Biomarker composition for diagnosing blood coagulation disorders, comprising miRNA in extracellular vesicles

Abstract

The present invention relates to a biomarker for diagnosing blood coagulation disorders, comprising miRNA in extracellular vesicles. It has been experimentally confirmed that the miRNA in the extracellular vesicles according to the present invention shows a specific expression pattern in patients with blood coagulation disorders compared to normal subjects. This means that the miRNA in the extracellular vesicles of the present invention may be used as a biomarker for blood coagulation disorders, and may be used in various ways in the field of diagnosing blood coagulation disorders.

Description

[Technical field]

[0001] The present invention relates to a biomarker for diagnosing blood coagulation disorders, comprising miRNA in extracellular vesicles. [Background technology]

[0002] In addition to death due to cancer itself, various procoagulants secreted from cancer cells cause coagulation disorders, and the main causes of death and disability in malignant tumor patients are cerebral infarction or pulmonary embolism. Various anticoagulants have been developed, and their use can effectively prevent and correct coagulation disorders. However, there is no method to predict this in cancer patients, and coagulation disorders are diagnosed only after they have occurred. In addition, since anticoagulants are accompanied by the risk of bleeding, it is difficult to recommend preventive administration in advance to cancer patients who have not yet developed thrombosis. Therefore, it is very important to predict this in advance or diagnose it early, but so far there is no known efficient method for predicting or early diagnosing the risk of blood coagulation in cancer patients to prevent it. Various clinical prediction methods and blood D-dimer levels are used in clinical practice, but they are non-specific and have low diagnostic value.

[0003] Studies have been reported on diagnostic methods using circulating microRNAs (miRNAs) to predict prognosis, including death, in patients with malignant tumors. However, because circulating cell-free miRNAs are destroyed by circulating RNases, a more consistent method for measuring miRNA levels is needed.

[0004] Extracellular vesicles are classified into exosomes and microvesicles according to their size, with exosomes having a diameter of 30-150 nm and microvesicles having a diameter of 100-1,000 nm. Extracellular vesicles are a part of the cell membrane that is released into the blood, contain both proteins and nuclear components, and are known to mediate intercellular communication. Extracellular vesicles have been found to exist in most body fluids that occur normally or during disease, such as blood, urine, saliva, breast milk, pleural effusion, ascites, and cerebrospinal fluid, and their clinical usefulness is very high. In fact, there are active efforts being made internationally to develop a method for diagnosing various diseases, including cancer, by isolating and analyzing extracellular vesicles from human body fluids. miRNAs contained in extracellular vesicles are protected from RNase in the blood by a lipid bilayer, so they show a consistent high level of miRNAs compared to cell-free miRNAs. It is known that the miRNAs contained in extracellular vesicles have different miRNA profiles between exosomes and microvesicles. Summary of the Invention [Problem to be solved by the invention]

[0005] Therefore, the inventors have developed a biomarker for diagnosing blood coagulation disorders that contains miRNA in extracellular vesicles, thereby completing the present invention.

[0006] Therefore, an object of the present invention is to provide a biomarker composition for diagnosing a coagulation disorder, comprising one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646.

[0007] Another object of the present invention is to provide a composition for diagnosing blood coagulation disorders, comprising a preparation for measuring the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646.

[0008] It is still another object of the present invention to provide a kit for diagnosing blood coagulation disorders, comprising the above-mentioned composition for diagnosing blood coagulation disorders.

[0009] Another object of the present invention is to provide a method for providing information for diagnosing blood coagulation disorders, comprising: (a) isolating extracellular vesicles from a subject's biological sample; and (b) comparing the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 in the extracellular vesicles with the expression level of the corresponding miRNA in a control sample.

[0010] Another object of the present invention is to provide a method for diagnosing and treating blood coagulation disorders, comprising: (a) obtaining an analytical sample from an individual; (b) diagnosing the subject as having a blood coagulation disorder if the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 is higher in the analytical sample from step (a) than in a control group; and (c) administering an effective amount of a therapeutic agent for blood coagulation disorders to the individual diagnosed as having a blood coagulation disorder in step (b). [Means for solving the problem]

[0011] In order to achieve the above object, the present invention provides a biomarker composition for diagnosing a coagulation disorder, comprising one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646.

[0012] The present invention also provides a composition for diagnosing blood coagulation disorders, comprising a preparation for measuring the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646.

