Methods of Treating Medical Conditions Using Sensavudine or Related Compounds

Abstract

The present invention provides methods and compositions for treating medical disorders, such as cancer, autoimmune disorders, and / or neurological disorders, and for modulating LINE1 reverse transcriptase and / or HERV-K reverse transcriptase using sensavidine or related compounds.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 312,472, filed February 22, 2022, the entire contents of which are incorporated herein by reference.

[0002] Electronic Sequence Listing Reference This application contains a Sequence Listing that has been submitted electronically in XML format via the Patent Center, and is incorporated herein by reference in its entirety. The XML copy, created on February 21, 2023, is named 197910_seqlist.xml and is 2,838 bytes in size.

[0003] The present invention provides methods and compositions for treating medical disorders, such as cancer, autoimmune disorders, and / or neurological disorders, and for modulating LINE1 reverse transcriptase and / or HERV-K reverse transcriptase using sensavidine or related compounds. [Background technology]

[0004] Transposable elements (or transposons) are genomic DNA sequences that have the ability to move within the genome, changing its composition, expanding its size, and creating duplications and redundancies. (Ukadike and Mustelin, J. Clin. Med., 10:856 (2021)). These genomic sequences are thought to have been introduced into the human genome either by infection with exogenous retroviruses that infected human ancestors millions of years ago, or by ancient descendants of retroviruses that had embedded in the human germline genome and retained the ability to replicate. (Ukadike and Mustelin, 2021).

[0005] Long interspersed nuclear element 1 (LINE-1) is a class I transposable element in the DNA of some organisms and constitutes about 17% of the human genome. LINE-1 harbors two open reading frames, ORF1 and ORF2, which encode ORF1p, which has nucleic acid chaperone activity, and ORF2p, which has reverse transcriptase (RT) and endonuclease activities, respectively. (Reviewed in Babushok and Kazazian, Hum. Mut. 28:527-539, (2007)). LINE-1 retrotransposition activity is mediated by ORF2p. Although the majority of LINE-1 elements in the human genome contain inactivating mutations, a small percentage of LINE-1 elements are intact and retain the ability to retrotranspose. This ability varies between individuals and even between cell types within an individual. Active LINE-1 elements are believed to disrupt the genome through insertions, deletions, rearrangements, and recombinations. (Garcia-Perez et al, Development, 143:4101-4114(2016)). LINE-1 activity is normally tightly regulated in the germline by DNA methylation, histone modifications, and piRNAs.

[0006] Retrotransposons are transposable elements that are associated with the pathogenesis of many diseases, including cancer, autoimmune diseases, and neurological disorders, among others. (Zhang, et al, Frontiers in Cell and Dev. Bio., 8:657 (Aug. 2020); Kuriyama et al, Nature: Scientific Reports, 11:23146 (2021)). Overexpression of LINE-1 RNA and protein can promote apoptosis, DNA damage and repair, and cellular plasticity, thereby promoting tumor progression. Furthermore, DNA damage caused by hypomethylation of repetitive sequences (genome-wide or interspersed) can induce an inflammatory microenvironment. (Zhang, 2020).

[0007] Cancer remains a major health problem, despite the extensive research efforts and scientific advances reported in the literature regarding the treatment of this disease. Solid tumors, including prostate, breast, and lung cancer, remain widespread among the world's population. Leukemia and lymphoma also account for a significant proportion of new cancer diagnoses. Current treatment options for these cancers may not be effective for all patients and / or may have significant adverse side effects. New therapies are needed to address this unmet need in cancer therapy.

[0008] High LINE-1 activity has been observed in many tumor tissues. LINE-1-mediated gene rearrangements can induce oncogene amplification. In addition, LINE-1 can mediate the deletion of tumor suppressor genes (Zhange, 2020). Inhibition of LINE-1 RT in cancer cells, either by RNA interface-dependent silencing of active LINE-1 elements or by the use of RT inhibitory compounds, can reduce cancer cell proliferation, promote cancer cell differentiation, and delay tumor progression in certain animal models. (Sciamann et al, Frontiers in Chemistry, 4:6 (Feb. 2016)).

[0009] LINE-1 RT uses a procedure called target-site primed reverse transcription (TPRT), which involves nicking of genomic DNA followed by reverse transcription and insertion of LINE-1 into the genome. The product of LINE-1 reverse transcription is a potential trigger for DNA-sensing receptors such as cGAS, a DNA sensor that activates the STING pathway leading to type I interferon production. (Zhao, J. Autoimmunity, 90:105-115 (2018)). Hypomethylated and highly expressed LINE-1 has been found in many patients with autoimmune diseases such as systemic lupus erythematosus (SLE), Sjögren's syndrome (SS), and psoriasis. (Zhang et al). LINE-1 has also been found to be significantly upregulated in dermatomyositis (DM) patients, who also showed significantly elevated levels of interferon alpha and interferon beta. (Kuriyama et al, J. Am. Acad, Dermatol., 84(4):1103-1105(2020)).

[0010] Overproduction of interferon is a defining characteristic of type I interferonopathies. These include rare genetic disorders with an incidence of 1:10,000 to 1:1,000,000. Pathological overexpression of type I interferon causes hyperactivation of the immune system, which leads to systemic inflammation that can affect the nervous system, lungs, and blood vessels, among other organ systems (Nesterova et al. “Congenital and Acquired Interferonopathies: Differentiated Approaches to Interferon Therapy”. Innate Immunity in Health and Disease, Ed. Saxena and Prakash, IntechOpen, 2020). Expression of LINE-1 has been shown to induce type I interferon resulting in type I interferonopathies. (Ukadike and Mustelin, 2021). There is a high unmet medical need in this area as these diseases have very limited effective treatment options.

[0011] LINE-1 expression is higher in brain tissue compared to other organs. LINE-1 is active in neural progenitor cells, and overexpression of LINE-1 increases somatic mosaicism. LINE-1 has also been implicated in neurological disorders such as ataxia telangiectasia (AT) and Rett syndrome. LINE-1 has also been implicated in the aging process and frontotemporal degeneration. (Zhang, 2020).

[0012] Human endogenous retroviruses (HERVs) comprise nearly 8% of the human genome and are thought to have originated from ancient integration of retroviruses into the germ line. Although the biology of HERVs is poorly defined, accumulating evidence supports a pathological role in diverse diseases, including cancer, autoimmune diseases, and neurodegenerative disorders. HERV-encoding genes, including reverse transcriptase (RT), produce functional proteins that may contribute to pathology due to aberrant HERV-K expression.

[0013] HERVs function in early development by rewiring gene regulatory networks in preimplantation embryos (Fu et al., Biomolecules, 11(6):829(2021)). HERV expression is thought to be a hallmark of the undifferentiated state, resulting in phenotypic plasticity and acquisition of stem cell properties (Balestrieri et al., Frontiers in Microbiology, 9:1448(2018)), traits associated with aggressive cancers and poor patient outcomes. HERV expression is usually tightly regulated in normal adult tissues, but has been reported to be aberrantly expressed in cancer (Downey et al, Int. J. Cancer, 137(6):1249-1257 (2015)), inflammatory diseases (Greenig, Peer J 7:e6711 (2019)), neurological diseases (Kury et al, Trends Mol. Med., 24(4):379-394 (2018)), aging (Gorbunova et al, Nature, 596(7870):43-53 (2021)), and viral diseases (Romer, Frontiers in Neuroscience, 15:648629-648629 (2021)). There are numerous reports of upregulation of HERV-K [HML-2 (human endogenous MMTV-like) subtype]-derived mRNA and protein in various solid and liquid tumor types (Dervan et al., Front. Onc., 11:658489 (2021); Hohn et al., Front. Onc., 3:246 (2013)). The association of disease with endogenous retrovirus and HERV-encoded protein expression during disease states suggests that antiretroviral therapy may be explored in the management of these pathologies.

[0014] Thus, there is a need for new therapeutic methods that provide improved efficacy and / or reduced side effects for treating medical disorders such as cancer, autoimmune diseases, and / or neurological disorders. The present invention addresses the aforementioned needs and provides other related advantages. Summary of the Invention

[0015] The present invention provides methods and compositions for treating medical disorders such as cancer, autoimmune disorders, and / or neurological disorders, and modulating LINE1 reverse transcriptase and / or HERV-K reverse transcriptase using sensavidine or related compounds. In particular, one aspect of the present invention provides a method for treating a disorder selected from the group consisting of cancer, autoimmune disorders, and neurological disorders. The method comprises administering to a subject in need thereof a therapeutically effective amount of: [ka] The method comprises administering a compound of formula I represented by: or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein the variables are as defined in the detailed description. Further description of additional groups of sensavidine and related compounds is provided in the detailed description. These compounds may be part of a pharmaceutical composition that includes a pharma- ceutically acceptable carrier. Additional features of the method are provided in the detailed description.

[0016] Another aspect of the invention provides a method for inhibiting LINE1 reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering the LINE1 reverse transcriptase to a subject in need thereof in an effective amount of: [ka] or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein the variables are as defined in the detailed description. Further description of additional groups of sensavidine and related compounds is provided in the detailed description. Additional features of the method are provided in the detailed description.

[0017] Another aspect of the invention provides a method for inhibiting HERV-K reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering the HERV-K reverse transcriptase to a subject in need thereof in an effective amount of: [ka] or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein the variables are as defined in the detailed description. Further description of additional groups of sensavidine and related compounds is provided in the detailed description. Additional features of the method are provided in the detailed description. [Brief description of the drawings]

[0018] [Figure 1] 1 is a graph showing inhibition of LINE1 reverse transcriptase by test compounds in an artificial intron cis LINE1 reporter assay, as described in Example 1. [Diagram 2] 1 shows that administration of sensavidine leads to inhibition of interferon in a TREX1 knockout (KO) THP1 cell line. [Figure 3A] 1 shows that administration of censavudine leads to an attenuation of the autoreactive T cell response. 2 shows a reduction in T cell proliferation in response to administration of censavudine. A significant reduction in the autoreactive T cell response occurs at doses between 40 mg / kg and 200 mg / kg. [Figure 3B] Figure 1 shows that administration of censavudine leads to attenuation of autoreactive T cell responses. Figure 2 shows the reduction of cytokine Th17 in response to administration of various doses of censavudine. A significant reduction of autoreactive T cell responses occurs at doses between 40mg / kg and 200mg / kg. [Figure 3C]FIG. 1 shows that administration of censavudine leads to an attenuation of the autoreactive T cell response. FIG. 2 shows the reduction of cytokine Th1 in response to administration of various doses of censavudine. A significant reduction of the autoreactive T cell response occurs at doses between 40 mg / kg and 200 mg / kg. [Figure 4A] Figure 1 shows that administration of censavudine leads to a reduction in pro-inflammatory cytokines. Figure 2 shows the reduction in IL17A after administration of various doses of censavudine. All doses of censavudine showed some effect, with the best response occurring at doses of 40mg / kg and 200mg / kg. [Figure 4B] Figure 1 shows that administration of censavudine leads to a reduction in pro-inflammatory cytokines. Figure 2 shows a reduction in TNF after administration of various doses of censavudine. All doses of censavudine showed some effect, with the best response occurring at doses of 40mg / kg and 200mg / kg. [Figure 4C] Figure 1 shows that administration of censavudine leads to a reduction in pro-inflammatory cytokines. Figure 2 shows the reduction in IFNγ after administration of various doses of censavudine. All doses of censavudine showed some effect, with the best response occurring at doses of 40 mg / kg and 200 mg / kg. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0019] The present invention provides methods and compositions for treating medical disorders, such as cancer, autoimmune disorders, and / or neurological disorders, and for modulating LINE1 reverse transcriptase and / or HERV-K reverse transcriptase using sensavidine or related compounds.

[0020] Various aspects of the invention are described in the following sections, but the aspects of the invention described in a particular section are not limited to any particular section. Further, if a variable is not accompanied by a definition, the previous definition of the variable shall control.

[0021] definition As used herein, the term "pharmaceutically acceptable salt" refers to a salt that is suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response, etc., within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, which is incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. Other pharma- ceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, and the like. Salts include, for example, salts of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109 ...

[0022] Salts derived from appropriate bases include alkali metal salts, alkaline earth metal salts, ammonium salts, and N + (C 1-4 Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, cesium, and the like. Further pharma-ceutically acceptable salts include non-toxic ammonium, quaternary ammonium, and amine cations, formed where appropriate using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates.

[0023] Unless otherwise specified, structures depicted herein are also intended to include all isomeric (e.g., enantiomeric, diastereomeric, and geometric (or conformational)) forms of the structure, such as the R and S configurations for each asymmetric center, Z and E double bond isomers, and Z and E conformational isomers. Thus, single stereochemical isomers as well as enantiomeric, diastereomeric, and geometric (or conformational) mixtures of the present compounds are within the scope of the invention. Unless otherwise specified, all tautomeric forms of the compounds of the invention are within the scope of the invention. Additionally, unless otherwise specified, structures depicted herein are also intended to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, the replacement of hydrogen with deuterium or tritium, or the replacement of a carbon with a hydrogen atom ... 13 C-enriched carbon or 14 Compounds having the subject structures, including those containing C-enriched carbon replacements, are within the scope of the invention. Such compounds are useful, for example, as analytical tools, as probes in biological assays, or as therapeutic agents according to the invention.

[0024] As used herein, the terms "a" and "an" mean "one or more" and include plurals unless the context is inappropriate.

