Methods and compositions for improving in vivo survival of midbrain dopamine neurons

Abstract

The present disclosure provides a method for improving in vivo survival of midbrain dopamine (mDA) neurons (e.g., in vitro differentiated mDA neurons) by suppressing p53-mediated apoptosis of the mDA neurons. The present disclosure further provides a method for treating a subject (e.g., a subject suffering from neurodegeneration and / or a neurodegenerative disease of midbrain dopamine neurons), the method comprising administering one or more mDA to the subject, whereby p53-mediated apoptosis of the one or more mDA neurons is suppressed.

Description

[Technical field]

[0001] Grant Information This disclosure was made with Government support under Grant No. NS118067-01A1 awarded by the National Institutes of Health. The Government has certain rights in this disclosure.

[0002] Priority This patent application claims priority to U.S. Provisional Application No. 63 / 321,507, filed March 18, 2022, the contents of which are incorporated by reference in their entirety herein.

[0003] Sequence Listing A sequence listing conforming to the rules of WIPO Standard ST.26 is incorporated herein by reference. The sequence listing has been submitted as an electronic document in ASCII format encoded as XML via the PatentCenter. The electronic document, created on March 19, 2023, is entitled "072734.1438_ST26.xml" and is 714,898 bytes in size.

[0004] Introduction The present disclosure provides methods and compositions for improving in vivo survival of midbrain dopamine (mDA) neurons (e.g., in vitro differentiated mDA neurons) by suppressing p53-mediated apoptosis of the mDA neurons. The present disclosure further provides methods and compositions for treating a subject (e.g., a subject suffering from neurodegeneration and / or a neurodegenerative disease of midbrain dopamine neurons), the methods comprising administering to the subject one or more mDAs, whereby p53-mediated apoptosis of the one or more mDA neurons is suppressed. [Background technology]

[0005] Parkinson's disease (PD) remains a major scientific and therapeutic challenge. PD affects an estimated 10 million cases worldwide and incurs significant costs for affected individuals and society in general (Dorsey et al., 2018, J Parkinsons Dis 8, S3-S8). The rapid increase in the number of PD cases worldwide has been referred to by some as a "Parkinson's pandemic," highlighting the urgent need for the development of disease-modifying therapies (Dorsey et al., 2018). Existing therapies can alleviate motor symptoms in the early stages of the disease, but these symptomatic treatments become less effective over time, do not prevent or slow disease progression, and may cause side effects such as dyskinesia, speech disorders, or depression in some patients (Jenner, 2008, Nat Rev Neurosci 9, 665-677).

[0006] PD patients share a common pathological feature, the progressive degeneration of dopamine neurons in the substantia nigra pars compacta (Poewe et al., 2017, Nat Rev Dis Primers 3, 17013). Cell-based therapy has been explored as a novel therapeutic strategy due to its potential to achieve circuit-level restoration of dopaminergic function. Current cell replacement therapy in PD patients has been pursued using human fetal midbrain tissue transplants. Although this procedure has shown success in improving motor-related symptoms in a small subset of PD patients (Kefalopoulou et al., 2014, JAMA Neurol 71, 83-87; Li et al., 2016, Proc Natl Acad Sci USA 113, 6544-6549), there has been a large variability in clinical response among patients. Two placebo-controlled studies failed to meet their primary endpoints (Freed et al., 2001, N Engl J Med 344, 710-719; Olanow et al., 2003, Ann Neurol 54, 403-414). Given the challenges of using human fetal tissue as a routine, scalable, and defined source of dopamine neurons, alternative sources such as human pluripotent stem cell (hPSC)-derived dopamine neurons have become the focus of ongoing cell therapy efforts in PD (Piao et al., 2021, Cell Stem Cell 28, 217-229 e217; Schweitzer et al., 2020, N Engl J Med 382, ​​1926-1932).

[0007] One challenge that has been largely overlooked in all these efforts is the limited survival of transplanted dopamine neurons after the transplantation procedure. This is a key factor in determining the success of the procedure, considering the need to reach a critical dose of dopamine neurons to achieve clinical improvement, and the challenge of predicting an effective dose in the patient's brain when there is considerable variability in initial cell survival. Furthermore, injecting a large number of cells to overcome limited in vivo survival may pose the risk of inducing a host inflammatory response from the procedure and associated cell death of the transplanted cells (Kriks et al., 2011, Nature 480, 547-551.; Tao et al., 2021, Nat Med 27, 632-639.).

[0008] Thus, there remains a need to improve the survival of midbrain dopamine neurons after transplantation. [Prior art documents] [Non-patent literature]

[0009] [Non-Patent Document 1] Dorsey et al.,2018,J Parkinsons Dis 8,S3-S8 [Non-Patent Document 2] Jenner,2008,Nat Rev Neurosci 9,665-677 [Non-Patent Document 3] Poewe et al.,2017,Nat Rev Dis Primers 3,17013 [Non-Patent Document 4] Kefalopoulou et al.,2014,JAMA Neurol 71,83-87 [Non-Patent Document 5] Li et al.,2016,Proc Natl Acad Sci USA 113,6544-6549 [Non-Patent Document 6] Freed et al.,2001,N Engl J Med 344,710-719 [Non-Patent Document 7] Olanow et al.,2003,Ann Neurol 54,403-414 [Non-Patent Document 8] Piao et al.,2021,Cell Stem Cell 28,217-229 e217 [Non-Patent Document 9] Schweitzer et al.,2020,N Engl J Med 382,1926-1932 [Non-Patent Document 10] Kriks et al.,2011,Nature 480,547-551. [Non-Patent Document 11] Tao et al.,2021,Nat Med 27,632-639. Summary of the Invention [Means for solving the problem]

[0010] The present disclosure provides methods and compositions for improving in vivo survival of midbrain dopamine (mDA) neurons (e.g., in vitro differentiated mDA neurons) by suppressing p53-mediated apoptosis of the mDA neurons. The present disclosure further provides methods and compositions for treating a subject (e.g., a subject suffering from neurodegeneration and / or a neurodegenerative disease of midbrain dopamine neurons), the methods comprising administering one or more mDA to the subject, whereby p53-mediated apoptosis of the one or more mDA neurons is suppressed.

[0011] In certain embodiments, the disclosure provides a method for treating a subject. In certain embodiments, the method comprises administering to the subject one or more midbrain dopamine (mDA) neurons, and inhibiting p53-mediated apoptosis of the one or more mDA neurons. In certain embodiments, inhibiting p53-mediated apoptosis comprises administering to the subject at least one compound selected from the group consisting of tumor necrosis factor alpha (TNFα) inhibitors, nuclear factor kappa B (NFκB) inhibitors, p53 inhibitors, and combinations thereof. In certain embodiments, the method comprises administering one or more mDA neurons simultaneously with the administration of the at least one compound. In certain embodiments, inhibiting p53-mediated apoptosis comprises contacting one or more mDA neurons with at least one compound selected from the group consisting of TNFα inhibitors, NFκB inhibitors, p53 inhibitors, and combinations thereof.

[0012] In certain embodiments, the subject suffers from a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons. In certain embodiments, the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and combinations thereof.

[0013] In certain embodiments, the present disclosure provides a method for improving the in vivo survival of one or more midbrain dopamine (mDA) neurons.In certain embodiments, the method comprises suppressing p53-mediated apoptosis of one or more mDA neurons.In certain embodiments, suppressing p53-mediated apoptosis comprises contacting one or more mDA neurons with a compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof.

[0014] In certain embodiments, the inhibition of p53-mediated apoptosis comprises inhibition of tumor necrosis factor alpha (TNFα) signaling, inhibition of nuclear factor kappa B (NFκB) signaling, inhibition of p53 signaling, or a combination of the foregoing.

[0015] In certain embodiments, the TNFα inhibitor is an anti-TNFα antibody, a TNFα decoy receptor, a chemical compound, a nucleic acid inhibitor, a small molecule inhibitor, a receptor biological inhibitor, an inactive TNF fragment, a TNFα circulating receptor fusion protein, a xanthine derivative, a 5-HT 2A agonists, and combinations thereof. In certain embodiments, the TNFα inhibitor is an anti-TNFα antibody. In certain embodiments, the anti-TNFα antibody is selected from the group consisting of adalimumab, adalimumab-adbm, adalimumab-adaz, adalimumab-atto, certolizumab pegol, golimumab, infliximab, infliximab-abda, infliximab-dyyb, lemtolumab, afelimomab, nerelimomab, ozoralizumab, placurab, and combinations thereof. In certain embodiments, the anti-TNFα antibody is adalimumab.

[0016] In certain embodiments, the NFκB inhibitor is selected from the group consisting of upstream inhibitors of NFκB, inhibitors of IKK activity, inhibitors of IκB phosphorylation, inhibitors of IκB degradation, proteasome inhibitors, protease inhibitors, IκB upregulators, inhibitors of NFκB nuclear translocation and expression, NFκB DNA binding inhibitors, and NFκB transactivation inhibitors, inhibitors of NFκB-directed gene transactivation, antioxidants, and combinations thereof.

[0017] In certain embodiments, the p53 inhibitor is selected from the group consisting of a JNK inhibitor, a p38 MAPK inhibitor, a caspase inhibitor, a puma / BBC3 inhibitor, a BAX inhibitor, a CDK inhibitor, an MDM2 and MDMX activator, and combinations thereof.

[0018] In certain embodiments, suppressing p53-mediated apoptosis comprises knocking out or knocking down the TP53 gene in one or more mDA neurons.In certain embodiments, the TP53 gene is knocked out or knocked down by a genetic engineering system.In certain embodiments, the genetic engineering system is a CRISPR-Cas system.

[0019] In certain embodiments, the one or more mDA neurons express a marker selected from the group consisting of EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, SATB1, CALB1, CALB2, SNCG, PBX1, and combinations thereof. In certain embodiments, the one or more mDA neurons are post-mitotic mDA neurons.

[0020] In certain embodiments, the one or more mDA neurons are differentiated in vitro from one or more stem cells. In certain embodiments, the one or more stem cells are selected from the group consisting of human stem cells, non-human primate stem cells, rodent non-embryonic stem cells, human embryonic stem cells, non-human primate embryonic stem cells, rodent embryonic stem cells, human induced pluripotent stem cells, non-human primate induced pluripotent stem cells, rodent induced pluripotent stem cells, and human recombinant pluripotent cells, non-human primate recombinant pluripotent cells, and rodent recombinant pluripotent cells. In certain embodiments, the one or more stem cells are human stem cells. In certain embodiments, the one or more stem cells are one or more pluripotent stem cells or multipotent stem cells. In certain embodiments, the one or more stem cells are selected from the group consisting of embryonic stem cells, induced pluripotent stem cells, and combinations thereof. In certain embodiments, the one or more stem cells are one or more induced pluripotent stem cells.

[0021] In certain embodiments, in vitro differentiation comprises contacting one or more stem cells with at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, at least one activator of Sonic hedgehog (SHH) signaling, and at least one activator of wingless (Wnt) signaling.

[0022] In certain embodiments, the concentration of the at least one activator of Wnt signaling contacted with the cells is increased from about 2 days to about 6 days after initial contact of the cells with the at least one activator of Wnt signaling. In certain embodiments, the concentration of the at least one activator of Wnt signaling contacted with the cells is increased from about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling contacted with the cells.

[0023] In certain embodiments, the at least one activator of Wnt signaling comprises an inhibitor of glycogen synthase kinase 3β (GSK3β) signaling. In certain embodiments, the at least one activator of Wnt signaling is selected from the group consisting of CHIR99021, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763, Wnt3A, Wnt1, Wnt5a, derivatives thereof, and combinations thereof. In certain embodiments, the at least one activator of Wnt signaling comprises CHIR99021.

[0024] In certain embodiments, the at least one inhibitor of SMAD signaling comprises an inhibitor of TGFβ / activin-Nodal signaling, an inhibitor of bone morphogenetic protein (BMP) signaling, or a combination thereof. In certain embodiments, the at least one inhibitor of TGFβ / activin-Nodal signaling is selected from the group consisting of SB431542, a derivative of SB431542, and a combination thereof. In certain embodiments, the derivative of SB431542 comprises A83-01. In certain embodiments, the at least one inhibitor of TGFβ / activin-Nodal signaling comprises SB431542. In certain embodiments, the at least one inhibitor of BMP signaling is selected from the group consisting of LDN193189, Noggin, Dorsomorphin, a derivative of LDN193189, a derivative of Noggin, a derivative of Dorsomorphin, and a combination thereof. In certain embodiments, the at least one inhibitor of BMP comprises LDN-193189.

[0025] In certain embodiments, the at least one activator of SHH signaling is selected from the group consisting of SHH protein, Smoothened agonist (SAG), and combinations thereof. In certain embodiments, the SHH protein is selected from the group consisting of recombinant SHH, modified N-terminal SHH, and combinations thereof. In certain embodiments, the modified N-terminal SHH comprises two isoleucines at the N-terminus. In certain embodiments, the modified N-terminal SHH has at least about 90% sequence identity with the unmodified N-terminal SHH. In certain embodiments, the unmodified N-terminal SHH is unmodified mouse N-terminal SHH or unmodified human N-terminal SHH. In certain embodiments, the modified N-terminal SHH comprises SHH C25II. In certain embodiments, the SAG comprises purmorphamine. In certain embodiments, the at least one activator of SHH signaling comprises SHH C25II.

[0026] In certain embodiments, the in vitro differentiation further comprises contacting the one or more stem cells with at least one activator of fibroblast growth factor (FGF) signaling. In certain embodiments, the at least one activator of FGF signaling is selected from the group consisting of FGF18, FGF17, FGF8a, FGF8b, FGF4, FGF2, and combinations thereof. In certain embodiments, the at least one activator of FGF signaling comprises FGF18. In certain embodiments, the at least one activator of FGF signaling comprises FGF8.

[0027] In certain embodiments, the in vitro differentiation further comprises contacting one or more stem cells with at least one inhibitor of Wnt signaling. In certain embodiments, the at least one inhibitor of Wnt signaling is selected from the group consisting of IWP2, IWR1-endo, XAV939, IWP-O1, Wnt-C59, IWP-L6, and ICG-001, and combinations thereof. In certain embodiments, the at least one inhibitor of Wnt signaling comprises IWP2.

[0028] In certain embodiments, the one or more mDA neurons express detectable levels of CD184 and do not express detectable levels of CD49e.

[0029] In certain embodiments, the present disclosure provides a composition comprising: (a) one or more midbrain dopamine (mDA) neurons; and (b) at least one compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof. In certain embodiments, the composition is a pharmaceutical composition further comprising a pharma- ceutically acceptable carrier.

[0030] In certain embodiments, the composition is for treating or ameliorating a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons. In certain embodiments, the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and combinations thereof.

[0031] In certain embodiments, the TNFα inhibitor is an anti-TNFα antibody, a TNFα decoy receptor, a chemical compound, a nucleic acid inhibitor, a small molecule inhibitor, a receptor biological inhibitor, an inactive TNF fragment, a TNFα circulating receptor fusion protein, a xanthine derivative, a 5-HT 2A agonists, and combinations thereof. In certain embodiments, the TNFα inhibitor is an anti-TNFα antibody. In certain embodiments, the anti-TNFα antibody is selected from the group consisting of adalimumab, adalimumab-adbm, adalimumab-adaz, adalimumab-atto, certolizumab pegol, golimumab, infliximab, infliximab-abda, infliximab-dyyb, lemtolumab, afelimomab, nerelimomab, ozoralizumab, placurab, and combinations thereof. In certain embodiments, the anti-TNFα antibody is adalimumab. In certain embodiments, the NFKB inhibitor is selected from the group consisting of upstream inhibitors of NFKB, inhibitors of IKK activity, inhibitors of IKB phosphorylation, inhibitors of IKB degradation, proteasome inhibitors, protease inhibitors, IKB upregulators, inhibitors of NFKB nuclear translocation and expression, NFKB DNA binding inhibitors, and NFKB transactivation inhibitors, inhibitors of NFKB-directed gene transactivation, antioxidants, and combinations thereof. In certain embodiments, the p53 inhibitor is selected from the group consisting of JNK inhibitors, p38 MAPK inhibitors, caspase inhibitors, BBC3 / PUMA inhibitors, BAX inhibitors, CDK inhibitors, MDM2 and MDMX activators, and combinations thereof.

[0032] In certain embodiments, the one or more mDA neurons express a marker selected from the group consisting of EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, SATB1, CALB1, CALB2, SNCG, PBX1, and combinations thereof. In certain embodiments, the one or more mDA neurons are post-mitotic mDA neurons.

[0033] In certain embodiments, the one or more mDA neurons are differentiated in vitro from one or more stem cells. In certain embodiments, the one or more stem cells are selected from the group consisting of human stem cells, non-human primate stem cells, rodent non-embryonic stem cells, human embryonic stem cells, non-human primate embryonic stem cells, rodent embryonic stem cells, human induced pluripotent stem cells, non-human primate induced pluripotent stem cells, rodent induced pluripotent stem cells, and human recombinant pluripotent cells, non-human primate recombinant pluripotent cells, and rodent recombinant pluripotent cells. In certain embodiments, the one or more stem cells are human stem cells. In certain embodiments, the one or more stem cells are one or more pluripotent stem cells or multipotent stem cells. In certain embodiments, the one or more stem cells are selected from the group consisting of embryonic stem cells, induced pluripotent stem cells, and combinations thereof. In certain embodiments, the one or more stem cells are one or more induced pluripotent stem cells.

[0034] In certain embodiments, in vitro differentiation comprises contacting one or more stem cells with at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, at least one activator of Sonic hedgehog (SHH) signaling, and at least one activator of wingless (Wnt) signaling.

[0035] In certain embodiments, the concentration of the at least one activator of Wnt signaling contacted with the cells is increased from about 2 days to about 6 days after initial contact of the cells with the at least one activator of Wnt signaling. In certain embodiments, the concentration of the at least one activator of Wnt signaling contacted with the cells is increased from about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling contacted with the cells.

[0036] In certain embodiments, the at least one activator of Wnt signaling comprises an inhibitor of glycogen synthase kinase 3β (GSK3β) signaling. In certain embodiments, the at least one activator of Wnt signaling is selected from the group consisting of CHIR99021, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763, Wnt3A, Wnt1, Wnt5a, derivatives thereof, and combinations thereof. In certain embodiments, the at least one activator of Wnt signaling comprises CHIR99021.

[0037] In certain embodiments, the at least one inhibitor of SMAD signaling comprises an inhibitor of TGFβ / activin-Nodal signaling, an inhibitor of bone morphogenetic protein (BMP) signaling, or a combination thereof. In certain embodiments, the at least one inhibitor of TGFβ / activin-Nodal signaling is selected from the group consisting of SB431542, a derivative of SB431542, and a combination thereof. In certain embodiments, the derivative of SB431542 comprises A83-01. In certain embodiments, the at least one inhibitor of TGFβ / activin-Nodal signaling comprises SB431542. In certain embodiments, the at least one inhibitor of BMP signaling is selected from the group consisting of LDN193189, Noggin, Dorsomorphin, a derivative of LDN193189, a derivative of Noggin, a derivative of Dorsomorphin, and a combination thereof. In certain embodiments, the at least one inhibitor of BMP comprises LDN-193189.

[0038] In certain embodiments, the at least one activator of SHH signaling is selected from the group consisting of SHH protein, Smoothened agonist (SAG), and combinations thereof. In certain embodiments, the SHH protein is selected from the group consisting of recombinant SHH, modified N-terminal SHH, and combinations thereof. In certain embodiments, the modified N-terminal SHH comprises two isoleucines at the N-terminus. In certain embodiments, the modified N-terminal SHH has at least about 90% sequence identity with unmodified N-terminal SHH. In certain embodiments, the unmodified N-terminal SHH is unmodified mouse N-terminal SHH or unmodified human N-terminal SHH. In certain embodiments, the modified N-terminal SHH comprises SHH C25II. In certain embodiments, the SAG comprises palmorfamine. In certain embodiments, the at least one activator of SHH signaling comprises SHH C25II.

[0039] In certain embodiments, the in vitro differentiation further comprises contacting the one or more stem cells with at least one activator of fibroblast growth factor (FGF) signaling. In certain embodiments, the at least one activator of FGF signaling is selected from the group consisting of FGF18, FGF17, FGF8a, FGF8b, FGF4, FGF2, and combinations thereof. In certain embodiments, the at least one activator of FGF signaling comprises FGF18. In certain embodiments, the at least one activator of FGF signaling comprises FGF8.

[0040] In certain embodiments, the in vitro differentiation further comprises contacting one or more stem cells with at least one inhibitor of Wnt signaling. In certain embodiments, the at least one inhibitor of Wnt signaling is selected from the group consisting of IWP2, IWR1-endo, XAV939, IWP-O1, Wnt-C59, IWP-L6, and ICG-001, and combinations thereof. In certain embodiments, the at least one inhibitor of Wnt signaling comprises IWP2.

[0041] In certain embodiments, the one or more mDA neurons express detectable levels of CD184 and do not express detectable levels of CD49e. [Brief description of the drawings]

