Cell therapy

JP2025510686A5Pending Publication Date: 2026-04-02UNIVERSITY OF BASEL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2023-03-22
Publication Date
2026-04-02

AI Technical Summary

Technical Problem

Current cell therapies, such as CAR T-cell therapy, face challenges with insufficient cell persistence and recurrence of diseases, particularly in solid cancers and infectious diseases.

Method used

Engineered cells that enforce expression of phosphoglycerate dehydrogenase (PHGDH) are used, particularly in immune cells like T cells, to enhance their persistence and therapeutic efficacy.

Benefits of technology

Forced expression of PHGDH in immune cells improves their persistence in vivo and in vitro, leading to enhanced therapeutic potential for treating cancer and infectious diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000047_0000
    Figure 00000047_0000
  • Figure 00000048_0000
    Figure 00000048_0000
  • Figure 00000048_0001
    Figure 00000048_0001
Patent Text Reader

Abstract

The present invention is in the field of regenerative medicine and provides compositions and methods for treating cancer and / or infectious diseases in patients.The present invention provides cells, preferably immune cells, genetically engineered to force the expression of phosphoglycerate dehydrogenase (PHGDH), as well as expression constructs, vectors, and methods for their preparation and use.The present invention provides an expression cassette comprising a polynucleotide sequence encoding phosphoglycerate dehydrogenase (PHGDH).
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Field The present invention is in the field of regenerative medicine, particularly cell therapy, and provides compositions and methods for treating cancer and / or infectious diseases in patients.The present invention provides cells, preferably immune cells, genetically engineered to force the expression of PHGDH, as well as expression constructs, vectors and methods for preparing and using them.

[0002] Sequence Listing The Sequence Listing associated with this application (HORN_002_001WO_SeqList_ST26.xml; size: 14,059 bytes; and creation date: March 17, 2023) has been provided electronically in lieu of a paper copy and is hereby incorporated by reference in its entirety. [Background technology]

[0003] background Cell therapy is the transplantation of intact, living cells into a patient to treat a disease or condition. The cells can be derived from the patient (autologous cells) or a donor (allogeneic cells), and recent developments allow the use of cells from different organisms (xenogeneic).

[0004] Adoptive cell therapy (also called cellular immunotherapy) is a form of cellular treatment that uses cells of our immune system to treat a disease or condition.

[0005] Our immune system is able to recognize and eliminate infected or damaged cells, as well as cancerous cells. In the case of cancer, cytotoxic T cells (CTL or CD8 + Immune cells known as T cells are particularly powerful due to their ability to bind to appropriate cell surface molecules on cancer cells, known as antigens.

[0006] CD8 + T cells are critically involved in protecting the host from viruses, intracellular bacteria, and malignant cells. During acute infections, naive CD8 + T(TNV ) cells are primed in the lymph nodes, clonally expand, and differentiate into primary effector cells. Effector cells then leave the lymph nodes, enter the bloodstream, and migrate to sites of inflammation where they secrete cytokines and kill infected cells. Once the pathogen is cleared, the majority of effector cells undergo apoptosis during the contraction phase, whereas a small proportion of antigen-specific CD8 + T cells differentiate to form a memory pool. The defining feature of memory T cells is their ability to repopulate and acquire effector functions more rapidly than their naive counterparts upon encountering the same antigen (secondary effector cells), allowing for improved efficacy in combating reinfection. Reflecting the orchestration of the recall response, various subsets of memory T cells exist, which differ with respect to migration patterns and tissue distribution, phenotype, and functional properties. Human central memory (T CM ) and Effector Memory (T EM )CD8 + T cells are readily accessible in peripheral blood: the former recirculate between the bloodstream and lymph nodes, whereas the latter migrate from the blood circulation to different peripheral tissue sites.

[0007] CD4 + T cells display a diverse repertoire of effector functions and exhibit considerable phenotypic plasticity and heterogeneity, depending on the local context and microenvironment. + A key role of T cells is to modulate the status and function of other immune cells. Due to their intrinsic ability to orchestrate broad immune responses, and their flexible differentiation into different effector lineages, CD4 + T cells are essential for optimal antitumor responses, including cancer immunotherapy. Effector CD4 + T cells contribute to antitumor responses through different major strategies, including direct antitumor activity by producing IFN-γ and TNF-α. + T cells secrete IL-2, which is then transduced into CD8 + By driving CTL effector function, differentiation, and proliferation, CD8+ Directly activates CTL. CD4 + T cells support and maintain proinflammatory cross-presenting dendritic cells (DCs) by upregulating CD8 + Indirectly helps T cells, resulting in CD8 + Activates T cells. CD4 + T cells are also essential for inducing humoral responses against tumor antigens by orchestrating antibody production.