[0025] One or more compounds of the present invention may exist in unsolvated and solvated forms with pharma- ceutically acceptable solvents such as water, ethanol, etc., and the present invention is intended to include both solvated and unsolvated forms. "Solvate" refers to a physical association of a compound of the present invention with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain cases, a solvate will be isolable, for example, when one or more solvent molecules are incorporated into the crystal lattice of a crystalline solid. "Solvate" includes both solution-phase and isolable solvates. Non-limiting examples of suitable solvates include ethanolate, methanolate, etc. "Hydrate" is a solvate in which the solvent molecule is H2O.

[0026] As used herein, the terms "subject" and "patient" are used interchangeably and refer to an organism to be treated by the methods of the present invention. Such organisms preferably include, but are not limited to, mammals (e.g., murine, simian, equine, bovine, porcine, canine, feline, etc.), and most preferably, humans.

[0027] As used herein, the term "effective amount" refers to an amount of a compound sufficient to achieve a beneficial or desired result (e.g., a therapeutic, ameliorative, inhibitory, or preventative result). An effective amount can be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a particular formulation or route of administration. As used herein, the term "treating" includes any effect, e.g., alleviation, reduction, modulation, amelioration, or elimination, that results in the improvement of a condition, disease, disorder, or the like, or the amelioration of symptoms thereof. For example, treating cancer can mean extending the time during which tumor burden does not increase (progression-free survival), reducing tumor burden, extending the overall survival of a patient, ameliorating symptoms associated with cancer, preventing metastasis, slowing metastasis, and the like. Treating autoimmune diseases includes reducing symptoms of the disease, extending the time between disease flares, relieving the disease, preventing disease from worsening, and the like. Treating neurological diseases can include improving cognitive function, reducing the rate of cognitive loss, reducing symptoms, and the like.

[0028] In some embodiments, treatment is administered after one or more symptoms have developed. In some embodiments, treatment is administered in the absence of symptoms. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and / or in light of genetic or other susceptibility factors). Treatment may be continued after symptoms have resolved, for example, to prevent or delay the recurrence of symptoms.

[0029] As used herein, the term "pharmaceutical composition" refers to a combination of an active agent with an inert or active carrier, adjuvant, or vehicle that makes the composition particularly suitable for in vivo or ex vivo diagnostic or therapeutic uses.

[0030] As used herein, the term "pharmaceutically acceptable carrier, adjuvant, and / or vehicle" refers to any non-toxic carrier, adjuvant, and / or vehicle that does not impair the pharmacological activity of the compound with which it is formulated.The pharmaceutically acceptable carrier, adjuvant, and / or vehicle used in the composition of the present invention includes, but is not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, potassium sorbate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, salts or electrolytes such as zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, emulsions (such as oil / water or water / oil emulsions), and various types of wetting agents. The compositions may also include stabilizers and / or preservatives. For examples of carriers, vehicles, and adjuvants, see, e.g., Martin, Remington's Pharmaceutical Sciences, 15th Ed., Mack Publ. Co., Easton, PA

[1975] .

[0031] The term "combination" refers to simultaneous, separate, or sequential administration. In one aspect of the invention, "combination" refers to simultaneous administration. In another aspect of the invention, "combination" refers to separate administration. In another aspect of the invention, "combination" refers to sequential administration. When administration is separate or sequential, the delay in administration of one or more additional therapeutic agents is performed at an interval designed not to lose the beneficial effect of the combination.

[0032] Throughout this specification, when compositions are described as having, including, or comprising certain components, or processes and methods are described as having, including, or comprising certain steps, it is additionally contemplated that there are compositions of the invention that consist essentially of or consist of the recited components, and that there are processes and methods of the invention that consist essentially of or consist of the recited processing steps.

[0033] As used herein, the terms "comprising" or "comprises" are used in reference to compounds, uses, compositions, methods, and their respective component(s) that are essential to the method or composition, but are not limited to including non-specified elements, whether essential or not. The term "consisting of" refers to compounds, uses, compositions, methods, and their respective component(s) described herein, excluding any element not listed in the description of the embodiment. The term "consisting essentially of" refers to elements required for a given embodiment. This term permits the presence of elements that do not materially affect the basic and novel functional characteristic(s) of the embodiment.

[0034] As used herein, "sensavidine" refers to the chemical compound represented by the following structure: 1-[(2R,5R)-5-ethynyl-5-(hydroxymethyl)-2H-furan-2-yl]-5-methylpyrimidine-2,4-dione, in any physical form, e.g., crystalline or amorphous: [ka] Or its pharmaceutically acceptable salt. Other names for sensavidine include festinavir, 4'-ethynylstavudine, 2',3'-didehydro-3'-deoxy-4'-ethynylthymidine, 4'-ethynylD4T, 4'-ED4T, BMS-986001, and OBP-601. The term "sensavidine" includes any commercially suitable formulation containing 1-[(2R,5R)-5-ethynyl-5-(hydroxymethyl)-2H-furan-2-yl]-5-methylpyrimidine-2,4-dione or its pharmaceutically acceptable salt. The synthesis of sensavidine can be found in U.S. Pat. No. 7,589,078 and PCT application WO2013 / 177243, among others.

[0035] As a general rule, compositions specifying percentages are by weight unless otherwise specified.

[0036] I. Methods for Treating Medical Disorders Sensavudine and related compounds described herein, e.g., compounds of formula I or other compounds in Section III below, are contemplated to provide therapeutic benefit to subjects suffering from cancer, autoimmune diseases, and / or neurological disorders.

[0037] Thus, one aspect of the present invention provides a method for treating a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering to a subject in need thereof a therapeutically effective amount of: [ka] or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein R 1 is hydrogen, -P(O)(OH), -P(O)(OH)-OP(O)(OH), or -(P(O)(OH))-OP(O)(OH).

[0038] In certain embodiments, the compound of formula I is a compound defined by one of the embodiments described in Section III below, e.g., [ka] It is.

[0039] In certain embodiments, the compound of formula I or other compounds defined by one of the embodiments described in Section III below, such as [ka] is administered in a pharmaceutical composition comprising the compound and a pharma- ceutically acceptable carrier, adjuvant, and / or vehicle, as further described in Section V below.

[0040] In certain embodiments, the methods further comprise administering an effective amount of an additional therapeutic agent, as further described in Section IV below.

[0041] cancer In certain embodiments, the disorder is cancer. In certain embodiments, the cancer is a solid tumor or leukemia. In certain embodiments, the cancer is a solid tumor. In certain embodiments, the cancer is a carcinoma or melanoma. In certain embodiments, the cancer is a carcinoma. In certain embodiments, the cancer is a sarcoma. In certain embodiments, the cancer is a melanoma. In certain embodiments, the cancer is a lymphoma. In certain embodiments, the cancer is a leukemia.

[0042] In certain embodiments, the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, gastric cancer, bile duct and gallbladder cancer, bladder cancer, urethral cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer.

[0043] In certain embodiments, the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, gastric cancer, bile duct and gallbladder cancer, bladder cancer.

[0044] In certain embodiments, the cancer has (i) expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide, (ii) LINE1 reverse transcriptase activity, (iii) expression of HERV-K RNA, and / or (iv) HERV-K reverse transcriptase activity.

[0045] In certain embodiments, the cancer has (i) expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide, and / or (ii) LINE1 reverse transcriptase activity. In certain embodiments, the cancer has expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide. In certain embodiments, the cancer has expression of LINE1 RNA. In certain embodiments, the cancer has expression of LINE1 ORF1 polypeptide. In certain embodiments, the cancer has expression of LINE1 ORF2 polypeptide. In certain embodiments, the cancer has LINE1 reverse transcriptase activity.

[0046] In certain embodiments, the cancer has (i) expression of HERV-K RNA and / or (ii) HERV-K reverse transcriptase activity. In certain embodiments, the cancer has expression of HERV-K RNA. In certain embodiments, the cancer has HERV-K reverse transcriptase activity.

[0047] In certain embodiments, the cancer has elevated (i) LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide levels, (ii) LINE1 reverse transcriptase activity, (iii) HERV-K RNA levels, and / or (iv) HERV-K reverse transcriptase activity.

[0048] In certain embodiments, the cancer has elevated (i) levels of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide, and / or (ii) LINE1 reverse transcriptase activity. In certain embodiments, the cancer has elevated levels of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide. In certain embodiments, the cancer has elevated levels of LINE1 RNA. In certain embodiments, the cancer has elevated levels of LINE1 ORF1 polypeptide. In certain embodiments, the cancer has elevated levels of LINE1 ORF2 polypeptide. In certain embodiments, the cancer has elevated LINE1 reverse transcriptase activity.

[0049] In certain embodiments, the cancer has elevated (i) levels of HERV-K RNA and / or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the cancer has elevated levels of HERV-K RNA. In certain embodiments, the cancer has elevated activity of HERV-K reverse transcriptase.

[0050] In certain embodiments, the cancer is an epithelial cancer. In certain embodiments, the epithelial cancer is pancreatic cancer, colon cancer, breast cancer, prostate cancer, esophageal cancer, head and neck cancer, renal cancer, ovarian cancer, or lung cancer. In certain embodiments, the cancer is pancreatic cancer. In certain embodiments, the cancer is pancreatic adenocarcinoma. In certain embodiments, the cancer is colon cancer. In certain embodiments, the cancer comprises microsatellite instability (MSI) colon cancer or microsatellite stability (MSS) colon cancer. In certain embodiments, the cancer is breast cancer. In certain embodiments, the cancer is prostate cancer. In certain embodiments, the cancer is esophageal cancer. In certain embodiments, the cancer is head and neck cancer. In certain embodiments, the cancer is rectal cancer. In certain embodiments, the cancer is ovarian cancer. In certain embodiments, the cancer is lung cancer. In certain embodiments, the lung cancer is non-small cell lung cancer or small cell lung cancer. In certain embodiments, the cancer is non-small cell lung cancer. In certain embodiments, the cancer is small cell lung cancer.

[0051] In certain embodiments, the cancer is pre-neoplastic or early cancer lesion. In certain embodiments, the cancer is intraductal papillary mucinous neoplasm (IPMN), pancreatic intraepithelial neoplasm (PanIN), ductal carcinoma in situ (DCIS), or Barrett's esophagus. In certain embodiments, the cancer is intraductal papillary mucinous neoplasm (IPMN). In certain embodiments, the cancer is pancreatic intraepithelial neoplasm (PanIN). In certain embodiments, the cancer is ductal carcinoma in situ (DCIS). In certain embodiments, the cancer is Barrett's esophagus.

[0052] In certain embodiments, the cancer has elevated levels of pericentromeric human satellite II (HSATII) RNA. In some embodiments, the cancer is a microsatellite unstable (MSI) cancer. In some embodiments, the cancer is a microsatellite stable (MSS) cancer.

[0053] In any aspect of the embodiments, the cancer is associated with long interspersed nuclear element-1 (LINE-1) reverse transcriptase (RT). In a further aspect of these embodiments, the cancer is associated with high levels of LINE-1 RT activity.

[0054] In certain embodiments, the cancer is a B-cell lymphoma (e.g., B-cell chronic lymphocytic leukemia, B-cell non-Hodgkin's lymphoma, cutaneous B-cell lymphoma, diffuse large B-cell lymphoma), basal cell carcinoma, bladder cancer, blastoma, brain metastasis, breast cancer, Burkitt's lymphoma, carcinoma (e.g., adenocarcinoma (e.g., of the esophagogastric junction)), cervical cancer, colon cancer, colorectal cancer (colon and rectal cancer), endometrial cancer, esophageal cancer, Ewin's lymphoma, or other cancers. sarcoma, follicular lymphoma, gastric cancer, gastroesophageal junction cancer, gastrointestinal cancer, glioblastoma (e.g., glioblastoma multiforme, e.g., newly diagnosed or recurrent), glioma, head and neck cancer (e.g., head and neck squamous cell carcinoma), liver metastases, Hodgkin's and non-Hodgkin's lymphoma, kidney cancer (e.g., renal cell carcinoma and Wilms' tumor), laryngeal cancer, leukemia (e.g., chronic myeloid leukemia, hairy cell leukemia), liver cancer (e.g., hepatoma, hepatoma, lung cancer (e.g., non-small cell lung cancer and small cell lung cancer), lymphoblastic lymphoma, lymphoma, mantle cell lymphoma, metastatic brain tumor, metastatic carcinoma, myeloma (e.g., multiple myeloma), neuroblastoma, ocular melanoma, oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer (e.g., pancreatic ductal adenocarcinoma), prostate cancer (e.g., hormone refractory (e.g., castration resistant), metastatic, metastatic hormone refractory (e.g., castration resistant), androgen-resistant, androgen-independent), renal cell carcinoma (e.g., metastatic), salivary gland carcinoma, sarcoma (e.g., rhabdomyosarcoma), skin cancer (e.g., melanoma (e.g., metastatic melanoma)), soft tissue sarcoma, solid tumor, squamous cell carcinoma, synovial sarcoma, testicular cancer, thyroid carcinoma, transitional cell carcinoma (urothelial cell carcinoma), uveal melanoma (e.g., metastatic), verrucous carcinoma, vulvar carcinoma, and Waldenstrom's macroglobulinemia.

