Chimeric bait receptors and uses thereof

Abstract

Provided herein are novel chimeric polypeptides that bind to antigenic peptides (e.g., viral antigens or tumor-associated antigens) and activate endogenous phagocytic signaling pathways. Also provided are such chimeric polypeptides, nucleic acids encoding them, compositions and methods useful for producing phagocytes modified to express such chimeric polypeptides, and methods for treating various disorders, such as viral infections or cancer.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 315,388, filed March 1, 2022, the entire contents of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format and is incorporated by reference in its entirety. The XML file was created on Feb. 28, 2023, is named 405320-HGXR-001WO.xml, and is 203,056 bytes in size.

[0003] The present disclosure relates to novel chimeric polypeptides that bind to antigenic peptides (e.g., viral antigens or tumor-associated antigens) and activate endogenous phagocytic signaling pathways. Also provided are such chimeric polypeptides, nucleic acids encoding same, compositions and methods useful for producing phagocytes modified to express such chimeric polypeptides, and methods for the treatment of various disorders, such as viral infections or cancer. [Background technology]

[0004] Many viruses bind to one or more specific receptors on host cells to attach, enter, and / or signal. A single viral receptor can mediate all of the above functions, or the virus can utilize a separate receptor to mediate each function, thereby conferring even greater specificity in tissue tropism. In other cases, coordinated virus-receptor interactions are required to mediate specific functions, such as activating signaling events. Studies have revealed common viral receptors, including integrins, selectins, cadherins, and immunoglobulin superfamily (IgSF) receptors, and cell adhesion molecules (CAMs), such as the PtdSer receptor. Viruses including HIV, measles virus, reovirus, rhinovirus, adenovirus, poliovirus, and coxsackievirus B (CVB) utilize IgSF members as receptors, whereas integrins function as receptors for reovirus, rotavirus, adenovirus, West Nile virus (WNV), human metapneumovirus (hMPV), foot and mouth disease virus (FMDV), herpes simplex virus (HSV), human cytomegalovirus (HCMV), and human herpesvirus-8.

[0005] Other viruses bind to less common receptors on host cells for attachment, entry, and / or signaling. For example, SARS-CoV-2 binds to human angiotensin-converting enzyme 2 (ACE2), a membrane-bound enzyme that is part of the renin-angiotensin-aldosterone system.

[0006] The immune system is constantly patrolling the human body, trying to eliminate cancerous cells and harmful microorganisms. Under normal circumstances, immune cells are able to identify these threats because they are able to recognize specific signals present on the surface of target cells. The immunity provided by antibodies produced against viral antigens, either by previous infection or vaccination, is currently the primary method for preventing viral infections. However, frequent viral mutations may allow viruses to evade this immunity if the antibodies produced no longer recognize the viral antigen or bind to it with lower affinity.

[0007] Furthermore, cancer cells often find ways to evade the immune system and grow. The endogenous immune system is usually non-responsive to malignant cells or can be actively immunosuppressive in terms of the body's response to the presence of malignant cells. Despite many recent advances in cancer immunotherapy, the majority of current cell therapies focus almost exclusively on T cells. This focus is primarily due to the fact that T cells can be engineered to express synthetic immune receptors (known as chimeric antigen receptors (CARs)) that contain an extracellular targeting antibody and an intracellular signaling domain, giving T cells expressing such CARs the ability to target tumor-associated antigens. For example, in recent years, T cells expressing CARs directed against CD19 have been shown to have significant anti-leukemia efficacy, with complete remissions being achieved in 90% of treated acute lymphoblastic leukemia patients. These results are accompanied by robust T cell proliferation and clearly documented T cell infiltration into tumor sites in leukemia patients so treated. Despite the high response rates demonstrated in hematopoietic malignancies, the efficacy of CART cells in solid tumors and certain lymphomas may be limited. Possible explanations for this include a reduced potential for T cells to infiltrate solid tumors, poor trafficking, an immunosuppressive tumor microenvironment, and the expression of few tumor-specific antigens on solid tumor cells.

[0008] There is a continuing need for new compositions and methods for treating infectious diseases, inflammatory diseases, immune diseases, and various cancers. Given the problems associated with natural and recombinant antibodies against viruses, there is an unmet need for antibody-independent innate immune mechanisms to neutralize viruses. Targeting viral receptors on host cells provides an opportunity to prevent and / or treat viral infections. There is also a need for more effective compositions and methods for treating cancer by improving specificity to tumor cells and improving invasion into tumor sites in both solid tumors and hematological malignancies. Summary of the Invention [Problem to be solved by the invention]

[0009] The present disclosure provides chimeric polypeptides comprising a portion capable of specifically binding to an antigen and a portion that targets the chimeric polypeptide for endocytosis upon binding to the antigen. As described in more detail below, the antigen may be a viral protein and the portion capable of specifically binding to the viral protein may be a binding region to which the virus binds on a host cell. In other embodiments, the antigen may be a tumor-associated antigen (TAA) and the portion capable of specifically binding to the TAA may be an antigen-binding portion, such as an antibody or a fragment thereof. The portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis may be an intracellular (i.e., cytoplasmic) signaling region of an endocytic receptor. In other embodiments, the portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis may be a ligand for an endocytic receptor. [Means for solving the problem]

[0010] In one aspect, a chimeric bait receptor (CBR) is provided that includes: a) an extracellular portion that includes a binding region to which a virus specifically binds, where the binding region is not an antibody; b) a transmembrane portion; and c) an intracellular portion that includes an intracellular signaling region of an endocytic receptor.

[0011] In some embodiments, the binding region is a portion of a host protein that confers attachment of the virus to a host cell when the binding region is exposed to the virus and the binding region is expressed in a host cell.

[0012] In some embodiments, the binding region comprises a portion of a protein selected from the group consisting of angiotensin converting enzyme 2 (ACE2), CD4, CCR5, CXCR4, T cell Ig and mucin domain 1 (TIM-1), CD46, and SLAMF1. In some embodiments, the binding region comprises ACE2 or a fragment thereof. In some embodiments, the binding region comprises amino acids 19-358, 19-605, or 19-740 of SEQ ID NO:2. In some embodiments, the binding region comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8.

[0013] In some embodiments, the transmembrane portion comprises a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), Dectin-1, and a scavenger receptor.

[0014] In some embodiments, the transmembrane portion comprises a transmembrane portion of a scavenger receptor, hi some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of classes A, B, C, D, E, F, G, H, IK, J, K, and L scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of scavenger receptor class A type I / II (SR AI / II), macrophage receptor with collagenous structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, scavenger receptor class B type I (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like moieties 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), link domain-containing scavenger receptor-1 (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44, and scavenger receptor class L type I (SR-L1).

[0015] In some embodiments, the intracellular signaling region of the endocytic receptor comprises the intracellular portion of the mannose receptor.

[0016] In some embodiments, the transmembrane portion comprises the transmembrane portion of the mannose receptor.

[0017] In some embodiments, the transmembrane and intracellular portions of the mannose receptor comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:10.

[0018] In some embodiments, the transmembrane and intracellular portions of the mannose receptor comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:12.

[0019] In some embodiments, the intracellular signaling region of an endocytic receptor comprises the intracellular signaling region of a phagocytic receptor.

[0020] In some embodiments, the transmembrane portion comprises the transmembrane portion of a phagocytic receptor.

[0021] In some embodiments, the intracellular signaling region of the phagocytic receptor comprises an intracellular portion from a protein selected from the group consisting of MERTK, Dectin-1, and Fc gamma receptor (FcγR).

[0022] In some embodiments, the transmembrane portion and intracellular signaling region of the phagocytic receptor comprises the transmembrane portion and intracellular portion of MERTK. In some embodiments, the transmembrane portion and intracellular portion of MERTK comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:14.

[0023] In some embodiments, the transmembrane portion and intracellular signaling region of the phagocytic receptor comprise the transmembrane portion and intracellular portion of Dectin-1. In some embodiments, the transmembrane portion and intracellular portion of Dectin-1 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO: 16. In some embodiments, the CBR comprises SEQ ID NO: 18.

[0024] In some embodiments, the intracellular signaling region of the phagocytic receptor comprises an intracellular portion of an FcγR. In some embodiments, the intracellular portion of an FcγR comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:20.

[0025] In some embodiments, the transmembrane portion and intracellular signaling region of the endocytic receptor comprises the transmembrane portion and intracellular signaling region of a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of class A, B, C, D, E, F, G, H, IK, J, K, and L scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

[0026] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises a transmembrane and intracellular portion of SR AI / II. In some embodiments, the transmembrane and intracellular portion of SR AI / II comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:22.

[0027] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of MARCO. In some embodiments, the transmembrane and intracellular portions of MARCO comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:24.

[0028] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprises the transmembrane portion and intracellular portion of the SCARA5 receptor. In some embodiments, the transmembrane portion and intracellular portion of the SCARA5 receptor comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:26.

[0029] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises a transmembrane and intracellular portion of SRCL. In some embodiments, the transmembrane and intracellular portion of SRCL comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:28.

[0030] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD36. In some embodiments, the transmembrane and intracellular portions of CD36 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:30.

[0031] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of SR-BI, hi some embodiments, the transmembrane and intracellular portions of SR-BI comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:32.

[0032] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD68. In some embodiments, the transmembrane and intracellular portions of CD68 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:34.

[0033] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprise the transmembrane portion and intracellular portion of LOX-1. In some embodiments, the transmembrane portion and intracellular portion of LOX-1 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:36.

[0034] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprises the transmembrane portion and intracellular portion of SREC. In some embodiments, the transmembrane portion and intracellular portion of SREC comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:38.

[0035] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprise the transmembrane portion and intracellular portion of MEGF10. In some embodiments, the transmembrane portion and intracellular portion of MEGF10 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:40.

[0036] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of SR-PSOX. In some embodiments, the transmembrane and intracellular portions of SR-PSOX comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:42.

[0037] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprises the transmembrane portion and intracellular portion of FEEL-1. In some embodiments, the transmembrane portion and intracellular portion of FEEL-1 comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:44.

[0038] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD 163. In some embodiments, the transmembrane and intracellular portions of CD 163 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:46.

[0039] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of RAGE, hi some embodiments, the transmembrane and intracellular portions of RAGE comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:48.

[0040] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD44. In some embodiments, the transmembrane and intracellular portions of CD44 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:50.

[0041] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of SR-L1. In some embodiments, the transmembrane and intracellular portions of SR-L1 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:52.

[0042] In some embodiments, the CBR further comprises an N-terminal signal peptide, hi some embodiments, the N-terminal signal peptide comprises a CD8 signal peptide or a mannose receptor signal peptide.

[0043] In some embodiments, the CBR comprises an amino acid sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 61-67.

[0044] Also provided are nucleic acids encoding one or more of the CBRs described herein.

[0045] In some embodiments, the nucleic acid comprises a nucleotide sequence that is at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs:54-60.

[0046] Also provided are recombinant vectors encoding one or more CBRs of the disclosure, as well as cells comprising one or more CBRs, nucleic acids encoding one or more CBRs, and / or vectors capable of expressing one or more CBRs. In some embodiments, the host cell is a phagocyte, such as a macrophage, dendritic cell, mast cell, monocyte, neutrophil, microglial cell, or astrocyte. Also provided are cell populations comprising two or more cells described herein.

[0047] Also provided are pharmaceutical compositions comprising a therapeutically effective amount of one or more CBRs, one or more nucleic acids encoding the CBRs, one or more vectors capable of expressing the CBRs, a host cell or host cell population containing the CBRs, and a pharma- ceutically acceptable carrier.

[0048] Also provided is a method for treating or preventing a viral infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more CBRs, one or more nucleic acids encoding CBRs, one or more vectors capable of expressing CBRs, a host cell or host cell population comprising a CBR, or a pharmaceutical composition comprising any of the above.

[0049] In some embodiments, the subject is a human.

[0050] In some embodiments, the viral infection is caused by a virus selected from the group consisting of Togaviridae, Coronaviridae, Flaviviridae, Orthomyxoviridae, Filoviridae, Paramyxoviridae, Retroviridae, and Bunyaviridae.

[0051] In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2.

[0052] In one aspect, a chimeric phagocytic receptor (CPR) is provided that comprises: a) an extracellular portion comprising an antigen binding portion, b) a transmembrane portion, and c) an intracellular portion comprising an intracellular signaling region of an endocytic receptor, wherein the CPR does not comprise a recruitment portion, wherein the recruitment portion is not the intracellular region of an endocytic receptor, and wherein the recruitment portion binds to a cytoplasmic protein in a phagocytic signaling pathway.

[0053] In some embodiments, the antigen-binding portion comprises an antibody, hi some embodiments, the antibody comprises a single chain variable fragment (scFv) or single moiety antibody (sdAb) variable portion.

[0054] In some embodiments, the antigen binding portion is selected from the group consisting of CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD10, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3 (CD135), TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD117), CD213A2, IL-1 The present invention specifically binds to an antigen selected from the group consisting of IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-beta, SSEA-4, CD20, MUC1, EGFR, NCAM, prostase, PAP, ELF2M, ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide, and IGLL1.

[0055] In some embodiments, the transmembrane portion comprises a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), Dectin-1, and a scavenger receptor.

[0056] In some embodiments, the transmembrane portion comprises a transmembrane portion of a scavenger receptor, hi some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of classes A, B, C, D, E, F, G, H, IK, J, K, and L scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of scavenger receptor class A type I / II (SR AI / II), macrophage receptor with collagenous structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, scavenger receptor class B type I (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like moieties 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), link domain-containing scavenger receptor-1 (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44, and scavenger receptor class L type I (SR-L1).

[0057] In some embodiments, the intracellular signaling region of the endocytic receptor comprises the intracellular portion of the mannose receptor.

[0058] In some embodiments, the transmembrane portion comprises the transmembrane portion of the mannose receptor.

[0059] In some embodiments, the transmembrane and intracellular portions of the mannose receptor comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:10.

[0060] In some embodiments, the transmembrane and intracellular portions of the mannose receptor comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:12.

[0061] In some embodiments, the intracellular signaling region of an endocytic receptor comprises the intracellular signaling region of a phagocytic receptor.

[0062] In some embodiments, the transmembrane portion comprises the transmembrane portion of a phagocytic receptor.

[0063] In some embodiments, the intracellular signaling region of the phagocytic receptor comprises an intracellular portion from a protein selected from the group consisting of MERTK, Dectin-1, and Fc gamma receptor (FcγR).

[0064] In some embodiments, the transmembrane portion and intracellular signaling region of the phagocytic receptor comprises the transmembrane portion and intracellular portion of MERTK. In some embodiments, the transmembrane portion and intracellular portion of MERTK comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:14.

[0065] In some embodiments, the transmembrane portion and intracellular signaling region of the phagocytic receptor comprise the transmembrane portion and intracellular portion of Dectin-1. In some embodiments, the transmembrane portion and intracellular portion of Dectin-1 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO: 16. In some embodiments, the CBR comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO: 18.

[0066] In some embodiments, the intracellular signaling region of the phagocytic receptor comprises an intracellular portion of an FcγR. In some embodiments, the intracellular portion of an FcγR comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:20.

[0067] In some embodiments, the transmembrane portion and intracellular signaling region of the endocytic receptor comprises the transmembrane portion and intracellular signaling region of a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of classes A, B, C, D, E, F, G, H, IK, J, K, and L scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

[0068] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises a transmembrane and intracellular portion of SR AI / II. In some embodiments, the transmembrane and intracellular portion of SR AI / II comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:22.

[0069] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of MARCO. In some embodiments, the transmembrane and intracellular portions of MARCO comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:24.

[0070] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprises the transmembrane portion and intracellular portion of the SCARA5 receptor. In some embodiments, the transmembrane portion and intracellular portion of the SCARA5 receptor comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:26.

[0071] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises a transmembrane and intracellular portion of SRCL. In some embodiments, the transmembrane and intracellular portion of SRCL comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:28.

[0072] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD36. In some embodiments, the transmembrane and intracellular portions of CD36 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:30.

[0073] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of SR-BI, hi some embodiments, the transmembrane and intracellular portions of SR-BI comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:32.

[0074] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD68. In some embodiments, the transmembrane and intracellular portions of CD68 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:34.

[0075] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprise the transmembrane portion and intracellular portion of LOX-1. In some embodiments, the transmembrane portion and intracellular portion of LOX-1 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:36.

[0076] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprises the transmembrane portion and intracellular portion of SREC. In some embodiments, the transmembrane portion and intracellular portion of SREC comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:38.

[0077] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprise the transmembrane portion and intracellular portion of MEGF10. In some embodiments, the transmembrane portion and intracellular portion of MEGF10 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:40.

[0078] In some embodiments, the transmembrane portion and the intracellular signaling region of the scavenger receptor comprise the transmembrane portion and the intracellular portion of SR-PSOX. In some embodiments, the intracellular portion of SR-PSOX comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:42.

[0079] In some embodiments, the transmembrane portion and intracellular signaling region of the scavenger receptor comprises the transmembrane portion and intracellular portion of FEEL-1. In some embodiments, the transmembrane portion and intracellular portion of FEEL-1 comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:44.

[0080] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD 163. In some embodiments, the transmembrane and intracellular portions of CD 163 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:46.

[0081] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of RAGE, hi some embodiments, the transmembrane and intracellular portions of RAGE comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:48.

[0082] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of CD44. In some embodiments, the transmembrane and intracellular portions of CD44 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:50.

[0083] In some embodiments, the transmembrane and intracellular signaling region of the scavenger receptor comprises the transmembrane and intracellular portions of SR-L1. In some embodiments, the transmembrane and intracellular portions of SR-L1 comprise at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO:52.

[0084] In some embodiments, the recruitment moiety is selected from the group consisting of: a) a p85 recruitment moiety that binds to the p85 regulatory subunit of phosphoinositide 3-kinase (PI3K), b) an SH3 moiety derived from Crk, Cdc25, phospholipase, Ras, Vav, GRB2, FAK, Pyk2, TRIP10, or Gads, and c) a proline-rich peptide sequence from C3G, p41, PEP, p4'7, HPK1, SLP-1, CD3.epsilon., PAK, AIP4, or Sos, which binds to an SH3 moiety-containing protein. In some embodiments, the recruitment moiety is a p85 recruitment moiety, wherein the p85 recruitment moiety is derived from CD19, Gab2, IREM-1, PDGF receptor, CSFR-1, c-Kit, ErbB3, or CD7.

[0085] In some embodiments, the CPR further comprises an N-terminal signal peptide, hi some embodiments, the N-terminal signal peptide comprises the CD8 signal peptide or the mannose receptor signal peptide.

[0086] In some embodiments, the CPR comprises an amino acid sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs:86-103.

[0087] Also provided are nucleic acids encoding one or more of the CPRs described herein.

[0088] In some embodiments, the nucleic acid comprises a nucleotide sequence that is at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs:68-85.

