1.0 x 10 8 CFU / mL ~ approx. 1 x 10 12 The method of any one of the preceding paragraphs, including a microbial concentration in CFU / mL. 104. The method of any one of the preceding paragraphs, wherein the step of fermenting the inoculum composition comprises sealing the inoculum composition in a fermentation vat under substantially anaerobic conditions. 105. The method of any one of the preceding paragraphs, wherein the step of fermenting the inoculum composition includes purging the fermentation vat with nitrogen gas such that the percentage of oxygen in the fermentation vat is maintained at ≦1.5%. 106. The method of any one of the preceding paragraphs, wherein the step of fermenting the inoculum composition includes incubating the inoculum composition at a temperature of about 33°C to about 40°C. 107. The method of any one of the preceding paragraphs, wherein the step of fermenting the inoculum composition includes maintaining a pH of the fermentation in the range of about 5.0 to about 7.5. 108. The method of any one of the preceding paragraphs, further comprising freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition. 109. The method of any one of the preceding paragraphs, further comprising the step of formulating the postbiotic composition for oral delivery. 110. The method of any one of the preceding paragraphs, further comprising formulating the postbiotic composition as a tablet, pill, capsule, or microcapsule. 111. The method of any one of the preceding paragraphs, further comprising formulating the postbiotic composition in a liquid suspension. 112. A pharmaceutical composition comprising a composition prepared by the method of any one of the preceding paragraphs and a pharma- ceutically acceptable carrier. 113. A method of treating cancer, comprising administering to a subject in need thereof at least one cancer treatment and a postbiotic composition; the administering step is effective to treat said cancer; The method, wherein the postbiotic composition is prepared by a process comprising the steps of: (a) preparing a culture of microorganisms including B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei; (b) herbal ingredients including ashwagandha root and elderberry; Sufficient liquid water to suspend or immerse the herbal material preparing a fermentation substrate composition comprising in combination with (c) inoculating the fermentation substrate composition with a culture of the microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain a postbiotic composition.

[0284] The technology described herein is further illustrated by the following examples, which should in no way be construed as further limiting. EXAMPLES

[0285] Example 1 – Preparation of Bifidobacterium cultures 1 L flasks were washed with detergent and rinsed with hot water and sterilized. 500 mL of MRS broth was prepared and stirred without autoclaving. 500 mL aliquots of MRS broth were inoculated with Bifidobacterium culture powder containing B. lactis, B. breve, and B. infantis to achieve a target concentration of 1.00E+10 CFU / mL.

[0286] Example 2 – Preparation of Lactobacillus cultures 1 L flasks were washed with detergent and rinsed with hot water and sterilized. 500 mL of MRS broth was prepared and stirred without autoclaving. 500 mL aliquots of MRS broth were inoculated with Lactobacillus culture powders including L. plantarum, L. acidophilus, L. rhamnosus, and L. paracasei to achieve a target concentration of 1.00E+10 CFU / mL.

[0287] Example 3 – Preparation of Herbal Matrix Composition The blender was cleaned with detergent, rinsed with hot water, and sterilized. The ingredients of the herbal matrix listed in Table 4 were added to the blender and blended until smooth. The pH of the herbal matrix composition was adjusted to 6.5 with 1 M NaOH.

[0288] Table 4. Ingredients of herbal matrix TIFF2025504433000132.tif70147

[0289] Another formulation may include the following mixed with water: Ashwagandha powder, 3.5% by weight; Elderberry powder, 3.5% by weight; Sucrose, 3.5% by weight. The term "Withania somnifera extract" may be used interchangeably with the terms "Ashwagandha" or "Ashwagandha powder." In some embodiments of any aspect, the elderberry powder includes an extract of elderberry juice. In some embodiments, the formulation may include the following mixed with water: Withania somnifera extract, 3.5% by weight; Elderberry juice extract, 3.5% by weight; Sucrose, 3.5% by weight.