[0013] The present invention also provides a kit for diagnosing a blood coagulation disorder, comprising the above-mentioned composition for diagnosing a blood coagulation disorder.

[0014] The present invention also provides a method for providing information for diagnosing blood coagulation disorders, comprising: (a) isolating extracellular vesicles from a subject's biological sample; and (b) comparing the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646 in the extracellular vesicles with the expression level of the corresponding miRNA in a comparative control sample.

[0015] The present invention also provides a method for diagnosing and treating blood coagulation disorders, comprising the steps of: (a) obtaining an analytical sample from an individual; (b) diagnosing the subject as having a blood coagulation disorder if the analytical sample from step (a) reveals a higher expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 compared to a control group; and (c) administering an effective amount of a therapeutic agent for blood coagulation disorders to the individual diagnosed as having a blood coagulation disorder in step (b). Effect of the Invention

[0016] It has been experimentally confirmed that the miRNA in the extracellular vesicles according to the present invention shows a specific expression pattern in patients with blood coagulation disorders compared to normal subjects. This means that the miRNA in the extracellular vesicles according to the present invention may be used as a biomarker for blood coagulation disorders, and may be used in various ways in the field of diagnosing blood coagulation disorders. [Brief description of the drawings]

[0017] [Figure 1] FIG. 1 shows the overall study design. [Figure 2a] FIG. 1 shows the process of separating microvesicles and exosomes from extracellular vesicles in patient blood. [Figure 2b] FIG. 1 shows the results of size distribution of extracellular vesicles determined by NanoSight Tracking Analysis. [Figure 2c] FIG. 1 shows the results of confirming the morphology of extracellular vesicles using an electron microscope. [Figure 2d]FIG. 1 shows the results of detection of positive and negative markers for extracellular vesicles by Western blotting. [Diagram 3] This figure shows the results of measuring blood microvesicle and exosome miRNA levels in pooled samples from cancer patients with and without cerebral infarction, and deriving candidate miRNAs associated with cancer-associated coagulation disorders (CC: cancer-control, CS: cancer-stroke). [Figure 4a] FIG. 1 shows the results of comparing the miRNA levels in microvesicles from samples of normal subjects, cancer patients without cerebral infarction, and cancer patients with cerebral infarction. [Figure 4b] This figure shows a receiver operating characteristics (ROC) curve for cancer-stroke caused by cancer-related coagulation disorders in cancer patients, based on the results of comparing the miRNA levels in microvesicles from each sample. [Figure 5a] This figure shows the results of comparing the levels of miR-205-5p, miR-645, and miR-646 in microvesicles between stroke patients with cerebral infarction due to cancer-related coagulation disorders (cancer-stroke) and those with cerebral infarction without cancer (stroke-control, acute stroke). [Figure 5b] This figure shows the receiver operating characteristics (ROC) curve for cancer-stroke caused by cancer-related coagulation disorders in cancer patients, based on the results of comparing the levels of miR-205-5p, miR-645, and miR-646 in microvesicles from each sample. [Figure 6] Figures 1A and 1B show the results of comparing mRNA expression in an independent cohort using the Xeno-sensor technique for external validation to diagnose cerebral infarction due to cancer-related coagulopathy (A, B), and the results of diagnosing cerebral infarction due to cancer-related coagulopathy (C). [Figure 7a]FIG. 1 shows the results of confirming the function of target genes of miRNAs in microvesicles increased in blood from patients with cerebral infarction due to cancer-related coagulation disorder by GO (gene ontology) pathway analysis. [Figure 7b] FIG. 1 shows the results of KEGG (Kyoto Encyclopedia of Genes and Genomes) analysis to confirm the functions of target genes of miRNAs in microvesicles increased in blood from patients with cerebral infarction due to cancer-related coagulation disorders. [Figure 7c] FIG. 1 shows the results of analyzing VEGFA mRNA expression in human umbilical vein endothelial cells infected with con-miR, pre-miR-205-5p, pre-miR-645, or pre-miR-646. [Figure 7d] FIG. 1 shows the results of analyzing VEGFA protein expression in human umbilical vein endothelial cells infected with con-miR, pre-miR-205-5p, pre-miR-645, or pre-miR-646. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0018] The present invention will be described in detail below.

[0019] According to an aspect of the present invention, the present invention provides a biomarker composition for diagnosing a coagulation disorder, comprising one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646.