[0055] In some embodiments, the cancer is a virus-associated cancer. As used herein, the term "virus-associated cancer" refers to any cancer in which a virus is known to be involved. For example, Epstein-Barr Virus (EBV) has been reported to be associated with unique variants of Burkitt's lymphoma and certain other lymphomas. Infection with Human Papillomavirus (HPV) is believed to be the cause of certain types of cervical and / or genital cancer. Human T-cell leukemia virus 1 (HTLV-1) has been reported to be associated with adult T-cell leukemia / lymphoma (ATLL). Human T-cell leukemia virus 2 (HTLV-2) has been reported to be associated with cutaneous T-cell lymphoma. Human Herpesvirus 8 (HHV-8) is believed to cause Kaposi's sarcoma in AIDS patients. In certain embodiments, the cancer is associated with EBV, HPV, HTLV-1, HTLV-2, or HHV-8. In certain embodiments, the cancer is Burkitt's lymphoma, cervical cancer, reproductive cancer, adult T-cell leukemia / lymphoma, cutaneous T-cell lymphoma, or Kaposi's sarcoma.

[0056] In some embodiments, the cancer is a cancer other than a virus-associated cancer. In certain embodiments, the cancer is a cancer other than a cancer associated with EBV, HPV, HTLV-1, HTLV-2, or HHV-8. In certain embodiments, the cancer is a cancer other than Burkitt's lymphoma, cervical cancer, reproductive cancer, adult T-cell leukemia / lymphoma, cutaneous T-cell lymphoma, or Kaposi's sarcoma. In one embodiment, the cancer is a tumor associated with Li-Fraumeni syndrome.

[0057] In some embodiments, the cancer is renal cell carcinoma or kidney cancer, mesothelioma, hepatobiliary cancer (liver and bile duct), bone cancer, rhabdomyosarcoma, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular melanoma, ovarian cancer, colon cancer, rectal cancer, anal cancer, gastric cancer, gastrointestinal cancer (stomach, colon, and duodenum), uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, adrenal cortical carcinoma, soft tissue sarcoma, synovial sarcoma of soft tissue and bone, urethral cancer, penile cancer, prostate cancer. , testicular cancer, chronic or acute leukemia, chronic myeloid leukemia, acute myeloid leukemia, lymphocytic lymphoma, bladder cancer, cancer of the kidney or ureter, renal cell carcinoma, renal pelvis carcinoma, non-Hodgkin's lymphoma, spinal axis tumor, brain stem glioma, pituitary adenoma, adrenal cortical carcinoma, gallbladder cancer, multiple myeloma, cholangiocarcinoma, fibrosarcoma, neuroblastoma, retinoblastoma, squamous cell carcinoma of the head and neck (SCCHN), salivary gland cancer, neurofibromatosis-1-associated malignant peripheral nerve sheath tumor (MPNST), and medulloblastoma, or a combination of one or more of the foregoing cancers.

[0058] In some embodiments, the cancer is hepatocellular carcinoma (HCC). In some embodiments, the cancer is hepatoblastoma. In some embodiments, the cancer is colon cancer. In some embodiments, the cancer is rectal cancer. In some embodiments, the cancer is ovarian cancer or ovarian carcinoma. In some embodiments, the cancer is epithelial ovarian cancer. In some embodiments, the cancer is fallopian tube carcinoma. In some embodiments, the cancer is serous papillary cystadenocarcinoma. In some embodiments, the cancer is uterine serous papillary carcinoma (UPSC). In some embodiments, the cancer is bile duct hepatoma. In some embodiments, the cancer is synovial sarcoma of soft tissue and bone. In some embodiments, the cancer is rhabdomyosarcoma. In some embodiments, the cancer is osteosarcoma. In some embodiments, the cancer is anaplastic thyroid carcinoma. In some embodiments, the cancer is adrenocortical carcinoma. In some embodiments, the cancer is pancreatic cancer or pancreatic ductal carcinoma. In some embodiments, the cancer is pancreatic adenocarcinoma. In some embodiments, the cancer is glioma. In some embodiments, the cancer is malignant peripheral nerve sheath tumor (MPNST). In some embodiments, the cancer is neurofibromatosis-1 associated MPNST. In some embodiments, the cancer is Waldenstrom's macroglobulinemia. In some embodiments, the cancer is medulloblastoma.

[0059] In certain embodiments, the cancer is leukemia (e.g., acute leukemia, acute lymphocytic leukemia, acute myelocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute erythroleukemia, chronic leukemia, chronic myelocytic leukemia, chronic lymphocytic leukemia), polycythemia vera, lymphoma (e.g., Hodgkin's disease or non-Hodgkin's disease), Waldenstrom's macroglobulinemia, multiple myeloma, or heavy chain disease. In one embodiment, the cancer is a solid tumor, e.g., sarcoma and carcinoma (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovium, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, Cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, cholangiocarcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma, and retinoblastoma).

[0060] In some embodiments, the cancer is a glioma, astrocytoma, glioblastoma multiforme (GBM, also known as glioblastoma), medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, neurofibrosarcoma, meningioma, melanoma, neuroblastoma, or retinoblastoma.

[0061] In some embodiments, the cancer is an acoustic neuroma, astrocytoma (e.g., grade I-pilocytic astrocytoma, grade II-low-grade astrocytoma, grade III-anaplastic astrocytoma, or grade IV-glioblastoma (GBM)), chordoma, CNS lymphoma, craniopharyngioma, brain stem glioma, ependymoma, mixed glioma, optic nerve glioma, subependymoma, medulloblastoma, meningioma, metastatic brain tumor, oligodendroglioma, pituitary tumor, primitive neuroectodermal (PNET) tumor, or schwannoma. In some embodiments, the cancer is a type that is more common in children than adults, such as brain stem glioma, craniopharyngioma, ependymoma, juvenile pilocytic astrocytoma (JPA), medulloblastoma, optic nerve glioma, pineal tumor, primitive neuroectodermal tumor (PNET), or rhabdoid tumor.

[0062] Autoimmune disorders In certain embodiments, the disorder is an autoimmune disorder. As used herein, "autoimmune disorder" includes disorders traditionally classified as autoimmune disorders, as well as inflammatory and immune disorders (excluding viral infections). The intent of the term "autoimmune disorder" is to include all diseases and disorders caused by innate immune responses and adaptive immune responses that initiate certain innate immune inflammatory responses. It is the intent of the applicant to include the full range of diseases and disorders caused by innate inflammation in the term "autoimmune disorder", with the exception of viral infections.

[0063] In certain embodiments, the present invention provides treatment of autoimmune disorders. Traditional autoimmune disorders generally occur when the immune system attacks normal cells and / or tissues in the body. Inflammatory disorders often exhibit chronic inflammation (among other symptoms) in the absence of infection. Autoimmune disorders also include conditions that arise when the cellular immune system reacts against the body's self-antigens. Autoimmune and / or inflammatory symptoms may also occur in association with various primary immunodeficiency diseases. In further aspects of these embodiments, the autoimmune disease or disorder is associated with high levels of LINE-1 and / or HERV-K RNA protein expression.

[0064] One embodiment of the present invention is a method of treating type I interferonopathy. In one aspect of this embodiment, type I interferonopathy is a congenital disorder associated with overexpression of type I interferons. In one aspect of this embodiment, the type I interferonopathy is selected from Aicardi-Goutières syndrome (AGS), Singleton-Merten syndrome, proteasome-associated autoinflammatory syndrome, chronic atypical neutrophilic dermatosis with lipodystrophy and elevated temperature (CANDLE), STING-associated vasculopathy of early childhood (SAVI), Japanese autoinflammatory syndrome with lipodystrophy (JASL), spinal endochondrodysplasia (SPENCD), ISG15 deficiency, ubiquitin-specific peptidase 18 deficiency (pseudo-TORCH syndrome), chronic atypical neutrophilic dermatitis with lipodystrophy, DNA II deficiency, trichoheptoenteric syndrome 2, retinal vasculopathy with cerebral leukodystrophy, familial lupus pernio, and X-linked reticular pigmentopathy (XLPDR). In another embodiment, the type I interferonopathy is an acquired disorder in the IFN system.

[0065] In one embodiment, the invention provides a method of treating an autoimmune disease resulting in overproduction of interferon. In one aspect of this embodiment, the expressed interferon comprises a type I interferon. In another aspect of this embodiment, the autoimmune disease is associated with elevated LINE-1 activity and / or expression. In another aspect of this embodiment, the autoimmune disease is associated with elevated HERV-K RNA activity and / or expression.

[0066] In certain embodiments, the autoimmune disorder is selected from the group consisting of achalasia, Addison's disease, adult Still's disease, agammaglobulinemia, alopecia areata, amyloidosis, ankylosing spondylitis, anti-GBM / anti-TBM nephritis, antiphospholipid syndrome, autoimmune angioedema, autoimmune autonomic neuropathy, autoimmune encephalitis, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune myocarditis, autoimmune oophoritis, autoimmune orchitis, autoimmune pancreatitis, autoimmune retinopathy, autoimmune urticaria, axonal and neuronal neuropathy (AMAN), Baro's disease, Behcet's disease, benign mucous membrane pemphigoid, bullous Pemphigoid, Castleman's disease (CD), celiac disease, Chagas' disease, chronic inflammatory demyelinating polyneuropathy (CIDP), chronic relapsing multifactorial osteomyelitis (CRMO), Churg-Strauss syndrome or eosinophilic granulomatosis, cicatricial pemphigoid, Cogan's syndrome, cold agglutinin disease, complex regional pain syndrome (formerly known as reflex sympathetic dystrophy), congenital heart block, Coxsackie myocarditis, CREST syndrome, Crohn's disease, cutaneous lupus erythematosus (CLE), dermatitis herpetiformis, dermatomyositis, Devic's disease (neuromyelitis optica), discoid lupus, Dressler's syndrome, endometriosis, Eosinophilic esophagitis (EoE), eosinophilic fasciitis, erythema nodosum, essential mixed cryoglobulinemia, Evans syndrome, fibromyalgia, fibrosing alveolitis, giant cell arteritis (temporal arteritis), giant cell myocarditis, glomerulonephritis, Goodpasture's syndrome, granulomatosis with polyangiitis, graft-versus-host disease, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, hemolytic anemia, Henoch-Schönlein purpura (HSP), herpes gestationis or pemphigoid of gestationis (PG), hidradenitis suppurativa (acne inversa), inflammatory bowel disease, IgA nephropathy, IgG4-related sclerosing disease, immune thrombocytopenic purpura (IGT), TP), Inclusion body myositis (IBM), Interstitial cystitis (IC), Juvenile arthritis, Juvenile diabetes mellitus (Type I diabetes), Juvenile myositis (JM), Kawasaki disease, Lambert-Eaton syndrome, Lichen planus, Lichen sclerosus, Lignin conjunctivitis, Linear immunoglobulin A disease (LAD), Lupus nephritis, Lyme disease (chronic), Meniere's disease, Microscopic polyangiitis (MPA), Mixed connective tissue disease (MCTD), Multifocal motor neuropathy, Multiple sclerosis, Myasthenia gravis, Myelin oligodendrocyte glycoprotein antibody disorder, Myositis, Narcolepsy, Neonatal lupus, Neutropenia, Ocular cicatricial pemphigoid, Optic neuritis,Relapsing rheumatism, Streptococcus aureus-associated childhood autoimmune neuropsychiatric disorder (PANDAS), paraneoplastic cerebellar degeneration (PCD), paroxysmal nocturnal hemoglobinuria (PNH), pars planitis (peripheral uveitis), Parsonage-Turner syndrome, pemphigus, peripheral neuropathy, perivenous encephalomyelitis, pernicious anemia (PA), POEMS syndrome, polymyalgia rheumatica, polymyositis, post-myocardial infarction syndrome, post-pericardiotomy syndrome, primary biliary cholangitis, primary sclerosing cholangitis, progesterone dermatitis, progressive facial hemifacial atrophy (Parry-Romberg syndrome), psoriasis, psoriatic arthritis, pure red cell aplasia, pyoderma gangrenosum, Raynaud's syndrome phenomenon, reactive arthritis, relapsing polychondritis, restless legs syndrome (RLS), retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis (RA), sarcoidosis, Schmidt's syndrome (autoimmune polyendocrine syndrome type II), scleritis, scleroderma, Sjogren's disease, stiff-body syndrome, Susac's syndrome, sympathetic ophthalmia, systemic lupus erythematosus (SLE), Takayasu's arteritis, thrombotic thrombocytopenic purpura, thyroid eye disease, Tolosa-Hunt syndrome, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, uveitis, vasculitis, vitiligo, Vogt-Koyanagi-Harada disease, and warm autoimmune hemolytic anemia.

[0067] In certain embodiments, the autoimmune disorder is selected from Aicardi-Goutieres syndrome, rheumatoid arthritis, psoriasis, systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), graft-versus-host disease, scleroderma, type I diabetes, dermatomyositis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, vasculitis, and Sjogren's syndrome.

[0068] In certain embodiments, the autoimmune disorder is Aicardi-Goutieres syndrome (AGS). In another embodiment, the autoimmune disorder is systemic lupus erythematosus (SLE). In another embodiment, the autoimmune disease is lupus nephritis. In a further embodiment, the autoimmune disease is cutaneous lupus erythematosus (CLE). In another embodiment, the autoimmune disease is dermatomyositis.

[0069] In certain embodiments, the autoimmune disorder is type 1 interferonopathy. In certain embodiments, the autoimmune disorder is type 1 diabetes, Aicardi-Goutieres syndrome (AGS), systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), familial pernio lupus, systemic sclerosis, STING-associated vasculopathy of early childhood (SAVI), Sjogren's syndrome, or dermatomyositis. In certain embodiments, the autoimmune disorder is systemic lupus erythematosus (SLE), lupus nephritis, cutaneous lupus erythematosus (CLE), or familial pernio lupus.