[0290] Example 4 - Fermentation process for preparing a postbiotic composition An example of fermentation to produce a postbiotic composition is described below. The fermentation vat was washed with detergent, rinsed with hot water, and sterilized. The herbal matrix composition was transferred to the fermentation vat. The vat containing the herbal matrix composition was inoculated with the Bifidobacterium culture of Example 1 (starting concentration was 3.00E+10 CFU / mL for Bifidobacterium) and the Lactobacillus culture of Example 2 (starting concentration was 4.00E+10 CFU / mL for Lactobacillus) by pipette. The target concentration was 2.00E+06 CFU / mL. During fermentation, the fermentation vat was sealed and purged with nitrogen gas (99.99% purity) to achieve an oxygen concentration of ≦1%. The fermentation vat was incubated at 37° C. The pH of the fermentation was adjusted to 6.5 with 1 M NaOH, if necessary. On the fifth day, the fermented composition was freeze-dried to produce the postbiotic composition.

[0291] Example 5 – Clinical Efficacy of Postbiotic Compositions Thirty-two patients were enrolled in a randomized placebo-controlled study. The patients were treated with oral antibiotics at a medical institution for non-gut-related conditions (e.g., ear infections). After providing informed consent, each patient received a conventional probiotic composition and took their antibiotics with either: (1) placebo control, or (2) the postbiotic composition described herein. Three stool samples were collected for each patient, one on the last day of the antibiotic period to evaluate the primary endpoint of the study, and two more at later time points to obtain additional data. The 16S rRNA gene sequencing data of gut microbiota was analyzed using pre-specified analyses and statistics.

[0292] As shown in FIG. 1, the results of the randomized placebo-controlled study showed that the microbial diversity in the gut microbiota of patients receiving the composition of the present disclosure was significantly higher after antibiotic treatment compared to the placebo control. In particular, as shown in FIG. 2, a higher relative abundance of microbial families associated with good health was observed, and a decrease in potentially pathogenic dysbiosis-related microbial families was also observed compared to the control arm. The patient's microbiome was measured during the final day and after the patient's antibiotic period, as this is when antibiotic-induced microbiota damage is expected to be at its maximum. At the end of the antibiotic period, diversity was maintained by administration of the composition of the present disclosure. Furthermore, in the absence of administration of the composition of the present disclosure, the control arm remained inferior until 10 days after antibiotic administration.

[0293] As shown in FIG. 3, administration of the probiotic composition of the present disclosure prevented damage to the diversity of the microbiota after the antibiotic period, resulting in a significantly higher average diversity (>40% diversity) than the conventional probiotic composition. As shown in FIG. 4, administration of the postbiotic composition of the present disclosure also showed a higher retention of bacteria associated with good health, such as Firmicutes, and also prevented an increase in potentially pathogenic bacteria, such as Proteobacteria. As a result, the postbiotic composition of the present disclosure can be effective in protecting the gut microbiota during antibiotic administration and can prevent antibiotic-induced secondary dysbiosis of the gut microbiota. Thus, the postbiotic composition and method of the present disclosure can be useful in reducing antibiotic resistance genes, preventing common side effects of antibiotic treatment, including diarrhea, and preventing secondary infections, especially in vulnerable populations.

[0294] Example 6 - Exemplary Protocols for Preparing and Testing Postbiotic Compositions for Use in Cancer Therapy The postbiotic composition can be prepared according to Examples 1-4. For example, the bacteria B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and L. casei can be used to ferment a fermentation substrate composition including ashwagandha root and elderberry (e.g., elderberry juice). In some embodiments, the formulation can include the following mixed with water: Withania somnifera extract, 3.5% by weight; elderberry juice extract, 3.5% by weight; sucrose, 3.5% by weight.

[0295] The postbiotic composition prepared from the exemplary fermentation described above, or a placebo, can be administered to a cancer patient, as shown in Figure 5. Instead of or in addition to the antibiotic treatment shown in Figure 5, the cancer patient can be administered at least one cancer treatment, such as at least one cancer immunotherapy (e.g., immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy, CAR-T therapy, dendritic cell vaccine, or any other approach that promotes or activates immune cell responses to cancer), or at least one chemotherapy. It is contemplated herein that the patient can be administered both at least one cancer treatment (e.g., chemotherapy, cancer immunotherapy) and at least one antibiotic. A clinician or oncologist of ordinary skill can select and administer the appropriate cancer therapy or the appropriate cancer therapies for a given cancer of the patient. A range of such cancer treatments tend to have a negative impact on the gut microbiome and / or gut barrier function, and therefore patients undergoing these treatments may benefit from treatment with postbiotics as described herein that help maintain and / or restore the microbiome and barrier function. A clinician or oncologist of ordinary skill will know whether a given cancer treatment approach has a negative impact on the gut microbiome, its function, or gut barrier function.