[0020] In a specific example of the present invention, the miR-205-5p may be represented by the base sequence of SEQ ID NO: 1 (UCCUUCAUUCCACCGGAGUCUG), the miR-645 may be represented by the base sequence of SEQ ID NO: 2 (UCUAGGCUGGUACUGCUGA), and the miR-646 may be represented by the base sequence of SEQ ID NO: 3 (AAGCAGCUGCCUCUGAGGC).

[0021] That is, the most notable feature of the present invention is that the miRNA is used as a biomarker to diagnose and predict the onset of blood coagulation disorders.

[0022] As used herein, the term "miRNA (microRNA)" refers to an approximately 22-nt non-translated RNA that acts as a post-transcriptional repressor through base binding to the 3' untranslated region (UTR) of mRNA.

[0023] In the present invention, "diagnosis" refers to confirming the presence or characteristics of a pathological state. The diagnosis includes not only the presence or absence of a disease, but also confirmation of the prognosis, course, stage, etc. For the purposes of the present invention, diagnosis refers to confirmation of the onset, prognosis, course, stage, or characteristics of a blood coagulation disorder.

[0024] The term "biomarker" in the present invention means a substance that may be used as a diagnostic marker or a diagnostic marker and can distinguish and diagnose the occurrence or nonoccurrence of a blood coagulation disorder from a biological sample.

[0025] In a specific embodiment of the present invention, the blood coagulation disorder is preferably a cancer-related blood coagulation disorder, and more preferably, the cancer-related blood coagulation disorder may be, but is not limited to, a cancer-related stroke. The cancer-related blood coagulation disorder refers to a blood coagulation disorder caused by various coagulation-promoting substances secreted from cancer cells, and a representative example of a cancer-related blood coagulation disorder is a stroke.

[0026] In a specific example of the present invention, the miR-205-5p, miR-645 and miR-646 may be miRNAs in extracellular vesicles, and are preferably miRNAs present in extracellular vesicles in blood.

[0027] In a preferred embodiment of the present invention, the extracellular vesicles are preferably microvesicles.

[0028] In the present invention, "extracellular vesicles (EVs)" are classified into exosomes and microvesicles according to size, with exosomes having a diameter of 30 to 150 nm and microvesicles having a diameter of 100 to 1,000 nm. Since the miRNAs contained in extracellular vesicles are protected from RNase in the blood by a lipid bilayer, they show a consistent miRNAs level that is higher than that of cell-free miRNAs. It is also known that the miRNAs contained in extracellular vesicles have different miRNA profiles between exosomes and microvesicles.

[0029] In a specific embodiment of the present invention, the miR-205-5p, miR-645 and miR-646 are preferably highly expressed when blood coagulation disorders occur. More specifically, the expression of miR-205-5p, miR-645 and miR-646 is significantly increased in the cancer-associated blood coagulation disorder patient group compared to a normal human group, a cancer patient group without stroke, and a stroke group without cancer, and therefore the expression of miR-205-5p, miR-645 and miR-646 may be utilized as a biomarker for cancer-associated blood coagulation disorders.

[0030] As used herein, the term "high expression" in reference to expression levels of miRNA refers to a value or level of a biomarker in a biological sample that is higher than the range of values ​​or levels of the biomarker detected in a biological sample obtained from a healthy or normal individual or a comparison individual, where the biomarker is indicative of or symptomatic of an abnormal process, disease or other pathological condition in an individual.

[0031] According to another aspect of the present invention, there is provided a composition for diagnosing blood coagulation disorders, comprising a preparation for measuring the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646.

[0032] In the present invention, a "preparation for measuring the expression level of miRNA" means a molecule that specifically binds to miR-205-5p, miR-645, and miR-646, which are markers whose expression is increased in biological samples from patients with blood coagulation disorders, as described above, and may be used to detect the markers by confirming their expression levels.

[0033] Unless otherwise specified herein, the expression "measuring the expression level of miRNA" as used herein means detecting a target to be detected in a sample.

[0034] In a specific example of the present invention, the preparation may be a primer or a probe that specifically binds to one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646.

[0035] In the present invention, the term "primer" refers to a short nucleic acid sequence having a short free 3' hydroxyl group, which may form a base pair with a complementary template and serves as a starting point for replication of the template strand. The primer can initiate DNA synthesis in the presence of a reagent for polymerization reaction (i.e., DNA polymerase or reverse transcriptase) and four different nucleoside triphosphates at an appropriate buffer solution and temperature. Specifically, blood coagulation disorders can be diagnosed by performing PCR amplification using sense and antisense primers of TrioBP polynucleotides and determining whether or not a desired product is produced. The PCR conditions and the lengths of the sense and antisense primers can be modified based on what is known in the art.

