Modified cells and uses thereof

Abstract

The disclosure provides modified immune cells, proteins encoding PD-L1 variants, and polynucleotides encoding PD-L1 variants, as well as pharmaceutical compositions comprising same and methods for treating diseases.

Description

[Technical field]

[0001] The present invention relates to modified cells (eg, modified immune cells), pharmaceutical compositions thereof, and methods of using such to prevent and / or treat disease. [Background technology]

[0002] Autologous, patient-derived chimeric antigen receptor T cell (CAR-T) therapy has shown remarkable efficacy in the treatment of some cancers (e.g., hematological cancers). However, autologous CAR-T therapy poses manufacturing challenges and financial burdens due to the need for personalized therapy. Therefore, there has been interest in allogeneic CAR-T therapy, which uses allogeneic or "off-the-shelf" T cells and has a similar clinical efficacy profile to autologous products. Summary of the Invention [Problem to be solved by the invention]

[0003] Although allogeneic CAR-T therapy may reduce the cost of production and lot-to-lot variability, allogeneic immune cells are prone to recognition and rejection by the host immune system, thus compromising the therapeutic efficacy of CAR-T cells. Furthermore, allogeneic CAR-T therapy may further suffer from immunosuppression, which may reduce the effector function and cytotoxicity of CAR-T cells. Therefore, there is a need for novel adaptive cell therapy with increased effector function and reduced immunogenicity. [Means for solving the problem]

[0004] In one aspect, the disclosure provides modified cells or populations thereof, where the modified cells are deficient in an endogenous inhibitory checkpoint molecule relative to an unmodified corresponding cell and have been engineered to express a ligand of the deficient endogenous inhibitory checkpoint molecule, in certain embodiments, the ligand is a mutant of the cognate ligand and is characterized by a reduced ability to induce immune inhibitory signaling relative to the cognate ligand.

[0005] In one aspect, the disclosure provides modified cells or populations thereof, wherein the modified cells are engineered to express a ligand of an inhibitory checkpoint molecule, the ligand being a mutant of the cognate ligand and characterized by a reduced ability to induce immune inhibitory signaling compared to the cognate ligand, hi certain embodiments, the cells are defective in the inhibitory checkpoint molecule corresponding to the ligand.

[0006] In some embodiments, the cells are: a) animal or human cells, b) immune cells, c) stem cells or cells differentiated from stem cells, d) suitable for transplantation, e) allogeneic with respect to the intended recipient of the cells, or f) any combination thereof.

[0007] In some embodiments, the cell is: a) an immune cell, the immune cell being a T cell, a natural killer (NK) cell, a NKT cell, a B cell, a macrophage cell, a tumor infiltrating lymphocyte, a monocyte, a dendritic cell (DC cell), a neutrophil, or a γδ T cell; or b) the cell is a stem cell, or a cell differentiated from a stem cell, the stem cell being a hematopoietic progenitor cell (e.g., a T cell progenitor, a NK cell progenitor, a macrophage progenitor), a hematopoietic stem cell (HSC), a CD34+ cell, a cell line of embryonic stem cells, a mesenchymal stem cell, or an iPSC cell. In such embodiments, the T cell is selected from the group consisting of a CD4+ T cell, a CD8+ T cell, a cytotoxic T cell, an end effector T cell, a memory T cell, a naive T cell, a regulatory T cell, a natural killer T cell, a γδ T cell, a cytokine-induced killer (CIK) T cell, and a tumor infiltrating lymphocyte, and is optionally an activated T cell.

[0008] In some embodiments, a) the inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329); and / or b) the ligand is PD-L1, PD- Selected from the group consisting of L2, HMGB1, Ceacam-1, phosphatidylserine (PS), LSECtin, a-synuclein, FGL1, adenosine, HVEM (herpes virus entry mediator), CD28, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), MHC class I, sialoglycoprotein, CD112, CD113, galectin 9, CD24, and CD47.

[0009] In some embodiments, a) the inhibitory checkpoint molecule is PD-1 and the ligand comprises at least one of PD-L1 or a variant thereof, or PD-L2 or a functional equivalent thereof; b) the inhibitory checkpoint molecule is TIM3 and the ligand comprises at least one of galectin-9, HMGB1, Ceacam-1, or phosphatidylserine (PS), or a functional equivalent thereof; c) the inhibitory checkpoint molecule is LAG-3 and the ligand comprises at least one of galectin-3, LSECtin, a-synuclein, or FGL1, or a functional equivalent thereof; d) the inhibitory checkpoint molecule is TIGIT and the ligand comprises at least one of CD155, CD113, or CD112, or a functional equivalent thereof; e) the inhibitory checkpoint molecule is adenosine A2A receptor (A2AR) and the ligand comprises adenosine; and f) the inhibitory checkpoint molecule is BTLA. and the ligand comprises HVEM (herpes virus entry mediator) or a functional equivalent thereof; g) the inhibitory checkpoint molecule is CTLA-4 and the ligand comprises CD28 or a functional equivalent thereof; h) the inhibitory checkpoint molecule is a killer cell immunoglobulin-like receptor (KIR) and the ligand comprises an MHC class I molecule (e.g., other than HLA-A, HLA-B) or a functional equivalent thereof; i) the inhibitory checkpoint molecule is VISTA (V domain Ig suppressor of T cell activation) and the ligand comprises at least one of PD-L1 or PD-L2, or a functional equivalent thereof; j) the inhibitory checkpoint molecule is SIGLEC-7 (sialic acid-binding immunoglobulin-type lectin 7, CD328) and the ligand comprises a sialoglycoprotein or a functional equivalent thereof; or k) the inhibitory checkpoint molecule is SIGLEC-9 (CD329) and the ligand comprises a sialoglycoprotein or a functional equivalent thereof.

[0010] In some embodiments, a) the cell is a T cell and the inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329); and b) the cell is a natural killer (NK) cell and the inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329). c) the cell is a dendritic cell (DC cell) and the inhibitory checkpoint molecule is selected from the group consisting of A2AR, CD47, IDO1, IDO2, and TDO; or d) the cell is a macrophage and the inhibitory checkpoint molecule is selected from the group consisting of A2AR, CD47, IDO1, IDO2, and CD24.

[0011] In some embodiments, the variant lacks a functional immune inhibitory signaling domain of the cognate ligand. In some embodiments, the variant comprises at least one mutation that reduces the ability of the cognate ligand to induce immune inhibitory signaling. In some embodiments, the at least one mutation comprises a substitution, a deletion, an insertion, or any combination thereof. In some embodiments, the at least one mutation comprises a deletion of at least one amino acid residue. In some embodiments, the cognate ligand comprises an extracellular domain, a transmembrane domain, and an intracellular domain. In some embodiments, the at least one mutation is in the intracellular domain of the cognate ligand, or in the transmembrane domain of the cognate ligand, or in the extracellular domain of the cognate ligand, or any combination thereof.

[0012] In some embodiments, the variant is a PD-L1 variant or a PD-L2 variant. In some embodiments, the PD-L1 variant comprises at least one mutation in the intracellular domain (e.g., SEQ ID NO: 1), or in the transmembrane domain (e.g., SEQ ID NO: 2), or in the extracellular domain (e.g., SEQ ID NO: 3), or in the domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO: 5), or any combination thereof, where the at least one mutation reduces the ability of PD-L1 to induce immune inhibitory signaling. In some embodiments, the PD-L1 variant comprises a deletion of at least a portion of the intracellular domain of PD-L1 (e.g., SEQ ID NO: 1), or a deletion of at least a portion of the transmembrane domain of PD-L1 (e.g., SEQ ID NO: 2), or a deletion of at least a portion of the extracellular domain of PD-L1 (e.g., SEQ ID NO: 3), or a deletion of at least a portion of the domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO: 5), or any combination thereof. In some embodiments, the PD-L1 variant comprises an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 100% identical to SEQ ID NO: 11, or a portion of equal length to SEQ ID NO: 11, and the PD-L1 variant does not comprise the amino acid sequence of SEQ ID NO: 11. In some embodiments, the PD-L1 variant comprises the amino acid sequence of SEQ ID NO:7.

[0013] In some embodiments, the modified cells comprise: a) a first mutation in a coding or regulatory sequence in a genomic region of an inhibitory checkpoint molecule, which first mutation reduces expression or activity of the inhibitory checkpoint molecule; or b) a first interfering oligonucleotide that targets the mRNA of an inhibitory checkpoint molecule, which first interfering oligonucleotide reduces expression of the inhibitory checkpoint molecule; or c) an introduced protein, polypeptide, or small molecule that inhibits expression and / or activity of the inhibitory checkpoint molecule.

[0014] In some embodiments, the modified cell comprises a first exogenous polynucleotide comprising a coding sequence for a ligand. In such embodiments, the first exogenous polynucleotide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the ligand. In some embodiments, the first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the ligand. In some embodiments, the first exogenous polynucleotide is an mRNA or an expression vector, optionally a viral expression vector.

[0015] In some embodiments, the modified cells are introduced with expression of a ligand. In some embodiments, the cells further lack MHC class I proteins, or lack MHC class II proteins or MHC class II transactivators, or both. In some embodiments, the MHC class I proteins include HLA-A, or HLA-B, HLA-C, B2M, or any combination thereof, and optionally the cells further lack both HLA-A and HLA-B. In certain embodiments, the MHC class II proteins include HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, or any combination thereof, and optionally the cells further lack HLA-DR. In certain embodiments, the MHC class II transactivator is CIITA, and optionally the cells further lack CIITA. In some embodiments, the cells further lack an endogenous TCR, and optionally, the cells further lack a T cell receptor alpha chain constant region (TRAC), a T cell receptor beta constant 1 (TRBC1), a T cell receptor beta constant 2 (TRBC2), or any combination thereof.

[0016] In some embodiments, the modified cells comprise: a) a second mutation in a coding or regulatory sequence within the genomic region of the MHC class I protein, which second mutation reduces expression or activity of the MHC class I protein; or b) a second interfering oligonucleotide that targets the mRNA of the MHC class I protein, thereby reducing expression of the MHC class I protein in the cell. In some embodiments, the modified cells comprise: a) a third mutation in a coding or regulatory sequence in a genomic region of an MHC class II protein or an MHC class II transactivator (e.g., CIITA), which reduces expression or activity of the MHC class II protein or an MHC class II transactivator (e.g., CIITA); or b) a third interfering oligonucleotide that targets the mRNA of an MHC class II protein or an MHC class II transactivator (e.g., CIITA), thereby reducing expression of the MHC class II protein or an MHC class II transactivator (e.g., CIITA) in the cell. In some embodiments, the modified cell comprises: a) a fourth mutation in a coding or regulatory sequence in the genomic region of an endogenous TCR or TRAC or TRBC1 or TRBC2, the fourth mutation reducing expression or activity of the endogenous TCR or TRAC or TRBC1 or TRBC2, or b) a fourth interfering oligonucleotide that targets the endogenous TCR or TRAC or TRBC1 or TRBC2 mRNA, thereby reducing expression of the TCR or TRAC or TRBC1 or TRBC2 in the. In certain embodiments, the second mutation, or the third mutation, or the fourth mutation, or any combination thereof, is introduced by gene editing.

[0017] In some embodiments, the modified cell has been modified or further modified to introduce a second exogenous polynucleotide comprising a coding sequence for a polypeptide of interest, and optionally the modified cell expresses the polypeptide of interest. In some embodiments, the polypeptide of interest comprises a chimeric antigen receptor (CAR), or a recombinant TCR, or other cell surface receptor, or ligand. In some embodiments, the CAR comprises an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, and further optionally, the CAR further comprises a costimulatory signal region. In some embodiments, the intracellular signaling domain comprises a TCR signaling domain. In some embodiments, the recombinant TCR comprises a recombinant antigen binding domain. In some embodiments, the modified cell is a modified T cell, and optionally, the modified T cell further lacks an endogenous T cell receptor. In some embodiments, the antigen binding domain of the CAR or recombinant TCR is capable of binding to a target antigen, optionally a target cell antigen. In some embodiments, the target cell antigen comprises a tumor antigen, an inflammation-associated antigen, an autoimmune-associated antigen, or an infectious agent-associated antigen. In some embodiments, the target cell antigen is associated with a disease selected from the group consisting of cancer, autoimmune disease, infectious disease, metabolic disease, and genetic disease. In such embodiments, the tumor antigen is BCMA, CD7, CD10, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD38, CD44, CD79a, CD79b, CD123, CD138, CD 179b, CEA, CLEC12A, claudin 18.2, CS-1, DLL3, EGFR, EGFRvIII, EPCAM, FLT-3, FOLR1, FOLR3, GD2, gpA33, GPC3, HER2, HM1.24, LGR5, mesothelin, MSLN, MCSP, MICA / B, PSMA, PAMA, P-cadherin, or ROR1. In some embodiments, the cells are grown ex vivo.

[0018] In another aspect, the present application discloses a population of modified cells, the population of modified cells having one or more of the following characteristics: a) reduced autoinhibition, b) improved effector cell function, and / or c) improved cell activation and / or proliferation, compared to a comparison population of corresponding cells that express both an endogenous inhibitory checkpoint molecule and a ligand for an endogenous inhibitory checkpoint molecule, or that are innate cells (i.e., innate immune cells).

[0019] In yet another aspect, the present application discloses a method for producing a modified cell provided herein, comprising: a) providing a starting cell; and b) modifying the starting cell to decrease expression or activity of an endogenous inhibitory checkpoint molecule and increase expression or activity of a ligand of the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cell.

[0020] In yet another aspect, the present application discloses a method for producing a modified cell provided herein, comprising: a) providing a starting cell expressing an endogenous inhibitory checkpoint and a ligand for the endogenous inhibitory checkpoint molecule; and b) modifying the starting cell to reduce expression or activity of the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cell.

[0021] In yet another aspect, the present application discloses a method for producing a modified cell provided herein, comprising: a) providing a starting cell that is deficient in an endogenous inhibitory checkpoint molecule; and b) modifying the starting cell to increase expression or activity of a ligand for the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cell.

[0022] In some embodiments, modifying the starting cell to reduce expression or activity of an endogenous inhibitory checkpoint molecule comprises a) introducing a first mutation into a coding or regulatory sequence within the genomic region of the inhibitory checkpoint molecule in the starting cell, such that the inhibitory checkpoint molecule causes reduced expression or reduced activity in the starting cell, or b) introducing into the starting cell a first interfering oligonucleotide that targets the mRNA of the inhibitory checkpoint molecule, such that the inhibitory checkpoint molecule causes reduced expression in the starting cell. In some embodiments, the first mutation is introduced by gene editing.

[0023] In some embodiments, gene editing comprises a) introducing into the cell i) a sequence-targeting protein or a polynucleotide encoding it, and ii) an oligonucleotide complementary to a target sequence in the coding sequence or a regulatory sequence in the genomic region of the inhibitory checkpoint molecule. In some embodiments, the sequence-targeting protein comprises an RNA-guided DNA endonuclease, optionally Cas9. In some embodiments, the oligonucleotide comprises a guide RNA sequence complementary to the target sequence. In some embodiments, modifying the starting cell to increase expression or activity of the ligand of the inhibitory checkpoint molecule comprises a) introducing into the starting cell a first exogenous polynucleotide comprising a coding sequence for the ligand, thereby causing expression of the ligand from the starting cell, b) knocking out or knocking down one or more repressing transcription factors, c) editing one or more regulatory sequences for expression of the gene encoding the ligand, or d) knocking in the gene encoding the ligand.

[0024] In some embodiments, the first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the ligand. In some embodiments, the first exogenous polynucleotide is an mRNA, an expression vector, optionally a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a virus-like particle (VLP), a herpes simplex viral (HSV) vector, a plasmid, a minicircle, a nanoplasmid, a DNA vector, or an RNA vector. In such embodiments, the expression vector is a viral expression vector, optionally a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a virus-like particle (VLP), or a herpes simplex viral (HSV) vector.

[0025] In some embodiments, the starting cells are natural or differentiated cells, or recombinant cells genetically engineered from natural or differentiated cells. In some embodiments, the differentiated cells are differentiated from stem cells. In some embodiments, the stem cells are hematopoietic progenitor cells (e.g., T cell progenitors, NK cell progenitors, macrophage progenitors), hematopoietic stem cells (HSCs), CD34+ cells, cell lines of embryonic stem cells, mesenchymal stem cells, or iPSC cells.

[0026] In yet another aspect, the present application discloses kits comprising the modified cells provided herein.

[0027] In yet another aspect, the present application discloses a method of treating a condition or disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the modified cells provided herein, In such embodiments, the subject has a disease selected from cancer, an autoimmune disease, an infectious disease, aging, a metabolic disease, and a cardiovascular disease.

[0028] In yet another aspect, the application discloses a protein comprising a PD-L1 variant, characterized in that the variant has a reduced ability to induce immune inhibitory signaling compared to native PD-L1. In some embodiments, the PD-L1 variant lacks a functional immune inhibitory signaling domain of native PD-L1. In some embodiments, the PD-L1 variant comprises at least one mutation that reduces its ability to induce immune inhibitory signaling. In some embodiments, the at least one mutation comprises a substitution, deletion, insertion, or any combination thereof. In some embodiments, the at least one mutation is in the intracellular domain of PD-L1 (e.g., SEQ ID NO: 1), or in the transmembrane domain of PD-L1 (e.g., SEQ ID NO: 2), or in the extracellular domain of PD-L1 (e.g., SEQ ID NO: 3), or in a domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO: 5), or any combination thereof. In some embodiments, the at least one mutation comprises a deletion of at least one amino acid residue.

[0029] In some embodiments, the deletion comprises a deletion of at least a portion of the intracellular domain of PD-L1 (e.g., SEQ ID NO:1), or a deletion of at least a portion of the transmembrane domain of PD-L1 (e.g., SEQ ID NO:2), or a deletion of at least a portion of the extracellular domain of PD-L1 (e.g., SEQ ID NO:3), or a deletion of at least a portion of a domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO:5), or any combination thereof. In some embodiments, the PD-L1 variant comprises an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 100% identical to SEQ ID NO:11, or a portion of a length equivalent to SEQ ID NO:11, but does not include the amino acid sequence of SEQ ID NO:11. In some embodiments, the PD-L1 variant comprises the amino acid sequence of SEQ ID NO:7. In some embodiments, the PD-L1 variant is optionally linked to the polypeptide of interest via a linker. In such embodiments, the linker is cleavable.

[0030] In some embodiments, the polypeptide of interest comprises a chimeric antigen receptor (CAR), a recombinant TCR, or other cell surface receptor or ligand. In some embodiments, the protein further comprises a signal peptide.

[0031] In yet another aspect, the present application provides polynucleotides encoding the proteins disclosed herein.

[0032] In yet another aspect, the present application provides an expression vector comprising a polynucleotide disclosed herein.

[0033] In yet another aspect, the present application provides a recombinant cell comprising the expression vector disclosed herein.

[0034] In yet another aspect, the application provides a method of producing a recombinant cell provided herein, comprising introducing into a starting cell an expression vector provided herein under conditions suitable for expressing a polynucleotide in the cell.

[0035] In yet another aspect, the application provides cell populations produced ex vivo by the methods described herein, in some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the cell population express detectable levels of a protein provided herein.

[0036] In yet another aspect, the application provides a method for producing a recombinant cell with increased immune tolerance, comprising increasing the immune tolerance of the recombinant cell by introducing into a cell an expression vector provided herein under conditions suitable for expressing in the cell a polynucleotide provided herein.

[0037] In yet another aspect, the application provides a method of transplanting cells into a subject with a reduced risk of immune rejection, comprising administering to the subject a therapeutically effective amount of a transplant of recombinant cells provided herein, or modified cells provided herein, wherein the recombinant cells or modified cells are allogeneic to the subject. [Brief description of the drawings]

[0038] [Figure 1A] Schematic diagram of a chimeric antigen receptor (CAR) expression construct. [Figure 1B] Schematic diagram of incorporating a CAR expression construct into a lentiviral vector. [Diagram 2] Figure 1 shows CD19 CAR expression detected by flow cytometry in 293T cells transfected with lentiviral expression of CD19 CAR-P2A-TrPD-L1 with various amounts of virus (i.e., 1 μL / well, 10 μL / well, 20 μL / well, 30 μL / well, or 50 μL / well). [Figure 3A] Expression of CD19 CAR is shown. [Figure 3B] 1 shows the expression of TrPD-L1, both detected by flow cytometry in TrPDL1-CART cells transfected with lentivirus containing an expression cassette for CD19 CAR-P2A-TrPD-L1. [Figure 3C] Shows expression of CD19-CAR and full-length wtPD-L1 in PD-L1 CART as determined by flow cytometry. [Figure 4A] The cytolytic effect of TrPDL1-CART and TrPDL1-UCART cells in luciferase-expressing cells (Raji-Luci) after incubation for 24 h (FIG. 4A) at different effector:target (E:T) ratios. Naive T cells were used as a control. [Figure 4B]The cytolytic effect of TrPDL1-CART and TrPDL1-UCART cells in luciferase-expressing cells (Raji-Luci) after incubation for 48 h (FIG. 4B) at different effector:target (E:T) ratios. Naive T cells were used as a control. [Figure 5A] Shown is the release of TNFα (FIG. 5A) from TrPDL1-CART and TrPDL1-UCART cells after incubation with luciferase-expressing Raji cells (Raji-Luci) for 24 hours. [Figure 5B] Shown is the release of IFNγ (FIG. 5B) from TrPDL1-CART and TrPDL1-UCART cells after incubation with luciferase-expressing Raji cells (Raji-Luci) for 24 hours. [Figure 6] 1 shows a schematic diagram of the plasmid pELPS. [Figure 7] Shown are the levels of p-P38 and p-AKT in PDL1-UCART and TrPDL1-UCART cells after treatment with CD3 / CD28 beads and recombinant PD-1. [Figure 8] 1 shows FACS results showing T activation after CD3 / CD28 bead activation of T cells where PD-1 is knocked out and expresses TrPD-L1, or PD-1 is knocked out and expresses PD-L1, or expresses PD-1 and TrPD-L1, or expresses PD-1 and PD-L1 in the presence of recombinant PD-1 and recombinant PD-L1. [Figure 9A] The cytotoxicity of PSMA-targeted UCAR-T cells and PSMA-targeted CAR-T cells is shown. [Figure 9B] Shows the activity of PSMA-targeted UCAR-T and PSMA-targeted CAR-T cells in inducing cytokine IFNγ release. [Figure 10-1] Some of the sequences disclosed in this disclosure are shown. [Figure 10-2] Some of the sequences disclosed in this disclosure are shown. [Figure 10-3]Some of the sequences disclosed in this disclosure are shown. [Figure 10-4] Some of the sequences disclosed in this disclosure are shown. [Figure 10-5] Some of the sequences disclosed in this disclosure are shown. [Figure 10-6] Some of the sequences disclosed in this disclosure are shown. [Figure 10-7] Some of the sequences disclosed in this disclosure are shown. [Figure 10-8] Some of the sequences disclosed in this disclosure are shown. [Figure 10-9] Some of the sequences disclosed in this disclosure are shown. [Figure 10-10] Some of the sequences disclosed in this disclosure are shown. [Figure 10-11] Some of the sequences disclosed in this disclosure are shown. [Figure 10-12] Some of the sequences disclosed in this disclosure are shown. [Figure 10-13] Some of the sequences disclosed in this disclosure are shown. [Figure 10-14] Some of the sequences disclosed in this disclosure are shown. [Figure 10-15] Some of the sequences disclosed in this disclosure are shown. [Figure 10-16] Some of the sequences disclosed in this disclosure are shown. [Figure 10-17] Some of the sequences disclosed in this disclosure are shown. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0039] The following description of the present invention is merely intended to illustrate various embodiments of the present invention. Therefore, the specific modifications discussed should not be construed as limiting the scope of the present invention. It will be apparent to those skilled in the art that various equivalents, changes, and modifications can be made without departing from the scope of the present invention, and it is understood that such equivalent embodiments can be included herein. All references cited herein, including publications, patents, and patent applications, are incorporated herein by reference in their entirety.

[0040] Although various technical features of the present disclosure are described in a single embodiment, the features can also be provided individually and / or in any suitable combination. Conversely, various technical features of the present disclosure are described herein in separate embodiments for clarity, and any of these features can also be implemented in a single embodiment.

[0041] definition As used herein, terms or terminology is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0042] The singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. For example, reference to "a cell" means one or more cells, and reference to "the method" includes reference to equivalent steps, methods, etc. disclosed herein and / or known to those of skill in the art. Similarly, the word "or" is intended to include "and" unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, preferred methods and materials are described below. The abbreviation "eg" is derived from the Latin "exempli gratia" and is used herein to indicate a non-limiting example. Thus, the abbreviation "eg)" is synonymous with the term "for example."