[0042] [Figure 1A] Derivation and validation of NURR1:GFP sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. Dopamine neuron populations in culture. [Figure 1B] Figure 1 shows derivation and validation of NURR1:GFP sorted DA neurons for CRISPR / Cas9 screening in vitro and in vivo. Figure 2 shows microscopy images of endogenous NURR1::GFP and TH expression in grafts one month after transplantation of NURR1::GFP sorted DA neurons on day 25. [Figure 1C]Figure 1 shows the derivation and validation of NURR1:GFP sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. Figure 2 shows flow cytometry images for generating hPSC lines containing pooled lentiviral sgRNAs at an MOI of 0.35, demonstrating integration of a single copy sgRNA per cell. [Figure 1D] Derivation and validation of NURR1:GFP sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. Shown are day 40 dopamine neurons co-expressing NURR1::GFP and gRNA::tdTomato after sorting with GFP and Tomato at day 25, with or without dox treatment from day 16 to day 25. [Figure 1E] Derivation and validation of NURR1:GFP sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. Loss of tdTomato signal in hPSC-derived postmitotic dopamine neurons after dox exposure from day 16 to day 25. [Figure 1F] Derivation and validation of NURR1:GFP sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. Graft fluorescence expression one month after transplantation is shown. [Figure 1G] Derivation and validation of NURR1:GFP-sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. PCR analysis to detect the human PTGER2 gene from dissected tissues around the transplant area. [Figure 1H] Derivation and validation of NURR1:GFP sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. Global representation of sgRNAs across all conditions by next generation sequencing (NGS) from genomic DNA of in vitro cultured cells and in vivo transplanted cells. [Figure 1I]Derivation and validation of NURR1:GFP sorted DA neurons for in vitro and in vivo CRISPR / Cas9 screening. Global expression of sgRNAs across all conditions is shown. [Figure 2A] 1 shows a CRISPR screen identifying TP53 as a limiting factor for survival of postmitotic dopamine neurons during transplantation. 2 shows a schematic of the in vivo CRISPR screen. [Figure 2B] Figure 1 shows a CRISPR screen identifying TP53 as a limiting factor for survival of postmitotic dopamine neurons during transplantation. Correlation matrix of all guide RNAs from different experimental conditions for a large pooled screen is shown (day 16 in vitro vs. day 25 in vitro (no dox) vs. day 25 in vitro (with dox) vs. day 25 in vivo (with dox). Scale bar ranges from 0.9 to 1 (1 being the most correlated value). [Figure 2C] Figure 1 shows a CRISPR screen identifying TP53 as a limiting factor for survival of postmitotic dopamine neurons during transplantation. Volcano plots comparing each experimental condition are shown. Depleted genes are labeled in red and enriched genes are labeled in blue. [Figure 2D] CRISPR screen identifying TP53 as a limiting factor for survival of postmitotic dopamine neurons during transplantation. Enriched sgRNAs in in vivo transplanted cells versus cells at day 25 of in vitro culture. [Figure 2E] Figure 1 shows a CRISPR screen identifying TP53 as a limiting factor for survival of postmitotic dopamine neurons during transplantation. Correlation matrix plots of the small pool screen are shown. Similar scale bar ranges are used. [Figure 2F-1]CRISPR screen identifying TP53 as a limiting factor for survival of postmitotic dopamine neurons during transplantation. Heatmap of all guide RNAs comparing day 16 progenitor cells vs. day 25 neurons (with dox treatment) vs. day 25 neurons (without dox treatment) (left). Heatmap of the same set of gRNAs for two independent small pool screens (right). Red coloring in the scale bar indicates enrichment of each guide RNA in dopamine neurons surviving in vivo. [Figure 2F-2] Same as above. [Figure 3A] Characterization of p53-induced dopamine neuron death during transplantation. FACS strategy for injecting enriched NURR1::GFP and sgRNA-p53-tdTomato postmitotic DA neurons. FACS-sorted Dox-treated (D16-D25) or untreated dopamine neurons are injected bilaterally into each striatum of adult NSG mice. [Figure 3B] Characterization of p53-induced dopamine neuron death during transplantation. Representative immunofluorescence images of sorted DA neurons in cultures at day 25 post-sort expressing NURR1::GFP, gRNA::RFP, and TH are shown (n=3 independent experiments). [Figure 3C] Characterization of p53-induced dopamine neuron death during transplantation. Representative confocal images of dopamine neuron grafts at 1 month post-transplantation stained with an antibody against NURR1-GFP are shown. Scale bar = 100 μm. [Figure 3D] Characterization of p53-induced dopamine neuron death during transplantation. Stereological analysis of the number (using an optical fractionator) and volume (cavalier estimator) of surviving dopamine neurons one month after transplantation. *p<0.05 (paired t-test). [Figure 3E]Characterization of p53-induced dopamine neuron death during transplantation. Representative immunohistochemical images of transplanted dopamine neurons at different time points (4 hpt, 24 hpt, 72 hpt, 7 dpt) for TP53, cleaved caspase 3 (CC3), and TUNEL assays are shown. Scale bar = 50 μm. [Figure 3F] Characterization of p53-induced dopamine neuron death during transplantation. Quantification of the percentage of TP53, CC3, and TUNEL in DA neurons upon transplantation. n=3 independent experiments. [Figure 4A] Figure 1 shows increased survival of p53 KO dopamine neurons in grafts indicating dopamine neuron identity. Immunofluorescence analysis of FOXA2, TH, and NURR1-GFP signals in surviving p53 WT and KO dopamine neurons in grafts (WT; -DOX, KO; +DOX). [Figure 4B] Figure 1 shows increased survival of p53 KO dopamine neurons in grafts indicating dopamine neuron identity. Immunofluorescence analysis of FOXA2, TH, and NURR1-GFP signals in surviving p53 WT and KO dopamine neurons in grafts (WT; -DOX, KO; +DOX). [Figure 4C] Figure 1 shows increased survival of p53 KO dopamine neurons in grafts indicating dopamine neuron identity. Immunofluorescence analysis of FOXA2, TH, and NURR1-GFP signals in surviving p53 WT and KO dopamine neurons in grafts (WT; -DOX, KO; +DOX). [Figure 4D] Figure 1 shows increased survival of p53 KO dopamine neurons in grafts indicating dopamine neuron identity.Figure 2 shows RT-qPCR analysis of p53 and p53 downstream genes before and after needle injection of NURR1:GFP sorted DA neurons in culture. [Figure 5A] 1 shows a time course analysis of neuroimmune cell infiltration into the core of the graft. H&E staining of the graft is shown. [Figure 5B] Figure 2 shows a time course analysis of neuroimmune cell infiltration into the core of the graft. Figure 3 shows immunofluorescence analysis of IBA1. [Figure 5C] Figure 2 shows a time course analysis of neuroimmune cell infiltration into the core of the graft. Immunofluorescence analysis of GFAP and FOXA2 is shown. [Figure 5D] Figure 2 shows a time course analysis of neuroimmune cell infiltration into the core of the graft. H&E staining of IBA1 is shown. [Figure 5E] Figure 2 shows a time course analysis of neuroimmune cell infiltration into the core of the graft. H&E staining for Ly6G is shown. [Figure 6] 1 shows a time course analysis of fiber outgrowth patterns from the graft. [Figure 7A] Figure 1 shows that the TNFα-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts.PCA plots of bulk RNAseq datasets showing gene expression profiles from sorted dopamine neurons (day 0), in vitro cultured neurons 1 day after sorting (day 1 culture), and in vivo transplanted neurons on day 1 (day 1 transplant). [Figure 7B] Figure 2 shows that the TNFα-NFκB pathway is an upstream regulator that induces TP53-dependent DA neuron death in grafts. Figure 2 shows differentially expressed gene analysis between day 1 of culture and day 1 of transplantation. [Figure 7C] Figure 1 shows that the TNFα-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts.Figure 2 shows a signature analysis of upregulated categories in day 1 transplanted neurons versus day 1 cultured neurons. [Figure 7D] Figure 1 shows that the TNFα-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts. Figure 2 shows NES analysis of tumor necrosis factor-related genes enriched in day 1 grafts compared with day 1 cultured neurons. [Figure 7E-1] Figure 1 shows that the TNFα-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts.GSEA scores from enriched genes in day 1 transplanted neurons versus day 1 cultured neurons are shown. [Figure 7E-2] Same as above. [Figure 7F] Figure 1 shows that the TNFα-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts. Representative immunohistochemical images of phosphorylated NFkappaB in transplanted neurons at different time points after transplantation are shown. The percentage of phosphorylated NFkB positive cells from the whole graft was quantified. n=2 independent experiments. [Figure 7G] Figure 1 shows that the TNFα-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts. Representative immunofluorescence images of in vitro dopamine neurons as indicated by NURR1::GFP for induction of p53 and NFκB-p65 comparing mock vs. TNFα-treated groups vs. TNFα and monoclonal antibody to TNFα (referred to as adalimumab-treated condition). n=3 independent experiments. [Figure 7H] We show that the TNFα-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts. qRT-PCR of gene expression profiles of the three groups listed in Figure 7G for FOXA2, NURR1, P53, P21, and BBC3 (PUMA). [Figure 8A] Figure 1 shows that the TNF-NFκB pathway is an upstream regulator that induces TP53-dependent DA neuron death in grafts. Figure 2 shows the cellular dendrograms among in vitro cultured and in vivo transplanted DA neurons sorted from total RNA-seq. [Figure 8B-1] We show that the TNF-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts. Heatmap analysis of TNFα-NFκB-related genes sorted from total RNA-seq and enriched in grafted DA neurons compared to in vitro cultured DA neurons. [Figure 8B-2] Same as above. [Figure 8C]Figure 1 shows that the TNF-NFκB pathway is an upstream regulator that induces TP53-dependent DA neuron death in grafts.Clustering distribution of wild-type and p53 knockout (KO) transplanted DA neurons 1 day after transplantation from single-cell RNA-seq. [Figure 8D] Figure 1 shows that the TNF-NFκB pathway is an upstream regulator that induces TP53-dependent DA neuron death in grafts.Histograms of wild-type and p53 knockout (KO) clustering distribution are shown. [Figure 8E] Figure 1 shows that the TNF-NFκB pathway is an upstream regulator that induces TP53-dependent DA neuron death in grafts.Figure 2 shows the clustering distribution of neuronal MAP2 expression. [Figure 8F-1] We show that the TNF-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts. Violin plots of neuronal dopamine-specific marker and MAP2 expression are shown (left) and percent of indicated genes from the total single-cell RNA-seq population (right). [Figure 8F-2] Same as above. [Figure 9A] Figure 1 shows that the TNF-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts.Clustering analysis of PCA graphs showing annotated neuroblasts and floor plate progenitor cells. [Figure 9B-1] Figure 1 shows that the TNF-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts.Heatmaps from apoptotic cell death-related genes enriched in clusters 3, 4, and 7 are shown. [Figure 9B-2] Same as above. [Figure 9B-3] Same as above. [Figure 9B-4] Same as above. [Figure 9C] Figure 1 shows that the TNF-NFκB pathway is an upstream regulator that induces TP53-dependent DA neuron death in grafts. Figure 2 shows TNFRSF12A-positive cells in PCA. [Figure 9D]Figure 1 shows that the TNF-NFκB pathway is an upstream regulator that induces TP53-dependent DA neuron death in grafts.Violin plots of TNFRSF12A-positive cells within a cluster are shown. [Figure 9E-1] Figure 1 shows that the TNF-NFκB pathway is an upstream regulator inducing TP53-dependent DA neuron death in grafts.Violin plots of increased genes, such as BAX, BAD, TNFRSF1A, TNFRSF12A, and TNFRSF10B, in p53 WT vs. p53 KO DA neurons within each cluster are shown. [Figure 9E-2] Same as above. [Figure 10A-1] We show that a clinically relevant TNFα neutralizing antibody and CD marker sorting strategy functionally improves survival of postmitotic dopamine neurons during transplantation. We show a schematic of a flow-based cell surface marker screen to enrich for postmitotic DA neurons using the genetic NURR1::GFP marker. [Figure 10A-2] Same as above. [Figure 10B-1] Figure 1 shows that a clinically relevant TNFα neutralizing antibody and CD marker sorting strategy functionally improves survival of postmitotic dopamine neurons during transplantation.FACS plots of the % of NURR1::GFP population corresponding to each sorting strategy (CD49e depletion, CD49e depletion and CD171 enriched dual, CD49e depletion and CD184 enriched dual) are shown, demonstrating that CD49e depletion and CD184 enriched dual CD marker sorting yields the most enriched population of DA neurons expressing NURR1::GFP. [Figure 10B-2] Same as above. [Figure 10C] Figure 10B shows that clinically relevant TNFα neutralizing antibodies and CD marker sorting strategies functionally improve survival of postmitotic dopamine neurons during transplantation. Figure 10B shows gene expression of NURR1 via qRT-PCR assay 2 days after sorting using each sorting strategy from Figure 10B. [Figure 10D]We show that a clinically relevant TNFα neutralizing antibody and CD marker sorting strategy functionally improves survival of postmitotic dopamine neurons during transplantation. Representative immunofluorescence images of CD49e- / CD184+ double sorted dopamine neurons at 40 DIV are shown, giving rise to pure dopamine neuron cultures co-expressing NURR1::GFP, FOXA2, and TH. [Figure 10E] We show that a clinically relevant TNFα neutralizing antibody and CD marker sorting strategy functionally improves survival of postmitotic dopamine neurons during transplantation. We show short-term in vivo histological analysis of CD49e- / CD184+ double sorted grafts over a one-month period compared to unsorted grafts. Dual CD marker sorted neuronal grafts show much denser surviving dopamine neurons than unsorted grafts, as shown by human NA and TH immunofluorescence staining. [Figure 10F] We show that a clinically relevant TNFα neutralizing antibody and CD marker sorting strategy functionally improves survival of postmitotic dopamine neurons during transplantation. Representative immunofluorescence images of CD49e- / CD184+ double sorted dopamine neurons treated with either PBS or the TNFα blocking antibody adalimumab are shown. Quantification of stereological number and volume of surviving dopamine neurons using NURR1::GFP, n=3. [Figure 10G] 10A-10C show that a clinically relevant TNFα neutralizing antibody and CD marker selection strategy functionally improves survival of postmitotic dopamine neurons during transplantation. [Figure 10H] We show that a clinically relevant TNFα neutralizing antibody and CD marker sorting strategy functionally improves survival of postmitotic dopamine neurons during transplantation. We show D-amphetamine-induced rotation assays in a 6-OHDA-based PD mouse model after transplantation of PBS, CD sorted cells, co-injection of CD sorted cells with adalimumab, frozen day 16 DA progenitor cells, and co-injection of frozen day 16 DA progenitor cells with adalimumab. [Figure 11A-1]Figure 1 shows that high content cell surface marker screening identifies a novel double sorting strategy matching NURR1-GFP+ dopamine neurons. Figure 2 shows FACS analysis of NURR1:GFP neurons with the indicated CD markers. [Figure 11A-2] Same as above. [Figure 11B] Figure 1 shows that high content cell surface marker screening identifies a novel double sorting strategy that matches NURR1-GFP+ dopamine neurons. Immunofluorescence analysis of CD49e- / CD184+ double sorted dopamine neurons and unsorted neurons using FOXA2 and a proliferation marker (Ki67). [Figure 11C] Figure 1 shows that high content cell surface marker screening identifies a novel double sorting strategy to match NURR1-GFP+ dopamine neurons. Figure 2 shows the analysis of surviving DA neurons and their volume from CD49e- / CD184+ double sorted dopamine neurons in p53 WT and KO. [Figure 11D] Figure 1 shows that high content cell surface marker screening identifies a novel double sorting strategy consistent with NURR1-GFP+ dopamine neurons. Figure 2 shows H&E analysis of grafts 1 day after transplantation treated with either PBS or the TNFα blocking antibody adalimumab. [Figure 12A] 1 shows an in vivo CRISPR / Cas9 screen to identify TP53 as a limiting factor for in vivo survival of hPSC-derived postmitotic dopamine neurons. 2 shows a schematic diagram of the pooled CRISPR / Cas9 screen. [Figure 12B] Figure 1 shows an in vivo CRISPR / Cas9 screen to identify TP53 as a limiting factor for in vivo survival of hPSC-derived postmitotic dopamine neurons. Pearson correlation abundance matrix of all guide RNAs across different experimental conditions is shown [day 16 in vitro (D16) vs. day 25 in vitro (without dox) (-D25) vs. day 25 in vitro (with dox) (+D25) vs. day 25 in vivo (with dox) (D25)]. Scale bars range from 0.9 to 1 (with 1 being the most correlated value). [Figure 12C] Figure 1 shows an in vivo CRISPR / Cas9 screen to identify TP53 as a limiting factor for in vivo survival of hPSC-derived postmitotic dopamine neurons. Volcano plots comparing each experimental condition are shown. Depleted sgRNAs are labeled in blue and enriched sgRNAs are labeled in red. [Figure 12D] Figure 1 shows an in vivo CRISPR / Cas9 screen to identify TP53 as a limiting factor for in vivo survival of hPSC-derived postmitotic dopamine neurons. Enriched sgRNAs in in vivo transplanted cells vs. day 25 in vitro cells, both treated with dox. Blue bars indicate two sgRNAs and red bars indicate three sgRNAs targeting the indicated genes enriched in transplanted cells over in vitro cells. [Figure 12E] Figure 1 shows an in vivo CRISPR / Cas9 screen to identify TP53 as a limiting factor for in vivo survival of hPSC-derived postmitotic dopamine neurons. Figure 2 shows a Pearson correlation matrix plot of the pooled validation screen (library #2). Scale bars range from 0.8 to 1. [Figure 12F-1] Figure 1 shows an in vivo CRISPR / Cas9 screen to identify TP53 as a limiting factor for in vivo survival of hPSC-derived postmitotic dopamine neurons. Heatmaps of all guide RNAs from pooled library #2 screen comparing day 16 (D16) vs day 25 neurons (without dox treatment) (-D25) vs day 25 in culture (with dox treatment) (+D25) (left). Heatmaps of the same set of sgRNAs comparing +D25 in vivo vs +D25 in culture from two independent replicate screens (right). Red vs blue scale indicates enrichment of each sgRNA in surviving DA neurons of in vivo transplants (+D25 in vivo) vs day 25 cultured cells (with dox) (+D25 in vitro). [Figure 12F-2] Same as above. [Figure 13A]Characterization of p53-induced dopamine neuron death during transplantation. FACS strategy for injecting enriched postmitotic dopamine neurons expressing NURR1::GFP and sgRNA-TP53-tdTomato. Each dot in the scatter plot represents a single dopamine neuron at 25 DIV. Dox-treated (+DOX, TP53 knockout; KO) or untreated (-DOX, isogenic TP53 wild type; WT) dopamine neurons from days 16 to 25 are isolated by FACS on day 25 based on the NURR1::GFP signal (upper panel: P5) followed by the sgRNA::tdTomato signal (lower panel: P6). GFP+ / tdTomato+ dopamine neurons (P6 population: -DOX vs. +DOX) are injected bilaterally into the striatum of adult NSG mice. [Figure 13B] Characterization of p53-induced dopamine neuron death during transplantation. Representative confocal images (scale bar = 100 μm) of dopamine neuron grafts stained with an antibody against GFP (equivalent to NURR1) one month after transplantation (FIG. 13B) and stereological analysis (n = 5) of the number (using an optical fractionator, left) and volume (cavalier estimator, right) of surviving dopamine neurons one month after transplantation (FIG. 13C) are shown. [Figure 13C] Characterization of p53-induced dopamine neuron death during transplantation. Representative confocal images (scale bar = 100 μm) of dopamine neuron grafts stained with an antibody against GFP (equivalent to NURR1) one month after transplantation (FIG. 13B) and stereological analysis (n = 5) of the number (using an optical fractionator, left) and volume (cavalier estimator, right) of surviving dopamine neurons one month after transplantation (FIG. 13C) are shown. [Figure 13D] Characterization of p53-induced dopamine neuron death during transplantation. Representative confocal images of ALDH1A1 (A9-type dopamine neuron marker) and CALB1 (A10-type dopamine neuron marker) are shown. Scale bar = 100 μm. [Figure 13E]Characterization of p53-induced dopamine neuron death during transplantation. Quantification of the percentage of A9 (ALDH1A1, FIG. 13E) and A10 (CALB1, FIG. 13F) dopamine neurons per NURR1-expressing DA neuron one month after transplantation. *p<0.05 (paired t-test). ns.=not significant. [Figure 13F] Characterization of p53-induced dopamine neuron death during transplantation. Representative confocal images of ALDH1A1 (A9-type dopamine neuron marker) and CALB1 (A10-type dopamine neuron marker) are shown. Scale bar = 100 μm. [Figure 13G] Characterization of p53-induced dopamine neuron death during transplantation. Quantification of the percentage of A9 (ALDH1A1, FIG. 13E) and A10 (CALB1, FIG. 13F) dopamine neurons per NURR1-expressing DA neuron one month after transplantation. *p<0.05 (paired t-test). ns.=not significant. [Figure 14A-C][Figure 14A] Time course dynamics of p53-mediated dopamine neuron death-related pathways after transplantation. Representative immunohistochemical images (Figures 14A-14C) and percentage quantification (Figures 14D-14F) of transplanted dopamine neurons at different time points (4 hpt, 24 hpt, 72 hpt, 7 dpt) for TP53, cleaved caspase 3 (CC3), and TUNEL as apoptosis markers in dopamine neuron grafts upon transplantation are shown. All markers show robust induction at 24 hours. Scale bar = 50 μm. n = 4 independent experiments. [Figure 14B] Time course dynamics of p53-mediated dopamine neuron death-related pathways after transplantation. Representative immunohistochemical images (Figures 14A-14C) and percentage quantification (Figures 14D-14F) of transplanted dopamine neurons at different time points (4 hpt, 24 hpt, 72 hpt, 7 dpt) for TP53, cleaved caspase 3 (CC3), and TUNEL as apoptotic markers in dopamine neuron grafts upon transplantation. All markers show robust induction at 24 hours. Scale bar = 50 μm. n = 4 independent experiments. [Figure 14C] Time course kinetics of p53-mediated dopamine neuron death-related pathways after transplantation. Representative immunohistochemical images (FIGS. 14A-14C) and percentage quantification (FIGS. 14D-14F) of transplanted dopamine neurons at different time points (4 hpt, 24 hpt, 72 hpt, 7 dpt) for TP53, cleaved caspase 3 (CC3), and TUNEL as apoptotic markers in dopamine neuron grafts upon transplantation. All markers show robust induction at 24 hours. Scale bar=50 μm. n=4 independent experiments. [Figure 14D]Figure 14 shows the time course dynamics of p53-mediated dopamine neuron death-related pathways after transplantation. Representative immunohistochemical images (Figures 14A-14C) and percentage quantification (Figures 14D-14F) of transplanted dopamine neurons at different time points (4 hpt, 24 hpt, 72 hpt, 7 dpt) for TP53, cleaved caspase 3 (CC3), and TUNEL as apoptotic markers in dopamine neuron grafts upon transplantation. All markers show robust induction at 24 hours. Scale bar = 50 μm. n = 4 independent experiments. [Figure 14E] Figure 14 shows the time course dynamics of p53-mediated dopamine neuron death-related pathways after transplantation. Representative immunohistochemical images (Figures 14A-14C) and percentage quantification (Figures 14D-14F) of transplanted dopamine neurons at different time points (4 hpt, 24 hpt, 72 hpt, 7 dpt) for TP53, cleaved caspase 3 (CC3), and TUNEL as apoptotic markers in dopamine neuron grafts upon transplantation. All markers show robust induction at 24 hours. Scale bar = 50 μm. n = 4 independent experiments. [Figure 14F] Figure 14 shows the time course dynamics of p53-mediated dopamine neuron death-related pathways after transplantation. Representative immunohistochemical images (Figures 14A-14C) and percentage quantification (Figures 14D-14F) of transplanted dopamine neurons at different time points (4 hpt, 24 hpt, 72 hpt, 7 dpt) for TP53, cleaved caspase 3 (CC3), and TUNEL as apoptotic markers in dopamine neuron grafts upon transplantation. All markers show robust induction at 24 hours. Scale bar = 50 μm. n = 4 independent experiments. [Figure 15A] Figure 1 shows that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts.PCA plots of bulk RNAseq data of sorted dopamine neurons either immediately after FACS (day 0, D0), in vitro culture for 1 day after sorting (day 1 culture, D1 culture), or in vivo transplantation for 1 day (day 1 transplantation, D1 transplantation). [Figure 15B]Figure 2 shows that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts.Analysis of differentially expressed genes (DEGs) between D1 culture versus D1 transplantation. [Figure 15C] Figure 1 shows that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts. Figure 2 shows signature pathway analysis of upregulated genes for functional categories in D1 transplanted versus D1 cultured neurons. [Figure 15D] Figure 1 shows that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts. Normalized enrichment score (NES) analysis of enriched TNF-related genes in D1 grafts versus D1 cultured neurons. [Figure 15E-1] We show that the TNFa-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts. We show that unbiased gene set enrichment analysis (GSEA) identifies apoptosis, TP53, and TNFa as the most frequently enriched GO terms in D1 grafts versus D1 cultured neurons. [Figure 15E-2] Same as above. [Figure 15F] Figure 1 shows that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts. The left panel shows representative immunohistochemical images of phosphorylated NFκB (p-NFκB) in grafted neurons at different time points after transplantation. Scale bar = 50 μm. The right panel shows quantification of the percentage of p-NFκB positive cells among all cells within the graft. n = 3 independent experiments. [Figure 15G] Figure 1 shows that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts.Representative immunofluorescence images of NURR1::GFP sorted DA neurons in vitro for induction of p53 and NFkB-p65 comparing mock vs. TNFα vs. TNFα and monoclonal antibody against TNFα (adalimumab) for 1 day treatment conditions. [Figure 15H]We show that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts. Western blot and qRT-PCR of gene expression profiles of the three groups listed in Figure 15G for TH and TP53 (Figure 15H), and midbrain mDA markers FOXA2 and NURR1, TP53, and PUMA (downstream target of TP53) (Figure 15I). N>3 independent experiments. [Figure 15I] We show that the TNFα-NFκB pathway is an upstream inducer of p53-dependent dopamine neuron death in grafts. Western blot and qRT-PCR of gene expression profiles of the three groups listed in Figure 15G for TH and TP53 (Figure 15H), and midbrain mDA markers FOXA2 and NURR1, TP53, and PUMA (downstream target of TP53) (Figure 15I). N>3 independent experiments. [Figure 16A] Figure 16 shows that single-cell RNA sequencing of transplanted neurons identifies JUN-associated survival signatures and cell death-associated dedifferentiation after transplantation. UMAP plots of scRNA TP53 WT and KO transplanted cells 1 day after transplantation, colored by cell clusters (Figure 16A), TP53 WT and KO genotypes (Figure 16B), and annotated cell types, including neuroblasts (hNbM), floor plate progenitors (hProgFPL), and very few pericytes (hPeric) (Figure 16C). [Figure 16B] Figure 16 shows that single-cell RNA sequencing of transplanted neurons identifies JUN-associated survival signatures and cell death-associated dedifferentiation after transplantation. UMAP plots of scRNA TP53 WT and KO transplanted cells 1 day after transplantation, colored by cell clusters (Figure 16A), TP53 WT and KO genotypes (Figure 16B), and annotated cell types, including neuroblasts (hNbM), floor plate progenitors (hProgFPL), and very few pericytes (hPeric) (Figure 16C). [Figure 16C]Figure 16 shows that single-cell RNA sequencing of transplanted neurons identifies JUN-associated survival signatures and cell death-associated dedifferentiation after transplantation. UMAP plots of scRNA TP53 WT and KO transplanted cells 1 day after transplantation, colored by cell clusters (Figure 16A), TP53 WT and KO genotypes (Figure 16B), and annotated cell types, including neuroblasts (hNbM), floor plate progenitors (hProgFPL), and very few pericytes (hPeric) (Figure 16C). [Figure 16D-1] Figure 1 shows that single-cell RNA sequencing of transplanted neurons identifies a JUN-associated survival signature and cell death-associated dedifferentiation after transplantation. Heatmap of the top enriched gene sets in each cluster of TP53 WT vs. TP53 KO cells 1 day after transplantation. Cell death-associated genes are highly increased in clusters 3, 5, and 6, and survival-associated genes in clusters 2, 4. Red indicates survival-associated genes. [Figure 16D-2] Same as above. [Figure 16E] Figure 1 shows that single-cell RNA sequencing of transplanted neurons identifies JUN-associated survival signatures and cell death-associated dedifferentiation after transplantation. Volcano plot of differentially expressed genes, such as BAX, CDK1NA, CDKN2B, BBC3 (PUMA), and PHPT1 (red), in TP53 WT versus TP53 KO transplanted dopamine neurons from clusters 3, 5, and 6. [Figure 16F] Figure 1 shows that single-cell RNA sequencing of transplanted neurons identifies a JUN-associated survival signature and cell death-associated dedifferentiation after transplantation. Violin plots of BAX, TNFRSF12A, and JUN positive cells across clusters are shown. Cluster 7 is excluded due to very few cells. [Figure 16G] We show that single-cell RNA sequencing of transplanted neurons identifies a JUN-associated survival signature and cell death-associated dedifferentiation after transplantation. HES5-positive cells specific to dedifferentiated cells in clusters 3, 5, and 6 mark in UMAPs from 1 day after transplantation (Figure 16G), but are not expressed in sorted cells before transplantation (Figure 16H). [Figure 16H] We show that single-cell RNA sequencing of transplanted neurons identifies a JUN-associated survival signature and cell death-associated dedifferentiation after transplantation. HES5-positive cells specific to dedifferentiated cells in clusters 3, 5, and 6 mark in UMAPs from 1 day after transplantation (Figure 16G), but are not expressed in sorted cells before transplantation (Figure 16H). [Figure 17A-1] Figure 1 shows a high-throughput flow-based cell surface marker screen to identify novel CD markers to purify NURR1-stage postmitotic dopamine neurons for translational use. Schematic diagram of flow-based CD marker screen to enrich for postmitotic dopamine neurons matched by genetic NURR1::GFP reporter expression. [Figure 17A-2] Same as above. [Figure 17A-3] Same as above. [Figure 17B] We show a high-throughput-based cell surface marker screen to identify novel CD markers to purify NURR1 stage postmitotic dopamine neurons for translational use. FACS plots of %NURR1::GFP populations corresponding to each sorting strategy (control, CD49e-low, CD49-low / CD171-high, CD49e-low / CD184-high) are shown, demonstrating that CD49e-low / CD184-high dual CD marker sorting yields the most enriched dopamine neuron population expressing NURR1::GFP. [Figure 17C] Figure 17B shows a high-throughput-based cell surface marker screen to identify novel CD markers to purify NURR1 stage postmitotic dopamine neurons for translational use. Figure 17C shows gene expression of NURR1 by qRT-PCR assay 2 days after sorting using each sorting strategy from Figure 17B. [Figure 17D]Figure 1 shows a high-through-flow based cell surface marker screen to identify novel CD markers to purify NURR1 stage postmitotic dopamine neurons for translational use. Representative immunofluorescence images of CD49e-low / CD184-high double sorted dopamine neurons at day 40 giving rise to pure dopamine neuron cultures co-expressing NURR1::GFP, FOXA2, and TH. Scale bar = 100 μm. [Figure 17E] Figure 1 shows a high-through-flow based cell surface marker screen to identify novel CD markers to purify NURR1 stage postmitotic dopamine neurons for translational use. Figure 2 shows short-term in vivo histological analysis one month after transplantation of double CD49e-low / CD184-high sorted grafts compared to unsorted cells. Double CD49e-low / CD184-high sorted neuronal grafts are composed of densely packed dopamine neurons in contrast to unsorted grafts which result in a lower percentage of dopamine neurons as detected by human nuclear antigen (hNA) and TH immunofluorescence staining. [Figure 18A] Figure 1 shows that a clinically relevant TNFα neutralizing antibody functionally improves survival of postmitotic dopamine neurons during transplantation. Representative immunofluorescence images of CD49e-low / CD184-high double sorted dopamine neurons co-injected with either PBS or the TNFα blocking antibody adalimumab are shown. Scale bar = 100 μm. [Figure 18B] Figure 1 shows that a clinically relevant TNFα neutralizing antibody functionally improves survival of postmitotic dopamine neurons during transplantation. Quantification of stereological cell number and volume of surviving dopamine neurons one month after transplantation using NURR1::GFP. n=5. **p<0.01, *p<0.05 (paired t-test). [Figure 18C]We show that a clinically relevant TNFα neutralizing antibody functionally improves survival of postmitotic dopamine neurons during transplantation. We show a D-amphetamine-induced rotation assay in a transplanted PD mouse model with unilateral 6-OHDA lesions. The three treatment groups are PBS-injected (sham), CD sorted neurons, and CD sorted neurons co-injected with adalimumab. [Figure 18D] Figure 1 shows that a clinically relevant TNFα neutralizing antibody functionally improves survival of postmitotic dopamine neurons during transplantation. Representative immunofluorescence images of human grafts highly enriched in floor plate-derived dopamine neurons as indicated by hNA, FOXA2, and TH for each group are shown. Scale bar = 50 μm. [Figure 18E] Figure 1 shows that a clinically relevant TNFα neutralizing antibody functionally improves survival of postmitotic dopamine neurons during transplantation. Stereological analysis of the number (using an optical fractionator) and volume (cavalier estimator) of surviving dopamine neurons based on TH expression 6 months after transplantation is shown. *p<0.05 (paired t-test). [Figure 18F] Figure 18 shows that a clinically relevant TNFα neutralizing antibody functionally improves survival of postmitotic dopamine neurons during transplantation. Representative immunofluorescence images and quantification of ALDH1A1 demarking the A9 subtype (Figure 18F) and CALB1 demarking the A10 subtype (Figure 18G) dopamine neuron populations (TH+) in 6-month-old grafts. [Figure 18G] Figure 18 shows that a clinically relevant TNFα neutralizing antibody functionally improves survival of postmitotic dopamine neurons during transplantation. Representative immunofluorescence images and quantification of ALDH1A1 demarking the A9 subtype (Figure 18F) and CALB1 demarking the A10 subtype (Figure 18G) dopamine neuron populations (TH+) in 6-month-old grafts. [Figure 19A]Derivation and validation of NURR1:GFP sorted dopamine neurons for in vitro and in vivo CRISPR / Cas9 screening. Immunofluorescence staining of dopamine neuron markers NURR1:GFP, FOXA2, and TH in NURR1:GFP sorted cells 2 weeks (day 40) after sorting. Scale bar = 100 μm. [Figure 19B] Derivation and validation of NURR1:GFP-sorted dopamine neurons for CRISPR / Cas9 screening in vitro and in vivo. Immunofluorescence staining of dopamine neuron markers TH and NURR1::GFP in grafts one month after transplantation of NURR1:GFP-sorted DA neurons on day 25. Scale bar = 100 μm. [Figure 19C] Figure 1 shows the derivation and validation of NURR1:GFP sorted dopamine neurons for in vitro and in vivo CRISPR / Cas9 screening. Figure 2 shows transduction efficiency and isolated transduced hPSCs containing pooled lentiviral sgRNA expressing Tomato at an MOI=0.35 (which represents integration of a single copy sgRNA per cell). [Figure 19D] Derivation and validation of NURR1:GFP sorted dopamine neurons for CRISPR / Cas9 screening in vitro and in vivo. Immunofluorescence staining of TH, NURR1::GFP, and gRNA::tdTomato in dopamine neurons at day 40 after sorting with GFP and Tomato at day 25 with or without dox treatment from day 16 to day 25. Scale bar = 50 μm. [Figure 19E] Derivation and validation of NURR1:GFP sorted dopamine neurons for in vitro and in vivo CRISPR / Cas9 screening. Loss of tdTomato signal in hPSC-derived postmitotic dopamine neurons at day 25 after dox exposure (dox 1ug / ml) from day 16 to day 25. Scale bar = 200μm. [Figure 19F]Derivation and validation of NURR1:GFP-sorted dopamine neurons for CRISPR / Cas9 screening in vitro and in vivo. Graft fluorescence expression one month after transplantation (top). PCR analysis to detect human PTGER2 gene from genomic DNA isolated from dissected tissues around the graft area (bottom). Scale bar = 500 μm. [Figure 19G] Derivation and validation of NURR1:GFP-sorted dopamine neurons for CRISPR / Cas9 screening in vitro and in vivo. Global representation of sgRNAs across all conditions by next generation sequencing (NGS) from genomic DNA of in vitro cultured cells (days 16 and 25) and in vivo transplanted cells from library (Figure 19G) and the more restricted library #2 (Figure 19H). [Figure 19H] Derivation and validation of NURR1:GFP-sorted dopamine neurons for CRISPR / Cas9 screening in vitro and in vivo. Global representation of sgRNAs across all conditions by next generation sequencing (NGS) from genomic DNA of in vitro cultured cells (days 16 and 25) and in vivo transplanted cells from library (Figure 19G) and the more restricted library #2 (Figure 19H). [Figure 20A] Figure 1 shows increased survival of TP53 KO dopamine neurons in grafts indicating dopamine neuron identity, and needle injection of dopamine neurons does not induce TP53 and TP53 downstream genes. Immunofluorescence staining of NURR1:GFP, sgTP53RNA-Tomato, and FOXA2 and TH of dopamine neurons at day 40 after sorting by GFP and Tomato at day 25 with or without dox exposure from day 16 to day 25. Scale bar = 100 μm. [Figure 20B]We show increased survival of TP53 KO dopamine neurons in grafts, indicating dopamine neuron identity, and needle injection of dopamine neurons does not induce TP53 and TP53 downstream genes. Representative immunofluorescence images of expression of dopamine markers such as FOXA2, TH, and NURR1-GFP (Figures 20B-20D), as well as the proliferation marker hKi67 (Figure 20E), in surviving p53 WT and KO dopamine neurons in grafts (WT; -DOX, KO; +DOX). [Figure 20C] We show increased survival of TP53 KO dopamine neurons in grafts, indicating dopamine neuron identity, and needle injection of dopamine neurons does not induce TP53 and TP53 downstream genes. Representative immunofluorescence images of expression of dopamine markers such as FOXA2, TH, and NURR1-GFP (Figures 20B-20D), as well as the proliferation marker hKi67 (Figure 20E), in surviving p53 WT and KO dopamine neurons in grafts (WT; -DOX, KO; +DOX). [Figure 20D] We show increased survival of TP53 KO dopamine neurons in grafts, indicating dopamine neuron identity, and needle injection of dopamine neurons does not induce TP53 and TP53 downstream genes. Representative immunofluorescence images of expression of dopamine markers such as FOXA2, TH, and NURR1-GFP (Figures 20B-20D), as well as the proliferation marker hKi67 (Figure 20E), in surviving p53 WT and KO dopamine neurons in grafts (WT; -DOX, KO; +DOX). [Figure 20E] We show increased survival of TP53 KO dopamine neurons in grafts, indicating dopamine neuron identity, and needle injection of dopamine neurons does not induce TP53 and TP53 downstream genes. Representative immunofluorescence images of expression of dopamine markers such as FOXA2, TH, and NURR1-GFP (Figures 20B-20D), as well as the proliferation marker hKi67 (Figure 20E), in surviving p53 WT and KO dopamine neurons in grafts (WT; -DOX, KO; +DOX). [Figure 20F]Figure 1 shows increased survival of TP53 KO dopamine neurons in grafts indicating dopamine neuron identity, and needle injection of dopamine neurons does not induce TP53 and TP53 downstream genes. Figure 2 shows qRT-qPCR analysis of TP53 and TP53 downstream genes (p21 and PUMA) before and 1 hour after needle injection of NURR1:GFP sorted dopamine neurons. [Figure 21A] Time course analysis of post-transplant host neuroimmune cells near the transplant site. Immunofluorescence analysis of IBA1 (top) and GFAP (bottom) is shown after transplantation (4 h, 24 h, 72 h, 7 days). Scale bar = 50 μm. [Figure 21B] Time course analysis of host neuroimmune cells after transplantation near the transplant site. H&E staining of the transplant is shown. Scale bar = 100 μm. [Figure 21C] Time course analysis of post-transplant host neuroimmune cells near the transplant site. Immunofluorescence and immunohistochemistry for Ly6G to investigate neutrophils at the transplant site. Left panel examined at 12 hpt. Yellow arrows indicate Ly6G positive cells near transplanted cells are FOXA2 positive. Right panel examined at 3 dpt. Ly6G positive cells, as indicated by dark brown staining, infiltrate within the graft. Scale bar = 50 μm. [Figure 21D] Figure 1 shows a time course analysis of host neuroimmune cells post-transplant near the transplant site. Immunofluorescence analysis of fiber outgrowth patterns from the grafts post-transplant using STEM121. Fiber outgrowth begins at 24 hpt. Scale bar = 50 μm. [Figure 22A] Analysis of bulk RNA-seq from sorted cells vs. cultured cells 1 day after sorting vs. transplanted cells 1 day after sorting, and characterization of cultured cells 1 day after sorting. Cellular dendrograms between sorted dopamine neurons (day 0), in vitro cultured dopamine neurons (cultured 1 day), and in vivo transplanted dopamine neurons (transplanted 1 day) from bulk RNA-seq are shown, showing concordance between replicate samples and a distinct signature of the day 1 transplanted sample. [Figure 22B]Analysis of bulk RNA-seq from sorted cells vs. 1-day post-sort cultured cells vs. 1-day post-sort transplanted cells, and characterization of 1-day post-sort cultured cells. Pathway enrichment identifies mTORC1 signaling as an upregulated category in day 1 culture samples. [Figure 22C-1] Analysis of bulk RNA-seq from sorted cells vs. 1-day-old cultured cells vs. 1-day-old transplanted cells, and characterization of 1-day-old cultured cells. Heatmap analysis from total RNA-seq of enriched TNFα-NFκB related genes in transplanted dopamine neurons vs. sorted and cultured dopamine neurons. [Figure 22C-2] Same as above. [Figure 22D] Analysis of bulk RNA-seq from sorted cells vs. 1-day-old cultured cells vs. 1-day-old transplanted cells and characterization of 1-day-old cultured cells. Immunofluorescence staining of NURR1::GFP, TP53, and NFkB-p65 in dopamine neurons at day 26 in 1-day-old cultures sorted by GFP, showing no nuclear induction of NFkB. Scale bar = 100 μm. [Figure 22E] Analysis of bulk RNA-seq from sorted cells vs. 1 day post-sort cultured cells vs. 1 day post-sorted transplanted cells, and characterization of 1 day post-sorted cultured cells. Immunofluorescence staining of TNFα ligand in 1 day transplanted neurons confirming protein expression of TNFα ligand. [Figure 23A] ScRNA-seq analysis from p53 WT and KO dopamine neuron grafts at 1 day after transplantation. Clustering distribution of p53 WT and p53 KO in transplanted dopamine neurons at 1 day after transplantation from scRNA-seq. [Figure 23B] ScRNA-seq analysis from p53 WT and KO dopamine neuron grafts 1 day after transplantation. Histograms of the percentage of cells expressing MAP2, Ki67, and TH positive cells in p53 WT and KO are shown. [Figure 23C]Figure 1 shows scRNA-seq analysis from p53 WT and KO dopamine neuron grafts 1 day after transplantation. Figure 2 shows UMAP plots of MAP2, PBX1, and MKI67 in p53 WT and p53 KO neurons from scRNA-seq. [Figure 23D] Figure 1 shows scRNA-seq analysis from p53 WT and KO dopamine neuron grafts 1 day after transplantation. Volcano plot of differentially expressed genes in p53 KO vs. p53 WT from scRNA-seq. [Figure 24A-1] Characterization of cells sorted with cell surface (CD) markers consistent with NURR1::GFP in vitro and in vivo. FACS analysis of NURR1::GFP neuronal populations with the indicated CD markers is shown. Three CD markers (49e, 99, and 340) are negatively enriched, while two CD markers (171 and 184) are positively enriched in the NURR1::GFP population. [Figure 24A-2] Same as above. [Figure 24B] Characterization of cells sorted with cell surface (CD) markers consistent with NURR1::GFP in vitro and in vivo. Immunofluorescence analysis of transplanted cells from CD49-low / CD184-high double sorted and unsorted cells with FOXA2 and human proliferation marker (hKi67) one month after transplantation (left) and quantification of Ki67 positive cells within the grafts (right). [Figure 25A] Figure 25 shows the innervation of grafts from CD marker-sorted dopamine neurons co-injected with either PBS or the TNFα inhibitor adalimumab at 6 months. Representative images are shown of extensive innervation of CD marker-sorted dopamine neuron grafts co-injected with PBS or adalimumab towards the host striatum as shown by TH (Figure 25A) and hNCAM immunofluorescence staining (Figure 25B). Scale bar = 500 μm. [Figure 25B]Figure 25 shows the innervation of grafts from CD marker-sorted dopamine neurons co-injected with either PBS or the TNFα inhibitor adalimumab at 6 months. Representative images are shown of extensive innervation of CD marker-sorted dopamine neuron grafts co-injected with PBS or adalimumab towards the host striatum as shown by TH (Figure 25A) and hNCAM immunofluorescence staining (Figure 25B). Scale bar = 500 μm. [Figure 25C] Figure 1 shows the innervation of grafts from CD marker-sorted dopamine neurons co-injected with either PBS or the TNFα inhibitor adalimumab at 6 months. Immunofluorescence assay to examine the spread of adalimumab in the brain. Anti-human IgG1 Alexa fluorophore 555 was probed to detect the presence of adalimumab, comparing adalimumab co-injected versus PBS-injected neurons at 24 hpt. The red signal indicates specific detection of human monoclonal antibodies present only in adalimumab. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0043] The present disclosure provides methods and compositions for improving in vivo survival of midbrain dopamine (mDA) neurons (e.g., in vitro differentiated mDA neurons) by suppressing p53-mediated apoptosis of mDA neurons. The present disclosure further provides methods and compositions for treating a subject (e.g., a subject suffering from a neurodegenerative disease and / or neurodegeneration of midbrain dopamine neurons), comprising administering one or more mDAs to the subject, whereby p53-mediated apoptosis of one or more mDA neurons is suppressed. In certain embodiments, the suppression of p53-mediated apoptosis comprises inhibiting TNFα signaling, inhibiting NFκB signaling, inhibiting p53 signaling, or a combination of the foregoing. In certain embodiments, the suppression of p53-mediated apoptosis comprises administering a TNFα inhibitor (e.g., an antagonistic anti-TNFα antibody) to the subject. In certain embodiments, the suppression of p53-mediated apoptosis comprises contacting one or more mDA neurons with a TNFα inhibitor (e.g., an antagonistic anti-TNFα antibody).