[0070] In certain embodiments, the autoimmune disorder is type 1 diabetes. In certain embodiments, the autoimmune disorder is familial pernio lupus. In certain embodiments, the autoimmune disorder is systemic sclerosis. In certain embodiments, the autoimmune disorder is STING-associated vasculopathy of early childhood (SAVI). In certain embodiments, the autoimmune disorder is Sjogren's syndrome.

[0071] In certain embodiments, the autoimmune disorder is inflammatory bowel disease, Crohn's disease, or ulcerative colitis. In certain embodiments, the autoimmune disorder is inflammatory bowel disease. In certain embodiments, the autoimmune disorder is Crohn's disease. In certain embodiments, the autoimmune disorder is ulcerative colitis. In one embodiment, the autoimmune disorder is drug-induced colitis, such as colitis associated with administration of checkpoint inhibitors to cancer patients.

[0072] Neurological disorders In certain embodiments, the disorder is a neurological disorder.In certain embodiments, the neurological disorder is Alzheimer's disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson's disease, Huntington's disease, peripheral neuropathy, age-related macular degeneration, Creutzfeldt-Jakob disease, stroke, prion disease, frontotemporal dementia, Pick's disease, progressive supranuclear palsy, spinocerebellar ataxia, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, anxiety disorder, or major depression.In certain embodiments, the neurological disorder is Alzheimer's disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson's disease, Huntington's disease, or dementia.In another embodiment, the neurological disorder is ALS or progressive supranuclear palsy.

[0073] In certain embodiments, the neurological disorder is peripheral neuropathy, age-related macular degeneration, Creutzfeldt-Jakob disease, stroke, prion disease, frontotemporal dementia, Pick's disease, progressive supranuclear palsy, spinocerebellar ataxia, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, anxiety disorder, or major depression.

[0074] In certain embodiments, the neurological disorder is Alzheimer's disease. In other embodiments, the neurological disorder is amyotrophic lateral sclerosis (ALS). In another embodiment, the neurological disorder is multiple sclerosis. In a further embodiment, the neurological disorder is Parkinson's disease. In another embodiment, the neurological disorder is Huntington's disease. In another embodiment, the neurological disorder is dementia. In certain embodiments, the neurological disorder is age-related macular degeneration. In a further embodiment, the neurological disorder is progressive supranuclear palsy.

[0075] subject In certain embodiments, the subject has (i) expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide, (ii) LINE1 reverse transcriptase activity, (iii) expression of HERV-K RNA, and / or (iv) HERV-K reverse transcriptase activity.

[0076] In certain embodiments, the subject has (i) expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide, and / or (ii) LINE1 reverse transcriptase activity. In certain embodiments, the subject has (i) elevated expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide, and / or (ii) elevated LINE1 reverse transcriptase activity. In certain embodiments, the subject has expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide. In certain embodiments, the subject has expression of LINE1 RNA. In certain embodiments, the subject has expression of LINE1 ORF1 polypeptide. In certain embodiments, the subject has expression of LINE1 ORF2 polypeptide. In certain embodiments, the subject has LINE1 reverse transcriptase activity.

[0077] In certain embodiments, the subject has (i) expression of HERV-K RNA and / or (ii) HERV-K reverse transcriptase activity. In certain embodiments, the subject has expression of HERV-K RNA. In certain embodiments, the subject has HERV-K reverse transcriptase activity.

[0078] In certain embodiments, the subject has elevated (i) LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide levels, (ii) LINE1 reverse transcriptase activity, (iii) HERV-K RNA levels, and / or (iv) HERV-K reverse transcriptase activity.

[0079] In certain embodiments, the subject has elevated (i) LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide levels, and / or (ii) LINE1 reverse transcriptase activity. In certain embodiments, the subject has elevated LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide levels. In certain embodiments, the subject has elevated LINE1 RNA levels. In certain embodiments, the subject has elevated LINE1 ORF1 polypeptide levels. In certain embodiments, the subject has elevated LINE1 ORF2 polypeptide levels. In certain embodiments, the subject has elevated LINE1 reverse transcriptase activity.

[0080] In certain embodiments, the subject has elevated (i) levels of HERV-K RNA and / or (ii) activity of HERV-K reverse transcriptase. In certain embodiments, the subject has elevated levels of HERV-K RNA. In certain embodiments, the subject has elevated activity of HERV-K reverse transcriptase.

[0081] In certain embodiments, the subject is a human. In certain embodiments, the subject is an adult. In certain embodiments, the subject is a child. In certain embodiments, the subject is a companion animal. In certain embodiments, the subject is a dog, cat, or horse.

[0082] Use of the compound Another aspect of the present invention provides the use of a compound described herein (such as a compound of Formula I, or other compounds in Section III) for treating a medical disorder, such as a medical disorder described herein.

[0083] Another aspect of the present invention provides the use of a compound described herein (such as a compound of Formula I, or other compounds in Section III) in the manufacture of a medicament. In certain embodiments, the medicament is for treating a disorder described herein, such as cancer.

[0084] II. Methods of Inhibiting LINE1 and / or HERV-K Reverse Transcriptase Activity in a Subject Another aspect of the invention provides a method for inhibiting LINE1 reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering the LINE1 reverse transcriptase to a subject in need thereof in an effective amount of: [ka] or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein R 1 is hydrogen, -P(O)(OH), -P(O)(OH)-OP(O)(OH), or -(P(O)(OH))-OP(O)(OH).

[0085] In certain embodiments, the compound of formula I is a compound defined by one of the embodiments described in Section III below, e.g., [ka] or a pharma- ceutically acceptable salt thereof.

[0086] In certain embodiments, the disorder is a disorder defined by one of the embodiments described in section I above, such as cancer, an autoimmune disorder, or a neurological disorder.

[0087] In certain embodiments, the method further comprises inhibiting HERV-K reverse transcriptase activity in the subject.

[0088] Another aspect of the invention provides a method for inhibiting HERV-K reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering the HERV-K reverse transcriptase to a subject in need thereof in an effective amount of: [ka] or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein R 1 is hydrogen, -P(O)(OH), -P(O)(OH)-OP(O)(OH), or -(P(O)(OH))-OP(O)(OH).

[0089] In certain embodiments, the compound of formula I is a compound defined by one of the embodiments described in Section III below, e.g., [ka] or a pharma- ceutically acceptable salt thereof.

[0090] In certain embodiments, the disorder is a disorder defined by one of the embodiments described in section I above, such as cancer, an autoimmune disorder, or a neurological disorder.

[0091] In certain embodiments, the method further comprises inhibiting LINE1 reverse transcriptase activity in the subject.

[0092] Compounds can be tested for their ability to inhibit LINE1 reverse transcriptase activity, for example, as described in the Examples. Compounds can be tested for their ability to inhibit HERV-K reverse transcriptase activity, for example, as described in the Examples.

[0093] III. Sensavudine and Related Compounds The methods described in Sections I and II above can be further characterized according to the compounds used in the methods. Exemplary compounds are described below along with exemplary procedures for making the compounds.

[0094] In certain embodiments, the compound is [ka] or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein R 1 is hydrogen, -P(O)(OH), -P(O)(OH)-OP(O)(OH), or -(P(O)(OH))-OP(O)(OH).

[0095] In certain embodiments, the compound is a compound of formula I, or a pharma- ceutically acceptable salt thereof. In certain embodiments, the compound is a compound of formula I. In certain embodiments, the compound is a stereoisomer of a compound of formula I, or a pharma- ceutically acceptable salt thereof. In certain embodiments, the compound is a stereoisomer of a compound of formula I.

[0096] In certain embodiments, in formula I, R 1 is hydrogen. In certain embodiments, R 1 is -P(O)(OH), -P(O)(OH)-OP(O)(OH), or -(P(O)(OH))-OP(O)(OH).

[0097] In certain embodiments, the compound of formula I is [ka] or a pharma- ceutically acceptable salt thereof. In certain embodiments, the compound of formula I is [ka] or a pharma- ceutically acceptable salt thereof. In certain embodiments, the compound of formula I is [ka] or a pharma- ceutically acceptable salt thereof.

[0098] Methods for preparing 2',3'-didehydro-3'-deoxy-4'-ethynylthymidine are provided, for example, in US 7,589,078, US 9,051,288, US 2016 / 0060252, and references therein. Additional compounds of formula I can be prepared according to procedures described in journal articles such as, for example, Krishnan, Preethi, et al, Phosphorylation of Pyrimidine L-Deoxynucleoside Analog Diphosphates, J. Bio. Chem., 277(35):31593-31600 (2002), and Yang, Guangwei, et al, Highly Selective Action of Triphosphate Metabolite of 4'-Ethynyl D4T: A Novel Anti-HIV Compound Against HIV-RT, Antiviral Research, 73:185-191 (2007), each of which is incorporated herein by reference.

[0099] The modular synthetic routes described in the above-mentioned references can also be readily modified by those skilled in the art of organic synthesis to provide additional substituted sensavidines and related compounds using strategies and reactions well known in the art, for example, as described in "Comprehensive Organic Synthesis" (BM Trost & I. Fleming, eds., 1991-1992).

[0100] IV. Combination Therapy Another aspect of the present invention provides combination therapy. Sensavudine or related compounds described herein (e.g., compounds of formula I, or other compounds in Section III) or their pharmaceutically acceptable salts can be used in combination with additional therapeutic agents to treat medical disorders (e.g., disorders such as cancer, according to the methods described in Section I). Thus, in some embodiments, the methods of the present invention further comprise administering an effective amount of additional therapeutic agents.

[0101] In some embodiments, the present invention provides a method of treating a disclosed disease or condition, the method comprising administering to a patient in need thereof an effective amount of a compound disclosed herein or a pharma- ceutically acceptable salt thereof and simultaneously, separately, or sequentially co-administering an effective amount of one or more additional therapeutic agents (such as those described herein). In some embodiments, the method comprises co-administering one additional therapeutic agent. In some embodiments, the method comprises co-administering two additional therapeutic agents. In some embodiments, the combination of the disclosed compound and the additional therapeutic agent(s) acts synergistically.

[0102] One or more other therapeutic agents may be administered separately from the compound or composition of the present invention as part of a multiple dose regimen. Alternatively, one or more other therapeutic agents may be part of a single dosage form, mixed together with the compound of the present invention in a single composition. When administered as a multiple dose regimen, one or more other therapeutic agents and the compound or composition of the present invention may be administered simultaneously, sequentially, or separately within a period of time from each other, for example, within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20, 21, 22, 23, or 24 hours from each other. In some embodiments, one or more other therapeutic agents and the compound or composition of the present invention are administered more than 24 hours apart as a multiple dose regimen.

[0103] The dose and administration regimen of the active ingredients used in the combination therapy can be determined by the attending clinician. In certain embodiments, the censavudine or related compounds described herein (e.g., compounds of formula I, or other compounds in Section III) and the additional therapeutic agent(s) (e.g., second, third, or fourth, or fifth anti-cancer agents described below) are administered at a dose that is generally used when such agents are used as monotherapy to treat a disorder. In other embodiments, the censavudine or related compounds described herein (e.g., compounds of formula I, or other compounds in Section III) and the additional therapeutic agent(s) (e.g., second, third, or fourth, or fifth anti-cancer agents described below) are administered at a dose that is lower than the dose that is generally used when such agents are used as monotherapy to treat a disorder. In certain embodiments, the censavudine or related compound described herein (e.g., a compound of Formula I, or other compounds in Section III) and the additional therapeutic agent(s) (e.g., a second, third, or fourth, or fifth anti-cancer agent described below) are present in the same composition that is suitable for oral administration.

[0104] In certain embodiments, the censavudine or related compounds described herein (e.g., compounds of Formula I, or other compounds in Section III) and the additional therapeutic agent(s) (e.g., a second, third, or fourth, or fifth anti-cancer agent described below) may act additively or synergistically. A synergistic combination may allow one or more agents of the combination therapy to be used in lower dosages and / or one or more agents to be administered less frequently. Lower dosages or less frequent administration of one or more agents may reduce the toxicity of the therapy without reducing the efficacy of the therapy.

[0105] Another aspect of the invention is a kit comprising a therapeutically effective amount of sensavidine or a related compound described herein (e.g., a compound of Formula I, or other compounds in Section III) and a pharma- ceutically acceptable carrier, vehicle or diluent, and optionally at least one additional therapeutic agent as described above.

[0106] cancer Thus, another aspect of the present invention provides a method for treating cancer in a patient, comprising administering to a subject in need thereof (i) a therapeutically effective amount of sensavidine or related compounds as described herein, and (ii) a second anti-cancer agent, to treat the cancer.

[0107] In certain embodiments, the second anti-cancer agent is radiation therapy.

[0108] In certain embodiments, the second anti-cancer agent is a therapeutic antibody. In certain embodiments, the therapeutic antibody targets one of CD20, CD30, CD33, CD52, EpCAM, CEA, gpA33, mucin, TAG-72, CAIX, PSMA, folate binding protein, ganglioside, Le, VEGF, VEGFR, VEGFR2, integrin αVβ3, integrin α5β1, EGFR, ERBB2, ERBB3, MET, IGF1R, EPHA3, TRAILR1, TRAILR2, RANKL, FAP, tenascin, CD19, KIR, NKG2A, CD47, CEACAM1, c-MET, VISTA, CD73, CD38, BAFF, interleukin-1 beta, B4GALNT1, interleukin-6, and interleukin-6 receptor.