[0043] In this application, wherever a series of numerical values ​​is recited, it can be understood that any of the recited numerical values ​​can be the upper or lower limit of the numerical range. It can be further understood that the present invention encompasses all such numerical ranges, i.e., ranges having combinations of upper and lower numerical values, and the numerical values ​​for each of the upper and lower limits can be any numerical value recited herein. Ranges provided herein can be understood to include all values ​​within the range. For example, 1 to 10 is understood to include the values ​​1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, as well as all fractional values, where appropriate. Similarly, a range defined by "at least" is understood to include the lower value provided and all higher numbers.

[0044] As used herein, "about" is understood to include within 3 standard deviations of the mean, or within the normal range accepted in the particular art. In certain embodiments, about is understood to include a variation of 0.5 or less.

[0045] The term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." Similarly, the term "such as" is used herein to mean, and is used interchangeably with, the phrase "for example, but not limited to."

[0046] As used herein, the terms "comprising" or "comprises" are used to refer to compositions, methods, and corresponding components thereof that are essential to the method or composition, and are open to the inclusion of unspecified elements, whether essential or not.

[0047] The term "consisting of" refers to the compositions, methods, and corresponding components thereof described herein, excluding any element not recited in that description of an embodiment.

[0048] The term "operably linked" or "operably linked" means that two or more biological sequences of interest are juxtaposed, with or without spacers or linkers, in a relationship that allows them to function in a desired manner. When used in reference to proteins, it is intended to mean that the protein sequences are linked in a manner that allows them to impart a desired biological function to the linked product. The term can also be used in reference to polynucleotides. For example, when a polynucleotide encoding a protein is operably linked to a regulatory sequence (e.g., a promoter, enhancer, silencer sequence, etc.), it is intended to mean that the polynucleotide sequences are linked in a manner that allows control of expression of the protein from the polynucleotide.

[0049] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. These terms also apply to amino acid polymers in which one or more amino acid residues are artificial chimeric mimetics of a corresponding naturally occurring amino acid, as well as to naturally occurring and non-naturally occurring amino acid polymers.

[0050] As used herein, the terms "nucleotide", "nucleic acid", or "polynucleotide" include oligonucleotides (i.e., short polynucleotides). They also refer to synthetic and / or non-naturally occurring nucleic acid molecules (e.g., containing nucleotide analogs, or modified backbone residues or linkages). The terms also refer to deoxyribonucleotide or ribonucleotide oligonucleotides in either single-stranded or double-stranded form. The terms encompass nucleic acids containing analogs of natural nucleotides. The terms also encompass structures that resemble nucleic acids with synthetic backbones. Unless otherwise indicated, a particular polynucleotide sequence also implicitly encompasses not only the sequence explicitly stated, but also conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (see Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0051] "Percent (%) sequence identity" is defined as the percentage of amino acid (or nucleic acid) residues in a candidate sequence that are identical to the amino acid (or nucleic acid) residues in a reference sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum number of identical amino acids (or nucleic acids). In other words, the percent sequence identity of an amino acid sequence (or nucleic acid sequence) can be calculated by dividing the number of identical amino acid residues (or bases) in the reference sequence being compared by the total number of amino acid residues (or bases) in the candidate sequence or in the reference sequence (whichever is shorter). Conservative substitutions of amino acid residues are not considered to be identical residues. Alignment to measure percent amino acid (or nucleic acid) sequence identity can be accomplished using publicly available tools such as, for example, BLASTN, BLASTp (available at the National Center for Biotechnology Information (NCBI) website, see also Altschul SF et al, J. Mol. Biol., 215:403-410 (1990); Stephen F. et al, Nucleic Acids Res., 25:3389-3402 (1997)), ClustalW2 (available at the European Bioinformatics Institute website, see also Higgins DGet al, Methods in Enzymology, 266:383-402 (1996); Larkin MA et al, Bioinformatics (Oxford, England), 23(21):2947-8 (2007)), and ALIGN or Megalin (DNASTAR) software. One skilled in the art can use the default parameters provided by the tool or can customize the parameters to those suitable for alignment, for example by selecting a suitable algorithm.

[0052] "Conservative substitution" in reference to an amino acid sequence means replacing an amino acid residue with a different amino acid residue having a side chain with similar physicochemical properties. For example, conservative substitutions can be made between amino acid residues with hydrophobic side chains (e.g., Met, Ala, Val, Leu, and Ile), between residues with neutral hydrophilic side chains (e.g., Cys, Ser, Thr, Asn, and Gln), between residues with acidic side chains (e.g., Asp, Glu), between amino acids with basic side chains (e.g., His, Lys, and Arg), or between residues with aromatic side chains (e.g., Trp, Tyr, and Phe). As is well known in the art, conservative substitutions usually do not cause significant changes in the conformational structure of a protein, and thus can retain the biological activity of the protein.

[0053] As used herein, the term "functional equivalents" refers to various forms of a parent molecule (such as mutants, fusions, derivatives, and mimetics) that, despite differing fragments in amino acid sequence or chemical structure, still maintain substantial biological activity of the parent molecule. As used herein, the phrase "maintain substantial biological activity" means exhibiting at least a portion (e.g., less than about 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%) or all of the biological activity of the parent molecule. Functional equivalents of a parent protein can include both naturally occurring variant forms, such as those obtained by recombinant methods or chemical synthesis, and forms that do not occur in nature. Functional equivalents can contain non-natural amino acid residues.

[0054] As used herein, the term "deficiency" means an insufficiency in activity or level, and can include, for example, less than normal activity or level, or absent or zero activity or level.

[0055] As used herein, the term "CAR," which may be used interchangeably with the term "chimeric antigen receptor," refers to a recombinant or artificial receptor, or a polynucleotide encoding the same. The recombinant or synthetic receptor comprises an extracellular domain that includes an antigen-binding domain, a transmembrane domain, and / or an intracellular signaling domain, which bind to or are operably linked to each other and confer specificity for the antigen on immune effector cells and bypass MHC class I and class II restriction.

[0056] The term "chimeric antigen receptor T cells," which is used interchangeably with the term "CAR-T cells" or "CART cells," refers to T cells or populations thereof that have been engineered (e.g., by genetic recombination) to express a CAR on the T cell surface. CAR-T cells can be T helper CD4+ and / or T effector CD8+ cells. CAR-T cells can bind to target cells expressing a target antigen and initiate an immune response against the target cells.

[0057] As used herein, the term "TCR", which can be used interchangeably with the term "T cell receptor" or "TCR complex", refers to a natural (or endogenous) TCR or a recombinant TCR. TCR refers to a disulfide-linked membrane-bound heterodimeric protein complex that is usually highly variable and includes α and β chains complexed with one CD3γ, one CD3δ, and two CD3ε and CD3ζ chains. The amino acid sequences of the α and β chains vary between different T cells. The transmembrane regions of the α and β chains are surrounded by the CD3 transmembrane region in an open barrel. The intracellular tails of the CD3γ, CD3δ, and CD3ε molecules each contain a single conserved motif, called the immunoreceptor tyrosine-based activation motif (ITAM), which is important for the signaling capacity of the TCR complex and initiating signal transduction upon binding to the antigen-MHC complex.

[0058] As used herein, the term "T cell receptor T cells", which is used interchangeably with the term "TCR-T", refers to T cells or populations thereof that have been modified by biological methods (e.g., genetic recombination) to express a TCR on the T cell surface. TCR-T cells can be T helper CD4+ and / or T effector CD8+ cells. TCR-T can recognize MHC-binding cells and initiate an immune response, thus targeting intracellular targets in target cells.

[0059] As used herein, the term "B2M", which is used interchangeably with the term "beta-2-microglobulin", refers to a protein that is a component of class I major histocompatibility complex (MHC), which comprises the amino acid sequence set forth in UniProtKB Accession No. P61769 or variants thereof, or a polynucleotide encoding the aforementioned protein, which retains immunoregulatory activity. B2M is required for the expression of MHC class I on the cell surface and for the stability of the peptide binding groove. Most MHC class I molecules cannot be detected on the cell surface in the absence of B2M.

[0060] As used herein, the term "MHC", which is used interchangeably with the term "major histocompatibility complex", refers to a protein or polynucleotide that encodes a protein capable of presenting intracellular peptides on the cell surface as antigens and forming a complex with antigens present on the cell surface. The MHC-antigen complex can interact with the TCR and its co-receptors to induce an immune response (e.g., T cell activation). MHC can be categorized into MHC class I, MHC class II, and MHC class III. MHC class I molecules, which are expressed in all nucleated cells and platelets, support cellular immunity against intracellular pathogens (e.g., viruses and bacteria). In humans, MHC class I is called human leukocyte antigen (HLA) class I and includes HLA-A, HLA-B, HLA-C, HLA-E, HLE-F, and HLA-G molecules. MHC class II, which generally occurs only in macrophages, B cells, and dendritic cells, can mediate immunity to antigen tolerance under certain conditions. In humans, MHC class II is called HLA class II. MHC (or HLA) molecules can act as antigens in transplantation procedures, eliciting immune responses in recipients and causing transplant rejection (Abbas AB, Lichtman AH (2009). "Ch. 10 Immune responses against tumors and transplant". Basic Immunology. Functions and disorders of the immune system (3rd ed.). Saunders (Elsevier). ISBN 978-1-4160-4688-2).

[0061] As used herein, the term "CIITA," which is used interchangeably with the term "class II, major histocompatibility complex, transactivator," refers to a protein comprising an amino acid sequence having at least about 80% sequence identity to NCBI Accession No. NP_001273331.1 or a functional fragment thereof, while still maintaining immunoregulatory activity, or a polynucleotide encoding the aforementioned protein. CIITA is classified as a transcriptional coactivator, which functions to positively regulate the expression of MHC class II genes by activating the transcription factor RFX5.

[0062] As used herein, the term "effector function" with respect to an immune cell refers to a specialized function of the cell, such as phagocytic activity, cytolytic activity, or helper activity, including secretion of cytokines for T cells.

[0063] As used herein, "treating" a condition or "treatment" of a condition includes alleviating the condition, slowing the onset or rate of progression of the condition, reducing the risk of progression of the condition, preventing or slowing the progression of symptoms associated with the condition, reducing or terminating symptoms associated with the condition, causing complete or partial regression of the condition, curing the condition, or some combination thereof.

[0064] As used herein, the term "vector" refers to a vehicle into which a polynucleotide encoding a protein can be operatively inserted to effect expression of the protein. A vector can be used to transform, transduce, or transfect a host cell to effect expression of the genetic element carried by the vector in the host cell. Examples of vectors include plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages, such as lambda phage or M13 phage; and animal viruses. Categories of animal viruses used as vectors include retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex viruses), pox viruses, baculoviruses, papilloma viruses, and papova viruses (e.g., SV40). A vector can contain various elements for controlling expression, including promoter sequences, transcription initiation sequences, enhancer sequences, selectable elements, and reporter genes. In addition, the vector can contain an origin of replication. The vector can also contain materials to aid in the introduction of the vector into cells, including but not limited to viral particles, liposomes, or protein coatings. The vector can be an expression vector or a cloning vector. The present disclosure provides a vector (e.g., an expression vector) that contains the nucleic acid sequence provided herein that encodes a fusion protein, at least one promoter (e.g., SV40, CMV, EF-1α) operably linked to the nucleic acid sequence, and at least one selectable marker.Examples of vectors include retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papilloma viruses, papova viruses (e.g., SV40), lambda phage, and M13 phage, and the plasmids pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, and pBAD. , pcDNA, pCal, pL, pET, pGEMEX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS10, pLexA, pACT2.2, pCMV-SCRIPT.RTM., pCDM8, pCDNA1.1 / amp, pcDNA3.1, pRc / RSV, PCR 2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos, and the like.

[0065] As used herein, the phrase "host cell" means a cell into which an exogenous polynucleotide and / or vector has been introduced.

[0066] The term "pharmaceutical acceptable" indicates that the specified carrier, vehicle, diluent, excipient, and / or salt is generally chemically and / or physically compatible with other ingredients contained in the formulation and physiologically compatible with the recipient thereof.

[0067] As used herein, the terms "subject" or "individual" or "animal" or "patient" refer to a human or non-human animal, including a mammal or primate, in need of diagnosis, prognosis, mitigation, prevention, and / or treatment of a disease or disorder. Mammalian subjects include humans, farm animals, livestock, and zoo, sports, or pet animals, such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, pigs, cows, bears, and the like.

[0068] I. Overview Adoptive cell therapy involves the adoptive transfer of autologous cells (i.e., cells derived from the recipient himself) or allogeneic cells (i.e., cells derived from a donor different from the recipient). For example, immune cells, or more specifically, T cells, are of great therapeutic interest. Immune cells or T cells can be modified ex vivo to express CAR or TCR on the cell surface and mediate a specific immune response against target cells (e.g., cancer cells) that express a certain target antigen.

[0069] While allogeneic cells offer a promising off-the-shelf cellular therapy and are highly desirable in the clinical setting, they are also associated with a risk of graft-versus-host rejection (GVHD) due to rejection by the host's immune system upon recognition of MHC class I molecules expressed on the surface of allogeneic cells.

[0070] In addition, therapeutic immune cells (such as CAR-T or TCR-T cells) may be subject to immunosuppression, which leads to a decrease in the effector function of the therapeutic immune cells and, therefore, a decrease in the therapeutic efficacy. Immunosuppression can be induced, for example, by the interaction of immune checkpoints, such as PD-1, present on these immune cells with immune checkpoint ligands, such as PD-L1, expressed on target cells, such as tumor cells.

[0071] The present invention provides modified cells that, on the one hand, are less susceptible to immune-mediated recognition and destruction from the allogeneic recipient, and, on the other hand, maintain the desired therapeutic effect (e.g., cytotoxicity) on the treated target cells. The present invention is described in more detail below.

[0072] II. Modified cells In one aspect, the disclosure provides a modified cell or population thereof, wherein the modified cell, relative to an unmodified corresponding cell, i) is deficient in an endogenous inhibitory checkpoint molecule and ii) is engineered to express a ligand of the deficient endogenous inhibitory checkpoint molecule. In certain embodiments, the cell is an immune cell.

[0073] To reduce or avoid immune rejection from the host immune system, allogeneic immune cells can be modified to express a ligand of an inhibitory checkpoint molecule (e.g., PD-L1) such that the expressed ligand can interact with an inhibitory checkpoint molecule (e.g., PD-1) expressed on the host immune cell, thereby protecting the allogeneic immune cell from immune rejection by the host immune system. However, it has been unexpectedly discovered by the inventors that if the modified allogeneic immune cell itself endogenously expresses an inhibitory checkpoint molecule (e.g., PD-1), this can potentially result in autoimmune suppression, in which an endogenous inhibitory checkpoint molecule present in the modified cell (e.g., modified immune cell) can interact with its ligand present in another modified cell (e.g., modified immune cell). Thus, the inventors have conceived modified cells that, on the one hand, are deficient in an endogenous inhibitory checkpoint molecule, and, on the other hand, are engineered to express a ligand of the deficient endogenous inhibitory checkpoint molecule. Such modified cells are shown in the present disclosure to be useful in suppressing autoimmune suppression and providing significantly improved therapeutic efficacy.

[0074] In another aspect, the disclosure provides modified cells or populations thereof engineered to express a ligand of an inhibitory checkpoint molecule, wherein the ligand is a mutant of the cognate ligand, and the mutant is characterized in that it has a reduced ability to induce immune inhibitory signaling compared to the cognate ligand, hi certain embodiments, the mutant ligand lacks a functional immune inhibitory signaling domain of the cognate ligand.

[0075] While expression of a cognate ligand of an inhibitory checkpoint molecule (e.g., PD-L1) in an allogeneic cell may be useful to avoid immune rejection, the present inventors have unexpectedly discovered that expression of such a ligand in a cell (e.g., an immune cell) can also induce immune suppression in the cell expressing the ligand, presumably due to the cognate ligand's inherent immune inhibitory signaling domain. Certain ligands of inhibitory checkpoint molecules have been found to be transmembrane proteins (e.g., PD-L1) and contain cytoplasmic domains that can mediate immune inhibitory signaling. Following interaction of the ligand with its corresponding inhibitory checkpoint molecule in a host immune cell, the ligand itself can also be activated to mediate immune inhibitory signaling in the cell expressing the ligand (e.g., an immune cell). Thus, another aspect of the present invention provides modified cells engineered to express a mutant ligand that has a reduced ability to induce immune inhibitory signaling compared to the cognate ligand, thus significantly reducing or minimizing the possibility of immune suppression in the allogeneic cell expressing the ligand.

[0076] In yet another aspect, the disclosure provides modified cells or populations thereof, where the modified cells, relative to an unmodified corresponding cell, i) are deficient in an endogenous inhibitory checkpoint molecule, and ii) have been engineered to express a ligand of the defective endogenous inhibitory checkpoint molecule, where the ligand is a mutant of the cognate ligand and has a reduced ability to induce immune inhibitory signaling relative to the cognate ligand (e.g., lacking a functional immune inhibitory signaling domain of the cognate ligand).

[0077] In yet another aspect, the disclosure provides modified cells or populations thereof, wherein the modified cells have been engineered to express a ligand of an inhibitory checkpoint molecule, wherein the ligand is a mutant of the cognate ligand and is characterized by a reduced ability to induce immune inhibitory signaling compared to the cognate ligand, and wherein the cells lack the inhibitory checkpoint molecule corresponding to the ligand.

[0078] As used herein with respect to a cell, the term "modified" means that the cell has been altered, either structurally or functionally. For example, the cell can be modified by introducing a nucleic acid or a biologically active agent.

[0079] In certain embodiments, the modified cells are animal or human cells.

[0080] In certain embodiments, the modified cell is an immune cell or any other type of cell in which it is desirable to retain a cellular activity, such as cytolytic activity or effector function. In certain embodiments, the modified cell is an immune cell. As used herein, the term "immune cell" refers to a cell that, upon activation, is capable of eliciting an immune response against a target antigen. Exemplary immune cells include, but are not limited to, T cells (e.g., CD4+ T cells, CD8+ T cells, cytotoxic T cells, terminal effector T cells, memory T cells, naive T cells, regulatory T cells, natural killer T cells, γδ T cells, cytokine-induced killer (CIK) T cells, and tumor-infiltrating lymphocytes, CD4+CD8+ T cells, CD4-CD8- T cells, T helper cells (e.g., T helper 1 (Th1), T helper 2 (Th2) cells, or helper T cells expressing CD4 (CD4+ T cells))), natural killer (NK) cells, NKT cells, B cells, macrophage cells, tumor-infiltrating lymphocytes, monocytes, dendritic cells, neutrophils, and γδ T cells.

[0081] Immune cells can be obtained from anywhere immune cells are present in a subject, such as blood, umbilical cord blood, thymus, pleural effusion, lymph nodes, spleen, splenic tissue, tumors, and bone marrow. Isolated immune cells can be directly recombined or can be stored for a period of time (e.g., by freezing).

[0082] In certain embodiments, the immune cell can be a T cell, a natural killer (NK) cell, an NKT cell, a B cell, a macrophage cell, a tumor-infiltrating lymphocyte, a monocyte, a dendritic cell, a neutrophil, or a γδ T cell.

[0083] In certain embodiments, the immune cells are T cells, and the T cells are selected from the group consisting of CD4+ T cells, CD8+ T cells, cytotoxic T cells, terminal effector T cells, memory T cells, naive T cells, regulatory T cells, natural killer T cells, γδ T cells, cytokine-induced killer (CIK) T cells, and tumor-infiltrating lymphocytes. In certain embodiments, the T cells are activated T cells. In some embodiments, the T cells can be obtained from blood collected from a subject using various techniques well known in the art, such as apheresis. In some embodiments, CD4+ helper and CD8+ cytotoxic T cells are isolated.

[0084] In certain embodiments, the modified cell is a stem cell or a cell differentiated from a stem cell. In certain embodiments, the stem cell comprises one or more genetic modifications (e.g., nucleotide insertion, deletion, and substitution) in its genome. The genetic modifications are maintained and remain functional in the cells derived after differentiation, proliferation, passage, and / or transplantation (e.g., recombinant cells provided herein). A detailed description of how to recombine stem cells (e.g., iPSCs) and differentiate recombinant stem cells to obtain functional differentiated cells can be found, for example, in WO2021011919, the disclosure of which is incorporated herein in its entirety.

[0085] In certain embodiments, the stem cell is a hematopoietic progenitor cell (e.g., a T cell progenitor cell, a NK cell progenitor cell, a macrophage progenitor cell), a hematopoietic stem cell (HSC), a CD34+ cell, an embryonic stem cell line, a mesenchymal stem cell, or an iPSC cell.

[0086] In certain embodiments, the cells are suitable for transplantation. The cells may be any type of cell that is useful for transplantation or desirable to reduce immune rejection from the host.

[0087] In one embodiment, the modified cells provided herein can be derived from cells (e.g., immune cells) isolated from a human subject, such as a subject suspected of having a particular disease or condition, a subject susceptible to a particular disease or condition, or a subject who will be undergoing, is undergoing, or has undergone treatment for a particular disease or condition. In certain embodiments, the modified cells are derived from cells (e.g., immune cells isolated from a subject who is a healthy volunteer or healthy donor) or from a blood bank. Thus, the modified cells provided herein can be autologous or allogeneic to the subject of interest.

[0088] In certain embodiments, the modified cells are allogeneic with respect to the intended recipient to the modified cells (e.g., modified immune cells).

[0089] In certain embodiments, the cells are expanded ex vivo. In certain embodiments, the cells are activated prior to transplantation into a subject of interest. In certain embodiments, the cells are enriched for the presence or absence of a particular marker (e.g., CD3).

[0090] In certain embodiments, the present disclosure provides a population of modified cells (e.g., modified immune cells) as described above, which have one or more of the following characteristics relative to a comparison population of corresponding cells (e.g., corresponding immune cells): 1) reduced autoinhibition, 2) improved effector cell function, and 3) improved cell activation and / or proliferation.

[0091] In one embodiment, the modified cells provided herein have reduced immunogenicity in an allogeneic environment and maintain unrepressed effector function.

[0092] i) Deficiency of endogenous inhibitory checkpoint molecules In certain embodiments, the modified cells are deficient in endogenous inhibitory checkpoint molecules.

[0093] In certain embodiments, the modified cells are deficient in endogenous inhibitory checkpoint molecules compared to unmodified counterpart cells. As used herein, the term "corresponding cells" means that the cells are of the same cell type as the modified cells. The corresponding cells can be obtained from the same individual as the modified cells or from a different individual. As used herein, the term "unmodified" means that the corresponding cells do not have the same modifications as the modified cells, or alternatively, do not have any modifications at all. In certain embodiments, the unmodified counterpart cells may be unmodified native or natural cells of the same type as the modified cells. In certain embodiments, the unmodified counterpart cells (e.g., corresponding immune cells) are deficient in endogenous inhibitory checkpoint molecules. In certain embodiments, the unmodified counterpart cells are innate immune cells.

[0094] As used herein, the term "inhibitory checkpoint molecule" refers to an inhibitory regulator of the immune system that has an inhibitory effect on the host's immune system. Activation of immune checkpoint molecules can inhibit immune responses, such as cytokine secretion, NK cell activation, T cell proliferation, and antibody production. Inhibitory checkpoint molecules mediate immune evasion of certain cancer cells that express inhibitory checkpoint ligands of such inhibitory checkpoint molecules.

[0095] In certain embodiments, the inhibitory checkpoint molecule is endogenous to the unmodified cell. "Endogenous" as used herein with respect to a protein means that the protein is naturally or naturally expressed within the cell.

[0096] Exemplary inhibitory checkpoint molecules include, but are not limited to, PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0097] "PD-1" is an abbreviation for programmed cell death 1 (PD-1) receptor. Exemplary sequences of human PD-1 include human PD-1 protein and human PD-1 gene. A more detailed description can be found, for example, in Philips et al., (January 1, 2015). "Therapeutic uses of anti-PD-1 and anti-PD-L1 antibodies". Int Immunol. 27(1):39-46.

[0098] "TIM3" is an abbreviation for T cell immunoglobulin domain and mucin domain 3, a more detailed description can be found, for example, in Zhu et al., (August 11, 2010). TIM-3 and its regulatory role in immune responses. Curr Top Microbiol Immunol. Current Topics in Microbiology and Immunology. 350. pp. 1-15.