[0044] The present disclosure is based at least on the discovery that expression of p53 limits the survival of postmitotic dopamine neurons in vivo after transplantation.Furthermore, transcriptome analysis reveals that TNFα-mediated activation of NFκB is the main upstream regulator of p53-mediated dopamine neuron death.The inventors have found that knocking out the TP53 gene in midbrain dopamine neurons significantly improves the survival of postmitotic midbrain dopamine neurons in vivo.The inventors have also found that the survival of postmitotic midbrain dopamine neurons in vivo after transplantation can be significantly improved by TNFα antagonists (e.g., adalimumab).

[0045] Non-limiting embodiments of the present disclosure are illustrated in the specification and examples.

[0046] For clarity of disclosure, and not by way of limitation, the detailed description is divided into the following sections. 5.1. Definition, 5.2. Methods for improving in vivo survival of dopamine neurons 5.3. Compositions, and 5.4. Treatment methods.

[0047] 5.1.Definition The terms used herein generally have their ordinary meanings in the art, within the context of this disclosure and in the specific context in which each term is used. Particular terms are discussed below or elsewhere in the specification to provide additional guidance to the practitioner in describing the compositions and methods of the present disclosure and how to make and use them.

[0048] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., on the limitations of the measurement system. For example, "about" can mean within 3 or more than 3 standard deviations, as is customary in the art. Alternatively, "about" can mean within 20%, e.g., within 10%, up to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, e.g., within 5-fold or within 2-fold, of a value.

[0049] As used herein, the term "signal transduction" with respect to "signal transduction proteins" refers to membrane receptor proteins or proteins that are activated or otherwise affected by ligand binding to some other stimulus. Examples of signal transduction proteins include, but are not limited to, tumor necrosis factor alpha (TNFα), nuclear factor kappa B (NFκB), p53. For many cell surface receptors or internal receptor proteins, the ligand-receptor interaction is not directly related to the cell's response. A ligand-activated receptor may first interact with other proteins within the cell before the ultimate physiological effect of the ligand on the cell's behavior occurs. In many cases, the behavior of a chain of several interacting cellular proteins changes following receptor activation or inhibition. The entire series of cellular changes induced by receptor activation is called a signal transduction mechanism or signal transduction pathway.

[0050] As used herein, the term "signals" refers to internal and external factors that control changes in cell structure and function. They can be chemical or physical in nature.

[0051] As used herein, the term "ligand" refers to molecules and proteins that bind to receptors.

[0052] As used herein, an "inhibitor" refers to a compound or molecule (e.g., a small molecule, an antibody, a peptide, a peptidomimetic, a natural compound, an siRNA, an antisense nucleic acid, or an aptamer) that interferes with (e.g., antagonizes, reduces, decreases, suppresses, eliminates, or blocks) the function of a target molecule or pathway. An inhibitor can be any compound or molecule that alters the activity of a specified protein (signaling molecule, any molecule involved in a specified signaling molecule, a specified associated molecule) (e.g., including but not limited to the signaling molecules described herein) and affects the expression of TNFα target genes, for example, by directly contacting TNFα, contacting TNFα mRNA, causing a conformational change in TNFα, reducing the protein level of TNFα, or disrupting the interaction of TNFα with a signaling partner / receptor (e.g., TNFRSF11B, TNFRSF10B, and TNFRSF12A).

[0053] Inhibitors also include molecules that indirectly regulate biological activity (e.g., SMAD biological activity) by blocking upstream signaling molecules (e.g., within the extracellular domain, examples of signaling molecules and effects include: Noggin sequesters bone morphogenetic proteins and inhibits activation of ALK receptors 1, 2, 3, and 6, thus preventing downstream SMAD activation; Similarly, Chordin, Cerberus, Follistatin similarly sequester extracellular activators of SMAD signaling; Bambi is a transmembrane protein that also functions as a pseudo-receptor to sequester extracellular TGFβ signaling molecules). Antibodies that block upstream or downstream proteins are contemplated for use to neutralize extracellular activators of protein signaling, and the like. While the foregoing examples relate to inhibition of SMAD signaling, other signaling molecules can be inhibited using similar or analogous mechanisms. Examples of inhibitors include, but are not limited to, LDN193189 (LDN) and SB431542 (SB) (LSB) for inhibition of SMAD signaling, and IWP2 for inhibition of Wnt. Inhibitors are described in terms of competitive inhibition (binding to the active site in such a way as to preclude or reduce binding of another known binding compound) and allosteric inhibition (binding to the protein in such a way as to alter the protein conformation in such a way as to prevent binding of the compound to the active site of that protein), in addition to inhibition induced by binding or affecting a molecule upstream of a specified signaling molecule, which in turn causes inhibition of the specified molecule. Inhibitors can be "direct inhibitors" that inhibit a signaling target or pathway by actually contacting the signaling target.

[0054] As used herein, "activator" refers to a compound that increases, induces, stimulates, activates, promotes, or enhances the activation of the signaling function of a molecule or pathway (e.g., Wnt signaling, SHH signaling, FGF signaling, etc.).

[0055] As used herein, the term "Wnt" or "wingless" with respect to ligand refers to a group of secreted proteins that can interact with Wnt receptors, such as receptors in the Frizzled and LRPDerailed / RYK receptor families (e.g., integrin 1 in humans). As used herein, the term "Wnt or wingless signaling pathway" refers to a signaling pathway composed of Wnt family ligands and Wnt family receptors (e.g., Frizzled receptors and LRPDerailed / RYK receptors) that are mediated with or without β-catenin. Wnt signaling pathways include canonical Wnt signaling (e.g., mediated by β-catenin) and non-canonical Wnt signaling (mediated without β-catenin).

[0056] As used herein, the term "derivative" refers to a chemical compound that has a similar core structure.

[0057] As used herein, the term "cell population" or "cell population" refers to a group of at least two cells. In non-limiting examples, a cell population can include at least about 10, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000 cells. The population can be a pure population that includes one cell type, such as a population of midbrain DA progenitor cells, or a population of undifferentiated stem cells. Alternatively, the population can include more than one cell type, for example, a mixed cell population.

[0058] As used herein, the term "stem cell" refers to a cell that has the capacity to divide indefinitely in culture and give rise to specialized cells.

[0059] As used herein, the terms "embryonic stem cells" and "ESCs" refer to primitive (undifferentiated) cells derived from preimplantation stage embryos, capable of dividing in culture without differentiation for extended periods of time, and known to develop into cells and tissues of the three primary germ layers. Human embryonic stem cells refer to embryonic stem cells derived from human embryos. As used herein, the terms "human embryonic stem cells" or "hESCs" refer to a type of pluripotent stem cell derived from early stage human embryos up to the blastocyst stage, capable of dividing in culture without differentiation for extended periods of time, and known to develop into cells and tissues of the three primary germ layers.

[0060] As used herein, the term "embryonic stem cell line" refers to a population of embryonic stem cells cultured under in vitro conditions that allow proliferation without differentiation for days, months or years.

[0061] As used herein, the term "totipotency" refers to the ability to give rise to all cell types of the body, as well as all of the cell types that make up extraembryonic tissues, such as the placenta.

[0062] As used herein, the term "pluripotency" refers to the ability to develop into more than one cell type of the body.

[0063] As used herein, the term "pluripotent" refers to the capacity to develop into an organism's three developmental germ layers, including endoderm, mesoderm, and ectoderm.

[0064] As used herein, the term "induced pluripotent stem cells" or "iPSCs" refers to a type of pluripotent stem cell that is formed by introducing certain embryonic genes (e.g., but not limited to, OCT4, SOX2, and KLF4 transgenes) (see, e.g., Takahashi and Yamanaka Cell 126, 663-676 (2006) (herein incorporated by reference)) into somatic cells.

[0065] As used herein, the term "neuron" refers to a nerve cell, which is the primary functional unit of the nervous system. A neuron consists of a cell body and its processes (an axon and at least one dendrite). Neurons transmit information to other neurons or cells by releasing neurotransmitters at synapses.

[0066] As used herein, the term "differentiation" refers to the process by which an unspecialized embryonic cell acquires the characteristics of a specialized cell, such as a neuronal, cardiac, hepatic, or muscle cell. Differentiation is usually controlled by the interaction of the cell's genes with the physical and chemical conditions outside the cell, via signaling pathways involving proteins embedded in the cell surface.

[0067] As used herein, the term "directed differentiation" refers to the manipulation of stem cell culture conditions to induce differentiation into a particular (e.g., desired) cell type, such as midbrain dopamine neurons or their progenitors. In the context of stem cells, "directed differentiation" refers to the use of small molecules, growth factor proteins, and other growth conditions to promote the transition of stem cells from a pluripotent state to a more mature or specialized cell fate.

[0068] As used herein, the term "inducing differentiation" with respect to a cell refers to changing a default cell type (genotype and / or phenotype) to a non-default cell type (genotype and / or phenotype). Thus, "inducing differentiation in stem cells" refers to inducing stem cells (e.g., human stem cells) to divide into progeny cells that have characteristics that are distinct from the stem cell, such as genotype (e.g., changes in gene expression as determined by genetic analysis such as microarrays) and / or phenotype (e.g., changes in expression of protein markers of mDA neurons such as EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, PBX1, SNCG, SATB1, CALB1, and CALB2).

[0069] As used herein, the term "cell culture" refers to the growth of cells in vitro in an artificial medium for research or medical purposes.

[0070] As used herein, the term "medium" refers to the covering within a culture vessel, such as a petri plate, multi-well plate, etc., the liquid containing nutrients that nourish and support the cells. Culture medium may also include growth factors that are added to effect desired changes in the cells.

[0071] As used herein, the term "contacting" a cell(s) with a compound (e.g., at least one inhibitor, activator, and / or inducer) refers to providing the compound in a location that allows the cell(s) to access the compound. Contacting can be achieved using any suitable method. For example, contacting can be achieved by adding a concentrated form of the compound to a cell or cell population, e.g., in the context of cell culture, to achieve a desired concentration. Contacting can also be achieved by including the compound as a component of a formulated medium.

[0072] As used herein, the term "in vitro" refers to an artificial environment and to processes or reactions that occur within an artificial environment. In vitro environments are exemplified, but are not limited to, test tubes and cell cultures.

[0073] As used herein, the term "in vivo" refers to the natural environment (eg, an animal or a cell) and to processes or reactions that occur within a natural environment, such as embryonic development, cell differentiation, neurulation, etc.

[0074] As used herein, the term "express" in reference to a gene or protein refers to producing an mRNA or protein that can be observed using an assay such as a microarray assay, an antibody staining assay, or the like.

[0075] As used herein, the term "marker" or "cell marker" refers to a gene or protein that identifies a particular cell or cell type. A cellular marker is not limited to one marker, but may refer to a "pattern" of markers such that a designated group of markers can identify one cell or cell type from another.

[0076] As used herein, when made with reference to any cell disclosed herein, the terms "derived from" or "established from" or "differentiated from" refer to cells obtained from an ultimate parent cell in a cell line, tissue (e.g., dissociated embryo), or body fluid using any manipulation (e.g., without limitation, single cell isolation, in vitro culture, treatment, and / or mutagenesis) using, for example, proteins, chemicals, radiation, infection with a virus, transfection with a DNA sequence (e.g., with a morphogen, etc.), selection (e.g., by continuous culture) of any cells contained in the cultured parent cell). Derived cells can be selected from a mixed population by response to growth factors, cytokines, a selected course of cytokine treatment, adhesion, lack of adhesion, a sorting procedure, etc.

[0077] An "individual" or "subject" herein is a vertebrate, e.g., a human or a non-human animal, e.g., a mammal. Mammals include, but are not limited to, humans, non-human primates, farm animals, sport animals, rodents, and pets. Non-limiting examples of non-human animal subjects include rodents, such as mice, rats, and hamsters, and non-human primates, such as guinea pigs, rabbits, dogs, cats, sheep, pigs, goats, cows, horses, and apes and monkeys.

[0078] As used herein, "disease" refers to any condition or disorder that damages or interferes with the normal function of a cell, tissue, or organ.

[0079] As used herein, the term "treat" or "treatment" refers to clinical intervention in an attempt to alter the disease course of the individual or cell being treated, and can be performed either for prophylaxis or during the course of clinical pathology. The therapeutic effect of treatment includes, but is not limited to, preventing the onset or recurrence of the disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, reducing the rate of disease progression, improving or alleviating the disease state, as well as remission or improved prognosis. By preventing the progression of a disease or disorder, treatment can not only prevent deterioration due to the disorder in a subject who has been affected or diagnosed, or a subject suspected of having the disorder, but also can prevent the onset of the disorder or symptoms of the disorder in a subject at risk of the disorder or a subject suspected of having the disorder.

[0080] As used herein, the terms "negative," "weak," or "-," when used in reference to any surface marker disclosed herein, refer to the surface marker (e.g., CD49e) being not expressed at a detectable level or being expressed at a reduced level in a cell compared to the average expression of the surface marker in the population of cells from which the cells are selected or sorted. As used herein, the terms "high," "strong," "+," or "positive," when used in reference to any surface marker disclosed herein, refer to the surface marker (e.g., CD184) being expressed at a detectable level or being expressed at an increased level compared to the average expression of the surface marker in the population of cells.

[0081] In certain embodiments, cells are differentiated according to their surface marker expression levels based on easily identifiable differences in staining intensity, as known to those skilled in the art. In certain embodiments, the cutoff for designating cells as surface marker "weak", "negative", or "-" cells can be set in terms of the staining intensity distribution (e.g., fluorescence intensity distribution) observed for all cells, and these cells are designated as surface marker "weak", "negative", or "-" cells with staining intensity below about 50%, about 40%, about 30%, about 20%, about 10%, or about 5%. In certain embodiments, the cutoff for designating cells as surface marker "strong", "high", "+", or "positive" cells can be set in terms of the staining intensity distribution (e.g., fluorescence intensity distribution) observed for all cells, and these cells are designated as surface marker "strong", "high", "+", or "positive" cells with staining intensity above about 50%, about 60%, about 70%, about 80%, about 90%, or about 95%. In certain embodiments, a frequency distribution of surface marker staining is obtained for all cells, population curves are fitted to the higher and lower staining populations, and cells are assigned to the population to which they are statistically most likely to belong given the statistical analysis of each population distribution.

[0082] 5.2. Methods for improving in vivo survival of midbrain dopamine neurons The present disclosure provides a method for improving the in vivo survival of one or more midbrain dopamine (mDA) neurons. In certain embodiments, the method comprises suppressing p53-mediated apoptosis of one or more mDA neurons. In certain embodiments, the suppression of p53-mediated apoptosis comprises inhibiting tumor necrosis factor alpha (TNFα) signaling, inhibiting nuclear factor kappa B (NFκB) signaling, inhibiting p53 signaling, or a combination of the above. In certain embodiments, the suppression of p53-mediated apoptosis comprises contacting one or more mDA neurons with at least one compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof. In certain embodiments, the suppression of p53-mediated apoptosis comprises contacting one or more mDA neurons with a TNFα inhibitor.

[0083] In certain embodiments, the one or more mDA neurons express a marker selected from the group consisting of EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, SATB1, CALB1, CALB2, SNCG, PBX1, and combinations thereof. In certain embodiments, the one or more mDA neurons are postmitotic mDA neurons. In certain embodiments, the one or more mDA neurons are differentiated in vitro from one or more stem cells. In certain embodiments, the one or more stem cells are human stem cells. In certain embodiments, the one or more stem cells are one or more induced pluripotent stem cells.

[0084] Inhibition of TNFα signaling In certain embodiments, the suppression of p53-mediated apoptosis includes the inhibition of TNFα signaling. The TNFα signaling pathway plays an important role in various physiological and pathological processes, including the regulation of cell proliferation, differentiation, apoptosis, and immune responses, and the induction of inflammation. TNFα is a multifunctional proinflammatory cytokine that affects lipid metabolism, coagulation, insulin resistance, and endothelial function. TNFα can be produced by many cell types (e.g., macrophages, lymphocytes, fibroblasts, and keratinocytes) in response to inflammation, infection, and other environmental stresses. TNFα acts by binding to its receptors (e.g., TNFR1, TNFR2, TNFRSF11B, TNFRSF10B, and TNFRSF12A), which then recruit and activate complex signaling cascades and networks.

[0085] In certain embodiments, the inhibition of TNFα signaling is achieved by an inhibitor of TNFα signaling. In certain embodiments, the inhibitor of TNFα signaling can be a molecule (e.g., a chemical compound or an antibody) that interferes with (e.g., antagonizes, reduces, decreases, eliminates, or blocks) the function of TNFα and / or its signaling. In certain embodiments, the inhibitor of TNFα signaling is a TNFα inhibitor.

[0086] In certain embodiments, the inhibitor of TNFα signaling and / or the TNFα inhibitor may include, but is not limited to, an interfering ribonucleic acid (e.g., siRNA, shRNA), an aptamer, or a peptidomimetic.

[0087] Non-limiting examples of inhibitors of TNFα signaling and / or TNFα inhibitors include anti-TNFα antibodies, TNFα decoy receptors, chemical compounds. In certain embodiments, the TNFα inhibitors include anti-TNFα antibodies, TNFα decoy receptors, chemical compounds, nucleic acid inhibitors, small molecule inhibitors, receptor biological inhibitors, inactive TNF fragments, TNFα circulating receptor fusion proteins (e.g., etanercept, etanercept-szzs), xanthine derivatives (e.g., pentoxifylline), and 5-HT 2A agonists (e.g., (R)-DOI, TCB-2, LSD, LA-SS-Ac).

[0088] In certain embodiments, the inhibitor of TNFα signaling and / or the TNFα inhibitor is an antibody. In certain embodiments, the antibody is an anti-TNFα antibody. In certain embodiments, the antibody is an antagonistic anti-TNFα antibody. In certain embodiments, the anti-TNFα antibody is selected from the group consisting of adalimumab (Humira®), adalimumab-adbm (Cyltezo®), adalimumab-adaz (Hyrimoz®), adalimumab-atto (Amgevita®), certolizumab pegol (Cimzia®), golimumab (Simponi®, Simponi Aria®), infliximab (Remicade®, infliximab-abda (Renflexis®), infliximab-dyyb (Inflectra®), lemtolumab, afelimomab, nerelimomab, ozoralizumab, placulumab, and combinations thereof. In certain embodiments, the TNFα inhibitor is adalimumab.

[0089] In certain embodiments, the inhibitor of TNFα signaling and / or the TNFα inhibitor is a polypeptide. In certain embodiments, the polypeptide is a TNFα decoy receptor. In certain embodiments, the TNFα decoy receptor is selected from the group consisting of etanercept (Enbrel®), etanercept-szzs (Ereizi®), pegsunercept, onercept, and lenercept.

[0090] In certain embodiments, the inhibitor of TNFα signaling and / or the TNFα inhibitor is a chemical compound. Non-limiting examples of chemical compounds that can be used with the present disclosure include apremilast (Otezla®), bupropion (Zyban®), catechin, cannabinoids, curcumin, lysergic acid 2,4-dimethylazetidide (LA-SS-Az, LSZ), apigenin-7-O-glucuronide, JTE-607 dihydrochloride, MD2-TLR4-IN-1, AUDA, isoflurane, sucrose ... Dinaxib (APX-115 free base), IQ3, 3-deazaadenosine hydrochloride, cucurbitacin IIb, lenalidomide (CC-5013), aprepitant (MK-0869), thalidomide (K17), amarogentin, pomalidomide (CC-4047), acetylcysteine ​​(N-acetylcysteine), butoconazole nitrate, CPI-1189, methylthiouracil, UCB-92 60, mesaconitine, myrislignan, falcarindiol, gardenoside, demethylene berberine, stylopine, racemic benpyrine, muscone, ginsenoside Rb1, cepharanthin, QNZ (EVP4593), AX-024HCl, NE52-QQ57, resatorbid (TAK-242), apremilast (CC-10004), necrostatin-1, PF-3644022, GSK5 83, shikonin (CI75535), GSK2982772, mulberoside A, corilagin, 20(S)-ginsenoside Rh1, forsythoside B, 2',5'-dihydroxyacetophenone, geraniin, homoplantaginin, SPD-304, UCB-6876, UCB-5307, UCB-9260, PF-3644022, R-7050, citronellol, and madecassic acid.

[0091] Inhibition of NFκB signaling In certain embodiments, the suppression of p53-mediated apoptosis comprises the inhibition of NFκB signaling. NFκB represents a family of inducible transcription factors that regulate a large number of genes involved in different processes of immune and inflammatory responses. This family is composed of five structurally related members, including NFκB1, NFκB2, RelA, RelB, and c-Rel, which mediate the transcription of target genes by binding to specific DNA elements (e.g., κB enhancers). NFκB can regulate inflammatory responses by mediating the induction of various proinflammatory genes in innate immune cells. NFκB can also regulate the activation, differentiation, and effector functions of inflammatory T cells.