[0296] The postbiotic composition described herein has been shown to increase the family of bacteria associated with good health in the microbiome.Without wishing to be bound by theory, it is contemplated herein that administering postbiotics to cancer patients in combination with cancer therapy will increase the family of bacteria associated with good health in the microbiome when compared to placebo and cancer treatment, resulting in better immunotherapy outcomes and more rapid immune recovery, such as results similar to those shown in Figures 1-4 and / or 6-9.

[0297] It is contemplated herein that administration of a postbiotic composition in combination with a cancer treatment will be associated with at least one of the following outcomes when compared to a negative control, e.g., a subject receiving a placebo, a subject not receiving the composition, or a subject being treated prior to receiving the postbiotic composition: reduced cancer recurrence rate (e.g., no recurrence); increased survival from cancer; reduced time to neutrophil engraftment; improved peripheral blood mononuclear cell recovery trajectory (e.g., higher peripheral blood mononuclear cell counts); reduced incidence of febrile neutropenia; reduced incidence of bloodstream infections; and / or reduced 30-day readmission events.

[0298] In some embodiments of any aspect, administration of the postbiotic composition in combination with chemotherapy is associated with an improvement in intestinal mucositis (e.g., a decrease in intestinal mucositis) associated with chemotherapy, as compared to a negative control, e.g., a subject receiving a placebo, a subject not receiving the composition, or a treated subject prior to administration of the postbiotic composition.

[0299] It is contemplated herein that administration of a postbiotic composition in combination with a cancer treatment is associated with increased efficacy of the cancer treatment as compared to subjects receiving a placebo and the cancer treatment.

Claims

1. 1. A postbiotic composition for use in a method of treating or preventing disruption of the gut microbiota associated with the administration of antibiotic treatment, chemotherapy treatment, or a pharmaceutical or medical treatment that causes dysbiosis in a subject, comprising: The method includes administering to the subject an amount of a postbiotic composition effective to treat or prevent the disruption; The postbiotic composition is prepared by a process comprising: (a) preparing a culture of a microorganism; (b) preparing a fermentation substrate composition comprising herbal raw materials, including herbs of the Solanaceae or Solanaceae family and berries of the genus Sambucus L., in combination with sufficient liquid water to suspend or soak the herbal raw materials; (c) inoculating the fermentation substrate composition with a culture of a microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition. The postbiotic composition.

2. 2. The postbiotic composition for use according to claim 1, wherein the medical treatment comprises cancer immunotherapy, vaccination, or a drug that causes dysbiosis, and optionally the cancer immunotherapy comprises immune checkpoint modulator / inhibitor therapy, hematopoietic cell transplantation therapy, CAR-T therapy, dendritic cell vaccine, or any other approach that promotes or activates immune cell responses against cancer, and optionally the drug that causes dysbiosis is selected from the group consisting of acid blocking drugs, proton pump inhibitors (PPIs), H2 blockers, contraception, steroids, antipsychotics, opioids, metformin, SSRIs, nonsteroidal anti-inflammatory drugs (NSAIDs), and any combination thereof.

3. 1. A postbiotic composition for use in a method for treating cancer, the method comprising administering to a subject in need thereof cancer immunotherapy, CAR-T therapy, or chemotherapy, and administering a postbiotic composition, wherein the administering step is effective to treat the cancer, the postbiotic composition having been prepared by a process comprising: (a) preparing a culture of a microbial organism; (b) preparing a fermentation substrate composition comprising herbal ingredients, including herbs of the Solanaceae family or Solanaceae family and berries of the genus Sambucus L., in combination with sufficient liquid water to suspend or soak the herbal ingredients; (c) inoculating the fermentation substrate composition with a culture of the microbial organism to produce an inoculum composition; (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition.

4. 1. A postbiotic composition for use in a method for treating an infection, the method comprising administering at least one antibiotic and administering a postbiotic composition to a subject in need thereof, wherein the administering step is effective to treat the infection, the postbiotic composition having been prepared by a process comprising: (a) preparing a culture of a microorganism; (b) preparing a fermentation substrate composition comprising herbal raw materials comprising an herb of the Solanaceae family or Solanaceae family and a berry of the genus Sambucus L., in combination with sufficient liquid water to suspend or soak the herbal raw materials; (c) inoculating the fermentation substrate composition with a culture of the microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition.