[0099] "TIGIT" is an abbreviation for T cell immunoreceptor with Ig and ITIM domains, and a more detailed description can be found, for example, in Yu et al., (Jan 2009). "The surface protein TIGIT suppresses T cell activation by promoting the generation of mature immunoregulatory dendritic cells". Nat Immunol. 10(1):48-57. doi:10.1038 / ni.1674.

[0100] "LAG3" is an abbreviation for lymphocyte activation gene 3, and a more detailed description can be found, for example, in Huang et al., (October 1, 2004). "Role of LAG-3 in regulatory T cells". Immunity. 21(4)::503-13; Grosso et al. (November 1, 2007). "LAG-3 regulates CD8+ T cell accumulation and effector function in murine self- and tumor-tolerance systems". J Clin Invest. 117(11):3383-92.

[0101] "A2AR" is an abbreviation for adenosine A2A receptor, a more detailed description can be found, for example, in Leone et al., (April 8, 2015). "A2aR antagonists: Next generation checkpoint blockade for cancer immunotherapy". Comput Struct Biotechnol J. 13:265-72.

[0102] "BTLA" is an abbreviation for B and T lymphocyte attenuator and is used interchangeably with the term "CD272" and a more detailed description can be found, for example, in Derre et al., (January 1, 2010). "BTLA mediates inhibition of human tumor-specific CD8+ T cells that can be partially reversed by vaccination". J Clin Invest. 120(1):157-67.

[0103] "CTLA-4" is an abbreviation for cytotoxic T-lymphocyte-associated protein 4, also known as CD152, a more detailed description of which can be found, for example, in Kolar et al., (January 1, 2009). "CTLA-4 (CD152) controls homeostasis and suppressive capacity of regulatory T cells in mice". Arthritis Rheum. 60(1):123-32.

[0104] "IDO1" and "IDO2" are abbreviations for indoleamine 2,3-dioxygenase 1 and indoleamine 2,3-dioxygenase 2, respectively, and a more detailed description can be found, for example, in Prendergast et al., (July 1, 2014). "Indoleamine 2,3-dioxygenase pathways of pathogenic inflammation and immune escape in cancer". Cancer Immunol Immunother. 63(7):721-35.

[0105] "TDO" is an abbreviation for tryptophan 2,3-dioxygenase.

[0106] "KIR" is an abbreviation for killer cell immunoglobulin-like receptor, which is the receptor for MHC class I molecules on natural killer cells.

[0107] "NOX2" is an abbreviation for nicotinamide adenine dinucleotide phosphate NADPH oxidase isoform 2, a more detailed description can be found, for example, in Martner et al., (October 1, 2018). "NOX2 in autoimmunity, tumor growth and metastasis". J Pathol. 247(2):151-154.

[0108] "VISTA" is an abbreviation for V-domain Ig inhibitor of T cell activation, and a more detailed description can be found, for example, in Wang et al., (March 14, 2011). "VISTA, a novel mouse Ig superfamily ligand that negatively regulates T cell responses". J Exp Med. 208(3):577-92 and Lines et al., (April 1, 2014). "VISTA is an immune checkpoint molecule for human T cells". Cancer Res. 74(7):1924-32.

[0109] PVR (CD155) is an abbreviation for poliovirus receptor and is a member of the nectin-like family of proteins. PVR is a member of the immunoglobulin superfamily, defined by the presence of immunoglobulin domain V, a C1-like domain, and a C2 domain within its extracellular region.

[0110] "SIGLEC7" is an abbreviation for sialic acid-binding immunoglobulin-type lectin 7, also designated CD328. "SIGLEC9" is an abbreviation for sialic acid-binding immunoglobulin-type lectin 9, also designated CD329, a more detailed description of which can be found, for example, in Varki et al., (2007). "Siglecs and their roles in the immune system". Nature Reviews Immunology. 7(4):255-266.

[0111] In certain embodiments, the inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0112] In certain embodiments, the cell is a T cell and the endogenous inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0113] In certain embodiments, the cell is a NK cell and the endogenous inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), IDO1, IDO2, KIR, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329).

[0114] In certain embodiments, the cell is a DC cell and the endogenous inhibitory checkpoint molecule is selected from the group consisting of A2AR, CD47, IDO1, IDO2, and TDO.

[0115] In certain embodiments, the cell is a macrophage and the endogenous inhibitory checkpoint molecule is selected from the group consisting of A2AR, CD47, IDO1, IDO2, and CD24.

[0116] As used herein, the term "deficient" means that the endogenous inhibitory checkpoint molecule in the modified cell has either no or zero activity or level, or has a lower than normal activity or level compared to the activity or level in the corresponding unmodified cell. For example, the gene of the endogenous inhibitory checkpoint molecule in the modified cell can be deleted or mutated to confer a loss-of-function phenotype. As another example, the endogenous inhibitory checkpoint molecule can be expressed at a reduced level or in a form with reduced activity in the modified cell. The level and / or activity of the endogenous inhibitory checkpoint molecule can be measured using various techniques well known in the art, such as immunohistochemistry, Western blot, immunofluorescence microscopy, and quantitative flow cytometry.

[0117] Any suitable method can be used to modify cells to lack endogenous inhibitory checkpoint molecules, for example, by gene editing, interfering with the expression of the endogenous inhibitory checkpoint molecule, or promoting the degradation of the endogenous inhibitory checkpoint molecule or its encoding mRNA. In certain embodiments, the modified cell (e.g., modified immune cell) comprises a first mutation in a coding or regulatory sequence in the genomic region of the inhibitory checkpoint molecule, which reduces the expression or activity of the inhibitory checkpoint molecule. In certain embodiments, the modified cell (e.g., modified immune cell) comprises a first interfering oligonucleotide that targets the mRNA of the inhibitory checkpoint molecule, which reduces the expression of the inhibitory checkpoint molecule. In certain embodiments, the modified cell (e.g., modified immune cell) comprises an introduced protein, polypeptide, or small molecule that inhibits the expression and / or activity of the inhibitory checkpoint molecule.

[0118] In certain embodiments, the inhibitory checkpoint molecule is PD-1. In certain embodiments, the modified cells lack endogenous PD-1.

[0119] Levels of PD-1 can be measured by methods well known in the art, such as immunohistochemistry, Western blot, immunofluorescence microscopy, and quantitative flow cytometry.

[0120] PD-1 activity (i.e., PD-1-mediated immune inhibition) can be determined by measuring the expression of activated versions of PD-1 (e.g., phosphorylated PD-1 (Kankana et al., Phosphorylation of PD-1-Y248 is a marker of PD-1-mediated inhibitory function in human T cells, Scientific Reports | (2019) 9: 17252), such as PD-1 with phosphorylation Y248, which is essential for delivery of PD-1 inhibitory function). PD-1 activity can also be measured by measuring the expression levels of activated proteins downstream of PD-1, such as phosphorylated phosphoproteins associated with glycosphingolipid-enriched microdomain 1 (PAG), which contribute to the inhibitory function of PD-1 in immune cells (Marianne et al., Transmembrane adaptor protein PAG is a mediator of PD-1 inhibitory signaling in human T cells, COMMUNICATIONS BIOLOGY | (2021) 4: 672).

[0121] ii) Recombinant to express ligands of inhibitory checkpoint molecules In certain embodiments, the modified cells provided herein are engineered to express a ligand for an inhibitory checkpoint molecule.

[0122] In certain embodiments, the modified cells provided herein are recombinantly engineered to express a ligand of a defective endogenous inhibitory checkpoint molecule provided herein.

[0123] As used herein, the term "ligand" with respect to an inhibitory checkpoint molecule means a molecule that can bind to and activate the inhibitory checkpoint molecule to exert an immunosuppressive effect, in certain embodiments, the ligand comprises a transmembrane protein that includes an extracellular domain, a transmembrane domain, and an intracellular domain.

[0124] The ligand may be the cognate ligand of the inhibitory checkpoint molecule, or alternatively, may be a variant of the cognate ligand, or alternatively, may be any agonist of the inhibitory checkpoint molecule. As used herein, the term "cognate ligand" refers to the endogenous or natural ligand of a protein.

[0125] Any suitable method can be used to engineer the cell to express the ligand of the inhibitory checkpoint molecule. In certain embodiments, the modified cell comprises a first exogenous polynucleotide comprising a coding sequence for the ligand. In certain embodiments, the first exogenous polynucleotide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the ligand. In certain embodiments, the first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the ligand. In certain embodiments, the first exogenous polynucleotide is an mRNA or an expression vector, optionally a viral expression vector.

[0126] In certain embodiments, the modified cell (e.g., modified immune cell) has been introduced with expression of a ligand. As used herein, the term "introduced expression" with respect to a ligand means expression of the ligand by providing a cell with a nucleic acid (e.g., a coding sequence) for the ligand. The nucleic acid may be integrated into the genome of the cell or may be provided transiently to the cell.

[0127] In certain embodiments, the ligand is selected from the group consisting of PD-L1, PD-L2, HMGB1, Ceacam-1, phosphatidylserine (PS), LSECtin, a-synuclein, FGL1, adenosine, HVEM (herpes virus entry mediator), CD28, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), MHC class I, sialoglycoprotein, CD112, CD113, galectin 9, CD24, and CD47. These ligands are well known in the art, and the coding genes can be found in public databases, such as the National Center for Biotechnology Information (NCBI), US National Library of Medicine gene database, for example, with their respective gene IDs: PD-L1 (gene ID: 29126), PD-L2 (gene ID: 80380), HMGB1 (gene ID: 3146), Ceacam-1 (gene ID: 634), LSECtin (gene ID: 339390), a-synuclein (gene ID: 6622), FGL1 (gene ID: 2267), Available are HVEM (herpes virus entry mediator) (gene ID: 8764), CD28 (gene ID: 940), B7-H3 (CD276) (gene ID: 80381), B7-H4 (VTCN1) (gene ID: 79679), PVR (CD155) (gene ID: 5817), MHC class I, CD112 (gene ID: 5819), CD113 (gene ID: 25945), Galectin9 (gene ID: 16859), CD24 (gene ID: 100133941), and CD47 (gene ID: 961).

[0128] a) The expressed ligand pairs with a defective endogenous inhibitory checkpoint molecule

[0129] In certain embodiments, the modified cells provided herein are defective in an endogenous inhibitory checkpoint molecule while being engineered to express a ligand of such endogenous inhibitory checkpoint molecule, in other words, the defective inhibitory checkpoint molecule and the expressed ligand are paired.

[0130] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is PD-1 and the expressed ligand comprises at least one of PD-L1 or PD-L2, or a functional equivalent thereof, or a variant thereof.

[0131] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is TIM3 and the expressed ligand comprises at least one of galectin 9, HMGB1, Ceacam-1, or phosphatidylserine (PS), or a functional equivalent thereof capable of binding to TIM3.

[0132] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is LAG-3 and the expressed ligand comprises at least one of galectin-3, LSECtin, a-synuclein, or FGL1, or a functional equivalent thereof capable of binding to LAG-3.

[0133] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is TIGIT and the expressed ligand comprises at least one of CD155, CD113, or CD112, or a functional equivalent thereof capable of binding to TIGIT.

[0134] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is the adenosine A2A receptor (A2AR) and the ligand comprises adenosine.

[0135] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is BTLA and the expressed ligand comprises herpes virus entry mediator (HVEM), or a functional equivalent thereof capable of binding to BTLA.

[0136] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is CTLA-4 and the expressed ligand comprises CD28, or a functional equivalent thereof capable of binding to CTLA4.

[0137] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is a killer cell immunoglobulin-like receptor (KIR) and the expressed ligand comprises MHC class I, or a functional equivalent thereof capable of binding to the KIR.

[0138] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is VISTA (V domain Ig suppressor of T cell activation) and the expressed ligand comprises at least one of PD-L1 or PD-L2, or a functional equivalent thereof capable of binding to VISTA.

[0139] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is sialic acid-binding immunoglobulin-type lectin 7 (SIGLEC-7, CD328) and the ligand comprises a sialoglycoprotein or a functional equivalent thereof capable of binding to SIGLEC-7.

[0140] In certain embodiments, the defective endogenous inhibitory checkpoint molecule is SIGLEC-9 (CD329) and the ligand comprises a sialoglycoprotein or a functional equivalent thereof capable of binding to SIGLEC-9.

[0141] In certain embodiments, the modified cell comprises in its genome a first mutation in a coding or regulatory sequence of an inhibitory checkpoint molecule and / or a first exogenous polynucleotide comprising a coding sequence for a ligand of the inhibitory checkpoint molecule, wherein the first mutation reduces expression or activity of the inhibitory checkpoint molecule and the first exogenous polynucleotide results in the introduced expression of the ligand of the inhibitory checkpoint molecule.

[0142] In certain embodiments, the cells further lack one or more additional endogenous inhibitory checkpoint molecules.

[0143] In certain embodiments, when the inhibitory checkpoint molecule is PD-1, the ligand may be PD-L1 or PD-L2, or a functional equivalent. Binding of PD-L1 or PD-L2, or a functional equivalent, to PD-1 recruits Src homology 2 domain containing phosphatase 1 and 2 (SHP-1 / SHP-2) to the tyrosine-based switch motif (ITSM) of PD-1, which leads to the dephosphorylation of signaling kinases such as CD3zeta, PKCtheta, and ZAP70, resulting in an overall inhibitory effect on T cell proliferation (Yokosuka et al.,Programmed cell death 1 forms negative costimulatory microclusters that directly inhibit T cell receptor signaling by recruiting phosphatase SHP2.J Exp Med 2012;209:1201-17).

[0144] The above-mentioned ligands can be screened by generating a library of mutants of the ligand and testing their binding affinity to the inhibitory checkpoint molecule as well as the inherent immune inhibitory signaling of the mutants. Those mutants that maintain high binding affinity to the inhibitory checkpoint molecule still show a reduction in inherent immune inhibitory signaling and are selected as ligands for modified cells (e.g., immune cells) of the present disclosure. Inherent immune inhibitory signaling can be measured by various techniques well known in the art, such as FACS, PCR, Western blot, or by detecting the expression of signaling proteins or modifications thereof in cells.

[0145] In certain embodiments, the ligand comprises a secreted or cell surface agonist capable of activating an inhibitory checkpoint molecule. For example, a PD-1 agonist can bind to PD-1 to induce PD-1-mediated inhibitory signaling and thus can be modified to be released from the surface of a modified cell (e.g., a modified immune cell) or expressed on the surface of a modified cell (e.g., a modified immune cell). Exemplary PD-1 agonists include, but are not limited to, PD-1 binding proteins or mini-proteins that can be computationally designed and interact with PD-1 to inhibit T cell activation (Cassie et al., Computational design of a synthetic PD-1 agonist. PNAS July 20, 2021 118(29) e2102164118). These PD-1 agonists can be engineered onto the surface of modified cells (e.g., modified immune cells) using protein engineering techniques, for example, by fusing the PD-1 agonist to a transmembrane domain and other elements necessary to express the PD-1 agonist on the outside of the cell surface while bound to the surface.

[0146] b) Mutants of ligands of inhibitory checkpoint molecules In certain embodiments, the ligands provided herein are variants of the cognate ligand of an endogenous inhibitory checkpoint molecule.

[0147] As used herein, the term "variant" of a ligand refers to a protein that is different but homologous to a cognate or natural ligand and that substantially maintains the ability of the cognate or natural ligand to bind to a binding partner (e.g., an immune checkpoint molecule). A variant may differ from the parent peptide by one or more amino acid residues. For example, a variant may have conservative substitutions, deletions, or insertions of one or more amino acid residues of the parent protein. In certain embodiments, a variant has at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% sequence identity to the cognate ligand while substantially maintaining the ability of the cognate ligand to bind to its binding partner (e.g., an immune checkpoint molecule). A "variant" of a native or natural ligand (e.g., native PD-L1) may be in different forms, including, but not limited to, fragments, variants, fusions, or any combination thereof, of the naturally occurring or natural ligand. A variant ligand does not contain the full-length natural ligand. However, variants may include fragments or portions of the natural ligand, or fusion proteins containing such fragments or portions. Variant ligands may also include mutated forms of the full-length natural ligand, or mutated forms of fragments of the natural ligand, or fusion proteins containing such mutated forms.

[0148] The mutant ligand has a reduced ability to induce immune inhibitory signaling compared to the cognate ligand.

[0149] At least some of the cognate ligands of inhibitory checkpoint molecules have been found to have signaling domains capable of mediating immune inhibitory signaling. Following interaction of the cognate ligand with its corresponding inhibitory checkpoint molecule, the cognate ligand itself can also be activated to mediate immune inhibitory signaling in modified cells expressing the cognate ligand. Without wishing to be bound by any theory, it is believed that mutation or deletion of the immune inhibitory signaling domain of the cognate ligand reduces "back signaling" in modified cells expressing the ligand (e.g., modified immune cells). Upon binding of the ligand to the corresponding inhibitory checkpoint molecule (e.g., present in the recipient's immune cells). This can help to reduce inhibitory signaling in modified cells (e.g., modified immune cells) that may impair the effector function of the modified cells (e.g., modified immune cells), and thus can increase the effector function of the modified cells (e.g., modified immune cells).

[0150] In certain embodiments, the variant ligand has reduced immune inhibitory signaling compared to the cognate ligand, hi certain embodiments, the immune inhibitory signaling of the variant is reduced substantially below (e.g., at least 20% below, at least 40% below, at least 60% below, or at least 80% below) the normal or basal levels of immune inhibitory signaling of the cognate ligand.

[0151] In certain embodiments, the modified cells provided herein are recombinantly expressed a ligand of an inhibitory checkpoint molecule, where the ligand is a mutant of the cognate ligand and lacks a functional immune inhibitory signaling domain of the cognate ligand.

[0152] In certain embodiments, the variant comprises at least one mutation that reduces the ability of the cognate ligand to induce immune inhibitory signaling, hi certain embodiments, the at least one mutation comprises a substitution, a deletion, an insertion, or any combination thereof.

[0153] In certain embodiments, the at least one mutation is a deletion of at least one amino acid residue, e.g., at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, The deletion may include at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50 amino acid residues, or more.

[0154] In certain embodiments, the cognate ligand comprises a transmembrane protein comprising an extracellular domain, a transmembrane domain, and an intracellular domain, hi certain embodiments, at least one mutation is in the intracellular domain of the cognate ligand, or in the transmembrane domain of the cognate ligand, or in the extracellular domain of the cognate ligand, or any combination thereof.

[0155] In certain embodiments, the immune inhibitory signaling domain is present within the intracellular or transmembrane domain of the cognate ligand. For example, some ligands of inhibitory checkpoint molecules are transmembrane proteins (e.g., PD-L1) and have been found to contain cytoplasmic domains that can mediate immune inhibitory signaling.

[0156] In certain embodiments, the variants are variants of a cognate ligand of an immunoinhibitory checkpoint molecule, where the cognate ligand is selected from the group consisting of PD-L1, PD-L2, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), MHC class I, sialoglycoprotein, CD112, CD113, galectin 9, CD24, and CD47, and the variants have a reduced ability to induce immunoinhibitory signaling compared to the cognate ligand and / or lack a functional immunoinhibitory signaling domain of the corresponding cognate ligand.

[0157] The cells can be recombinantly expressed to a mutant ligand of an inhibitory checkpoint molecule using the methods described above, i.e., by introducing into the modified cell a first exogenous polynucleotide comprising a coding sequence for the ligand. In certain embodiments, the first exogenous polynucleotide comprises a coding sequence for a mutant ligand. In certain embodiments, the first exogenous polynucleotide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the mutant ligand. In certain embodiments, the first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the mutant ligand. In certain embodiments, the first exogenous polynucleotide is an mRNA or an expression vector, optionally a viral expression vector. In certain embodiments, the modified cell comprises a first exogenous polynucleotide comprising a coding sequence for a mutant ligand.

[0158] c) PD-L1 mutants In certain embodiments, the mutant ligand of an inhibitory checkpoint molecule provided herein is a PD-L1 mutant or a PD-L2 mutant.

[0159] PD-L1 is a type I transmembrane protein with a size of approximately 40 kDa, which consists of an IgV-like and IgC-like extracellular domain, a hydrophobic transmembrane domain, and a short cytoplasmic tail made of 30-31 amino acids. (Kythreotou et al.,PD-L1.J.Clin.Pathol.71,189-194(2018); Dong et al.,B7-H1,a third member of the B7 family,costimulates T-cell proliferation and interleukin-10 secretion.Nat Med 1999;5:1365-9; and Chen et al.,Regulation of PD-L1: a novel role of pro-survival signalling in cancer.Ann Oncol 2016;27:409-16.). PD-L1 is encoded by the PDCDL1 gene, which is found at position p24.1 on human chromosome 9 (NCBI gene resource CD274 molecule [Homo sapiens(human)]-gene-NCBI.2017 https: / / www.ncbi.nlm.nih.gov / gene(accessed 29 Jun 2017).). The full length of PD-L1 is encoded by seven exons, which corresponds to a protein of 290 amino acids including its signal peptide. Recent studies have found that engagement of PD-L1 upon activation induces T cell apoptosis by inducing intracellular signaling similar to that of PD-1, which has been named "back signaling" (Brian et al.,PD-L1 engagement on T cells promotes self-tolerance and suppression of neighboring macrophages and effector T cells in cancer,Nature Immunology | VOL 21 442 | April 2020 | 442~454).

[0160] In certain embodiments, the PD-L1 variant or PD-L2 variant may be stably expressed. In certain embodiments, the PD-L1 variant or PD-L2 variant has a reduced ability to induce immune inhibitory signaling, but still substantially retains the ability to bind to or binding affinity for PD-1.

[0161] The binding ability and / or affinity of the PD-L1 variants or PD-L2 variants may be measured by any suitable assay, such as ELISA, Western blot, flow cytometry assays, and other binding assays. In certain embodiments, the binding ability and / or affinity is measured by flow cytometry. Generally, PD-L1-expressing cells may be incubated with a range of concentrations of PD-1-expressing cells or soluble PD-L1 (e.g., PD-1 extracellular domain, optionally fused to Fc), followed by incubation with a fluorescently labeled secondary antibody, after which the fluorescent signal intensity may be analyzed.

[0162] PD-L1 or PD-L2 mutant immune inhibitory signaling can be measured by any suitable assay. For example, PD-1 knockout (PD-1 - / - ) T cells can be recombinantly made to express PD-L1, or a PD-L1 variant provided herein, and the resulting recombinant T cells can be incubated with PD-1 expressing cells or soluble PD-1 (e.g., the PD-1 extracellular domain, optionally fused to Fc), followed by detection of T cell activation or proliferation or differentiation. Whereas recombinant T cells express full-length PD-L1, activation or proliferation or differentiation of the recombinant T cells can be inhibited by engagement of PD-1, recombinant T cells expressing a PD-L1 variant provided herein are much less inhibited by engagement of PD-1.

[0163] In certain embodiments, the PD-L1 variants or PD-L2 variants provided herein have no more than 80%, 70%, 60%, 50%, 40%, 30%, 20%, or 10% or 5% of the immune inhibitory signaling of full-length wild-type PD-L1. In certain embodiments, the PD-L1 variants or PD-L2 variants provided herein have undetectable immune inhibitory signaling.

[0164] In certain embodiments, PD-L1 variants lack a functional immune inhibitory signaling domain of native PD-L1. In certain embodiments, PD-L2 variants lack a functional immune inhibitory signaling domain of native PD-L2. In certain embodiments, PD-L1 variants do not contain full-length PD-L1. PD-L1 variants do not contain full-length native PD-L1. PD-L2 variants do not contain full-length native PD-L2. In certain embodiments, PD-L1 variants comprise truncated native PD-L1 or truncated mutant PD-L1. In certain embodiments, truncated mutants comprise C-terminal truncated PD-L1.

[0165] In certain embodiments, the PD-L1 variant comprises at least one mutation that reduces its ability to induce immune inhibitory signaling compared to native PD-L1. In certain embodiments, the PD-L1 variant comprises at least one mutation within the intracellular domain (e.g., SEQ ID NO: 1), or within the transmembrane domain (e.g., SEQ ID NO: 2), or within the extracellular domain (e.g., SEQ ID NO: 3), or any combination thereof. In certain embodiments, the PD-L1 variant comprises at least one mutation within the intracellular domain (e.g., SEQ ID NO: 1), which spans amino acid residues 260 to 290 of PD-L1, and at least one mutation within a motif spanning amino acid residues 268 to 271 of PD-L1. In certain embodiments, the PD-L1 variant comprises at least one mutation at residues 268, 269, 270, and / or 271 of PD-L1. In certain embodiments, the PD-L1 variant comprises at least one mutation within a domain spanning the extracellular and intracellular domains, e.g., a domain comprising or consisting of the amino acid sequence of SEQ ID NO: 5. In other embodiments, the at least one mutation comprises a mutation outside of one or more domains involved in transduction of immune inhibitory signaling, yet still results in a structural change that disrupts the transduction of immune inhibitory signaling.