[0089] Also provided are recombinant vectors encoding one or more CPRs of the disclosure, as well as cells comprising one or more CPRs, nucleic acids encoding one or more CPRs, and / or vectors capable of expressing one or more CPRs. In some embodiments, the host cell is a phagocyte, such as a macrophage, dendritic cell, mast cell, monocyte, neutrophil, microglial cell, or astrocyte. Also provided are cell populations comprising two or more cells described herein.

[0090] Also provided are pharmaceutical compositions comprising a therapeutically effective amount of one or more CPRs, one or more nucleic acids encoding a CPR, one or more vectors capable of expressing a CPR, a host cell or host cell population containing a CPR, and a pharma- ceutically acceptable carrier.

[0091] Also provided are methods of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more CPRs, one or more nucleic acids encoding a CPR, one or more vectors capable of expressing a CPR, a host cell or host cell population comprising a CPR, or a pharmaceutical composition comprising any of the above. In some embodiments, the subject is a human.

[0092] In one aspect, a bait macrophage engager (BME) is provided that comprises: a) a binding domain to which a virus specifically binds, the binding domain being other than an antibody; and b) a ligand for an endocytic receptor.

[0093] In one aspect, a bait macrophage engager (BME) is provided that comprises: a) a binding domain to which a virus specifically binds, where the binding domain is a portion of a host protein that confers attachment of the virus to a host cell when the binding domain is exposed to the virus and the binding domain is expressed in a host cell; and b) a ligand for an endocytic receptor.

[0094] In some embodiments, the binding region comprises a portion of a protein selected from the group consisting of angiotensin-converting enzyme 2 (ACE2), CD4, CCR5, CXCR4, T-cell Ig and mucin domain 1 (TIM-1), CD46, and SLAMF1.

[0095] In some embodiments, the binding region comprises ACE2 or a fragment thereof. In some embodiments, the binding region comprises amino acids 19-358, 19-605, or 19-740 of SEQ ID NO:2. In some embodiments, the binding region comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8.

[0096] In some embodiments, the endocytosis receptor is the mannose receptor.

[0097] In some embodiments, the endocytosis receptor is a phagocytic receptor, hi some embodiments, the phagocytic receptor is selected from the group consisting of MERTK, Dectin-1, and Fc gamma receptor (FcγR).

[0098] In some embodiments, the endocytic receptor is a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of class A, B, C, D, E, F, G, H, IK, J, K, and L scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

[0099] In some embodiments, the ligand is selected from the group consisting of soluble CD163 (sCD163), mannose, growth arrest specific factor 6 (Gas6), protein S (Pros1), low density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanion, ferritin, ferritin light chain, beta-glucan, N-acetylgalactosamine, GAL type ligand (beta-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptide, high density cholesterol (HDL), lectin, selectin, C1q, hemoglobin, haptoglobin, amyloid-beta peptide, hyaluronic acid (HA aka hyaluronan), and microtubule associated protein tau (MAPT).

[0100] In some embodiments, the ligand is soluble CD 163. In some embodiments, the ligand comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO: 105.

[0101] In some embodiments, the BME comprises an amino acid sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to the amino acid sequence of SEQ ID NO:107.

[0102] In some embodiments, the BME further comprises an IgG Fc.

[0103] Also provided are nucleic acids encoding one or more of the BMEs described herein.

[0104] In some embodiments, the nucleic acid comprises a nucleotide sequence that is at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to the nucleotide sequence of SEQ ID NO:106.

[0105] Also provided are recombinant vectors encoding one or more BMEs of the disclosure, as well as cells comprising one or more BMEs, nucleic acids encoding one or more BMEs, and / or vectors capable of expressing one or more BMEs. Also provided are cell populations comprising two or more cells as described herein.

[0106] Also provided are pharmaceutical compositions comprising a therapeutically effective amount of one or more BMEs and a pharma- ceutically acceptable carrier.

[0107] Also provided is a method of treating or preventing a viral infection in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more BMEs or pharmaceutical compositions thereof.

[0108] In some embodiments, the subject is a human.

[0109] In some embodiments, the viral infection is caused by a virus selected from the group consisting of Togaviridae, Coronaviridae, Flaviviridae, Orthomyxoviridae, Filoviridae, Paramyxoviridae, Retroviridae, and Bunyaviridae.

[0110] In some embodiments, the virus is a coronavirus. In some embodiments, the coronavirus is SARS-CoV-2.

[0111] In one aspect, an antigen-macrophage engager (AME) is provided that comprises: a) an antibody that binds to an antigen expressed on the surface of a cancer cell; and b) a ligand for an endocytic receptor.

[0112] In some embodiments, the antibody comprises a single chain variable fragment (scFv) or single moiety antibody (sdAb) variable portion.

[0113] In some embodiments, the antigen binding portion is selected from the group consisting of CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD117), CD213A2, IL-1 The present invention specifically binds to an antigen selected from the group consisting of IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-beta, SSEA-4, CD20, MUC1, EGFR, NCAM, prostase, PAP, ELF2M, ephrin B2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide, and IGLL1.

[0114] In some embodiments, the endocytosis receptor is the mannose receptor.

[0115] In some embodiments, the endocytic receptor is a phagocytic receptor. In some embodiments, the intracellular signaling region of the phagocytic receptor comprises an intracellular portion from a protein selected from the group consisting of MERTK and Fc gamma receptor (FcγR).

[0116] In some embodiments, the endocytic receptor is a scavenger receptor. In some embodiments, the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of class A, B, C, D, E, F, G, H, IK, J, K, and L scavenger receptors. In some embodiments, the scavenger receptor is selected from the group consisting of SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

[0117] In some embodiments, the ligand is selected from the group consisting of soluble CD163 (sCD163), mannose, growth arrest specific factor 6 (Gas6), protein S (Pros1), low density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanion, ferritin, ferritin light chain, beta-glucan, N-acetylgalactosamine, GAL type ligand (beta-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptide, high density cholesterol (HDL), lectin, selectin, C1q, hemoglobin, haptoglobin, amyloid-beta peptide, hyaluronic acid (HA aka hyaluronan), and microtubule associated protein tau (MAPT).

[0118] In some embodiments, the ligand is soluble CD 163. In some embodiments, the ligand comprises at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% of the amino acid sequence of SEQ ID NO: 105.

[0119] Also provided are nucleic acids encoding one or more of the AMEs described herein.

[0120] Also provided are recombinant vectors encoding one or more AMEs of the disclosure, as well as cells comprising one or more AMEs, nucleic acids encoding one or more AMEs, and / or vectors capable of expressing one or more AMEs. Also provided are cell populations comprising two or more cells described herein.

[0121] Also provided are pharmaceutical compositions comprising a therapeutically effective amount of one or more AMEs and a pharma- ceutically acceptable carrier.

[0122] Also provided are methods of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of one or more AMEs described herein or pharmaceutical compositions thereof. In some embodiments, the subject is a human.

[0123] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the present disclosure and, together with the description, serve to explain the principles of the disclosure. [Brief description of the drawings]

[0124] [Figure 1] Schematic diagram comparing antibody recognition of viruses (left panel) and chimeric bait receptor (CBR) recognition of viruses (right panel). Mutant viruses (labeled "Mut") are not recognized by antibodies. However, both wild-type and mutant viruses are recognized by the extracellular "bait" portion of the chimeric bait receptor (e.g., ACE2). [Diagram 2] A series of fluorescence microscopy images showing phagocytosis of SARS-CoV-2 spike protein coated or uncoated beads by either untransduced (UTD) Thp1 cells or Thp1 cells transduced with the mannose receptor-based F4-AC construct containing the ACE2(19-740AA) bait. [Figure 3A] Flow cytometry plots of phagocytosis of SARS-CoV-2 spike-coated or non-coated beads by either untransduced (UTD) Thp1 cells or Thp1 cells transduced with the mannose receptor-based F4-AC construct containing the ACE2(19-740AA) bait. One-way ANOVA followed by Tukey's post-hoc analysis. ***p<0.0001. [Figure 3B] Summary of flow cytometry results. Mean ± SEM (n=3). One-way ANOVA followed by Tukey's post-hoc analysis. ***p<0.0001. [Figure 4A]Flow cytometry plots of phagocytosis of B.1.1.7 or WT SARS-CoV-2 spike-coated or non-coated beads by either untransduced (UTD) Thp1 cells or Thp1 cells transduced with a mannose receptor-based F4-AC construct containing an ACE2(19-740AA) bait. One-way ANOVA followed by Tukey's post-hoc analysis. ***p<0.0001. [Figure 4B] Summary of flow cytometry results. Mean ± SEM (n=3). One-way ANOVA followed by Tukey's post-hoc analysis. ***p<0.0001. [Figure 5A] Flow cytometry plots of phagocytosis of B.1.617.2 or WT SARS-CoV-2 spike-coated or non-coated beads by untransduced (UTD) Thp1 cells or Thp1 cells transduced with a mannose receptor-based F4-AC construct containing an ACE2(19-740AA) bait. Mean ± SEM (n=3). One-way ANOVA followed by Tukey's post-hoc analysis. ***p<0.0001. [Figure 5B] Summary of flow cytometry results. Mean ± SEM (n=3). One-way ANOVA followed by Tukey's post-hoc analysis. ***p<0.0001. [Figure 6] Schematic diagram of the neutralization assay. Lentivirus carrying a GFP transfer plasmid was pseudotyped with spike envelope protein to generate spike-LV. Spike-LV particles were preincubated with Thp1 effector cells expressing the CBR construct. After 30 min to 2 h preincubation, cells were spun down and the supernatant was collected and incubated with HEK293T cells expressing the hACE2 receptor on the cell surface (ACE2-293). The frequency of GFP+ was determined by flow cytometer to test the neutralization effect. [Figure 7A]Results from neutralization assays are shown. Flow cytometry plots of transduced ACE2-293 target cells after 30 min preincubation of virus with effector cells. Mean ± SEM (n=2). One-way ANOVA for each MOI separately compared to the mean of control (virus, no effector cells), followed by Holm-Sidak post-hoc analysis. For MOI 0.1, ** / *** compare to control (virus, no effector cells). [Figure 7B] Results from neutralization assays are shown. Summary of flow cytometry results. Mean ± SEM (n=2). One-way ANOVA for each MOI separately compared to the mean of control (virus present, no effector cells), followed by Holm-Sidak post-hoc analysis. For MOI 0.1, ** / *** compares to control (virus present, no effector cells). [Figure 8] 1 is a schematic diagram of a series of various chimeric bait receptors (CBRs) and chimeric phagocytic receptors (CPRs) provided by the present disclosure. The CBR constructs contain ACE2 as a viral (e.g., SARS-COV-2) bait, and the CPR constructs contain anti-FLT3 scFv. The extracellular bait (e.g., ACE2) or antigen-binding portion (e.g., anti-FLT3 scFv) is fused to the intracellular signaling domain of one of the following phagocytic receptors: MERTK, MEGF10, Dectin-1, or CD163. [Figure 9A] Representative flow cytometry plots of phagocytosis of spike-coated and non-coated beads by either untransduced (UTD) Thp1 cells or Thp1 cells transduced with MEGF10-based B4-AC construct containing ACE2(19-740AA) bait. Two-way ANOVA followed by Tukey post-hoc analysis. [Figure 9B] Summary of flow cytometry results. Mean ± SEM (n=3). Two-way ANOVA followed by Tukey post-hoc analysis. [Figure 9C] Two-way ANOVA followed by Tukey post-hoc analysis. Microscopic images of UTD and B4-AC Thp1 cells showing cell clustering. [Figure 10A] Results from neutralization assays are shown. Representative flow cytometry plots of transduced ACE2-293 target cells after 2 h preincubation of virus with effector cells. Mean ± SEM (n=2). One-way ANOVA followed by Holm-Sidak post-hoc analysis. [Figure 10B] Results from neutralization assays are shown. Summary of flow cytometry results. Mean ± SEM (n=2). One-way ANOVA followed by Holm-Sidak post-hoc analysis. [Figure 11]

[0023] Figure 1 is a series of schematic diagrams of various exemplary chimeric phagocytic receptor (CPR) constructs provided by the present disclosure. The CPR constructs comprise either an anti-CD19 scFv or an anti-CD20 scFv fused to the intracellular signaling domain of one of the following phagocytic receptors: mannose receptor (F4), MERTK, MEGF10, Dectin-1, or CD163. [Figure 12] FIG. 1 is a schematic diagram of an exemplary bait macrophage engager (BME) construct provided by the present disclosure in which soluble CD163 (sCD163) is fused to ACE2(19-740). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0125] The present disclosure provides novel chimeric bait receptors (CBRs) for eliminating viral infections by programming immune cells (e.g., macrophages) responsible for innate immunity to destroy the viruses that cause them. The CBRs provided herein contain a portion of the protein that the virus binds to infect human cells, which acts as a bait for the virus and then allows the immune cells to destroy it. Compared to other existing approaches to combat viral infections, the main advantages of these CBRs are durability (e.g., due to the use of bait, they are not susceptible to targeted viral mutations), efficiency (e.g., CBRs are made from portions of naturally occurring proteins / receptors responsible for phagocytosis or endocytosis in macrophages, endowing immune cells with the ability to destroy invading pathogens), and versatility (CBRs are modular synthetic receptors that can be reconfigured to attack almost any virus, bacteria, or mammalian cell, including malignant cells).

[0126] The CBRs described herein include an extracellular portion that includes a binding region ("viral bait") to which the virus specifically binds, a transmembrane portion, and an intracellular portion that includes an intracellular signaling region of an endocytic receptor. Typically, the viral binding region is not an antibody, but instead is a host cell receptor or protein that the virus binds to infect the host cell. When the virus binds to the extracellular viral bait, the intracellular signaling region is activated, resulting in endocytosis of the virus. Thus, the CBRs are particularly useful in methods of treating or preventing viral infections (e.g., SARS-CoV-2 infections) in subjects in need of such treatment and prevention.

[0127] The CBR of the present disclosure can be reconstituted to replace the extracellular viral bait with an extracellular portion that comprises an antigen-binding portion. These reconstituted CBRs are referred to herein as chimeric phagocytic receptors (CPRs) and are also provided by the present disclosure. These CPRs can be used to target any antigen, such as tumor-associated antigens (TAAs), and destroy any cell that expresses the antigen on its surface. Thus, these CPRs are particularly useful in methods of treating cancer in subjects in need of such treatment.

[0128] Also provided herein are bait macrophage engagers (BMEs) and antigen macrophage engagers (AMEs), which are similar to CBRs and CPRs, respectively, with the transmembrane and intracellular portions replaced with ligands for endocytic receptors. In other words, BMEs include a binding domain to which a virus specifically binds ("viral bait") and a ligand for an endocytic receptor, and AMEs include an antigen-binding portion and a ligand for an endocytic receptor. BMEs and AMEs function by inducing endocytosis of a virus or an antigen-presenting cell when the ligand portion binds to an endocytic receptor. Thus, BMEs are particularly useful in methods of treating or preventing a viral infection (e.g., SARS-CoV-2 infection) in a subject in need of such treatment or prevention, and AMEs are particularly useful in methods of treating cancer in a subject in need of such treatment.

[0129] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the claimed subject matter belongs. It is to be understood that the foregoing general description and the following detailed description are merely exemplary and explanatory and are not intended to limit any claimed subject matter. In this application, the use of the singular includes the plural unless specifically stated otherwise. It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. In this application, the use of "or" means "and / or" unless specifically stated otherwise. Furthermore, the term "including," as well as other forms of "include," "includes," and "included," are not limiting. The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0130] As used herein, when used to modify a numerical value or numerical range, the terms "about" and "approximately" indicate a deviation of 5%-10% above (e.g., up to 5%-10% above) and 5%-10% below (e.g., up to 5%-10% below) that value or range while remaining within the intended meaning of the cited value or range.

[0131] As used herein, the term "extracellular" with respect to a recombinant transmembrane protein refers to one or more portions of the recombinant transmembrane protein that are located outside the cell.

[0132] As used herein, the term "transmembrane" with respect to a recombinant transmembrane protein refers to one or more portions of the recombinant transmembrane protein that are embedded in the plasma membrane of a cell.

[0133] As used herein, the term "intracellular" with respect to a recombinant transmembrane protein refers to one or more portions of the recombinant transmembrane protein that are located within the cytoplasm of a cell. The terms "cytoplasmic" and "intracellular" are interchangeable.

[0134] "Binding affinity" generally refers to the strength of the sum of non-covalent interactions between a single binding site of a molecule (e.g., CBR) and its binding partner (e.g., viral protein). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., CBR and a viral protein). The affinity of a molecule X for its partner Y is generally determined by the dissociation constant (K D Affinity can be expressed by, but is not limited to, the equilibrium dissociation constant (K D ), and the equilibrium association constant (K A ) can be measured and / or expressed in a number of ways known in the art. D is k off / k on It is calculated from the quotient of K A is k on / k off It is calculated from the quotient of k on refers to the association rate constant, k off k refers to the dissociation rate constant. on and k off can be determined by techniques known to those of skill in the art, such as using BIAcore® or KinExA. As used herein, a "low affinity" refers to a larger K D Refers to...

[0135] For example, "specifically binds to" may be used to refer to the ability of a receptor to preferentially bind to a particular ligand (e.g., an antigen or viral protein), as such binding is understood by those of skill in the art. For example, an antibody or antibody fragment that specifically binds to an antigen can generally bind other antigens with lower affinity, as determined, for example, by BIAcore® or other immunoassays known in the art (see, e.g., Savage et al., (1999) Immunity. 10(4):485-92, which is incorporated herein by reference in its entirety).

[0136] As used herein, "epitope" is a term in the art and refers to a localized region of an antigen (e.g., a peptide or peptide-MHC complex) to which a CPR can bind. In certain embodiments, the epitope to which a CPR binds can be determined, for example, by NMR spectroscopy, X-ray diffraction crystallographic studies, ELISA assays, hydrogen / deuterium exchange coupled with mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), flow cytometry analysis, mutagenesis mapping (e.g., site-directed mutagenesis mapping), and / or structural modeling. For X-ray crystallography, crystallization can be achieved using any of the methods known in the art (e.g., Giege R et al., (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4):339-350; McPherson A, (1990) Eur J Biochem 189:1-23; Chayen NE, (1997) Structure 5:1269-1274; McPherson A, (1976) J Biol Chem 251:6300-6303, each of which is incorporated herein by reference in its entirety). TCR:antigen crystals can be studied using well-known X-ray diffraction techniques, including X-PLOR (Yale University, 1992, distributed by Molecular Simulations, Inc., see e.g., Meth Enzymol (1985) volumes 114&115, eds Wyckoff HW, et al., US2004 / 0014194), and BUSTER (Bricogne G, (1993) Acta Crystallogr D Biol Crystallogr 49(Pt 1):37-60; Bricogne G, (1997) Meth Enzymol 276A:361-423, ed Carter CW, and Roversi P et al., (2000) Acta Crystallogr D Biol Crystallogr 56(Pt 10):1316-1323), each of which is incorporated herein by reference in its entirety.Mutagenesis mapping studies can be accomplished using any method known to those of skill in the art. For a description of mutagenesis techniques, including alanine scanning mutagenesis techniques, see, for example, Champe M et al., (1995) J Biol Chem 270:1388-1394 and Cunningham BC & Wells JA, (1989) Science 244:1081-1085, each of which is incorporated herein by reference in its entirety. In a specific embodiment, the epitope of the antigen is determined using alanine scanning mutagenesis studies. In a specific embodiment, the epitope of the antigen is determined using hydrogen / deuterium exchange coupled with mass spectrometry. In a particular embodiment, the antigen is a peptide-MHC complex. In a particular embodiment, the antigen is a peptide presented by an MHC molecule.