[0109] In certain embodiments, the second anticancer agent is selected from the group consisting of rituximab, ibritumomab tiuxetan, tositumomab, obinutuzumab, ofatumumab, brentuximab vedotin, gemtuzumab ozogamicin, alemtuzumab, IGN101, adecatumumab, labetuzumab, huA33, pemtumomab, oregovomab, minetumomab, cG250, J591, Mov18, farletuzumab, 3F8, ch14 .18, KW-2871, hu3S193, lgN311, bevacizumab, IM-2C6, pazopanib, sorafenib, axitinib, CDP791, lenvatinib, ramucirumab, etaracizumab, volociximab, cetuximab, panitumumab, nimotuzumab, 806, afatinib, erlotinib, gefitinib, osimertinib, vandetanib, trastuzumab, pertuzumab, MM-121, AMG 102, METMAB, SCH 900105, AVE1642, IMC-A12, MK-0646, R1507, CP 751871, KB004, IIIA-4, mapatuzumab, HGS-ETR2, CS-1008, denosumab, sibrotuzumab, F19, 81C6, MEDI551, lirilumab, MEDI9447, daratumumab, belimumab, canakinumab, dinutuximab, siltuximab, and tocilizumab.

[0110] In certain embodiments, the second anti-cancer agent is a cytokine. In certain embodiments, the cytokine is IL-12, IL-15, GM-CSF, or G-CSF.

[0111] In certain embodiments, the second anticancer agent is sipuleucel-T, aldesleukin (human recombinant interleukin-2 product having the chemical name des-alanyl-1, serine-125 human interleukin-2), dabrafenib (kinase inhibitor having the chemical name N-{3-[5-(2-aminopyrimidin-4-yl)-2-tert-butyl-1,3-thiazol-4-yl]-2-fluorophenyl}-2,6-difluorobenzenesulfonamide), vemurafenib (kinase inhibitor having the chemical name propane-1-sulfonic acid {3-[5-(4-chlorophenyl)-1H-pyrrolo[2,3-b]pyridine-3-carbonyl]-2,4-difluoro-phenyl}-amide), or 2-chloro-deoxyadenosine.

[0112] In certain embodiments, the second anti-cancer agent is a placental growth factor, an antibody-drug conjugate, an oncolytic virus, or an anti-cancer vaccine. In certain embodiments, the second anti-cancer agent is a placental growth factor. In certain embodiments, the second anti-cancer agent is a placental growth factor, including ziv-aflibercept. In certain embodiments, the second anti-cancer agent is an antibody-drug conjugate. In certain embodiments, the second anti-cancer agent is an antibody-drug conjugate selected from the group consisting of brentoxumab vedotin and trastuzumab emtransine.

[0113] In certain embodiments, the second anti-cancer agent is an oncolytic virus. In certain embodiments, the second anti-cancer agent is the oncolytic virus talimogene laherparepvec. In certain embodiments, the second anti-cancer agent is an anti-cancer vaccine. In certain embodiments, the second anti-cancer agent is an anti-cancer vaccine selected from the group consisting of GM-CSF tumor vaccine, STING / GM-CSF tumor vaccine, and NY-ESO-1. In certain embodiments, the second anti-cancer agent is a cytokine selected from IL-12, IL-15, GM-CSF, and G-CSF.

[0114] In certain embodiments, the second anticancer agent is an immune checkpoint inhibitor (also called an immune checkpoint blocker). Immune checkpoint inhibitors are a class of therapeutic agents that have the effect of blocking immune checkpoints. See, for example, Pardoll in Nature Reviews Cancer (2012) vol. 12, pages 252-264. In certain embodiments, the immune checkpoint inhibitor is an agent that inhibits one or more of: (i) cytotoxic T-lymphocyte-associated antigen 4 (CTLA4), (ii) programmed cell death protein 1 (PD1), (iii) PDL1, (iv) LAB3, (v) B7-H3, (vi) B7-H4, and (vii) TIM3. In certain embodiments, the immune checkpoint inhibitor is ipilumumab. In certain embodiments, the immune checkpoint inhibitor is pembrolizumab.

[0115] In certain embodiments, the second anti-cancer agent is a monoclonal antibody that targets a non-checkpoint target (e.g., Herceptin). In certain embodiments, the second anti-cancer agent is a non-cytotoxic agent (e.g., a kinase inhibitor).

[0116] In certain embodiments, the second anticancer agent is selected from the group consisting of mitomycin, ribomustine, vincristine, tretinoin, etoposide, cladribine, gemcitabine, mitobronitol, methotrexate, doxorubicin, carboquone, pentostatin, nitracrine, zinostatin, cetrorelix, letrozole, raltitrexed, daunorubicin, fadrozole, fotemustine, thymalfasin, sobuzoxane, nedaplatin, aminoglutethimide, amsacrine, proglumide, elliptinium acetate, ketanserin, doxifluridine, etretinate, isotretinoin, streptozocin, nimustine, vindesine, cytarabine, bicalutamide, vinoretin ... The drug is selected from rubin, vesnarinone, flutamide, drogenil, butosin, carmofur, razoxane, sizofiran, carboplatin, mitolactol, tegafur, ifosfamide, prednimustine, picibanil, levamisole, teniposide, improsulfan, enocitabine, lisuride, oxymetholone, tamoxifen, progesterone, mepitiostane, epitiostanol, formestane, colony-stimulating factor-1, colony-stimulating factor-2, denileukin diftitox, interleukin-2, luteinizing hormone-releasing factor, interferon-alpha, interferon-2alpha, interferon-beta, and interferon-gamma.

[0117] In certain embodiments, the second anticancer agent is an ALK inhibitor, an ATR inhibitor, an A2A antagonist, a base excision repair inhibitor, a Bcr-Abl tyrosine kinase inhibitor, a Bruton's tyrosine kinase inhibitor, a CDC7 inhibitor, a CHK1 inhibitor, a cyclin-dependent kinase inhibitor, a DNA-PK inhibitor, an inhibitor of both DNA-PK and mTOR, a DNMT1 inhibitor, a DNMT1 inhibitor and 2-chloro-deoxyadenosine, an HDAC inhibitor, a hedgehog signaling pathway inhibitor, an IDO inhibitor, a JAK inhibitor, an mTOR inhibitor, a MEK inhibitor, a MELK inhibitor, an MTH1 inhibitor, a PARP inhibitor, a phosphoinositide 3-kinase inhibitor, an inhibitor of both PARP1 and DHODH, a proteasome inhibitor, a topoisomerase-II inhibitor, a tyrosine kinase inhibitor, a VEGFR inhibitor, or a WEE1 inhibitor.

[0118] In certain embodiments, the second anti-cancer agent is an ALK inhibitor. In certain embodiments, the second anti-cancer agent is an ALK inhibitor comprising ceritinib or crizotinib. In certain embodiments, the second anti-cancer agent is an ATR inhibitor. In certain embodiments, the second anti-cancer agent is an ATR inhibitor comprising AZD6738 or VX-970. In certain embodiments, the second anti-cancer agent is an A2A antagonist. In certain embodiments, the second anti-cancer agent is a base excision repair inhibitor comprising methoxyamine. In certain embodiments, the second anti-cancer agent is a base excision repair inhibitor such as methoxyamine. In certain embodiments, the second anti-cancer agent is a Bcr-Abl tyrosine kinase inhibitor. In certain embodiments, the second anti-cancer agent is a Bcr-Abl tyrosine kinase inhibitor comprising dasatinib or nilotinib. In certain embodiments, the second anti-cancer agent is a Bruton's tyrosine kinase inhibitor. In certain embodiments, the second anticancer drug is a Bruton's tyrosine kinase inhibitor, including ibrutinib.In certain embodiments, the second anticancer drug is a CDC7 inhibitor.In certain embodiments, the second anticancer drug is a CDC7 inhibitor, including RXDX-103 or AS-141.

[0119] In certain embodiments, the second anti-cancer agent is a CHK1 inhibitor. In certain embodiments, the second anti-cancer agent is a CHK1 inhibitor comprising MK-8776, ARRY-575, or SAR-020106. In certain embodiments, the second anti-cancer agent is a cyclin-dependent kinase inhibitor. In certain embodiments, the second anti-cancer agent is a cyclin-dependent kinase inhibitor comprising palbociclib. In certain embodiments, the second anti-cancer agent is a DNA-PK inhibitor. In certain embodiments, the second anti-cancer agent is a DNA-PK inhibitor comprising MSC2490484A. In certain embodiments, the second anti-cancer agent is an inhibitor of both DNA-PK and mTOR. In certain embodiments, the second anti-cancer agent comprises CC-115.

[0120] In certain embodiments, the second anti-cancer agent is a DNMT1 inhibitor. In certain embodiments, the second anti-cancer agent is a DNMT1 inhibitor comprising decitabine, RX-3117, guadecitabine, NUC-8000, or azacitidine. In certain embodiments, the second anti-cancer agent comprises a DNMT1 inhibitor and 2-chloro-deoxyadenosine. In certain embodiments, the second anti-cancer agent comprises ASTX-727.

[0121] In certain embodiments, the second anticancer drug is HDAC inhibitor.In certain embodiments, the second anticancer drug is HDAC inhibitor, including OBP-801, CHR-3996, echinostat, resminostat, prasinostat, CG-200745, panobinostat, romidepsin, mocetinostat, belinostat, AR-42, ricorinostat, KA-3000 or ACY-241.

[0122] In certain embodiments, the second anti-cancer agent is a hedgehog signaling pathway inhibitor. In certain embodiments, the second anti-cancer agent is a hedgehog signaling pathway inhibitor comprising sonidegib or vismodegib. In certain embodiments, the second anti-cancer agent is an IDO inhibitor. In certain embodiments, the second anti-cancer agent is an IDO inhibitor comprising INCB024360. In certain embodiments, the second anti-cancer agent is a JAK inhibitor. In certain embodiments, the second anti-cancer agent is a JAK inhibitor comprising ruxolitinib or tofacitinib. In certain embodiments, the second anti-cancer agent is an mTOR inhibitor. In certain embodiments, the second anti-cancer agent is an mTOR inhibitor comprising everolimus or temsirolimus. In certain embodiments, the second anti-cancer agent is a MEK inhibitor. In certain embodiments, the second anti-cancer agent is a MEK inhibitor comprising cobimetinib or trametinib. In certain embodiments, the second anti-cancer agent is a MELK inhibitor. In certain embodiments, the second anti-cancer agent is a MELK inhibitor comprising ARN-7016, APTO-500, or OTS-167. In certain embodiments, the second anti-cancer agent is an MTH1 inhibitor. In certain embodiments, the second anti-cancer agent is an MTH1 inhibitor comprising (S)-crizotinib, TH287, or TH588.

[0123] In certain embodiments, the second anti-cancer agent is a PARP inhibitor. In certain embodiments, the second anti-cancer agent is a PARP inhibitor, including MP-124, olaparib, BGB-290, talazoparib, veliparib, niraparib, E7449, lucaparb, or ABT-767. In certain embodiments, the second anti-cancer agent is a phosphoinositide 3-kinase inhibitor. In certain embodiments, the second anti-cancer agent is a phosphoinositide 3-kinase inhibitor, including idelalisib. In certain embodiments, the second anti-cancer agent is an inhibitor of both PARP1 and DHODH (i.e., an agent that inhibits both poly ADP-ribose polymerase 1 and dihydroorotate dehydrogenase).

[0124] In certain embodiments, the second anti-cancer drug is a proteasome inhibitor.In certain embodiments, the second anti-cancer drug is a proteasome inhibitor comprising bortezomib or carfilzomib.In certain embodiments, the second anti-cancer drug is a topoisomerase-II inhibitor.In certain embodiments, the second anti-cancer drug is a topoisomerase-II inhibitor comprising vosaroxin.

[0125] In certain embodiments, the second anti-cancer agent is a tyrosine kinase inhibitor. In certain embodiments, the second anti-cancer agent is a tyrosine kinase inhibitor comprising bosutinib, cabozantinib, imatinib, or ponatinib. In certain embodiments, the second anti-cancer agent is a VEGFR inhibitor. In certain embodiments, the second anti-cancer agent is a VEGFR inhibitor comprising regorafenib. In certain embodiments, the second anti-cancer agent is a WEE1 inhibitor. In certain embodiments, the second anti-cancer agent is a WEE1 inhibitor comprising AZD1775.

[0126] In certain embodiments, the second anti-cancer agent is an agonist of OX40, CD137, CD40, GITR, CD27, HVEM, TNFRSF25 or ICOS.In certain embodiments, the second anti-cancer agent is an agonist of OX40, CD137, CD40 or GITR.In certain embodiments, the second anti-cancer agent is an agonist of CD27, HVEM, TNFRSF25 or ICOS.

[0127] In certain embodiments, the method further comprises administering to the subject a third anti-cancer agent. In certain embodiments, the method further comprises administering to the subject a fourth anti-cancer agent. In certain embodiments, the method further comprises administering to the subject a fifth anti-cancer agent.

[0128] In certain embodiments, the third anti-cancer drug is one of the second anti-cancer drugs described above.In certain embodiments, the fourth anti-cancer drug is one of the second anti-cancer drugs described above.In certain embodiments, the fifth anti-cancer drug is one of the second anti-cancer drugs described above.

[0129] Autoimmune disorders Thus, another aspect of the present invention provides a method for treating an autoimmune disorder in a patient, comprising administering to a subject in need thereof (i) a therapeutically effective amount of sensavidine or related compounds as described herein, and (ii) a second therapeutic agent, to treat the autoimmune disorder.