[0036] In the present invention, the term "probe" refers to a nucleic acid fragment such as RNA or DNA, which can specifically bind to mRNA and is as short as a few bases or as long as several hundred bases, and is labeled to confirm the presence or absence of a specific mRNA. The probe may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, etc. The selection of an appropriate probe and the hybridization conditions may be modified based on what is known in the art.

[0037] The primers or probes of the present invention may be chemically synthesized using the phosphoramidite solid support method or other widely known methods. Such nucleic acid sequences may also be modified using a number of means known in the art. Non-limiting examples of such modifications include methylation, "capping," substitution of one or more analogues of natural nucleotides, and internucleotide modifications, such as uncharged linkages (e.g., methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

[0038] The expression level of miRNA may be measured by a method commonly used in the biokit field, including, but not limited to, reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), real-time reverse transcriptase polymerase reaction (Real-time RT-PCR), RNase protection assay (RPA), Northern blotting, or gene chips.

[0039] In still another aspect, the present invention provides a kit for diagnosing a blood coagulation disorder, comprising the composition for diagnosing a blood coagulation disorder.

[0040] The kit may include not only a preparation for measuring the expression level of the exosomal miRNA, but also tools, reagents, etc. commonly used in the art that are suitable for use as a blood coagulation disorder diagnostic kit.

[0041] Examples of the tools or reagents include, but are not limited to, suitable carriers, labeling substances capable of generating detectable signals, chromophores, dissolving agents, detergents, buffers, stabilizers, etc. When the labeling substance is an enzyme, it may include a substrate capable of measuring the enzyme activity and a reaction stopper. The carrier may be a soluble carrier or an insoluble carrier. An example of a soluble carrier is a physiologically acceptable buffer solution known in the art, such as PBS, and an example of an insoluble carrier may be a polymer such as polystyrene, polyethylene, polypropylene, polyester, polyacrylonitrile, fluororesin, cross-linked dextran, polysaccharide, magnetic particles formed by plating metal on latex, other paper, glass, metal, agarose, and combinations thereof.

[0042] For example, the diagnostic kit of the present invention may be a kit containing essential elements required for performing RT-PCR. The RT-PCR kit may include test tubes or other suitable containers, reaction buffers (variable in pH and magnesium concentration), deoxyribonucleic acid (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNAse inhibitors, DEPC-water, sterile water, etc., in addition to respective primer pairs specific to the marker miRNA.

[0043] Since the kit of the present invention comprises the above-mentioned biomarkers and compositions as components, the description of the overlapping contents will be omitted in order to avoid excessive complexity of this specification.

[0044] According to another aspect of the present invention, the present invention provides a method for providing information for diagnosing a blood coagulation disorder, comprising: (a) isolating extracellular vesicles from a subject's biological sample; and (b) comparing the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 in the extracellular vesicles with the expression level of the corresponding miRNA in a control sample.

[0045] In a specific embodiment of the invention, the method may further comprise the step of measuring the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646.

[0046] In a specific example of the present invention, it is preferable that step (b) is to determine that the subject has a blood coagulation disorder if the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 is highly expressed compared to a control group.

[0047] By "biological sample" herein is meant any sample obtained from an individual in which expression of a biomarker of the invention can be detected.

[0048] In a specific embodiment of the present invention, the biological sample is blood or serum, and is not particularly limited thereto, and may be prepared by processing using a method commonly used in the technical field of the present invention.

[0049] Unless otherwise specified herein, the term "control group" as used herein refers to the expression levels of the above-mentioned miRNAs in samples from a normal human group, a cancer patient group without stroke, and a stroke group without cancer.

[0050] When the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 is measured to be significantly higher in a patient sample suspected of developing or progressing a blood coagulation disorder than the expression levels of miR-205-5p, miR-645 and miR-646 in a control sample, information that a blood coagulation disorder has developed can be provided. In particular, the biomarkers miR-205-5p, miR-645 and miR-646 used in this method are highly expressed in a cancer-related stroke patient group compared to the control groups (normal human group, cancer patient group without stroke and stroke group without cancer), and can provide information regarding the diagnosis of a cancer-related blood coagulation disorder.