[0092] In certain embodiments, the inhibition of NFκB signal transduction is achieved by an inhibitor of NFκB signal transduction. In certain embodiments, the inhibitor of NFκB signal transduction can be a molecule (e.g., a chemical compound) that interferes with (e.g., antagonizes, reduces, decreases, suppresses, eliminates, or blocks) the transcriptional activity of NFκB and its signal transduction. In certain embodiments, the inhibitor of NFκB signal transduction is an NFκB inhibitor.

[0093] Non-limiting examples of NFκB signaling and NFκB inhibitors that can be used with the present disclosure include upstream inhibitors of NFκB, inhibitors of IKK activity, inhibitors of IκB phosphorylation, inhibitors of IκB degradation, proteasome inhibitors, protease inhibitors, IκB upregulators, inhibitors of NFκB nuclear translocation and expression, NFκB DNA binding inhibitors, and NFκB transactivation inhibitors, inhibitors of NFκB-directed gene transactivation, and antioxidants. Additional examples of NFκB signaling and NFκB inhibitors that can be used with the present disclosure include, but are not limited to, antioxidants, interfering ribonucleic acids (e.g., siRNA, shRNA), antibodies, aptamers, or peptidomimetics.

[0094] In certain embodiments, inhibition of NFκB signaling is achieved by an upstream inhibitor of NFκB. Non-limiting examples of upstream inhibitors of NFκB that can be used with the present disclosure include rituximab, pigment epithelium-derived factor, betaine, desloratadine, LY29, LY30, MOL294, pefabloc, rhein, salmeterol, and fluticasone propionate.

[0095] In certain embodiments, the inhibition of NFκB signaling is achieved by an inhibitor of the IKK activity of IκB phosphorylation.Non-limiting examples of inhibitors of the IKK activity of IκB phosphorylation that can be used with the present disclosure include heparin-binding epidermal growth factor-like growth factor, hepatocyte growth factor, interleukin-10, antithrombin III, chorionic gonadotropin, interferon-α, 2-amino-3-cyano-4-aryl-6-(2-hydroxy-phenyl)pyridine derivatives, acrolein, AS602868, aspirin, dihydroxyphenylethanol, epoxyquinone A monomer, MLB120, BMS-34. 5541, CYL-19s, CYL-26z, 2-amino-6-[2-(cyclopropylmethoxy)-6-hydroxyphenyl]-4-piperidin-4-ylnicotinonitrile, Compound A, Compound 5, cyclopentenone, gesterone dimer, PS-1145 (MLN1145), 2-[(aminocarbonyl)amino]-5-acetylenyl-3-thiophenecarboxamide, aminopyrimidine, benzimidazole derivative, CDDO-Me (synthetic triterpenoid), CHS828 (anticancer drug), dia Imidazolylpyridine derivatives, imidazolylquinoline-carboxaldehyde derivatives, indolecarboxamides, LF15-0195 (analogue of 15-deoxyspergualin), ML120B, MX781 (retinoid antagonist), N-(4-hydroxyphenyl)retinamide, pyrazolo[4,3-c]quinoline derivatives, pyridoxazinone derivatives, scytonemin, sulfasalazine, thalidomide, azidothymidine (AZT), BAY-11-7082 (E3((4-methylphenyl)-sulfonyl)-2-methyl-2-propanediol), benzo[1,2-diphenyl ... -propenenitrile), BAY-11-7083 (E3 ((4-t-butylphenyl)sulfonyl)-2-propenenitrile), benzyl isothiocyanate, carboplatin, gabexate mesylate, Gleevec (Imatanib), hydroquinone, ibuprofen, methotrexate, monochloramine, nafamostat mesylate, statins, and THI52 (1-naphthylethyl-6,7-dihydroxy-1,2,3,4-tetrahydroisoquinoline).

[0096] In certain embodiments, inhibition of NFκB signaling is achieved by an inhibitor of IκB degradation. Non-limiting examples of inhibitors of IκB degradation that can be used with the present disclosure include penetratin, vasoactive intestinal peptide, alpha-melanocyte stimulating hormone (a-MSH), IL-13, intravenous immunoglobulin, pituitary adenylate cyclase activating polypeptide (PACAP), SAIF (Saccharomyces boulardii anti-inflammatory factor), acetaminophen, 1-bromopropane, diamide (tyrosine phosphatase inhibitor), dobutamine, E-73 (cycloheximide analog), ecabet sodium, gabexate mesylate, glimepiride, losartan, pervanadate, phenylarsine oxide, phenytoin, sabaexane, U0126 (MEK inhibitor), and Ro106-9920 (small molecule).

[0097] In certain embodiments, inhibition of NFκB signaling is achieved by a proteasome or protease inhibitor. Non-limiting examples of proteasome or protease inhibitors that can be used in the present disclosure include N-acetyl-leucinyl-leucinyl-norleucinal, MG101, N-acetyl-leucinyl-leucinyl-methional, carbobenzoxyl-leucinyl-leucinyl-norvalinal, MG115, N-acetyl-L-leucinyl-L-leucinyl-L-norleucinal, MG132, ubiquitin ligase inhibitors, boronate peptides, bortezomib, salinosporamide A, tacrolimus, deoxyspergualin, disulfiram, N-acetyl-DL-phenylalanine-b-naphthyl ester, N-benzoyl-L-tyrosine-ethyl ester, 3,4-dichloroisocoumarin, diisopropyl fluorophosphate, N-alpha-tosyl-L-phenylalanine chloromethyl ketone, and N-alpha-tosyl-L-lysine chloromethyl ketone.

[0098] In certain embodiments, the inhibition of NFκB signaling is achieved by an inhibitor of NFκB nuclear translocation and expression.Non-limiting examples of inhibitors of NFκB nuclear translocation and expression for use in the present disclosure include atorvastatin, phalacidin, piperine, pitavastatin, selenomethionine, clarithromycin, cantharidin, neomycin, paeoniflorin, rapamycin, ranpirnase, BMD (N(1)-benzyl-4-methylbenzene-1,2-diamine), carbaryl, indole-3-carbinol, dehydroxymethylepoxyquinomycin, dipyridamole, disulfiram, diltiazem, fluvastatin, levamisole, rolipram, SC236, omapatrilat, enalapril, and CGS25462.

[0099] In certain embodiments, inhibition of NFκB signaling is achieved by an NFκB DNA binding or transactivation inhibitor. Non-limiting examples of NFκB DNA binding or transactivation inhibitors that can be used with the present disclosure include 7-amino-4-methylcoumarin, amrinone, atrovastat (HMG-CoA reductase inhibitor), benfotiamine (a thiamine derivative), bisphenol A, carprofen, carbocysteine, celecoxib, gemcitabine, flurbiprofen, lovastatin, mercaptopyrazine, monomethyl fumarate, moxifloxacin, nicorandil, nilvadipine, pioglitazone, pirfenidone, pyridoxine, riboflavin ... and sirolimus N-oxide derivatives, quinadryl, raloxifene, laxoferast, ribavirin, rifamide, ritonavir, rosiglitazone, roxithromycin, simvastatin, SM-7368, sulfasalazine, verapamil, dimethyl fumarate (DMF), ethyl 2-[(3-methyl-2,5-dioxo(3-pyrrolinyl))pyrimidine-5-carboxylate, nelfinavir, ritonavir, saquinavir, RO31-8220, SB203580, and troglitazone.

[0100] 5.2.3.Inhibition of p53 signaling In certain embodiments, suppression of p53-mediated apoptosis comprises inhibition of p53 signal transduction. p53 is a transcription factor that is often associated with cancer. Physiologically, p53 can be disabled by mutation or by upstream negative regulators, including but not limited to MDM2 and MDMX.

[0101] In certain embodiments, inhibiting p53 signal transduction is achieved by reducing the expression of p53.In certain embodiments, reducing the expression of p53 comprises knocking out or knocking down the TP53 gene in one or more mDA neurons.In certain embodiments, the TP53 gene is knocked out or knocked down in one or more mDA neurons by gene editing system.

[0102] Non-limiting examples of gene editing systems for use with the present disclosure include systems that utilize non-naturally occurring or engineered nucleases (including but not limited to zinc finger nucleases (ZNFs), meganucleases, transcription activator-like effector nucleases (TALENs)) or CRISPR-Cas systems. Details of gene editing systems for use with the present disclosure can be found in Adli et al., Nat Commun. 2018 May 15;9(1):1911 and Maeder & Gersbach, Mol Ther. 2016 Mar;24(3):430-46, the contents of each of which are incorporated by reference in their entirety.

[0103] In certain embodiments, the CRISPR-Cas system is used to knock out or knock down the TP53 gene. The CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) system is an engineered nuclease system based on a bacterial system that can be used for genome engineering. It is based in part on the adaptive immune response of many bacteria and archaea. When a virus or plasmid invades a bacterium, a segment of the invader's DNA is converted into CRISPR RNA (crRNA) by the "immune" response. The crRNA then associates with another type of RNA called tracrRNA through a region of partial complementarity to guide the CRISPR-Cas nuclease to a region of the target DNA that is homologous to the crRNA, called the "protospacer." The CRISPR-Cas nuclease cleaves the DNA to generate blunt ends at the DSB at the site specified by a 20-nucleotide guide sequence contained within the crRNA transcript. The CRISPR-Cas nuclease requires both the crRNA and tracrRNA for site-specific DNA recognition and cleavage. This system has been engineered to combine crRNA and tracrRNA into one molecule ("single guide RNA"), where the crRNA equivalent portion of the single guide RNA can be engineered to guide CRISPR-Cas nuclease to target any desired sequence (see Jinek et al., Science (2012); 337: 816-821). Thus, the CRISPR-Cas system can be engineered to generate DSBs at desired targets in the genome. In certain embodiments, the CRISPR-Cas system comprises a CRISPR-Cas nuclease and a single guide RNA.Suitable examples of CRISPR-Cas nucleases include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csx12, Csx13, Csx14, Csx15, Csx16, Csx17, Csx18, Csx19, Csx10, Csx11, Csx12, Csx13, Csx14, Csx15, Csx16, Csx17, Csx18, Csx19, Csx19, Csx19, Csx19, Csx10, Csx10, Csx10 Examples of CRISPR-Cas nucleases include, but are not limited to, sm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their homologs, or modified versions thereof. These CRISPR-Cas nucleases are known, for example, the amino acid sequence of S.pyogenes Cas9 protein can be found in the Swissprot database under the accession number Q99ZW2. In some embodiments, the CRISPR-Cas nuclease has DNA cleavage activity, e.g., Cas9. In certain embodiments, the CRISPR-Cas nuclease is Cas9. The CRISPR-Cas nuclease can direct cleavage of one or both strands at the location of the target sequence (e.g., a genomic safe harbor site). Additionally, the CRISPR-Cas nuclease can direct cleavage of one or both strands within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 200, 500, or more base pairs from the first or last nucleotide of the target sequence.

[0104] In certain embodiments, the inhibition of p53 signal transduction is achieved by an inhibitor of p53 signal transduction.In certain embodiments, the inhibitor of p53 signal transduction can be a molecule (e.g., chemical compound) that interferes with (e.g., antagonizes, reduces, decreases, suppresses, eliminates, or blocks) the transcriptional activity of p53 and its signal transduction.In certain embodiments, the inhibitor of p53 signal transduction is a p53 inhibitor.

[0105] Non-limiting examples of p53 signaling inhibitors and p53 inhibitors that can be used with the present disclosure include JNK inhibitors, p38 MAPK inhibitors, caspase inhibitors, puma / BBC3 inhibitors, BAX inhibitors, CDK inhibitors, MDM2 and MDMX activators, and combinations thereof. Additional examples of p53 signaling inhibitors and p53 inhibitors for use with the present disclosure include, but are not limited to, interfering ribonucleic acids (e.g., siRNA, shRNA), antibodies, aptamers, or peptidomimetics.

[0106] In certain embodiments, inhibition of p53 signaling is achieved by a JNK inhibitor. c-Jun N-terminal protein kinase (JNK) is a subfamily of the mitogen-activated protein kinase (MAPK) superfamily. JNK is a key regulator of many cellular events, including programmed cell death (apoptosis). In addition, JNK activates p53, which regulates the apoptotic process. Non-limiting examples of JNK inhibitors that can be used in the present disclosure include SP600125, AS601245, AS602801, JNK-IN-1, JNK-IN-8, ginsenoside Rg1, AV7, BI-78D3, pyridopyrimidione derivatives, CC-930, quinazolines, triazolothiones 1, XG-102 (D-JNKI-1), 4-fluorophenylisoxazoles, 4-quinolone analogs, and 4-phenylisoquinolones.

[0107] In certain embodiments, the inhibition of p53 signal transduction is achieved by a p38 MAPK inhibitor. p38 mitogen-activated protein kinase is a class of mitogen-activated protein kinase (MAPK) that responds to stress stimuli such as cytokines, ultraviolet radiation, heat shock, and osmotic shock, and is involved in cell differentiation, apoptosis, and autophagy. p38 MAPK can activate p53. Non-limiting examples of p38 MAPK inhibitors that can be used with the present disclosure include dorampimod, skepinone, ralimetinib, TAK-715, losmapimod, neflamapimod, R1487, VX-702, pamapimod, and adesmapimod.

[0108] In certain embodiments, inhibition of p53 signaling is achieved by caspase inhibitors. Non-limiting examples of caspase inhibitors that can be used in the present disclosure include Ac-IETD-CHO, Ac-YVAD-CHO, Ac-DEVD-CMK, Z-VAD-FMK, Z-YVAD-FMK, Boc-D-FMK, TRP-601, Q-VD-OPh, VX-765 (Vernacasan), VRT-043198, VX-740 (Pralnacasan), IDN-6556 (Emericasan, PF-034911390), VX-166, M826, M867, QPI-1007 (Cosdosilane), NCX-1000, and isatin sulfonamide.

[0109] In certain embodiments, inhibition of p53 signaling is achieved by a nucleic acid that targets a protein that regulates the p53 pathway. In certain embodiments, the nucleic acid targets p53. Non-limiting examples of nucleic acids that can be used in the present disclosure include siRNA and shRNA. siRNA molecules are generally polynucleotides about 20 to about 25 nucleotides in length that are designed to bind to a specific RNA sequence (e.g., p53 mRNA). siRNA silences gene expression in a sequence-specific manner, binding to a target RNA (e.g., an RNA with a complementary sequence) and causing the RNA to be degraded by endoribonucleases. siRNA molecules capable of inhibiting the expression of p53 can be produced by suitable methods. There are several algorithms that can be used to design siRNA molecules that bind to the sequence of a gene of interest (see, for example, Huesken et al., Nat. Biotechnol. 23:995-1001; Jagla et al., RNA 11:864-872, 2005; Shabalinea, BMC Bioinformatics 7:65, 2005). In addition or alternatively, expression vectors that express siRNA or shRNA can be used (see, for example, Brummelkamp, ​​Science 296:550-553, 2002; Lee et al., Nature Biotechnol. 20:500-505, 2002; Elbashir et al., Nature 411:494-498, 2001).

[0110] In certain embodiments, inhibition of p53 signaling is achieved by ribozymes that inhibit the expression of p53. Ribozymes are RNA molecules with enzymatic activity. One class of ribozymes can repeatedly cleave other separate RNA molecules into two or more parts in a nucleotide base sequence specific manner (see Kim et al., Proc Natl Acad Sci USA, 84:8788 (1987); Haseloff & Gerlach, Nature, 334:585 (1988); and Jefferies et al., Nucleic Acid Res, 17:1371 (1989)). Such ribozymes typically have two functional domains: a catalytic domain and a binding sequence that induces the binding of the ribozyme to the target RNA through complementary base pairing. When a specifically designed ribozyme binds to a target mRNA, it enzymatically cleaves the target mRNA, reducing its stability and destroying its ability to directly translate the encoded protein. Methods for selecting ribozyme target sequences and for designing and producing ribozymes are generally known in the art.

[0111] 5.2.4. Midbrain dopamine (mDA) neurons In certain embodiments, one or more mDA neurons used in the methods of the present disclosure express markers indicative of mDA neurons.Non-limiting examples of markers indicative of mDA neurons include engrailed-1 (EN1), orthodenticle homeobox 2 (OTX2), tyrosine hydroxylase (TH), nuclear receptor-related-1 protein (NURR1), forkhead box protein A2 (FOXA2), and LIM homeobox transcription factor 1 alpha (LMX1A), PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, DAT, VMAT1, SOX6, WNT1, GIRK2, SATB1, CALB1, CALB2, and PBX1. In certain embodiments, the mDA neurons do not express detectable levels of at least one marker selected from the group consisting of PAX6, EMX2, LHX2, SMA, SIX1, PITX2, SIM1, POU4F1, PHOX2A, BARHL1, BARHL2, GBX2, HOXA1, HOXA2, HOXB1, HOXB2, POU5F1, NANOG, and combinations thereof. In certain embodiments, the one or more mDA neurons express at least one of an A9 subtype mDA neuron marker, an A10 subtype mDA neuron marker, and an mDA neuron maturation marker. In certain embodiments, the one or more mDA neurons express at least one marker selected from the group consisting of TH, EN1, NURR1, and ALDH1A1. In certain embodiments, the one or more mDA neurons express ALDH1A1.

[0112] In certain embodiments, the one or more mDA neurons are one or more postmitotic mDA neurons. A "postmitotic" cell is a terminally differentiated cell that can no longer undergo mitosis and proliferation. In certain embodiments, the one or more postmitotic mDA neurons do not express detectable levels of CD49e and express detectable levels of CD184. In certain embodiments, the one or more mDA neurons are selected by not expressing detectable levels of CD49e and expressing detectable levels of CD184.

[0113] In certain embodiments, one or more mDA neurons are differentiated in vitro from stem cells.In certain embodiments, one or more mDA neurons are differentiated in vitro from one or more stem cells according to the method disclosed in International Patent Publication Nos. WO2013067362, WO2016196661, WO2021042027 and WO2021203009 (each of which is incorporated by reference in its entirety).

[0114] In certain embodiments, the in vitro differentiation comprises contacting one or more stem cells with at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling (referred to as a "SMAD inhibitor"), at least one activator of Sonic hedgehog (SHH) signaling (referred to as a "SHH activator"), and at least one activator of wingless (WNT) signaling (referred to as a "Wnt activator"). In certain embodiments, the in vitro differentiation further comprises contacting the cells with at least one activator of fibroblast growth factor (FGF) signaling (referred to as an "FGF activator"). In certain embodiments, the in vitro differentiation further comprises contacting the cells with at least one inhibitor of Wnt signaling. In certain embodiments, the cells are further contacted with DA neuron lineage-specific activators and inhibitors.

[0115] 5.2.4.1. Stem cells In certain embodiments, the stem cells are pluripotent stem cells. In certain embodiments, the pluripotent stem cells are selected from embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), and combinations thereof. In certain embodiments, the stem cells are multipotent stem cells. Non-limiting examples of stem cells that can be used in the methods of the present disclosure include non-embryonic stem cells, embryonic stem cells, induced non-embryonic pluripotent cells, and engineered pluripotent cells. In certain embodiments, the stem cells are human stem cells. Non-limiting examples of human stem cells include human embryonic stem cells (hESCs), human pluripotent stem cells (hPSCs), human induced pluripotent stem cells (hiPSCs), human unisexual germ stem cells, primordial germ cell-like pluripotent stem cells, epiblast stem cells, F class pluripotent stem cells, somatic stem cells, cancer stem cells, or any other cells capable of lineage-specific differentiation. In certain embodiments, the stem cells are human embryonic stem cells (hESCs). In certain embodiments, the stem cell is a human induced pluripotent stem cell (hiPSC). In certain embodiments, the stem cell is a non-human stem cell. In certain embodiments, the stem cell is a non-human primate stem cell. In certain embodiments, the stem cell is a rodent stem cell.

[0116] SMAD inhibitors Non-limiting examples of SMAD inhibitors include inhibitors of transforming growth factor beta (TGFβ) / activin-Nodal signaling (referred to as "TGFβ / activin-Nodal inhibitors"), and inhibitors of bone morphogenetic protein (BMP) signaling. In certain embodiments, TGFβ / activin-Nodal inhibitors can block signaling pathways including TGFβ, BMP, Nodal, and activin by neutralizing their ligands and / or blocking their receptors and downstream effectors. Non-limiting examples of TGFβ / Activin-Nodal inhibitors include those disclosed in WO2010 / 096496, WO2011 / 149762, WO2013 / 067362, WO2014 / 176606, WO2015 / 077648, Chambers et al., Nat Biotechnol. 2009 Mar;27(3):275-80, Kriks et al., Nature. 2011 Nov 6;480(7378):547-51, and Chambers et al., Nat Biotechnol. 2012 Jul 1;30(7):715-20(2012), all of which are incorporated by reference in their entirety for all purposes. In certain embodiments, the at least one TGFβ / activin-Nodal inhibitor is selected from an inhibitor of ALK5, an inhibitor of ALK4, an inhibitor of ALK7, and combinations thereof. In certain embodiments, the TGFβ / activin-Nodal inhibitor comprises an inhibitor of ALK5. In certain embodiments, the TGFβ / activin-Nodal inhibitor is a small molecule selected from SB431542, derivatives thereof, and mixtures thereof. "SB431542" refers to the compound designated CAS 301836-41-9, C 22 H 18 It refers to a molecule having the molecular formula of N4O3 and the name 4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]-benzamide, see, for example, the following structure: [ka] .

[0117] In certain embodiments, the TGFβ / activin-Nodal inhibitor comprises SB431542. In certain embodiments, the TGFβ / activin-Nodal inhibitor comprises a derivative of SB431542. In certain embodiments, the derivative of SB431542 is A83-01.

[0118] In certain embodiments, the at least one SMAD inhibitor comprises an inhibitor of BMP signaling (referred to as a "BMP inhibitor"). Non-limiting examples of BMP inhibitors include those disclosed in WO2011 / 149762, Chambers et al., Nat Biotechnol. 2009 Mar;27(3):275-80, Kriks et al., Nature. 2011 Nov 6;480(7378):547-51, and Chambers et al., Nat Biotechnol. 2012 Jul 1;30(7):715-20, all of which are incorporated herein by reference in their entirety. In certain embodiments, the BMP inhibitor is a small molecule selected from LDN193189, Noggin, Dorsomorphin, derivatives thereof, and mixtures thereof. "LDN193189" refers to the small molecule DM-3189, having the formula: 25 H 22 It has the chemical formula N6 and the IUPAC name 4-(6-(4-(piperazin-1-yl)phenyl)pyrazolo[1,5-a]pyrimidin-3-yl)quinoline. [ka]

[0119] LDN193189 can function as a SMAD signaling inhibitor. LDN193189 is also a highly potent small molecule inhibitor of ALK2, ALK3, and ALK6, protein tyrosine kinase (PTK), and inhibits the signaling of members of the ALK1 and ALK3 family of type I TGFβ receptors, leading to the inhibition of the transmission of multiple biological signals, including bone morphogenetic protein (BMP) BMP2, BMP4, BMP6, BMP7, and activin cytokine signals, and subsequently inhibits the phosphorylation of SMADs Smad1, Smad5, and Smad8 (Yu et al. (2008) Nat Med 14:1363-1369, Cuny et al. (2008) Bioorg.Med.Chem.Lett.18:4388-4392 (incorporated herein by reference).

[0120] In certain embodiments, the BMP inhibitor comprises LDN193189. In certain embodiments, the BMP inhibitor comprises Noggin.

[0121] In certain embodiments, stem cells are exposed to one SMAD inhibitor (e.g., one TGFβ / activin-Nodal inhibitor). In certain embodiments, the TGFβ / activin-Nodal inhibitor is SB431542. In certain embodiments, the TGFβ / activin-Nodal inhibitor is a derivative of SB431542. In certain embodiments, the TGFβ / activin-Nodal inhibitor is A83-01.

[0122] In certain embodiments, the stem cells are exposed to two SMAD inhibitors. In certain embodiments, the two SMAD inhibitors are a TGFβ / Activin-Nodal inhibitor and a BMP inhibitor. In certain embodiments, the stem cells are exposed to SB431542 or A83-01, and LDN193189 or Noggin. In certain embodiments, the stem cells are exposed to SB431542 and LDN193189. In certain embodiments, the stem cells are exposed to A83-01 and LDN193189. In certain embodiments, the stem cells are exposed to SB431542 and Noggin. In certain embodiments, the stem cells are exposed to A83-01 and Noggin.

[0123] In certain embodiments, the stem cells are contacted or exposed to at least one SMAD inhibitor for about 5, 6, or 7 days. In certain embodiments, the cells are contacted or exposed to at least one SMAD inhibitor from day 0 to day 6.

[0124] In certain embodiments, the cell is contacted or exposed to a TGFβ / activin-Nodal inhibitor. In certain embodiments, the concentration of the TGFβ / activin-Nodal inhibitor that the cell is contacted or exposed to is about 5 μM or about 10 μM. In certain embodiments, the TGFβ / activin-Nodal inhibitor comprises SB431542 or its derivative (e.g., A83-01). In certain embodiments, the TGFβ / activin-Nodal inhibitor comprises SB431542.

[0125] In certain embodiments, the cell is contacted or exposed to a BMP inhibitor. In certain embodiments, the concentration of the BMP inhibitor that is contacted or exposed to the cell is about 250 nM. In certain embodiments, the BMP inhibitor comprises LDN193189 or its derivative. In certain embodiments, the BMP inhibitor comprises LDN193189.

[0126] In certain embodiments, the cells are contacted or exposed to the TGFβ / activin-Nodal inhibitor and the BMP inhibitor simultaneously. In certain embodiments, the stem cells are contacted or exposed to the TGFβ / activin-Nodal inhibitor and the BMP inhibitor for about 5 days, 6 days, or 7 days. In certain embodiments, the cells are contacted or exposed to the TGFβ / activin-Nodal inhibitor and the BMP inhibitor from day 0 to day 6.

[0127] 5.2.4.3.Wnt activator In certain embodiments, at least one Wnt activator reduces GSK3β for activation of Wnt signaling. Thus, in certain embodiments, the Wnt activator is a GSK3β inhibitor. GSK3β inhibitors can activate the WNT signaling pathway. See, for example, Cadigan, et al., J Cell Sci. 2006; 119: 395-402, Kikuchi, et al., Cell Signaling. 2007; 19: 659-671 (incorporated herein by reference in their entirety). As used herein, the term "glycogen synthase kinase 3β inhibitor" or "GSK3β inhibitor" refers to a compound that inhibits glycogen synthase kinase 3β enzyme. See, for example, Doble, et al., J Cell Sci. 2003; 116: 1175-1186 (incorporated herein by reference in their entirety). Non-limiting examples of GSK3β inhibitors include CHIR99021, BIO ((3E)-6-bromo-3-[3-(hydroxyamino)indol-2-ylidene]-1H-indol-2-one), AMBMP hydrochloride, LP 922056, SB-216763, CHIR98014, lithium, 3F8, deoxycholic acid, and the like, as described in WO2011 / 149762, WO13 / 067362, Chambers et al., Nat Biotechnol. 2012 Jul 1;30(7):715-20, Kriks et al., Nature. 2011 Nov 6;480(7378):547-51, and Calder et al., J Neurosci. 2015 Aug 2016. 19;35(33):11462-81, all of which are incorporated by reference in their entireties.

[0128] Non-limiting examples of Wnt activators include CHIR99021, Wnt3A, Wnt1, Wnt5a, BIO ((3E)-6-bromo-3-[3-(hydroxyamino)indol-2-ylidene]-1H-indol-2-one), AMBMP hydrochloride, LP 922056, SB-216763, CHIR98014, lithium, 3F8, deoxycholic acid, and other compounds described in WO2011 / 149762, WO13 / 067362, Chambers et al., Nat Biotechnol. 2012 Jul 1;30(7):715-20, Kriks et al., Nature. 2011 Nov 6;480(7378):547-51, and Calder et al., J Neurosci. 2015 Aug 2016. 19;35(33):11462-81, all of which are incorporated by reference in their entirety. In certain embodiments, the at least one Wnt activator is a small molecule selected from CHIR99021, Wnt3A, Wnt1, Wnt5a, BIO, CHIR98014, lithium, 3F8, deoxycholic acid, derivatives thereof, and mixtures thereof. In certain embodiments, the at least one Wnt activator comprises CHIR99021 or a derivative thereof. In certain embodiments, the at least one Wnt activator comprises CHIR99021. "CHIR99021" (also known as "aminopyrimidine" or "3-[3-(2-carboxyethyl)-4-methylpyrrole-2-methylidenyl]-2-indolinone") refers to the IUPAC name 6-(2-(4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazol-2-yl)pyrimidin-2-ylamino)ethylamino)nicotinonitrile, which has the formula: [ka]

[0129] CHIR99021 is highly selective, with IC50=6.7 nM against human GSK3β and nanomolar IC50 values ​​against the rodent GSK3β homolog, demonstrating nearly 1000-fold selectivity against a panel of related and unrelated kinases.

[0130] In certain embodiments, the cells are contacted with at least one Wnt activating agent for about 15 days, 16 days, or 17 days. In certain embodiments, the cells are contacted with at least one Wnt activating agent from day 0 to day 16.