[0166] In certain embodiments, a PD-L1 variant comprises a deletion of at least a portion of the intracellular domain of PD-L1 (e.g., SEQ ID NO: 1), or a deletion of at least a portion of the transmembrane domain of PD-L1 (e.g., SEQ ID NO: 2), or a deletion of at least a portion of the extracellular domain of PD-L1 (e.g., SEQ ID NO: 3), or any combination thereof. In certain embodiments, a PD-L1 variant comprises a deletion of at least a portion of a domain spanning the extracellular and intracellular domains, for example a domain comprising or consisting of the amino acid sequence of SEQ ID NO: 5.

[0167] In certain embodiments, the PD-L1 variant comprises a deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, or at least 31 amino acid residues within a region corresponding to the amino acid sequence of SEQ ID NO:1 of a native PD-L1.

[0168] In certain embodiments, the recombinant intracellular domain and / or the recombinant transmembrane domain of PD-L1 comprises a deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, or at least 21 amino acid residues within a region spanning positions 1-21 of SEQ ID NO:2, which corresponds to the amino acid sequence of native PD-L1 in SEQ ID NO:2.

[0169] In certain embodiments, the PD-L1 variant has at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, at least 100, at least 101, at least 102, at least 103, at least 104, at least 105, at least 106, at least 107, at least 108, at All include a deletion of at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, or at least 51 amino acid residues.

[0170] In certain embodiments, the PD-L1 mutant is a C-terminal truncation mutant having a C-terminal deletion.

[0171] In certain embodiments, a PD-L1 variant (e.g., a C-terminal truncation variant) comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 100% identical to a native PD-L1 (e.g., SEQ ID NO: 11), or a portion of the same length as SEQ ID NO: 11, while still substantially retaining the ability to bind to PD-1. A PD-L1 variant does not comprise the amino acid sequence of SEQ ID NO: 11.

[0172] In certain embodiments, a PD-L1 variant (e.g., a C-terminal truncation variant) comprises an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 100% identical to a native PD-L1 (e.g., SEQ ID NO: 7), or a portion of the same length as SEQ ID NO: 7, while still substantially retaining the ability to bind to PD-1.

[0173] In certain embodiments, the PD-L1 variant comprises a truncated PD-L1 (e.g., a C-terminally truncated PD-L1). The truncated PD-L1 may be a truncated version of native PD-L1 or a truncated mutant PD-L1. In certain embodiments, the truncated PD-L1 has fewer than 271 amino acid residues, fewer than 270 amino acid residues, fewer than 265 amino acid residues, fewer than 260 amino acid residues, fewer than 255 amino acid residues, fewer than 250 amino acid residues, fewer than 245 amino acid residues, fewer than 240 amino acid residues, fewer than 235 amino acid residues, fewer than 230 amino acid residues, fewer than 225 amino acid residues, fewer than 220 amino acid residues (e.g., For example, 220~272, 220~271, 220~270, 220~269, 220~268, 220~267, 220~265, 220~264, 220~263, 220~262, 220~261, 220~260, 220~259, 220~258, 220~257, 220~256, 220~255, 220~254, 220~253, 220~252, 220~2 51, 220-250, 220-249, 220-248, 220-247, 220-246, 220-245, 220-244, 220-243, 220-242, 220-241, 241-272, 241-271, 241-270, 241-269, 241-268, 241-267, 241-265, 241-264, 241-263, 241-262, 241-2 241-242, 241-243, 241-244, 241-245, 241-246, 241-247, 241-248, 241-249 ...

[0174] In certain embodiments, the PD-L1 variant comprises the amino acid sequence of SEQ ID NO: 7. In certain embodiments, the amino acid sequence of the PD-L1 variant is SEQ ID NO: 7.

[0175] Using the methods described above, the cells can be engineered to express the PD-L1 variant, i.e., by introducing into the modified cells a first exogenous polynucleotide comprising a coding sequence for the PD-L1 variant. In certain embodiments, the first exogenous polynucleotide comprises a coding sequence for the PD-L1 variant. In certain embodiments, the first exogenous polynucleotide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the PD-L1 variant. In certain embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 4. In certain embodiments, the first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the PD-L1 variant. In certain embodiments, the first exogenous polynucleotide is an mRNA or an expression vector, optionally a viral expression vector.

[0176] In certain embodiments, the modified cells comprise a first exogenous polynucleotide comprising a coding sequence for a PD-L1 mutant.

[0177] d) Polynucleotides encoding PD-L1 mutants and cells containing the polynucleotides In a separate aspect, the disclosure further provides a protein comprising a PD-L1 variant that has a reduced ability to induce immune inhibitory signaling compared to native PD-L1. In certain embodiments, the PD-L1 variant lacks a functional immune inhibitory signaling domain of native PD-L1. In certain embodiments, the PD-L1 variant comprises at least one mutation that reduces its ability to induce immune inhibitory signaling. The PD-L1 variants of other aspects are the same as those described in the sections above.

[0178] In certain embodiments, the protein comprises a PD-L1 variant linked to a polypeptide of interest. In certain embodiments, the polypeptide of interest may be expressed on the cell surface or may be secreted. In certain embodiments, the polypeptide of interest is capable of binding to a target antigen (e.g., a target cell antigen) provided herein. In certain embodiments, the polypeptide of interest is a chimeric antigen receptor (CAR), or a recombinant TCR, or other cell surface receptor, or ligand. Further details of the polypeptides of interest, CARs, and recombinant TCRs are described below and are applicable to the embodiments herein.

[0179] In certain embodiments, the PD-L1 variant is linked to the polypeptide of interest via a linker. In certain embodiments, the linker is cleavable. In certain embodiments, the cleavable linker is a self-cleaving peptide, such as a 2A peptide, such as P2A (e.g., SEQ ID NO: 16), T2A, or F2A. In certain embodiments, the nucleotide sequence encoding P2A has the nucleotide sequence of SEQ ID NO: 15.

[0180] In certain embodiments, the protein further comprises a signal peptide. In certain embodiments, the PD-L1 variant further comprises a signal peptide.

[0181] In certain embodiments, the protein comprises a PD-L1 variant linked to a linker, optionally a cleavable linker. In certain embodiments, the protein comprises a PD-L1 variant linked to P2A. In certain embodiments, the protein comprises the amino acid sequence of SEQ ID NO: 17.

[0182] In certain embodiments, the present disclosure further provides a polynucleotide encoding a protein provided herein, in certain embodiments, such polynucleotide comprises a nucleotide sequence comprising SEQ ID NO: 13, 14, or 18, or a homologous sequence thereof with at least 50% sequence identity, optionally encoding the same protein or a protein variant with at least 90%, 95%, or 99% sequence identity.

[0183] In certain embodiments, the present disclosure further provides an expression vector comprising a polynucleotide provided herein.

[0184] In certain embodiments, the present disclosure further provides a recombinant cell comprising an expression vector provided herein. In certain embodiments, the recombinant cell is an animal cell or a human cell. In certain embodiments, the recombinant cell is an immune cell. In certain embodiments, the recombinant cell is a stem cell, or a cell differentiated from a stem cell. In certain embodiments, the cell is suitable for transplantation. In certain embodiments, the recombinant cell is allogeneic with respect to the intended recipient for the recombinant cell.

[0185] In another aspect, the disclosure provides recombinant cells or populations thereof engineered to express a PD-L1 variant or a PD-L2 variant.

[0186] In another aspect, the disclosure also provides a population of recombinant cells produced ex vivo by the methods described above, in certain embodiments, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the cell population express detectable levels of a PD-L1 variant provided herein.

[0187] In another aspect, the disclosure provides a method for producing a recombinant cell with increased immune tolerance in an allogeneic host, comprising increasing the immune tolerance of the recombinant cell by introducing an expression vector provided herein into a cell under conditions suitable for expressing a polynucleotide provided herein in the cell. As used herein, the term "immune tolerance" refers to the ability to tolerate or reduce immune rejection of the recombinant cell by the immune system of an allogeneic host. In certain embodiments, the recombinant cell further lacks an antigen-presenting protein, such as an MHC I class protein (e.g., HLA class I) and / or an MHC II class protein (e.g., HLA class I protein) or an MHC class II transactivator (e.g., CIITA).

[0188] iii) Expression of other polypeptides of interest In certain embodiments, the modified cells (e.g., modified immune cells) or populations thereof provided herein further express another polypeptide of interest.

[0189] In certain embodiments, the modified cells (e.g., modified immune cells) or populations thereof provided herein have been modified, or further modified, to introduce a second exogenous polynucleotide comprising a coding sequence for a polypeptide of interest, and optionally, the modified cells express the polypeptide of interest.

[0190] In certain embodiments, the polypeptide of interest may be expressed on the cell surface or may be secreted, hi certain embodiments, the polypeptide of interest is capable of binding to a target antigen, such as a target cell antigen.

[0191] The target cell antigen may be a cell surface marker on the target cell associated with a disease or condition of interest. In certain embodiments, the target cell antigen comprises a tumor antigen, an inflammation-associated antigen, or an infectious agent-associated antigen (e.g., a viral antigen). In certain embodiments, the target cell antigen is associated with a disease selected from the group consisting of cancer, an autoimmune disease, or an infectious disease.

[0192] Examples of tumor antigens include, but are not limited to, BCMA, CD7, CD10, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD38, CD44, CD79a, CD79b, CD123, CD138, CD 179b, CEA, CLEC12A, claudin 18.2, CS-1, DLL3, EGFR, EGFRvIII, EPCAM, FLT-3, FOLR1, FOLR3, GD2, gpA33, GPC3, HER2, HM1.24, LGR5, mesothelin, MSLN, MCSP, MICA / B, PSMA, PAMA, P-cadherin, and ROR1.

[0193] Any suitable method can be used to engineer the cell to further express the polypeptide of interest. In certain embodiments, the modified cell comprises a second exogenous polynucleotide comprising a coding sequence for another polypeptide of interest. In certain embodiments, the second exogenous polynucleotide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the other polypeptide of interest. In certain embodiments, the second exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the other polypeptide of interest. In certain embodiments, the second exogenous polynucleotide is an mRNA or an expression vector, optionally a viral expression vector.

[0194] In certain embodiments, the other polypeptide of interest is co-expressed with a ligand of the endogenous inhibitory checkpoint molecule. In certain embodiments, the other polypeptide of interest is expressed as a fusion protein with the ligand or a mutant ligand. In certain embodiments, the other polypeptide of interest is optionally linked to the ligand of the endogenous inhibitory checkpoint molecule (or a mutant of the cognate ligand) via a linker, e.g., a cleavable linker.

[0195] In certain embodiments, the cleavable linker is a self-cleaving peptide, such as a 2A peptide. 2A peptides are viral oligopeptides with a length of 18-22 amino acid residues that mediate cleavage of polypeptides during eukaryotic translation. Various viral 2A peptides are generally named after the viruses from which they are derived, e.g., F2A is derived from hand, foot and mouth disease virus, E2A is derived from equine rhinitis A virus, P2A is derived from porcine teschovirus-1 2A, and T2A is derived from Zosea asignavirus 2A (for details, see Liu, Z et al, Scientific Reports, volume 7, Article number: 2193 (2017)). The highly conserved sequence GDVEXNPGP (SEQ ID NO: 6, where X can be any amino acid residue) is shared by different 2As at the C-terminus and is essential for the generation of steric hindrance and ribosome skipping. 2A peptides are useful for inducing high levels of downstream protein expression for co-expression of multiple genes, and they are small in size and therefore have a low risk of interfering with the function of the co-expressed genes. 2A peptides have been successfully used in polycistronic and bicistronic multigene expression. In certain embodiments, the cleavable linker comprises P2A (e.g., SEQ ID NO: 16), F2A (e.g., SEQ ID NO: 9, GSGVKQTLNFDLLKLAGDVESNPGP), T2A (e.g., SEQ ID NO: 71, GSGEGRGSLTCGDVEENPGP), and E2A (e.g., SEQ ID NO: 72, GSGQCTNYALLKLAGDVESNPGP). In certain embodiments, the nucleotide sequence encoding P2A has the nucleotide sequence of SEQ ID NO: 15.

[0196] In such embodiments, the second exogenous polynucleotide and the first exogenous polynucleotide are one combined polynucleotide that encodes a fusion protein comprising a polypeptide and a ligand (e.g., a mutant of the cognate ligand) that are the subject of an endogenous inhibitory checkpoint molecule. The combined polynucleotide may further comprise a coding sequence for a signal peptide operably linked to the coding sequence for the fusion protein. In certain embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO: 21. In certain embodiments, the combined polynucleotide may further comprise a promoter operably linked to the coding sequence for the fusion protein.

[0197] In certain embodiments, the polypeptide of interest is a chimeric antigen receptor (CAR), or a recombinant TCR, or other cell surface receptor, or ligand.

[0198] In certain embodiments, the CAR or recombinant TCR is capable of binding to a target cell antigen, such as the target cell surface antigens described above.

[0199] In certain embodiments, the modified cells are modified T cells, and optionally the modified T cells further lack an endogenous T cell receptor, as described in more detail in the following sections.

[0200] a) Chimeric Antigen Receptor (CAR) Chimeric antigen receptors (CARs) are recombinant chimeric receptors that combine an antigen-binding domain with one or more signaling domains for immune cell activation. Upon binding to a target antigen, CARs can mediate antigen-specific cellular immune activity in modified immune cells (e.g., T cells and NK cells), allowing such CAR-expressing immune cells to eliminate cells expressing the target antigen (e.g., tumor cells). CAR-mediated cellular immune activity can also include proliferation of CAR-expressing immune cells, release of cytotoxic factors such as perforin, granzymes, and granulysin, and initiation of cytolysis and / or apoptosis of target cells.

[0201] In certain embodiments, the CAR comprises an antigen binding domain, a transmembrane domain, and an intracellular signaling domain. In certain embodiments, the intracellular signaling domain comprises a TCR signaling domain.

[0202] In certain embodiments, the CAR further comprises a costimulatory signal region. The costimulatory signal region and the intracellular signaling domain can be linked together, optionally in a random or specific order, by a short peptide linker (e.g., a glycine-serine doublet linker) having a suitable length, such as, for example, 2-10 amino acids.

[0203] In some embodiments, the antigen binding domain of the CAR comprises one or more antigen binding fragments derived from an antibody against the target antigen. In some embodiments, it is beneficial for the antigen binding domain to be derived from the same species in which the CAR will ultimately be used. For example, for use in humans, it may be beneficial to have the antigen binding domain used in the CAR derived from a human antibody or a humanized antibody. In some embodiments, the antigen binding domain comprises a single chain variable fragment (scFv). In some embodiments, the antigen binding domain can exist in a variety of other forms, including, for example, Fv, Fab, and (Fab')2, as well as bifunctional (i.e., bispecific) hybrid antibody fragments (e.g., Lanzavecchia et al., Eur. J. Immunol. 17, 105 (1987)). In certain embodiments, the antigen binding domain comprises a Fab or scFv.

[0204] In certain embodiments, the CAR comprises a transmembrane domain fused to the extracellular antigen-binding domain of the CAR. In one embodiment, the transmembrane domain can be selected so that it naturally associates with one of the domains in the CAR. In some cases, the transmembrane domain can be selected or modified so that it does not associate with the transmembrane domain of other members of the T cell receptor complex.

[0205] The transmembrane domain of the CAR provided herein can be derived from the transmembrane domain of any natural membrane-bound or transmembrane protein, such as, for example, the α, β, or ζ chain of the T cell receptor, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154. In some embodiments, the transmembrane domain of the CAR can also use various human hinges, such as human Ig (immunoglobulin) hinges. In certain embodiments, the CAR further comprises an antibody hinge region. For example, the hinge region can comprise the amino acid sequence of SEQ ID NO: 25. In certain embodiments, the CAR further comprises a CD8α transmembrane domain (TM), optionally comprising the amino acid sequence of SEQ ID NO: 26.

[0206] Alternatively, the transmembrane domain of the CAR provided herein can be synthetic and can comprise primarily hydrophobic residues, such as, for example, leucine and valine. In one embodiment, a triplet of phenylalanine, tryptophan, and valine is included at each end of the synthetic transmembrane domain. Optionally, a short oligo- or polypeptide linker, 2-10 amino acids in length, can form the link between the transmembrane domain of the CAR and the intracellular signaling domain. A glycine-serine doublet provides a particularly suitable linker.

[0207] The intracellular signaling domain of a CAR can activate an immune cell expressing the CAR to exert one of the normal effector functions of an immune cell, e.g., cytolytic activity or helper activity, including secretion of cytokines. The intracellular signaling domain can be either a full-length, naturally occurring intracellular signal transduction domain or a fragment thereof sufficient to transduce an effector function signal.

[0208] Exemplary intracellular signaling domains useful in the CARs provided herein include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors, which together initiate signal transduction following antigen receptor engagement, as well as any derivatives or variants of these sequences, and synthetic sequences having the same functional capabilities.

[0209] In certain embodiments, the intracellular signaling domain comprises a TCR signaling domain. The TCR signaling domain that functions upon stimulation may contain a signaling motif known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAMs that contain a TCR signaling domain useful in the CARs provided herein include those derived from TCRzeta, FcRgamma, FcRbeta, CD3gamma, CD3delta, CD3epsilon, CD5, CD22, CD79a, CD79b, and CD66d. In certain embodiments, the TCR signaling domain comprises a cytoplasmic signaling sequence derived from CD3zeta. In certain embodiments, the CAR further comprises a CD3zeta signal transduction domain comprising the amino acid sequence SEQ ID NO:28.

[0210] In certain embodiments, the CARs provided herein further comprise a costimulatory signaling region. The costimulatory signaling region can function independently of an antigen to mediate CAR signaling or activation, and can be derived from a costimulatory molecule required for efficient lymphocyte response to antigen. Exemplary costimulatory molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds to CD83. In certain embodiments, the CAR further comprises a 4-1BB costimulatory signal region comprising the amino acid sequence of SEQ ID NO:27.

[0211] An example of a CAR is a single chain variable fragment (scFv) derived from a monoclonal antibody fused to the CD3ζ transmembrane and endodomain, which results in the transmission of a zeta signal upon specific binding of the scFv to its target. Methods for preparing CARs are publicly available (see, e.g., Grupp et al., N Engl J Med., 368:1509-1518, 2013; Park et al., Trends Biotechnol., 29:550-557, 2011; Haso et al., (2013) Blood, 121, 1165-1174; Han et al., J. Hematol Oncol. 6:47, 2013; WO2012 / 079000; U.S. Publication No. 2012 / 0213783; and WO2013 / 059593, each of which is incorporated by reference in its entirety herein). Further details about CARs can also be found in, for example, Cheng et al., Engineering CAR-T cells. Biomarker Research (2017) 5:22; Yang et al., Challenges and Opportunities of Allogeneic Donor-Derived CAR T cells. Curr Opin Hematol. 2015 November; 22(6):509-515.

[0212] In certain embodiments, the CAR comprises an anti-CD19 scFv derived from the CD19 antibody FMC63, comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 22 and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 24, optionally linked via a linker (e.g., comprising the amino acid sequence of SEQ ID NO: 23).

[0213] In certain embodiments, the CAR comprises an anti-PSMA scFv derived from the CD19 antibody J591 comprising a light chain variable region comprising the amino acid sequence of SEQ ID NO: 81 and a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 82, optionally linked via a linker (e.g., comprising the amino acid sequence of SEQ ID NO: 23).

[0214] In certain embodiments, the CAR is linked to the PD-L1 variant provided herein, optionally via a linker, e.g., a cleavable linker. In certain embodiments, the CAR is linked to the PD-L1 variant via a P2A linker. In certain embodiments, the CAR comprises an anti-CD19 CAR linked to the PD-L1 variant via a P2A linker, such a protein comprising the amino acid sequence of SEQ ID NO: 19. In certain embodiments, the CAR comprises an anti-PSMA CAR linked to the PD-L1 variant via a P2A linker, such a protein comprising the amino acid sequence of SEQ ID NO: 83.

[0215] In certain embodiments, the present disclosure further provides a polynucleotide encoding the protein provided herein. In certain embodiments, such a polynucleotide comprises a nucleotide sequence comprising SEQ ID NO: 20, SEQ ID NO: 84, or a homologous sequence thereof with at least 50% sequence identity, optionally encoding the same protein or a protein variant with at least 90%, or 95%, or 99% sequence identity. In certain embodiments, the CAR further comprises a signal peptide at its N-terminus.

[0216] b) Recombinant T cell receptor (TCR) In certain embodiments, the recombinant TCR comprises a recombinant antigen binding domain. In certain embodiments, the affinity of the recombinant TCR for a cell surface antigen is higher than that of the wild-type TCR. In other embodiments, the TCR can comprise a modified chain, such as a modified α or β chain. Such modifications can include, but are not limited to, N-deglycosylation, altered domains (such as recombinant variable regions that target or increase affinity for a specific antigen), the addition of one or more disulfide bonds, whole chains or fragments from different species, and any combination thereof.

[0217] Techniques for recombinantly expressing TCR are well known in the art. For example, TCR can be produced as a TCR heterodimer that contains natural disulfide bonds associated with corresponding subunits. See, for example, Garboczi, et al., (1996), Nature 384(6605):134-41; Garboczi, et al., (1996), J Immunol 157(12):5403-10; Chang et al., (1994), PNAS USA 91:11408-11412; Davodeau et al., (1993), J.Biol.Chem.268(21):15455-15460; Golden et al., (1997), J.Imm.Meth.206:163-169; U.S. Patent No. 6,080,840. A detailed description of recombinant TCRs can also be found, for example, in Ping et al., T-cell receptor-engineered T cells for cancer treatment: current status and future directions. Protein Cell 2018, 9(3):254-266.

[0218] iv) Modified cells further lacking antigen-presenting proteins and other proteins In certain embodiments, the modified cells (e.g., modified immune cells) provided herein are further deficient in one or more proteins involved in antigen processing, antigen presentation, antigen recognition, and / or antigen response, including, but not limited to, beta-2-microglobulin (B2M), class II major histocompatibility complex transactivator (CIITA), and ICP47 polypeptides.

[0219] In certain embodiments, the modified cells (e.g., modified immune cells) provided herein further lack an MHC class I protein, or further lack an MHC class II protein (or an MHC class II transactivator), or both.

[0220] In certain embodiments, the modified cells further lack MHC class I proteins, including HLA-A, HLA-B, HLA-C, B2M, or any combination thereof, hi certain embodiments, the modified cells lack both HLA-A and HLA-B.

[0221] Human leukocyte antigens (HLA) are one of the main markers for the immune system to recognize "self" antigens versus "non-self" antigens (Hudson et al., Leukocyte Ig-like receptors-a model for MHC class I disease associations. Front Immunol (2016) 7:281. doi:10.3389 / fimmu.2016.00281). HLA class I molecules are the main antigens that induce host-versus-graft disease (HVGD) during allogeneic transplantation. By recombining or knocking down HLA class I molecules on allogeneic cells, the immunogenicity of allogeneic cells can be reduced. See, for example, WO2021050601, WO2021062227, WO2021011919, the disclosures of which are incorporated herein in their entireties.

[0222] MHC class I molecules are heterodimers composed of a highly variable α chain and a constant β chain, the latter also called β microglobulin (B2M). The α and β chains of MHC class I molecules bind to intracellular antigen peptides for assembly, and the assembled HLA antigen-peptide complexes are transported onto the cell surface. Antigen peptides loaded onto MHC class I molecules are generated in the cytosol and transported to the endoplasmic reticulum (ER) by a transporter associated with antigen processing (TAP) (Michalek et al., (1993) A role for the ubiquitin-dependent proteolytic pathway in MHC class I-restricted antigen presentation. Nature 363 (6429): 552-554). In the ER, antigen peptides can be further trimmed by aminopeptidases ERAP1 and ERAP2 (Saveanu et al., (2005) Concerted peptide trimming by human ERAP1 and ERAP2 aminopeptidase complexes in the endoplasmic reticulum. Nat Immunol 6(7):689-697.). Therefore, defects in the α or β chain of MHC class I molecules, or proteins involved in the assembly of MHC into peptides (e.g., TAP protein), adversely affect the assembly of MHC class I molecules into antigen peptides and their cell surface expression. In addition, dysregulation of antigen-processing machinery (APM) proteins such as tapasin also leads to reduced cell surface expression of MHC class I (Camilla et al., HLA class I is most tightly linked to levels of tapasin compared with other antigen-processing proteins in glioblastoma. British Journal of Cancer (2015) 113, 952-962).