[0008] Cancer patients may have endogenous T cells that can target cancer cells. + T cells can recognize and eliminate cancer cells in a very precise manner. However, the presence of these cells does not necessarily mean that they are sufficient to eliminate tumors. The cells must also be able to maintain their activity in sufficient numbers and for a long enough time to sustain an effective antitumor response.

[0009] Some adoptive cell therapy approaches involve directly isolating our own immune cells and expanding their numbers (e.g., TILs) before reinfusion, whereas other approaches involve genetically engineering immune cells to enhance their effector functions (e.g., CAR T cells). In particular, the chimeric antigen receptor (CAR) T cell approach has emerged as the strategy with the greatest potential for the treatment of various malignancies and other diseases, especially cancer.

[0010] CAR T cell therapy relies on redirecting T cells to the appropriate cell surface molecules on cancer cells and has shown promising results in harnessing the power of the immune system to treat malignancies and other cancers. Gamma-retroviral and lentiviral transduction approaches are most commonly used in genetically engineered CAR T cells due to their high transduction efficiency. Most of the currently available CAR-T therapies are manufactured using lentiviruses. Therapies using CAR T cells have shown very promising results in treating various tumor types, especially hematological malignancies. In 2017, the two first CAR T cell therapies, Kymriah (tisagenlecleucel, Novartis) and Yescarta (axicabtageneciloleucel, Gilead), received FDA approval. Both treatments are approved for patients with certain hematological cancers refractory to standard treatments, or recurrent disease. Such patients were previously considered incurable and had virtually no treatment options.

[0011] Natural killer (NK) cell therapy is another form of adoptive cell therapy. These NK cells may be equipped with a CAR to target cancer.

[0012] Tumor infiltrating lymphocyte (TIL) therapy is an adoptive cell therapy approach that harvests naturally occurring T cells that have already infiltrated a patient's tumor, activates and expands them ex vivo, and then reinjects them back into the patient.

[0013] Engineered T cell receptor (TCR) therapy is another adoptive cell therapy approach that involves taking T cells from a patient and equipping them with new T cell receptors that target specific cancer antigens, allowing doctors to choose the best targets and different types of engineered T cells for each patient's tumor.

[0014] Cell therapy has also been investigated for the treatment of infectious diseases, particularly viral diseases such as chronic hepatitis B, CMV infection, EBV, and HIV, or opportunistic fungal infections. Viral infections or relapses that have developed in immunosuppressed patients (e.g., patients after hematopoietic stem cell or organ transplants with human cytomegalovirus or EBV reactivation) have been shown to respond to adoptive immunotherapy using autologous in vitro expanded virus-specific T cells derived from memory or naive T cell populations (Houghtelin A. et al. 2017, Front. Immunol. 8:1272. doi: 10.3389 / fimmu.2017.01272). Despite the great success of CAR T cells in treating certain hematological malignancies, not all patients respond to adoptive cell therapy. A significant proportion of patients treated with CAR T cells experience relapse, and CAR T cell-based treatment of solid tumors remains a major obstacle. In addition to the ability of the CAR on the genetically modified T cells to recognize and destroy the targeted cells, successful therapeutic T cell therapy must have the ability to grow and persist for a long period of time, as well as the ability to further monitor tumor cell escape. Therefore, engineering CAR T cells to improve their survival rate, and therefore persistence, is a logical therapeutic approach to improve their therapeutic potential. [Prior art documents] [Non-patent literature]

[0015] [Non-Patent Document 1] Houghtelin A. et al. 2017, Front. Immunol. 8:1272. doi: 10.3389 / fimmu.2017.01272 Summary of the Invention [Problem to be solved by the invention]

[0016] There remains a need in the art for improved cell therapies, particularly improved adoptive cell therapies such as CAR T cell therapies with improved survival and / or persistence, which provide more effective treatment of diseases such as cancer and infectious diseases. [Means for solving the problem]

[0017] Summary of the Invention In a first aspect, the present invention provides cells genetically engineered to enforce expression of phosphoglycerate dehydrogenase (PHGDH).