[0137] As used herein, the terms "treat", "treating" and "treatment" refer to therapeutic or prophylactic measures as described herein. In some embodiments, the method of "treatment" employs administering a CBR or CPR, or a cell expressing a CBR or CPR, to a subject having a disease or disorder or predisposed to having such a disease or disorder to prevent, cure, delay, reduce the severity of, or ameliorate a disease or disorder, or one or more symptoms of a recurrent disease or disorder, or to extend the subject's survival beyond that expected in the absence of such treatment.

[0138] As used herein, in the context of administering a therapy, the term "effective amount" refers to the amount of the therapy that achieves a desired prophylactic or therapeutic effect.

[0139] As used herein, the term "subject" includes any human or non-human animal. In one embodiment, the subject is a human or non-human mammal. In one embodiment, the subject is a human.

[0140] The determination of "percent identity" between two sequences (e.g., amino acid sequences or nucleic acid sequences) can be accomplished using a mathematical algorithm. A specific, non-limiting example of a mathematical algorithm utilized for comparing two sequences is the algorithm of Karlin S&Altschul SF,(1990) PNAS 87:2264-2268, modified as in Karlin S&Altschul SF,(1993) PNAS 90:5873-5877, each of which is incorporated herein by reference in its entirety. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul SF et al.,(1990) J Mol Biol 215:403, which are incorporated herein by reference in their entirety. To obtain nucleotide sequences homologous to the nucleic acid molecules described herein, BLAST nucleotide searches can be performed using, for example, the NBLAST nucleotide program parameters set to score=100, word length=12, etc. To obtain amino acid sequences homologous to the protein molecules described herein, BLAST protein searches can be performed using XBLAST program parameters set, for example, score 50, word length = 3, etc. To obtain gapped alignments for comparison purposes, gapped BLAST can be utilized as described in Altschul SF et al., (1997) Nuc Acids Res 25:3389-3402, which is incorporated herein by reference in its entirety. Alternatively, PSI BLAST can be used to perform an iterative search that detects distant relationships between molecules. (Id.) When utilizing BLAST, gapped BLAST, and PSI BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used (see, e.g., National Center for Biotechnology Information (NCBI) on the worldwide web, ncbi.nlm.nih.gov).Another specific, non-limiting example of a mathematical algorithm utilized for comparing sequences is the algorithm of Myers and Miller, (1988), CABIOS 4:11-17, which is incorporated herein by reference in its entirety. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program to compare amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0141] The percent identity between two sequences can be determined using techniques similar to those described above, with or without allowing gaps. In calculating percent identity, typically only exact matches are counted.

[0142] As used herein, the term "operably linked" refers to the linkage of polynucleotide or amino acid sequence elements in a functional relationship. For example, a polynucleotide sequence is operably linked when it is placed in a functional relationship with another polynucleotide sequence. In some embodiments, a transcriptional regulatory polynucleotide sequence, such as a promoter, enhancer, or other expression control element, is operably linked to a polynucleotide sequence encoding a protein if it affects the transcription of the polynucleotide sequence encoding the protein. An operably linked element can be contiguous or non-contiguous. In addition, in the context of a polypeptide, "operably linked" refers to a physical linkage (e.g., directly or indirectly linked) between amino acid sequences (e.g., different segments, regions, or domains) to effect the described activity of the polypeptide. In the present disclosure, various segments, regions, or domains of the chimeric polypeptide of the present disclosure can be operably linked to retain the proper folding, processing, targeting, expression, binding, and other functional properties of the chimeric polypeptide in a cell. Unless otherwise specified, the various regions, domains, and segments of the chimeric polypeptides of the present disclosure are operably linked to one another. The operably linked regions, domains, and segments of the chimeric polypeptides of the present disclosure can be contiguous or non-contiguous (e.g., linked to one another via a linker).

[0143] The term "polynucleotide" as used herein refers to a polymer of DNA or RNA. Polynucleotide sequences may be single-stranded or double-stranded, may contain natural, non-natural, or modified nucleotides, and may contain natural, non-natural, or modified internucleotide bonds, such as phosphoramidate or phosphorothioate bonds, instead of the phosphodiesters found between nucleotides in unmodified polynucleotide sequences. Polynucleotide sequences include, but are not limited to, all polynucleotide sequences obtained by any means available in the art, including, but not limited to, recombinant means, such as cloning polynucleotide sequences from recombinant libraries or cell genomes, using conventional cloning techniques and the polymerase chain reaction, and synthetic means.

[0144] The terms "amino acid sequence" and "polypeptide" are used interchangeably herein and refer to a polymer of amino acids joined by one or more peptide bonds. As used herein, "amino acid sequence" refers to information that describes the relative order and identity of the amino acid residues that make up a polypeptide.

[0145] The term "functional fragment" as used herein with respect to a protein or polypeptide refers to a fragment of a reference protein that retains at least one particular function. Not all functions of the reference protein need be retained by a functional fragment of a protein. In some cases, one or more functions are selectively reduced or eliminated.

[0146] As used herein, the term "modification" with respect to a polynucleotide sequence refers to a polynucleotide sequence that contains at least one substitution, alteration, inversion, addition, or deletion of a nucleotide compared to a reference polynucleotide sequence. As used herein, the term "modification" with respect to an amino acid sequence refers to an amino acid sequence that contains at least one substitution, alteration, inversion, addition, or deletion of an amino acid residue compared to a reference amino acid sequence.

[0147] As used herein, the term "derived from" with respect to a polynucleotide sequence refers to a polynucleotide sequence that has at least 85% sequence identity to a reference naturally occurring nucleic acid sequence from which it is derived. The term "derived from" with respect to an amino acid sequence refers to an amino acid sequence that has at least 85% sequence identity to a reference naturally occurring amino acid sequence from which it is derived. As used herein, the term "derived from" does not refer to any particular process or method for obtaining a polynucleotide or amino acid sequence. For example, a polynucleotide or amino acid sequence can be chemically synthesized.

[0148] The term "recombinant" or "engineered" nucleic acid molecule as used herein refers to a nucleic acid molecule that has been modified by human intervention. As a non-limiting example, a cDNA is a recombinant DNA molecule, as is any nucleic acid molecule that has been produced by the action(s) of a polymerase in vitro, or to which a linker has been attached, or that has been incorporated into a vector, such as a cloning vector or an expression vector.

[0149] As used herein, the term "host protein" refers to a cell-associated protein to which a virus binds in the process of infecting the cell. For example, in the case of SARS-CoV-2, at least one host protein includes human angiotensin-converting enzyme 2 (ACE2). In some embodiments, the host protein may be an antibody or other immune system protein that specifically binds to the virus in the process of removing the virus from the organism. In some embodiments, the host protein may not be an antibody or other immune system protein that specifically binds to the virus in the process of removing the virus from the organism.

[0150] As used herein, the term "vector" refers to a nucleic acid molecule or sequence capable of transferring or transporting another nucleic acid molecule. The transferred nucleic acid molecule is generally linked, e.g., inserted, into the vector nucleic acid molecule.

[0151] Phagocytosis Phagocytosis generally refers to the process of engulfing cells or large particles (>0.5 μm), in which tethering of the target cell or particle, engulfment of the target cell or particle, and degradation of the internalized target cell or particle occur. In certain embodiments, phagocytosis includes the formation of a phagosome that contains the internalized target cell or particle, and phagosome fusion with a lysosome to form a phagolysosome, in which the contents are degraded. Thus, "phagocytosis" includes the process of "efferocytosis" (specifically referring to the phagocytosis of apoptotic or necrotic cells in a non-inflammatory manner).

[0152] There are two main types of phagocytosis, influenced by the target, cell type, and surrounding environment. Antimicrobial phagocytosis removes and degrades disease-causing microorganisms, induces proinflammatory signaling via cytokine and chemokine secretion, and recruits immune cells to initiate an effective inflammatory response. This type of phagocytosis is often referred to as "inflammatory phagocytosis" (or "immunogenic phagocytosis"). However, in some cases, such as certain persistent infections, an anti-inflammatory response may follow the uptake of the microorganism. Antimicrobial phagocytosis is generally performed by professional phagocytes of the myeloid lineage, such as immature dendritic cells (DCs) and macrophages, as well as tissue-resident immune cells.

[0153] In contrast, phagocytosis (e.g., efferocytosis) of damaged, autologous, apoptotic cells or cell debris is usually a non-inflammatory (also referred to as "non-immunogenic") process. Billions of damaged, dying, and unwanted cells undergo apoptosis every day. Unwanted cells include, for example, excess cells generated during development, senescent cells, infected cells (intracellular bacteria or viruses), transformed or malignant cells, and cells irreversibly damaged by cytotoxic agents. Phagocytes carry out specific and rapid removal of apoptotic cells without causing damage to surrounding tissues or inducing a proinflammatory immune response. The steps for the clearance of apoptotic cells include: (1) the release of a “find me” signal from the apoptotic cell to recruit phagocytes to the location of the apoptotic cell; (2) the “eat me” signal exposed on the surface of the apoptotic cell is bound by phagocytes via specific receptors; (3) cytoskeleton rearrangement to phagocytose the apoptotic cell; and (4) the digestion of the ingested apoptotic cell and the induction of specific phagocytic responses (e.g., secretion of anti-inflammatory cytokines).

[0154] The terms "phagocytic cell" and "phagocyte" are used interchangeably herein to refer to cells capable of phagocytosis, e.g., ingesting microorganisms and foreign particles, and capable of engulfing large particulate masses, e.g., up to the size of microbial cells or mammalian cells, e.g., tumor cells, e.g., from about 0.1 μm in diameter up to about 2 mm or about 1 mm in diameter, e.g., from about 0.5 μm in diameter to about 1 mm in diameter, in particular. Phagocytosis encompasses the engulfment of cells, pathogens, and various particles by surrounding it with an effector cell membrane, as described above. Thus, phagocytes protect the body by ingesting harmful foreign particles, bacteria, and dead or dying cells. These cells are essential for fighting infection and subsequent immunity.

[0155] There are several categories of phagocytes. Exemplary phagocytes include macrophages, mononuclear cells (histiocytes and monocytes), polymorphonuclear leukocytes, (neutrophils), and dendritic cells. Human and other jawed vertebrate phagocytes are divided into "professional" and "non-professional" groups based on their efficiency in participating in phagocytosis. Professional phagocytes include many types of white blood cells (e.g., neutrophils, monocytes, macrophages, mast cells, and dendritic cells). The main difference between professional and non-professional phagocytes is that professional phagocytes have molecules on their surface called receptors that can detect harmful objects, such as bacteria, that are not normally found in the body. Thus, professional phagocytes can recognize a wide variety of phagocytic targets and ingest them at a higher rate than non-phagocytes.

[0156] Dendritic cells (DCs) refer to any member of a diverse population of morphologically similar cell types found in lymphoid or non-lymphoid tissues. DCs are referred to as "professional" antigen-presenting cells and have a high capacity to prime MHC-restricted T cells. DCs can be recognized by function, by phenotype, and / or by gene expression patterns, especially by cell surface phenotype. These cells are characterized by their unique morphology, high levels of surface MHC-class II expression, and the ability to present antigens to CD4+ and / or CD8+ T cells, especially naive T cells.

[0157] Neutrophils and macrophages represent fully differentiated phagocytes. Neutrophils leaving the bone marrow are fully differentiated, whereas macrophages differentiate from circulating monocytes in extravascular tissues. Monocytes exhibit a reduced phagocytic response compared to neutrophils and macrophages and must respond to activation and differentiation signals to achieve optimal phagocytic capacity. The process of differentiation of monocytes to macrophages has been well characterized and can be performed in vitro or in vivo.

[0158] Macrophages are of particular interest. These immune cells can enter tumors and migrate to cancers that the rest of the immune system cannot reach. Macrophages are key effectors of the innate immune system and are responsible for phagocytosis of debris and pathogens. Accumulating evidence suggests that macrophages are abundant in the tumor microenvironment of many cancers, where they can adopt classically activated (M1, antitumor) or alternatively activated (M2, protumor) phenotypes. Macrophages are potent effectors of the innate immune system and are capable of at least three distinct antitumor functions: phagocytosis, cytotoxicity, and antigen presentation to orchestrate adaptive immune responses. Whereas T cells require antigen-dependent activation via T cell receptors or chimeric immune receptors, macrophages can be activated in a variety of ways. Direct macrophage activation is antigen-independent, relying on mechanisms such as pathogen-associated molecular pattern recognition by Toll-like receptors (TLRs). Macrophages are uniquely capable of penetrating solid tumors while other immune cells, such as T cells, are physically excluded or inactivated, suggesting that engineered macrophages could augment existing T cell-based therapies.

[0159] Chimeric Polypeptides The present disclosure provides chimeric polypeptides comprising a portion capable of specifically binding to an antigen and a portion that targets the chimeric polypeptide for endocytosis upon binding to the antigen. As described in more detail below, the antigen may be a viral protein and the portion capable of specifically binding to the viral protein may be a binding region to which the virus binds on a host cell. In other embodiments, the antigen may be a tumor-associated antigen (TAA) and the portion capable of specifically binding to the TAA may be an antigen-binding portion, such as an antibody or a fragment thereof. The portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis may be an intracellular (i.e., cytoplasmic) signaling region of an endocytic receptor. In other embodiments, the portion of the chimeric polypeptide that targets the chimeric polypeptide for endocytosis may be a ligand for an endocytic receptor.

[0160] In one aspect, the present disclosure provides a chimeric bait receptor (CBR) comprising: a) an extracellular portion capable of specifically binding to a viral protein; b) a transmembrane portion; and c) an intracellular portion comprising an intracellular signaling region of an endocytic receptor. In some embodiments, the extracellular portion is not an antibody. In some embodiments, the extracellular portion specifically binds to a viral protein that binds to a host cell and confers attachment of the virus to the host cell. In some embodiments, the intracellular portion comprises an intracellular signaling region of an endocytic receptor selected from a phagocytic receptor or a scavenger receptor. The transmembrane portion can be any transmembrane portion capable of expressing the CBR on the surface of a cell, particularly a phagocyte. In some embodiments, the transmembrane portion can be a transmembrane portion of an endocytic receptor. In some embodiments, the transmembrane portion and the intracellular portion of the CBR can be derived from the same endocytic receptor. In other embodiments, the transmembrane portion and the intracellular portion of the CBR can be derived from different endocytic receptors. In other embodiments, the transmembrane portion is not derived from an endocytic receptor.

[0161] As a proof of concept, an exemplary CBR of the present disclosure was developed to program macrophages to neutralize the SARS-CoV-2 virus by phagocytosis. The exemplary CBR contains a portion of the receptor, angiotensin-converting enzyme 2 (ACE2), to which the SARS-CoV-2 virus binds to infect cells. When the CBR is expressed by macrophages, the ACE2 portion is presented on the cell surface as bait for the virus. Macrophages expressing a CBR for SARS-CoV-2 were shown to selectively phagocytose 1) beads with SARS-CoV-2 spike envelope protein attached from multiple variant strains, and 2) live lentivirus carrying (pseudotyped) spike envelope protein of the SARS-CoV-2 virus.

[0162] Thus, in some embodiments, the extracellular portion of a CBR of the disclosure comprises a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein. In some embodiments, the CBR of the disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), Dectin-1, multiple EGF-like moieties 10 (MEGF10), and CD163, and c) an intracellular signaling region of an endocytic receptor selected from the group consisting of mannose receptor, MERTK, Dectin-1, MEGF10, and CD163.

[0163] In some embodiments, a CBR of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of the mannose receptor, and c) an intracellular signaling region of the mannose receptor.

[0164] In some embodiments, the CBR of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of MERTK, and c) an intracellular signaling region of MERTK.

[0165] In some embodiments, a CBR of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of Dectin-1, and c) an intracellular signaling region of Dectin-1.

[0166] In some embodiments, a CBR of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of MEGF10, and c) an intracellular signaling region of MEGF10.

[0167] In some embodiments, a CBR of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, b) a transmembrane portion of CD163, and c) an intracellular signaling region of CD163.

[0168] In some embodiments, a CBR of the present disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs:61-67.

[0169] In another aspect, the present disclosure provides a chimeric phagocytic receptor (CPR) comprising: a) an extracellular portion comprising an antigen-binding portion; b) a transmembrane portion; and c) an intracellular portion comprising an intracellular signaling region of an endocytic receptor. In some embodiments, the extracellular portion is an antibody or a fragment thereof (e.g., a single chain variable fragment (scFv) or a single moiety antibody (sdAb) variable portion). In some embodiments, the extracellular portion specifically binds to a tumor-associated antigen (TAA). In some embodiments, the intracellular portion comprises an intracellular signaling region of an endocytic receptor selected from a phagocytic receptor or a scavenger receptor. The transmembrane portion can be any transmembrane portion capable of expressing the CBR on the surface of a cell, particularly a phagocyte. In some embodiments, the transmembrane portion can be a transmembrane portion of an endocytic receptor. In some embodiments, the transmembrane portion and the intracellular portion of the CBR can be derived from the same endocytic receptor. In other embodiments, the transmembrane portion and the intracellular portion of the CBR can be derived from different endocytic receptors. In other embodiments, the transmembrane portion is not derived from an endocytic receptor.

[0170] In some embodiments, a CPR of the present disclosure does not include a recruitment moiety, which is not an intracellular region of an endocytic receptor, and which binds to a cytoplasmic protein in the phagocytic signaling pathway.

[0171] An exemplary CPR of the present disclosure was designed to target cancer cells for phagocytosis. The exemplary CPR comprises an scFv that specifically binds to an antigen selected from FLT3, CD19, or CD20. Similar to the CBR described above, when the CPR is expressed by macrophages, the scFv is presented on the cell surface as a bait for cancer cells expressing the tumor-associated antigen(s) (e.g., FLT3, CD19, or CD20). Thus, macrophages expressing the CPR present an alternative to conventional chimeric antigen receptor (CAR)-T and / or T cell receptor (TCR)-T cells currently being developed as cancer therapeutics. For example, T cells expressing CARs directed against CD19 have been shown recently to have significant anti-leukemia efficacy, with complete remissions being achieved in 90% of treated acute lymphoblastic leukemia patients. These results are accompanied by robust T cell proliferation and clearly documented T cell infiltration into tumor sites in leukemia patients so treated. Despite the high response rates demonstrated in hematopoietic malignancies, the efficacy of CAR-T cells in solid tumors and certain lymphomas may be limited. Possible explanations for this include a reduced potential of T cells to infiltrate solid tumors, poor trafficking, an immunosuppressive tumor microenvironment, and the expression of low numbers of tumor-specific antigens on solid tumor cells.