5. 1. A postbiotic composition for use in a method for increasing neutrophil engraftment, the method comprising administering an effective amount of the postbiotic composition to a subject in need thereof, the postbiotic composition having been prepared by a process comprising: (a) preparing a culture of a microorganism; (b) preparing a fermentation substrate composition comprising herbal raw materials, the herb comprising a Solanaceae or Solanaceae herb and a berry of the genus Sambucus L., in combination with sufficient liquid water to suspend or soak the herbal raw materials; (c) inoculating the fermentation substrate composition with the culture of the microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition.

6. 1. A postbiotic composition for use in a method for treating or preventing chemotherapy-associated intestinal mucositis, the method comprising administering chemotherapy to a subject in need thereof and administering a postbiotic composition, wherein the administering step is effective to treat the intestinal mucositis, the postbiotic composition having been prepared by a process comprising: (a) preparing a culture of a microbial organism; (b) preparing a fermentation substrate composition comprising herbal ingredients comprising herbs of the Solanaceae family or Solanaceae family and berries of the genus Sambucus L., combined with sufficient liquid water to suspend or soak the herbal ingredients; (c) inoculating the fermentation substrate composition with a culture of the microbial organism to produce an inoculum composition; (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain the postbiotic composition.

7. Administering the postbiotic composition increases the following outcomes when compared to a negative control, e.g., a subject not receiving the composition, or a treated subject prior to receiving the composition: Decreased cancer recurrence rate (e.g., recurrence-free); increased cancer survival; decreased time to neutrophil engraftment; improved peripheral blood mononuclear cell recovery trajectory (e.g., higher peripheral blood mononuclear cell count); decreased incidence of febrile neutropenia; decreased incidence of bloodstream infections; and / or decreased 30-day readmission events. or administering the composition in combination with chemotherapy is accompanied by an improvement in intestinal mucositis associated with the chemotherapy as compared to a negative control, e.g., a subject not receiving the composition, or a treated subject prior to receiving the composition; A postbiotic composition for use according to any one of claims 1 to 6.

8. The fermentation substrate comprises herbs of the Astragalaceae family, herbs of the Solanaceae or Solanaceae family, and berries of the genus Sambucus L.; the fermentation substrate further comprises one or more of glucose, sucrose, fructose, honey, and molasses; The herbal ingredients are provided as dry powders before being combined with water; Ashwagandha root is an herb from the Solanum family or Nightshade family; The berry of the genus Sambucus L. is an elderberry; or The herb of the Astragalaceae family is the root of Astragalus membranaceus. A postbiotic composition for use according to any one of claims 1 to 6.

9. The fermentation substrate is Approximately 2% by weight to approximately 10% by weight of Ashwagandha; Approximately 2% by weight to approximately 10% by weight of elderberry; about 2% by weight to about 10% by weight of glucose, sucrose, fructose, honey, or molasses; or Approximately 70% to 95% water by weight A postbiotic composition for use according to any one of claims 1 to 6, comprising:

10. 7. The postbiotic composition for use according to any one of claims 1 to 6, wherein the microbial culture comprises at least one Bifidobacterium species and at least one Lactobacillus species, optionally wherein the Bifidobacterium is selected from the group consisting of B. lactis, B. breve, B. infantis, and any combination thereof; and optionally wherein the Lactobacillus is selected from the group consisting of L. plantarum, L. acidophilus, L. rhamnosus, L. paracasei, L. casei, and any combination thereof; and optionally wherein the microbial culture comprises a microbial concentration of from about 1.0 x 10 CFU / mL to about 1 x 10 CFU / mL.

11. fermenting the inoculum composition sealing the inoculum composition in a fermentation vat under substantially anaerobic conditions; purging the fermentation vat with nitrogen gas so that the percentage of oxygen in the fermentation vat is maintained at ≦1.5%; incubating the inoculum composition at a temperature of about 33°C to about 40°C; and / or Maintaining the pH of the fermentation in the range of about 5.0 to about 7.5 Contains, or the predetermined period of time is from about 24 hours to about 10 days; A postbiotic composition for use according to any one of claims 1 to 6.

12. formulating said postbiotic composition for oral delivery; formulating the postbiotic composition as a tablet, pill, capsule, or microcapsule; and / or formulating said postbiotic composition in a liquid suspension or the postbiotic composition further comprises a carrier, optionally the carrier is resistant starch or maltodextrin; A postbiotic composition for use according to any one of claims 1 to 6.