[0131] In certain embodiments, the concentration of at least one Wnt activator is increased during exposure to the cells (also referred to as "Wnt boost"). In certain embodiments, the increase or Wnt boost is initiated at least about 2 days, at least about 4 days, or at least about 5 days after the initial exposure of the cells to the at least one Wnt activator. In certain embodiments, the increase or Wnt boost is initiated about 4 days after the initial exposure of the cells to the at least one Wnt activator. In certain embodiments, the concentration of at least one activator of Wnt signaling contacted with the cells is increased about 2 days to about 6 days after the initial contact of the cells with the at least one activator of Wnt signaling.

[0132] In certain embodiments, the cells are contacted or exposed to increased concentrations of at least one Wnt activator for at least about 5 days or at least about 10 days, in certain embodiments, the cells are contacted with increased concentrations of at least one Wnt activator for up to about 10 days.

[0133] In certain embodiments, the cells are contacted or exposed to the increased concentration of at least one Wnt activator for about 5 days, 5 days, or 6 days. In certain embodiments, the cells are contacted or exposed to the increased concentration of at least one Wnt activator from day 4 to day 9. In certain embodiments, the cells are contacted or exposed to the increased concentration of at least one Wnt activator for about 10 days, 12 days, or 13 days. In certain embodiments, the cells are contacted or exposed to the increased concentration of at least one Wnt activator from day 4 to day 16.

[0134] In certain embodiments, the initial concentration of at least one Wnt activator contacted or exposed to the cells prior to the Wnt boost is about 1 μM or about 0.5 μM. In certain embodiments, the initial concentration of at least one Wnt activator contacted or exposed to the cells prior to the Wnt boost is about 0.7 μM.

[0135] In certain embodiments, the increased concentration of at least one Wnt activator after the Wnt boost is about 3 μM or about 6 μM. In certain embodiments, the increased concentration of at least one Wnt activator after the Wnt boost is about 7 μM or about 7.5 μM.

[0136] In certain embodiments, the concentration of the at least one Wnt activator is increased by about 200%, about 250%, about 300%, about 350%, about 400%, about 450%, about 500%, about 550%, about 600%, about 650%, about 700%, about 750%, about 800%, about 850%, about 900%, about 950%, about 1000%, about 1050%, or about 1100% from the initial concentration contacted or exposed to the cell. In certain embodiments, the concentration of the at least one activator of Wnt signaling contacted with the cell is increased by about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling contacted with the cell.

[0137] In certain embodiments, the concentration of at least one Wnt activator is increased from about 1 μM to about 6 μM. In certain embodiments, the concentration of at least one Wnt activator is increased from about 1 μM to about 3 μM to about 5 μM. In certain embodiments, the concentration of at least one Wnt activator is increased from about 1 μM to about 3 μM.

[0138] In certain embodiments, at least one Wnt activator comprises a GSK3β inhibitor. In certain embodiments, at least one Wnt activator comprises CHIR99021 or a derivative thereof. In certain embodiments, at least one Wnt activator comprises CHIR99021.

[0139] 5.2.4.4.SHH activators As used herein, the term "Sonic hedgehog," "SHH," or "Shh" refers to a protein that is one of at least three proteins in the mammalian signaling pathway family called hedgehogs (another protein is Desert Hedgehog (DHH) and the third is Indian Hedgehog (IHH)). SHH interacts with at least two transmembrane proteins by interacting with the transmembrane molecules Patched (PTC) and Smoothened (SMO). SHH typically binds to PTC, which then allows activation of SMO as a signaling factor. In the absence of SHH, PTC typically inhibits SMO, which in turn activates a transcriptional repressor so that transcription of certain genes does not occur. When SHH is present and bound to PTC, PTC is unable to prevent the function of SMO. When SMO is not inhibited, certain proteins can enter the nucleus and act as transcription factors that allow certain genes to be activated (see Gilbert, 2000 Developmental Biology (Sunderland, Mass., Sinauer Associates, Inc., Publishers)). In certain embodiments, SHH activators refer to any molecule or compound that can activate the SHH signaling pathway, including molecules or compounds that can bind to PTC or SMO. In certain embodiments, at least one SHH activator is selected from the group consisting of molecules that bind to PCT, molecules that bind to SMO, and combinations thereof. Non-limiting examples of SHH activators include those disclosed in WO10 / 096496, WO13 / 067362, Chambers et al., Nat Biotechnol. 2009 Mar;27(3):275-80, and Kriks et al., Nature. 2011 Nov 6;480(7378):547-51. In certain embodiments, the at least one SHH activator is selected from the group consisting of an SHH protein, an SMO agonist, or a combination thereof.In certain embodiments, the SHH protein is selected from the group consisting of recombinant SHH, modified N-terminal SHH, or a combination thereof. In certain embodiments, the recombinant SHH comprises an N-terminal fragment and a C-terminal fragment. In certain embodiments, the modified N-terminal SHH comprises two isoleucines at the N-terminus. In certain embodiments, the modified N-terminal SHH has at least about 80%, about 85%, about 90%, about 95%, or about 99% sequence identity with unmodified N-terminal SHH. In certain embodiments, the modified N-terminal SHH has at least about 80%, about 85%, about 90%, about 95%, or about 99% sequence identity with unmodified human N-terminal SHH. In certain embodiments, the modified N-terminal SHH has at least about 80%, about 85%, about 90%, about 95%, or about 99% sequence identity with unmodified mouse N-terminal SHH. In certain embodiments, the modified N-terminal SHH comprises SHH C25II. In certain embodiments, the modified N-terminal SHH comprises SHH C24II.

[0140] Non-limiting examples of SMO agonists (SAGs) include palmorfamine, GSA10, and 20(S)-hydroxycholesterol. In certain embodiments, the SAG comprises palmorfamine.

[0141] In certain embodiments, the cells are contacted or exposed to at least one SHH activator for about 5, 6, or 7 days. In certain embodiments, the cells are contacted or exposed to at least one SHH activator from day 0 to day 6.

[0142] In certain embodiments, the concentration of at least one SHH activator contacted or exposed to the cells is about 400 ng / mL, about 450 ng / mL, about 500 ng / mL, about 550 ng / mL, or about 600 ng / mL.

[0143] In certain embodiments, the at least one activator of SHH signaling comprises SHH C25II.

[0144] FGF activators The FGF family includes secreted signaling proteins (secreted FGFs) that transmit signals to receptor tyrosine kinases. Phylogenetic analysis suggests that the 22 Fgf genes can be classified into seven subfamilies, each containing two to four members. The branch length is proportional to the evolutionary distance between each gene.

[0145] In certain embodiments, the at least one FGF activator is selected from the group consisting of FGF8a, FGF17, FGF18, FGF8b, FGF2, FGF4, and derivatives thereof. In certain embodiments, the at least one FGF activator is selected from the group consisting of FGF8a, FGF17, FGF18, FGF2, FGF4, and derivatives thereof. In certain embodiments, the at least one FGF activator is selected from the group consisting of FGF8a, FGF17, and FGF18.

[0146] The FGF8 subfamily consists of FGF8a, FGF8b, FGF17, and FGF18. Early patterning of the vertebrate midbrain and cerebellum is regulated by the midbrain / hindbrain organizer, which produces FGF8a, FGF8b, FGF17, and FGF18. It has been shown that FGF8b has a different function than FGF8a, FGF17, and FGF18 (Liu et al., Development. 2003 Dec; 130(25): 6175-85). FGF8b is the only protein that can induce the r1 gene Gbx2, strongly activate the pathway inhibitor Spry1 / 2, and repress the midbrain gene Otx2 (Liu 2003). Furthermore, FGF8b extends the organizer along the junction between the induced Gbx2 domain and the remaining Otx2 region in the midbrain, correlating with cerebellar development (Liu 2003). In contrast, FGF8a, FGF17, and FGF18 cause midbrain expansion and upregulation of midbrain gene expression (Liu 2003).

[0147] In certain embodiments, at least one FGF activator can cause midbrain expansion and upregulate midbrain gene expression. In certain embodiments, at least one FGF activator can promote midbrain development. In certain embodiments, at least one FGF activator is selected from the group consisting of FGF8a, FGF17, FGF18, FGF2, FGF4, their derivatives, and combinations thereof. In certain embodiments, at least one FGF activator is selected from the group consisting of FGF8a, FGF17, FGF18, and combinations thereof. In certain embodiments, at least one FGF activator comprises or is FGF18.

[0148] In certain embodiments, the cells are contacted or exposed to at least one FGF activating agent for about 3 days, about 5 days, or about 8 days. In certain embodiments, the cells are contacted or exposed to at least one FGF activating agent for about 4 days. In certain embodiments, the cells are contacted or exposed to at least one FGF activating agent for 5 days.

[0149] In certain embodiments, contacting or exposing the cells to at least one FGF activator is initiated about 10 days after initial contact or exposure of the cells to at least one SMAD inhibitor, and the cells are contacted with at least one FGF activator for about 5 days. In certain embodiments, contacting or exposing the cells to at least one FGF activator is initiated 12 or 13 days after initial contact or exposure of the cells to at least one SMAD inhibitor, and the cells are contacted with at least one FGF activator for about 4 or 5 days. In certain embodiments, the cells are contacted or exposed to at least one FGF activator from day 12 to day 16.

[0150] In certain embodiments, the concentration of at least one FGF activator contacted or exposed to the cells is about 100 ng / mL or about 200 ng / mL. In certain embodiments, the concentration of at least one FGF activator contacted or exposed to the cells is about 200 ng / mL.

[0151] In certain embodiments, the at least one FGF activator comprises FGF18.

[0152] Wnt inhibitors Wnt signaling includes canonical Wnt signaling and non-canonical Wnt signaling. In certain embodiments, at least one Wnt inhibitor can inhibit canonical Wnt signaling. In certain embodiments, at least one Wnt inhibitor can inhibit both canonical Wnt signaling and non-canonical Wnt signaling. Non-limiting examples of Wnt inhibitors capable of inhibiting both canonical and non-canonical Wnt signaling include IWP2, IWR1-endo, IWP-O1, Wnt-C59, IWP-L6, IWP12, LGK-974, IWR-1, ETC-159, iCRT3, IWP-4, salinomycin, pyrvinium pamoate, iCRT14, FH535, CCT251545, wogonin, NCB-0846, hexachlorophene, KY02111, SO3031(KY01-I), SO2031(KY02-I), BC2059, PKF115-584, quercetin, NSC668036, G007-LK, and derivatives thereof. In certain embodiments, the at least one Wnt inhibitor is selected from the group consisting of IWP2, IWR1-endo, XAV939, IWP-O1, Wnt-C59, IWP-L6, LGK-974, IWR-1, Wnt-C59, ETC-159, iCRT3, IWP-4, ICG-001, salinomycin, pyrvinium pamoate, iCRT14, FH535, CCT251545, KYA1797K, wogonin, NCB-0846, hexacycline, cyclospor ... Selected from the group consisting of sachlorophene, PNU-74654, KY02111, SO3031 (KY01-I), SO2031 (KY02-I), triptonide, IWP12, BC2059, PKF115-584, quercetin, NSC668036, G007-LK, MSAB, LF3, JW55, isoquercitrin, WIKI4 (Wnt inhibitor kinase inhibitor 4), derivatives thereof, and combinations thereof.In certain embodiments, the at least one inhibitor of Wnt signaling is selected from the group consisting of IWP2, IWR1-endo, IWP-O1, IWP12, Wnt-C59, IWP-L6, LGK-974, IWR-1, ETC-159, iCRT3, IWP-4, salinomycin, pyrvinium pamoate, iCRT14, FH535, CCT251545, wogonin, NCB-0846, hexachlorophene, KY02111, SO3031(KY01-I), SO2031(KY02-I), BC2059, PKF115-584, quercetin, NSC668036, G007-LK, derivatives thereof, and combinations thereof. In certain embodiments, the at least one inhibitor of Wnt signaling is selected from the group consisting of XAV939, ICG-001, PNU-74654, triptonide, KYA1797K, MSAB, LF3, JW55, isoquercitrin, WIKI4, derivatives thereof, and combinations thereof. In certain embodiments, the at least one Wnt inhibitor comprises IWP2 or a derivative thereof.

[0153] In certain embodiments, the cells are contacted or exposed to at least one Wnt inhibitor for about 15 days or about 20 days. In certain embodiments, the cells are contacted or exposed to at least one Wnt inhibitor for 4 days, 5 days, 6 days, 7 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, or 23 days.

[0154] In certain embodiments, the cells contacted with at least one Wnt inhibitor include mDA neuron progenitor cells and mDA neurons.

[0155] In certain embodiments, contacting or exposing the cells to at least one Wnt inhibitor is initiated about 10 days after the first contact or exposure of the cells to at least one SMAD inhibitor, and the cells are contacted with the Wnt inhibitor for at least about 5 days. In certain embodiments, contacting or exposing the cells to at least one Wnt inhibitor is initiated 12 or 13 days after the first contact or exposure of the cells to at least one SMAD inhibitor, and the cells are contacted with the at least one Wnt inhibitor for about 4 or 5 days. In certain embodiments, the cells are contacted or exposed to the at least one Wnt inhibitor from day 12 to day 16. In certain embodiments, the cells are contacted or exposed to the at least one Wnt inhibitor from day 12 to day 25. In certain embodiments, the at least one Wnt inhibitor is added to the cell culture medium containing the cells every day or every other day from day 12 to day 25. In certain embodiments, at least one Wnt inhibitor is added to the cell culture medium containing the cells every day or every other day from day 12 to day 30.

[0156] In certain embodiments, the concentration of the at least one Wnt inhibitor contacted or exposed to the cells is about 1 μM.

[0157] In certain embodiments, the at least one Wnt inhibitor comprises IWP2.

[0158] DA neuron lineage-specific activators and inhibitors In certain embodiments, the cell is further contacted with a DA neuron lineage-specific activator and inhibitor to obtain mDA neurons (e.g., postmitotic mDA neurons).Non-limiting examples of DA neuron lineage-specific activators and inhibitors include L-glutamine, brain-derived neurotrophic factor (BDNF), glial cell lineage-derived neurotrophic factor (GDNF), cyclic adenosine monophosphate (cAMP), transforming growth factor beta (TGFβ, e.g., TGFβ3), ascorbic acid (AA), and DAPT (N-[(3,5-difluorophenyl)acetyl]-L-alanyl-2-phenyl]glycine-1,1-dimethylethyl ester; also known as LY-374973, N-[N-(3,5-difluorophenylacetyl)-L-alanyl]-S-phenylglycine t-butyl ester; or N-[N-(3,5-difluorophenylacetyl)-L-alanyl]-S-phenylglycine t-butyl ester).

[0159] In certain embodiments, the cells are contacted with the DA neuron lineage-specific activators and inhibitors for about 4 days, about 5 days, about 6 days, about 7 days, or about 8 days.

[0160] In certain embodiments, the cells are contacted with L-glutamine at a concentration of about 2 mM. In certain embodiments, the cells are contacted with BDNF at a concentration of about 20 ng / mL. In certain embodiments, the cells are contacted with AA at a concentration of about 200 nM. In certain embodiments, the cells are contacted with GDNF at a concentration of about 20 ng / mL. In certain embodiments, the cells are contacted with cAMP at a concentration of about 500 nM. In certain embodiments, the cells are contacted with TGFβ3 at a concentration of about 1 ng / mL. In certain embodiments, the cells are contacted with DAPT at a concentration of about 10 nM.

[0161] 5.3. Composition The present disclosure provides compositions for treating neurodegeneration of midbrain dopamine neurons and / or compositions for treating neurodegenerative disorders. In certain embodiments, the compositions include (i) one or more mDA neurons (e.g., mDA neurons disclosed in Section 5.2.4) and (ii) at least one compound selected from the group consisting of a TNFα inhibitor (e.g., a TNFα inhibitor disclosed in Section 5.2.1), an NFκB inhibitor (e.g., an NFκB inhibitor disclosed in Section 5.2.2), a p53 inhibitor (e.g., a p53 inhibitor disclosed in Section 5.2.3), and combinations thereof.

[0162] In certain embodiments, the one or more mDA neurons and at least one compound are included in a composition that further includes a biocompatible scaffold or matrix (e.g., a biocompatible three-dimensional scaffold that promotes tissue regeneration when the one or more mDA neurons are implanted or grafted into a subject). In certain embodiments, the biocompatible scaffold includes an extracellular matrix material, a synthetic polymer, a cytokine, a collagen, a polypeptide or protein, fibronectin, laminin, keratin, fibrin, fibrinogen, hyaluronic acid, heparin sulfate, chondroitin sulfate, agarose or gelatin, and / or a hydrogel. (See, e.g., U.S. Publication Nos. 2015 / 0159135, 2011 / 0296542, 2009 / 0123433, and 2008 / 0268019, the contents of each of which are incorporated by reference in their entirety). In certain embodiments, the composition further comprises growth factors to promote maturation of the implanted / grafted cells.

[0163] In certain embodiments, the composition comprises about 1×10 4 ~Approx. 1×10 10 , about 1×10 4 ~Approx. 1×10 5 , about 1×10 5 ~Approx. 1×10 9 , about 1×105 ~Approx. 1×10 6 , about 1×10 5 ~Approx. 1×10 7 , about 1×10 6 ~Approx. 1×10 7 , about 1×10 6 ~Approx. 1×10 8 , about 1×10 7 ~Approx. 1×10 8 , about 1×10 8 ~Approx. 1×10 9 , about 1×10 8 ~Approx. 1×10 10 , or about 1 × 10 9 ~Approx. 1×10 10 In certain embodiments, the composition comprises about 1×10 mDA neurons. 5 ~Approx. 1×10 7 Contains mDA neurons.

[0164] In certain embodiments, the composition is frozen. In certain embodiments, the composition further comprises at least one cryoprotectant (such as, but not limited to, dimethyl sulfoxide (DMSO), glycerol, polyethylene glycol, sucrose, trehalose, dextrose, or a combination thereof).

[0165] In certain embodiments, the composition is a pharmaceutical composition comprising a pharma- ceutical acceptable carrier.In certain embodiments, the composition can be used to prevent and / or treat neurodegenerative disorders, including Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), and frontotemporal dementia.In certain embodiments, the composition can be used to improve the neurodegeneration of mDA neurons.

[0166] The present disclosure also provides a device comprising the composition of the present disclosure. The device can be used to administer the composition of the present disclosure. Any suitable administration device can be used in the present disclosure. Non-limiting examples of devices include syringes, fine glass tubes, stereotactic needles, and cannulas.

[0167] 5.4. Treatment method The present disclosure provides a method for treating a subject. In certain embodiments, the subject suffers from neurodegeneration of midbrain dopamine neurons. The present disclosure also provides a method for improving the neurodegeneration of mDA neurons. In certain embodiments, the subject has a neurodegenerative disorder. Non-limiting examples of neurodegenerative disorders include Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), and frontotemporal dementia. The present disclosure further provides a method for preventing and / or treating at least one symptom in a subject with a neurological disorder and / or a subject suffering from neurodegeneration of midbrain dopamine neurons.

[0168] In certain embodiments, the method includes administering to the subject one or more mDA neurons, where p53-mediated apoptosis of one or more mDA neurons is inhibited (e.g., those mDA neurons disclosed in Section 5.2.4). In certain embodiments, the inhibition of p53-mediated apoptosis includes inhibition of tumor necrosis factor alpha (TNFα) signaling (e.g., inhibition of TNFα signaling as disclosed in Section 5.2.1), inhibition of nuclear factor kappa B (NFκB) signaling (e.g., inhibition of NFκB signaling as disclosed in Section 5.2.2), inhibition of p53 signaling (e.g., inhibition of p53 signaling as disclosed in Section 5.2.3), or a combination of the foregoing. In certain embodiments, the inhibition of p53-mediated apoptosis includes administering to the subject at least one compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof. In certain embodiments, the method includes administering to the subject one or more mDA neurons simultaneously with the administration of the compound. In certain embodiments, one or more mDA neurons are contacted with at least one compound before one or more mDA neurons are administered to subject.In certain embodiments, the method comprises administering at least one compound immediately after the administration of one or more mDA neurons.In certain embodiments, the method comprises administering at least one compound before the administration of one or more mDA neurons.

[0169] In certain embodiments, the methods include administering to a subject a composition disclosed in Section 5.3.

[0170] In certain embodiments, the neurodegenerative disorder is Parkinson's disease. The cardinal motor symptoms of Parkinson's disease include, but are not limited to, tremors in the hands, arms, legs, jaw, and face, bradykinesia or slowness of movement, rigidity or stiffness of the limbs and trunk, and postural instability or impaired balance and coordination.

[0171] In certain embodiments, the neurodegenerative disorder is Parkinsonism disease, which refers to a disease associated with a lack of dopamine in the basal ganglia, the part of the brain that controls movement.Symptoms include tremor, bradykinesia (extremely slow movement), flexed posture, postural instability, and rigidity.Non-limiting examples of Parkinsonism disease include corticobasal degeneration, dementia with Lewy bodies, multiple system atrophy, and progressive supranuclear palsy.

[0172] In certain embodiments, one or more mDA neurons and means for inhibiting p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations thereof) can be administered or provided systemically or directly to a subject suffering from neurodegenerative disorders and / or neurodegeneration of midbrain dopamine neurons. In certain embodiments, one or more mDA neurons and means for inhibiting p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations thereof) are directly injected into an organ of interest (e.g., the central nervous system (CNS) or the peripheral nervous system (PNS)). In certain embodiments, one or more mDA neurons and means for inhibiting p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations thereof) are directly injected into the striatum.

[0173] In certain embodiments, one or more mDA neurons and means for suppressing p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations thereof) can be administered in any physiologically acceptable vehicle. In certain embodiments, one or more mDA neurons and means for suppressing p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations thereof) can be administered via local injection, orthotopic (OT) injection, systemic injection, intravenous injection, or parenteral administration. In certain embodiments, one or more mDA neurons and means for suppressing p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations thereof) are administered via orthotopic (OT) injection to a subject suffering from neurodegenerative disorders and / or neurodegeneration of midbrain dopamine neurons.

[0174] In certain embodiments, the means for inhibiting one or more mDA neurons and p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations of the foregoing) can be conveniently provided as a sterile liquid preparation, such as an isotonic aqueous solution, suspension, emulsion, dispersion, or viscous composition that can be buffered to a selected pH. Liquid preparations are usually easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, particularly by injection. Viscous compositions, on the other hand, can be formulated within an appropriate viscosity range to provide a longer contact period with a particular tissue. The liquid or viscous composition can include a carrier, which can be a solvent or dispersion medium, for example, containing water, saline, phosphate buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), and suitable mixtures thereof. Sterile injectable solutions can be prepared by incorporating the subject compositions of the present disclosure (e.g., compositions of Section 5.4) in the required amount of an appropriate solvent with various amounts of other ingredients, as needed. Such compositions may be in admixture with suitable carriers, diluents, or excipients, such as sterile water, saline, glucose, dextrose, and the like. The compositions may also be lyophilized. Depending on the route of administration and the desired preparation, the compositions may contain auxiliary substances, such as wetting agents, dispersing agents, or emulsifying agents (e.g., methylcellulose), pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, dyes, and the like. Standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985 (hereby incorporated by reference), may be consulted to prepare suitable preparations without undue experimentation.

[0175] Various additives can be added to improve the stability and sterility of the composition, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Prevention of microbial activity can be ensured by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. Prolonged absorption of injectable pharmaceutical forms can be brought about by the use of agents delaying absorption, such as aluminum monostearate and gelatin.

[0176] The viscosity of the composition can be maintained at a selected level, if desired, by using a pharma- ceutically acceptable thickening agent. Methylcellulose can be used because it is readily and economically available and easy to handle. Other suitable thickening agents include, for example, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, and the like. The concentration of the thickening agent can depend on the selected drug. The important point is to use an amount that achieves the selected viscosity. The selection of suitable carriers and other additives depends on the exact route of administration and the nature of the particular dosage form, for example, the liquid dosage form (e.g., whether the composition is formulated into a solution, suspension, gel, or another liquid form such as a time-release form or liquid-filled form).

[0177] Those skilled in the art will recognize that the components of the composition should be selected to be chemically inert and not affect the viability or efficacy of the stem cell-derived progenitor cells of the present disclosure. This will not pose any problems to those skilled in the art familiar with chemical and pharmaceutical principles from this disclosure and the documents cited herein, or can be easily avoided by reference to standard textbooks or by simple experimentation (without undue experimentation).

[0178] One consideration regarding therapeutic use of cells and means of inhibiting p53-mediated apoptosis (e.g., TNFα inhibitors, NFκB inhibitors, p53 inhibitors, or combinations of the above) is the amount of cells and inhibitor(s) required to achieve an optimal effect, including, but not limited to, repopulation of CNS and / or PNS regions of a subject suffering from neurodegenerative disorders and / or neurodegeneration of midbrain dopamine neurons, improving the function of midbrain dopamine neurons in a subject, improving the CNS and / or PNS of a subject, and the in vivo survival of cells.

[0179] An "effective amount" (or "therapeutically effective amount") is an amount sufficient to produce a beneficial or desired clinical result upon treatment. An effective amount can be administered to a subject in at least one dose. In terms of treatment, an effective amount is an amount sufficient to palliate, improve, stabilize, reverse, or slow the progression of a neurodegenerative or pituitary disorder, or otherwise reduce the pathological consequences of a neurodegenerative disorder. An effective amount is generally determined by a physician on a case-by-case basis and is within the skill of one of ordinary skill in the art. Several factors are typically considered in determining the appropriate dosage to achieve an effective amount. These factors include the age, sex, and weight of the subject, the condition being treated, the severity of the condition, and the form and effective concentration of the cells to be administered.

[0180] In certain embodiments, the effective amount of cells is sufficient to improve the neurodegeneration of midbrain dopamine neurons.In certain embodiments, the effective amount of cells is sufficient to improve the function of midbrain dopamine neurons in subjects suffering from neurodegenerative disorders and / or neurodegeneration of midbrain dopamine neurons, for example, the improvement of function can be about 1%, about 5%, about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98%, about 99%, or about 100% of the function of midbrain dopamine neurons in normal people.

[0181] In certain embodiments, the effective amount of a means for inhibiting p53-mediated apoptosis (e.g., a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, or a combination of the foregoing) is an amount sufficient to improve the in vivo survival of transplanted mDA neurons.

[0182] The amount of cells administered will vary depending on the subject being treated. In one particular embodiment, about 1×10 4 ~Approx. 1×10 10 , about 1×10 4 ~Approx. 1×10 5 , about 1×10 5 ~Approx. 1×10 9 , about 1×10 5 ~Approx. 1×10 6 , about 1×10 5 ~Approx. 1×10 7 , about 1×10 6 ~Approx. 1×10 7 , about 1×10 6 ~Approx. 1×10 8 , about 1×10 7 ~Approx. 1×10 8 , about 1×10 8 ~Approx. 1×10 9 , about 1×10 8 ~Approx. 1×10 10 , or about 1 × 10 9 ~Approx. 1×10 10 In one particular embodiment, about 1×10 cells are administered to a subject. 5 ~Approx. 1×10 7 In one particular embodiment, about 1×10 cells are administered to a subject suffering from a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons. 6 ~Approx. 1×10 7 In one particular embodiment, about 1×10 cells are administered to a subject suffering from a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons. 6 ~Approx. 4×10 6 The cells are administered to a subject suffering from a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons.

[0183] The precise determination of what is considered an effective dose may be based on individual factors for each subject, including the size, age, sex, weight, and condition of the particular subject. Dosage amounts may be readily ascertained by one of ordinary skill in the art from this disclosure and knowledge in the art.