[0172] In contrast, macrophages are uniquely capable of enriching in tumor microenvironments where T cells are often excluded.Therefore, the use of macrophages expressing CPRs of the present disclosure provides a unique and potentially synergistic approach to existing CAR-T therapy.In addition, macrophages expressing CPRs can act as bait for metastatic cancer cells to spread throughout the body.Therefore, the use of CPRs to treat cancer is provided by the present disclosure and is further described herein.

[0173] In some embodiments, the extracellular portion of a CPR of the present disclosure may be selected from the group consisting of, but not limited to, CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD10, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3 (CD135), TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD117), CD213A2, IL-1 The extracellular portion of the CPR of the present disclosure comprises an antigen-binding portion that specifically binds to a tumor-associated antigen, including an antigen selected from the group consisting of IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-beta, SSEA-4, CD20, MUC1, EGFR, NCAM, prostase, PAP, ELF2M, ephrinB2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide (e.g., an O-glycan consisting of a single N-acetylgalactosamine-GalNAc, known as the Tn antigen), and IGLL1. In certain embodiments, the extracellular portion of the CPR of the present disclosure comprises an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3. In certain embodiments, the antigen-binding portion is an scFv.

[0174] In some embodiments, a CPR of the disclosure comprises a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3; b) a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), Dectin-1, multiple EGF-like moiety 10 (MEGF10), and CD163; and c) an intracellular signaling region of an endocytic receptor selected from the group consisting of mannose receptor, MERTK, Dectin-1, MEGF10, and CD163.

[0175] In some embodiments, a CPR of the disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of the mannose receptor, and c) an intracellular signaling region of the mannose receptor.

[0176] In some embodiments, the CPR of the present disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of MERTK, and c) an intracellular signaling region of MERTK.

[0177] In some embodiments, a CPR of the present disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of Dectin-1, and c) an intracellular signaling region of Dectin-1.

[0178] In some embodiments, a CPR of the present disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of MEGF10, and c) an intracellular signaling region of MEGF10.

[0179] In some embodiments, a CPR of the present disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of CD163, and c) an intracellular signaling region of CD163.

[0180] In some embodiments, a CPR of the disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs:86-103.

[0181] In another aspect, the disclosure provides a bait macrophage engager (BME) comprising a) a binding domain to which a virus specifically binds, and b) a ligand for an endocytic receptor. In some embodiments, the binding domain is not an antibody. In some embodiments, the binding domain specifically binds to a viral protein that binds to a host cell and confers attachment of the virus to the host cell. In some embodiments, the ligand is a ligand for an endocytic receptor selected from a phagocytic receptor or a scavenger receptor. In some embodiments, the ligand is one or more of the following: soluble CD163 (sCD163), mannose, growth arrest specific factor 6 (Gas6), protein S (Pros1), low density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanion, ferritin, ferritin light chain, beta-glucan, N-acetylgalactosamine, GAL type ligand (beta-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptide, high density cholesterol (HDL), lectin, selectin, C1q, hemoglobin, haptoglobin, amyloid-beta peptide, hyaluronic acid (HA aka hyaluronan), microtubule associated protein tau (MAPT), or a fragment of any of the ligands described herein.

[0182] An exemplary BME of the present disclosure was developed to neutralize the SARS-CoV-2 virus by phagocytosis. The exemplary BME comprises a portion of ACE2 fused to soluble CD163 (sCD163). sCD163 is a natural scavenger involved in iron recycling by recruiting macrophages. Thus, a BME comprising ACE2 and sCD163 can be used as a replacement for neutralizing antibodies against SARS-CoV-2. Instead of recruiting immune cells via Fc, the BME recruits macrophages via CD163.

[0183] Thus, in some embodiments, the binding region of a BME of the disclosure comprises a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein. In some embodiments, a BME of the disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for an endocytic receptor selected from the group consisting of the mannose receptor, MERTK, Dectin-1, MEGF10, and CD163.

[0184] In some embodiments, a BME of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for the mannose receptor, e.g., mannose or a fragment thereof.

[0185] In some embodiments, the BME of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for MERTK, such as growth arrest specific factor 6 (Gas6) or protein S (Pros1), or a fragment thereof.

[0186] In some embodiments, a BME of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for Dectin-1, e.g., beta-glucan.

[0187] In some embodiments, a BME of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for MEGF10, e.g., C1q or a fragment thereof.

[0188] In some embodiments, a BME of the present disclosure comprises a) a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein, and b) a ligand for CD163, e.g., a fragment thereof, sCD163.

[0189] In some embodiments, a BME of the disclosure comprises an amino acid sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO:107.

[0190] In another aspect, the disclosure provides an antigen-macrophage engager (AME) comprising: a) an antibody that binds to an antigen expressed on the surface of a cancer cell; and b) a ligand for an endocytic receptor. In some embodiments, the antibody comprises, or alternatively consists of, a single chain variable fragment (scFv) or single moiety antibody (sdAb) variable portion. In some embodiments, the ligand is a ligand for an endocytic receptor selected from a phagocytic receptor or a scavenger receptor.

[0191] Exemplary AMEs of the present disclosure target cancer cells for phagocytosis. Exemplary AMEs include scFvs that specifically bind to an antigen selected from FLT3, CD19, or CD20. Similar to the CPRs described above, the scFvs act as bait for cancer cells expressing tumor-associated antigen(s) (e.g., FLT3, CD19, or CD20). Binding of the ligand portion of the AME to its respective endocytic receptor results in phagocytosis of the AME and the attached cancer cells. Thus, AMEs can also be used as cancer therapeutics.

[0192] In some embodiments, the AME of the present disclosure may be any of a variety of markers, including, but not limited to, CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD10, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3 (CD135), TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD117), CD213A2, IL-1 The AME comprises an antibody or antigen-binding portion thereof that specifically binds to a tumor-associated antigen, including an antigen selected from the group consisting of IRa, PRSS21, VEGFR2, FSHR, TROP2, CD24, MUC-16, PDGFR-beta, SSEA-4, CD20, MUC1, EGFR, NCAM, prostase, PAP, ELF2M, ephrinB2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, Tn-glycopeptide, and IGLL1. In certain embodiments, the AME of the present disclosure comprises an antibody or antigen-binding portion thereof that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3. In certain embodiments, the antibody or antigen-binding portion thereof is an scFv.

[0193] In some embodiments, an AME of the disclosure comprises a) an antigen binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, b) a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), multiple EGF-like moiety 10 (MEGF10), and CD163, and c) a ligand for an endocytic receptor selected from the group consisting of mannose receptor, MERTK, Dectin-1, MEGF10, and CD163.

[0194] In some embodiments, an AME of the disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, and b) a ligand for the mannose receptor, e.g., mannose or a fragment thereof.

[0195] In some embodiments, an AME of the disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, and b) a ligand for MERTK, such as growth arrest specific factor 6 (Gas6) or protein S (Pros1), or a fragment thereof.

[0196] In some embodiments, an AME of the present disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, and b) a ligand for MEGF10, e.g., C1q or a fragment thereof.

[0197] In some embodiments, an AME of the disclosure comprises a) an antigen-binding portion that specifically binds to an antigen selected from the group consisting of CD19, CD20, and FLT3, and b) a ligand for CD163, e.g., a fragment thereof, sCD163.

[0198] In some embodiments, the chimeric polypeptide of the present disclosure comprises a portion of the extracellular domain of an endocytic receptor. For example, the CBR of the present disclosure may comprise a binding region fused to a portion of an endocytic receptor, including a portion of the extracellular domain, transmembrane domain, and intracellular domain of the endocytic receptor, to which a virus specifically binds. Similarly, the CPR of the present disclosure may comprise an antigen-binding portion fused to a portion of an endocytic receptor, including a portion of the extracellular domain, transmembrane domain, and intracellular domain of the endocytic receptor. In some embodiments, the chimeric polypeptide of the present disclosure comprises a full-length endocytic receptor (e.g., the entire extracellular domain, transmembrane domain, and intracellular domain of an endocytic receptor). For example, the CBR of the present disclosure may comprise a binding region fused to a full-length endocytic receptor, to which a virus specifically binds. Similarly, the CPR of the present disclosure may comprise an antigen-binding portion fused to a full-length endocytic receptor.

[0199] Non-limiting examples of sequences that can be used to generate the chimeric polypeptides of the present disclosure are provided in Table 1. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 1-8] [Table 1-9]

[0200] Exemplary chimeric polypeptide constructs are provided in Table 2. [Table 2-1] [Table 2-2]

Table 2-3

Table 2-4

Table 2-5

Table 2-6

Table 2-7

Table 2-8

Table 2-9

Table 2-10

Table 2-11

Table 2-12

Table 2-13

Table 2-14

Table 2-15

Table 2-16

Table 2-17

Table 2-18

Table 2-19

Table 2-20

Table 2-21

[0201] In some embodiments, the chimeric polypeptides of the present disclosure may further comprise one or more linkers between various portions of the chimeric polypeptide. For example, the CBR or CPR of the present disclosure may comprise one or more linkers between the extracellular portion and the transmembrane portion and / or between the transmembrane portion and the intracellular portion. The BME may comprise one or more linkers between the binding region and the ligand of the endocytic receptor. The AME may comprise one or more linkers between the antibody and the ligand of the endocytic receptor. Those skilled in the art will understand that any linker that maintains the function of the chimeric polypeptide may be used. There are no particular limitations regarding the linkers that may be used in the chimeric polypeptides described herein. In some embodiments, the linker comprises a peptide linker / spacer sequence. In some embodiments, the linker is a synthetic compound linker, such as a chemical crosslinker. Non-limiting examples of suitable cross-linkers available commercially include N-hydroxysuccinimide (NHS), disuccinimidyl suberate (DSS), bis(sulfosuccinimidyl)suberate (BS3), dithiobis(succinimidyl propionate) (DSP), dithiobis(sulfosuccinimidyl propionate) (DTSSP), ethylene glycol bis(succinimidyl succinate) (EGS), ethylene glycol bis(sulfosuccinimidyl succinate) (sulfoEGS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfoDST), bis[2-(succinimidooxycarbonyloxy)ethyl]sulfone (BSOCOES), and bis[2-(sulfosuccinimidooxycarbonyloxy)ethyl]sulfone (sulfoBSOCOES).

[0202] In some embodiments, the linker comprises a peptide linker sequence. In principle, there is no particular limit to the length and / or amino acid composition of the linker peptide sequence. In some embodiments, any single-chain peptide comprising about 1-100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a peptide linker. In some embodiments, the linker peptide sequence comprises about 5-50, about 10-60, about 20-70, about 30-80, about 40-90, about 50-100, about 60-80, about 70-100, about 30-60, about 20-80, about 30-90 amino acid residues. In some embodiments, the linker peptide sequence comprises about 1-10, about 5-15, about 10-20, about 15-25, about 20-40, about 30-50, about 40-60, about 50-70 amino acid residues. In some embodiments, the linker peptide sequence comprises about 40-70, about 50-80, about 60-80, about 70-90, or about 80-100 amino acid residues. In some embodiments, the linker peptide sequence comprises about 1-10, about 5-15, about 10-20, about 15-25 amino acid residues. In some embodiments, the linker peptide sequence may comprise up to 300 amino acids, preferably 10-100 amino acids, and most preferably 25-50 amino acids. In some embodiments, a short oligo- or polypeptide linker, preferably 2-10 amino acids in length, may form a link between the extracellular domain and the transmembrane domain of the chimeric polypeptide of the present disclosure.

[0203] In some embodiments, the length and amino acid composition of the linker peptide sequence may be optimized to alter the orientation and / or proximity of the polypeptide domains relative to one another to achieve a desired activity of the chimeric polypeptide. In some embodiments, the orientation and / or proximity of the polypeptide domains relative to one another may be optimized to result in a partial to fully phagocytic version of the chimeric polypeptide. In certain embodiments, the linker contains only glycine and / or serine residues (e.g., a glycine-serine linker). Examples of such peptide linkers include Gly(x)Ser (where x is 0-6), or Ser Gly(x) (where x is 0-6), (Gly Gly Gly Gly Ser)n (where n is an integer equal to or greater than 1), and (Ser Gly Gly Gly Gly)n (where n is an integer equal to or greater than 1). In some embodiments, the linker peptide is modified such that the amino acid sequence GSG (which occurs at the junction of a traditional Gly / Ser linker peptide repeat) is absent. For example, in some embodiments, the peptide linker comprises an amino acid sequence selected from the group consisting of (GGGXX)nGGGGS and GGGGS(XGGGS)n, where X is any amino acid that can be inserted into the sequence and does not result in a polypeptide comprising the sequence GSG, and n is 0-4. In some embodiments, the sequence of the linker peptide is (GGGX1X2)nGGGGS, where X1 is P, X2 is S, and n is 0-4. In some other embodiments, the sequence of the linker peptide is (GGGX1X2)nGGGGS, where X1 is G, X2 is Q, and n is 0-4. In some other embodiments, the sequence of the linker peptide is (GGGX1X2)nGGGGS, where X1 is G, X2 is A, and n is 0-4. In still other embodiments, the sequence of the linker peptide is GGGGS(XGGGS)n, where X is P, and n is 0-4. In some embodiments, a linker peptide of the present disclosure comprises or consists of the amino acid sequence (GGGGA)2GGGGS. In some embodiments, a linker peptide comprises or consists of the amino acid sequence (GGGGQ)2GGGGS.In another embodiment, the linker peptide comprises or consists of the amino acid sequence (GGGPS)2GGGGS. In another embodiment, the linker peptide comprises or consists of the amino acid sequence GGGGS(PGGGS)2. In yet another embodiment, the linker peptide comprises or consists of the amino acid sequence GSGGS or SGGSGS. In some embodiments, the linker peptide comprises or consists of the amino acid sequence GGGSGGGGSGGGSGGGGGS.

[0204] In some embodiments, the linker is a hinge region of a protein, for example, a CD8 hinge region.

[0205] In some embodiments, the chimeric polypeptide further comprises a signal peptide operably linked upstream (e.g., at the N-terminus) of the extracellular domain. Any signal peptide that targets the protein to the cell membrane of a phagocyte can be used. In some embodiments, the signal peptide is derived from a phagocytic receptor. In some embodiments, the signal peptide is derived from a T cell receptor or co-receptor. In certain embodiments, the signal peptide is selected from a CD8 signal peptide and a mannose receptor signal peptide. In some embodiments, the chimeric polypeptide does not include its corresponding signal peptide.

[0206] In some embodiments, the chimeric polypeptide further comprises a tag. Suitable tags for use in protein detection and / or purification are known in the art, any of which may be included in the chimeric polypeptides described herein. Exemplary tags include, but are not limited to, poly-His tags, maltose binding protein tags, glutathione-S-transferase tags, and calmodulin binding protein tags. In some embodiments, the chimeric polypeptide does not comprise a tag.

[0207] Virus-binding polypeptides In some embodiments, the chimeric polypeptides described herein comprise a binding region to which a virus specifically binds (e.g., an extracellular portion that comprises a virus-binding polypeptide.

[0208] In some embodiments, the virus-binding polypeptide is a portion of angiotensin-converting enzyme 2 (ACE2), a receptor to which the SARS-CoV-2 virus binds in order to infect cells. Thus, in some embodiments, the virus-binding polypeptide is a portion of ACE2 sufficient to bind to the SARS-CoV-2 spike protein. In some embodiments, the ACE2 is human ACE2 (SEQ ID NO:2). In some embodiments, the virus-binding polypeptide comprises amino acids 19-358, 19-605, or 19-740 of SEQ ID NO:2, provided herein as SEQ ID NOs:4, 6, and 8, respectively. Thus, in some embodiments, the virus-binding polypeptide comprises, or alternatively consists of, an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8.

[0209] In some embodiments, the virus binding polypeptide comprises an amino acid sequence having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8. In some embodiments, the virus binding polypeptide comprises an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8.

[0210] In some embodiments, the virus-binding polypeptide is a portion of a receptor to which the HIV virus binds to infect cells, including, for example, CD4, CCR5, and CXCR4. In some embodiments, the virus-binding polypeptide is a portion of CD4 sufficient to bind to HIV, such as, for example, the CD4 extracellular domain or a fragment thereof. In some embodiments, the virus-binding polypeptide is a portion of CCR5 sufficient to bind to HIV, such as, for example, the CCR5 extracellular domain or a fragment thereof. In some embodiments, the virus-binding polypeptide is a portion of CXCR4 sufficient to bind to HIV, such as, for example, the CXCR4 extracellular domain or a fragment thereof.

[0211] In some embodiments, the virus-binding polypeptide is a portion of a receptor to which a filovirus (e.g., Ebola virus or Marburg virus) binds to infect a cell, including, for example, T cell Ig and mucin domain 1 (TIM-1). In some embodiments, the virus-binding polypeptide is a sufficient portion of TIM-1 (such as, for example, the extracellular domain of TIM-1 or a fragment thereof) to bind to the filovirus.

[0212] In some embodiments, the virus binding polypeptide is a portion of a receptor to which the measles virus binds to infect cells, including, for example, CD46 and SLAMF1 (CD150). In some embodiments, the virus binding protein is a portion of CD46 sufficient to bind to the measles virus, such as, for example, the extracellular domain of CD46 or a fragment thereof. In some embodiments, the virus binding protein is a portion of SLAMF1 sufficient to bind to the measles virus, such as, for example, the extracellular domain of SLAMF1 or a fragment thereof.

[0213] Antigen-binding polypeptides In some embodiments, the chimeric polypeptides described herein comprise an antigen-binding portion that binds to one or more target antigens of interest. In some embodiments, the antigen-binding portion binds to one or more target antigens (e.g., cell surface markers) expressed on the surface of a target cell. Examples of cell surface markers that may act as antigens that bind to the antigen-binding portion of the chimeric polypeptide include those associated with viral, bacterial, and parasitic infections, autoimmune diseases, and cancer cells. In some embodiments, the antigen-binding portion binds to a cancer-associated antigen, e.g., a tumor antigen, such as an antigen specific to a tumor or cancer of interest. Thus, in some embodiments, the extracellular domain of the chimeric polypeptide comprises an antigen-binding portion that binds to one or more specific cancer-associated antigens. In general, the cancer-associated antigen can be any cancer-associated antigen. Suitable cancer-associated antigens include, but are not limited to, CD19, CD22, HER2 (ERBB2 / neu), mesothelin, PSCA, CD123, CD30, CD171, CD138, CS-1, CLECL1, CD33, CD79b, EGFRvIII, GD2, GD3, BCMA, PSMA, ROR1, FLT3, TAG72, CD38, CD44v6, CEA, EPCAM, B7H3 (CD276), KIT (CD117), CD213A2, IL-1 These include IRa, PRSS21, VEGFR2, CD24, MUC-16, PDGFR-beta, SSEA-4, CD20, MUC1, EGFR, NCAM, prostase, PAP, ELF2M, ephrinB2, FAP, EphA2, GM3, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CD97, CD179a, ALK, and IGLLE. In some embodiments, the one or more cancer associated antigens are selected from the group consisting of FLT3, CD19, and CD20.