13. The postbiotic composition of claim 12, wherein the final bacterial content after fermentation is about 1.0 x 108 to about 1 x 1011 cfu / ml; the bacterial content after drying is about 0 cfu / g to about 10 x 1010 cfu / g; the bacterial content after spray drying is about 0 cfu / g; or the bacterial content after freeze-drying is up to about 1010 cfu / g.

14. At least one metabolite selected from Table 2; at least one metabolite selected from the group consisting of 3-hydroxybutyric acid, quercetin, phloionolic acid, wedelolactone, luteolin, N-[(2S)-2-hydroxypropanoyl]-L-leucine, indole organic acids, or any combination thereof; 3-hydroxybutyric acid, quercetin, fleionolic acid, wedelolactone, luteolin, and N-[(2S)-2-hydroxypropanoyl]-L-leucine, and indole organic acids, respectively; one or more organic acids produced by fermentation, the one or more organic acids being selected from citric acid, succinic acid, lactic acid, glycerol, and acetic acid; each of citric acid, succinic acid, lactic acid, glycerol, and acetic acid; a nucleic acid comprising a sequence selected from B. lactis, B. breve, B. infantis, L. plantarum, L. acidophilus, L. rhamnosus, L. casei, and / or L. paracasei; A nucleic acid molecule capable of hybridizing to a primer sequence selected from: B. lactis: TGGAGGGTTCGATTCTGGCTCAGGATGAACGCTG (SEQ ID NO: 1), B. Breve: CCGGATGCTCCATCACAC (SEQ ID NO: 2), B. Breve: ACAAAGTGCCTTGCTCCCT (SEQ ID NO: 3), B. infantis: TTCCAGTTGATCGCATGGTC (SEQ ID NO: 4), B. infantis: GGAAACCCCATCTCTGGGAT (SEQ ID NO: 5), L. plantarum: GCTGGCAATGCCATCGTGCT (SEQ ID NO: 6), L. plantarum: TCTCAACGGTTGCTGTATCG (SEQ ID NO: 7), L. acidophilus: CCTTTCTAAGGAAGCGAAGGAT (SEQ ID NO: 8), L. acidophilus: ACGCTTGGTATTCCAAATCGC (SEQ ID NO: 9), L. rhamnosus: GCCGATCGTTGACGTTAGTTGG (SEQ ID NO: 10), L. rhamnosus: CAGCGGTTATGCGATGCGAAT (SEQ ID NO: 11), L. paracasei: CAATGCCGTGGTTGTTGGAA (SEQ ID NO: 12), or L. paracasei: GCCAATCACCGCATTAATCG (SEQ ID NO: 13); Bacteria of the genera Bifidobacterium and Lactobacillus; or a 16S RNA having a nucleic acid sequence that is at least 90% identical to one of SEQ ID NOs: 14-16 (B. lactis), SEQ ID NOs: 17-20 (B. breve), SEQ ID NOs: 21-26 (B. infantis), SEQ ID NOs: 27-32 (L. plantarum), SEQ ID NOs: 33-39 (L. acidophilus), SEQ ID NOs: 40-44 (L. rhamnosus), SEQ ID NOs: 45-48 (L. paracasei), or SEQ ID NOs: 49-52 (L. casei); A postbiotic composition for use according to any one of claims 1 to 6, comprising:

15. 1. A postbiotic composition for use in a method of treating cancer, the method comprising administering to a subject in need thereof at least one cancer treatment and administering a postbiotic composition; the administering step is effective to treat said cancer; The postbiotic composition, wherein the postbiotic composition is prepared by a process comprising the steps of: (a) preparing a culture of microorganisms including B. lactis, B. infantis, B. breve, L. paracasei, L. rhamnosus, and / or L. casei; (b) preparing a fermented substrate composition comprising herbal ingredients including ashwagandha root and elderberry in combination with sufficient liquid water to suspend or soak the herbal ingredients; (c) inoculating the fermentation substrate composition with a culture of the microorganism to produce an inoculum composition; (d) fermenting the inoculum composition for a predetermined period of time to produce a fermented inoculum composition; and (e) freeze-drying or spray-drying the fermented inoculum composition to obtain a postbiotic composition.