[0223] Any suitable method can be used to render a cell MHC class I protein deficient, for example by gene editing, by interfering with the expression of the MHC class I protein or by promoting the degradation of the MHC class I protein or its encoding mRNA. In certain embodiments, the modified cell (e.g., modified immune cell) comprises a second mutation in the coding or regulatory sequence in the genomic region of the MHC class I protein or B2M, which mutation (e.g., deletion, substitution, insertion) reduces the expression or activity of the MHC class I protein or B2M. In certain embodiments, the modified cell (e.g., modified immune cell) comprises a second interfering oligonucleotide that targets the mRNA of MHC class I or B2M, thereby reducing the expression of the MHC class I protein or B2M.

[0224] In certain embodiments, the modified cells (e.g., modified immune cells) provided herein further lack an MHC class II protein, including HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, or any combination thereof. In certain embodiments, the modified cells (e.g., modified immune cells) provided herein lack an MHC class II transactivator that is CIITA.

[0225] Any suitable method can be used to render a cell MHC class II protein deficient, for example by gene editing, by interfering with the expression of an MHC class II protein or by promoting the degradation of an MHC class II protein or its encoding mRNA. In certain embodiments, the modified cell (e.g., modified immune cell) comprises a third mutation in a coding or regulatory sequence in a genomic region of an MHC class II protein or an MHC class II transactivator (e.g., CIITA), which mutation (e.g., deletion, substitution, insertion) reduces the expression or activity of an MHC class II protein or an MHC class II transactivator (e.g., CIITA). In certain embodiments, the modified cell (e.g., modified immune cell) comprises a third interfering oligonucleotide that targets an MHC class II protein or an MHC class II transactivator (e.g., CIITA) mRNA, thereby reducing the expression of an MHC class II protein or an MHC class II transactivator (e.g., CIITA) in the cell.

[0226] In certain embodiments, the modified cells (e.g., modified immune cells, modified T cells) provided herein further lack an endogenous T cell receptor.

[0227] "Lacks endogenous T cell receptors" means that the level of endogenous TCR, or the number of endogenous TCR molecules, present in a modified cell (e.g., a modified T cell) does not induce, or induces less than 10% of the functions of, a T cell (e.g., to proliferate, produce cytokines, and / or induce lytic activity), even at high doses of immunogen (e.g., near-saturating doses to induce the above-mentioned functions of T cells in a subject receiving the immunogen). The level of TCR present on T cells, or the number of TCR molecules, can be determined by, for example, Davis et al.,(1998).Determination of CD4 antigen density on cells:role of antibody valency,avidity,clones,and conjugation.Cytometry 33,197-205;Labrecque et al.,How much TCR does a T cell need? Immunity.2001;15:71-82 and James et al.,Mathematical modeling of chimeric TCR triggering predicts the magnitude of target lysis and its impairment by TCR downmodulation.Journal of Immunology.2010;184:4284-94;Wei et al.,(1999).Mapping the sensitivity of T cells with an optical trap:polarity and minimal number of receptors for Ca(2+) signaling can be measured by methods such as quantitative flow cytometry, immunofluorescence microscopy, and optical trapping, as described in Proc. Natl. Acad. Sci. 96, 8471-8476.For example, studies have shown that approximately 1000 or fewer (e.g., 200-400, 450) surface TCR molecules are required for a T cell response to in vivo immunization with high doses of immunogen in mice (Labrecque et al., How much TCR does a T cell need? Immunity. 2001;15:71-82; Wei et al., (1999). Mapping the sensitivity of T cells with an optical trap: polarity and minimal number of receptors for Ca(2+) signaling. Proc. Natl. Acad. Sci. 96,8471-8476).

[0228] In certain embodiments, the modified cells (e.g., modified immune cells, modified T cells) provided herein further lack a T cell receptor alpha chain constant region (TRAC), a T cell receptor beta constant 1 (TRBC1), a T cell receptor beta constant 2 (TRBC2), or any combination thereof.

[0229] Any suitable method can be used to make the cell endogenous TCR-deficient, for example by gene editing, by interfering with the expression of endogenous TCR or by promoting the degradation of endogenous TCR or its encoding mRNA. In certain embodiments, the modified cell (e.g., modified immune cell) comprises a fourth mutation in the coding or regulatory sequence in the genomic region of endogenous TCR or TRAC or TRBC1 or TRBC2, or any combination thereof, which mutation (e.g., deletion, substitution, insertion) reduces the expression or activity of endogenous TCR or TRAC or TRBC1 or TRBC2, or any combination thereof. In certain embodiments, the modified cell (e.g., modified immune cell) comprises a fourth interference oligonucleotide that targets the mRNA of endogenous TCR or TRAC or TRBC1 or TRBC2, or any combination thereof, thereby causing a reduction in the expression of endogenous TCR or TRAC or TRBC1 or TRBC2, or any combination thereof.

[0230] In certain embodiments, the second mutation, or the third mutation, or the fourth mutation, or any combination thereof, is introduced by any suitable means known in the art, for example, but not limited to, by gene editing. Suitable methods are described in more detail in the following sections of this disclosure.

[0231] v) Combination of modifications within modified cells In certain embodiments, the modified cells provided herein, or populations thereof, are modified to be deficient in a combination of molecules, such as a combination of an endogenous immune inhibitory checkpoint molecule and an MHC class I protein; or a combination of an endogenous immune inhibitory checkpoint molecule and an MHC class II protein (or an MHC class II transactivator); or a combination of an endogenous immune inhibitory checkpoint molecule, an MHC class I protein, and an MHC class II protein (or an MHC class II transactivator). In certain embodiments, when the modified cells are T cells, they are further modified to be deficient in an endogenous T cell receptor.

[0232] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a ligand of the defective immune inhibitory checkpoint molecule.

[0233] In certain embodiments, the modified cells (eg, modified immune cells), or populations thereof, are deficient in HLA-A and HLA-B compared to their unmodified counterparts.

[0234] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in HLA-A, HLA-B, and CIITA compared to their unmodified counterparts.

[0235] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in B2M, CIITA, and PD-1 compared to their unmodified counterparts. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express PD-L1 or PD-L2 compared to their unmodified counterparts. In certain embodiments, the PD-L1 is a PD-L1 mutant provided herein. In certain embodiments, the PD-L2 is a PD-L2 mutant.

[0236] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in B2M, CIITA, and TIM-3, as compared to unmodified counterpart cells. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a ligand of TIM3 (e.g., galectin 9), as compared to unmodified counterpart cells. In certain embodiments, the ligand of TIM3 9 (e.g., galectin 9) is a mutant that has reduced immune inhibitory signaling, as compared to the natural ligand (e.g., natural galectin 9).

[0237] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in B2M, CIITA, and LAG-3, as compared to unmodified counterpart cells. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a ligand of LAG3 (e.g., Galectin-3, LSECtin, a-synuclein, FGL1, or MHCII), as compared to unmodified counterpart cells. In certain embodiments, the ligand of LAG3 is a mutant that has reduced immune inhibitory signaling, as compared to the natural ligand of LAG3.

[0238] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in B2M, CIITA, and TIGIT, as compared to unmodified counterpart cells. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a ligand of TIGIT (e.g., CD155, CD112, or CD113), as compared to unmodified counterpart cells. In certain embodiments, the ligand of TIGIT is a mutant that has reduced immune inhibitory signaling, as compared to the natural ligand of TIGIT.

[0239] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in HLA-A, HLA-B, CIITA, and PD-1, relative to their unmodified counterparts. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express PD-L1 or PD-L2, relative to their unmodified counterparts. In certain embodiments, the PD-L1 is a PD-L1 variant provided herein. In certain embodiments, the PD-L2 is a PD-L2 variant.

[0240] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in HLA-A, HLA-B, CIITA, and TIM3, as compared to unmodified counterpart cells. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a ligand for TIM3 9 (e.g., galectin 9), as compared to unmodified counterpart cells. In certain embodiments, the ligand for TIM3 9 (e.g., galectin 9) is a mutant that has reduced immune inhibitory signaling, as compared to the natural ligand (e.g., natural galectin 9).

[0241] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in HLA-A, HLA-B, CIITA, and LAG3, as compared to unmodified counterpart cells. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a ligand of LAG3 (e.g., Galectin-3, LSECtin, a-synuclein, FGL1, or MHCII), as compared to unmodified counterpart cells. In certain embodiments, the ligand of LAG3 is a mutant that has reduced immune inhibitory signaling, as compared to the natural ligand of LAG3.

[0242] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are deficient in HLA-A, HLA-B, CIITA, and TIGIT, as compared to unmodified counterpart cells. In certain of these embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a ligand of TIGIT (e.g., CD155, CD112, or CD113), as compared to unmodified counterpart cells. In certain embodiments, the ligand of TIGIT is a mutant that has reduced immune inhibitory signaling, as compared to the natural ligand of TIGIT.

[0243] In certain embodiments, the modified cells (e.g., modified immune cells), or populations thereof, are further engineered to express a polypeptide of interest (e.g., a CAR or recombinant TCR, or other cell surface receptor or ligand).

[0244] Methods for Producing Modified Cells (e.g., Modified Immune Cells) Also provided herein is a method for producing the above-mentioned modified cells (e.g., modified immune cells), comprising providing a starting cell and modifying the starting cell to reduce the expression or activity of an endogenous inhibitory checkpoint molecule and increase the expression or activity of a ligand of the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cell (e.g., modified immune cell). The endogenous inhibitory checkpoint molecule and its ligand may be the same as those described in the above section. In certain embodiments, the starting cell is an immune cell, e.g., an immune cell that expresses an endogenous inhibitory checkpoint molecule. In certain embodiments, the starting cell is an immune cell, e.g., an immune cell that expresses both an endogenous inhibitory checkpoint molecule and a ligand for the endogenous inhibitory checkpoint molecule.

[0245] Also provided herein is a method for producing the above-mentioned modified cells (e.g., modified immune cells), comprising providing an endogenous inhibitory checkpoint molecule and a starting cell (e.g., immune cell) expressing the endogenous inhibitory checkpoint molecule, and modifying the starting cell (e.g., immune cell) to reduce the expression or activity of the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cell (e.g., modified immune cell). The endogenous inhibitory checkpoint molecule and its ligand may be the same as those described in the above section.

[0246] Also provided herein is a method for producing the above-mentioned modified cells (e.g., modified immune cells), comprising providing a starting cell (e.g., immune cell) that is deficient in an endogenous inhibitory checkpoint molecule, and modifying the starting cell (e.g., immune cell) to increase expression or activity of a ligand for the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cell (e.g., modified immune cell). The endogenous inhibitory checkpoint molecule and its ligand may be the same as those described in the above section.

[0247] Also provided herein is a method for producing the above-mentioned modified cells (e.g., modified immune cells), comprising providing a starting cell and modifying the starting cell to express a ligand of an inhibitory checkpoint molecule, where the ligand is a mutant of the cognate ligand that has a reduced ability to induce immune inhibitory signaling compared to the cognate ligand. The mutant of the cognate ligand may be the same as described in the section above.

[0248] In certain embodiments, modifying a starting cell (e.g., immune cell) to reduce expression or activity of an endogenous inhibitory checkpoint molecule comprises: a) introducing into the starting cell a first mutation to a coding or regulatory sequence within a genomic region of the inhibitory checkpoint molecule, such that the inhibitory checkpoint molecule causes reduced expression or reduced activity in the starting cell; or b) introducing into the starting cell (e.g., immune cell) a first interfering oligonucleotide that targets the mRNA of the inhibitory checkpoint molecule, such that the inhibitory checkpoint molecule causes reduced expression in the starting cell; or c) introducing into the starting cell (e.g., immune cell) a protein, polypeptide, or small molecule that inhibits expression and / or activity of the inhibitory checkpoint molecule; or d) contacting the starting cell (e.g., immune cell) with a protein, polypeptide, or small molecule that inhibits expression and / or activity of the inhibitory checkpoint molecule.

[0249] In certain embodiments, the method includes a) introducing into the starting cell, or into a cell modified from the starting cell, a second mutation to a coding or regulatory sequence within a genomic region of an MHC class I protein (e.g., HLA-A, HLA-B, or B2M) such that the MHC class I protein is reduced in expression or reduced in activity in the starting cell; or b) introducing into the starting cell (e.g., immune cell) or into a cell modified from the starting cell, a second interfering oligonucleotide that targets the mRNA of an MHC class I protein (e.g., HLA-A, HLA-B, or B2M) such that the MHC class I protein is reduced in expression in the starting cell. or c) introducing into the starting cell (e.g., immune cell) or cell modified from the starting cell a protein, polypeptide or small molecule that inhibits expression and / or activity of an MHC class I protein (e.g., HLA-A, HLA-B, or B2M), or d) contacting the starting cell (e.g., immune cell) or cell modified from the starting cell with a protein, polypeptide or small molecule that inhibits expression and / or activity of an MHC class I protein.

[0250] In certain embodiments, the method includes the steps of: a) introducing into the starting cell, or into a cell modified from the starting cell, a third mutation to a coding or regulatory sequence within a genomic region of the MHC class II protein (or an MHC class II transactivator, e.g., CIITA), such that the MHC class II protein is reduced in expression or reduced in activity in the starting cell; or b) introducing into the starting cell (e.g., immune cell), or into a cell modified from the starting cell, a second interfering oligonucleotide targeting the mRNA of the MHC class II protein (or an MHC class II transactivator, e.g., CIITA), such that the MHC class II protein is reduced in expression or reduced in activity in the starting cell. The method may further comprise the step of modifying the starting cell (e.g., immune cell) or the cell modified from the starting cell to reduce expression or activity of an MHC class II protein, including the steps of: c) introducing into the starting cell (e.g., immune cell) or the cell modified from the starting cell a protein, polypeptide, or small molecule that inhibits expression and / or activity of an MHC class II protein (e.g., CIITA), or d) contacting the starting cell (e.g., immune cell) or the cell modified from the starting cell with a protein, polypeptide, or small molecule that inhibits expression and / or activity of an MHC class II protein.

[0251] In certain embodiments, the method includes a) introducing into the starting cell, or into a cell modified from the starting cell, a fourth mutation to a coding or regulatory sequence in a genomic region of the endogenous TCR (e.g., TRAC or TRBC1 or TRBC2), such that the endogenous TCR is reduced in expression or reduced in activity in the starting cell; or b) introducing into the starting cell (e.g., immune cell) or into a cell modified from the starting cell, a third interfering oligonucleotide that targets the mRNA of the endogenous TCR (e.g., TRAC or TRBC1 or TRBC2), such that the endogenous TCR is reduced in expression or reduced in activity in the starting cell. or c) introducing into the starting cell (e.g., immune cell) or cell modified from the starting cell a protein, polypeptide or small molecule that inhibits endogenous TCR expression and / or activity; or d) contacting the starting cell (e.g., immune cell) or cell modified from the starting cell with a protein, polypeptide or small molecule that inhibits endogenous TCR expression and / or activity.

[0252] In certain embodiments, the first mutation, the second mutation, the third mutation, and / or the fourth mutation are introduced by gene editing. Many nucleic acid-based compositions and methods are useful for gene editing, such as antisense RNA, antagomir RNA, siRNA, shRNA, and CRISPR system.

[0253] In certain embodiments, gene editing comprises introducing into the immune cell i) a sequence-targeting protein or a polynucleotide encoding the sequence-targeting protein, and ii) an oligonucleotide complementary to a target sequence within the coding sequence or a regulatory sequence within the genomic region of an inhibitory checkpoint molecule (e.g., an inhibitory checkpoint molecule, an MHC class I protein, and / or an MHC class II protein, or an endogenous TCR). In certain embodiments, the sequence-targeting protein comprises a sequence-guided DNA endonuclease, such as Cas9, T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, and Fok1.

[0254] In certain embodiments, the oligonucleotide comprises a guide nucleic acid. The guide nucleic acid sequence comprises an RNA sequence, a DNA sequence, a combination thereof (RNA-DNA combination sequence), or a sequence comprising synthetic nucleotides. The guide nucleic acid sequence may be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA. In one embodiment, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, or more nucleotides in length.

[0255] In certain embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNAs) that target a) a coding or regulatory sequence within the genomic region of an MHC class I protein (e.g., HLA-A, HLA-B, or B2M); b) a coding or regulatory sequence within the genomic region of an MHC class II protein (or an MHC class II transactivator, e.g., CIITA); c) a coding or regulatory sequence within the genomic region of an inhibitory checkpoint molecule (e.g., PD-1, TIM3, LAG3, or TIGIT); or d) a coding or regulatory sequence within the genomic region of an endogenous TCR (e.g., TRAC or TRBC1 or TRBC2).

[0256] In certain embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNAs) that target a genomic region of HLA-A and are complementary to a fragment of SEQ ID NO: 63 or 64.

[0257] In certain embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNAs) that target a genomic region of HLA-B and are complementary to a fragment of SEQ ID NO: 65 or 66.

[0258] In certain embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNAs) that target a genomic region of B2M and are complementary to a fragment of SEQ ID NO:67.

[0259] In certain embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNAs) that target a genomic region of CIITA and are complementary to a fragment of SEQ ID NO:68.

[0260] In certain embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNAs) that target a genomic region of PD-1 and are complementary to a fragment of SEQ ID NO:69.

[0261] In certain embodiments, the oligonucleotide comprises one or more guide nucleic acids (e.g., guide RNAs) that target a genomic region of TRAC and are complementary to a fragment of SEQ ID NO:70.

[0262] In certain embodiments, the step of modifying a starting cell (e.g., immune cell) to increase expression or activity of a ligand of an inhibitory checkpoint molecule includes: a) introducing a first exogenous polynucleotide comprising a coding sequence for the ligand into the starting cell (e.g., immune cell) to cause expression of the ligand from the starting cell; b) knocking out or knocking down one or more inhibitory transcription factors; c) editing one or more regulatory sequences for expression of a gene encoding the ligand; or d) knocking in a gene encoding the ligand. For example, Keisuke et al. found that truncation of the 3'-untranslated (3'-UTR) of the PD-L1 transcript leads to increased expression of PD-L1 in various cancers (Keisuke et al. Aberrant PD-L1 expression through 3'-UTR disruption in multiple cancers. Nature. 2016 Jun 16;534(7607):402-6.). Thus, modified immune cells comprising a truncation in the 3'UTR region of the PD-L1 transcript can be expected to result in increased expression of PD-L1. Methods for disrupting the 3'-UTR region of the PD-L1 transcript can be found, for example, in Keisuke et al. Aberrant PD-L1 expression through 3'-UTR disruption in multiple cancers. Nature. 2016 Jun 16;534(7607):402-6.

[0263] In certain embodiments, a method of modifying a starting cell (e.g., an immune cell) to express a variant of a cognate ligand comprises: a) introducing into the starting cell (e.g., an immune cell) a first exogenous polynucleotide that includes a coding sequence for the variant, thereby causing expression of the derived variant; or b) knocking in a gene encoding the variant.

[0264] In certain embodiments, the first exogenous polynucleotide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the ligand or for a variant of the ligand.

[0265] In certain embodiments, the polypeptide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the ligand or for a variant of the ligand.

[0266] In certain embodiments, the first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the ligand.

[0267] In certain embodiments, the first exogenous polynucleotide is an mRNA, an expression vector, optionally a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a virus-like particle (VLP), a herpes simplex viral (HSV) vector, a plasmid, a minicircle, a nanoplasmid, a DNA vector, or an RNA vector. In certain embodiments, the expression vector is a viral expression vector, optionally a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a virus-like particle (VLP), or a herpes simplex viral (HSV) vector.

[0268] In certain embodiments, the starting cells are natural cells or differentiated cells. In certain embodiments, the starting cells are recombinant cells that have been genetically modified from natural cells or genetically modified from differentiated cells.

[0269] In certain embodiments, the differentiated cells are differentiated from stem cells. In certain embodiments, the stem cells are hematopoietic progenitor cells (e.g., T cell progenitors, NK cell progenitors, macrophage progenitors), hematopoietic stem cells (HSCs), CD34+ cells, embryonic stem cell lines, mesenchymal stem cells, or iPSC cells. The stem cells can first be modified to increase expression or activity of a ligand of an inhibitory checkpoint molecule, and then genetically edited with an endogenous inhibitory checkpoint molecule to decrease expression or activity of an endogenous inhibitory checkpoint molecule, an MHC class I protein, and / or an MHC class II protein, and / or an endogenous TCR. After modifying or modifying the stem cells, the modified or modified stem cells can be differentiated under suitable conditions to obtain the modified cells of the present disclosure. For differentiated hematopoietic lineage cells genetically modified to express a recombinant TCR or CAR, the cells can be activated and expanded, for example, using methods described in U.S. Pat. No. 6,352,694. In certain embodiments, the starting cells and / or modified cells may be expanded and / or activated ex vivo prior to infusion.

[0270] The methods provided herein can further include obtaining starting cells from a source, culturing the cells, activating the cells, and expanding the cells.

[0271] The methods provided herein can also involve isolating starting cells (e.g., immune cells) using various techniques well known in the art, such as flow cytometry. Briefly, fluorescently labeled antibodies with affinity for the markers of starting cells (e.g., immune cells) are used to label the starting cells in the sample. A gating strategy appropriate for cells expressing the marker is used to separate the cells. For example, T cells can be separated from other cells in the sample by using fluorescently labeled antibodies specific for cell markers such as CD4, CD8, CD28, and CD45, and corresponding gating methods. In certain embodiments, T cells that lack CD3 are separated or enriched.

[0272] Polynucleotides and Vectors Suitable recombinant techniques can be used to construct the nucleic acids or polynucleotides provided herein, such as those encoding a ligand for an inhibitory checkpoint molecule, or encoding a mutant ligand, or encoding a PD-L1 mutant. Optionally, a polynucleotide sequence encoding one or more linkers may also be operably linked to allow for expression of the desired product.

[0273] The encoding polynucleotide sequence can be mRNA, which can be in vitro transcribed and optionally encapsulated in a suitable delivery vehicle, such as a lipid nanoparticle.

[0274] The coding polynucleotide sequence can be inserted into a vector for further cloning (amplification of DNA) or for expression using recombinant techniques well known in the art. Many vectors are available. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter (e.g., prokaryotic promoters such as T7, T7lac, Sp6, araBAD, trp, lac, tac, pLm, A3, lac, lpp, npr, pac, syn, trc, and T3, or eukaryotic promoters such as SV40, CMV, and EF-1α), and a transcription termination sequence.

[0275] In another aspect, the present disclosure provides an expression vector comprising the polynucleotide provided herein.In certain embodiments, the expression vector provided herein comprises sufficient cis-acting elements for expression, and other elements for expression can be provided by the host cell or can be provided in an in vitro expression system.In certain embodiments, the expression vector provided herein also comprises a nucleotide sequence encoding a signal peptide, for example, for nuclear localization, nucleolar localization, or mitochondrial localization.

[0276] In certain embodiments, the expression vectors provided herein comprise a polynucleotide encoding a ligand of the present disclosure and a polynucleotide encoding one or more CARs or TCRs.

[0277] The expression vectors provided herein can also include a polynucleotide encoding an RNA-guided DNA endonuclease (e.g., Cas9), and one or more nuclear localization sequences, and optionally, one or more deaminases.

[0278] The expression vectors of the present disclosure can also include any suitable number of control / regulatory elements, such as promoters, enhancers, introns, polyadenylation signals, Kozak consensus sequences, internal ribosome entry sites (IRES), or peptide 2A (P2A) sequences, which are well known in the art.

[0279] The expression vector can be selected from the group consisting of a viral vector, a virus-like particle (VLP), a plasmid, a minicircle, a nanoplasmid, a DNA vector, or an RNA vector. In certain embodiments, the expression vector is a viral expression vector, optionally a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a virus-like particle (VLP), and a herpes simplex viral (HSV) vector. In general, a viral vector comprises an origin of replication, a promoter, a restriction endonuclease site, and one or more selectable markers that are functional in at least one organism.

[0280] The expression vector provided herein can be a lentiviral vector, which is advantageous for long-term stable integration of a polynucleotide encoding a CAR into the genome of non-proliferating cells, resulting in stable expression of the CAR in host cells, e.g., host T cells. Lentiviruses are complex retroviruses that can infect and express genes in both mitotic and postmitotic cells. Human immunodeficiency virus (HIV) is the most common lentivirus known, and it uses the envelope glycoproteins of other viruses to target a wide range of cell types. Preparation of lentiviruses is described in Gustabo et al., Production and purification of lentiviral vectors. Nature Protocols volume 1, pages 241-245 (2006).