[0018] In a second aspect, the present invention provides an expression cassette comprising a polynucleotide sequence encoding phosphoglycerate dehydrogenase (PHGDH).

[0019] In a third aspect, the present invention provides a vector comprising a polynucleotide sequence encoding phosphoglycerate dehydrogenase (PHGDH), optionally wherein the polynucleotide sequence comprises SEQ ID NO:4 or a sequence having 95% identity to SEQ ID NO:4, and wherein the sequence encodes a polypeptide having RNA binding activity, or a variant or functional fragment thereof.

[0020] In a fourth aspect, the present invention provides a cell comprising an expression cassette as described herein or a vector as described herein.

[0021] In a fifth aspect, the present invention provides a composition comprising a cell as described herein, an expression cassette as described herein, or a vector as described herein.

[0022] In a sixth aspect, the present invention provides a method of treating a disease or condition in a subject in need of such treatment, comprising administering to the subject a cell as described herein, an expression cassette as described herein, a vector as described herein, or a composition as described herein.

[0023] In a seventh aspect, the present invention provides a cell as described herein, an expression cassette as described herein, a vector as described herein, or a composition as described herein for use in a method of treating a disease or condition in a subject.

[0024] In an eighth aspect, the present invention provides a method of generating a cell genetically engineered to enforce expression of phosphoglycerate dehydrogenase (PHGDH), comprising contacting one or more cells with a vector described herein. [Brief description of the drawings]

[0025] [Figure 1A] FIG. 1A shows a schematic of the T cell isolation and sorting strategy.

[0026] [Figure 1B] Figure 1B shows the biological processes overrepresented among the differentially expressed transcripts / proteins between freshly sorted human TNV and TEM cells based on RNAseq data (upper panel) and proteomics data (lower panel). Specifically, GO term enrichment analysis was performed on the transcripts / proteins with decreased abundance in TEM cells compared to TNV cells. From each analysis, the 20 biological processes with the lowest p-values ​​are shown in ranking order. From MetaCore (Clarivate Analytics).

[0027] [Figure 1C] Figure 1C shows volcano plots of RNAseq (left panel) and proteomics (right panel) analyses comparing TNV and TEM cells (n=4) from healthy human donors. Detected transcripts / proteins related to serine metabolism are shown in red. Hits with padj<0.05 are shown in dark blue if log2FC>0.5 and in cyan if log2FC<0.5.

[0028] [Figure 1D] Figure ID shows a Western blot analyzing the expression of SSP enzymes in freshly sorted TNV, TEM, and TCM cells. Data are representative of two independent experiments.

[0029] [Figure 1E] FIG. 1E is a schematic diagram of the SSP enzymes (green), serine-permeable amino acid transporters (yellow), and enzymes representing the link to one-carbon metabolism (blue).

[0030] [Figure 1F] Figure IF is a representative Western blot analyzing the expression of proteins involved in serine metabolism in TNV, TEM, and TCM cells. T cells were left unstimulated (-) or activated for 24 h using anti-CD3 / CD28 mAb (+) coated beads (left panel). PHGDH protein amount was quantified by densitometry, normalized to actin, and expressed relative to the amount of PHGDH in each activated TEM cell of each donor (three independent experiments, right panel).

[0031] [Figure 1G] Figure 1G shows the assessment of proliferation by CFSE dye dilution 5 days after activation. Bar graph summary showing the percentage of cells that have diluted the dye by at least one cell division (n=3, left panel). Representative histograms of CFSE dilution of TNV, TCM, and TEM cells from one human donor (right panel). Data are presented as mean ± SD (F, G). P values ​​were determined using a paired two-tailed Student's t test. *P<0.05, **P<0.01; ns, not significant.