[0184] Exemplary embodiments A. In certain non-limiting embodiments, the presently disclosed subject matter provides a method for treating a subject comprising administering to the subject one or more midbrain dopamine (mDA) neurons, wherein p53-mediated apoptosis of the one or more mDA neurons is inhibited. A1. The method according to A above, wherein the subject is suffering from a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons. A2. The method according to any one of A to A1 above, wherein the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and combinations thereof. A3. The method according to any one of A to A2 above, wherein the inhibition of p53-mediated apoptosis comprises: a) administering to the subject at least one compound selected from the group consisting of a tumor necrosis factor alpha (TNFα) inhibitor, a nuclear factor kappa B (NFκB) inhibitor, a p53 inhibitor, and combinations thereof; or b) contacting one or more mDA neurons with at least one compound selected from the group consisting of a TNFα inhibitor, a NFκB inhibitor, a p53 inhibitor, and combinations thereof. A4. The method according to any one of A to A3 above, wherein the inhibition of p53-mediated apoptosis comprises administering a TNFα inhibitor to the subject. A5. A method according to any one of A to A4 above, comprising administering one or more mDA neurons simultaneously with the administration of at least one compound. B. In certain non-limiting embodiments, the presently disclosed subject matter provides a method of improving in vivo survival of one or more midbrain dopamine (mDA) neurons, comprising inhibiting p53-mediated apoptosis of one or more mDA neurons. B1. The method according to B above, wherein the inhibition of p53-mediated apoptosis comprises contacting one or more mDA neurons with a compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof. B2. The method of any one of B to B1 above, wherein inhibiting p53-mediated apoptosis comprises contacting one or more mDA neurons with a TNFα inhibitor. C. The method according to A-A5 or B-B2 above, wherein the suppression of p53-mediated apoptosis comprises inhibition of TNFα signaling, inhibition of NFκB signaling, inhibition of p53 signaling, or a combination of the foregoing. C1. TNFα inhibitors include anti-TNFα antibodies, TNFα decoy receptors, chemical compounds, nucleic acid inhibitors, small molecule inhibitors, receptor biological inhibitors, inactive TNF fragments, TNFα circulating receptor fusion proteins, xanthine derivatives, 5-HT 2A The method according to any one of A3, A4, B1, and B2 above, wherein the therapeutic agent is selected from the group consisting of: agonists, and combinations thereof. C2. The method according to C1 above, wherein the TNFα inhibitor is an anti-TNFα antibody. C3. The method of C2 above, wherein the anti-TNFα antibody is selected from the group consisting of adalimumab, adalimumab-adbm, adalimumab-adaz, adalimumab-atto, certolizumab pegol, golimumab, infliximab, infliximab-abda, infliximab-dyyb, lemtolumab, afelimomab, nerelimomab, ozoralizumab, placulumab, and combinations thereof. C4. The method of C3 above, wherein the anti-TNFα antibody is adalimumab. C5. The method according to A3 or B1 above, wherein the NFκB inhibitor is selected from the group consisting of upstream inhibitors of NFκB, inhibitors of IKK activity, inhibitors of IκB phosphorylation, inhibitors of IκB degradation, proteasome inhibitors, protease inhibitors, inhibitors of NFκB nuclear translocation and expression, NFκB DNA binding inhibitors, and NFκB transactivation inhibitors, inhibitors of NFκB-directed gene transactivation, antioxidants, and combinations thereof. C6. The method according to claim A3 or B1, wherein the p53 inhibitor is selected from the group consisting of JNK inhibitors, p38 MAPK inhibitors, caspase inhibitors, puma / BBC3 inhibitors, BAX inhibitors, CDK inhibitors, MDM2 and MDMX activators, and combinations thereof. C7. The method according to any one of A to A5, B to B2, or C to C6 above, wherein the inhibition of p53-mediated apoptosis comprises knocking out or knocking down the TP53 gene in one or more mDAs. C8. The method according to C7 above, wherein the TP53 gene is knocked out or knocked down by a genetic engineering system. C9. The method according to C8 above, wherein the genetic manipulation system is a CRISPR-Cas system. C10. The method of any one of A to A5, B to B2, or C to C9 above, wherein one or more mDA neurons express a marker selected from the group consisting of EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, SATB1, CALB1, CALB2, SNCG, PBX1, and combinations thereof. C11. The method of any one of A to A5, B to B2, or C to C10 above, wherein one or more mDA neurons are post-mitotic mDA neurons. C12. The method according to any one of A to A5, B to B2, or C to C11 above, wherein the one or more mDA neurons are differentiated in vitro from one or more stem cells. C13. The method of C12 above, wherein the one or more stem cells are selected from the group consisting of human stem cells, non-human primate stem cells, rodent non-embryonic stem cells, human embryonic stem cells, non-human primate embryonic stem cells, rodent embryonic stem cells, human induced pluripotent stem cells, non-human primate induced pluripotent stem cells, rodent induced pluripotent stem cells, and human recombinant pluripotent cells, non-human primate recombinant pluripotent cells, and rodent recombinant pluripotent cells. C14. The method of C12 or C13 above, wherein the one or more stem cells are human stem cells. C15. The method according to any one of C12 to C14 above, wherein the one or more stem cells are one or more pluripotent stem cells or multipotent stem cells. C16. The method according to any one of C12 to C15 above, wherein the one or more stem cells are selected from the group consisting of embryonic stem cells, induced pluripotent stem cells, and combinations thereof. C17. The method of C16 above, wherein the one or more stem cells are one or more induced pluripotent stem cells. C18. The method according to any one of C12 to C17 above, wherein the in vitro differentiation comprises contacting one or more stem cells with at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, at least one activator of Sonic hedgehog (SHH) signaling, and at least one activator of wingless (Wnt) signaling. C19. The method of C18 above, wherein the concentration of the at least one activator of Wnt signaling contacted with the cell is increased from about 2 days to about 6 days after initial contact of the cell with the at least one activator of Wnt signaling. C20. The method according to C18 or C19 above, wherein the concentration of the at least one activator of Wnt signaling contacted with the cell is increased by about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling contacted with the cell. C21. The method according to any one of C18 to C20 above, wherein at least one activator of Wnt signaling comprises an inhibitor of glycogen synthase kinase 3β (GSK3β) signaling. C22. The method according to any one of claims C18 to C21, wherein at least one activator of Wnt signaling is selected from the group consisting of CHIR99021, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763, Wnt3A, Wnt1, Wnt5a, derivatives thereof, and combinations thereof. C23. The method according to C22 above, wherein at least one activator of Wnt signaling comprises CHIR99021. C24. The method according to any one of C18 to C23 above, wherein the at least one inhibitor of SMAD signaling comprises an inhibitor of TGFβ / Activin-Nodal signaling, an inhibitor of bone morphogenetic protein (BMP) signaling, or a combination of the foregoing. C25. The method according to C24 above, wherein the at least one inhibitor of TGFβ / Activin-Nodal signaling is selected from the group consisting of SB431542, derivatives of SB431542, and combinations thereof. C26. The method according to C25 above, wherein the derivative of SB431542 includes A83-01. C27. The method according to any one of C24 to C26 above, wherein at least one inhibitor of TGFβ / Activin-Nodal signaling comprises SB431542. C28. The method according to C24 above, wherein at least one inhibitor of BMP signaling is selected from the group consisting of LDN193189, Noggin, Dorsomorphin, derivatives of LDN193189, derivatives of Noggin, derivatives of Dorsomorphin, and combinations thereof. C29. The method according to C28 above, wherein at least one inhibitor of BMP comprises LDN-193189. C30. The method according to any one of the preceding C18 to C29, wherein the at least one activator of SHH signaling is selected from the group consisting of SHH protein, Smoothened agonist (SAG), and combinations thereof. C31. The method according to C30 above, wherein the SHH protein is selected from the group consisting of recombinant SHH, modified N-terminal SHH, and combinations thereof. C32. The method of C31 above, wherein the modified N-terminal SHH comprises two isoleucines at the N-terminus. C33. The method of C31 or C32 above, wherein the modified N-terminal SHH has at least about 90% sequence identity to the unmodified N-terminal SHH. C34. The method of C33 above, wherein the unmodified N-terminal SHH is unmodified mouse N-terminal SHH or unmodified human N-terminal SHH. C35. The method according to any one of C31 to C33 above, wherein the modified N-terminal SHH comprises SHH C25II. The method of claim C30, wherein the SAG comprises palmorfamine. C37. The method of any one of C18 to C36 above, wherein the in vitro differentiation further comprises contacting the one or more stem cells with at least one activator of fibroblast growth factor (FGF) signaling. C38. The method of C37 above, wherein the at least one activator of FGF signaling is selected from the group consisting of FGF18, FGF17, FGF8a, FGF8b, FGF4, FGF2, and combinations thereof. C39. The method of C37 or C38 above, wherein the at least one activator of FGF signaling comprises FGF18 or FGF8. C40. The method of any one of C18 to C39 above, wherein the in vitro differentiation further comprises contacting the one or more stem cells with at least one inhibitor of Wnt signaling. C41. The method according to C40 above, wherein at least one inhibitor of Wnt signaling is selected from the group consisting of IWP2, IWR1-endo, XAV939, IWP-O1, Wnt-C59, IWP-L6, and ICG-001, and combinations thereof. C42. The method of C40 or C41 above, wherein at least one inhibitor of Wnt signaling comprises IWP2. C42. The method of any one of claims A-A5, B-B2, or C-C42, supra, wherein one or more mDA neurons express detectable levels of CD184 and do not express detectable levels of CD49e. D. In certain non-limiting embodiments, the presently disclosed subject matter provides compositions comprising: (a) one or more midbrain dopamine (mDA) neurons; and (b) at least one compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof. D1. The composition described in D above, wherein the composition is a pharmaceutical composition further comprising a pharma- ceutically acceptable carrier. D2. The composition according to D or D1 above, wherein the composition is for treating or ameliorating a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons. D3. The composition described in D2 above, wherein the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and combinations thereof. D4. TNFα inhibitors include anti-TNFα antibodies, TNFα decoy receptors, chemical compounds, nucleic acid inhibitors, small molecule inhibitors, receptor biological inhibitors, inactive TNF fragments, TNFα circulating receptor fusion proteins, xanthine derivatives, 5-HT 2A The composition according to D to D3 above, wherein the composition is selected from the group consisting of agonists, agonists, and combinations thereof. D5. The composition according to D4 above, wherein the TNFα inhibitor is an anti-TNFα antibody. D6. The composition described in D5 above, wherein the anti-TNFα antibody is selected from the group consisting of adalimumab, adalimumab-adbm, adalimumab-adaz, adalimumab-atto, certolizumab pegol, golimumab, infliximab, infliximab-abda, infliximab-dyyb, lemtolumab, afelimomab, nerelimomab, ozoralizumab, plaquemab, and combinations thereof. D7. The composition of D5 above, wherein the anti-TNFα antibody is adalimumab. D8. The composition according to any one of the preceding D to D7, wherein the NFκB inhibitor is selected from the group consisting of upstream inhibitors of NFκB, inhibitors of IKK activity, inhibitors of IκB phosphorylation, inhibitors of IκB degradation, proteasome inhibitors, protease inhibitors, inhibitors of NFκB nuclear translocation and expression, NFκB DNA binding inhibitors, and NFκB transactivation inhibitors, inhibitors of NFκB-directed gene transactivation, antioxidants, and combinations thereof. D9. The composition described in D to D8 above, wherein the p53 inhibitor is selected from the group consisting of a JNK inhibitor, a p38 MAPK inhibitor, a caspase inhibitor, a puma / BBC3 inhibitor, a BAX inhibitor, a CDK inhibitor, an MDM2 and MDMX activator, and combinations thereof. D10. The composition described in D to D9 above, wherein one or more mDA neurons express a marker selected from the group consisting of EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, SATB1, CALB1, CALB2, SNCG, PBX1, and combinations thereof. D11. The composition described in D-D10 above, wherein one or more mDA neurons are post-mitotic mDA neurons. D12. The composition according to D-D11 above, wherein the one or more mDA neurons are differentiated in vitro from one or more stem cells. D13. The composition of D12 above, wherein the one or more stem cells are selected from the group consisting of human stem cells, non-human primate stem cells, rodent non-embryonic stem cells, human embryonic stem cells, non-human primate embryonic stem cells, rodent embryonic stem cells, human induced pluripotent stem cells, non-human primate induced pluripotent stem cells, rodent induced pluripotent stem cells, and human recombinant pluripotent cells, non-human primate recombinant pluripotent cells, and rodent recombinant pluripotent cells. D14. The composition according to D12 or D13 above, wherein the one or more stem cells are human stem cells. D15. The composition according to any one of D12 to D14 above, wherein the one or more stem cells are one or more pluripotent stem cells or multipotent stem cells. D16. The composition according to D12-D14 above, wherein the one or more stem cells are selected from the group consisting of embryonic stem cells, induced pluripotent stem cells, and combinations thereof. D17. The composition according to D16 above, wherein the one or more stem cells are one or more induced pluripotent stem cells. D18. The composition described in D12 to D17 above, wherein the in vitro differentiation comprises contacting one or more stem cells with at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, at least one activator of Sonic hedgehog (SHH) signaling, and at least one activator of wingless (Wnt) signaling. D19. The composition according to D18, wherein the concentration of the at least one activator of Wnt signaling contacted with the cell is increased from about 2 days to about 6 days after the initial contact of the cell with the at least one activator of Wnt signaling. D20. The composition according to any of the preceding D18 or D19, wherein the concentration of the at least one activator of Wnt signaling in contact with the cells is increased by about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling in contact with the cells. D21. A composition according to any one of claims D18 to D20, wherein at least one activator of Wnt signalling comprises an inhibitor of glycogen synthase kinase 3β (GSK3β) signalling. D22. The composition according to any one of D18 to D21 above, wherein at least one activator of Wnt signaling is selected from the group consisting of CHIR99021, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763, Wnt3A, Wnt1, Wnt5a, derivatives thereof, and combinations thereof. D23. The composition according to D22 above, wherein at least one activator of Wnt signaling comprises CHIR99021. D24. A composition described in D18 to D23 above, wherein at least one inhibitor of SMAD signaling comprises an inhibitor of TGFβ / Activin-Nodal signaling, an inhibitor of bone morphogenetic protein (BMP) signaling, or a combination of the above. D25. The composition according to D24 above, wherein at least one inhibitor of TGFβ / Activin-Nodal signaling is selected from the group consisting of SB431542, derivatives of SB431542, and combinations thereof. D26. The composition according to D25 above, wherein the derivative of SB431542 comprises A83-01. D27. The composition according to D25 above, wherein at least one inhibitor of TGFβ / Activin-Nodal signaling comprises SB431542. D28. The composition according to any one of D24 to D27 above, wherein at least one inhibitor of BMP signaling is selected from the group consisting of LDN193189, Noggin, Dorsomorphin, derivatives of LDN193189, derivatives of Noggin, derivatives of Dorsomorphin, and combinations thereof. D29. The composition according to D28 above, wherein at least one inhibitor of BMP comprises LDN-193189. D30. The composition according to any one of D19 to D29 above, wherein the at least one activator of SHH signaling is selected from the group consisting of SHH protein, Smoothened agonist (SAG), and combinations thereof. D31. The composition according to D30 above, wherein the SHH protein is selected from the group consisting of recombinant SHH, modified N-terminal SHH, and combinations thereof. D32. The composition according to D31 above, wherein the modified N-terminal SHH comprises two isoleucines at the N-terminus. D33. The composition according to D31 or D32 above, wherein the modified N-terminal SHH has at least about 90% sequence identity with the unmodified N-terminal SHH. D34. The composition according to D33 above, wherein the unmodified N-terminal SHH is unmodified mouse N-terminal SHH or unmodified human N-terminal SHH. D35. The composition according to any one of D31 to D34 above, wherein the modified N-terminal SHH comprises SHH C25II. D36. The composition according to D30 above, wherein the SAG comprises palmorfamine. D37. The composition according to any of D18 to D36 above, wherein the in vitro differentiation further comprises contacting the one or more stem cells with at least one activator of fibroblast growth factor (FGF) signaling. D38. The composition according to D37 above, wherein at least one activator of FGF signaling is selected from the group consisting of FGF18, FGF17, FGF8a, FGF8b, FGF4, FGF2, and combinations thereof. D39. The composition according to D37 or D38 above, wherein at least one activator of FGF signalling comprises FGF18 or FGF8. D40. The composition according to any of D18 to D39 above, wherein the in vitro differentiation further comprises contacting the one or more stem cells with at least one inhibitor of Wnt signaling. D41. The composition described in D40 above, wherein at least one inhibitor of Wnt signaling is selected from the group consisting of IWP2, IWR1-endo, XAV939, IWP-O1, Wnt-C59, IWP-L6, and ICG-001, and combinations thereof. D42. The composition according to D40 or D41 above, wherein at least one inhibitor of Wnt signalling comprises IWP2. D43. The composition according to any of the preceding D-D42, wherein one or more mDA neurons express detectable levels of CD184 and do not express detectable levels of CD49e. EXAMPLES

[0185] The present disclosure will be better understood by reference to the following examples, which are provided by way of illustration and not limitation of the subject matter of the present disclosure.

[0186] Example 1 - Manipulation of the TNF-NFκB-p53 axis for survival of enriched hPSC-derived post-mitotic dopamine neurons in vivo. One challenge in developing hPSC-based cell therapy in PD is to exclude contaminating cell types such as non-dopaminergic neurons and a range of non-neuronal lineages within the graft. Studies using fetal tissue transplants have resulted in graft-induced dyskinesias (GIDs) as an unexpected side effect in some patients (Dorsey et al., 2018, J Parkinsons Dis 8, S3-S8), and it has been suggested that GIDs may be caused by contamination of serotonergic neurons in fetal grafts (Politis et al., 2010, Sci Transl Med 2, 38ra46). Recent hPSC-based studies have highlighted the presence of potential other contaminants in transplants of dopamine neurons, such as contamination of TTR+ positive choroid plexus epithelial cells (Doi et al., 2020, Nat Commun 11, 3369) or the presence of perivascular fibroblast-like populations, in rare cases.

[0187] Surface marker sorting strategies have been proposed to enrich mid- or late-stage floor plate dopamine progenitor cells for transplantation, but none of these markers are specific for the dopamine neuron lineage. First-in-human clinical trials using transplants of hPSC-derived dopamine neurons are based on transplanting dopamine neuron progenitor cells rather than postmitotic dopamine neurons as the cell type of choice (Doi et al., 2020, Nat Commun 11, 3369; Kirkeby et al., 2017, Cell Stem Cell 20, 135-148; Piao et al., 2021, Cell Stem Cell 28, 217-229 e217; Schweitzer et al., 2020, N Engl J Med 382, ​​1926-1932). However, given the limited understanding of long-term risks and potential side effects that may arise from "off-target" or non-neuronal populations, it may be ideal to transplant a homogenous population of post-mitotic dopamine neurons to minimize safety-related concerns.

[0188] Pooled genetic screens using CRISPR / Cas9 technology are becoming the technique of choice to uncover causative genes driving specific phenotypes in an unbiased manner (Shalem et al., 2015, Nat Rev Genet 16, 299-311). This approach has been widely adopted for in vitro studies, but is also essential for discovering genes essential for in vivo tumor growth and metastasis (Chen et al., 2015, Cell 160, 1246-1260), modulators of macrophage infiltration and targets for cancer immunotherapy (Wang et al., 2021, Cell 184, 5357-5374 e5322), and in vivo colon tumor suppressors (Michels et al., 2020, Cell Stem Cell 26, 782-792 e787). Here, the subject matter of the present disclosure aims to systematically identify candidate mechanisms driving the death of transplanted cellular dopamine neurons using CRISPR-Cas9 technology. Purified Nurr1::H2B-GFP+ postmitotic dopamine neurons were used for this screen to avoid confounding factors such as dopamine neuron progenitor proliferation, and ultimately to identify conditions that may enable efficient transplantation of postmitotic neurons in a translational setting. Barcode sequencing identified the critical role of TP53 in limiting the survival of postmitotic dopamine neurons after transplantation. Furthermore, the kinetics of p53 induction upon transplantation, and the subsequent recruitment of host neuroimmune cells to dying neurons, were mapped and examined. Transcriptome analysis revealed TNFα-mediated activation of NFκB as one of the main upstream regulators of p53-mediated dopamine neuron death. To further exploit these insights towards translational use, a set of two cell surface markers was identified that reliably enrich for postmitotic dopamine neurons, thereby circumventing the need for a genetic reporter system. Furthermore, it has been demonstrated that the use of an FDA-approved monoclonal antibody that blocks TNFα (adalimumab) can dramatically improve postmitotic dopamine neuron survival, mimicking the results observed in TP53-null dopamine neurons.This example provides a better understanding of the mechanisms driving postmitotic dopamine neuron death upon transplantation and establishes a clinically relevant strategy for future implementation in cell-based therapy approaches for PD.

[0189] method Cell lines. The H9 (WA-09, passages 40–60) human pluripotent stem cell (hPSC) line was used throughout the study. This line has been engineered to generate Nurr1::GFP hPSCs and doxycycline-inducible CRISPR / Cas9 expression in the Nurr1::GFP hPSC line (iCas9 / NURR1::GFP hPSC), as well as the Nurr1::GFP reporter hPSC and doxycycline-inducible CRISPR / Cas9 expression in the iCas9 / NURR1::GFP hPSC line containing sgRNA pooled libraries and sgRNAs against dTomato and p53. hPSCs were grown in feed-free conditions on vitronectin (VTN-N; Thermo Fisher Scientific)-coated dishes in E8 essential medium and maintained at 37 °C and 5% CO2. This study was approved by Tri-I (MSKCC, Weil-Cornell, Rockefeller University) Embryonic Stem Cell Oversight (ESCRO).

[0190] Construction of Nurr1:GFP and CRISPR / Cas9 inducible expression in Nurr1:GFP hESC line. The generation of Nurr1::GFP hESC line was previously reported (Riessland et al., 2019, Cell Stem Cell. Oct 3;25(4):514-530.e8). Briefly, the stop codon of endogenous NR4A2 (Nurr1) was replaced with an EGFP expression cassette (P2A-H2B-PgkPuro) by using a CRISPR / CAS9-mediated knock-in approach. The resulting NURR1:GFP +The cells express approximately TH (mature mDA marker; 98%) based on single-cell qRT-PCR. To generate doxycycline-inducible CRISPR / Cas9 expression in Nurr1::GFP hPSC lines (iCas9 / NURR1::GFP hPSC lines), a pair of TALENs targeting the AAVS locus, Neo-M2rtTA donor and Hygro-Cas9 donor (Addgene #86883), were transfected into Nurr1::GFP hPSCs using Nucleofector (Lonza, B-016 program) on an AMAXA machine to generate stable cell lines according to published protocols. Briefly, 2 days after transfection, clonally expanded hPSCs were selected by treatment with neomycin and hygromycin (100 μg / ml) for 1 week. After exposure to Dox (1 μg / ml) for 3 days, inducible expression of Cas9 in each clone was confirmed by immunofluorescence staining with Cas9 antibody.

[0191] Single-stranded guide RNA (sgRNA) design and cloning. sgRNA sequences of the pooled library were identified by Guidescan (MSKCC) and sgRNA oligos were synthesized on-Chip (Agilent). Synthesized oligos were PCR amplified and amplicons were restriction cloned into SGL40C.EFS.dTomato (Addgene #89395). Library representation was assessed by NGS (Illumina). Individual sgRNAs for dTomato and p53, designed by a web-based tool (http: / / crispor.tefor.net) and then designed using Guidescan (MSKCC), were restriction cloned into the SGL40C.EFS.dTomato plasmid vector (Addgene #89395).

[0192] Lentivirus production and transduction. The SGL40C.EFS.dTomato vector containing the library, dTomato, and sgRNA against p53 was co-transfected with the packaging vector, psPAX2 (Addgene #12260), and pMD2.G (Addgene #12259) into HEK293T cells using Xtream Gene 9 transfection reagent (Sigma). Virus was harvested 2 days after transfection and used to infect iCas9 / NURR1::GFP hPSCs. Two days after infection, dTomato-expressing hPSCs were sorted using flow cytometry-associated cell sorting (FACS) at the Flow Cytometry Core Facility at MSKCC. Sorted hPSCs were cultured and maintained for subsequent experiments until use.

[0193] hESC Differentiation into DA Neurons. Midbrain dopaminergic neuron differentiation was performed using H9 hESCs containing Nurr1::GFP. hESCs were grown on 6-well plates coated with VTN-N (Thermo Fisher Scientific) in E8 essential medium. Cells were maintained at 37°C and 5% CO2. hESCs were differentiated using optimized protocols from previously reported studies (Kim et al., 2021, Cell Stem Cell Feb 4;28(2):343-355.e5; Riessland et al., 2019, Cell Stem Cell.Oct 3;25(4):514-530.e8). Flow cytometry-associated cell sorting (FACS) was used to sort GFP- and dTomato-expressing dopamine neurons on day 25 of differentiation from hPSC iCas9 / NURR1::GFP hPSC line containing sgRNA pool library and sgRNA against dTomato and p53 hPSC. Sorted hPSC were either injected into mice or cultured for subsequent experiments until use. Furthermore, a double sorting approach by CD49e-low and CD184-high was applied to enrich postmitotic dopamine neurons on day 25 of differentiation derived from hPSC using FACS, and sorted cells were used for transplantation and in vitro culture. TNF-a neutralizing antibody was used either for co-injection (1 mg / ml) or in vitro cultured dopamine neurons (10 μg / ml).

[0194] sgRNA barcode sequencing and analysis to identify targets. Cell pellets were lysed at each desired time point and genomic DNA was extracted (Qiagen) and quantified by Qubit (Thermo Scientific). Amounts of gDNA covering 1000-fold representation of sgRNAs were PCR amplified to add Illumina adapters and multiplexed barcodes. Amplicons were quantified by Qubit and Bioanalyzer (Agilent) and sequenced on an Illumina HiSeq 2500. Sequencing reads were aligned to the screened library and counts were obtained for each gRNA. The quality of the resulting single-end reads was checked (FastQC v0.11.5) and processed using the Digital Expression Explorer 2 (DEE2) workflow. Adapter trimming was performed with Skewer (v0.2.2). Further quality control was performed with Minion, part of the Kraken package. Differential gRNA hits were identified using EdgeR, a Bioconductor package, to identify primary hits. Trimmed mean M values ​​were used for normalization, and glmQLFTest / F-test was used for statistical testing. Additionally, the camera analysis function from EdgeR was used for gene-level analysis, as previously described. To calculate correlations between screening samples, quantification was normalized by estimateSizeFactorsForMatrix in DESeq2 using only non-targeting controls and safe harbor probes. Pairwise Pearson correlations were plotted using the R package pheatmap (https: / / CRAN.R-project.org / package=pheatmap).

[0195] Intracranial transplantation. hESCs-derived DA neurons, sorted based on either NURR1::H2B-GFP or CD49e-low and CD184-high, were resuspended at 100,000 ± cells / µL in neurobasal medium containing 200 mM L-glutamine and 100 mM ascorbic acid (AA) transplantation medium (without human albumin or 25% ketoglutamine). Unless specified, 3–4 µL of sorted neurons were injected into the striatum of 6–8 week-old male NSG mice at a rate of 0.5–1 µL per deposit ([AP] +0.5 mm, [ML] + / -1.8 mm, [DV] -3.4–3.3 mm from dura). Each surgery did not exceed 30 min per animal, and the total surgery time was within 8–10 h after cell preparation. For short-term 1-month survival studies, p53 WT (-dox) vs. KO (+dox) NURR1::GFP+ dopamine neurons or CD4+PBS vs. CD4+adalimumab were implanted bilaterally into the striatum of the same mouse brain to reduce inter-animal variability. For other studies, including time-course or behavioral studies, cells are implanted unilaterally. For time-course experiments, mice were euthanized and used for immunohistochemistry analysis at the indicated time points (4 h, 1 day, 3 days, and 7 days after implantation). For in vivo CRISPR screening, the maximum loadable amount of cells is implanted at a cell density of 200,000 ± 10,000 cells / μL (4 μL total in each striatum) to have sufficient expression of guide RNA.

[0196] DNA extraction from xenograft samples and detection of human DNA. One-month transplanted dopamine neurons were isolated from thick tissue slices based on the expression of NURR1::GFP and sgRNA::Tomato, and genomic DNA was extracted using the DNeasy Tissue kit according to the manufacturer's protocol (Qiagen #69556). To detect human DNA from the extracted genomic DNA, PCR was performed using the Q5 High-Fidelity PCR kit (NEB #M0493S) with human and mouse specific primers for PTGFR2 and ptgfr2 to detect human and mouse cells. The primer sequences are as follows: Human PTGFR2 primer 5': GCTGCTTCTCATTGTCTCGG (SEQ ID NO: 539) Human PTGFR2 primer 3': GCCAGGAGAATGAGGGTGGTC (SEQ ID NO: 540) Mouse ptgfr2 primer 5': CCTGCTGCTTATCGTGGCTG (SEQ ID NO: 541) Mouse ptgfr2 primer 3':GCCAGGAGAATGAGGTGGTC (SEQ ID NO:542)

[0197] 6-OHDA Mouse Model. Briefly, adult female and male NSG mice (6-12 weeks old) were anesthetized with 1%-2% isoflurane mixed in oxygen. 1 μL of 6-OHDA (3 mg / ml in saline with 1% ascorbic acid) was directly injected into the right side of the substantia nigra (anterior-posterior [AP] = -2.9 mm, lateral [ML] = 1.1 mm, vertical [DV] = 4.5 mm from dura) at a rate of 0.5-1 μL per minute to generate a unilateral toxoparkinsonian mouse model. Animals with amphetamine-induced rotations >6 rotations per minute were selected for cell transplantation 4 weeks after 6-OHDA lesion surgery. Animals were randomly grouped and transplanted with CD-sorted neurons vs. CD-sorted neurons + adalimumab vs. PBS (sham-operated controls).

[0198] d-Amphetamine-induced rotation behavior assay. Amphetamine-induced rotation tests were performed twice before implantation and at 1, 2, 3, 4, 5, and 6 months after implantation. Mice were intraperitoneally injected with d-amphetamine (Sigma, 10 mg / kg) in saline. After 10 min, rotation was observed.

[0199] Immunohistochemistry Histology on tissues from mice was performed on frozen sections from xenografts. Mice were anesthetized with pentobarbital and perfused transcardially using heparinized (10 U / mL) PBS (pH 7.4) followed by 4% paraformaldehyde in PBS. Fluid is administered using a peristaltic pump to control the rate of solution delivery to the whole body. Tissues were fixed after 18 hours in ice-cold 4% paraformaldehyde and transferred to 30% sucrose (until tissues sunk, typically 3-6 days later) and subsequently snap frozen in OCT (Fisher Scientific, Pittsburgh, PA) or Neg-50 (Thermo Scientific). All brain tissues were sectioned into 30 μm thick coronal sections using a cryostat and mounted on Superfrost plus microscope slides (Fisher Scientific). All slides are stored at -80°C for extended periods until use. For immunolabeling, tissues were washed twice with 1x PBS, followed by permeabilization in 0.5% Triton X-100 in PBS for 10 min. Live cells in culture were directly fixed in 4% paraformaldehyde for 18 min, followed by permeabilization in 0.5% Triton X-100 in PBS for 10 min. For labeling, cells or tissue sections were immunostained with the primary antibody of interest in 2% BSA in 0.25% Triton X-100 in PBS overnight at 4°C. The next day, the appropriate Alexa Fluor secondary antibody was conjugated at a dilution of 1:1,000 for 1 h at room temperature. Nuclei were counterstained with DAPI.