[0281] Other expression vectors, such as plasmid vectors, phagemid vectors, phage derivative vectors, cosmid vectors, transposon vectors, site-specific insertion vectors (e.g., CRISPR, zinc finger nucleases, TALEN), in vitro transcribed RNA vectors, and suicide expression vectors, are also within the contemplation of this disclosure.

[0282] The expression vectors provided herein can be delivered to host cells using various techniques well known in the art, for example, by physical, chemical, or biological means. Physical methods for transducing expression vectors into host cells include, but are not limited to, lipofection, calcium phosphate precipitation, particle bombardment, microinjection, and electroporation. Biological methods include, but are not limited to, the use of viral vectors (particularly retroviral vectors, e.g., lentiviral vectors) to insert genes into host cells. Chemical means include, but are not limited to, colloidal dispersion systems (e.g., macromolecular complexes, nanocapsules, microspheres, beads), and lipid-based systems (e.g., oil-in-water emulsions, micelles, mixed micelles, and liposomes).

[0283] Pharmaceutical Compositions In another aspect, the present disclosure also provides a pharmaceutical composition comprising a modified cell provided herein (e.g., a modified immune cell), a recombinant cell provided herein, a protein provided herein, or a polynucleotide provided herein, and a pharma- ceutically acceptable vehicle. As used herein, the term "pharmaceutical composition" refers to a composition formulated for pharmaceutical use.

[0284] The term "pharmaceutical acceptable" indicates that the specified carrier, vehicle, diluent, excipient, and / or salt is generally chemically and / or physically compatible with other ingredients contained in the formulation and physiologically compatible with the recipient thereof.

[0285] "Pharmaceutically acceptable medium" refers to an ingredient in a pharmaceutical formulation other than the active ingredient that has acceptable biological activity and is non-toxic to a subject. Pharmaceutically acceptable mediums for use in the pharmaceutical compositions disclosed herein can include, for example, pharma- ceutically acceptable liquid, gel, or solid carriers, aqueous or non-aqueous vehicles, antibacterial agents, buffers, antioxidants, isotonicity agents, suspending / dispersing agents, sequestering or chelating agents, diluents, adjuvants, excipients, or non-toxic auxiliary substances, or various combinations thereof.

[0286] The pharmaceutical compositions of the present disclosure can be prepared using various techniques well known in the art. See, for example, Remington, The Science And Practice of Pharmacy (21st ed.2005). Briefly, the modified / recombinant cells, or populations thereof, are mixed with a suitable medium prior to use or storage. A suitable pharmaceutically acceptable medium generally contains inert substances that aid in 1) administering the pharmaceutical composition to a subject, 2) processing the pharmaceutical composition into a deliverable preparation, and / or 3) storing the pharmaceutical composition prior to administration. In certain embodiments, the pharmaceutically acceptable medium contains agents that can stabilize, optimize, or change the morphology, consistency, viscosity, pH, pharmacokinetics, and / or solubility of the formulation. Such agents include, but are not limited to, buffering agents, wetting agents, emulsifying agents, diluents, encapsulating agents, and skin penetration enhancers, such as saline, buffered saline, dextrose, arginine, sucrose, water, glycerol, ethanol, sorbitol, dextran, sodium carboxymethylcellulose, and combinations thereof.

[0287] Exemplary pharma- ceutically acceptable vehicles include sugars (e.g., lactose, glucose, and sucrose), starches (e.g., corn starch and potato starch), cellulose and its derivatives (e.g., sodium carboxymethylcellulose, methylcellulose, ethylcellulose, microcrystalline cellulose, and cellulose acetate), powdered tragacanth, malt, gelatin, lubricants (e.g., magnesium stearate, sodium lauryl sulfate, and talc), excipients (e.g., cocoa butter and suppository wax), oils (e.g., peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil), glycols (e.g., glyceryl stearate, sorbitol ... , propylene glycol), polyols (e.g., glycerin, sorbitol, mannitol, and polyethylene glycol (PEG)), esters (e.g., ethyl oleate and ethyl laurate), agar, buffers (e.g., magnesium hydroxide and aluminum hydroxide), alginic acid, pyrogen-free water, isotonic saline, Ringer's solution, ethyl alcohol, pH buffered solutions, polyesters, polycarbonates, polyanhydrides, bulking agents (e.g., polypeptides and amino acids), serum alcohol (e.g., ethanol), (sterile) phosphate buffered saline, dextrose solution, and other non-toxic, compatible substances used in drug formulations.

[0288] The pharmaceutical compositions of the present invention can include the modified cells described herein in combination with one or more pharma- ceutical or physiologically acceptable carriers, diluents, or excipients. Such compositions can include a buffer, such as neutral buffered saline, phosphate buffered saline, or the like; a carbohydrate, such as glucose, mannose, sucrose, or dextran, mannitol; a protein; a polypeptide, or an amino acid, such as glycine; an antioxidant; a chelating agent, such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); and a preservative. The compositions of the present invention are preferably formulated for intravenous administration.

[0289] kit In another aspect, the present disclosure also provides kits comprising modified cells (e.g., modified immune cells) or recombinant cells provided herein with reduced autoinhibition, improved effector cell function, and improved cell activation and / or proliferation. In another aspect, the present disclosure also provides kits comprising proteins provided herein, polynucleotides or expression vectors provided herein for use in generating CAR-expressing or TCR-expressing modified cells (e.g., modified immune cells) or recombinant cells with reduced autoinhibition, improved effector cell function, and improved cell activation and / or proliferation.

[0290] In some embodiments, the kit of the present disclosure includes written instructions for using the kit. In certain embodiments, the instructions include at least one of the following: clinical studies, precautions, warnings, and / or references. The instructions can either be printed directly on the container (if present) or provided in or with the container, as a label attached to the container, or as a separate sheet, pamphlet, or folder. Suitable containers include, for example, bottles, syringes, vials, and test tubes. The container can be formed from a variety of materials, such as plastic or glass. In certain embodiments, the container holds the pharmaceutical composition provided herein and has a sterile access port.

[0291] In certain embodiments, the kit further comprises a second container comprising a pharma- ceutically acceptable vehicle as described above, hi certain embodiments, the kit further comprises other commercially desirable or user-friendly materials, such as other diluents, buffers, needles, filters, syringes, and package inserts containing instructions for use.

[0292] Treatment method In another aspect, the disclosure provides a method of treating a condition or disease in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a modified cell (e.g., a modified immune cell) provided herein.

[0293] In certain embodiments, the subject has a disease selected from cancer, an autoimmune disease, an infectious disease, aging, a metabolic disease, and a cardiovascular disease. Cellular therapy has been approved to treat cancer and has been found to be useful in the treatment of many other different conditions and diseases. For further details, see Chu ETet al.,Cells.2020 Mar;9(3):563;Rurik JGet al,CAR T cells produced in vivo to treat cardiac injury,Science 375,91~96(2022);Aghajanian H.et al.,Targeting cardiac fibrosis with engineered T cells,Nature,573,430~433(2019);Amor C. et al.,Senolytic CAR T cells reverse senescence-associated pathologies,Nature,583,127~132(2020);Wagner V.et al, T cells engineered to target senescence,Nature,583,37~38(2020),Nezhad,MS et al,Chimeric Antigen Receptor Based Therapy as a Potential Approach in Autoimmune Diseases:How Close Are We to the Treatment? Front.Immunol.,26 November 2020, Stewart et al., Infectious complications of CAR T-cell therapy: a clinical update, Ther Adv Infect Dis. 2021 Jan-Dec;8:20499361211036773, which are incorporated herein in their entireties.

[0294] In certain embodiments, the cancer is a hematological cancer or a solid tumor.

[0295] In certain embodiments, the condition or disease is a hematological cancer. In certain embodiments, the hematological cancer is a B-cell cancer. In certain embodiments, the hematological cancer is selected from the group consisting of leukemia, myeloma, lymphoma, and combinations thereof. In certain embodiments, the hematological cancer is selected from the group consisting of T-cell acute lymphoblastic leukemia, mycosis fungoides, Sezary syndrome, peripheral T lymphoma, NK / T-cell lymphoma, anaplastic large cell lymphoma ALK+, primary cutaneous T-cell lymphoma (CTCL), T-cell large granular lymphocytic leukemia (T-LGLL), angioimmunoblastic T / NK-cell lymphoma, hepatosplenic T-cell lymphoma, primary cutaneous CD30+ lymphoproliferative syndrome, extranodal NK / T-cell lymphoma (ENKTL), adult T-cell leukemia / lymphoma (ATLL), T-cell prolymphocytic leukemia (T-PLL), subcutaneous pancreatitis-like T-cell lymphoma (SPTCL), primary cutaneous gamma delta T-cell lymphoma (PCGD-TCL), aggressive NK-cell leukemia (ANKL), and enteropathy-associated T-cell lymphoma (EATL).

[0296] In certain embodiments, the condition or disease is a solid tumor. In certain embodiments, the solid tumor is selected from the group consisting of breast cancer, lung cancer, colon cancer, pancreatic cancer, glioma and lymphoma, head and neck tumor, neuroendocrine tumor, colon tumor, prostate tumor, breast tumor, lung tumor (such as small cell and non-small cell lung tumor), pancreatic tumor, thyroid tumor, ovarian tumor, cervical tumor, kidney tumor, brain tumor, liver tumor, Kaposi's sarcoma, CNS tumor, neuroblastoma, capillary hemangioblastoma, meningioma, brain metastasis, melanoma, gastrointestinal and renal cancer / sarcoma (e.g., gastric cancer), rhabdomyosarcoma, glioblastoma, preferably glioblastoma multiforme, leiomyosarcoma, squamous cell carcinoma treatable by suppressing proliferation of malignant keratinocytes (e.g., human malignant keratinocytes), basal cell carcinoma, and skin cancer.

[0297] In certain embodiments, the autoimmune disease is selected from the group consisting of lupus erythematosus, rheumatoid arthritis, and GVHD.

[0298] In certain embodiments, the infection is a fungal infection, a parasitic / protozoan infection, malaria, Coccidioides immitis, histoplasmosis, onychomycosis, aspergillosis, blastomycosis, Candida albicans, paracoccidioiomycosis, microsporidiosis, acanthamoeba keratitis, amebiasis, ascariasis, babesiosis, balantidiosis, raccoon ascariasis, Insects, Chagas disease, Clonorchiasis, Cochliomyia infection, Cryptosporidiosis, Diphyllobothriasis, Dracunculiasis, Echinococcosis, Elephantiasis, Enterobiasis, Fasciola hepatica, Fasciola hepatica, Filariasis, Giardiasis, Gnathostomiasis, Tapeworm disease, Isosporiasis, Katayama fever, Leishmaniasis, Lyme disease, Metagonimiasis, Myiasis, Onchocerciasis, Lice disease , SARS-CoV infection, SARS-CoV-2 infection, scabies, schistosomiasis, lethargic encephalitis, strongyloidiasis, taeniasis, toxocariasis, toxoplasmosis, trichinosis, trichuriasis, trypanosomiasis, helminth infection, hepatitis B (HBV), hepatitis C (HCV), herpes virus, Epstein-Barr virus, HIV-1, HIV-2, cytomegalovirus, herpes simplex virus type I, herpes simplex virus type II, human papillomavirus, adenovirus, Kaposi-West sarcoma-associated herpes virus epidemic, thin ring virus (Torquetenovirus), human T-lymphotrophic virus I, human T-lymphotrophic virus II, varicella-zoster, JC virus and BK virus infection.

[0299] In certain embodiments, the recipient has graft-versus-host disease (GVHD) or is predisposed to developing GVHD.

[0300] In certain embodiments, the recipient has a neoplasia (eg, leukemia) or has a propensity to develop a neoplasia (eg, leukemia).

[0301] In certain embodiments, the methods provided herein involve administering to the subject one or more additional modified immune cells or populations thereof, immune checkpoint inhibitors (e.g., anti-PD-L1 antibodies, anti-PD-1 antibodies), one or more cytokines (e.g., IL-2, IFN-α, IFN-γ, or combinations thereof), or one or more chemotherapeutic agents (e.g., cyclophosphamide, doxorubicin, vincristine, prednisone, rituximab, obinutuzumab, bendamustine, chlorambucil, cyclophosphamide, The method further comprises administering one or more additional therapeutic agents, such as ibrutinib, methotrexate, cytarabine, dexamethasone, cisplatin, bortezomib, fludarabine, idelalisib, acalabrutinib, lenalidomide, venetoclax, cyclophosphamide, ifosfamide, etoposide, pentostatin, melphalan, carfilzomib, ixazomib, panobinostat, daratumumab, elotuzumab, thalidomide, lenalidomide, or pomalidomide, or a combination thereof. The one or more additional therapeutic agents described above can be administered before, simultaneously with, or after administration of the recombinant or modified cells provided herein.

[0302] In another aspect, the disclosure also provides a method of reducing a recipient's immune response to a cell transplant, comprising administering to a subject a therapeutically effective amount of a transplant of recombinant or modified cells provided herein, thereby reducing the recipient's immune response.

[0303] In another aspect, the disclosure also provides a method of transplanting cells into a subject with a reduced risk of immune rejection, comprising administering to the subject a therapeutically effective amount of a transplant of recombinant cells provided herein, or modified cells provided herein, wherein the recombinant or modified cells are allogeneic to the subject.

[0304] In some embodiments, the modified or recombinant cells of the present disclosure that are administered to a recipient can expand in vivo and remain in the subject for extended periods of time. If the modified cells are modified immune cells, the modified immune cells can mature into memory immune cells and remain in circulation within the recipient, generating a population of cells that can subsequently respond aggressively to the recurrence of diseased or abnormal cells that express a marker recognized by the CAR of the modified immune cells.

[0305] In certain embodiments, the recipient is administered at least 1×10 4 cells, at least 5 x 10 4 cells, at least 1 x 10 5 cells, at least 5 x 10 5 cells, at least 1 x 10 6 cells, at least 5 x 10 6 cells, at least 1 x 10 7 cells, at least 5 x 10 7 cells, at least 1 x 10 8 cells, at least 5 x 10 8 cells, at least 1 x 10 9 cells, at least 2 x 10 9 cells, at least 3 x 10 9 cells, at least 4 x 10 9 cells, at least 5 x 10 9 cells or at least 1 × 10 10 In certain embodiments, the recipient is administered at least 1×10 cells. 3 At least 5 x 10 cells / kg body weight 3 At least 1 x 10 cells / kg body weight 4 At least 5 x 10 cells / kg body weight 4 At least 1 x 10 cells / kg body weight 5 At least 5 x 10 cells / kg body weight 5 At least 1 x 10 cells / kg body weight 6 At least 5 x 10 cells / kg body weight 6 At least 1 x 10 cells / kg body weight7 At least 5 x 10 cells / kg body weight 7 At least 1 x 10 cells / kg body weight 8 At least 2 x 10 cells / kg body weight 8 At least 3 x 10 cells / kg body weight 8 At least 4 x 10 cells / kg body weight 8 At least 5 x 10 cells / kg body weight 8 cells / kg body weight or at least 6 x 10 8 cells / kg body weight are administered.

[0306] Those skilled in the art will appreciate that dosages of the pharmaceutical compositions provided herein can be determined based on a variety of factors of the recipient, such as size, age, sex, weight, and condition, etc. Dosages can be readily determined by those of skill in the art from this disclosure and knowledge in the art.

[0307] One skilled in the art can readily determine the number of modified / recombinant cells and the amount of any additives, vehicles, media, and / or carriers in the compositions and that can be administered in the methods of the present disclosure. Typically, additives, if present, are present in an amount of 0.001 to 50% (by weight) solution in phosphate buffered saline, and active ingredients (e.g., modified / recombinant cells provided herein) are present in the order of micrograms to milligrams, e.g., about 0.0001 to about 5% by weight, preferably about 0.0001 to about 1% by weight, even more preferably about 0.0001 to about 0.05% by weight or about 0.001 to about 20% by weight, preferably about 0.01 to about 10% by weight, and even more preferably about 0.05 to about 5% by weight.

[0308] It may be preferable to measure toxicity at a particular dose, for example, by determining the lethal dose (LD) and LD50 in a suitable animal model (e.g., mouse). It may also be preferable to determine the timing of administration of the composition to elicit a suitable response. Such determinations would not require undue experimentation from one of ordinary skill in the art and knowledge of this disclosure.

[0309] Administration of the pharmaceutical compositions provided herein can be accomplished using a variety of conventional techniques, including, but not limited to, injection, infusion, or parenteral administration. In some embodiments, parenteral administration includes intravascular, intratumoral, intravenous, intradermal, intramuscular, intraarterial, intratracheal, intrathecal, intraperitoneal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, and intrasternal infusion or injection.

[0310] In certain embodiments, the pharmaceutical compositions provided herein are administered locally to the site of disease (e.g., tumor site). In certain embodiments, the pharmaceutical compositions provided herein are administered to the subject by injection, catheter, suppository, or implant (e.g., of a porous, non-porous, or gelatinous material, e.g., a membrane such as a sialastic membrane). In certain embodiments, the pharmaceutical compositions provided herein are delivered in a controlled release system.

[0311] The therapeutic methods provided herein result in an increase in the survival time of the recipient (e.g., human subject) compared to the expected survival time of the recipient (e.g., human subject) if the human subject is not treated with a pharmaceutical composition provided herein. In another embodiment, the increase in survival time of the human subject is at least 30 days. The increase in survival time of the human subject may be at least 3 months, at least 6 months, or at least 1 year. In certain embodiments, the recipient (e.g., human subject) is intolerant and / or refractory to one or more other treatments for the disease and / or condition (e.g., cancer). In certain embodiments, the recipient (e.g., human subject) has had at least one failed treatment and / or therapy for the disease and / or condition (e.g., cancer) prior to the therapeutic methods of the present disclosure. In certain embodiments, the recipient (e.g., human subject) who can be treated with the methods provided herein is a child (e.g., 0-18 years old) or an adult (e.g., 18 years old or older).

[0312] In certain embodiments, the therapeutic method of the present disclosure relates to the use of modified immune cells (e.g., modified T cells) expressing CAR. CAR can be specifically directed to antigen targets present on unwanted cells (e.g., cancer cells) of the host. In certain embodiments, the modified immune cells (e.g., modified T cells) have enhanced cytotoxic responses against their targets. In certain embodiments, the modified immune cells (e.g., modified T cells) induce enhanced cytotoxic responses against their targets compared to reference cells (e.g., natural T cells).

[0313] In certain embodiments, the modified immune cell (e.g., modified T cell) exhibits an enhanced cytotoxicity response of at least 1.2 fold, 1.4 fold, 1.6 fold, 2 fold, 2.5 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 12 fold, 14 fold, 15 fold, 16 fold, 17 fold, 18 fold, 19 fold, 20 fold, 21 fold, 22 fold, 23 fold, 24 fold, 25 fold, 26 fold or more compared to a reference cell (e.g., a natural T cell).

[0314] In some embodiments, the modified immune cells (e.g., modified T cells) are capable of killing at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 60%, at least 80%, at least 100%, at least 120%, at least 200%, at least 500%, at least 1000%, or at least 2000% more target cells than a reference cell (e.g., a natural T cell). In some embodiments, the modified immune cells (e.g., modified T cells) are administered to an allogeneic host and the modified immune cells (e.g., modified T cells) are subject to reduced or no (or negligible or minimal) rejection by the host. EXAMPLES

[0315] While the present disclosure has been specifically shown and described with reference to certain embodiments, some of which are preferred embodiments, it should be understood by those skilled in the art that various changes in form and detail can be made therein without departing from the spirit and scope of the disclosure disclosed herein.

[0316] Example 1: sgRNA design sgRNA sequences targeting HLA-A, HLA-B, TRAC, CIITA, and PD-1, respectively, were designed based on the genome sequence using GPP sgRNA Designer (an online design tool from Broad Institute, USA) at the whole-exon scale (https: / / portals.broadinstitute.org / gpp / public / analysis-tools / sgrna-design). Tools including "CRISPRko", "SpyoCas9 NGG", and "Human GRCh38" were selected to generate all possible sgRNAs for these genes (Tables 1-4), and the top 10 sgRNAs for each gene were selected as preferred sequences according to priority order.

[0317] According to the "NGG" feature in the target gene sequence, multiple sets of sgRNA sequences were designed to target target DNA sequences in the upstream and downstream sequences of HLA-A and HLA-B genes (Table 1), CIITA (Table 2), and TRAC (Table 3), respectively. Table 1 below lists the target DNA sequences upstream of HLA-A (designated "AU"), downstream of HLA-A (designated "AD"), upstream of HLA-B (designated "BU"), and downstream of HLA-B (designated "BD") targeted by the sgRNAs.

[0318] Table 1. Target genes (HLA-A and HLA-B) and target DNA sequences [Table 1]

[0319] Table 2 Target gene (CIITA) and target DNA sequence [Table 2]

[0320] Table 3. Targeted genes (TRAC) and target DNA sequences [Table 3]

[0321] Table 4. Targeted genes (PD-1) and target DNA sequences [Table 4]

[0322] Table A. Targeted gene (B2M) and target DNA sequence [Table 5]

[0323] Based on the target DNA sequences listed in Tables 1-4 above, sgRNA sequences were designed and synthesized as follows: Each sgRNA of the present application is composed of a 5' targeting fragment and a 3' Cas binding fragment. The 5' targeting fragment is complementary to the target site in the genome and is identical to the 20 nucleotide sequence upstream of the PAM sequence NGG (i.e., the target DNA sequence in Tables 1-4 and Table A above), except that all thymines (T) are replaced with uracils (U). The 3' Cas binding fragment is a consensus motif and has the nucleotide sequence as follows: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (sequence number 59).

[0324] Taking the sgRNA targeting PD-1 as an example, the 5' target DNA sequence has the sequence of CGACTGGCCAGGGCGCCTGT (SEQ ID NO: 60), except for the substitution of T with U, which is linked to the consensus motif of SEQ ID NO: 59 at the 3' end. The complete sgRNA sequence (5'-3') targeting PD-1 is shown below: CGACUGGCCAGGGCGCCUGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (sequence number 61).

[0325] It should be noted that each sgRNA in this example was chemically modified, including interphosphorothioate linkages and 2'-O-methyl (2-OMe modified) ribose sugar modifications at the first three nucleotides at the 5' end, as well as the second, third, and fourth nucleotides at the 3' end of the sgRNA. The final chemically modified sgRNA sequences are listed below, with the modified nucleotides in bold and italic format and marked with an asterisk (*): C*G*A*CUGGCCAGGGCGCCUGUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU*U*U*U (SEQ ID NO: 62)

[0326] Unless otherwise stated, all sgRNA sequences converted from target DNA sequences (in Tables 1 to 4) are synthesized according to the above rules, and sgRNAs are prepared by chemical synthesis.

[0327] Example 2. Construction of chimeric antigen receptor (CAR) expression vector This example shows the construction of an expression vector (Figure 1A) containing a CAR expression cassette expressing CAR linked to a truncated PD-L1 (SEQ ID NO: 19) by P2A.

[0328] The CAR contains an anti-CD19 single-chain Fv (scFv) derived from the antibody FMC63 (CD19-scFv), followed by the CD8a transmembrane domain (CD8aTM), 4-1BB, and CD3ζ.

[0329] Compared to wild-type PD-L1 (1-290, SEQ ID NO: 12), truncated PD-L1 (abbreviated herein as TrPD-L1) lacks the sequence at positions 260-290 at the C-terminus.

[0330] To construct the CAR expression cassette, DNA sequences encoding the following elements were synthesized and ligated in 5' to 3' order: signal peptide (amino acid sequence SEQ ID NO:21), light chain variable region of CD19 antibody FMC63 (amino acid sequence SEQ ID NO:22), linker (amino acid sequence SEQ ID NO:23), heavy chain variable region of CD19 antibody FMC63 (amino acid sequence SEQ ID NO:24), hinge region (amino acid sequence SEQ ID NO:25), CD8α transmembrane domain (TM) (amino acid sequence SEQ ID NO:26), 4-1BB costimulatory signal region (amino acid sequence SEQ ID NO:27), CD3ζ signal transduction domain (amino acid sequence SEQ ID NO:28), P2A (amino acid sequence SEQ ID NO:16), and truncated PD-L1 (TrPD-L1) (amino acid sequence SEQ ID NO:8). The resulting expression cassette encodes the fusion protein CD19 CAR-P2A-TrPD-L1, which has the full-length amino acid sequence of SEQ ID NO:19, and the polynucleotide sequence is shown in SEQ ID NO:20.

[0331] A control CAR expression cassette was also constructed by replacing the TrPD-L1 sequence in the above-mentioned CD19 CAR-P2A-TrPD-L1 expression cassette with the wild-type PD-L1 sequence to generate a control CD19 CAR-P2A-wtPD-L1 expression cassette.