[0051] According to yet another aspect of the present invention, there is provided a method for diagnosing and treating blood coagulation disorders, comprising: (a) obtaining an analytical sample from an individual; (b) diagnosing the subject as having a blood coagulation disorder if the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 is higher in the analytical sample from step (a) than in a control group; and (c) administering an effective amount of a therapeutic agent for blood coagulation disorders to the individual diagnosed as having a blood coagulation disorder in step (b).

[0052] In the present invention, a therapeutic agent for blood coagulation disorders means a preparation for alleviating or treating the symptoms of blood coagulation disorders.

[0053] In a specific embodiment of the present invention, the blood coagulation disorder therapeutic agent is preferably one or more selected from the group consisting of heparin, dalteparin, enoxaparin, tanzapirin, warfarin, xarelto, eliquis, pradaxa, and Lixiana, but is not limited thereto.

[0054] Among the blood coagulation disorder therapeutic agents, dalteparin, enoxaparin, and tinzapirin belong to low molecular weight heparins (LMWH), the warfarin belongs to vitamin K antagonists (coumarins), and Xarelto, Eliquis, Pradaxa, and Lixiana belong to new oral anticoagulants (NOACs).

[0055] In consideration of the complexity of this specification, duplicate content will be omitted, and terms not otherwise defined herein have the meanings commonly used in the technical field to which this invention pertains.

[0056] MODE FOR CARRYING OUT THEINVENTION The present invention will be described in more detail below with reference to examples. It is obvious to those skilled in the art that these examples are merely for illustrating the present invention and the scope of the present invention is not limited by these examples.

[0057] Example 1. Collection of extracellular vesicles from blood in clinical trial groups

[0058] 1.1. Clinical trial group setting

[0059] Serum samples were obtained from 220 patients enrolled in the OASIS-CANCER clinical trial (Clinicaltrials.gov. Unique identifier: NCT02743052), including 45 cancer-related stroke patients (cancer-stroke), 76 healthy controls (healthy-control), 39 cancer patients without stroke (cancer-control), and 60 stroke patients without cancer (stroke-control).

[0060] The cancer-related cerebral infarction group was patients who had developed cerebral infarction within the last 6 months, who had been diagnosed with a malignant tumor, or who were undergoing anti-cancer treatment, and who did not have arteriosclerosis, cardioembolism, or any other cause other than cancer-related embolism. The healthy control group was patients who had no history of stroke or malignant tumor. The cancer patients who did not develop stroke (cancer-control) were patients who had developed a malignant tumor within the last 6 months, or who were undergoing anti-cancer treatment, and who had no history of stroke. The non-cancer cerebral infarction group (stroke-control) was patients whose stroke was caused by common mechanisms of cerebral infarction, such as arteriosclerosis or cardioembolism (CE).

[0061] The development cohort for calculating biomarker candidates consisted of 143 patients, and the validation cohort included 77 patients as an independent patient group for validating the candidate biomarkers. In both the development and validation cohorts, the stroke-control group was older than the other groups. In both the cancer-control and cancer-stroke groups, lung cancer was the most common primary cancer, and most patients had metastases. Information on the study participants is shown in Tables 1 and 2.

[0062] [Table 1]

[0063] [Table 2]

[0064] 1.2. Collection and analysis of blood extracellular vesicles

[0065] The overall clinical trial design is presented in Figure 1.

[0066] All patients had plasma samples collected via vein. Plasma samples were prepared from citrated whole blood and then immediately centrifuged at 2000g for 15 min and stored at -80°C for the experiments. Microvesicles and exosomes were isolated by differential ultra-centrifugation method. The centrifugation process was performed at 4°C using an Optima TLX ultracentrifuge (Beckman Coulter, Brea, CA, USA) and a TLA120.2 rotor. The specific method is shown in Figure 2a.