[0130] In certain embodiments, the second therapeutic agent is a small molecule or a recombinant biological agent. In certain embodiments, the second therapeutic agent is acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDS), such as aspirin, ibuprofen, naproxen, etodolac (Lodine®) and celecoxib, colchicine (Colcrys®), corticosteroids, such as prednisone, prednisolone, methylprednisolone, hydrocortisone, probenecid, allopurinol, febuxostat (Uloric®), sulfasalazine (Azulfidine®), anti-inflammatory drugs, such as acetaminophen, benzodiazepines, benzodiazepines, benzodiazepines, benzodiazepines, benzocaine ... Malarial drugs such as hydroxychloroquine (Plaquenil®) and chloroquine (Aralen®), methotrexate (Rheumatrex®), gold salts such as gold thioglucose (Solganal®), gold thiomalate (Myochrysine®) and auranofin (Ridaura®), D-penicillamine (Depen® or Cuprimine®), azathioprine (Imuran®), cyclophosphamide (C ytoxan®), chlorambucil (Leukeran®), cyclosporine (Sandimmune®, Neoral®), tacrolimus, sirolimus, mycophenolate, leflunomide (Arava®) and "anti-TNF" agents such as etanercept (Enbrel®), infliximab (Remicade®), golimumab (Simponi®), certolizumab pegol (Cimzia®) and adalimumab (Humira®). (Registered Trademarks), "anti-IL-1" agents such as anakinra (Kineret®) and rilonacept (Arcalyst®), anti-T cell antibodies such as thymoglobulin, IV immunoglobulin (IVIg), canakinumab (Ilaris®), anti-Jak inhibitors such as tofacitinib, antibodies such as rituximab (Rituxan®), "anti-T cell" agents such as abatacept (Orencia®), "anti-IL-6" agents such as tocilizumab (Actemra®), diclofenac,Cortisone, hyaluronic acid (Synvisc® or Hyalgan®), monoclonal antibodies such as tanezumab, anticoagulants such as heparin (Calcinparine® or Liquaemin®) and warfarin (Coumadin®), antidiarrheals such as diphenoxylate (Lomotil®) and loperamide (Imodium®), bile acid binders such as cholestyramine, alosetron (Lotronex®), lubiprostone (Amitiza®), ®), laxatives such as milk of magnesia, polyethylene glycols (MiraLax®), Dulcolax®, Correctol® and Senokot®, anticholinergics or antispasmodics such as dicyclomine (Bentyl®), Singulair®, beta-2 agonists such as albuterol (Ventolin® HFA, Proventil® HFA), levalbuterol (Xopenex®), metaproterenol (Alupe®), nt®), pirbuterol acetate (Maxair®), terbutaline sulfate (Brethaire®), salmeterol xinafoate (Serevent®) and formoterol (Foradil®), anticholinergics such as ipratropium bromide (Atrovent®) and tiotropium (Spiriva®), inhaled corticosteroids such as beclomethasone dipropionate (Beclovent®, Qvar®, and Vanceril®), (trademark), triamcinolone acetonide (Azmacort®), mometasone (Asthmanex®), budesonide (Pulmocort®), and flunisolide (Aerobid®), Afviar®, Symbicort®, Dulera®, sodium cromoglycate (Intal®), methylxanthines such as theophylline (Theo-Dur®, Theolair®, Slo-bid®, Uniphyl®,Theo-24®) and aminophylline, IgE antibodies such as omalizumab (Xolair®), nucleoside reverse transcriptase inhibitors such as zidovudine (Retrovir®), abacavir (Ziagen®), abacavir / lamivudine (Epzicom®), abacavir / lamivudine / zidovudine (Trizivir®), didanosine (Videx®), emtricitabine (Emtriva®), lamivudine (Epivir®), lamivudine / zide vudine (Combivir®), stavudine (Zerit®), and zalcitabine (Hivid®), non-nucleoside reverse transcriptase inhibitors such as delavirdine (Rescriptor®), efavirenz (Sustiva®), nevairapine (Viramune®) and etravirine (Intelence®), nucleoside reverse transcriptase inhibitors such as tenofovir (Viread®), protease inhibitors such as amprenavir (Amprenavir®), (Agenerase®), atazanavir (Reyataz®), darunavir (Prezista®), fosamprenavir (Lexiva®), indinavir (Crixivan®), lopinavir and ritonavir (Kaletra®), nelfinavir (Viracept®), ritonavir (Norvir®), saquinavir (Fortovase® or Invirase®), and tipranavir (Aptivus®), entry inhibitors such as enfuvirtide (Fuzeon®) and maraviroc (Selzentry®), integrase inhibitors such as raltegravir (Isentress®), doxorubicin (Hydrodaunorubicin®), vincristine (Oncovin®), bortezomib (Velcade®), and combinations of dexamethasone (Decadron®) and lenalidomide (Revlimid®), anti-IL36 agents such as BI655130,Dihydroorotate dehydrogenase inhibitors, such as IMU-838, anti-OX40 agents, such as KHK-4083, microbiome agents, such as RBX2660, SER-287, narrow spectrum kinase inhibitors, such as TOP-1288, anti-CD40 agents, such as BI-655064 and FFP-104, guanylate cyclase agonists, such as dolcatide, sphingosine kinase inhibitors, such as opaganib, anti-IL-12 / IL-23 agents, such as AK-101, ubiquitin protein ligases, such as ubiquitin ligases, MAP3K8 protein inhibitors, e.g. BBT-401, sphingosine receptor modulators, e.g. BMS-986166, P38MAPK / PDE4 inhibitors, e.g. CBS-3595, CCR9 antagonists, e.g. CCX-507, FimH antagonists, e.g. EB-8018, HIF-PH inhibitors, e.g. FG-6874, HIF-1α stabilizers, e.g. GB-004, MAP3K8 protein inhibitors, e.g. GS-4875, LAG-3 antibodies, e.g. GSK-2831781, RIP2 kinase inhibitors, e.g. enzyme inhibitors such as GSK-2983559, farnesoid X receptor agonists such as MET-409, CCK2 antagonists such as PNB-001, IL-23 receptor antagonists such as PTG-200, purinergic P2X7 receptor antagonists such as SGM-1019, PDE4 inhibitors such as Apremilast, ICAM-1 inhibitors such as Alicaforsen sodium, anti-IL23 agents such as Guselkumab, Brazikumab and Mirkizumab. , anti-IL-15 agents such as AMG-714, TYK-2 inhibitors such as BMS-986165, NK cell activators such as CNDO-201, RIP-1 kinase inhibitors such as GSK-2982772, anti-NKGD2 agents such as JNJ-4500, CXCL-10 antibodies such as JT-02, IL-22 receptor agonists such as RG-7880, GATA-3 antagonists such as SB-012, and colony-stimulating factor-1 receptor inhibitors such as edicotinib.

[0131] In certain embodiments, the second therapeutic agent is selected from the group consisting of pentoxifylline, propentofylline, torbafylline, cyclosporine, methotrexate, tamoxifen, forskolin and its analogs, tar derivatives, steroids, vitamin A and its derivatives, vitamin D and its derivatives, cytokines, chemokines, stem cell growth factors, lymphotoxins, hematopoietic factors, colony stimulating factors (CSFs), erythropoietin, thrombopoietin, tumor necrosis factor-α (TNF), TNF-θ, granulocyte colony stimulating factor (G-CSF), granulocyte macrophage colony stimulating factor (GM-CSF), interferon-α, interferon-β, interferon-γ, interferon-λ, stem cell growth factors referred to as "S1 factors", human growth hormone, N-methionyl human growth hormone, bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, proinsulin, serotonin ... Relaxin, follicle-stimulating hormone (FSH), thyroid-stimulating hormone (TSH), luteinizing hormone (LH), hepatic growth factor, prostaglandin, fibroblast growth factor, prolactin, placental lactogen, OB protein, Mullerian inhibitory substance, mouse gonadotropin-related peptide, inhibin, activin, vascular endothelial growth factor, integrin, NGF-β, platelet growth factor, TGF-α, TGF-β, insulin-like growth factor-I, insulin The inhibitors of the present invention are IL-1, IL-1a, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, IL-25, LIF, FLT-3, angiostatin, thrombospondin, endostatin, or lymphotoxin.

[0132] In certain embodiments, the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.

[0133] In certain embodiments, the third therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fourth therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fifth therapeutic agent is one of the second therapeutic agents described above.

[0134] Neurological disorders Therefore, another aspect of the present invention provides a method for treating a neurological disorder in a patient, comprising administering to a subject in need thereof (i) a therapeutically effective amount of sensavidine or related compounds as described herein, and (ii) a second therapeutic agent, to treat the neurological disorder.

[0135] In certain embodiments, the second therapeutic agent is a dopaminergic therapeutic agent, a cholinesterase inhibitor, an antipsychotic, deep brain stimulation (e.g., to stop tremors and refractory movement disorders), riluzole, a caffeine A2A receptor antagonist, pramipexole, or rasagiline.

[0136] In certain embodiments, the method further comprises administering to the subject a third therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fourth therapeutic agent. In certain embodiments, the method further comprises administering to the subject a fifth therapeutic agent.

[0137] In certain embodiments, the third therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fourth therapeutic agent is one of the second therapeutic agents described above. In certain embodiments, the fifth therapeutic agent is one of the second therapeutic agents described above.

[0138] V. Pharmaceutical Compositions and Dosage Considerations As mentioned above, the present invention provides pharmaceutical compositions comprising one or more of the above-mentioned compounds in a therapeutically effective amount, formulated with one or more pharma-ceutically acceptable carriers, adjuvants, and / or vehicles.The pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for (1) oral administration, such as drenches (aqueous or non-aqueous solutions or suspensions), tablets, such as those intended for buccal, sublingual, and systemic absorption, boluses, powders, granules, and pastes for application to the tongue, (2) parenteral administration, such as those by subcutaneous, intramuscular, intravenous, or epidural injection, such as those as sterile solutions or suspensions, or sustained release formulations, (3) topical application, such as those by creams, ointments, or controlled release patches or sprays applied to the skin, (4) vaginal or rectal administration, such as those by pessaries, creams, or foams, (5) sublingual, (6) ocular, (7) transdermal, or (8) nasal administration.

[0139] In certain embodiments, the present invention provides a pharmaceutical composition comprising a compound described herein (e.g., a compound of Formula I) and a pharma- ceutically acceptable carrier. In certain embodiments, the present invention provides a pharmaceutical composition comprising a compound described herein (e.g., a compound of Formula I), an additional therapeutic agent (e.g., a compound described in Section IV), and a pharma- ceutically acceptable carrier.

[0140] As used herein, the phrase "therapeutically effective amount" means an amount of a compound, material, or composition containing a compound of the invention that is effective to produce some desired therapeutic effect in at least a subpopulation of cells in an animal, at a reasonable benefit / risk ratio applicable to any medical treatment.

[0141] The phrase "pharmacologically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.

[0142] Wetting agents, emulsifying agents, and lubricating agents, such as sodium lauryl sulfate and magnesium stearate, as well as coloring agents, releasing agents, coating agents, sweetening, flavoring and perfuming agents, preservatives, and antioxidants can also be present in the composition.

[0143] Examples of pharma- ceutically acceptable antioxidants include: (1) water-soluble antioxidants such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium metabisulfite, and sodium sulfite; (2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, and α-tocopherol; and (3) metal chelating agents such as citric acid, ethylenediaminetetraacetic acid (EDTA), sorbitol, tartaric acid, and phosphoric acid.

[0144] The formulations of the present invention include those suitable for oral, nasal, topical (including buccal and sublingual), rectal, vaginal, and / or parenteral administration. The formulations can be conveniently provided in unit dosage form and can be prepared by any method well known in the art of pharmacy. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will vary depending on the host treated, the particular mode of administration. The amount of active ingredient that can be combined with a carrier material to produce a single dosage form will generally be that amount of compound that produces a therapeutic effect. Generally, out of one hundred percent, this amount will range from about 0.1 percent to about 99 percent of the active ingredient, preferably from about 5 percent to about 70 percent, and most preferably from about 10 percent to about 30 percent.

[0145] Methods of preparing these formulations or compositions include the step of bringing into association a compound of the present invention with the carrier and, optionally, one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association a compound of the present invention with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0146] Formulations of the present invention suitable for oral administration may be in the form of capsules, cachets, pills, tablets, lozenges (using a flavored base, usually sucrose and acacia or tragacanth), powder, granules, or as a solution or suspension in an aqueous or non-aqueous liquid, or an oil-in-water or water-in-oil liquid emulsion, or an elixir or syrup, or pastille (using an inert base such as gelatin and glycerin, or sucrose and acacia), and / or mouthwash, each containing a predetermined amount of a compound of the present invention as the active ingredient. The compounds of the present invention may also be administered as a bolus, electuary, or paste.

[0147] In solid dosage forms of the invention for oral administration (capsules, tablets, pills, dragees, powders, granules, troches, and the like), the active ingredient may be present in a carrier fluid such as sodium citrate or dicalcium phosphate, and / or (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and / or silicic acid; (2) binders, such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and / or acacia; (3) humectants, such as glycerol; (4) disintegrants, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) dissolution retarders, such as paraffin; (6) absorbents, such as sorbitol, ... The pharmaceutical compositions are mixed with one or more pharma- ceutically acceptable carriers, such as: (1) absorption enhancers, e.g., quaternary ammonium compounds, and surfactants, e.g., poloxamers and sodium lauryl sulfate; (2) wetting agents, e.g., cetyl alcohol, glycerol monostearate, and nonionic surfactants; (3) absorbents, e.g., kaolin and bentonite clay; (4) lubricants, e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, zinc stearate, sodium stearate, stearic acid, and mixtures thereof; (5) colorants; and (6) controlled release agents, e.g., crospovidone or ethylcellulose. In the case of capsules, tablets, and pills, the pharmaceutical compositions may also include buffering agents. Solid compositions of a similar type may also be used as fillers in soft and hard shell gelatin capsules, using excipients such as lactose or milk sugar, and high molecular weight polyethylene glycols.