[0332] The CD19 CAR-P2A-TrPD-L1 expression cassette or the CD19 CAR-P2A-wtPD-L1 control expression cassette, as described above, was inserted between the 5'- and 3'-terminal LTR sequences of the pELPS lentiviral vector (purchased from Kingsley Biotechnology) (FIG. 1B), respectively, to construct the CAR expression master plasmid CD19DL1-01, or the control plasmid CD19wtL1, which was then packaged into lentivirus according to the instructions provided by the supplier.

[0333] Example 3. Packaging and detection of lentivirus The CD19DL1-01 plasmid was transfected into 293T cells together with lentivirus packaging plasmids PMDLG / PRRE, PRSV / rev (purchased from Wuxi Shengji Medical Technology Co., Ltd.) and lentivirus envelope plasmid pMD2.G (purchased from Wuxi Shengji Medical Technology Co., Ltd.) using the transfection reagent PEI (polyetherimide, purchased from Polysciences, Inc.). The transfected 293T cells were cultured, and the culture supernatant was collected and concentrated by ultrafiltration and ultracentrifugation to obtain the lentivirus for expressing CD19 CAR-P2A-TrPD-L1.

[0334] Viral titers were detected by flow cytometry. Specifically, the lentivirus solution for expressing CD19 CAR-P2A-TrPD-L1 was diluted 100-fold and added at 1 μL / well, 10 μL / well, 20 μL / well, 30 μL / well, or 50 μL / well to 293T cells cultured for 8 hours in a 24-well plate. After 24 hours, the virus-infected 293T cells were centrifuged, resuspended, and added to 1 × 10 6The cells were adjusted to a cell density of 100 / mL and subsequently biotin-CD19 antigen was added at a final concentration of 1 μg / mL, followed by incubation with secondary antibody APC-streptavidin (purchased from BD), after which the expression of CD19 CAR in 293T cells was detected by flow cytometry.

[0335] The experimental results (FIG. 2) showed that the virus solution prepared by the virus packaging system of this example successfully infected 293T cells and had good infection ability. CD19 CAR was also expressed in the virus-transfected 293T cells and was capable of recognizing CD19 antigen. The virus titer was 2.79×10 8 The calculation results show that the total amount of TU / mL (transducing units / mL) was 100 mg / mL.

[0336] In a similar manner, the control plasmid CD19wtL1 prepared in Example 2 was used to package lentivirus to obtain and test a control virus for expressing CD19 CAR-P2A-wtPD-L1. The results showed that the control virus could also induce the expression of CD19 CAR in 293T cells (data not shown).

[0337] Example 4. Isolation and activation of T cells PBMC cells were removed from the liquid nitrogen tank, collected and counted. The total amount of PBMC cells was calculated according to cell count. An incubation system was also prepared. CD4 and CD8 magnetic sorting beads were added for sorting. Finally, x-vivo culture medium containing IL-2 and 10% FBS was added according to the total amount of sorted T cells. T cell TransAct magnetic beads were added. After mixing, they were placed in a 37℃, 5% CO2 incubator to activate and culture for 2 days.

[0338] Example 5. Viral transfection of activated T cells To prepare T cells expressing CD19-CAR and truncated PD-L1 TrPD-L1, T cells were activated (48 hours after activation) according to Example 4 and 1 × 106 The cells were adjusted to a density of 1000 μg / mL and subsequently transfected with the CD19 CAR-P2A-TrPD-L1 lentivirus obtained from Example 3 at a multiplicity of infection (MOI) of 15. 24 hours after viral infection, the cells were harvested and the expression of CD19-CAR and cleaved PD-L1 (TrPD-L1) was detected by flow cytometry. The results showed that both CD19-CAR (see FIG. 3A) and cleaved PD-L1 (TrPD-L1) (see FIG. 3B) could be highly expressed by the infected T cells, and the proportions of the two were synchronized (the positive expression proportions of CD19-CAR and TrPD-L1 were 37.42% and 41.49%, respectively), indicating that the gene overexpression system used was efficient, stable, and consistent. The resulting T cells expressing CD19-CAR and cleaved PD-L1 (TrPD-L1) are also referred to as TrPDL1-CART cells in this application.

[0339] As a control, T cells activated for 48 hours were infected with CD19 CAR-P2A-wtPD-L1 lentivirus obtained from Example 3 using the same method, the CD19-CAR and the resulting full-length wtPD-L1 expressing T cells are referred to as PDL1-CART cells in this application, and the expression of CD19-CAR and full-length wtPD-L1 was confirmed by flow cytometry (see Figure 3C).

[0340] Example 6. Preparation of a universal CART for T cell electroporation (S1-S7) and flow cytometry To prepare universal CAR-T cells (also known as UCART), the target genes TRAC, HLA-A, HLA-B, CIITA, and PD-1 were knocked out in TrPDL1-CART cells or PDL1-CART cells prepared in Example 5.

[0341] TrPDL1-CART cells or PDL1-CART cells were collected and counted, and gently mixed with electroporation buffer and RNP (ribonucleoprotein, ribonucleoprotein complex: the main component is a complex formed by the Cas9 protein and sgRNA prepared in Example 1), and then electroporation was started. Specifically, the sgRNA targeting HLA-A has the sequences of SEQ ID NO: 74 and 29, the sgRNA targeting HLA-B has the sequences of SEQ ID NO: 38 and 44, the sgRNA targeting CIITA has the sequence of SEQ ID NO: 53, the sgRNA targeting TRAC has the sequence of SEQ ID NO: 57, and the sgRNA targeting PD-1 has the sequence of SEQ ID NO: 58. After electroporation, the mixture was cultured in pre-warmed medium. After electroporation, the cells were sampled and counted every 2 days, and important parameters such as cell viability, total viable cell number, and cell diameter were recorded. After 7 days of culture, the knockout efficiency of the relevant genes was detected.

[0342] The resulting TrPDL1-CART cells in which the target genes (TRAC, HLA-A, HLA-B, CIITA, and PD-1) were knocked out were called TrPDL1-UCART cells. The resulting PDL1-CART cells in which the target genes (TRAC, HLA-A, HLA-B, CIITA, and PD-1) were knocked out were called PDL1-UCART cells.

[0343] Seven days after electroporation, sufficient numbers of natural T cells, TrPDL1-CART from Example 5, and TrPDL1-UCART cells from this Example were detected by flow cytometry for expression of HLA-A, HLA-B, HLA-DR (to verify knockout of CIITA), and CD3 (to verify knockout of TRAC). Detection antibodies were diluted in the dark with staining buffer according to the recommended dilution ratios shown in the table below.

[0344] Table 5 [Table 6]

[0345] The results showed that the above genes were effectively knocked out in TrPDL1-UCART cells, and the positive rates of HLA-A, HLA-B, HLA-DR, and CD3 expression were reduced to 25.38%, 4.67%, 23.85%, and 23.83%, respectively. The experimental results are shown in Table 6 as follows. PD-1 expression was also effectively knocked out (data not shown). PDL1-UCART cells had similar CD3, HLA-A, HLA-B, and HLA-DR expression rates as TrPDL1-UCART cells.

[0346] Table 6. Percentage of positive HLA-A, HLA-B, HLA-DR, and CD3 expression in cells [Table 7]

[0347] Example 7. Enrichment of CD3 negative cells To enrich for CD3-negative cells, the TrPDL1-UCART cells obtained from Example 6 were resuspended in an appropriate amount of enrichment buffer at an appropriate density, and then anti-human CD3 magnetic beads were added in proportion to the total number of cells to enrich for CD3-negative cells by magnetic bead column chromatography. An appropriate amount of purified cells was taken for flow cytometry to detect the positive rate of CD3, and the remaining cells were placed in a 37°C, 5% CO2 incubator overnight. Table 7 below shows the enrichment results detected by flow cytometry.

[0348] Table 7. Percentage of positive intracellular CD3 expression [Table 8]

[0349] The results showed that the CD3 positive rate was 25.6% before enrichment (i.e., 25.6% of the TrPDL1-UCART cells expressed CD3) and decreased to 0.36% after enrichment (i.e., only 0.36% of the enriched TrPDL1-UCART cells expressed CD3), indicating that the purity of CD3-negative TrPDL1-UCART cells was significantly improved.

[0350] Example 8. Detection of cytotoxicity of TrPDL1-CART and TrPDL1-UCART To test the cytotoxicity of TrPDL1-UCART, cell killing experiments were performed using enriched CD3-negative TrPDL1-UCART obtained in Example 7 as effector cells and luciferase-expressing Raji cells as target cells. As a control, natural T cells or TrPDL1-CART cells obtained from Example 5 were used as effector cells in parallel control experiments with the same target cells.

[0351] To obtain sufficient effector and target cells, effector cells were cultured at 4.0 x 10 6 Dilute target cells to a density of 2.0 x 10 / mL. 5 The cells were diluted to a density of 1:1.19 / mL. TrPDL1-CART was measured to have an anti-CD19 CAR expression rate of 63.05%, and TrPDL1-UCART was measured to have an anti-CD19 CAR expression rate of 75.58%. To ensure that the levels of anti-CD19 CAR in these cells were comparable, the volumes of TrPDL1-CART and TrPDL1-UCART cells were further adjusted to be diluted 1:1.19 relative to TrPDL1-UCART.

[0352] TrPDL1-CART and TrPDL1-UCART effector cells were then further diluted in X-VIVO complete medium according to the following gradient: 20:1, 15:1, 10:1, 5:1, 2:1, and 1:1.

[0353] Effector cells (naive T cells, TrPDL1-CART, or TrPDL1-UCART) were mixed with target cells at 50 uL / well:50 uL / well. After 24 and 48 hours of culture, 100 uL / well of luciferase substrate was added, and the OD value was read by a microplate reader to detect luciferase activity in the cells.

[0354] The results (Figures 4A and 4B) showed that TrPDL1-CART and TrPDL1-UCART could significantly kill target cells, and the killing effect was improved with increasing effector:target (E:T) ratio, indicating that the CART and UCART cells expressing truncated PD-L1 constructed according to the present invention had good cytotoxicity in target cells.

[0355] Example 9. ELISA detection of IFN-γ and TNF-α secreted by TrPDL1-CART and TrPDL1-UCART To test cytotoxicity, TrPDL1-UCART were used as effector cells and luciferase-expressing Raji cells were used as target cells, and the release of cytokines TNF-α and IFN-γ was detected 24 hours after incubation of effector cells with target cells. As a control, natural T cells or TrPDL1-CART cells obtained from Example 5 were tested as effector cells in parallel control experiments.

[0356] After 24 hours of co-culture, the cell supernatants were transferred to new centrifuge tubes and centrifuged to remove cell debris, and the supernatants were harvested to detect TNF-α and IFN-γ by ELISA.

[0357] The results showed that both TrPDL1-CART and TrPDL1-UCART could significantly release TNF-α and IFN-γ after co-culture with target cells (Figure 5), indicating that the universal CAR-T cells constructed according to the present invention had normal cytokine expression ability.

[0358] Example 10. MLR (mixed lymphocyte reaction) experiments using allogeneic PBMCs To evaluate whether CAR-T cells expressing truncated PD-L1 TrPDL1 could alleviate immune rejection from the allogeneic host immune system in vivo, mixed lymphocyte reaction experiments were performed in which peripheral blood mononuclear cells (PBMCs) from allogeneic individuals were used as effector cells and CAR-T cells expressing truncated PD-L1 TrPDL1 were used as target cells.

[0359] 1) Natural T cells, 2) TrPDL1-B2M - / - Different target cells were tested, including TrPDL1-CART cells, 3) TrPDL1-CART cells (prepared in Example 5), and 4) TrPDL1-UCART cells (prepared in Example 6 and enriched for CD3 negative in Example 7).

[0360] TrPDL1-B2M - / - -CART cells were prepared using a method similar to that described in Example 6. Briefly, TrPDL1-CART cells obtained from Example 5 were knocked out using sgRNA targeting B2M (see Example 1), and the knockout efficiency was detected by a method similar to that shown in Example 6. The results showed that TrPDL1-B2M - / - -The expression rate of B2M in CART cells was 2.25%.

[0361] Mixed lymphocyte reactions between the above target cells and allogeneic PBMC were performed as follows.

[0362] Preparation of effector cells: Allogeneic monocytes and PBMC cells were counted by centrifugation at 1200 rpm, washed and resuspended in PBS. The cell density was adjusted to 2×10 for future use. 5 / mL.

[0363] Target cell preparation: innate T cells, TrPDL1-B2M - / -TrPDL1-CART, TrPDL1-CART, and TrPDL1-UCART cells were irradiated with 2 Gy to destroy their proliferation ability, and then stained with 5 μM of the cell proliferation dye CFSE for 15 min at room temperature, and the cell density was reduced to 2 × 10 for future use. 5 / mL.

[0364] Mixed lymphocyte reaction: Stained target cells and allogeneic PBMCs were co-cultured in appropriate ratios in 96-well culture plates, and cells were harvested after 24 hours of culture.

[0365] The percentage of CD45+CFSE+ double positive cells was measured by flow cytometry, and the removal efficiency of target cells in the mixed lymphocyte reaction was calculated. If allogeneic PBMC cells have immune rejection in target cells, the target cells are lysed and the cell membrane is destroyed, so that CFSE fluorescence on the target cell surface cannot be detected. CD45 is a pan-leukocyte marker and is used to localize leukocytes, and the exclusion of non-leukocytes in PBMCs allows for more accurate localization of target cells.

[0366] The experimental results are shown in Table 8 below. The results showed that TrPDL1-UCART, when co-cultured with PBMCs from allogeneic individuals, could significantly inhibit allogeneic PBMC-derived immune rejection and was not eliminated by allogeneic PBMCs. In contrast, TrPDL1-B2M - / - -CART and TrPDL1-CART cells were still cleared by allogeneic PBMCs, suggesting that TrPDL1-UCART could significantly reduce immune rejection against allogeneic cells and was significantly more efficient than universal CAR-T cells with only B2M knockout.

[0367] Table 8 [Table 9]

[0368] Example 11. Effect of PD-1 engagement on TrPDL1-UCART and PDL1-UCART cells Both PD-1 and PD-L1 can mediate inhibitory signaling to T cells. The full-length PD-L1 sequence contains an intracellular domain. To examine whether truncation of the intracellular domain of PD-L1 can reduce the inhibitory signaling transmitted to T cells upon PD-L1 activation, we compared the cell proliferation and cytotoxicity of UCAR-T cells expressing full-length wtPD-L1 and UCAR cells expressing truncated PD-L1 TrPDL1 in the presence of PD-1-expressing cells.

[0369] Preparation of effector cells: CD19-binding TrPDL1-UCART and PDL1-UCART cells were prepared according to Example 6, then stained with 5 μM of the cell proliferation dye CFSE at room temperature for 15 min, and diluted at 2 × 10 5 The cells were adjusted to a cell density of 1 / mL.

[0370] Preparation of target cells: Raji-luciferase cells expressing PD-1 were obtained by recombinantly expressing human PD-1 in the Raji-luciferase cells provided in Example 8. Raji-luciferase cells also naturally express CD19. The cell density was adjusted to 2×10 for future use. 5 / mL.

[0371] Mixed lymphocyte reaction: the effector cells and target cells prepared above were mixed at a 1:1 ratio and cultured in a 96-well culture plate, and the cells were harvested after 0, 24, 48, and 72 hours, respectively.

[0372] The proliferation of effector cells and the efficiency of target cell elimination in the mixed lymphocyte reaction were evaluated by measuring the percentage of CFSE+ positive cells and CD19 positive cells by flow cytometry.

[0373] The results are shown in Tables 9 and 10 below. The results show that in the presence of cells expressing PD-1, PDL1-UCART cells expressing full-length PD-L1 suffered significant inhibition in both proliferation and target cell cytotoxicity, with only 1-fold proliferation at 72 hours and only less than 40% killing effect on target cells. In contrast, UCART expressing truncated PD-L1 TrPDL1 not only maintained high cell proliferation (more than 17-fold proliferation at 72 hours), but also showed significant target cell killing (99% killing of target cells was observed at 72 hours). This suggests that truncated PD-L1 TrPDL1 can significantly reduce PD-L1-mediated inhibition after PD-1 engagement, and greatly improve both UCART cell proliferation and cell killing effect.

[0374] Table 9 [Table 10]

[0375] Table 10 [Table 11]

[0376] Example 12. Evaluation of UCART without PD-1 knockout The proliferation and cytotoxicity of PD-L1-expressing UCAR-T cells with or without PD-1 knockout were further examined.

[0377] Preparation of effector cells: TrPDL1-UCART was prepared according to the method shown in Example 6, in which PD-1 was knocked out and truncated PD-L1 TrPDL1 was expressed. Using a method similar to that described in Example 6, mutant cells of TrPDL1-UCART in which PD-1 was not knocked out, expressing both PD-1 and truncated PD-L1, were prepared and designated PD-1+TrPDL1-UCART. Both TrPDL1-UCART and PD-1+TrPDL1-UCART were stained with 5 μM cell proliferation dye CFSE at room temperature for 15 min, and the cell density was adjusted to 2×10 for future use. 5 / mL.

[0378] Preparation of target cells: The cell density of Raji-luciferase cells as shown in Example 8 was adjusted to 2×10 for future use. 5 The cells also naturally express CD19.

[0379] Mixed lymphocyte reaction: The above effector cells and target cells were mixed in a 1:1 ratio in a 96-well culture plate, and 100 μL of target cell and effector cell suspension was added to each well, with triplicate wells for each group. The cells were cultured at 37° C. in a 5% CO2 incubator, and the cells were harvested after 0 h, 24 h, 48 h, and 72 h.

[0380] The ratios of CFSE-positive effector cells and CD19-positive target cells were measured by flow cytometry to evaluate the proliferation of effector cells and the efficiency of target cell clearance in the mixed lymphocyte reaction. The results are shown in Tables 11 and 12 below.

[0381] Table 11 [Table 12]

[0382] Table 12 [Table 13]

[0383] The results showed that when UCART cells expressed both PD-1 and PD-L1, their cell proliferation and cytotoxicity were significantly inhibited, with proliferation at 1.88-fold at 72 hours and cytotoxicity to target cells only below 50%. Because the target cells used in this experiment do not express PD-1, it is speculated that the interaction between PD-1 expressed in UCART cells and PD-L1 expressed in other UCART cells leads to the self-inhibition of proliferation and cytotoxicity of UCART cells expressing both PD-1 and PD-L1.

[0384] In contrast, when PD-L1-expressing UCART cells were knocked out with PD-1, they not only maintained high cell proliferation, with over 11-fold increase in proliferation at 72 hours, but also showed a significant increase in cytotoxicity, with 99% killing of target cells at 72 hours. This suggests that knocking out an endogenous inhibitory checkpoint molecule while expressing a ligand for the knocked-out checkpoint in UCART cells can significantly improve the proliferation and cytotoxicity of UCART cells and circumvent autoinhibition among UCART cells.

[0385] Example 13. Evaluation of UCART expressing full-length PD-L1 and truncated PD-L1 by Western blot To evaluate the difference between truncated PD-L1 TrPDL1 and full-length PD-L1 in UCAR-T cells, UCAR-T cells were prepared according to Example 6, in which target genes including TRAC, HLA-A, HLA-B, CIITA, and PD-1 were knocked out using Cas9 protein and sgRNAs directed against these target genes. Such UCAR-T cells were also generated to express truncated PD-L1 TrPDL1 (herein referred to as TrPDL1-UCART cells) or to express full-length PDL1 (herein referred to as PDL1-UCART). The two groups of UCAR-T cells were derived from the same donor.

[0386] TrPDL1-UCART cells and PDL1-UCART cells were incubated with CD3 / CD28 beads (20 μL × 10 8 cells) and recombinant (His-tagged) human PD-1 protein (10 μg / 1 × 10 8 T cells were treated with CD3 / CD28 and recombinant human PD-1 protein (SinoBiological, Cat:10377-H08H-B) for 2 hours. After treatment, cells were harvested and lysed, followed by analysis of phosphorylated p38 (p-P38) protein and phosphorylated AKT protein (p-AKT) by Western blot. Since T cell activation results in the phosphorylation of p38 and AKT, the levels of p-P38 and p-AKT can indicate the level of T cell activation after treatment with CD3 / CD28 and recombinant human PD-1 protein.

[0387] As shown in FIG. 7, in PDL1-UCART cells expressing full-length PD-L1, the levels of p-P38 and p-AKT after CD3 / CD28 treatment were significantly inhibited by the presence of recombinant human PD-1 protein. In contrast, TrPDL1-UCART cells expressing truncated PD-L1, which maintained good levels of p-P38 and p-AKT after CD3 / CD28 bead treatment, suggesting the presence of PD-1, despite the presence of recombinant human PD-1 protein, did not significantly inhibit the action of T cells expressing truncated PD-L1. This suggests that full-length PD-L1 can mediate immune inhibitory signals after interaction with PD-1, but truncated PD-L1 does not transmit such immune inhibitory signals despite the presence of PD-1. Thus, TrPDL1-UCART cells are more effective than PDL1-UCART cells in activating T cells.

[0388] Example 14. Assessment of T cells expressing full-length and truncated PD-L1 by FACS To assess differences in PD-1 and PD-L1 expression on T cells, natural T cells were obtained and purified from a single donor.

[0389] The T cells were divided into four groups. In group 1 and group 2 cells, PD-1 was knocked out using Cas9 protein and sgRNA directed against PD-1. As described in Example 3, group 1 cells were further transfected with a vector encoding PD-L1, and group 2 cells were further transfected with a vector encoding TrPD-L1. The knockout of PD-1 and the expression of PD-L1 or TrPD-L1 were confirmed using FACS. The resulting group 1 cells were transfected with PD1 - / - The resulting group 2 cells were called PD1 +TrPD-L1 cells. - / - These are called +PD-L1 cells.

[0390] Group 3 cells were transfected with a vector encoding PD-L1, and Group 4 cells were further transfected with a vector encoding TrPD-L1, as described in Example 3. No other modifications were made to Group 3 or Group 4 cells. Expression of PD-L1 or TrPD-L1 was confirmed using FACS. The resulting Group 3 cells were transfected with a vector encoding PD1 + / + The resulting group 4 cells were called PD1 +TrPD-L1 cells. + / + These are called +PD-L1 cells.

[0391] The four groups of cells were cultured in 100 mL of CD3 / CD28 beads (20 μL / 1 × 10 8 cells), and recombinant (His-tagged) human PD-1 protein (100 μg / 1 × 10 8 cells (SinoBiological, Cat:10377-H08H-B), and then 15 min later, recombinant PD-L1 protein (200 μg / 1 × 10 8 Wild-type T cells were used as a control, and CD3 / CD28 beads (20 μL / 1 × 10 8 Six hours after treatment, cells were harvested, permeabilized, fixed, and then analyzed for phosphorylated p38 (p-P38) and phosphorylated AKT (p-AKT) proteins by FACS.

[0392] The results showed that in the presence of CD3 / CD28 beads, recombinant human PD-1 protein, and recombinant human PD-L1 protein, the cells in group 1 (PD1 - / - +TrPD-L1 T cells) were comparable to those in control T cells, indicating that immune inhibition was not observed in such cells despite the expression of TrPD-L1. - / - +PD-L1 T cells) and group 4 cells (PD1 + / + +PD-L1 T cells), the expression levels of p-P38 and p-AKT were significantly reduced (see Figure 8), with group 4 cells having the lowest expression levels of p-P38 and p-AKT, indicating that such cells have the most potent immune inhibition.

[0393] Example 15. Preparation and evaluation of PSMA-targeted UCAR-T

[0394] A PSMA-targeted CAR expression cassette was constructed following a similar procedure as outlined in Example 2, except that the anti-CD19 scFv was replaced by an anti-PSMA scFv (PSMA-scFv) derived from the antibody J591, which has the light chain variable region of the anti-PSMA antibody J591 (amino acid sequence SEQ ID NO: 81) and the heavy chain variable region of the anti-PSMA antibody J591 (amino acid sequence SEQ ID NO: 82). The resulting expression cassette encodes the fusion protein PSMA CAR-P2A-TrPD-L1, which has the full-length amino acid sequence of SEQ ID NO: 83, and the polynucleotide sequence is shown in SEQ ID NO: 84.

[0395] The same procedures as those described in Examples 3, 4, and 5 were followed to prepare PSMA-targeted CAR-T cells, and CAR-T cells expressing anti-PSMA CAR and TrPD-L1 were obtained. These cells were called PSMA-targeted CAR-T cells and used as controls.