[0067] For optimal analysis, extracellular vesicles were pre-diluted in vesicle-free water, and the concentration and size distribution of extracellular vesicles were measured by a NanoSight NS300 instrument (Malvern, Worcestershire, UK). The average size and concentration (particles / mL) of extracellular vesicles were calculated by combining the data from three individual measurements. Extracellular vesicles were directly visualized using transmission electron microscopy (TEM). To identify positive and negative markers of extracellular vesicles, 20 μg of extracellular vesicle protein was separated by SDS-PAGE and transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). Membranes were incubated overnight at 4°C with primary antibodies against CD63, CD81, TSG101, and HSP70 (1:1000, Cell Signaling Technology, Beverly, MA, USA), or calnexin (1:1000, Santa Cruz Biotechnology, Santa Cruz, CA, USA), followed by reaction with horseradish peroxidase (HRP)-conjugated secondary antibodies (1:1000, anti-rabbit, Cell Signaling Technology) for 2 h. Proteins were detected using chemiluminescence substrate from ThermoFisher Scientific, Inc. (Waltham, MA, USA) and visualized on X-ray film (Agfa, Mortsel, Belgium). After treating MSCs, the levels of plasma extracellular vesicles were measured from the patients, and the morphology and size distribution of plasma extracellular vesicles were confirmed by Cryo-TEM, the results of which are shown in Figure 2b and Figure 2c, and the detection results of positive and negative markers of extracellular vesicles are shown in Figure 2d.

[0068] As shown in Figure 2b and Figure 2c, we confirmed that most of the extracellular vesicles had a round shape with electron-dense structures, with mean (SD) diameters of 179.9 ± 2.2 nm for microvesicles and 172.3 ± 3.7 nm for exosomes, respectively.

[0069] As shown in Figure 2d, circulating extracellular vesicles were positive for extracellular vesicle markers including CD63, CD81, TSG101 and HSP70, and Calnexin, a negative marker for extracellular vesicles, was not detected.

[0070] Example 2. Analysis of miRNA levels in extracellular vesicles

[0071] 2.1. Extraction of candidate miRNAs for cancer-related cerebral infarction from blood microvesicles and exosomes

[0072] After collecting serum from healthy-control, cancer-control and cancer-stroke groups, the miRNA levels were compared between microvesicles and exosomes from pooled samples by microarray. Specifically, miRNA profiles were measured using Human whole-miRNome Array and miScript SYBR green PCR kit. 4ul RNA was reverse transcribed to cDNA using miScript II RT kit. PCR template was diluted 1:20 with RT product, and qRT-PCR was performed in 384-well plates containing synthetic miRNAs miRTC, positive PCR control and housekeeping reference using ABI 7900HT Real-Time PCR System. Raw data was normalized to the reference miRNA included in all plates and normalized to the Global CT mean to calculate Cq values. Microarray results are shown in Figure 3a and Figure 3b.

[0073] As shown in FIG. 3a, it was confirmed that there was a difference in the expression level of miRNA between microvesicles and exosomes in each group.

[0074] As shown in Figure 3b, in the case of microvesicles, the miRNAs whose expression was increased in the cancer-stroke group were increased by more than 5-fold compared to the cancer-control group, and there were 32 miRNAs whose Cq values ​​were less than 35. When confirmed in each individual patient sample, the expression of 7 miRNAs was increased in the cancer-stroke group. Of these, only 3 miRNAs, namely miR-205-5p, miR-645, and miR-646, were increased compared to the stroke-control group, confirming that the increased expression was not due to stroke.

[0075] In the case of exosomes, 23 miRNAs were increased by more than three times in the cancer-stroke group compared to the cancer-control group, with Cq values ​​of less than 35. However, the expression levels of these miRNAs were not different from those in the stroke-control group. Therefore, in the case of microvesicles, three miRNAs showed significant expression differences in the cancer-stroke group, whereas in the case of exosomes, no miRNAs showed significant expression differences. Further research was conducted to analyze miRNAs in microvesicles.

[0076] 2.2. Extraction of candidate miRNAs for cancer-related cerebral infarction from blood microvesicles

[0077] The expression levels of miRNAs in microvesicles from individual patient samples were compared between groups by qPCR. Measurements were performed using TaqMan MicroRNA Assays (Applied Biosystems, Foster City, CA, USA) primers and analyzed using the 2-ΔCt quantitative method. miRNAs with Cq values ​​less than 35 and expression levels increased 5-fold or more compared to healthy controls were selected. The results of comparing the expression levels of miRNAs in microvesicles from individual patient samples are shown in Figure 4.

[0078] As shown in Figure 4, miR-203-3p, miR-205-5p, miR-645, miR-646, miR-632, and miR-623 contained in microvesicles were significantly increased in cancer stroke patients compared to healthy controls and cancer controls (Figure 4a), and these miRNAs showed diverse differential diagnostic power, with AUCs ranging from 0.754 to 0.924 (Figure 4b).

[0079] The miRNA levels in microvesicles of the cancer-stroke and stroke-control groups of stroke patients were compared, and the results are shown in FIG. 5.