[0214] A binding domain includes any naturally occurring, synthetic, semi-synthetic, or recombinantly produced binding partner for a biomolecule or other target of interest. In some embodiments, the binding region is an antigen-binding region, such as an antibody or a functional binding domain or antigen-binding portion thereof. The antigen-binding region may include any domain that binds to an antigen, including, but not limited to, a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a non-human antibody, and any fragment thereof. Thus, in some embodiments, the antigen-binding domain portion comprises a mammalian antibody or a fragment thereof. Non-limiting examples of antigen-binding regions suitable for the chimeric polypeptides of the present disclosure include antigen-binding fragments (Fab), single chain variable fragments (scFv), nanobodies, VH domains, VL domains, single domain antibodies (sdAbs), VNAR domains, and VHH domains, bispecific antibodies, diabodies, or any functional fragments thereof.

[0215] In some embodiments, "antigen-binding fragment" refers to an antibody fragment, such as, for example, a diabody, Fab, Fab', F(ab')2, Fv fragment, disulfide-stabilized Fv fragment (dsFv), (dsFv)2, bispecific dsFv (dsFv-dsFv'), disulfide-stabilized diabody (ds diabody), single-chain antibody molecule (scFv), scFv dimer (bivalent diabody), multispecific antibody formed from a portion of an antibody comprising one or more CDRs. Both blocking and non-blocking antibodies are suitable. As used herein, the term "blocking" or "antagonist" antibody refers to an antibody that prevents, inhibits, blocks, or reduces the biological or functional activity of the antigen to which it binds. A blocking or antagonist antibody can substantially or completely prevent, inhibit, block, or reduce the biological activity or function of an antigen. For example, a blocking anti-CD19 antibody can prevent, inhibit, block, or reduce the binding interaction between CD19 and its natural ligand (e.g., CD77), and thus prevent, block, block, or reduce the immunosuppressive function associated with the CD19 / CD77 interaction. The term "non-blocking" antibody refers to an antibody that does not interfere with, inhibit, block, or reduce the biological or functional activity of the antigen to which it binds.

[0216] Thus, in some embodiments, the antigen-binding portion of a chimeric polypeptide described herein comprises the amino acid sequence of an antibody selected from the group consisting of an antigen-binding fragment (Fab), a single chain variable fragment (scFv), a nanobody, a VH domain, a VL domain, a single domain antibody (dAb), a VNAR domain, and a VHH domain, a bispecific antibody, a diabody, or a functional fragment of any one of the foregoing. In some embodiments, the antigen-binding portion comprises a heavy chain variable region and a light chain variable region.

[0217] In some embodiments, the heavy and light chain variable regions of the antigen binding region are operably linked to each other via one or more intervening amino acid residues disposed between the heavy and light chain variable regions, in some embodiments, the one or more intervening amino acid residues comprise a linker peptide sequence.

[0218] In some embodiments, the antigen binding region is derived from the same cell type or species in which the chimeric polypeptide will ultimately be used, e.g., for human use, the antigen binding region of the chimeric polypeptide comprises a human antibody, a humanized antibody, or a fragment thereof.

[0219] Endocytic Receptors In some embodiments, the chimeric polypeptides described herein comprise a portion of an endocytic receptor. In some embodiments, the chimeric polypeptides described herein comprise a portion of an endocytic receptor, including one or more of an extracellular domain or fragment thereof, a transmembrane domain or fragment thereof, and an intracellular domain or fragment thereof. In some embodiments, the chimeric polypeptides described herein comprise an intracellular signaling region of an endocytic receptor. In some embodiments, the chimeric polypeptides described herein comprise a transmembrane domain and an intracellular domain of an endocytic receptor.

[0220] The intracellular signaling region of an endocytic receptor refers to an intracellular effector domain that, upon binding of a target molecule (e.g., a viral antigen or a tumor-associated antigen) targeted by the extracellular domain of a chimeric polypeptide expressed by a host cell, activates one or more signaling pathways in the host cell, resulting in endocytosis (which in certain embodiments includes host cell cytoskeletal rearrangements and internalization of the target cell, microorganism, or particle associated with the antigen). In some embodiments, the intracellular signaling domain activates one or more signaling pathways that result in phagocytosis of the target cell, microorganism, or particle.

[0221] In some embodiments, the intracellular signaling domain from an endocytic receptor can mediate the endogenous phagocytic signaling pathway. In some embodiments, the intracellular domain of the chimeric polypeptide comprises a domain responsible for signal activation and / or transduction. Non-limiting examples of intracellular domains suitable for the chimeric polypeptides disclosed herein include the cytoplasmic portion of a surface receptor that can initiate signaling in phagocytes (e.g., monocytes, macrophages, or dendritic cells), as well as any derivative or variant of these elements, and any synthetic sequence with the same functional capabilities. In some embodiments, the chimeric polypeptides of the present disclosure comprise at least one intracellular domain derived from an endocytic receptor, such as, for example, the mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), Dectin-1, and scavenger receptor.

[0222] In some embodiments, the scavenger receptor is a member of class A, B, C, D, E, F, G, H, IK, J, K, or L scavenger receptor. Examples of scavenger receptors suitable for use in the chimeric polypeptides of the present disclosure include, but are not limited to, scavenger receptor class A type I / II (SR AI / II), macrophage receptor with collagenous structure (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, scavenger receptor class B type I (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like moieties 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), link domain-containing scavenger receptor-1 (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44, and scavenger receptor class L type I (SR-L1).

[0223] In some embodiments, the chimeric polypeptide of the present disclosure is selected from the group consisting of SEQ ID NO: 10 (mannose receptor 82aa C-terminal fragment), SEQ ID NO: 12 (mannose receptor 96aa C-terminal fragment), SEQ ID NO: 14 (MERTK C-terminal fragment), SEQ ID NO: 16 (Dectin-1 N-terminal fragment), SEQ ID NO: 18 (Dectin-1 full length protein), SEQ ID NO: 20 (FcγR intracellular fragment), SEQ ID NO: 22 (SR-AI / II fragment), SEQ ID NO: 24 (MARCO fragment), SEQ ID NO: 26 (SCARA5 receptor fragment), SEQ ID NO: 28 (SRCL fragment), SEQ ID NO: 30 (CD36 fragment), SEQ ID NO: 32 (SR-BI fragment), SEQ ID NO: 34 (CD68 fragment), SEQ ID NO: 36 (LOX-1 fragment), SEQ ID NO: 38 (SREC fragment), SEQ ID NO: 40 (MEGF10 fragment), SEQ ID NO: 42 (SR-PSOX fragment), SEQ ID NO: 44 (FEEL-1 fragment), SEQ ID NO: 46 (CD163 fragment), SEQ ID NO: 48 (RAGE fragment), SEQ ID NO: 50 (CD44 fragment), and SEQ ID NO: 52 (SR-L1 fragment).

[0224] In some embodiments, the chimeric polypeptide of the disclosure is selected from the group consisting of SEQ ID NO:10 (mannose receptor 82aa C-terminal fragment), SEQ ID NO:12 (mannose receptor 96aa C-terminal fragment), SEQ ID NO:14 (MERTK C-terminal fragment), SEQ ID NO:16 (Dectin-1 N-terminal fragment), SEQ ID NO:18 (Dectin-1 full-length protein), SEQ ID NO:20 (FcγR intracellular fragment), SEQ ID NO:22 (SR-AI / II fragment), SEQ ID NO:24 (MARCO fragment), SEQ ID NO:26 (SCARA5 receptor fragment), SEQ ID NO:28 (SRCL fragment), SEQ ID NO:30 (CD36 fragment), SEQ ID NO:32 (SR-BI fragment), SEQ ID NO:34 (CD68 fragment), SEQ ID NO:36 (LOX-1 fragment), SEQ ID NO:38 (SREC fragment), SEQ ID NO:40 (MEGF10 fragment), SEQ ID NO:42 (SR-PSOX fragment), SEQ ID NO: 44 (FEEL-1 fragment), SEQ ID NO: 46 (CD163 fragment), SEQ ID NO: 48 (RAGE fragment), SEQ ID NO: 50 (CD44 fragment), and SEQ ID NO: 52 (SR-L1 fragment).

[0225] In some embodiments, the chimeric polypeptides of the present disclosure do not include a recruitment moiety. In the context of the present disclosure, a recruitment moiety does not encompass the intracellular region of an endocytic receptor. Instead, a recruitment moiety binds to a cytoplasmic protein of the phagocytic signaling pathway and is typically used to activate and / or enhance the activity of the endogenous phagocytic signaling pathway. Examples of recruitment moieties include, but are not limited to, a p85 recruitment moiety that binds to the p85 regulatory subunit of phosphoinositide 3-kinase (PI3K); an SH3 moiety derived from Crk, Cdc25, phospholipase, Ras, Vav, GRB2, FAK, Pyk2, TRIP10, or Gads; and a proline-rich peptide sequence from C3G, p41, PEP, p4'7, HPK1, SLP-1, CD3.epsilon., PAK, AIP4, or Sos that binds to SH3 moiety-containing proteins. In some embodiments, the recruitment moiety is a p85 recruitment moiety derived from CD19, Gab2, IREM-1, the PDGF receptor, CSFR-1, c-Kit, ErbB3, or CD7.

[0226] Ligands for endocytic receptors In some embodiments, the chimeric polypeptides described herein include a ligand for an endocytic receptor. The endocytic receptor can be any endocytic receptor described herein. In some embodiments, the ligand is one or more of the following: soluble CD163 (sCD163), mannose, growth arrest specific factor 6 (Gas6), protein S (Pros1), low density cholesterol (LDL), acetylated LDL (AcLDL), oxidized LDL (OxLDL) polyanion, ferritin, ferritin light chain, beta-glucan, N-acetylgalactosamine, GAL type ligand (beta-D-galactopyranose), L-fucose, D-fucose, diacylated lipopeptide, high density cholesterol (HDL), lectin, selectin, C1q, hemoglobin, haptoglobin, amyloid-beta peptide, hyaluronic acid (HA aka hyaluronan), microtubule associated protein tau (MAPT), or a fragment of any of the ligands described herein. Examples of ligands for endocytic receptors include, but are not limited to, ligands for the mannose receptor, such as mannose or a fragment thereof; ligands for MERTK, such as growth arrest specific factor 6 (Gas6) or protein S (Pros1), or a fragment thereof; ligands for Dectin-1, such as beta-glucan; ligands for MEGF10, such as C1q or a fragment thereof, and ligands for CD163, such as soluble CD163, or a fragment thereof. In some embodiments, the ligand is soluble CD163 (sCD163). In some embodiments, the ligand comprises an amino acid sequence of at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 105.

[0227] vector In one aspect, a recombinant vector comprising a nucleic acid molecule capable of expressing one or more chimeric polypeptides of the present disclosure is provided herein. Some embodiments disclosed herein relate to isolated, synthetic, or recombinant nucleic acid molecules encoding the chimeric polypeptides of the present disclosure, expression cassettes, and expression vectors comprising these nucleic acid molecules. In some embodiments, the isolated, synthetic, or recombinant nucleic acid molecules of the present disclosure are operably linked to regulatory sequences that allow expression of the chimeric polypeptides in a host cell or ex vivo cell-free expression system.

[0228] The terms "nucleic acid molecule" and "polynucleotide" are used interchangeably herein to refer to both RNA and DNA molecules, including nucleic acid molecules that include cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules, including nucleic acid analogs. Nucleic acid molecules can be double-stranded or single-stranded (e.g., sense or antisense strands). Nucleic acid molecules may contain non-conventional or modified nucleotides. The terms "polynucleotide sequence" and "nucleic acid sequence" are used interchangeably herein to refer to the sequence of a polynucleotide molecule.

[0229] The term "recombinant" nucleic acid molecule as used herein refers to a nucleic acid molecule that has been modified by human intervention. As a non-limiting example, cDNA is a recombinant DNA molecule, as is any nucleic acid molecule that has been produced by in vitro polymerase reaction(s) or to which a linker has been attached or that has been incorporated into a vector, such as a cloning vector or an expression vector. As a non-limiting example, a recombinant nucleic acid molecule is 1) synthesized or modified in vitro, for example, using chemical or enzymatic techniques (e.g., by using chemical nucleic acid synthesis or by using enzymes for replicating, polymerizing, exonucleic acid digestion, endonucleic acid digestion, ligating, reverse transcription, transcription, base modification (including, for example, methylation), or recombining (including homologous and site-specific recombination) of nucleic acid molecules; 2) contains linked nucleotide sequences that are not linked in nature; 3) has been engineered, using molecular cloning techniques, to lack one or more nucleotides relative to the naturally occurring nucleic acid molecule sequence; and / or 4) has been engineered, using molecular cloning techniques, to have one or more sequence changes or rearrangements relative to the naturally occurring nucleic acid sequence.

[0230] In some embodiments, a nucleic acid molecule is provided that comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80% sequence identity to the amino acid sequence of a chimeric polypeptide as disclosed herein, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of a chimeric polypeptide as disclosed herein, or a functional fragment thereof.

[0231] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 61-67, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 86-103, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 107, or a functional fragment thereof.

[0232] In some embodiments, the nucleic acid molecule comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 54-60, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 68-85, or a functional fragment thereof. In some embodiments, the nucleic acid molecule comprises a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to the nucleotide sequence of SEQ ID NO: 106, or a functional fragment thereof.

[0233] In some embodiments, the nucleic acid molecule as disclosed herein is operably linked to a heterologous nucleic acid sequence. Some embodiments disclosed herein relate to vectors or expression cassettes comprising isolated, synthetic, or recombinant nucleic acid molecules as disclosed herein. An expression cassette generally comprises a coding sequence and sufficient control information to direct proper transcription and / or translation of the coding sequence in a recipient cell in vivo and / or ex vivo. The expression cassette can be inserted into a vector for targeting to a desired host cell and / or into a subject. Thus, the term expression cassette can be used interchangeably with the term "expression construct". The expression cassette can be derived from any source and inserted as a linear or circular, single-stranded or double-stranded, DNA or RNA polynucleotide molecule into a plasmid, cosmid, virus, autonomously replicating polynucleotide molecule, phage capable of genomic integration or autonomous replication, comprising one or more nucleic acid sequences linked in a functionally operable manner, i.e., operably linked, nucleic acid molecule.

[0234] Generally, a vector can replicate when associated with the appropriate control elements. The term "vector" includes cloning and expression vectors, as well as viral and integrating vectors. An "expression vector" is a vector that includes a regulatory region, thereby allowing expression of DNA sequences and fragments in vitro and / or in vivo. A vector may include sequences that direct autonomous replication in a cell, or may include sequences sufficient to allow integration into host cell DNA. Useful vectors include, for example, plasmids (e.g., DNA or RNA plasmids), transposons, cosmids, bacterial artificial chromosomes, and viral vectors. Useful viral vectors include, for example, replication-defective retroviruses and lentiviruses. In some embodiments, the vector is a gene delivery vector. In some embodiments, the vector is used as a gene delivery vehicle to transfer genes into cells.

[0235] In some embodiments, the vector is a non-viral vector. Exemplary non-viral vectors include, but are not limited to, plasmid DNA, transposons, episomal plasmids, minicircles, ministrings, and oligonucleotides (e.g., mRNA, naked DNA). In some embodiments, the vector is a DNA plasmid vector.

[0236] In some embodiments, the vector is a viral vector. The viral vector may be replication-competent or replication-incompetent. The viral vector may be integrating or non-integrating. Several viral-based systems have been developed for gene transfer into mammalian cells, and a suitable viral vector may be selected by one skilled in the art. Exemplary viral vectors include, but are not limited to, adenoviral vectors (e.g., adenovirus 5), adeno-associated viral (AAV) vectors (e.g., AAV2, 3, 5, 6, 8, 9), retroviral vectors (MMSV, MSCV), lentiviral vectors (e.g., HIV-1, HIV-2), gamma retroviral vectors, herpes viral vectors (e.g., HSV1, HSV2), alphaviral vectors (e.g., SFV, SIN, VEE, M1), flavivirus (e.g., Kunjin, West Nile, Dengue virus), rhabdoviral vectors (e.g., rabies virus, VSV), measles viral vectors (e.g., MV-Edm), Newcastle disease viral vectors, pox viral vectors (e.g., VV), measles virus, and picornaviral vectors (e.g., coxsackie virus).

[0237] In some embodiments, the vector contains one or more additional elements, including but not limited to, promoters, enhancers, polyadenylation (polyA) sequences, and selection genes.

[0238] In some embodiments, the vector comprises a polynucleotide sequence encoding a selectable marker that confers a specific trait to cells in which the selectable marker is expressed, allowing for the artificial selection of those cells. Exemplary selectable markers include, but are not limited to, antibiotic resistance (e.g., resistance to kanamycin, ampicillin, or triclosan) genes.

[0239] In some embodiments, the vector comprises a transcriptional regulatory element. Exemplary transcriptional regulatory elements include, but are not limited to, promoters and enhancers.

[0240] DNA vectors can be introduced into prokaryotic or eukaryotic cells by conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (1989) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY) and other standard molecular biology laboratory manuals.

[0241] The nucleic acid sequence encoding the chimeric polypeptide of the present disclosure can be optimized for expression in a host cell of interest. For example, the GC content of the sequence can be adjusted to the average level of a given cell host, as calculated with reference to known genes expressed in the host cell. Methods for codon optimization are known in the art. The codon usage in the coding sequence of the chimeric polypeptide as disclosed herein can be optimized to enhance expression in a host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons in the coding sequence are optimized for expression in a particular host cell.

[0242] Non-limiting examples of vectors suitable for use include T7-based vectors for use in bacteria, pMSXND expression vectors for use in mammalian cells, and baculovirus-derived vectors for use in insect cells. In some embodiments, the nucleic acid inserts encoding the subject chimeric polypeptides in such vectors can be operably linked to a promoter selected, for example, based on the cell type in which expression is desired. A non-limiting example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive high levels of expression of any polynucleotide sequence operably linked to it. However, other constitutive promoter sequences may also be used, including, but not limited to, Simian Virus 40 (SV40) early promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, Rous sarcoma virus promoter, elongation factor-la promoter, and human gene promoters, such as, but not limited to, actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter. Furthermore, the present disclosure should not be limited to the use of constitutive promoters. Inducible promoters are also contemplated as part of the present disclosure. The use of inducible promoters provides a molecular switch that can turn on expression of an operably linked polynucleotide sequence when its expression is desired or turn off expression when expression is not desired. Examples of inducible promoters include, but are not limited to, metallothionine promoter, glucocorticoid promoter, progesterone promoter, and tetracycline promoter.

[0243] In addition, any of a wide variety of expression control sequences may be used in these vectors. Such useful expression control sequences include those associated with the structural genes of the expression vectors described above. Examples of useful expression control sequences include, for example, the early and late promoters of SV40 or adenovirus, the lac system, the trp system, the TAC or TRC system, the major operator and promoter regions of phage lambda, e.g., PL, the control region of the fd coat protein, the promoters of 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatases, e.g., PhoA, the promoters of the yeast a-mating system, the polyhedron promoter of baculoviruses, and other sequences known to control the expression of genes in prokaryotic or eukaryotic cells or viruses thereof, as well as various combinations thereof.