[0200] Tissue immunohistochemistry (IHC), TUNEL, and H&E staining. H&E and IHC on tissues from mice were performed on FFPE (formalin-fixed paraffin-embedded) sections from xenografts. Mice were anesthetized with pentobarbital and perfused transcardially using heparinized (10 U / mL) PBS (pH 7.4) followed by 10% formalin in PBS. Fluid is administered using a peristaltic pump to control the rate of solution delivery to the whole body. Tissues were post-fixed in 10% formalin for 24-48 hours at room temperature (may be left in 10% formalin for up to 1 week) and transferred directly to 70% ethanol. Histology was performed by HistoWiz Inc. (histowiz.com) using standard operating procedures and a fully automated workflow. Samples were embedded in paraffin and sectioned at 4 μm. Immunohistochemistry was performed on a Bond Rx autostainer (Leica Biosystems) with heat-mediated antigen retrieval using epitope retrieval solution 1 (Leica Biosystems). Primary antibodies used were rabbit polyclonal total NFkB (Cell Signaling, CST8242, 1:300), cleaved caspase-3 (Cell signaling, CST9661, 1:300), p53 (CM5P, 1:500), and p-NFkB (GTX55113, 1:5000), followed by anti-rabbit HRP-conjugated polymer system. Bond Polymer Refine Detection (Leica Biosystems) was used according to the manufacturer's protocol. After staining, sections were dehydrated and film coverslipped using TissueTek-Prisma and Coverslipper (Sakura). Whole slide scanning (40 times) was performed on an Aperio AT2 (Leica Biosystems). For TUNEL: Standardized conditions using the Leica Bond Polymer Refine detection kit (DS9800), Promega DeadEnd colorimetric detection system (G3250), 10 min enzymatic digestion. For H&E, staining was performed with the Sakura Autostainer.Briefly, slides are deparaffinized with two changes of xylene, two changes of 100% alcohol, one change of 95% alcohol, and washed with water. Slides are arranged in the following order: hematoxylin, water rinse, define solution, water rinse, bleach solution, water rinse, 95% alcohol, eosin, and 95% alcohol. Finish with two changes of 100% alcohol and two changes of xylene.

[0201] RNA extraction and real-time quantitative reverse transcription PCR (qRT-PCR). Total RNA samples were prepared from DNase I-treated cells using TRIzol according to the manufacturer's instructions. Delta-delta cycle threshold (ΔΔCT) was determined relative to GAPDH levels and normalized to control samples. Error bars indicate the standard deviation of the mean from three biological replicates. The sequences of qRT-PCR primers are shown below. Human GAPDH primer 5': ATGTTCGTCATGGGTGTGAA (SEQ ID NO: 543) Human GAPDH primer 3': AGGGGTGCTAAGCAGTTGGT (SEQ ID NO: 544) Human FOXA2 primer 5': CCGACTGGAGCAGCTACTATG (SEQ ID NO: 545) Human FOXA2 primer 3': TACGTGTTCATGCCGTTCAT (SEQ ID NO: 546) Human NURR1 primer 5': CGCTTCTCAGAGCTACAGTTAC (SEQ ID NO: 547) Human NURR1 primer 3': TGGTGAGGTCCATGCTAAAC (SEQ ID NO: 548) Human PUMA primer 5': CCTGGAGGGTCCTGTACAATCT (SEQ ID NO: 549) Human PUMA primer 3':TCTGTGGCCCCTGGGTAAG (SEQ ID NO:550) Human TP53 primer 5': GTACCACCATCCACTACAACTAC (SEQ ID NO: 551) Human TP53 primer 3': CACAAACACGCACCTCAAAG (SEQ ID NO: 552)

[0202] Protein isolation and Western blot analysis. Cells treated with PBS or monoclonal antibody against TNFα were harvested and lysed in the following lysis buffer (RIPA buffer, 1:1000 Halt™ protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific)). After resuspending the cells in lysis buffer, the cells are sonicated 3×30 sec at 4° C. The supernatant was collected by centrifugation for 15 min (>15,000 rpm at 4° C.) and protein concentration was measured using Precision Red Advanced Protein Assay (Cytoskeleton). Equal amounts of protein (20 micrograms) were boiled at 95° C. for 5 min in NuPAGE LSD sample buffer (Invitrogen) and separated using NuPAGE 4%-12% Bis-Tris protein gels (Invitrogen) in NuPAGE MES SDS running buffer (Invitrogen). Proteins were electrophoretically transferred to nitrocellulose membranes (Thermo Fisher Scientific) using NuPAGE transfer buffer (Invitrogen). Blots were blocked in 5% nonfat milk (Cell Signaling) in TBS-T+ for 60 min at room temperature and incubated with the respective primary antibodies overnight at 4°C. The following primary antibodies were used: mouse anti-GAPDH (6C5) (Santa Cruz, 1:1000), mouse anti-p53 (DO-1) (Santa Cruz, 1:1000), rabbit anti-tyrosine hydroxylase (Pel Freeze, 1:1000). Primary antibodies were detected using secondary anti-rabbit IgG HRP-conjugated (Cell Signaling, 1:1,000) or anti-mouse IgG HRP-conjugated (Cell Signaling, 1:1,000) with SuperSignal™ West Femto chemiluminescent substrate (Thermo Fisher Scientific).

[0203] RNA-Seq of NURR1-GFP 1 day after transplantation +One day after intracranial injection of signal-sorted mDA neurons, mice were euthanized and the injection site was grossly dissected and processed for papain dissociation (Worthington). Dissociated xenograft samples (day 1 in vitro) along with in vitro cultured neurons were simultaneously subjected to FACS to re-isolate dopamine neurons based on endogenous reporter signals. Total RNA was extracted with TRIzol (Invitrogen) according to the manufacturer's instructions. RNAseq libraries of polyadenylated RNA were prepared using the TruSeq Stranded mRNA Library Preparation Kit (Illumina) according to the manufacturer's instructions and sequenced on an Illumina NextSeq 500 platform. The quality of the obtained single-end reads was checked (FastQC v0.11.5), and processed RNAseq libraries of polyadenylated RNA were prepared using the TruSeq Stranded mRNA Library Preparation Kit (Illumina) according to the manufacturer's instructions and sequenced on an Illumina NextSeq 500 platform. Filtered reads were mapped to the human reference genome hg19 using STAR aligner (version 2.5.0a). Expression data at coding sequences were quantified using GENCODE version 38 transcriptome and HTSeq version 1.99.2 (Anders et al., 2015, Bioinformatics, 31(2):166-9). Differential expression analysis was performed using a negative binomial distribution statistical model using DESeq2 version 1.30.1 (Love et al., 2014, Genome Biol 15(12):550). Enrichment analysis using various reference data was performed using clusterProfiler version 4.2.1 (Yu et al., 2012, OMICS 16(5):284-7; Wu et al., 2021, Innovation (NY) 2(3):100141).

[0204] Single-cell transcriptome sequencing. Single-cell suspensions were stained with trypan blue and assessed for both cell number and viability using a Countess II automated cell counter (ThermoFisher). Following QC, single-cell suspensions were loaded onto a Chromium Chip B (10X Genomics PN 2000060) and GEM generation of 3,900-5,300 cells, cDNA synthesis, cDNA amplification, and library preparation proceeded using the Chromium Single Cell 3' Reagent Kit v3 (10X Genomics PN 1000075) according to the manufacturer's protocol. cDNA amplification included 12 cycles and sequencing libraries were prepared using 12 cycles of PCR using 88-99 ng of material. Index libraries were pooled equimolarly and sequenced on a NovaSeq 6000 in a PE28 / 91 paired-end run using the NovaSeq 6000 S1 reagent kit (100 cycles) (Illumina). An average of 94 million paired reads were generated per sample.

[0205] Single-cell analysis. Samples underwent 10X chromium Single Cell 3'v3 processing. Reads were aligned to human GRCh38 (GENCODE v32 / Ensembl 98) using Cell Ranger 5.0.0. The resulting filtered count matrix was further filtered for i) minimum 1000 UMI counts, ii) 500 <= gene count <= 7000, and iii) cells with mitochondrial gene percentage < 25%. Normalization by deconvolution in scran version 1.22.1 was performed and signals from cell cycle related gene expression were regressed according to instructions in Seurat version 4.1. A default set of 2000 highly variable genes was selected and the first 50 principal components were extracted from the cell cycle regression matrix. Shared neighborhoods were then calculated from the principal components using buildSNNGraph in the R software scran with a k parameter of 40. Seven clusters were identified using the walktrap algorithm with the function cluster_walktrap in the R implementation of the igraph package version 1.3.5. Uniform manifold approximation and projection (UMAP) was performed. Differential gene expression was performed via the Seurat package using MAST. Cluster annotation was performed via differential expression using the clusterProfiler package version 4.2.2 and EnhancedVolcano version 1.12.0.

[0206] Stereological analysis. For short-term survival studies, unbiased stereological counts of NURR1::H2B-GFP DA neurons in the striatum (AP+0.5, ML+ / -1.8, DV-3.4 to 3.3 (from dura)) were performed using stereological principles and analyzed with StereoInvestigator software (Microbrightfield, Williston, VT, USA) as previously described. For long-term behavioral studies, unbiased stereological counts of TH-positive DA neurons in the striatum were performed. Tissues were embedded in OCT or Neg-50 and sections were sliced ​​at 30 μm. Optical fractionator sampling was performed with an Olympus BX61 microscope equipped with a motorized stage and an Olympus 40× objective. Graft areas were outlined based on NURR1::GFP immunolabeling with reference to a coronal atlas of the mouse brain. Every 3rd to 10th section (depending on total thickness of the graft) from the start of the graft to the end of the graft was randomly and systematically selected for analysis. For each tissue section analyzed, section thickness was assessed at each sampling site, and a guard zone of 1 μm was used at the top and bottom of each section. A pilot study was used to determine suitable counting frame and sampling grid dimensions prior to counting to achieve sufficient power and low Gunderson coefficient variance. The following stereological parameters were used in the final study: for the optical fractionator probe, 65 μm × 65 μm optical disector, 100 μm × 100 μm SRS (or 10% of ROI), 20 μm optical disector height, and 1 μm guard zone. For the cavalier estimator probe, 50 μm × 50 μm grid spacing, 0 degree grid rotation, and 30 μm section thickness. At least 2 to 8 sections were evaluated for analysis. For all conditions, the Gundersen coefficient of error was less than 0.1. Stereological estimation was performed with the same parameters for all experimental conditions, p53 KO vs. WT (NURR1::GFP selection) or TNFα monoclonal antibody treatment vs. PBS (CD selection).

[0207] High-throughput cell surface marker screening and enrichment of dopamine neurons by using cell surface markers. Day 25 dopamine neuron differentiated cells from NURR1::GFP reporter hESCs were single cell suspended in flow cytometer staining buffer (PBS containing 2% bovine serum albumin). Cells were stained with 387 cell surface (CD) markers (0.2M cells per CD marker) for 30 minutes on ice in the dark. After washing three times with PBS, cells were co-stained with DAPI. All staining for screening was performed in 96-well plates. Data collection using a flow cytometer to identify CD markers to enrich the GFP-positive population was performed by the MSKCC Flow Cytometry Core Facility. To enrich for dopamine neurons using CD4 markers 49e and 184, day 25 cells were stained with 49e and / or 184, followed by isolation of 49e weak expressing cells, 49e weak and 174 high expressing cells, and 49e weak and 184 high expressing cells by FACS at the MSKCC Flow Cytometry Core Facility.

[0208] Transcriptome sequencing. After RiboGreen quantification and quality control with an Agilent BioAnalyzer, 0.5–1 ng of total RNA with RNA integrity numbers ranging from 6.1–10 was amplified using the SMART-Seq v4 Ultra Low Input RNA kit (Clonetech #63488) with 12 cycles of amplification. Libraries were subsequently prepared with the KAPA Hyper prep kit (Kapa Biosystems KK8504) using 1.6–10 ng of amplified cDNA with 8 cycles of PCR. Samples were barcoded and run on a HiSeq 4000 or NovaSeq 6000 in a PE50 run using a HiSeq 3000 / 4000 SBS kit or NovaSeq 6000 S1 reagent kit (100 cycles) (Illumina). An average of 56 million paired reads were generated per sample, and the percentage of mRNA bases per sample ranged from 48% to 76%.

[0209] Quantitative and statistical analysis. N=3 independent biological replicates were used for all experiments unless otherwise indicated. ns indicates non-significant differences. P values ​​were calculated by unpaired two-tailed Student's t-test unless otherwise indicated. *p<0.05, **p<0.01, and ***p<0.001.

[0210] result An in vivo CRISPR / Cas9 screen uncovered regulators of postmitotic dopamine neuron death. An in vivo CRISPR-Cas9 screen was developed to systematically address intrinsic factors that limit the survival of hPSC-derived postmitotic dopamine neurons. Previously, we demonstrated that NURR1 serves as a reliable marker for early postmitotic dopamine neurons derived from hPSCs under a floor plate differentiation paradigm (Riessland et al., 2019, Cell Stem Cell 25, 514-530 e518). FACS-based purification of NURR1::GFP positive cells yielded a nearly pure population of dopamine neurons in culture (Riessland et al., 2019, Cell Stem Cell 25, 514-530 e518) (Figure 1A; Figure 19A), giving rise to highly homogenous and dense dopamine neuron grafts in vivo as indicated by TH, despite an overall viability of approximately less than 5% derived from the endogenous NURR1::GFP hPSC reporter line (Figures 1B and 1G; Figure 3D; Figures 19B and 19F). Using this established NURR1::H2B-GFP reporter hPSC, the subject matter of the present disclosure further engineered an inducible Cas9 (iCas9) (e.g., doxycycline-inducible expression of Cas9) hPSC line integrated into the safe harbor locus, the AAVS locus, via TALEN-mediated gene targeting (iCas9 / NURR1::H2B-GFP hPSC line) (Figure 2A; Figure 12A). To determine the efficiency of iCas9 for gene knockout in the culture system of the present disclosure, sgRNA targeting tdTomato was stably integrated into the iCas9 / NURR1::H2B-GFP hPSC line. Using a clinical-grade protocol, efficient loss of tdTomato signal (Figure 1E; Figure 19E) was observed without disrupting dopamine neuron induction, as indicated by the expression of NURR1 and FOXA2, upon treatment with doxycycline from day 16 to day 25 during dopamine neuron differentiation. This enabled screening of the CRISPR / Cas9 loss-of-function pool in hPSC-derived postmitotic dopamine neurons.

[0211] Next, a pooled lentiviral custom-designed library of 550 sgRNAs (3 sgRNAs per gene) targeting a total of 150 genes associated with cell death pathways such as apoptosis, necroptosis, pyroptosis, ferroptosis, and autophagy, as well as 50 non-targeting and 50 safe harbor control guides, was stably introduced into the iCas9 / NURR1::H2B-GFP hPSC line (iCas9 / NURR1::H2B-GFP / library) (Tables 1 and 2). [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12]

[0212] Screening of pooled lentivirus requires a multiplicity of infection (MOI) of less than 1 for single copy sgRNA integration per cell (Figure 1C; Figure 19C). iCas9 / NURR1::H2B-GFP / library hPSCs were then differentiated into dopamine neurons using established protocols. On day 25 of differentiation, 800,000 homogenous postmitotic dopamine neurons were transplanted into the bilateral striatum of eight NOD / SCID IL2Rg null (NSG) mice using FACS with NURR1-GFP and gRNA-tdTomato (Figure 2A; Figure 12A). An additional 2 weeks of in vitro culture after sorting resulted in a highly homogenous identity of dopamine neurons co-expressing NURR1::GFP and gRNA::tdTomato with the mature dopamine marker TH, regardless of doxycycline treatment (Figure 1D; Figure 19D). The use of sorted NURR1-positive cell populations allowed us to accurately examine the survival rate of postmitotic dopamine neurons in vivo without any confounding factors from cells growing within the graft. One month after transplantation, transplanted cells were reisolated by dissecting the grafts based on fluorescence expression, and genomic DNA was extracted (Figure 1F; Figure 19F). Human-specific PCR reactions to detect the human PTGER2 gene demonstrated the presence of human cells in the xenograft samples (Figure 1G; Figure 19F). Next-generation sequencing (NGS) from genomic DNA of in vitro cultured cells and in vivo transplanted cells to detect sgRNA barcodes demonstrated consistent sgRNA library representation in vitro and in vivo, independent of Dox treatment (Figure 1H; Figure 19G).

[0213] We then compared the correlation of the integration ratio of each sgRNA from all samples (in vitro cells; day 16, day 25, no dox, day 25 + dox, and in vivo transplanted cells; one month after cell transplantation from day 25 + dox). Clustering dendrograms showed comparable sgRNA integration ratios regardless of dox treatment and cell stage in culture, except for transplanted cells (Figure 2B; Figure 12B). Detailed analysis of each sgRNA ratio in the conditions showed that without dox treatment in culture, no enriched or depleted sgRNAs could be detected. However, in dox-treated conditions, all three sgRNAs against BCL2L (BCLXL) were significantly depleted during directed differentiation (Figure 2C; Figure 12C), demonstrating that BCLX is an essential gene for proper dopamine neuron induction from hPSCs in the culture system. Previously, it was noted that Bcl-x knockout mice generated fewer dopamine neurons, and overexpression of BCLX promoted the induction of dopamine neurons from neural stem cells. This highlights that the hPSC-based iCas9 system with pooled sgRNA library is clearly functional in differentiation of dopamine neurons. Most importantly, several significantly enriched sgRNAs were identified in surviving dopamine neurons compared to pre-transplant cells based on the following two criteria: 1) sgRNAs above threshold [fold change; >0.3 (log2 value), and p-value; p<0.05], 2) hits of multiple different guide RNAs targeting the same gene [fold change; >0.25 (log2 value), and p-value; p<0.05]. Using these criteria, surviving dopamine neurons in grafts were enriched for sgRNAs corresponding to nine genes. This suggests that apoptosis and inflammation are the major limiting pathways for survival of postmitotic dopamine neurons in the grafts (FIGS. 2C and 2D; FIGS. 12C and 12D).

[0214] To further validate the hits, the screen generated stable hPSC lines containing only 33 sgRNAs targeting a total of nine genes (three sgRNAs per gene) along with six non-targeting and safe harbor control guides in the iCas9 / NURR1::H2B-GFP hPSC line (iCas9 / NURR1::H2B-GFP / Library#2). Similarly, the overall representation of sgRNAs was comparable across all conditions (Figure 1I, Figure 1H), and sgRNA integration was most distinct in transplanted cells than in in vitro cultured cells, as shown by clustering dendrograms (Figure 2E, Figure 12E). Two independent pooled screens with smaller pooled sgRNA libraries using the iCas9 / NURR1::H2B-GFP / Library#2 hPSC line consistently identified p53 as the most prominent hit containing two or more independent sgRNAs enriched in surviving dopamine neurons in transplants (Figure 2F; Figure 12F). Overall, these results demonstrate that postmitotic dopamine neuron death upon transplantation is driven by a p53-mediated cell death pathway.

[0215] p53 knockout (KO) resulted in improved survival of dopamine neurons. To investigate the role of p53 on dopamine neuron survival in in vivo grafts, we generated iCas9 / NURR1::H2B-GFP hPSC lines stably integrated with sgRNAs targeting the p53 gene. Although the p53 pathway was previously implicated in the death of exogenous fetal ventral midbrain grafts in rats, the effect of p53 on the survival of human postmitotic dopamine neurons in in vivo grafts remains unclear. Furthermore, the kinetics of p53-mediated graft death during the time course of transplantation have not been fully investigated. A directed differentiation and FACS purification strategy toward midbrain dopamine neuron lineages was performed, as well as a pooled sgRNA screen of this individual p53 KO study. To reduce inter-mouse variability, either dox-treated (p53 KO) or untreated dopamine (isogenic p53 WT) neurons were transplanted bilaterally into the striatum (Figure 3A; Figure S13A). Notably, dopamine neurons in p53 KO had no apparent survival advantage or excessive proliferation in culture, but rather, a highly pure identity of dopamine neurons expressing TH and FOXA2 emerged when examined 2 weeks after sorting with NURR1::GFP and sgRNA::tdTomato (Figure 3B; Figure S20A).

[0216] One month after transplantation, overall graft composition and size were determined using immunofluorescence assays, followed by stereological quantification (Figures 3C-3D; Figures 4A-4C; Figures 13B-13C; Figures 20A-20D). All surviving p53 KO dopamine neurons expressed floor plate identity, FOXA2, the mature dopamine neuron marker TH, and endogenous NURR1-GFP signal, without obvious detection of hKi67, indicative of proliferating cells, in TP53 KO or isogenic control grafts (Figure 20E). Stereological methods measured the total number and volume of viable NURR1::GFP positive neurons per 100,000 cells one month after transplantation and found that p53 KO grafts contained 13,666.78 (mean) ± 7,797.59 (standard deviation) NURR1::GFP dopamine neurons compared with 2,775.99 (mean) ± 1,178.21 (standard deviation) in wild-type neurons (Figure 3D; Figure S13C). The volume of p53 KO grafts was 0.086 ± 0.060 mm per 100,000 cells. 3 , whereas wild-type grafts were 0.022 ± 0.010 mm 3 (Figure 3D; Figure S13C). Taken together, single p53 gene KO increased a significant survival benefit (p<0.05, paired t-test, n=5) of postmitotic dopamine neurons in the grafts. This highlights the functional role of p53 in neuronal survival in in vivo grafts. In addition to the increased volume and number of NURR1+ neurons, p53 KO grafts also showed an increased proportion of ALDH1A1+ A9-type dopamine neurons. In contrast, the proportion of CALB1-positive (A10) neurons was comparable between p53 KO and p53 WT grafts (Figures 2D-2G). This suggests a specific vulnerability of the A9 but not A10 dopamine neuron subtype upon transplantation, which is mitigated in p53 KO grafts.

[0217] Temporal analysis of p53-mediated dopamine neuron death and host response. Next, experiments were performed to address the kinetics of p53-dependent neuronal cell death during the transplantation procedure. There are three major stages of cell death in the transplantation paradigm: 1) mechanical injury stress during cell loading into the needle, 2) short-term survival factors immediately after transplantation, and 3) long-term effects in the established graft. First, p53 and p53 downstream genes were not induced during cell preparation and loading of cells into the needle using RT-qPCR assays (Figure 4D; Figure 20F). This was consistent with previous reports demonstrating that there was no obvious sign of cell death after passing through the needle. Next, we mapped the induction of p53 and cleaved caspase 3 (CC3) using immunofluorescence assays at different time points immediately after transplantation, and at 1 day post transplantation (dpt), a strong induction of p53 and CC3 in 30-40% of dopamine neurons was observed (Figure 3E and 3F; Figure 14A-14F). Such induction was diminished at 3 dpt, and there was evidence of many apoptotic aggregated nuclei within the grafts, suggesting that p53-induced neurons at 1 dpt had already induced an intrinsic apoptotic “suicide” program. Additionally, rapid engagement of cell death dramatically reduced graft cell density from 1 dpt to 3 dpt (Figures 3E and 3F; Figures 14A-14F). At 7 dpt and beyond, this dynamic programmed cell death cascade appeared to be completely absent. Furthermore, TUNEL assays, which probe for apoptotic DNA fragmentation and detect the final stages of apoptosis, showed strong TUNEL-positive expression among 60% of grafted neurons starting at 1 dpt, and a peak of TUNEL-positive signal at 3 dpt in the grafts (Figures 3E and 3F; Figures 14A-14F). Again, the TUNEL signal was completely abolished at 7 dpt, suggesting that this apoptotic program may not continue beyond 7 dpt.

[0218] We next characterized neuroimmune cells near the transplant site, as published studies have shown that apoptotic neurons recruit neighboring macrophages that remove apoptotic cells. In conjunction with the finding that a high degree of induction of apoptosis appears in grafts at 1 dpt, both astrocytes and microglia rapidly and simultaneously polarized their processes toward the graft (Figures 5B and 5C). At 4 h and 1 dpt, most glial cells were located outside the graft core, suggesting that they were responding to, rather than driving, the first wave of dopamine neuron cell death (Figure 21A). At 3 dpt, the immune response peaked, but the degree of polarization was more pronounced in microglia than astrocytes, where microglia migrated further and completely engulfed apoptotic cell bodies by infiltrating the graft core by day 3 (dpt) (Figure 21A, top panel). This was further supported by existing literature reporting coordinated behavior of astrocytes and microglia (Figures 5B-5D). GFAP staining (more specific to A1-activated astrocytes) was also more strongly induced in host cells at 3 dpt, suggesting that activated microglia can further recruit neurotoxic reactive astrocytes (Figure 5C). Strong GFAP staining persisted until 7 dpt, creating an “astrocyte border” at the graft-host interface (Figure 21A, bottom panel). Also, evidence of vascular recruitment to the graft at 3 dpt by H&E staining (Figure 5A; Figure 21B) and neutrophil infiltration indicated by Ly6G was present before 24 hours post-transplantation (Figure 5E; Figure 21C). At the same time, surviving neurons began to extend axons at 1 dpt, as indicated by the outgrowth of SC121-positive fibers from the graft (Figure 6; Figure 21D), despite the fact that transplanted neurons were undergoing apoptosis and being phagocytosed by immune cells. Overall, these data revealed that p53-dependent apoptotic cell death of hPSC-derived postmitotic dopamine neurons after in vivo transplantation occurred rapidly in a very narrow window during the first 3 dpt, a time when brain immune cells were heavily recruited towards the graft.

[0219] The TNFα-NFκB pathway was an upstream regulator inducing TP53-dependent dopamine neuron death in grafts. Given the well-known role of p53 as a tumor suppressor and the high induction of p53 in grafts at 1 dpt, we sought to identify upstream factors of p53 induction. To gain molecular mechanistic insight into the potential triggers of p53, we performed bulk RNA-seq to compare grafted neurons isolated from mouse brains at 1 dpt with FACS-based sorted neurons at day 0 and in vitro cultured neurons 1 day after sorting. Principal component analysis (PCA) and dendrograms demonstrated that grafted dopamine neurons displayed distinct transcriptional patterns compared to either sorted or in vitro cultured dopamine neurons (Figure 7A; Figure 15A). In particular, gene ontology analysis of 279 differentially expressed genes (DEGs) upregulated in 1-day in vivo transplanted neurons versus 1-day in vitro cultured neurons showed that NF-kappaB, apoptosis, hypoxia, and TNF-alpha signaling via p53 pathways were significantly upregulated in transplanted neurons (Figures 7B and 7C; Figures 15B and 15C), while 374 DEGs downregulated in in vivo transplanted versus cultured neurons were related to apical junctions, mTORC1 signaling, and cholesterol homeostasis (Figure 22B). Gene set enrichment analysis (GSEA) of genes enriched in 1-day transplanted versus 1-day in vitro seeded neurons further confirmed the increase in signatures including apoptosis and tumor necrosis factor signaling pathways (Figures 7D and 7E; Figures 15D and 15E).

[0220] We next examined phosphorylated nuclear factor kappa B (pNFκB) as an indicator of active NFκB under TNF stimulation over time after transplantation. Time-course immunofluorescence assays during transplantation showed that pNFκB expression was significantly increased in transplanted neurons at 4 h and 1 dpt (representing nearly 80% of transplanted neurons), and such induction was reduced in the grafts from 3 dpt onwards (Figure 7F; Figure 15F). At 1 day after seeding, nuclear NFκB expression was not induced in dopamine neurons replaced in vitro (Figure 22D). This result indicated that the TNFα-NFκB signaling cascade occurred immediately after transplantation of dopamine neurons, prior to p53-dependent apoptosis. This suggests a potential upstream role of the TNFα-NFκB pathway for p53.

[0221] To verify the causal relationship of TNFα-mediated induction of NFκB and p53, treatment with a TNFα-blocking monoclonal antibody called adalimumab was administered to NURR1::H2B-GFP sorted neurons for 24 hours on day 25 (Figure 7G; Figure 15G). Upon TNFα treatment, the expression of p53 was increased in dopamine neurons, which showed co-positivity with NFκB-p65. In addition, p53 and p53 downstream genes (e.g., p21 and PUMA) mRNAs were upregulated under TNFα exposure conditions, but co-treatment with TNFα and adalimumab abolished such induction (Figures 7G and 7H; Figures 15G-15I). This confirmed the TNFα-NFκB-p53 axis in this established in vitro model system.

[0222] Single-cell RNA sequencing of transplanted neurons revealed that the p53-BAX axis is a major driver of neuronal death during transplantation. To obtain the molecular landscape of transplanted dopamine neurons at the single-cell level, single-cell mRNA sequencing was performed from p53 WT and KO transplanted neurons from mouse brains at 1 dpt. Uniform Manifold Approximation and Projection for Dimension Reduction (UMAP) analysis of wild-type and p53 knockout (KO) samples showed highly overlapping clustering distributions (Figures 8B and 8C). Based on the expression of PBX1 for dopamine-specific markers and MAP2 for neurons, >90% of cells showed postmitotic dopamine neuron identity with very low expression of proliferation marker MK167 in both p53 WT and KO neurons (Figures 8D and 8E). By comparing these data with available human fetal datasets, the majority of these cells, occupying one large cluster, were annotated as neuroblasts (indicating NURR1 expression stage) and a small cluster was annotated as floor plate progenitor cells (Figure 9A).