[0080] As shown in Figure 5, miR-205-5p, miR-645, and miR-646 showed significantly higher expression in both stroke and control (Figure 5a), and the AUC was 0.7095 to 0.8190, indicating the ability to differentiate in the event of cerebral infarction. When the three miRNAs were combined, the ability to differentiate was increased to 0.8810 (Figure 5b).

[0081] The miR-205-5p, miR-645, and miR-646 are represented by the base sequences of SEQ ID NOs: 1 to 3, respectively.

[0082] 2.3. Validation of miRNAs related to cancer-related cerebral infarction in blood microvesicles

[0083] For external validation, the expression levels of miR-205-5p, miR-645, and miR-646 in microvesicles were compared using Xeno-sensor technology in individual patient samples from independent patients. The results of analyzing mRNA expression using the Xeno-sensor technology are shown in Figure 6.

[0084] As shown in Figure 6a and Figure 6b, miR-205-5p, miR-645 and miR-646 in extracellular vesicles and microvesicles were significantly more highly expressed in cancer-stroke than in healthy-control (Normal), cancer-control and stroke-control (CE-AF). In addition, quantitative evaluation of miRNAs confirmed that the copy numbers of each miRNA were significantly different.

[0085] As shown in Figure 6c, the accuracy of diagnosing the occurrence of cerebral infarction in cancer patients was AUC 0.8221, 0.7692, and 0.7837 for miR-205-5p, miR-645, and miR-646, respectively, and 0.8510 for the combination of the three miRNAs. The diagnostic accuracy of differentiating cancer-related coagulation disorders from cerebral infarction patients was AUC 0.8077, 0.8846, and 0.8596, respectively, and 0.8788 for the combination of the three miRNAs.

[0086] 2.4. Bioinformatics analysis of miRNAs

[0087] Bioinformatics analysis of miRNAs was performed. Specifically, after confirming that the data were correctly normalized (miRNA profiles were analyzed using Human whole-miRNome Array), miRNAs that showed a difference of 2.0-fold or more between the mean signal values ​​of HC (healthy individual), CC (cancer-control), and CS (cancer-stroke) groups were selected. To classify the co-expression of miR groups with similar expression patterns, hierarchical clustering analysis was performed using MEV (Multi Experiment Viewer) software version 4.9.0. KEGG (Kyoto Encyclopedia of Genes and Genomes) and GO (Gene Ontology) pathway analysis was used to detect the functions of differentially expressed miRNAs selected from target genes. GO and KEGG pathway enrichment analysis was performed using the miRWalk2.0 web-based tool (http: / / zmf.umm.uni heidelberg.de / apps / zmf / mirwalk2 / ). Potential miRNA targets were predicted based on the RNA22 database (http: / / cm.jefferson.edu / rna22). The results of the miRNA bioinformatics analysis are shown in Figure 7a and Figure 7b.

[0088] As shown in Figure 7a and Figure 7b, GO and KEGG analysis confirmed that the miRNAs in microvesicles with increased expression in cancer stroke patients were related to cancer pathways, JAK / STAT signaling pathways, signaling pathways related to cell adhesion, cell cycle, cell differentiation, neural regeneration and immune response, and biological pathways. In particular, three miRNAs in microvesicles interacted with target genes related to cell-substrate adhesion, CNS development, and positive regulation of peptidyl-serine phosphorylation.

[0089] 2.5. Expression of VEGFA (vascular endothelial growth factor A) mRNA by infection with three types of miRNA

[0090] To confirm the regulation of VEGFA by the three miRNAs, human umbilical vein endothelial cells (HUVECs) were transfected with con-miR, pre-miR-205-5p, pre-miR-645, or pre-miR-646. Specifically, HUVECs were transfected with EGMTM-2 SingleQuots, which is required for endothelial cell growth. TM The cells were cultured in EBMTM-2 basal medium (Lonza, Cat# CC-3156) supplemented with supplement (CC-4176). For miRNA transfection, 4 × 10 5 Cells 60mm 2 Culture dishes were plated and transfected with 60 nM miRNA mimics for 6 h. Control miRNA and miRNA mimics were purchased from Bioneer (Bioneer, Daejeon, South Korea) and transfected with Lipofectamine according to the manufacturer's protocol. TM Transfection was performed using RNAiMAX transfection reagent (Thermofisher, Cat# 13778150). After 24 hours, cells were harvested and transfection was evaluated, and the results are shown in Figure 7c.