[0244] The T7 promoter can be used in bacteria, the polyhedrin promoter can be used in insect cells, and the cytomegalovirus or metallothionein promoter can be used in mammalian cells. Also, in the case of higher eukaryotes, tissue-specific and cell type-specific promoters are widely available. These promoters are so named because of their ability to direct the expression of a nucleic acid molecule in a given tissue or cell type in the body. Those skilled in the art will readily recognize the many promoters and other regulatory elements that can be used to direct the expression of a nucleic acid.

[0245] In selecting an expression control sequence, various factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the actual DNA sequence encoding the subject chimeric polypeptide, especially with respect to potential secondary structure. Hosts should be selected taking into consideration compatibility with the selected vector, the toxicity of the products encoded by the DNA sequences of the present disclosure, their secretion characteristics, their ability to correctly fold the polypeptide, their fermentation or cultivation requirements, and the ease of purification of the products encoded by the DNA sequences.

[0246] Within these parameters, one of skill in the art may select a variety of vector / expression control sequence / host combinations that will express the desired DNA sequence in fermentation or large scale animal culture using, for example, CHO or COS7 cells.

[0247] The choice of expression control sequences and expression vectors will depend in some embodiments on the choice of host. A wide variety of expression host / vector combinations can be used. Non-limiting examples of useful expression vectors for eukaryotic hosts include vectors with expression control sequences from, for example, SV40, bovine papilloma vim, adenovirus, and cytomegalovirus. Non-limiting examples of useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmids from E. coli, including col El, pCRI, pER32z, pMB9, and their derivatives, broader host range plasmids, such as RP4, phage DNA, such as many derivatives of phage lambda, such as NM989, and other DNA phages, such as M13 and filamentous single-stranded DNA phages. Non-limiting examples of useful expression vectors for yeast cells include the 2m plasmid and its derivatives. Non-limiting examples of useful vectors for insect cells include pVL 941 and pFastBac™1.

[0248] In addition to sequences that facilitate transcription of the inserted nucleic acid molecule, vectors may contain origins of replication and other genes that code for selectable markers. For example, the neomycin resistance (neoR) gene confers G418 resistance to cells in which it is expressed, thus allowing phenotypic selection of transfected cells. Those skilled in the art can readily determine whether a given regulatory element or selectable marker is suitable for use in a particular experimental context.

[0249] Viral vectors that can be used in the present disclosure include, for example, retrovirus, adenovirus and adeno-associated vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, e.g., Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, NY).

[0250] Recombinant prokaryotic or eukaryotic cells that contain and / or express a nucleic acid molecule that encodes any one of the chimeric polypeptides disclosed herein are also a feature of the disclosure. In some embodiments, a recombinant cell of the disclosure is a transfected cell, e.g., a cell into which a nucleic acid molecule, e.g., a nucleic acid molecule encoding a chimeric polypeptide disclosed herein, has been introduced by means of recombinant methodologies and techniques. The progeny of such cells are also considered within the scope of the disclosure. Cell cultures that contain at least one recombinant cell as disclosed herein are also within the scope of the disclosure.

[0251] The exact components of the expression system are not critical. For example, chimeric polypeptides as disclosed herein can be produced in prokaryotic hosts, such as bacteria, E. coli, or eukaryotic hosts, such as insect cells (e.g., Sf21 cells), or mammalian cells (e.g., COS cells, NIH 3T3 cells, or HeLa cells). In some embodiments, the recombinant cell is a phagocyte, such as a macrophage. Both professional and non-professional phagocytes are suitable. In some embodiments, the phagocyte is a professional phagocyte. In some embodiments, the phagocyte is a non-professional phagocyte. In some embodiments, the phagocyte is selected from the group consisting of macrophages, dendritic cells, mast cells, monocytes, neutrophils, microglia, and astrocytes. In some embodiments, the phagocyte is a BMDM or BMDC. In some embodiments, the phagocyte is a Thp-1 monocyte. In some embodiments, the phagocyte is a J774A.1 macrophage. These cells are available from many sources, including the American Type Culture Collection (Manassas, Va.). In selecting an expression system, it is only important that the components are compatible with one another; one of skill in the art is able to make such a determination. Additionally, if guidance is needed in selecting an expression system, one of skill in the art can consult Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, New York, NY, 1993) and Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987).

[0252] The expressed polypeptides can be purified from the expression system using routine biochemical procedures and can be used, for example, as therapeutic agents as described herein.

[0253] In some embodiments, the resulting chimeric polypeptide is glycosylated or non-glycosylated depending on the host organism used to produce the chimeric polypeptide. If a bacterium is selected as the host, the produced chimeric polypeptide will be non-glycosylated. On the other hand, eukaryotic cells will usually glycosylate the chimeric polypeptide, although maybe not in the same manner that the native polypeptide is glycosylated. The chimeric polypeptide produced by the transformed host cell can be purified according to any suitable method known in the art. The produced chimeric polypeptide can be isolated from inclusion bodies produced in bacteria such as E. coli, or from conditioned medium from either mammalian or yeast cultures producing a given chimeric polypeptide using cation exchange, gel filtration, and / or reverse phase liquid chromatography.

[0254] Thus, another exemplary method of constructing a DNA sequence encoding a chimeric polypeptide of the present disclosure is by chemical synthesis. This includes direct peptide synthesis by chemical means of a protein sequence encoding a chimeric polypeptide exhibiting the described properties. This method can incorporate both natural and unnatural amino acids at positions that affect the binding affinity of the chimeric polypeptide with the target antigen and / or target protein. Alternatively, a gene encoding a desired chimeric polypeptide can be synthesized by chemical means using an oligonucleotide synthesizer. Such oligonucleotides are designed based on the amino acid sequence of the desired chimeric polypeptide, preferably based on selecting codons that are favored in the host cell in which the recombinant chimeric polypeptide will be produced. In this regard, it is well recognized in the art that the genetic code is degenerate - an amino acid can be coded for by more than one codon. For example, Phe (F) is coded for by two codons, TIC or TTT, Tyr (Y) is coded for by TAC or TAT, and his (H) is coded for by CAC or CAT. Trp (W) is coded for by a single codon, TGG. Therefore, it will be understood by those skilled in the art that for a given DNA sequence that codes for a particular chimeric polypeptide, there are many degenerate DNA sequences that code for that chimeric polypeptide. For example, in addition to the DNA sequences of the chimeric polypeptides provided in the sequence listing, it will be understood that there are many degenerate DNA sequences that code for the chimeric polypeptides disclosed herein. These degenerate DNA sequences are considered to be within the scope of this disclosure. Therefore, "degenerate variants thereof" in the context of this disclosure refers to all DNA sequences that code for a particular chimeric polypeptide, thereby allowing the expression of that particular chimeric polypeptide.

[0255] Whether prepared by site-directed mutagenesis, chemical synthesis, or other methods, the DNA sequence encoding the subject chimeric polypeptide may also include a DNA sequence encoding a signal sequence. Such a signal sequence, if present, must be recognized by the cell selected for expression of the chimeric polypeptide. It may be prokaryotic, eukaryotic, or a combination of the two. In general, the inclusion of a signal sequence depends on whether it is desired to secrete the chimeric polypeptide as disclosed herein from the recombinant cell in which it is made. If the selected cell is prokaryotic, it is generally preferred that the DNA sequence does not encode a signal sequence. If the selected cell is eukaryotic, it is generally preferred that a signal sequence is included.

[0256] The provided nucleic acid molecules may include naturally occurring sequences or sequences that are different from naturally occurring sequences but that code for the same polypeptide due to the degeneracy of the genetic code. These nucleic acid molecules may be composed of RNA or DNA (e.g., genomic DNA, cDNA, or synthetic DNA, such as those produced by phosphoramidite-based synthesis), or combinations or modifications of nucleotides within these types of nucleic acids. In addition, the nucleic acid molecules may be double-stranded or single-stranded (e.g., either the sense strand or the antisense strand).

[0257] A nucleic acid molecule is also not limited to a sequence that codes for a polypeptide, but may include some or all of the non-coding sequences upstream or downstream of a coding sequence (e.g., the coding sequence of a chimeric polypeptide disclosed herein). Those skilled in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. These can be generated, for example, by treating genomic DNA with restriction endonucleases or by performing a polymerase chain reaction (PCR). In cases where the nucleic acid molecule is a ribonucleic acid (RNA), the molecule can be generated, for example, by in vitro transcription.

[0258] Exemplary isolated nucleic acid molecules of the present disclosure can include fragments not found in the natural state. Thus, the present disclosure encompasses recombinant molecules, such as those in which a nucleic acid sequence (e.g., a sequence encoding a chimeric polypeptide disclosed herein) is incorporated into a vector (e.g., a plasmid or viral vector) or into the genome of a heterologous cell (or the genome of a homologous cell at a location other than the native chromosomal location).

[0259] How to use In another aspect, the present disclosure provides a method of treating a subject using a chimeric bait receptor (CBR), a chimeric phagocytic receptor (CPR), a bait macrophage engager (BME), an antigen macrophage engager (AME), a recombinant vector, an engineered cell (e.g., a cell comprising a heterologous and / or recombinant nucleic acid), or a pharmaceutical composition disclosed herein. Any disease or disorder of a subject that would benefit from treatment with a recombinant cell of the present disclosure, or a polypeptide or polynucleotide or vector of the present disclosure, can be treated using the methods disclosed herein. The chimeric polypeptides, nucleic acid molecules, and / or pharmaceutical compositions of the present disclosure can be used to treat individuals who have, are suspected of having, or may be at high risk of developing one or more health conditions or disorders. Exemplary health conditions and disorders of interest can include, but are not limited to, those associated with acute and chronic infections, inflammatory diseases, immune diseases, and various cancers. In some embodiments, the methods disclosed herein are useful for treating one or more conditions or disorders by enhancing the removal of infected, transformed, malignant, apoptotic, damaged, or necrotic cells or particles from an individual's body.

[0260] In certain embodiments, the methods comprise administering to the subject an effective amount of a recombinant cell or population thereof as disclosed herein.

[0261] The cells administered to a subject can be autologous or allogeneic.

[0262] The number of cells used will depend on many circumstances, including the lifespan of the cells, the protocol used (e.g., number of administrations), the proliferation potential of the cells, the stability of the recombinant construct, etc. In certain embodiments, the cells are applied as a dispersion and generally injected at or near the site of interest. The cells may be administered in any physiologically acceptable medium.

[0263] In certain embodiments, the viral infection is caused by an enveloped RNA virus. Examples of enveloped RNA viruses include, but are not limited to, Togaviridae (e.g., Chikungunya virus (CHIKV)), Coronaviridae (e.g., SARS-CoV-2), Flaviviridae (e.g., Dengue, Zika), Orthomyxoviridae (e.g., Influenza), Filoviridae (e.g., Ebola), Paramyxoviridae (e.g., Measles, Respiratory Syncytial Virus), Retroviridae (e.g., HIV), and Bunyaviridae (e.g., Hantavirus).

[0264] In some embodiments, the viral infection is caused by a coronavirus. As used herein, the term "coronavirus" refers to a group of related RNA viruses that belong to the order Nidovirales, family Coronaviridae, and make up the subfamily Orthocoronavirus. Coronaviruses are further divided into four genera: Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus. Thus, in some embodiments, the viral infection is caused by an Alphacoronavirus, such as human coronavirus 229E (HCoV-229E), porcine epidemic diarrhea virus (PEDV), human coronavirus NL63 (HCoV-NL63), and Alphacoronavirus 1. In some embodiments, the viral infection is caused by a Betacoronavirus, such as Betacoronavirus 1, human coronavirus OC43 (HCoV-OC43), Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV), human coronavirus HKU1 (HCoV-HKU1), Middle East Respiratory Syndrome-related Coronavirus (MERS-CoV), and Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). In some embodiments, the viral infection is caused by a Gammacoronavirus. In some embodiments, the viral infection is caused by a deltacoronavirus.

[0265] In a preferred embodiment, the viral infection is caused by a betacoronavirus. In some embodiments, the viral infection is caused by human coronavirus OC43 (HCoV-OC43), severe acute respiratory syndrome coronavirus (SARS-CoV), human coronavirus HKU1, Middle East respiratory syndrome-associated coronavirus (MERS-CoV), or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In some embodiments, the viral infection is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

[0266] In some embodiments, the viral infection is caused by a virus that uses lysosomes for release.

[0267] In humans, coronaviruses cause respiratory infections that can be mild, such as in some cases of the common cold, and can be fatal, such as SARS-CoV, MERS-CoV, and SARS-CoV-2. Symptoms commonly associated with coronavirus infections include fever, cough, shortness of breath, chest pain or pressure, confusion, bluish lips or face, pneumonia, bronchitis, runny nose, sneezing, chills, worsening asthma, acute respiratory distress syndrome (ARDS), RNAaemia, acute cardiac damage, shock, muscle pain, fatigue, sputum production, rust-colored sputum, bloody sputum, swollen lymph nodes, ear infections, joint pain, wheezing, headache, hemoptysis, diarrhea, difficulty breathing, redness, swelling or edema, pain, loss of function, organ dysfunction, multiple organ system failure, acute kidney injury, malnutrition, sepsis, hypotension, hypertension, hypothermia, hypoxemia, leukocytosis, leukopenia, lymphopenia, thrombocytopenia, stuffy nose, sore throat, unwillingness to drink, convulsions, ongoing vomiting, abdominal pain, secondary infections, and multiple organ failure.

[0268] Common symptoms associated with SARS-CoV-2 include fever, cough, shortness of breath, difficulty breathing, fatigue, loss of appetite, muscle or body aches, and production of mucus or phlegm, among others. Less common symptoms include sore throat, headache, chills, loss of taste or smell, stuffy or runny nose, nausea, vomiting, diarrhea, chest pain or pressure, confusion, inability to wake up or staying awake, and bluish lips or face. The majority of cases result in mild symptoms, but some progress to severe pneumonia, acute respiratory distress syndrome (ARDS), cardiac damage, and multiple organ failure.

[0269] In some embodiments, the viral infection is caused by a virus from the Togaviridae family, such as an alphavirus. In some embodiments, the alphavirus is selected from the group consisting of Aura virus, Barmah Forest virus, Bebaru virus, Caaingua virus, Cabassou virus, Chikungunya virus, Eastern equine encephalitis virus, Eilat virus, Everglades virus, Fort Morgan virus, Getah virus, Highlands J virus, Madariaga virus, Mayaro virus, Middelburg virus, Mosso das Pedras virus, Mucambo virus, Ndumu virus, O'nyong'nyong virus, Pixuna virus, Rio Negro virus, Ross River virus, Salmon pancreas virus, In some embodiments, the alphavirus is selected from the group consisting of Chikungunya virus (CHIKV), Semliki Forest virus, Sindbis virus, Southern elephant seal virus, Tonate virus, Trocara virus, Una virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus, and Whataroa virus.

[0270] Common symptoms associated with CHIKV include fever, joint pain, and rash, among others. Less common symptoms include headache, fatigue, gastrointestinal pathology, and conjunctivitis. Chronic symptoms associated with CHIKV include arthritis, long-term musculoskeletal pain, and asthenia.

[0271] In some embodiments, the viral infection is caused by a virus from the Flaviviridae family. In some embodiments, the virus from the Flaviviridae family is Apoivirus, Aroavirus, Bagazavirus, Banzivirus, Boubouivirus, Bukarassa bat virus, Cacipacorevirus, Carey Island virus, Cowbone Ridge virus, Dakar bat virus, Dengue virus, Edge Hill virus, Entebbe bat virus, Gadgets Gully virus, or the like. Gully virus, Ilheus virus, Israeli turkey meningoencephalitis virus, Japanese encephalitis virus, Jugra virus, Jutiapa virus, Kadam virus, Kedougou virus, Cocobera virus, Koutango virus, Kyasanur Forest disease virus, Langat virus, Louping ill virus, Meaban virus, Modoc virus, Montana myotis leukoencephalitis virus, Murray Valley encephalitis virus, Ntaya virus, Omsk hemorrhagic fever virus, Phnom Penh bat virus, Powassan virus, Rio Bravo virus, Royal Farm virus, Saboya virus, St. Louis encephalitis virus, Sal Vieja virus, San Perrita virus, Perlita virus, Saumarez Reef virus, Sepik virus, Tembusu virus, Tick-borne encephalitis virus, Tyuleniy virus, Uganda S virus, Ustu virus, Wesselsbron virus, West Nile virus, Yaounde virus, Yellow fever virus, Yokose virus, and Zika virus.

[0272] In some embodiments, the viral infection is caused by a virus from the family Orthomyxoviridae, such as an alphainfluenza virus, a betainfluenza virus, a deltainfluenza virus, a gammainfluenza virus, an Aisa virus, a Thogoto virus, or a Quaranja virus. In some embodiments, the virus from the family Orthomyxoviridae is selected from the group consisting of influenza A virus, influenza B virus, influenza C virus, and influenza D virus. Examples of influenza A viruses include, but are not limited to, H1N1, H1N2, H2N2, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N8, H5N9, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, and H10N7.

[0273] In some embodiments, the viral infection is caused by a virus from the Filoviridae family, such as Cueva virus, Diaanlo virus, Ebola virus, Marburg virus, Striya virus, or Samuno virus. In some embodiments, the virus from the Filoviridae family is selected from the group consisting of Lloviu Cueva virus, Mengla Diaanlo virus, Bombali Ebola virus, Bundibugyo Ebola virus, Reston Ebola virus, Sudan Ebola virus, Taie Forest Ebola virus, Zaire Ebola virus, Marburg Marburg virus, Xilang Striya virus, and Huangjiao Samuno virus.

[0274] In some embodiments, the viral infection is caused by a virus from the Paramyxoviridae family, such as Metaabullavirus, Orthoabullavirus, Paraabullavirus, Metaparamyxiovirus, Aquaparamyxovirus, Ferulavirus, Henipavirus, Jayronvirus, Morbillivirus, Narmovirus, Respirovirus, Salemvirus, Orthorubulavirus, Pararubulavirus, Pneumovirus, Cynoglossusvirus, Hoplichthysvirus, or Scoliodonvirus. In some embodiments, the virus from the Paramyxoviridae family is selected from the group consisting of canine distemper virus (CDV), cetacean morbillivirus (CeMV), feline morbillivirus (FeMV), measles virus (MeV), peste des petits ruminants virus (PPRV), phocid distemper virus (PDV), Newcastle disease virus, Linder plague virus (RPV), mumps virus, Hendra virus (HeV), Nipah virus (NiV), human parainfluenza viruses (HPIV-1, HPIV-2, HPIV-3, HPIV-4), avian metapneumovirus (AMPV), human metapneumovirus (HMPV), bovine respiratory syncytial virus (BRSV), human respiratory syncytial virus (HRSV), and pneumonia virus of mice (MPV).