[0223] We next sought to determine whether any particular clusters displayed molecular signatures of neuronal cell death. Heatmaps from apoptotic cell death-related genes identified that clusters 3, 4, and 7 (Figure 9B-9D) showed increases in genes such as BAX, BAD, TNFRSF1A, TNFRSF12A, and TNFRSF10B. Violin plots of these genes from each cluster further demonstrated that these genes were more prominently expressed in WT than p53 KO neurons. This supports that TNF induced the p53-BAX gene, which triggered the p53-dependent apoptotic pathway in the grafts (Figure 9E).

[0224] The question remains as to the source of the TNFα ligand: this data set indicates that transplanted dopamine neurons expressed TNFα superfamily ligands, potentially suggesting that dying neurons during acute post-traumatic injury themselves secreted TNFα (data not shown).

[0225] High-throughput cell surface marker screening defined novel CD markers for enriching postmitotic dopamine neurons. Given the complexity of using genetically engineered hPSCs for translational applications, we sought to define surface markers to capture postmitotic dopamine neurons circumventing the need for genetic selection. High-throughput flow-based cell surface marker screening with 385 validated antibodies identified candidate CD markers, including three depletion hits (CD49e, CD99, CD340) and two enrichment hits (CD184, CD171), consistent with GFP signals from day 25 NURR1::H2B-GFP hPSC-derived dopamine neurons (Figures 6 and 10A; Figures 21D and 17A). After extensive characterization of cells sorted using either single and / or dual CD markers via flow analysis, qRT-PCR, and immunofluorescence assays to examine dopamine neuron identity, we found that CD49e low expressing cells and CXCR4 / CD184 high expressing cells exhibited the most highly enriched pure postmitotic dopamine neurons expressing FOXA2, NURR1::GFP, and TH at 2 weeks after in vitro sorting (Figures 10B-10D; Figures 17B-17D). Furthermore, short-term histological analysis at 1 month after transplantation demonstrated that dopamine neurons sorted for CD using this novel dual sorting strategy exhibited graft survival that homogeneously expressed TH without containing human Ki67 proliferating cells. This highlights the translational benefits for using postmitotic dopamine neurons enriched via the novel CD marker strategy for transplantation (Figures 10E and 11B; Figures 17E and 24B).

[0226] TNFα neutralizing monoclonal antibodies improved the survival of postmitotic dopamine neurons sorted by CD markers in grafts. We next investigated whether a publicly available TNFα neutralizing antibody called adalimumab (Humira) might have functional significance for the survival of CD-sorted dopamine neurons. Adalimumab has been reported to bind soluble and transmembrane-bound TNFα (McCoy and Tansey, 2008) and is widely used to treat arthritis and encephalitis and suppress inflammation. Co-injection with adalimumab significantly improved the survival of CD-sorted dopamine neurons in vivo after transplantation (Figures 10F and 10G; Figures 18A and 18B). Stereological counts of NURR1::GFP+ cells one month after transplantation revealed 12,423 (mean) ± 1,859 (SEM) cells per 100,000 cells injected in adalimumab-treated grafts versus 6,057 (mean) ± 378 (SEM) cells in PBS-treated neurons (p = 0.01, paired t-test, n = 5) (Figure 18B). The volume of adalimumab-treated grafts was 0.1175 mm per 100,000 cells in PBS-treated grafts. 3 (Average) ±0.003mm 3(SEM) (p=0.0085, paired t-test, n=5). We further investigated whether CD-sorted postmitotic dopamine neurons function to rescue amphetamine-induced rotational behavior in 6-OHDA-treated mice, with or without adalimumab treatment, which represents a widely used preclinical model to treat PD motor symptoms. At 6 months after transplantation, robust functional recovery was observed regardless of adalimumab exposure. mDA neurons co-injected with adalimumab showed a trend toward earlier and more complete functional rescue (Figure 10H; Figure 18C). Histological analysis showed that both groups gave rise to highly enriched neuronal populations in vivo at 6 months after transplantation (Figures 25A-25B). However, adalimumab-mediated inhibition of TNFα led to a significant increase in the total number of surviving dopamine neurons, as well as overall graft size (Figures 18D and 18E). Similar to the results of p53 KO cells, we observed that adalimumab treatment significantly increased the proportion of ALDH1A1+A9 mDA neuron subtypes without affecting the proportion of CALB1 expressing A10 dopamine neuron subtypes (Figures 18F and 18G). These results suggested that the strategy of CD marker selection and TNFα neutralizing antibody could be directly applied to clinical applications.

[0227] Consideration The main gene identified in the disclosed in vivo Crispr screen for dopamine neuron survival was TP53. TP53 is a master regulator of diverse cellular processes, ranging from tumor suppression to functioning as a guardian of cell fate identity and reprogramming, particularly sensing cellular stress associated with DNA damage, oxidative stress, or ischemic injury. TP53 has recently been suggested as a candidate factor driving vulnerability of human substantia nigra dopamine neurons during PD development based on selective expression patterns by single-cell analysis. Furthermore, interest has been focused on the role of TP53 as a common signaling hub for neuronal cell death across neurodegenerative disorders, such as p53-mediated regulation of C9ORF72-mediated neuronal death in ALS (Maor-Nof et al., 2021). In addition to TP53, the initial screen of the present disclosure identified several genes, including TNFRSF11B, BBC3, BCL2L11, CASP2, and CASP9, all associated with the TNFα / TP53 / apoptosis pathway, as genes that limit dopamine neuron survival in vivo. Alternative hits, such as SLC7A11, IL18, or TLR4, are associated with either ferroptosis or neuroinflammatory responses, respectively.

[0228] This disclosure focused on cell-intrinsic factors driving dopamine neuron death by screening for genes that directly limit survival in purified dopamine neurons without manipulating any host-associated responses. Using histological analysis, we described a cascade of host cell-associated responses at the transplant site, including recruitment of neutrophils, microglia, and vascular cells to enter the graft core by 3 dpt, and activation of inflammatory programs in both astrocytes and microglia. Our temporal analysis suggests that the host response occurs in response to, rather than mediating, dopamine neuron death. Transplant-associated dopamine neuron death subsided completely by 7 dpt.

[0229] The gene expression data of the present disclosure demonstrate that TNFα is produced by transplanted dopamine neurons after transplantation, likely in response to injury-related damage. TNFα is a known proinflammatory cytokine secreted in response to hemorrhagic, ischemic, or traumatic injury (Tuttolomondo et al., 2014), events commonly associated with cell transplantation.

[0230] The use of genetic reporter lines to purify postmitotic dopamine neurons allowed us to address survival without the confounding factors associated with cell growth factors or non-autonomous factors. This approach also sets the stage for transplanting postmitotic dopamine neurons for translational applications. The CD surface marker-based strategy of the present disclosure allows for dopamine neuron enrichment at the NURR1 stage without the need to establish genetic reporter lines. Thus, this strategy is compatible with translational applications of dopamine neuron replacement therapy in PD. It may also facilitate the use of purified dopamine neuron preparations in human iPSC-based disease modeling, given the difficulty of reliably generating specific neuronal subtypes across many cell lines and laboratories when modeling neurological disorders in a dish.

[0231] The studies disclosed herein demonstrate that co-injection of TNF-neutralizing antibodies, when combined with a CD marker strategy to enrich for postmitotic dopamine neurons, can significantly reduce neuronal death following transplantation. This technology may result in a cell therapy approach that maximizes safety for PD patients by avoiding the transplantation of dopamine neuron progenitor cells that retain at least short-term potential for in vivo cell proliferation (Kim et al.,2021,Cell Stem Cell Feb 4;28(2):343-355.e5; Kirkeby et al.,2017,Cell Stem Cell 20,135-148; Piao et al.,2021,Cell Stem Cell 28,217-229 e217; Schweitzer et al.,2020,N Engl J Med 382,1926-1932; Takahashi,Neuron.2017 Sep 13;95(6):1395-1405.e3).

[0232] Example 2 - Single cell RNA sequencing of day 1 transplanted neurons identifies molecular signatures of surviving dopamine neurons and dedifferentiation signatures in apoptotic dopamine neurons. To further define the transcriptional landscape of transplanted dopamine neurons, we performed single-cell mRNA sequencing from p53 wild-type (WT) and p53 knockout (KO) transplanted neurons reisolated from mouse brain at 1 dpt. Combined clustering of p53 WT and p53 KO cells showed highly overlapping distribution of clusters, suggesting that the cell state is not altered in dopamine neurons upon p53 KO (Figures 16A and 16B; Figures 23A-23C). Based on expression of PBX1, a marker specifically highly expressed in dopamine neurons, and MAP2, a neuronal marker, >90% of cells showed characteristics of postmitotic dopamine neuron identity, accompanied by very low expression of the proliferation marker MKI67, in both p53 WT and KO neurons (Figure 23B). By comparing our data with available datasets from developing human fetal dopamine neurons, the majority of cells isolated at 1 dpt were annotated as neuroblasts, compatible with an early NURR1-positive identity, and a small portion of cells were annotated as floor plate progenitors (Figure 16C).

[0233] We identified clusters that displayed molecular signatures of apoptosis or survival. Differential analysis of p53 WT vs. p53 KO identified clusters 3, 5, and 6, which had significantly increased expression of p53 downstream genes such as BAX, BBC3, CDKN1A, and PHPT1 (Figures 16D-16F). In these clusters, TNFRSF12A was more robustly expressed in both p53 WT and p53KO cells compared to the other clusters, supporting our finding that TNFα mediates the TP53-dependent apoptotic pathway in the explants (Figure 16F). Interestingly, the apoptotic cluster showed expression of SOX2 and HES5 and was annotated as a floor plate progenitor cell. However, no evidence of proliferation based on MKI67 expression was observed. This suggests that this cluster may reflect a dedifferentiated state rather than a signature of true proliferative floor plate progenitor cells (Figures 16G and 16H). Furthermore, the progenitor signature was specific to neurons immediately after transplantation (1 dpt) and was not observed in matched cells immediately prior to transplantation (Figure S4H). These data argue that a progenitor-like phenotype is induced in these clusters within 24 h after transplantation and likely does not represent contamination due to incomplete sorting.

[0234] Conversely, clusters 1, 2, and 4 showed high expression of survival signatures characterized by the expression of ATF4, JUN, FOS, HSPA6, HSPA1A, HSPA1B, and DNAJB1 (Figure 16D). This highlights that hPSC-derived dopamine neurons are under high cellular stress, such as axonal transection, endoplasmic reticulum stress, or DNA damage, during the transplantation procedure. Differential analysis between p53 WT and KO identified that JUN, a survival marker, was significantly upregulated upon p53 KO (Figures 16F and 23D). This highlights that blocking p53 expression confers a survival advantage to transplanted dopamine neurons.

[0235] Questions remain regarding the source of TNFα ligands. This dataset indicates that transplanted dopamine neurons show increased expression of TNFα superfamily ligands, such as TNFSF12 and TNFSF10, compared to their in vitro counterparts (Figure 22E).

[0236] Although the subject matter of the present disclosure and its advantages have been described in detail, it should be understood that various changes, substitutions, and alterations can be made herein without departing from the spirit and scope of the present disclosure. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the processes, machines, manufacture, and compositions of matter, means, methods, and steps described herein. As one skilled in the art would readily appreciate from this disclosure of the subject matter disclosed herein, any existing or later developed processes, machines, manufacture, compositions of matter, means, methods, or steps that perform substantially the same function or achieve substantially the same results as the corresponding embodiments described herein may be utilized in accordance with the subject matter of the present disclosure. It is therefore intended that the appended claims include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps.

[0237] Various patents, patent applications, publications, product descriptions, protocols, and sequence accession numbers are cited throughout this application, the disclosures of which are incorporated herein by reference in their entireties for all purposes.

Claims

1. 1. A method for treating a subject, comprising administering to the subject one or more midbrain dopamine (mDA) neurons, wherein p53-mediated apoptosis of the one or more mDA neurons is inhibited.

2. 2. The method of claim 1, wherein the subject is suffering from a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons.

3. 3. The method of claim 2, wherein the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and combinations thereof.

4. 4. The method of any one of claims 1 to 3, wherein inhibiting p53-mediated apoptosis comprises a) administering to the subject at least one compound selected from the group consisting of a tumor necrosis factor alpha (TNFα) inhibitor, a nuclear factor kappa B (NFκB) inhibitor, a p53 inhibitor, and combinations thereof, or b) contacting the one or more mDA neurons with at least one compound selected from the group consisting of a TNFα inhibitor, a NFκB inhibitor, a p53 inhibitor, and combinations thereof.

5. 5. The method of claim 4, wherein the inhibiting p53-mediated apoptosis comprises administering to the subject a TNFα inhibitor.

6. 6. The method of claim 4 or 5, comprising administering the one or more mDA neurons simultaneously with administration of the at least one compound.

7. 1. A method for improving in vivo survival of one or more midbrain dopamine (mDA) neurons, the method comprising inhibiting p53-mediated apoptosis of said one or more mDA neurons.

8. 8. The method of claim 7, wherein inhibiting p53-mediated apoptosis comprises contacting the one or more mDA neurons with a compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof.

9. 9. The method of claim 8, wherein the inhibiting p53-mediated apoptosis comprises contacting the one or more mDA neurons with a TNFα inhibitor.

10. The method of any one of claims 1 to 9, wherein the suppression of p53-mediated apoptosis comprises inhibition of TNFα signaling, inhibition of NFκB signaling, inhibition of p53 signaling, or a combination of the foregoing.

11. The TNFα inhibitors include anti-TNFα antibodies, TNFα decoy receptors, chemical compounds, nucleic acid inhibitors, small molecule inhibitors, receptor biological inhibitors, inactive TNF fragments, TNFα circulating receptor fusion proteins, xanthine derivatives, 5-HT ２Ａ 10. The method of any one of claims 4, 5, 8, and 9, wherein the compound is selected from the group consisting of: agonists, agonists, and combinations thereof.

12. The method of claim 11 , wherein the TNFα inhibitor is an anti-TNFα antibody.

13. 13. The method of claim 12, wherein the anti-TNFα antibody is selected from the group consisting of adalimumab, adalimumab-adbm, adalimumab-adaz, adalimumab-atto, certolizumab pegol, golimumab, infliximab, infliximab-abda, infliximab-dyyb, lemtolumab, afelimomab, nerelimomab, ozoralizumab, placlumab, and combinations thereof.

14. The method of claim 13, wherein the anti-TNFα antibody is adalimumab.

15. The method of claim 4 or 8, wherein the NFκB inhibitor is selected from the group consisting of upstream inhibitors of NFκB, inhibitors of IKK activity, inhibitors of IκB phosphorylation, inhibitors of IκB degradation, proteasome inhibitors, protease inhibitors, inhibitors of NFκB nuclear translocation and expression, NFκB DNA binding inhibitors, and NFκB transactivation inhibitors, inhibitors of NFκB-directed gene transactivation, antioxidants, and combinations thereof.

16. 9. The method of claim 4 or 8, wherein the p53 inhibitor is selected from the group consisting of JNK inhibitors, p38 MAPK inhibitors, caspase inhibitors, puma / BBC3 inhibitors, BAX inhibitors, CDK inhibitors, MDM2 and MDMX activators, and combinations thereof.

17. The method of any one of claims 1 to 16, wherein the inhibition of p53-mediated apoptosis comprises knocking out or knocking down the TP53 gene in the one or more mDAs.

18. 18. The method of claim 17, wherein the TP53 gene is knocked out or knocked down by a genetic engineering system.

19. The method of claim 18, wherein the genetic manipulation system is a CRISPR-Cas system.

20. 20. The method of any one of claims 1 to 19, wherein the one or more mDA neurons express a marker selected from the group consisting of EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, SATB1, CALB1, CALB2, SNCG, PBX1, and combinations thereof.

21. The method of any one of claims 1 to 20, wherein the one or more mDA neurons are post-mitotic mDA neurons.

22. The method of any one of claims 1 to 21, wherein the one or more mDA neurons are differentiated in vitro from one or more stem cells.

23. 23. The method of claim 22, wherein the one or more stem cells are selected from the group consisting of human stem cells, non-human primate stem cells, rodent non-embryonic stem cells, human embryonic stem cells, non-human primate embryonic stem cells, rodent embryonic stem cells, human induced pluripotent stem cells, non-human primate induced pluripotent stem cells, rodent induced pluripotent stem cells, and human recombinant pluripotent cells, non-human primate recombinant pluripotent cells, and rodent recombinant pluripotent cells.

24. 24. The method of claim 22 or 23, wherein the one or more stem cells are human stem cells.

25. The method according to any one of claims 22 to 24, wherein the one or more stem cells are one or more pluripotent or multipotent stem cells.

26. 26. The method of any one of claims 22 to 25, wherein the one or more stem cells are selected from the group consisting of embryonic stem cells, induced pluripotent stem cells, and combinations thereof.

27. 27. The method of claim 26, wherein the one or more stem cells are one or more induced pluripotent stem cells.

28. 28. The method of any one of claims 22 to 27, wherein in vitro differentiation comprises contacting the one or more stem cells with at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, at least one activator of Sonic hedgehog (SHH) signaling, and at least one activator of wingless (Wnt) signaling.

29. 29. The method of claim 28, wherein the concentration of the at least one activator of Wnt signaling contacted with the cells is increased from about 2 days to about 6 days after initial contact of the cells with the at least one activator of Wnt signaling.

30. 30. The method of claim 28 or 29, wherein the concentration of the at least one activator of Wnt signaling contacted with the cell is increased by about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling contacted with the cell.

31. The method according to any one of claims 28 to 30, wherein the at least one activator of Wnt signalling comprises an inhibitor of glycogen synthase kinase 3β (GSK3β) signalling.

32. 32. The method of any one of claims 28 to 31, wherein the at least one activator of Wnt signaling is selected from the group consisting of CHIR99021, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763, Wnt3A, Wnt1, Wnt5a, derivatives thereof, and combinations thereof.

33. 33. The method of claim 32, wherein the at least one activator of Wnt signaling comprises CHIR99021.

34. 34. The method of any one of claims 28 to 33, wherein the at least one inhibitor of SMAD signaling comprises an inhibitor of TGFβ / Activin-Nodal signaling, an inhibitor of bone morphogenetic protein (BMP) signaling, or a combination of the foregoing.

35. 35. The method of claim 34, wherein the at least one inhibitor of TGFβ / activin-Nodal signaling is selected from the group consisting of SB431542, a derivative of SB431542, and combinations thereof.

36. The method of claim 35, wherein the derivative of SB431542 comprises A83-01.

37. The method of any one of claims 34 to 36, wherein the at least one inhibitor of TGFβ / activin-Nodal signaling comprises SB431542.

38. 35. The method of claim 34, wherein the at least one inhibitor of BMP signaling is selected from the group consisting of LDN193189, Noggin, Dorsomorphin, derivatives of LDN193189, derivatives of Noggin, derivatives of Dorsomorphin, and combinations thereof.

39. 39. The method of claim 38, wherein the at least one inhibitor of BMP comprises LDN-193189.

40. The method according to any one of claims 28 to 39, wherein the at least one activator of SHH signalling is selected from the group consisting of an SHH protein, a Smoothened agonist (SAG), and combinations thereof.

41. 41. The method of claim 40, wherein the SHH protein is selected from the group consisting of recombinant SHH, modified N-terminal SHH, and combinations thereof.

42. 42. The method of claim 41, wherein the modified N-terminal SHH comprises two isoleucines at the N-terminus.

43. 43. The method of claim 41 or 42, wherein the modified N-terminal SHH has at least about 90% sequence identity to the unmodified N-terminal SHH.

44. 44. The method of claim 43, wherein the unmodified N-terminal SHH is unmodified mouse N-terminal SHH or unmodified human N-terminal SHH.

45. 44. The method of any one of claims 41 to 43, wherein the modified N-terminal SHH comprises SHH C25II.

46. 41. The method of claim 40, wherein the SAG comprises purmorphamine.

47. 47. The method of any one of claims 28 to 46, wherein said in vitro differentiation further comprises contacting said one or more stem cells with at least one activator of fibroblast growth factor (FGF) signaling.

48. 48. The method of claim 47, wherein the at least one activator of FGF signaling is selected from the group consisting of FGF18, FGF17, FGF8a, FGF8b, FGF4, FGF2, and combinations thereof.

49. 49. The method of claim 47 or 48, wherein the at least one activator of FGF signaling comprises FGF18 or FGF8.

50. 50. The method of any one of claims 28 to 49, wherein said in vitro differentiation further comprises contacting said one or more stem cells with at least one inhibitor of Wnt signaling.

51. 51. The method of claim 50, wherein the at least one inhibitor of Wnt signaling is selected from the group consisting of IWP2, IWR1-endo, XAV939, IWP-O1, Wnt-C59, IWP-L6, and ICG-001, and combinations thereof.

52. 52. The method of claim 50 or 51, wherein the at least one inhibitor of Wnt signaling comprises IWP2.

53. The method of any one of claims 1 to 52, wherein the one or more mDA neurons express detectable levels of CD184 and do not express detectable levels of CD49e.

54. 1. A composition comprising: (a) one or more midbrain dopamine (mDA) neurons; (b) at least one compound selected from the group consisting of a TNFα inhibitor, an NFκB inhibitor, a p53 inhibitor, and combinations thereof.

55. 55. The composition of claim 54, wherein the composition is a pharmaceutical composition further comprising a pharma- ceutically acceptable carrier.

56. 56. The composition of claim 54 or 55, wherein the composition is for treating or ameliorating a neurodegenerative disorder and / or neurodegeneration of midbrain dopamine neurons.

57. 57. The composition of claim 56, wherein the neurodegenerative disorder is selected from the group consisting of Parkinson's disease, Huntington's disease, Alzheimer's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, and combinations thereof.

58. The TNFα inhibitors include anti-TNFα antibodies, TNFα decoy receptors, chemical compounds, nucleic acid inhibitors, small molecule inhibitors, receptor biological inhibitors, inactive TNF fragments, TNFα circulating receptor fusion proteins, xanthine derivatives, 5-HT ２Ａ 58. The composition of any one of claims 54 to 57, wherein the compound is selected from the group consisting of: agonists, agonists, and combinations thereof.

59. 59. The composition of claim 58, wherein the TNFα inhibitor is an anti-TNFα antibody.

60. 60. The composition of claim 59, wherein the anti-TNFα antibody is selected from the group consisting of adalimumab, adalimumab-adbm, adalimumab-adaz, adalimumab-atto, certolizumab pegol, golimumab, infliximab, infliximab-abda, infliximab-dyyb, lemtolumab, afelimomab, nerelimomab, ozoralizumab, placlumab, and combinations thereof.

61. 60. The composition of claim 59, wherein the anti-TNFα antibody is adalimumab.

62. 62. The composition of any one of claims 54 to 61, wherein the NFκB inhibitor is selected from the group consisting of upstream inhibitors of NFκB, inhibitors of IKK activity, inhibitors of IκB phosphorylation, inhibitors of IκB degradation, proteasome inhibitors, protease inhibitors, inhibitors of NFκB nuclear translocation and expression, NFκB DNA binding inhibitors, and NFκB transactivation inhibitors, inhibitors of NFκB-directed gene transactivation, antioxidants, and combinations thereof.

63. 63. The composition of any one of claims 54 to 62, wherein the p53 inhibitor is selected from the group consisting of a JNK inhibitor, a p38 MAPK inhibitor, a caspase inhibitor, a puma / BBC3 inhibitor, a BAX inhibitor, a CDK inhibitor, an MDM2 and MDMX activator, and combinations thereof.

64. 64. The composition of any one of claims 54-63, wherein the one or more mDA neurons express a marker selected from the group consisting of EN1, OTX2, TH, NURR1, FOXA2, LMX1A, PITX3, LMO3, SNCA, ADCAP1, CHRNA4, ALDH1A1, SOX6, WNT1, DAT, VMAT2, GIRK2, SATB1, CALB1, CALB2, SNCG, PBX1, and combinations thereof.

65. The composition of any one of claims 54 to 64, wherein the one or more mDA neurons are post-mitotic mDA neurons.

66. The composition of any one of claims 54 to 65, wherein the one or more mDA neurons are differentiated in vitro from one or more stem cells.

67. 67. The composition of claim 66, wherein the one or more stem cells are selected from the group consisting of human stem cells, non-human primate stem cells, rodent non-embryonic stem cells, human embryonic stem cells, non-human primate embryonic stem cells, rodent embryonic stem cells, human induced pluripotent stem cells, non-human primate induced pluripotent stem cells, rodent induced pluripotent stem cells, and human recombinant pluripotent cells, non-human primate recombinant pluripotent cells, and rodent recombinant pluripotent cells.

68. 68. The composition of claim 66 or 67, wherein the one or more stem cells are human stem cells.

69. The composition of any one of claims 66 to 68, wherein the one or more stem cells are one or more pluripotent or multipotent stem cells.

70. 70. The composition of any one of claims 66-69, wherein the one or more stem cells are selected from the group consisting of embryonic stem cells, induced pluripotent stem cells, and combinations thereof.

71. 71. The composition of claim 70, wherein the one or more stem cells are one or more induced pluripotent stem cells.

72. 72. The composition of any one of claims 66 to 71, wherein in vitro differentiation comprises contacting the one or more stem cells with at least one inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, at least one activator of Sonic hedgehog (SHH) signaling, and at least one activator of wingless (Wnt) signaling.

73. The composition of claim 72, wherein the concentration of the at least one activator of Wnt signaling contacted with the cell is increased from about 2 days to about 6 days after initial contact of the cell with the at least one activator of Wnt signaling.

74. The composition of claim 72 or 73, wherein the concentration of the at least one activator of Wnt signaling contacted with the cell is increased by about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling contacted with the cell.

75. The composition according to any one of claims 72 to 74, wherein the at least one activator of Wnt signaling comprises an inhibitor of glycogen synthase kinase 3β (GSK3β) signaling.

76. 76. The composition of any one of claims 72 to 75, wherein the at least one activator of Wnt signaling is selected from the group consisting of CHIR99021, CHIR98014, AMBMP hydrochloride, LP 922056, lithium, deoxycholic acid, BIO, SB-216763, Wnt3A, Wnt1, Wnt5a, derivatives thereof, and combinations thereof.

77. 77. The composition of claim 76, wherein the at least one activator of Wnt signaling comprises CHIR99021.

78. 78. The composition of any one of claims 72 to 77, wherein the at least one inhibitor of SMAD signaling comprises an inhibitor of TGFβ / Activin-Nodal signaling, an inhibitor of bone morphogenetic protein (BMP) signaling, or a combination of the foregoing.

79. 79. The composition of claim 78, wherein the at least one inhibitor of TGFβ / activin-Nodal signaling is selected from the group consisting of SB431542, a derivative of SB431542, and combinations thereof.

80. The composition of claim 79, wherein the derivative of SB431542 comprises A83-01.

81. 80. The composition of claim 79, wherein the at least one inhibitor of TGFβ / activin-Nodal signaling comprises SB431542.

82. The composition of any one of claims 78 to 81, wherein the at least one inhibitor of BMP signaling is selected from the group consisting of LDN193189, Noggin, Dorsomorphin, derivatives of LDN193189, derivatives of Noggin, derivatives of Dorsomorphin, and combinations thereof.

83. 83. The composition of claim 82, wherein the at least one inhibitor of BMP comprises LDN-193189.

84. The composition according to any one of claims 72 to 83, wherein the at least one activator of SHH signalling is selected from the group consisting of SHH proteins, Smoothened agonists (SAGs), and combinations thereof.

85. 85. The composition of claim 84, wherein the SHH protein is selected from the group consisting of recombinant SHH, modified N-terminal SHH, and combinations thereof.

86. 86. The composition of claim 85, wherein the modified N-terminal SHH comprises two isoleucines at the N-terminus.

87. 87. The composition of claim 85 or 86, wherein the modified N-terminal SHH has at least about 90% sequence identity to unmodified N-terminal SHH.

88. 88. The composition of claim 87, wherein the unmodified N-terminal SHH is unmodified mouse N-terminal SHH or unmodified human N-terminal SHH.

89. 89. The composition of any one of claims 85 to 88, wherein the modified N-terminal SHH comprises SHH C25II.

90. 85. The composition of claim 84, wherein the SAG comprises palmorfamine.

91. 91. The composition of any one of claims 72 to 90, wherein said in vitro differentiation further comprises contacting said one or more stem cells with at least one activator of fibroblast growth factor (FGF) signaling.

92. 92. The composition of claim 91, wherein the at least one activator of FGF signaling is selected from the group consisting of FGF18, FGF17, FGF8a, FGF8b, FGF4, FGF2, and combinations thereof.

93. The composition of claim 91 or 92, wherein the at least one activator of FGF signaling comprises FGF18 or FGF8.

94. 94. The composition of any one of claims 72 to 93, wherein the in vitro differentiation further comprises contacting the one or more stem cells with at least one inhibitor of Wnt signaling.

95. 95. The composition of claim 94, wherein the at least one inhibitor of Wnt signaling is selected from the group consisting of IWP2, IWR1-endo, XAV939, IWP-O1, Wnt-C59, IWP-L6, and ICG-001, and combinations thereof.

96. 96. The composition of claim 94 or 95, wherein the at least one inhibitor of Wnt signaling comprises IWP2.

97. The composition of any one of claims 54 to 96, wherein the one or more mDA neurons express detectable levels of CD184 and do not express detectable levels of CD49e.

Images