[0148] Tablets can be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets can be prepared using binders (e.g., gelatin or hydroxypropylmethylcellulose), lubricants, inert diluents, preservatives, disintegrants (e.g., sodium starch glycolate or cross-linked sodium carboxymethylcellulose), surfactants, or dispersants. Molded tablets can be made by molding a mixture of the powdered compound moistened with an inert liquid diluent in a suitable machine.

[0149] Tablets and other solid dosage forms of the pharmaceutical composition of the present invention, such as dragees, capsules, pills, and granules, may be optionally imprinted or prepared with coatings and shells, such as enteric coatings and other coatings well known in the pharmaceutical formulation art. They may also be formulated to slow or controlled release the active ingredient therein, for example, using various proportions of hydroxypropylmethylcellulose, other polymer matrices, liposomes, and / or microspheres to produce the desired release profile. They may also be formulated for rapid release, for example, lyophilized. They may also be sterilized, for example, by filtration through a bacteria-retaining filter, or by incorporating a sterilizing agent in the form of a sterile solid composition that can be dissolved in sterile water or any other sterile injectable medium immediately before use. These compositions may also optionally contain opacifying agents, and may be of a composition that releases the active ingredient(s) only, or preferentially, in a certain part of the digestive tract, optionally in a delayed manner. Examples of embedding compositions that can be used include polymeric substances and waxes. The active ingredient can also be in microencapsulated form, if appropriate, with one or more of the above-mentioned excipients.

[0150] The liquid dosage form for oral administration of the compound of the present invention includes pharmaceutically acceptable emulsion, microemulsion, solution, suspension, syrup and elixir.In addition to active ingredient, liquid dosage form can contain inert diluents commonly used in the art, such as water or other solvents, solubilizers and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oil (especially cottonseed oil, peanut oil, corn oil, germ oil, olive oil, castor oil and sesame oil), glycerol, tetrahydrofuryl alcohol, polyethylene glycol and fatty acid ester of sorbitan, and mixtures thereof.

[0151] Besides inert diluents, the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, coloring, perfuming and preservative agents.

[0152] Suspensions may contain, in addition to the active compounds, suspending agents such as ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.

[0153] Formulations of the pharmaceutical compositions of the invention for rectal or vaginal administration can be provided as suppositories, which can be prepared by mixing one or more compounds of the invention with one or more suitable non-irritating excipients or carriers, such as cocoa butter, polyethylene glycol, suppository waxes or salicylates, which are solid at room temperature but liquid at body temperature and therefore melt in the rectum or vaginal cavity and release the active compound.

[0154] Formulations of the present invention which are suitable for vaginal administration also include pessaries, tampons, creams, gels, pastes, foams or spray formulations containing such carriers as are known in the art to be appropriate.

[0155] Dosage forms for topical or transdermal administration of a compound of this invention include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. The active compound may be mixed under sterile conditions with a pharma- ceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

[0156] The ointments, pastes, creams, and gels may contain, in addition to the active compounds of this invention, excipients such as animal and vegetable fats, oils, waxes, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonite, silicic acid, talc and zinc oxide, or mixtures thereof.

[0157] Powders and sprays can contain, in addition to the compounds of the invention, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays can additionally contain common propellants such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

[0158] Transdermal patch has the additional advantage of providing controlled delivery of the compound of the present invention to the body.Such dosage forms can be prepared by dissolving or dispersing the compound in suitable medium.Absorption enhancers can also be used to increase the flux of the compound through the skin.The rate of such flux can be controlled by either providing a rate-controlling membrane or dispersing the compound in a polymer matrix or gel.

[0159] Ophthalmic formulations, eye ointments, powders, solutions and the like, are also contemplated as being within the scope of the present invention.

[0160] Pharmaceutical compositions of the invention suitable for parenteral administration contain one or more compounds of the invention in combination with one or more pharma- ceutically acceptable sterile, isotonic aqueous or nonaqueous solutions, dispersions, suspensions, or emulsions, or sterile powders that can be reconstituted into sterile injectable solutions or dispersions immediately before use, which may contain sugars, alcohols, antioxidants, buffers, bacteriostats, solutes that render the formulation isotonic with the blood of the intended recipient, or suspending or thickening agents.

[0161] Examples of suitable aqueous and non-aqueous carriers that can be used in the pharmaceutical compositions of the present invention include water, ethanol, polyols (e.g., glycerol, propylene glycol, polyethylene glycol, etc.) and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0162] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifiers, and dispersing agents. Prevention of microbial action on the target compound can be ensured by including various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol sorbic acid, etc. It may also be desirable to include isotonic agents, such as sugars, sodium chloride, etc., in the composition. In addition, prolonged absorption of injectable pharmaceutical forms can be brought about by including agents that delay absorption, such as aluminum monostearate and gelatin.

[0163] In some cases, it is desirable to delay the absorption of drugs by subcutaneous or intramuscular injection in order to prolong the effect of drugs.This can be achieved by using a liquid suspension of poorly water-soluble crystalline or amorphous materials.In this case, the absorption rate of the drug depends on the dissolution rate, which may depend on the crystal size and crystalline form.Alternatively, the delayed absorption of parenterally administered drug forms can be achieved by dissolving or suspending the drug in an oil vehicle.

[0164] Injectable depot forms are prepared by forming microencapsule matrices of the subject compounds in biodegradable polymers such as polylactide-polyglycolide. Depending on the ratio of drug to polymer and the nature of the particular polymer used, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly(anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues.

[0165] When the compounds of the present invention are administered to humans and animals as pharmaceuticals, they may be administered as they are, or may be administered, for example, in the form of a pharmaceutical composition containing 0.1 to 99% (more preferably, 10 to 30%) of the active ingredient in combination with a pharma- ceutically acceptable carrier.

[0166] The preparations of the present invention can be administered orally, parenterally, topically, or rectally.They are naturally administered in a form suitable for each administration route.For example, they are administered in the form of tablets or capsules, by injection, inhalation, eye drops, ointments, suppositories, etc., by administration by injection, infusion or inhalation, topically by lotion or ointment, and rectally by suppositories.Oral administration is preferred.

[0167] The phrases "parenteral administration" and "administered parenterally", as used herein, mean modes of administration other than enteral administration and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intrathecal, and intrasternal injection and infusion.

[0168] The phrases "systemic administration," "administered systemically," "peripheral administration," and "administered peripherally," as used herein, refer to administration of a compound, drug, or other material not directly into the central nervous system, but rather such that it is taken up into the patient's body and is subject to metabolic and other similar processes, e.g., subcutaneous administration.

[0169] These compounds can be administered to humans and other animals for therapy by any suitable route of administration, including oral, nasal (such as by spray), rectal, intravaginal, parenteral, intracisternal, and topical (such as by powders, ointments or drops), including buccal and sublingual.

[0170] Regardless of the selected route of administration, the compounds of the present invention, which may be used in a suitable hydrated form, and / or the pharmaceutical compositions of the present invention, are formulated into pharma- ceutically acceptable dosage forms by conventional methods known to those skilled in the art.

[0171] Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention can be varied so as to obtain an amount of the active ingredient effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration without being toxic to the patient.

[0172] The selected dosage level will depend upon a variety of factors, including the activity of the particular compound of the invention, or esters, salts, or amides thereof, employed, the route of administration, the timing of administration, the rate of excretion or metabolism of the particular compound employed, the rate and extent of absorption, the duration of treatment, other drugs, compounds and / or materials used in combination with the particular compound employed, the age, sex, weight, condition, general health and medical history of the patient being treated, and similar factors well known in the medical arts.

[0173] A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian may start the dosage of the compound of the present invention used in the pharmaceutical composition at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved.

[0174] In general, a suitable daily dose of the compound of the present invention is that amount of the compound that is the lowest dose effective to produce a therapeutic effect. Such an effective dose generally depends on the factors mentioned above. Preferably, the compound is administered at about 0.01 mg / kg to about 200 mg / kg, more preferably about 0.1 mg / kg to about 100 mg / kg, and even more preferably about 0.5 mg / kg to about 50 mg / kg. When the compound described herein is co-administered with another agent (e.g., as a sensitizer), the effective amount may be less than when the agent is used alone.

[0175] If desired, the effective daily amount of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally in unit dosage form. Preferred administration is a single daily administration.

[0176] The present invention further provides unit dosage forms (such as tablets or capsules) containing a therapeutically effective amount of sensavidine or related compounds as described herein for the treatment of the medical disorders described herein. EXAMPLES

[0177] The invention generally described herein will be more readily understood by reference to the following examples. The examples are included solely for the purpose of illustrating certain aspects and embodiments of the invention and are not intended to limit the invention. Starting materials described herein can be obtained from commercial sources or can be readily prepared from commercially available materials using transformations known to those skilled in the art.

[0178] Example 1: Transient cell assay for inhibition of LINE1 reverse transcriptase Exemplary compounds were tested for their ability to inhibit LINE1 reverse transcriptase using a transient artificial intronic LINE1 reporter assay. The assay procedure and results are described below.

[0179] Part I: Procedure of the transient artificial intronic LINE1 reporter assay An intron-disrupted firefly luciferase (FLuc) expression cassette was generated as described in Xie, Y. et al. “Characterization of L1 retrotransposition with high-throughput dual-luciferase assays,” Nucleic Acid Res. (2011) Vol. 39, No. 3, e16. In addition, an intact Renilla luciferase (RLuc) expression cassette was included in the vector backbone of the plasmid to normalize transfection efficiency and measure potential cytotoxicity.

[0180] HEK293 cells were seeded at 1,000 cells / well in 55 μL in 96-well plates and grown for 24 hours. Cells were transfected with FuGeneHD (Promega) according to the manufacturer's protocol. Each well contained 0.133 ng of plasmid, 0.4 μL of FuGeneHD reagent, and 4.5 μL of Opti-MEM I reduced serum medium (Invitrogen) supplemented with GlutaMAX-I. Cells were treated simultaneously with test compounds serially diluted in a 3-fold dose response starting at 100 μM.

[0181] Luminescence was measured using the Dual-Glo Luciferase Assay System (Promega) according to the manufacturer's instructions. The ratio of FLuc to RLuc gene expression was used to record LINE1 activity.

[0182] Part II: Results The experimental results are shown in Figure 1. The following test compounds had an IC 50was found to inhibit FLuc (indicated as "FF / RR" in Figure 1): [ka]

[0183] Example 2: Stable cell assay for inhibition of LINE1 reverse transcriptase Exemplary compounds were tested for their ability to inhibit LINE1 reverse transcriptase using a stable artificial intronic LINE1 reporter assay. The assay procedure and results are described below.

[0184] Part I: Procedure for stable artificial intronic LINE1 reporter assay Stable HeLa Tet-On 3G (Takara, Cat. No. 631183) cell lines expressing bidirectional inducible LINE1 constructs were generated as described in Xie, Y. et al. “Cell division promotes efficient retrotransposition in a stable L1 reporter cell line,” Mobile DNA (2013) 4:10. Single cell clones were screened for high luciferase expression, and the firefly-expressing clone with the highest expression was selected for compound testing.

[0185] Test compounds were serially diluted in DMSO and spotted onto 96-well plates. HeLa L1 artificial intron reporter cells were then plated into compound-containing wells (8,000 cells / well) and the cells were induced for reporter expression with a final concentration of 500ng / mL doxycycline (Sigma Cat. No. D9891). 72 hours after plating, luminescence was measured using the Dual-Glo Luciferase Assay System (Promega Cat. No. E2940) according to the manufacturer's instructions. Firefly luciferase activity was used to record LINE1 activity.

[0186] Part II: Results The following test compounds had an IC of 0.13 μM: 50It was found to inhibit LINE1 reverse transcriptase with: [ka]

[0187] Example 3: Biochemical assay for inhibition of LINE1 reverse transcriptase Exemplary compounds were tested for their ability to inhibit LINE1 reverse transcriptase using a homogeneous time-resolved fluorescence (HTRF) assay. The assay procedure and results are described below.

[0188] Part I: Procedure for homogeneous time-resolved fluorescent LINE1 RT assay A homogeneous time-resolved fluorescence (HTRF) assay of LINE1 reverse transcriptase was performed using recombinant MBP-tagged LINE1 protein (238-1061) (produced and purified according to the procedure in Dai L. et al. BMC Biochemistry 2011;12:18) in a 384-well format. Test compounds were serially diluted in DMSO and further diluted in assay buffer (50 mM Tris-HCl, 50 mM KCl, 10 mM MgCl2, 10 mM DTT, pH 8.1) to achieve a final DMSO concentration of 1%. Serially diluted compounds were mixed with 64 ng / well of LINE1 enzyme, 5 nM of annealed template / biotin primer pair (synthesized at Generay Biotechnology), 10 nM of fluorescein-12-dATP fluorescent probe (Perkin Elmer), and 1 μM of dGTP / dCTP / dTTP (Thermo Fisher Scientific) in assay buffer. The template / biotin primer sequences were as follows: GUAACUAGAGAUCCCUCAGACCCUUUUAGUCAGAAU (SEQ ID NO: 1) from 5' to 3' 5' to 3' biotin-TTCTGACTAAAAGGGTCTGAGGGAT (SEQ ID NO: 2).