[0275] In some embodiments, the viral infection is caused by a virus from the Retroviridae family, hi some embodiments, the virus from the Retroviridae family is selected from the group consisting of human immunodeficiency virus 1 (HIV-1), human immunodeficiency virus 2 (HIV-2), human T-lymphotropic virus (HTLV), murine leukemia virus (MLV), avian leukemia virus, Rous sarcoma virus, mouse mammary tumor virus (MMTV), feline leukemia virus, bovine leukemia virus, simian immunodeficiency virus (SIV), and feline immunodeficiency virus (FIV).

[0276] In some embodiments, the viral infection is caused by a virus from the family Bunyaviridae, such as Peribunyaviridae, Fenuiviridae, Arenaviridae, Nairoviridae, and Hantaviridae. In some embodiments, the virus from the family Bunyaviridae is selected from the group consisting of California encephalitis virus, La Crosse encephalitis virus, Jamestown Canyon virus, Akabane virus, Oropouche virus, Group C virus, Guama virus, Tahina virus, Snowshoe hare virus, Hantaan virus, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, Sand fly fever virus, Hazara virus, Dobrava virus, Seoul virus, Puumala virus, Sin Nombre virus, and Severe fever with thrombocytopenia syndrome virus (SFTSV).

[0277] In certain embodiments, the cancer is lung cancer, bile duct cancer (e.g., cholangiocarcinoma), pancreatic cancer, colorectal cancer, ovarian cancer, or gynecological cancer. In certain embodiments, the cancer is leukemia (e.g., mixed lineage leukemia, acute lymphocytic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, or chronic myeloid leukemia), alveolar rhabdomyosarcoma, bone cancer, brain tumor (e.g., glioma, e.g., glioblastoma), breast cancer, anal, anal canal, or anorectal cancer, eye cancer, intrahepatic bile duct cancer (e.g., intrahepatic cholangiocarcinoma), joint cancer, cervical, gallbladder, or pleural cancer, nose, nasal cavity, or middle ear cancer, oral cavity cancer, vulva cancer, bone marrow tumor (e.g., chronic bone marrow cancer), colon cancer, esophageal cancer, cervical cancer, gastrointestinal cancer, gastrointestinal carcinoid tumor. Hodgkin's lymphoma, hypopharyngeal cancer, renal cancer, laryngeal cancer, liver cancer (e.g., hepatocellular carcinoma), lung cancer (e.g., non-small cell lung cancer), malignant mesothelioma, melanoma, multiple myeloma, nasopharyngeal cancer, non-Hodgkin's lymphoma, ovarian cancer, pancreatic cancer, peritoneal, retinal, and mesenteric cancer, pharyngeal cancer, prostate cancer, rectal cancer, kidney cancer (e.g., renal cell carcinoma (RCC)), gastric cancer, small intestine cancer, soft tissue cancer, stomach cancer, carcinoma, sarcoma (e.g., synovial sarcoma, rhabdomyosarcoma), skin cancer, testicular cancer, thyroid cancer, head and neck cancer, ureteral cancer, and bladder cancer. In certain embodiments, the cancer is melanoma, breast cancer, lung cancer, prostate cancer, thyroid cancer, ovarian cancer, or synovial sarcoma. In one embodiment, the cancer is synovial sarcoma or liposarcoma (e.g., myxoid / round cell liposarcoma). In certain embodiments, the cancer is lung cancer, cholangiocarcinoma, pancreatic cancer, colorectal cancer, gynecological cancer, or ovarian cancer.

[0278] The polypeptides, polynucleotides, recombinant vectors, engineered cells, or pharmaceutical compositions described herein may be delivered to a subject by a variety of routes. These routes include, but are not limited to, parenteral, intranasal, intratracheal, oral, intradermal, topical, intramuscular, intraperitoneal, transdermal, intravenous, intratumoral, conjunctival, intrathecal, and subcutaneous routes. Pulmonary administration can also be used, for example, by use of an inhaler or nebulizer, and formulation with an aerosolizing agent for use as a spray. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, engineered cells, or pharmaceutical compositions described herein are delivered intravenously. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, engineered cells, or pharmaceutical compositions described herein are delivered subcutaneously. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, engineered cells, or pharmaceutical compositions described herein are delivered intranasally. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, engineered cells, or pharmaceutical compositions described herein are delivered intramuscularly. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, engineered cells, or pharmaceutical compositions described herein are delivered intratumorally. In certain embodiments, the polypeptides, polynucleotides, recombinant vectors, engineered cells, or pharmaceutical compositions described herein are delivered to a tumor-draining lymph node.

[0279] The amount of polypeptide, polynucleotide, recombinant vector, engineered cell, or pharmaceutical composition that will be effective in the treatment and / or prevention of a condition will depend on the nature of the disease, and can be determined by standard clinical techniques.

[0280] The exact dose to be used in the composition also depends on the route of administration and the severity of the infection or disease caused thereby, and should be determined according to the judgment of the practitioner and the circumstances of each subject.For example, the effective dose may also vary depending on the means of administration, the target site, the physiological condition of the patient (including age, weight, and health), whether the patient is a human or an animal, other medicines administered, or whether the treatment is preventive or therapeutic.Usually, the patient is a human, but non-human mammals, including transgenic mammals, may also be treated.Therapeutic dosages may be optimally titrated to optimize safety and efficacy.

[0281] Manufacturing method The engineered cells described herein can be produced by any method known in the art. Some embodiments of the present disclosure relate to methods for modifying cells, including introducing (a) a chimeric polypeptide as described herein, and / or (b) an isolated, synthetic, or recombinant nucleic acid molecule as described herein into a cell to create a recombinant (e.g., engineered or transgenic). For example, a chimeric polypeptide or nucleic molecule as disclosed herein can be produced in a prokaryotic host, such as a bacterium, E. coli, or a eukaryotic host, such as an insect cell (e.g., Sf21 cell), or a mammalian cell (e.g., COS cell, NIH 3T3 cell, or HeLa cell). In some embodiments, the recombinant cell is a phagocytic cell, such as a phagocyte. Both professional and non-professional phagocytes are suitable. In some embodiments, the phagocytic cell is a professional phagocyte. In some embodiments, the phagocytic cell is a non-professional phagocyte. In some embodiments, the phagocytic cell is selected from the group consisting of macrophages, dendritic cells, mast cells, monocytes, neutrophils, microglia, and astrocytes. In some embodiments, the phagocytic cell is a BMDM or BMDC. In some embodiments, the phagocytic cell is a Thp1 monocyte. These cells are available from many sources, including American Type Culture Collection (Manassas, Va.). In some embodiments, the phagocytic cell is a macrophage derived from a pluripotent stem cell (iPSC-macrophage). Such iPSC-macrophages can be generated by knocking out B2M to eliminate all MHC I, followed by knocking in HLA E. The modified iPSCs can then be differentiated and polarized in culture into mature M1 macrophages using protocols known in the art (e.g., Cao et al., Stem Cell Reports, 2019).The source of iPSCs or phagocytes may be allogeneic or autologous donor.

[0282] In some embodiments, the recombinant cell expresses the chimeric polypeptide and has a targeted effector activity. In some embodiments, introducing the chimeric polypeptide into the cell comprises introducing a nucleic acid sequence encoding the chimeric polypeptide. In some embodiments, introducing the nucleic acid sequence comprises electroporating an mRNA encoding the chimeric polypeptide.

[0283] Methods for introducing and expressing genes, such as nucleic acid molecules and chimeric polypeptides encoded thereby, into cells are known in the art. In the context of expression vectors, the vectors can be easily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method in the art. For example, expression vectors can be introduced into host cells by physical, chemical, or biological means. Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. For example, nucleic acids can be introduced into target cells using commercially available methods, including electroporation. Nucleic acids can also be introduced into cells using cationic liposome-mediated transfection, using lipofection, using polymer encapsulation, using peptide-mediated transfection, or using biolistic particle delivery systems such as "gene guns."

[0284] Biological methods for introducing a polynucleotide of interest into a host cell include the use of DNA and RNA vectors. RNA vectors include vectors with an RNA promoter and / or other relevant domains for the production of an RNA transcript. Viral vectors, and especially retroviral vectors, have become the most widely used method for inserting genes into mammalian, e.g., human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex viruses, adenoviruses, and adeno-associated viruses, among others. Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0285] When a non-viral delivery system is utilized, an exemplary delivery vehicle is a liposome. "Liposome" is a general term that encompasses a variety of unilamellar and multilamellar lipid vesicles formed by the production of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having a vesicular structure with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of a closed structure, trapping water and dissolved solutes between the lipid bilayers. However, compositions that have a structure in solution that differs from the normal vesicular structure are also encompassed. For example, lipids may assume a micellar structure or simply exist as heterogeneous aggregates of lipid molecules. Lipofectamine nucleic acid complexes are also contemplated.

[0286] The use of lipid formulations is contemplated for the introduction of nucleic acids into host cells (in vitro, ex vivo, or in vivo). In some embodiments, the nucleic acid molecule or chimeric polypeptide may be associated with a lipid. The nucleic acid molecule or chimeric polypeptide associated with a lipid may be encapsulated in the aqueous interior of a liposome, dispersed within the lipid bilayer of a liposome, attached to a liposome via a linking molecule associated with both the liposome and the oligonucleotide, entrapped in a liposome, complexed with a liposome, dispersed in a solution containing lipid, mixed with a lipid, combined with a lipid, contained as a suspension in a lipid, contained in or complexed with a micelle, or otherwise associated with a lipid. The lipid, lipid / DNA, or lipid / expression vector associated compositions are not limited to any particular structure in solution. For example, they may exist in a bilayer structure as micelles, or may have a "collapsed" structure. They may also simply be dispersed in a solution or may form aggregates that are not uniform in size or shape. Lipids are fatty substances that can be naturally occurring or synthetic lipids. For example, lipids include the lipid droplets that occur naturally in the cytoplasm, as well as a class of compounds that contain long-chain aliphatic hydrocarbons and their derivatives, such as fatty acids, alcohols, amines, aminoalcohols, and aldehydes.

[0287] Pharmaceutical Compositions Provided herein are pharmaceutical compositions comprising a population of engineered immune effector cells disclosed herein having a desired purity in a physiologically acceptable carrier, excipient, or stabilizer (see, e.g., Remington's Pharmaceutical Sciences (1990) Mack Publishing Co., Easton, PA). In some embodiments, the cells are phagocytes. In some embodiments, the pharmaceutical compositions are protein therapeutics administered in a cell-free manner. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl, or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol); low molecular weight (less than about 10 residues) polypeptides; serum, albumin, and the like. Examples of suitable surfactants include proteins such as amine, gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose, or sorbitol, salt-forming counterion metal complexes such as sodium (e.g., zinc-protein complexes), and / or non-ionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).

[0288] The pharmaceutical compositions described herein may be useful for inducing an immune response in a subject and treating conditions such as cancer. In one embodiment, the present disclosure provides a pharmaceutical composition comprising a population of engineered immune effector cells described herein for use as a medicament. In another embodiment, the present disclosure provides a pharmaceutical composition for use in a method for treating cancer. In some embodiments, the pharmaceutical composition comprises a population of engineered immune effector cells disclosed herein, and optionally one or more additional prophylactic or therapeutic agents in a pharma- ceutically acceptable carrier.

[0289] The pharmaceutical composition may be formulated for any route of administration to a subject. Specific examples of routes of administration include parenteral administration (e.g., intravenous, subcutaneous, intramuscular). In some embodiments, the pharmaceutical composition is formulated for intravenous administration. Injections can be prepared in any conventional form, either liquid solution or suspension. Injections may contain one or more excipients. Exemplary excipients include, for example, water, saline, dextrose, glycerol or ethanol. In addition, if desired, the pharmaceutical composition to be administered may also contain small amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, pH buffers, stabilizers, solubility enhancers, and other such agents, for example, sodium acetate, sorbitan monolaurate, triethanolamine oleate, and cyclodextrins.

[0290] In some embodiments, the pharmaceutical composition is formulated for intravenous administration. Suitable carriers for intravenous administration include physiological saline or phosphate buffered saline (PBS), and solutions containing viscosity enhancers and solubilizers, such as glucose, polyethylene glycol, and polypropylene glycol, and mixtures thereof.

[0291] Formulations to be used for in vivo administration can be sterile, which is readily accomplished, for example, by filtration through sterile filtration membranes.

[0292] Pharmaceutically acceptable carriers used in parenteral formulations include, for example, aqueous vehicles, non-aqueous vehicles, antimicrobial agents, isotonic agents, buffers, antioxidants, local anesthetics, suspending and dispersing agents, emulsifying agents, sequestrants or chelating agents, and other pharma- ceutically acceptable substances. Examples of aqueous vehicles include sodium chloride injection, Ringer's injection, isotonic dextrose injection, sterile water injection, dextrose and lactated Ringer's injection. Non-aqueous parenteral vehicles include fixed oils of vegetable origin, cottonseed oil, corn oil, sesame oil, and peanut oil. Antimicrobial agents in bacteriostatic or fungistatic concentrations, including phenol or cresol, mercury, benzyl alcohol, chlorobutanol, methyl and propyl p-hydroxybenzoic acid esters, thimerosal, benzalkonium chloride, and benzethonium chloride, can be added to parenteral formulations packaged in multi-dose containers. Isotonic agents include sodium chloride and dextrose. Buffers include phosphate and citrate. Antioxidants include sodium bisulfate. Local anesthetics include procaine hydrochloride. Suspending and dispersing agents include sodium carboxymethylcellulose, hydroxypropylmethylcellulose, and polyvinylpyrrolidone. Emulsifying agents include polysorbate 80 (TWEEN® 80). Sequestering or chelating agents for metal ions include EDTA. Pharmaceutical carriers also include ethyl alcohol, polyethylene glycol, and propylene glycol for water-miscible vehicles, and sodium hydroxide, hydrochloric acid, citric acid, or lactic acid for pH adjustment. The exact dose to be used in the pharmaceutical composition also depends on the route of administration and the severity of the condition caused thereby, and should be determined according to the judgment of the practitioner and the circumstances of each subject.For example, the effective dose may also vary depending on the means of administration, the target site, the physiological condition of the subject (including age, weight, and health), other medicines administered, or whether the treatment is preventive or therapeutic.Therapeutic dosages can be optimally titrated to optimize safety and effectiveness.

[0293] kit In one aspect, provided herein is a kit comprising one or more of the pharmaceutical compositions, engineered effector cell (e.g., recombinant phagocyte) populations, proteins, polynucleotides, or vectors described herein and instructions for use. Such kits may include carriers, packages, or containers that are compartmentalized to receive one or more containers, such as, for example, vials, tubes, etc. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the containers may be formed from a variety of materials, such as glass or plastic.

[0294] In specific embodiments, provided herein is a pharmaceutical kit comprising one or more containers filled with one or more of the components of the pharmaceutical composition described herein, the population of engineered immune effector cells, polynucleotides, or vectors provided herein. In one embodiment, the kit comprises a pharmaceutical composition comprising a population of engineered immune effector cells described herein. In one embodiment, the kit comprises a pharmaceutical composition comprising a population of immune effector cells engineered according to the methods described herein. In some embodiments, the kit contains a pharmaceutical composition described herein, a prophylactic or therapeutic agent, and a drug. Optionally, associated with such container(s) may be a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceutical or biological products, which notice reflects approval by the agency of manufacture, use, or sale for human administration. EXAMPLES

[0295] The presently disclosed embodiments are provided by way of illustration and description and are not intended to limit the scope of the present disclosure.

[0296] Example 1: Initial design of chimeric bait receptor and chimeric phagocytic receptor constructs. Initially, chimeric bait receptor (CBR) and chimeric phagocytic receptor (CPR) constructs were designed based on conventional chimeric antigen receptors ("CARs"). The CAR-based constructs selected for modification contained the following components from N- to C-terminus: CD8 signal peptide + anti-FLT3 scFv + CD8 hinge + CD8 transmembrane (TM) domain + CD3 zeta intracellular domain + T2A + CopGFP (in frame with T2A).

[0297] The nucleotide sequence of the CAR-based construct is provided as SEQ ID NO:53.

[0298] Starting from this base construct, various constructs were developed to test the CBR / CPR concept, as described below.

[0299] First, the CD8 TM domain and CD3 ζ intracellular domain were replaced with the last 67 amino acids of the C-terminus of the mannose receptor (MR), which includes the TM and intracellular domains of the MR. The resulting construct contained the following components from N- to C-terminus: CD8 signal peptide + anti-FLT3 scFv + CD8 hinge + MR TM domain + MR intracellular domain + T2A + CopGFP (in frame with T2A).

[0300] The nucleotide sequence of this construct, including the last 67 amino acids of the mannose receptor, is provided as SEQ ID NO:68.

[0301] Second, to test the approach of using baits instead of scFvs, different regions of ACE2 that exhibit binding to the spike protein of SARS-CoV-2 were tested. Three separate constructs were designed that contained three different ACE2 fragments. The components of the three constructs (from N-terminus to C-terminus) were: 1. CD8 signal peptide + ACE2(19~358) + CD8 hinge + CD8 TM domain + CD3ζ intracellular domain + T2A + CopGFP (in frame with T2A). 2. CD8 signal peptide + ACE2(19~605) + CD8 hinge + CD8 TM domain + CD3ζ intracellular domain + T2A + CopGFP (in frame with T2A). 3. CD8 signal peptide + ACE2(19~740) + CD8 TM domain + CD3ζ intracellular domain + T2A + CopGFP (in frame with T2A).

[0302] The nucleotide sequences of the ACE2 sequences contained in constructs 1-3 are provided below.

[0303] ACE2(19-358) (SEQ ID NO: 3):

[0304] ACE2(19-605)(SEQ ID NO:5):

[0305] ACE2(19-740) (SEQ ID NO: 7):

[0306] Only construct #3, containing ACE2 19-740AA, showed binding to the spike and was selected as the bait to be placed in the extracellular domain of the CBR construct.

[0307] To improve the mannose receptor-based CBR, various constructs (F1-F5) containing different regions of the mannose receptor (MR), hinge, and signal peptide were tested. The components of the constructs are (from N-terminus to C-terminus) as follows:

[0308] F1: CD8 signal peptide + anti-FLT3 scFv + CD8 hinge + MR last 96AA + T2A + GFP (in frame with T2A).

[0309] F2: CD8 signal peptide + anti-FLT3 scFv + MR last 96AA + T2A + GFP (in frame with T2A).

[0310] F3: CD8 signal peptide + anti-FLT3 scFv + CD8 hinge + MR last 83AA + T2A + GFP (in frame with T2A).

[0311] F4: CD8 signal peptide + anti-FLT3 scFv or ACE2(19~740) + MR last 83AA + T2A + GFP (in frame with T2A).

[0312] F5: MR signal peptide + anti-FLT3 scFv or ACE2(19~740) + CD8 hinge + last 96AA + T2A + GFP (in frame with T2A).

[0313] The nucleotide sequences for each of these constructs (except T2A-GFP) are provided below.