[0091] As shown in Fig. 7c, VEGFA mRNA levels were significantly decreased in HUVECs transfected with pre-miR-645 (p<0.01), confirming that overexpression of miR-205-5p and miR-646 reduced the expression level of VEGFA mRNA.

[0092] 2.6.Effect of miRNA overexpression on VEGFA protein expression

[0093] HUVECs were lysed using RIPA buffer containing protease inhibitors. A total of 10ug of cell lysate was separated by SDS-polyacrylamide gel electrophoresis (Invitrogen, Cat# XP08162BOX) and transferred to a 0.45μm nitrocellulose membrane (BIO-RAD, Cat# 1620115). After blocking, the membrane was incubated with each primary antibody overnight at 4℃, washed three times for 10min with TBS-t, and incubated with the appropriate secondary antibody for 1hr at room temperature. The data were visualized using a chemiluminescence imaging system (VILBER, Fusion SOLO S), and the results are shown in Figure 7d.

[0094] As shown in FIG. 7d, overexpression of miR-645 in HUVECs was confirmed to decrease VEGFA protein levels.

[0095] Overall, it was confirmed that miRNAs (miR-205-5p, miR-645, miR-646) in microvesicles were significantly increased in patients with cerebral infarction due to cancer-related coagulation disorders. The increased miRNAs in blood microvesicles can be used to diagnose the occurrence of cerebral infarction due to coagulation disorders in cancer patients, and can be used as guideline markers for the application of anticoagulants to cancer patients. In addition, it was confirmed that miRNAs (miR-205-5p, miR-645, miR-646) in microvesicles can promote angiogenesis, and therefore can be used as therapeutic agents for ischemic diseases.

[0096] Although the specific parts of the present invention have been described in detail above, it is obvious to those skilled in the art that such specific description is merely a preferred embodiment and does not limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A biomarker composition for diagnosing a coagulation disorder, comprising one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646.

2. The biomarker composition for diagnosing a blood coagulation disorder according to claim 1, wherein the blood coagulation disorder is a cancer-associated blood coagulation disorder.

3. The biomarker composition for diagnosing a blood coagulation disorder according to claim 2, wherein the cancer-related blood coagulation disorder is cancer-related stroke.

4. The biomarker composition for diagnosing a blood coagulation disorder according to claim 1, wherein the miR-205-5p, miR-645 and miR-646 are miRNAs in extracellular vesicles.

5. The biomarker composition for diagnosing blood coagulation disorders according to claim 4 , wherein the extracellular vesicles are extracellular vesicles in blood.

6. The biomarker composition for diagnosing blood coagulation disorders according to claim 4 , wherein the extracellular vesicles are microvesicles.

7. 2. The biomarker composition for diagnosing a blood coagulation disorder according to claim 1, wherein the miR-205-5p, miR-645 and miR-646 are highly expressed when a blood coagulation disorder develops.

8. A composition for diagnosing a blood coagulation disorder, comprising a preparation for measuring the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646.

9. The composition for diagnosing a blood coagulation disorder according to claim 8, wherein the preparation is a primer or a probe that specifically binds to one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646.

10. A kit for diagnosing blood coagulation disorders, comprising the composition for diagnosing blood coagulation disorders according to claim 8.

11. (a) isolating extracellular vesicles from a biological sample of a subject; (b) comparing the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646 in the extracellular vesicles with the expression level of the corresponding miRNA in a comparative control sample.

12. The method for providing information for the diagnosis of blood coagulation disorders according to claim 11, wherein in the step (b), when the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645 and miR-646 is highly expressed as compared to a control group, the subject is judged to have a blood coagulation disorder.

13. The method for providing information for the diagnosis of blood coagulation disorders according to claim 11 , wherein the biological sample is blood or serum.

14. (a) obtaining an analytical sample from an individual; (b) diagnosing the subject as having a blood coagulation disorder when the expression level of one or more miRNAs selected from the group consisting of miR-205-5p, miR-645, and miR-646 is higher than that of a control group in the analysis sample of step (a); (c) administering to the individual diagnosed with a blood clotting disorder in step (b) an effective amount of a therapeutic agent for treating a blood clotting disorder.

15. The method for diagnosing and treating blood clotting disorders according to claim 14, wherein the blood clotting disorder therapeutic agent is one or more selected from the group consisting of heparin, dalteparin, enoxaparin, tanzapirin, warfarin, xarelto, eliquis, pradaxa, and lixiana.

Images