[0189] After incubation for 60 min at 25°C, PPI buffer (Cisbio Bioassay) containing detection reagent (streptavidin-terbium cryptate in 20 mM EDTA, Cisbio Bioassay) was added and the mixture was incubated for 30 min at 25°C. At the end of the incubation, fluorescence was read on an Envision 2104 plate reader (Perkin Elmer) at excitation / emission = 337 / 485 nm and excitation / emission = 337 / 520 nm. The fluorescence ratio at 520 / 485 nm was used for calculations. Percent inhibition was calculated with DMSO samples as 0% inhibition and no enzyme as 100% inhibition. IC 50 was calculated by fitting the compound dose-inhibition curves to a four-parameter nonlinear regression equation.

[0190] Part II: Results The tetra(triethylammonium) salt of the following compound has an IC of 0.070 μM 50 It was found to inhibit LINE1 reverse transcriptase with: [ka]

[0191] Example 4: Biochemical assay for inhibition of HERV-K reverse transcriptase Exemplary compounds were tested for their HERV-K reverse transcriptase inhibitory ability using a homogeneous time-resolved fluorescence (HTRF) assay. The assay procedure and results are described below.

[0192] Part I: Procedure for homogeneous time-resolved fluorescent HERV-K RT assay A homogeneous time-resolved fluorescence (HTRF) assay of HERV-K reverse transcriptase was performed using HERV-K reverse transcriptase (2-596)-8His protein in a 384-well format. Baculovirus was generated using Bac-to-Bac technology (Invitrogen). A pFastBac donor plasmid containing the HERV-K reverse transcriptase sequence (NCBI GenBank number AAC63291.1, J. Virology (1999) Vol. 73, No. 3, pp. 2365-2375) was transformed into DH10 Bac cells according to the manufacturer's instructions. The recombinant bacmid was then clonally isolated and transfected into SF9 cells using lipofectin. HERV-K reverse transcriptase was expressed in SF9 insect cells and then purified using immobilized metal affinity chromatography (IMAC) followed by size exclusion chromatography (SEC).

[0193] Test compounds were serially diluted in DMSO and further diluted in assay buffer (50 mM Tris-HCl, 50 mM KCl, 10 mM MgCl2, 10 mM DTT, pH 8.1) to achieve a final DMSO concentration of 1%. Serially diluted compounds were mixed with 16 ng / well HERV-K enzyme, 5 nM of pre-annealed template / biotin primer pair (synthesized at Geneway Biotechnology), and 10 nM of fluorescein-12-dUTP fluorescent probe (Perkin Elmer). The template / biotin primer sequence was poly(rA 45 ) and biotin-oligo(dT) 16 It was.

[0194] After 30 min incubation at 25°C, the detection reagent, streptavidin-terbium cryptate in PPI buffer (Cisbio Bioassay) with 20 mM EDTA (Cisbio Bioassay), was added and the mixture was incubated for 60 min at 25°C. At the end of the incubation, fluorescence was read on an Envision 2104 plate reader (Perkin Elmer) at excitation / emission = 337 / 485 nm and excitation / emission = 337 / 520 nm. The fluorescence ratio at 520 / 485 nm was used for calculations. Percent inhibition was calculated with DMSO samples as 0% inhibition and no enzyme as 100% inhibition. IC 50 was calculated by fitting the compound dose-inhibition curves to a four-parameter nonlinear regression equation.

[0195] Part II: Results The tetra(triethylammonium) salt of the following compound has an IC of 6.4 μM 50 It was found to inhibit HERV-K reverse transcriptase in: [ka]

[0196] Example 5: Cellular assay for inhibition of IFN production in THP1 TREX1 KO cells THP1 Dual TREX1 KO cells were purchased from Invivogen. THP1-Dual™ KO-TREX1 cells were cultured in RPMI 1640, 10% heat-inactivated fetal bovine serum, 25 mM HEPES, 10 μg / mL blasticidin, and 100 μg / mL zeocin. THP1-Dual™ KO-TREX1 cells were treated with increasing doses of censavudine alone or in the presence of 1 μM 5-aza-2′-deoxycytidine (Sigma, Cat. No. 189825). Type 1 interferon and cell viability were assessed after 6 days of treatment.

[0197] A stock solution of Sensavudine was prepared in DMSO and then diluted 3-fold in DMSO. For each dilution, an additional 50-fold dilution was prepared in cell culture medium. 10 μL of diluted Sensavudine was then added to a 96-well plate.

[0198] THP1-Dual™ KO-TREX1 cells were treated with either 1× PBS or 1 μM 5-aza-2′-deoxycytidine. 190 μL of THP1-Dual™ KO-TREX1 cells from each treatment were added to each well of a 96-well plate containing the sensavidine titration at 50,000 cells / well. Cells were incubated for 6 days at 37° C. and 5% CO2 in a humidified incubator. Cells treated with 1 μM 5-aza-2′-deoxycytidine were added at the same density as above and incubated for 6 days at 37° C. and 5% CO2 in a humidified incubator. On the sixth day, 25 μL of cell supernatant was transferred to a 96-well white-walled plate, followed by the addition of 50 μL of QUANTI-LUC solution containing stabilizers to each well. Luminescence was detected on a plate reader according to the manufacturer's instructions.

[0199] The remaining cells were assessed for cell viability by adding 25 μL of CellTiter-Glo (Promega, G9683) solution to each well and placing on a shaker at room temperature for 10 min. Luminescence was detected with a plate reader according to the manufacturer's instructions.

[0200] Part II: Results The results are shown in Figure 2. The results clearly show that administration of censavudine results in a significant reduction of interferon in this cell line. Administration of censavudine does not result in cell death. This cell line is a suitable pathogenic model for certain autoimmune diseases, including AGS, rheumatoid arthritis, psoriasis, systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), graft-versus-host disease, scleroderma, type I diabetes, dermatomyositis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, vasculitis, and Sjogren's syndrome.

[0201] Example 6: Mouse Myelin Oligodendrocyte Glycoprotein (MOG) Studies On day 0, four groups of six C57BL mice were transfected with MOG 35-55 Mice were immunized subcutaneously at two sites with 0.1 mL / site with 100 mg / CFA (Hooke's immunization kit). Mice were dosed starting on day 0 and continued through day 11. The dosing schedule was as follows: [Table 1]

[0202] The vehicle used was 0.5% methylcellulose. Mice were dosed daily at approximately the same time each day. On day 11, 1 hour after the last dose, plasma was collected and stored frozen at -80°C for analysis. At the end of the experiment, all mice were euthanized and inguinal lymph nodes were collected and processed.

[0203] Lymph node cells from each group were prepared in 96-well plates at 400k cells / well with antigen at seven concentrations: 0, 0.07μg / mL, 0.2μg / mL, 0.7μg / mL, 2.2μg / mL, 6.6μg / mL and 20.0μg / mL. After 72 hours of culture, supernatants were collected and analyzed for IL-17A, IFNγ and TNF using CBA kits (Becton-Dickinson).

[0204] Bromodeoxyuridine (BrdU) cell proliferation assays were performed on a portion of lymph node cells to determine whether treatment of mice with sensavidine altered proliferation of CD4+ T cells in culture in response to restimulation with antigen. Cell cultures were prepared in 96-well plates, each performed in duplicate, using 400k cells / well with six concentrations of antigen: 0, 0.2 μg / mL, 0.7 μg / mL, 2.2 μg / mL, 6.6 μg / mL, and 20.0 μg / mL. Cells were cultured for approximately 40 hours, and then BrdU was added to all wells at a concentration of 3 μg / mL. After BrdU addition, cells were cultured for an additional 3 hours. Cells were then harvested, stained with anti-CD4 and anti-BrdU antibodies (BrdU labeling was according to standard protocols from Becton Dickinson), and analyzed.

[0205] Part II: Results CBA Analysis: Results from lymph node cell culture and CBA analysis are shown in Figures 4A-4C. Administration of censavudine clearly shows a reduction in the levels of IL-17A, IFNγ, and TNF. These results support the use of censavudine to reduce inflammation and treat autoimmune disorders such as Aicardi-Goutières syndrome, rheumatoid arthritis, psoriasis, systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), graft-versus-host disease, scleroderma, type I diabetes, dermatomyositis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, vasculitis, and Sjogren's syndrome.

[0206] BrdU analysis: The results of BrdU analysis are shown in Figures 3A-3C. It is clearly shown that administration of sensavidine at appropriate concentrations reduces T cell proliferation, T17 and T1 levels. These results indicate that sensavidine may be an effective drug for reducing innate and adaptive immune responses in subjects suffering from autoimmune disorders such as those described above.

[0207] Incorporation by Reference The entire disclosure of each of the patent documents and scientific articles referenced herein is incorporated by reference for all purposes.

[0208] Equivalent The present invention may be embodied in other specific forms without departing from its spirit or essential characteristics. The foregoing embodiments are therefore to be considered in all respects as illustrative rather than limiting the invention described herein. The scope of the invention is therefore indicated by the appended claims rather than the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

1. 1. A method for treating a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering to a subject in need thereof a therapeutically effective amount of: 【Chemistry 1】 or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein R １ is hydrogen, -P(O)(OH) ２ , -P(O)(OH)-OP(O)(OH) ２ , or -(P(O)(OH)) ２ -OP(O)(OH) ２ The method according to claim 1,

2. 10. The method of claim 1, wherein the compound of formula I is administered in a pharmaceutical composition comprising the compound and a pharma- ceutically acceptable carrier, adjuvant, and / or vehicle.

3. 3. The method of claim 1 or 2, wherein the method further comprises administering an effective amount of an additional therapeutic agent.

4. 1. A method of inhibiting LINE1 reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering the LINE1 reverse transcriptase to a subject in need thereof in an effective amount of: 【Chemistry 2】 or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein R １ is hydrogen, -P(O)(OH) ２ , -P(O)(OH)-OP(O)(OH) ２ , or -(P(O)(OH)) ２ -OP(O)(OH) ２ The method according to claim 1,

5. The method of claim 4, wherein the method further comprises inhibiting HERV-K reverse transcriptase activity in the subject.

6. 1. A method for inhibiting HERV-K reverse transcriptase activity in a subject suffering from a disorder selected from the group consisting of cancer, an autoimmune disorder, and a neurological disorder, comprising administering the HERV-K reverse transcriptase to a subject in need of treatment with an effective amount of: 【Chemistry 3】 or a stereoisomer thereof, or a pharma- ceutically acceptable salt of any of the foregoing, wherein R １ is hydrogen, -P(O)(OH) ２ , -P(O)(OH)-OP(O)(OH) ２ , or -(P(O)(OH)) ２ -OP(O)(OH) ２ The method according to claim 1,

7. The method of any one of claims 1 to 6, wherein the compound is a compound of formula I.

8. R １ The method of any one of claims 1 to 7, wherein is hydrogen.

9. R １ is -P(O)(OH) ２ , -P(O)(OH)-OP(O)(OH) ２ , or -(P(O)(OH)) ２ -OP(O)(OH) ２ The method according to any one of claims 1 to 7, wherein

10. The compound is 【Chemistry 4】 or a pharma- ceutically acceptable salt thereof.

11. The method of any one of claims 1 to 10, wherein the disorder is cancer.

12. 12. The method of claim 11, wherein the cancer is breast cancer, ovarian cancer, uterine cancer, cervical cancer, prostate cancer, testicular cancer, lung cancer, leukemia, head and neck cancer, oral cancer, esophageal cancer, gastric cancer, bile duct and gallbladder cancer, bladder cancer, urethral cancer, colon cancer, rectal cancer, thyroid cancer, pancreatic cancer, kidney cancer, liver cancer, brain cancer, skin cancer, or eye cancer.

13. The method of any one of claims 1 to 10, wherein the disorder is an autoimmune disorder.

14. 14. The method of claim 13, wherein the autoimmune disorder is selected from Aicardi-Goutieres syndrome, rheumatoid arthritis, psoriasis, systemic lupus erythematosus (SLE), cutaneous lupus erythematosus (CLE), graft versus host disease, scleroderma, type I diabetes, dermatomyositis, inflammatory bowel disease, ulcerative colitis, Crohn's disease, vasculitis, and Sjogren's syndrome.

15. The method according to any one of claims 1 to 10, wherein the disorder is a neurological disorder.

16. 16. The method of claim 15, wherein the neurological disorder is Alzheimer's disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Parkinson's disease, Huntington's disease, peripheral neuropathy, age-related macular degeneration, Creutzfeldt-Jakob disease, stroke, prion disease, frontotemporal dementia, Pick's disease, progressive supranuclear palsy, spinocerebellar ataxia, Lewy body disease, dementia, multiple system atrophy, epilepsy, bipolar disorder, schizophrenia, anxiety disorder, or major depression.

17. The method of any one of claims 1 to 16, wherein the subject has (i) elevated expression of LINE1 RNA, LINE1 ORF1 polypeptide, and / or LINE1 ORF2 polypeptide, and / or (ii) elevated LINE1 reverse transcriptase activity.

18. The method of any one of claims 1 to 17, wherein the subject has (i) HERV-K RNA expression and / or (ii) HERV-K reverse transcriptase activity.

19. The method of any one of claims 1 to 18, wherein the subject is a human.

Images