[0314] F1 (SEQ ID NO:69):

[0315] F2 (SEQ ID NO:70):

[0316] F3 (SEQ ID NO:71):

[0317] F4-FLT3-scFv (SEQ ID NO:72):

[0318] F4-ACE2(19-740) (SEQ ID NO:54):

[0319] F5-FLT3-scFv (SEQ ID NO: 73):

[0320] F5-ACE2(19-740) (SEQ ID NO:55):

[0321] Mannose-based CBR development continued using the F4 construct, which contains the CD8 signal peptide, scFv or ACE2(19-740) bait, and the last 83 amino acids (transmembrane and intracellular domains) of the mannose receptor. Kruskal et al., 1992. J. Exp. Med., Harris et al., 1993. Biochem. Biophys. Res. Commun.

[0322] Example 2: Analysis of CBR-induced phagocytosis. Thp1 cells were transduced with lentivirus carrying the F4-AC construct under the EF1a promoter, cells were stained with biotinylated SARS-CoV-2 spike protein (MyBioSource, San Diego, CA) followed by PE-streptavidin (BioLegend, San Diego, CA), and positive cells were sorted using a Melody sorter (BD, Franklin Lakes, NJ). Streptavidin-coated 5.06um beads (Spherotech, Lake Forest, IL) were sterilized using 70% isopropanol and labeled with 10uM pHrodo red dye (Thermo Fisher, Waltham, MA) according to the manufacturer's instructions. The washed beads were then incubated with biotinylated spike protein at a ratio of 0.025nmole of biotinylated spike protein per 0.5mg of beads (MyBioSource, San Diego, CA). The beads were incubated overnight with the cells at a ratio of 1:5 (cells:beads).

[0323] As shown in Figures 2 and 3A-3B, only spike-coated beads were phagocytosed, and only by Thp1 transduced with a mannose receptor-based CBR construct containing an ACE2 bait on its surface. Uncoated beads were not phagocytosed, and untransduced (UTD) cells did not phagocytose any of the beads.

[0324] The results of this study demonstrate that CBR is able to bind to viral proteins and induce phagocytosis in a binding-specific manner.

[0325] Example 3: Analysis of CBR-induced phagocytosis of SARS-CoV-2 variants. The experiment described in Example 2 was repeated to test the ability of CBR-transduced cells to recognize and phagocytose spike proteins from two different SARS-CoV-2 variants (UK alpha variant B.1.1.7 and delta variant B.1.617.2). Specifically, Thp1 cells were transduced with a lentivirus carrying the F4-AC construct under the EF1a promoter, cells were stained with biotinylated SARS-CoV-2 spike proteins from either UK alpha variant B.1.1.7 (ACROBiosystems, Delaware Technology Park, DE) or delta variant B.1.617.2 (SinoBiological, Wayne, PA) followed by PE-streptavidin (BioLegend, San Diego, CA) and positive cells were sorted using a Melody sorter (BD, Franklin Lakes, NJ). Streptavidin-coated 5.06um beads (Spherotech, Lake Forest, IL) were sterilized using 70% isopropanol and labeled with 10uM pHrodo red dye (Thermo Fisher, Waltham, MA) according to the manufacturer's instructions. The washed beads were then incubated with biotinylated spike protein at a ratio of 0.025nmole of biotinylated spike protein per 0.5mg of beads. The beads were incubated overnight with cells at a ratio of 1:5 (cells:beads).

[0326] As shown in Figures 4A-4B, both wild-type spike-coated and B1.1.7 spike-coated beads were phagocytosed, and only by Thp1 transduced with a mannose receptor-based CBR construct containing an ACE2 bait on its surface. Uncoated beads were not phagocytosed, and untransduced (UTD) cells did not phagocytose any of the beads.

[0327] Similarly, wild-type spike-coated and B.1.617.2 spike-coated beads were phagocytosed, but only by Thp1 transduced with a mannose receptor-based CBR construct containing an ACE2 bait on its surface (Figures 5A-5B). Uncoated beads were not phagocytosed, and untransduced (UTD) cells did not phagocytose any of the beads.

[0328] The results of this study demonstrate that CBR is able to bind viral proteins from multiple variant strains and induce phagocytosis in a binding-specific manner.

[0329] Example 4: Analysis of CBR-induced SARS-CoV-2 neutralization. A neutralization assay (shown in Figure 6) was used to test the ability of Thp1 cells transduced with a mannose receptor-based CBR construct (F4 AC) containing an ACE2 bait on the surface to neutralize SARS-CoV-2 pseudotyped lentivirus. Specifically, lentivirus carrying a GFP transfer plasmid was pseudotyped with spike envelope protein (BEI Resources, Manassas, VA) to generate spike-LV. Spike-LV particles were preincubated with Thp1 effector cells expressing the F4 AC CBR construct, or with control cells, either ACE2-293 or untransfected ("UTD") Thp1, or no cells at preincubation. After 2 hours of preincubation, cells were spun down at 300g for 5 minutes, the supernatant was collected and incubated with HEK293T (ACE2-293) cells expressing the hACE2 receptor on the cell surface. After 2 days, GFP was transduced with mannose receptor-based CBR construct-containing Thp1 cells, and the ACE2 bait ...). +The frequency was determined by flow cytometer to test the neutralizing effect. The MOI of 0.1 or 0.85 was determined based on the target cells. The effector:target cell ratio was 100:1.

[0330] As shown in Figures 7A-7B, preincubation with either F4-AC Thp1 or ACE2-293 reduced the viral load in the supernatant, as observed by lower transduction efficiency of target cells after subsequent incubation.

[0331] Example 5: Additional phagocytic receptor-based CBR / CPR constructs. Additional CBR and CPR constructs were designed containing anti-FLT3 scFv or ACE2(19-740) baits on the following phagocytic receptors: MERTK, MEGF10, Dectin-1, and CD163. Schematics of each of the constructs are shown in FIG.

[0332] The nucleotide sequences of each of these constructs (except T2A-GFP) are provided below.

[0333] B1_sc_MER (SEQ ID NO: 74):

[0334] B2_AC_MER (SEQ ID NO:56):

[0335] B3_sc_MEG (SEQ ID NO: 75):

[0336] B4_AC_MEG (SEQ ID NO:57):

[0337] B5_sc_Dec (SEQ ID NO:76):

[0338] B6_AC_Dec (SEQ ID NO:58):

[0339] B7_sc_DecFull (SEQ ID NO: 77):

[0340] B8_AC_DecFull (SEQ ID NO:59):

[0341] B9_sc_163 (SEQ ID NO: 78):

[0342] B10_AC_163 (SEQ ID NO: 60): ACCGTGTGCGATGACAGCTGGGACCTGGACGACGCCCAGGTGGTGTGCCAACAGCTGGGTTGCGGGCCTGCCCTCCAAAGCATTTAAGGAAGCCGAATTCGGTCAGGGTACTGGGCCAATCTGGCTGAACGAGGTAAAGTGCAAAGGTAACGAAAGTAGCCTGTGGGACTGTCCGGCACGAAGGTGGGGCCACAGCGAGTGTGGCCATAAGGAAGACGCGGCCGTGAACTGTACAGACATATCCGTACAAAAAAGCCCCAAAAAGGCGACCGGGCGATCATCAAGACAATCTAGCTTTATTGCCG TGGGAATTCTCGGTGTAGTGCTTCTTGCTATATTGTCGCTTTGTTCTTTCTGACTAAAAAGCGCAGGCAAAGGCAGGCGGCTTGCTGTGAGCTCCGGGGAGAAAAACCTCGTTCACCAAATCCAATACCGAGAAATGAACTCCTGTCTAACGCCGACGATCTTGACCTGATGAACTCATCTGAGAACTCACACGAGTCCGCCGATTTCAGCGCGGGCGGAATTGATCTCTGTCAGCAAATTTCTGCCTATAAGTGGCATGGAAAAGAAGCCATACTCTTCACACGGAAAAAGGAAAATGGCAACCTT

[0343] Example 6: MEGF10-based CBR construction analysis。 Thp1 cells were transduced with a lentivirus carrying ACE2 (19-740aa) on MEGF10 construct (B4-AC) under the EF1a promoter, cells were stained with biotinylated SARS-CoV-2 spike protein (MyBioSource, San Diego, CA) followed by PE-streptavidin (BioLegend, San Diego, CA), and positive cells were sorted using a Melody sorter (BD, Franklin Lakes, NJ). Streptavidin-coated 5.06um beads (Spherotech, Lake Forest, IL) were sterilized using 70% isopropanol and labeled with 10uM pHrodo red dye (Thermo Fisher, Waltham, MA) according to the manufacturer's instructions. The washed beads were then incubated with biotinylated WT SARS-CoV-2 spike protein (MyBioSource, San Diego, CA) or delta variant B.1.617.2 SARS-CoV-2 spike protein (SinoBiological, Wayne, PA) at a ratio of 0.025 nmole of biotinylated spike protein per 0.5 mg of beads. The beads were incubated with the cells at a ratio of 1:5 (cells:beads) overnight. Because MEGF10 is involved in cell adhesion and all cells were clustered together and did not break apart by pipetting (Figure 9C), the cells were treated with Accutase (Sigma-Aldrich, St. Louis, MO) for 15 min prior to flow cytometry analysis.

[0344] As shown in Figures 9A-9B, only spike-coated beads (WT and B.1.167.2) were phagocytosed, and only by Thp1 transduced with the MEGF10-based B4-AC CBR construct containing the ACE2 (19-740AA) bait on its surface. Uncoated beads were not phagocytosed, and untransduced (UTD) cells did not phagocytose any of the beads.

[0345] A neutralization assay was used to test the ability of Thp1 cells transduced with MEGF10-based CBR constructs (B4-AC) containing ACE2 bait on the surface to neutralize SARS-CoV-2 pseudotyped lentivirus. As in Example 4, spike-LV-GFP was preincubated with either B4-AC Thp1 or UTD Thp1 or ACE2-293 effector cells for 2 hours, followed by incubation with ACE2-293 target cells. The E:T ratio was 100:1, and cells were mixed every 15 minutes during the preincubation period. Based on the amount of target cells, the MOI tested was 2.3. UTD and B4-AC Thp1 were treated with Accutase (Sigma-Aldrich, St. Louis, MO) for 15 minutes before being counted for preincubation.

[0346] As shown in Figures 10A-10B, preincubation with either B4-AC Thp1 or ACE2-293 cells reduced the viral load in the supernatant, as observed by the lower transduction efficiency of target cells after subsequent incubation. Preincubation with B4-AC Thp1 reduced the viral load by almost 10-fold.

[0347] Example 7: Additional scFv-based CPR constructs. Additional CPR constructs were designed containing anti-CD19 or anti-CD20 scFvs on the following phagocytic receptors: mannose receptor (F4), MERTK, MEGF10, Dectin-1, and CD163. Schematics of each of the constructs are shown in FIG.

[0348] The nucleotide sequence of each of these constructs is provided below.

[0349] F4_sc19 (SEQ ID NO:79):

[0350] F4_sc20 (SEQ ID NO: 80):

[0351] C1_sc19_MER (SEQ ID NO: 81):

[0352] C3_sc19_MEG (SEQ ID NO: 82):

[0353] C5_sc19_Dec (SEQ ID NO: 83):

[0354] C7_sc19_DecFull (SEQ ID NO: 84):

[0355] C9_sc19_163 (SEQ ID NO: 85):

[0356] Example 8: Design of BME constructs We designed a bait macrophage engager (BME) construct containing soluble CD163 (sCD163) fused to ACE2(19-740). This sCD163-ACE2(19-740) BME construct can be used as a replacement for neutralizing antibodies against SARS-CoV-2 to recruit macrophages via CD163 instead of recruiting immune cells via Fc. A schematic of the BME construct is shown in Figure 12.

[0357] The nucleotide sequence of the sCD163-ACE2(19-740) BME construct is provided as SEQ ID NO:106. GAAAGCTCTCTTTGGGACTGTCCGGCACGGCGGTGGGGGCACAGTGAGTGTGGCCATAAGGAAGACGCAGCAGTGAACTGCACGGATATTAGTGTTCAGAAGACCCCGCAAAAAGCGACGACCGGGCGGAGCTCCCGCCAGTCCAGT

[0358] Example 9: Preparation of CBR-macrophage cells. To avoid producing cells for each individual, we use commercially available CBR-programmed macrophages (CBRMs), which are pre-produced using universal induced pluripotent stem cell-derived macrophages (iPSC-macrophages) generated by knocking out B2M to eliminate all MHC I and then knocking in HLA E (Hoerster et al., Frontiers in Immunology, 2021).

[0359] iPSCs were generated from healthy donors using a Sendai virus kit (Thermo Fisher, Waltham, MA). iPSCs were differentiated and polarized in culture into mature M1 macrophages using the protocol from Cao et al., Stem Cell Reports, 2019.

[0360] The present invention is not limited in scope by the specific embodiments described herein. Indeed, various modifications of the invention in addition to those described will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

[0361] All references (e.g., publications or patents or patent applications) cited in this specification are incorporated by reference in their entirety for all purposes to the same extent as if each individual reference (e.g., publication or patent or patent application) was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Other embodiments are within the scope of the following claims.

Claims

1. a) an extracellular portion comprising a binding domain to which the virus specifically binds, said binding domain being not an antibody; b) a transmembrane portion, and c) A chimeric bait receptor (CBR) comprising an intracellular portion comprising the intracellular signaling domain of an endocytic receptor.

2. 2. The CBR of claim 1, wherein the binding region is a portion of a host protein that confers attachment of the virus to the host cell when the binding region is exposed to the virus and expressed in the host cell.

3. The binding region is 2. The CBR of claim 1, comprising a portion of a protein selected from the group consisting of angiotensin-converting enzyme 2 (ACE2) or a fragment thereof, CD4, CCR5, CXCR4, T-cell Ig and mucin domain 1 (TIM-1), CD46, and SLAMF1; amino acids 19-358, 19-605, or 19-740 of SEQ ID NO:2; or an amino acid sequence at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:

8.

4. 2. The CBR of claim 1, wherein the transmembrane portion comprises a transmembrane portion of a protein selected from the group consisting of CD8, mannose receptor, MER proto-oncogene tyrosine kinase (MERTK), dectin-1, and a scavenger receptor.

5. The CBR of claim 4 , wherein the transmembrane portion comprises the transmembrane portion of a scavenger receptor.

6. The scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of class A, B, C, D, E, F, G, H, I, K, J, K, and L scavenger receptors, or the scavenger receptor is a scavenger receptor class A type I / II (SR 6. The CBR of claim 5, wherein the CBR is selected from the group consisting of macrophage receptor with collagenous structures (MARCO), SCARA5 receptor, scavenger receptor with C-type lectin (SRCL), CD36, scavenger receptor class B type I (SR-BI), CD68, lectin-like oxLDL receptor 1 (LOX-1), scavenger receptor expressed by endothelial cells (SREC), multiple EGF-like moieties 10 (MEGF10), scavenger receptor for phosphatidylserine and oxidized lipoproteins (SR-PSOX), link domain-containing scavenger receptor-1 (FEEL-1), CD163, receptor for advanced glycation end products (RAGE), CD44, and scavenger receptor class L type I (SR-L1).

7. The CBR of claim 1, wherein the intracellular signaling region of the endocytic receptor comprises the intracellular portion of the mannose receptor.

8. The CBR of claim 7, wherein the transmembrane portion comprises the transmembrane portion of the mannose receptor.

9. The CBR of claim 1 , wherein the intracellular signaling region of the endocytic receptor comprises the intracellular signaling region of a phagocytic receptor.

10. The CBR of claim 9, wherein the transmembrane portion comprises the transmembrane portion of a phagocytic receptor.

11. 10. The CBR of claim 9, wherein the intracellular signaling region of the phagocytic receptor comprises an intracellular portion from a protein selected from the group consisting of MERTK, Dectin-1, and Fc gamma receptor (FcγR).

12. The CBR of claim 1 , wherein the transmembrane portion and the intracellular signaling region of the endocytic receptor comprise the transmembrane portion and the intracellular signaling region of a scavenger receptor.

13. 13. The CBR of claim 12, wherein the scavenger receptor is a member of a class of scavenger receptors selected from the group consisting of class A, B, C, D, E, F, G, H, I, K, J, K, and L scavenger receptors, and / or the scavenger receptor is selected from the group consisting of SR AI / II, MARCO, SCARA5 receptor, SRCL, CD36, SR-BI, CD68, LOX-1, SREC, MEGF10, SR-PSOX, FEEL-1, CD163, RAGE, CD44, and SR-L1.

14. The CBR of claim 1 , further comprising an N-terminal signal peptide.

15. The CBR of claim 14, wherein the N-terminal signal peptide comprises a CD8 signal peptide or a mannose receptor signal peptide.

16. 2. The CBR of claim 1, comprising an amino acid sequence that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 61-67.

17. a) amino acid residues 22 to 827 of SEQ ID NO: 61; b) amino acid residues 19 to 893 of SEQ ID NO: 62; c) amino acid residues 19 to 1291 of SEQ ID NO: 63; d) amino acid residues 19 to 1080 of SEQ ID NO: 64, and e) amino acid residues 19 to 1912 of SEQ ID NO:

67.

18. A nucleic acid encoding one or more of the CBRs according to any one of claims 1 to 17.

19. A nucleic acid comprising a nucleotide sequence that is at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to a nucleotide sequence selected from the group consisting of SEQ ID NOs:54-60.

20. a) nucleotides 64 to 2481 of SEQ ID NO: 54; b) nucleotides 55 to 2679 of SEQ ID NO: 55; c) nucleotides 55 to 3873 of SEQ ID NO: 56; d) nucleotides 55 to 3240 of SEQ ID NO: 57, and e) A nucleic acid comprising a nucleotide sequence that is at least 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical to a nucleotide sequence selected from the group consisting of nucleotides 55 to 5736 of SEQ ID NO:

67.

21. A recombinant vector comprising the nucleic acid of claim 18.

22. A cell comprising one or more of the CBRs described in any one of claims 1 to 17 and the nucleic acids described in claims 19 or 20.

23. A cell comprising one or more of the vectors described in claim 21.

24. A cell comprising one or more of the CBRs described in claim 2, wherein the host cell is a phagocyte.

25. 25. The cell of claim 24, wherein the phagocyte is selected from the group consisting of a macrophage, a dendritic cell, a mast cell, a monocyte, a neutrophil, a microglial cell, and an astrocyte.

26. A cell population comprising two or more cells according to claim 22.

27. ​​A cell population comprising two or more cells described in claim 23.

28. A pharmaceutical composition comprising a therapeutically effective amount of the CBR of any one of claims 1 to 17 and a pharmaceutically acceptable carrier.

29. 20. The CBR of any one of claims 1 to 17 for use in a method for treating or preventing a viral infection in a subject in need thereof.

30. 30. The CBR of claim 29, wherein the subject is a human.

31. 30. The CBR of claim 29, wherein the viral infection is caused by a virus selected from the group consisting of Togaviridae, Coronaviridae, Flaviviridae, Orthomyxoviridae, Filoviridae, Paramyxoviridae, Retroviridae, and Bunyaviridae.

Images