[0032] [Figure 2A]Figure 2A shows a comparison of the putative RNA-binding sites in GAPDH (left) and PHGDH (right). Structural features of GAPDH involved in RNA binding (Ref. 5) are highlighted and compared to PHGDH. The Rossmann-fold domains of the two interacting subunits are shown in green (α-helix) and blue (β-sheet), while R163 is labeled in red (upper panel). Electrostatic potential of surface residues. Yellow lines highlight regions of high positive potential that may be involved in electrostatic interactions with the negatively charged RNA (middle panel). Dimer interface. For GAPDH, two ensembles of five-stranded β-sheets are shown in black and orange, one color per subunit, with the rest of the protein shown as light grey ribbons. In the interface shown, one subunit has been removed for clarity, except for the rest of the interface. For PHGDH, the dimer interface is shown in black and orange, one color per subunit, and the rest of the protein is shown as a light grey ribbon with R163 labelled in red (lower panel).

[0033] [Figure 2B] Figure 2B shows that the specificity of the PHGDH antibody (#66350, D8F30, Cell Signaling) used for RIPseq experiments was tested on PHGDHWT (WT) and PHGDHKO (KO) Jurkat T cell lysates and total protein staining (left panel). IPs for RIPseq experiments were performed on sorted TNV 36 h post-activation using PHGDH and isotype control antibodies and verified by Western blot (n=3, right panel). RNA was isolated from each IP sample and sequenced in parallel with the input sample.

[0034] [Figure 2C]Figure 2C is a volcano plot of transcript abundance in PHGDH-IP vs. input (left panel) and isotype-IP vs. input (right panel). Red (upper) dots indicate transcripts that were significantly differentially expressed at padj < 0.05, while blue (lower) dots indicate transcripts with no significant enrichment after IP. From the 927 transcripts enriched in isotype-IP, 637 were also enriched in PHGDH-IP.

[0035] [Figure 2D] Figure 2D is a scatter plot of RIPseq data showing enrichment over input for each transcript using PHGDH-IP (x-axis) versus isotype-IP (y-axis). Pulldowns were defined as specific if an RNA species was (i) more than 2-fold enriched over input in PHGDH-IP and (ii) more than 2-fold enriched in PHGDH-IP compared to isotype-IP.

[0036] [Figure 2E] FIG. 2E shows the relative abundance of pro-survival genes in PHGDH (left bars) and isotype (right bars) IP samples detected in the RIPseq experiment.

[0037] [Figure 2F] FIG. 2F is a schematic diagram of the RNAseq experiment after CRISPR-Cas9 induced gene editing of PHGDH (n=5).

[0038] [Figure 2G] Figure 2G is a volcano plot of differentially expressed transcripts (RNAseq after gene editing) in PHGDH-expressing versus PHGDH-depleted primary effector T cells 72 h post activation.

[0039] [Figure 2H]Figure 2H is a Venn diagram of hits detected by RNAseq and RIPseq experiments. The overlap represents transcripts defined as PHGDH targets by RIPseq that also responded functionally upon PHGDH depletion (RNAseq). Transcripts associated with regulation of gene expression, development and survival are highlighted in boxes.

[0040] [Figure 3A] Figure 3A shows PHGDH mRNA expression in splenic (Sp) mouse T cell subsets according to the ImmGen database. Normalized expression values ​​for naive (T.8.Nve.Sp), LCMV-specific central memory (T8.Tcm.LCMV.d180.Sp) and effector memory CD8+ T cells (T8.Tem.LCMV.d180.Sp) are shown. Annotations reproduced from ImmGen.

[0041] [Figure 3B] Figure 3B shows the sorting strategy for mouse CD8+ TNV and TEM cells based on the expression of CD62L and CD44 (left panel). Bar graphs show PHGDH levels quantified by intracellular flow cytometry in splenic TNV and TEM cells (n=5 mice, center panel). Western blot of SSP-enzyme in sorted non-activated mouse TNV and TEM cells (pooled cells from 5 mice, right panel).

[0042] [Figure 3C] FIG. 3C is a schematic diagram of adoptive transfer experiments using OVA-specific OT-I T cells (Thy1.1+) transduced with an empty vector (EV) or a vector encoding PHGDH (OE-PHGDH).

[0043] [Figure 3D] FIG. 3D shows a Western blot analyzing PHGDH expression in OT-I T cells transduced with EV or OE-PHGDH prior to adoptive transfer.