[0396] To prepare universal CAR-T cells, the PSMA-targeted CAR-T cells were further treated with Cas9 protein and sgRNAs targeting TRAC, HLA-A, HLA-B, CIITA, and PD-1 to knock out these target genes, as described in Example 6.

[0397] The obtained PSMA-targeted universal CAR-T cells with the above target genes (TRAC, HLA-A, HLA-B, CIITA, and PD-1) knocked out were called PSMA-targeted UCART cells. As described in Example 7, the PSMA-targeted UCAR cells were treated and enriched for CD3-negative cells. The results showed that the above genes were efficiently knocked out in the PSMA-targeted UCAR T cells, and the positive rates of HLA-A, HLA-B, HLA-DR, and CD3 expression were reduced to 98.00%, 97.3%, 67.6%, and 98.9%, respectively. The experimental results are shown in Table 13 as follows: PD-1 expression was also efficiently knocked out (data not shown).

[0398] Table 13 [Table 14]

[0399] To test the cytotoxicity of PSMA-targeted UCAR T cells, cell killing experiments were performed with effector and target cells (luciferase-expressing prostate cancer PC3 cells) at various effector-target ratios of 0.25:1, 0.5:1, 1:1, and 2:1, following the same procedure as described in Example 8. Three types of effector cells were studied in parallel, including enriched CD3-negative PSMA-targeted UCAR T cells, control PSMA-targeted CAR-T cells expressing anti-PSMA CAR and TrPD-L1 and without knocking out the target gene, and natural T cells.

[0400] After 24 hours of culture, luciferase substrate was added, and the OD value was read by a microplate reader to detect luciferase activity in the cells. This indicated the viability of target cells, and was converted into a cytolysis rate. The results (Figure 9A) showed that both PSMA-targeted UCAR T and PSMA-targeted CAR-T significantly killed target cells, and the killing effect improved with increasing effector:target (E:T) ratio. This indicates that PSMA-targeted UCAR-T and PSMA-targeted CAR-T had good cytotoxicity in target cells. PSMA-targeted UCAR-T showed better cytotoxicity than PSMA-targeted CAR-T under the same effector:target (E:T) ratio.

[0401] To test cytotoxicity, the cytokine IFN-γ release was detected by ELISA 24 hours after incubation of effector cells with target cells as described in Example 9.

[0402] The results showed that both PSMA-targeted UCAR-T and PSMA-targeted CAR-T could significantly release IFN-γ after co-culture with target cells (Figure 9B), indicating that anti-PSMA CAR-T cells and anti-PSMA UCART cells had normal cytokine expression capacity.

[0403] Example 15. PD-L1 Mutants PD-L1 variants are prepared in which at least one mutation (particularly a deletion) has been introduced into the intracellular domain of PD-L1, particularly in the motif spanning amino acid residues 268 to 271 corresponding to full-length PD-L1. The motif of amino acid residues 268 to 271 is a beta sheet and is believed to contain or be part of a tertiary structure important for the biological activity of the intracellular domain of PD-L1. Mutations or deletions within this motif can disrupt intracellular signaling of PD-L1 and potentially reduce immune inhibitory signaling.

[0404] A group of PD-L1 mutants is generated in which deletions are introduced at amino acid residues 268, 269, 270, and / or 271, corresponding to full-length PD-L1. The PD-L1 mutants are each expressed in T cells isolated from human donors. The PD-L1 mutant-expressing T cells are activated with CD3 / CD28 beads in the presence or absence of His-PD-1 protein, followed by detection of phosphorylation of P38 and AKT using Western blot (similar to the procedure described in Example 13) or by FACS (similar to the procedure described in Example 14). The results show that deletions and mutations within the fragment of amino acid residues 268 to 271 of PD-L1 can reduce the intracellular signaling of PD-L1.

Claims

1. A modified cell or population thereof, wherein the modified cell, compared to an unmodified corresponding cell, has: lacking an endogenous inhibitory checkpoint molecule, and engineered to express a ligand of the defective endogenous inhibitory checkpoint molecule; Modified cells or populations thereof.

2. the ligand is a variant of a cognate ligand and has a reduced ability to induce immune inhibitory signaling compared to the cognate ligand; The modified cell of claim 1 .

3. A modified cell or population thereof, wherein the modified cell has been engineered to express a ligand of an inhibitory checkpoint molecule, the ligand being a mutant of the cognate ligand and having a reduced ability to induce immune inhibitory signaling compared to the cognate ligand. The modified cell or a population thereof,

4. the cell is deficient in an inhibitory checkpoint molecule corresponding to the ligand; The modified cell of claim 3.

5. The cells are a) an animal or human cell; b) an immune cell; c) a stem cell or a cell differentiated from the stem cell; d) suitable for transplantation; e) is allogeneic with respect to the intended recipient of the cells; or f) any combination thereof; 2. The modified cell according to any one of the preceding claims.

6. a) the cell is an immune cell, the immune cell being a T cell, a natural killer (NK) cell, an NKT cell, a B cell, a macrophage cell, a tumor infiltrating lymphocyte, a monocyte, a dendritic cell (DC cell), a neutrophil, or a γδ T cell; or b) the cell is a stem cell or a cell differentiated from the stem cell, the stem cell being a hematopoietic progenitor cell (e.g., a T cell progenitor, an NK cell progenitor, a macrophage progenitor), a hematopoietic stem cell (HSC), a CD34+ cell, a cell line of an embryonic stem cell, a mesenchymal stem cell, or an iPSC cell; The modified cell of claim 5 .

7. the T cells are selected from the group consisting of CD4+ T cells, CD8+ T cells, cytotoxic T cells, terminal effector T cells, memory T cells, naive T cells, regulatory T cells, natural killer T cells, γδ T cells, cytokine-induced killer (CIK) T cells, and tumor-infiltrating lymphocytes, and are optionally activated T cells; The modified cell of claim 6.

8. a) the inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, KIR, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329); and / or b) the ligand is selected from the group consisting of PD-L1, PD-L2, HMGB1, Ceacam-1, phosphatidylserine (PS), LSECtin, a-synuclein, FGL1, adenosine, HVEM (herpes virus entry mediator), CD28, B7-H3 (CD276), B7-H4 (VTCN1), PVR (CD155), MHC class I, sialoglycoprotein, CD112, CD113, galectin 9, CD24, and CD47; The modified cell of any one of claims 1, 2, or 4 to 7.

9. a) the inhibitory checkpoint molecule is PD-1 and the ligand comprises at least one of PD-L1 or a variant thereof, or PD-L2 or a functional equivalent thereof; b) the inhibitory checkpoint molecule is TIM3 and the ligand comprises at least one of galectin 9, HMGB1, Ceacam-1, or phosphatidylserine (PS), or a functional equivalent thereof; c) the inhibitory checkpoint molecule is LAG-3 and the ligand comprises at least one of galectin-3, LSECtin, a-synuclein, or FGL1, or a functional equivalent thereof; d) the inhibitory checkpoint molecule is TIGIT and the ligand comprises at least one of CD155, CD113, or CD112, or a functional equivalent thereof; e) the inhibitory checkpoint molecule is the adenosine A2A receptor (A2AR) and the ligand comprises adenosine; f) the inhibitory checkpoint molecule is BTLA and the ligand comprises HVEM (herpes virus entry mediator) or a functional equivalent thereof; g) the inhibitory checkpoint molecule is CTLA-4 and the ligand comprises CD28 or a functional equivalent thereof; h) the inhibitory checkpoint molecule is a killer cell immunoglobulin-like receptor (KIR) and the ligand comprises an MHC class I molecule (e.g., other than HLA-A, HLA-B), or a functional equivalent thereof; i) the inhibitory checkpoint molecule is VISTA (V domain Ig inhibitor of T cell activation) and the ligand comprises at least one of PD-L1 or PD-L2, or a functional equivalent thereof; j) the inhibitory checkpoint molecule is SIGLEC-7 (sialic acid-binding immunoglobulin-type lectin 7, CD328) and the ligand comprises a sialoglycoprotein or a functional equivalent thereof; or k) the inhibitory checkpoint molecule is SIGLEC-9 (CD329) and the ligand comprises a sialoglycoprotein or a functional equivalent thereof; The modified cell of claim 8.

10. a) the cell is a T cell and the inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), CTLA-4 (CD152), IDO1, IDO2, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329); b) the cell is a natural killer (NK) cell and the inhibitory checkpoint molecule is selected from the group consisting of PD-1, TIM3, TIGIT, LAG3, A2AR, BTLA (CD272), IDO1, IDO2, KIR, TDO, NOX2, VISTA, SIGLEC7 (CD328), PVR (CD155), and SIGLEC9 (CD329); c) the cell is a dendritic cell (DC cell) and the inhibitory checkpoint molecule is selected from the group consisting of A2AR, CD47, IDO1, IDO2, and TDO; or d) the cell is a macrophage and the inhibitory checkpoint molecule is selected from the group consisting of A2AR, CD47, IDO1, IDO2, and CD24; The modified cell of claim 8.

11. the variant lacks a functional immunoinhibitory signaling domain of the cognate ligand; The modified cell according to any one of claims 2 to 10.

12. the variant comprises at least one mutation that reduces the ability of the cognate ligand to induce immune inhibitory signaling; The modified cell of claim 11.

13. The at least one mutation comprises a substitution, a deletion, an insertion, or any combination thereof; The modified cell of claim 12.

14. The at least one mutation comprises a deletion of at least one amino acid residue. The modified cell of claim 13.

15. The cognate ligand comprises an extracellular domain, a transmembrane domain, and an intracellular domain. The modified cell according to any one of claims 2 to 14.

16. the at least one mutation is in the intracellular domain of the cognate ligand, or in the transmembrane domain of the cognate ligand, or in the extracellular domain of the cognate ligand, or any combination thereof; The modified cell of claim 15.

17. The mutant is a PD-L1 mutant or a PD-L2 mutant. The modified cell according to any one of claims 9 to 16.

18. the PD-L1 mutant comprises at least one mutation in the intracellular domain (e.g., SEQ ID NO:1), or in the transmembrane domain (e.g., SEQ ID NO:2), or in the extracellular domain (e.g., SEQ ID NO:3), or in a domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO:5), or in any combination thereof, wherein the at least one mutation reduces the ability of the PD-L1 to induce immune inhibitory signaling; The modified cell of claim 17.

19. The PD-L1 variant comprises a deletion of at least a portion of the intracellular domain of PD-L1 (e.g., SEQ ID NO: 1), or a deletion of at least a portion of the transmembrane domain of PD-L1 (e.g., SEQ ID NO: 2), or a deletion of at least a portion of the extracellular domain of PD-L1 (e.g., SEQ ID NO: 3), or a deletion of at least a portion of a domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO: 5), or any combination thereof.

19. The modified cell of claim 17 or 18.

20. the PD-L1 variant comprises an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 100% identical to SEQ ID NO:11, or a portion of the same length as SEQ ID NO:11, and the PD-L1 variant does not comprise the amino acid sequence of SEQ ID NO:11; The modified cell according to any one of claims 17 to 19.

21. The PD-L1 variant comprises the amino acid sequence of SEQ ID NO:

7. The modified cell of claim 19.

22. The modified cell comprises: a) a first mutation in a coding or regulatory sequence in a genomic region of the inhibitory checkpoint molecule, the first mutation reducing expression or activity of the inhibitory checkpoint molecule; or b) a first interfering oligonucleotide that targets an mRNA of the inhibitory checkpoint molecule, the first interfering oligonucleotide reducing expression of the inhibitory checkpoint molecule; and c) an introduced protein, polypeptide, or small molecule that inhibits the expression and / or activity of the inhibitory checkpoint molecule. A modified cell according to any one of claims 1 to 2 and 4 to 21.

23. the modified cell comprises a first exogenous polynucleotide comprising a coding sequence for the ligand; 2. The modified cell according to any one of the preceding claims.

24. the first exogenous polynucleotide further comprises a coding sequence for a signal peptide operably linked to the coding sequence for the ligand; The modified cell of claim 23.

25. The first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the ligand.

25. The modified cell of claim 23 or 24.

26. the first exogenous polynucleotide is an mRNA or an expression vector, optionally a viral expression vector; 26. The modified cell of claim 24 or 25.

27. The modified cells are transduced with expression of the ligand.

2. The modified cell according to any one of the preceding claims.

28. The cell further lacks: a) an MHC class I protein; or b) an MHC class II protein or an MHC class II transactivator; or c) both a) and b).

2. The modified cell according to any one of the preceding claims.

29. the MHC class I protein comprises HLA-A, or HLA-B, HLA-C, B2M, or any combination thereof, and optionally the cells are further deficient in both HLA-A and HLA-B; The modified cell of claim 28.

30. the MHC class II proteins include HLA-DP, HLA-DM, HLA-DOA, HLA-DOB, HLA-DQ, HLA-DR, or any combination thereof, and optionally the cells further lack HLA-DR; The modified cell according to any one of claims 28 to 29.

31. the MHC class II transactivator is CIITA, and optionally the cell is deficient in CIITA; The modified cell according to any one of claims 28 to 30.

32. the cell further lacks an endogenous TCR, and optionally the cell further lacks a T cell receptor alpha chain constant region (TRAC), a T cell receptor beta constant 1 (TRBC1), a T cell receptor beta constant 2 (TRBC2), or any combination thereof.

2. The modified cell according to any one of the preceding claims.

33. The modified cell comprises: a) a second mutation in a coding or regulatory sequence within the genomic region of the MHC class I protein, the second mutation reducing expression or activity of the MHC class I protein; or b) a second interfering oligonucleotide that targets the mRNA of the MHC class I protein, thereby reducing expression of the MHC class I protein in the The modified cell according to any one of claims 28 to 30.

34. The modified cell comprises: a) a third mutation in a coding or regulatory sequence in a genomic region of the MHC class II protein or MHC class II transactivator (e.g., CIITA), which reduces expression or activity of the MHC class II protein or MHC class II transactivator (e.g., CIITA); or b) a third interfering oligonucleotide that targets the mRNA of the MHC class II protein or MHC class II transactivator (e.g., CIITA), thereby reducing expression of the MHC class II protein or MHC class II transactivator (e.g., CIITA) in the The modified cell according to any one of claims 28 to 31.

35. the modified cell comprises a) a fourth mutation in a coding or regulatory sequence within the genomic region of the endogenous TCR or TRAC or TRBC1 or TRBC2, which fourth mutation reduces expression or activity of the endogenous TCR or TRAC or TRBC1 or TRBC2, or b) a fourth interfering oligonucleotide which targets the endogenous TCR or TRAC or TRBC1 or TRBC2 mRNA, thereby reducing expression of the TCR or TRAC or TRBC1 or TRBC2 in the The modified cell according to any one of claims 28 to 34.

36. The second mutation, the third mutation, or the fourth mutation, or any combination thereof, is introduced by gene editing; The modified cell according to any one of claims 33 to 35.

37. the modified cell has been modified or is further modified to introduce a second exogenous polynucleotide comprising a coding sequence for a polypeptide of interest, and optionally the modified cell expresses the polypeptide of interest; 2. The modified cell according to any one of the preceding claims.

38. The polypeptide of interest comprises a chimeric antigen receptor (CAR), or a recombinant TCR, or other cell surface receptor, or ligand. The modified cell of claim 37.

39. The CAR comprises an antigen binding domain, a transmembrane domain, and an intracellular signaling domain, and optionally, the CAR further comprises a costimulatory signal region. The modified cell of claim 38.

40. The intracellular signaling domain comprises a TCR signaling domain. The modified cell of claim 39.

41. The recombinant TCR comprises a recombinant antigen-binding domain. The modified cell of claim 38.

42. The modified cell is a modified T cell, and optionally, the modified T cell further lacks an endogenous T cell receptor. The modified cell according to any one of claims 37 to 41.

43. the antigen binding domain of the CAR or the recombinant TCR is capable of binding to a target antigen, optionally a target cell antigen; The modified cell according to any one of claims 37 to 41.

44. The target cell antigen comprises a tumor antigen, an inflammation-associated antigen, an autoimmune-associated antigen, or an infectious agent-associated antigen. The modified cell of claim 43.

45. The target cell antigen is associated with a disease selected from the group consisting of cancer, an autoimmune disease, an infectious disease, a metabolic disease, and a genetic disease. The modified cell of claim 44.

46. the tumor antigen is BCMA, CD7, CD10, CD19, CD20, CD22, CD24, CD30, CD33, CD34, CD38, CD44, CD79a, CD79b, CD123, CD138, CD 179b, CEA, CLEC12A, claudin 18.2, CS-1, DLL3, EGFR, EGFRvIII, EPCAM, FLT-3, FOLR1, FOLR3, GD2, gpA33, GPC3, HER2, HM1.24, LGR5, mesothelin, MSLN, MCSP, MICA / B, PSMA, PAMA, P-cadherin, or ROR1; The modified cell of claim 44.

47. The cells are expanded ex vivo.

2. The modified cell according to any one of the preceding claims.

48. 10. A population of modified cells according to any one of the preceding claims, wherein the population of modified cells expresses both the endogenous inhibitory checkpoint molecule and the ligand for the endogenous inhibitory checkpoint molecule, compared to a comparison population of corresponding cells which are innate cells (i.e. innate immune cells), a) Decreased self-control, b) improving effector cell function; and / or c) improving cell activation and / or proliferation; 2. A population of modified cells according to any one of the preceding claims, having one or more of the following characteristics:

49. A method for producing a modified cell according to any one of the preceding claims, comprising the steps of: a) providing a starting cell; b) modifying the starting cells to reduce the expression or activity of the endogenous inhibitory checkpoint molecule and to increase the expression or activity of the ligand of the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cells, method.

50. A method for producing a modified cell according to any one of the preceding claims, comprising the steps of: a) providing a starting cell expressing the endogenous inhibitory checkpoint and the ligand for the endogenous inhibitory checkpoint molecule; b) modifying said starting cells to reduce the expression or activity of said endogenous inhibitory checkpoint molecule, thereby obtaining said modified cells, method.

51. A method for producing a modified cell according to any one of the preceding claims, comprising the steps of: a) providing a starting cell that is deficient in said endogenous inhibitory checkpoint molecule; b) modifying the starting cells to increase the expression or activity of the ligand for the endogenous inhibitory checkpoint molecule, thereby obtaining the modified cells, method.

52. The step of modifying the starting cells to reduce expression or activity of the endogenous inhibitory checkpoint molecule comprises: a) introducing into the starting cell a first mutation to a coding or regulatory sequence within a genomic region of the inhibitory checkpoint molecule, such that the inhibitory checkpoint molecule causes reduced expression or reduced activity in the starting cell; or b) introducing into said starting cells a first interfering oligonucleotide that targets the mRNA of said inhibitory checkpoint molecule, thereby causing said inhibitory checkpoint molecule to cause reduced expression in said starting cells; 52. The method according to any one of claims 49 to 51.

53. The first mutation is introduced by gene editing; 53. The method of claim 52.

54. The gene editing a) introducing into said cell i) a sequence-targeted protein or a polynucleotide encoding said sequence-targeted protein, and ii) an oligonucleotide complementary to a target sequence within said coding sequence or a regulatory sequence within a genomic region of said inhibitory checkpoint molecule; 54. The method of claim 53.

55. The sequence-targeting protein comprises an RNA-guided DNA endonuclease, optionally Cas9; 55. The method of claim 54.

56. The oligonucleotide comprises a guide RNA sequence complementary to the target sequence; 56. The method of claim 54 or 55.

57. Modifying the starting cells to increase expression or activity of the ligand of the inhibitory checkpoint molecule comprises: a) causing expression of said ligand from said starting cell by introducing into said starting cell a first exogenous polynucleotide comprising a coding sequence for said ligand; b) knocking out or knocking down one or more repressor transcription factors; c) editing one or more regulatory sequences for expression of a gene encoding said ligand; or d) knocking in a gene encoding said ligand; 57. The method according to any one of claims 49 to 56.

58. The first exogenous polynucleotide further comprises a promoter operably linked to the coding sequence for the ligand.

58. The method of claim 57.

59. the first exogenous polynucleotide is an mRNA, an expression vector, optionally a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a virus-like particle (VLP), a herpes simplex viral (HSV) vector, a plasmid, a minicircle, a nanoplasmid, a DNA vector, or an RNA vector; 59. The method of claim 58.

60. the expression vector is a viral expression vector, optionally a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral (AAV) vector, a virus-like particle (VLP), or a herpes simplex viral (HSV) vector; 60. The method of claim 59.

61. The starting cell is a natural or differentiated cell, or a recombinant cell genetically modified from a natural or differentiated cell.

61. The method according to any one of claims 49 to 60.

62. The differentiated cells are differentiated from stem cells.

62. The method of claim 61.

63. The stem cells are hematopoietic progenitor cells (e.g., T cell progenitors, NK cell progenitors, macrophage progenitors), hematopoietic stem cells (HSCs), CD34+ cells, embryonic stem cell lines, mesenchymal stem cells, or iPSC cells.

63. The method of claim 62.

64. A method for the preparation of a modified cell comprising the steps of: Pharmaceutical compositions.

65. Comprising a modified cell according to any one of claims 1 to 48. kit.

66. 1. A method for treating a condition or disease in a subject in need thereof, comprising: Administering to the subject a therapeutically effective amount of modified cells according to any one of claims 1 to 48. method.

67. The subject has a disease selected from cancer, an autoimmune disease, an infectious disease, aging, a metabolic disease, and a cardiovascular disease.

67. The method of claim 66.

68. A protein comprising a PD-L1 mutant, said mutant having a reduced ability to induce immune inhibitory signaling compared to native PD-L1. A protein characterized by:

69. The PD-L1 mutant lacks a functional immune inhibitory signaling domain of native PD-L1.

69. The protein of claim 68.

70. the PD-L1 mutant comprises at least one mutation that reduces its ability to induce immune inhibitory signaling; 69. The protein of claim 68.

71. The at least one mutation comprises a substitution, a deletion, an insertion, or any combination thereof; The protein of claim 70.

72. the at least one mutation is in the intracellular domain of PD-L1 (e.g., SEQ ID NO:1), or in the transmembrane domain of PD-L1 (e.g., SEQ ID NO:2), or in the extracellular domain of PD-L1 (e.g., SEQ ID NO:3), or in a domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO:5), or any combination thereof; 72. The protein of claim 71.

73. The at least one mutation comprises a deletion of at least one amino acid residue. A protein according to any one of claims 70 to 72.

74. The deletion includes a deletion of at least a portion of the intracellular domain of PD-L1 (e.g., SEQ ID NO: 1), or a deletion of at least a portion of the transmembrane domain of PD-L1 (e.g., SEQ ID NO: 2), or a deletion of at least a portion of the extracellular domain of PD-L1 (e.g., SEQ ID NO: 3), or a deletion of at least a portion of a domain spanning the extracellular and intracellular domains (e.g., SEQ ID NO: 5), or any combination thereof. The protein described in claim 73.

75. the PD-L1 variant comprises an amino acid sequence at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, 100% identical to SEQ ID NO:11, or a portion of the same length as SEQ ID NO:11, but does not comprise the amino acid sequence of SEQ ID NO:11; The protein described in claim 74.

76. The PD-L1 variant comprises the amino acid sequence of SEQ ID NO:

7. The protein described in claim 75.

77. The PD-L1 variant is optionally linked to a polypeptide of interest via a linker. A protein according to any one of claims 68 to 76.

78. The protein of claim 77, wherein the linker is cleavable.

79. The polypeptide of interest comprises a chimeric antigen receptor (CAR), a recombinant TCR, or other cell surface receptor or ligand. The protein described in claim 78.

80. 80. The protein of claim 78, further comprising a signal peptide.

81. A polynucleotide encoding the protein according to any one of claims 68 to 80.

82. 82. An expression vector comprising the polynucleotide of claim 81.

83. 83. A recombinant cell comprising the expression vector of claim 82.

84. 84. A method for producing a recombinant cell according to claim 83, comprising introducing into a starting cell an expression vector according to claim 82 under conditions suitable for expressing in said cell the polynucleotide according to claim 81. method.

85. 85. A cell population produced ex vivo by the method of claim 84.

86. At least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the cell population expresses a detectable level of the protein of any one of claims 68 to 80. The cell population of claim 85.

87. 82. A method for producing a recombinant cell having increased immune tolerance, comprising increasing the immune tolerance of said recombinant cell by introducing into said cell an expression vector of claim 82 under conditions suitable for expressing in said cell the polynucleotide of claim 81. method.

88. A method of transplanting cells into a subject with reduced risk of immune rejection, comprising administering to the subject a therapeutically effective amount of a recombinant cell transplant according to claim 83 or a modified cell according to any one of claims 1 to 47, wherein the recombinant or modified cells are allogeneic to the subject. method.

Images