[0044] [Figure 3E] Figure 3E shows the frequency of Thy1.1+GFP+ T cells transduced with EV or OE-PHGDH over the course of LmOva infection (n = 8-9, left panel). Bar graphs representing the frequency of Thy1.1+GFP+ T cells at 7 and 14 dpi (middle and right panels).

[0045] [Figure 3F] Figure 3F shows the frequency of Thy1.1+GFP+ T cells transduced with EV (lower line), wild-type PHGDH (OE-WT) (middle line) or catalytically inactivated PHGDH (OE-CD) (upper line) over the course of LmOVA infection (n=5).

[0046] [Figure 3G] Figure 3G shows the frequency of Thy1.1+GFP+ T cells transduced with EV or OE-CD over the course of LmOVA infection followed by reinfection at 35 dpi (n=5). Data are presented as mean ± SD (B) or ± SEM. P values ​​were determined using an unpaired two-tailed Student's t-test.

[0047] [Figure 4A] FIG. 4A is a representative histogram of PHGDH expression in TNV electroporated with negative-gRNA (sg-Cont) (right peak) or PHGDH-gRNA (sg-PHGDH) (left peak) and then activated using anti-CD3 / CD28 mAb for 96 h.

[0048] [Figure 4B]Figure 4B is a dot plot showing the gating strategy used to identify viable, late and early apoptotic cells in TNV electroporated with sg-Cont or sg-PHGDH 96 hours after activation (left panel). Frequency of viable, late and early apoptotic cells in TNV electroporated with sg-Cont (left bar) or sg-PHGDH (right bar) 96 hours after activation (n=3, right panel).

[0049] [Figure 4C] Figure 4C is a dot plot representing the gating strategy used to sort CD19 CAR T cells (CAR only) and CD19 CAR_PHGDH(CD) T cells (CAR_PHGDH(CD)) according to GFP and mCherry expression (left panel). Relative cell numbers of CD19 CAR T cells and CD19 CAR_PHGDH(CD) T cells were normalized to CD19 CAR T cell numbers on days 2–4 (n=3–4, right panel).

[0050] [Figure 4D] Figure 4D shows a western blot analyzing PHGDH expression in CD19 CAR T cells and CD19 CAR_PHGDH T cells (n=2).

[0051] [Figure 4E] Figure 4E is a schematic of the experimental design (left panel). Frequency of CD3+CD45+ T cells 8 days after transplantation (n=4-8, right panel). Data are shown as mean ± SEM. P values ​​were determined using an unpaired two-tailed Student's t-test. *P<0.05, **P<0.01.

[0052] [Figure 5A] FIG. 5A is a schematic diagram of the experimental design.

[0053] [Figure 5B]FIG. 5B shows the frequency of splenic CD3+CD45+ T cells, CD8+ and CD4+ T cells within CD3+CD45+ T cells 8 days after transplantation (n=9). Data are presented as mean±SEM. P values ​​were determined using unpaired two-tailed Student's t-test. *P<0.05, **P<0.01.

[0054] [Figure 6A] Figure 6A shows the transcription levels of PHGDH and IRF1 in TNV with CRISPR-Cas9-induced knockout of PHGDH (n=5). Data are shown as mean ± SEM. P values ​​were determined using an unpaired two-tailed Student's t-test. *P<0.05, ****P<0.0001.

[0055] [Figure 6B] Figure 6B shows PHGDH and IRF1 protein levels upon CRISPR-Cas9-induced knockout of PHGDH (n=4). Data are presented as mean ± SEM. P values ​​were determined using unpaired two-tailed Student's t-test. *P<0.05, ****P<0.0001.

[0056] [Figure 6C] FIG. 6C is a schematic of the experimental design of the actinomycin D chasing experiment.

[0057] [Figure 6D] Figure 6D shows a western blot analyzing PHGDH and IRF1 expression in WT (neg.gRNA) or PHGDH knockout (PHGDH gRNA) CD8+ TNV cells before the actinomycin D chase experiment.

[0058] [Figure 6E] Figure 6E shows IRF1 mRNA levels upon 0, 1, 2, and 3 hours of actinomycin D treatment in WT (neg.gRNA; lower line) or PHGDH knockout (PHGDH gRNA; upper line) CD8+ TNV cells (n=3).

[0059] [Figure 7A] FIG. 7A is a schematic diagram of the IRF1-3′UTR fragment used in the microscale thermophoresis experiments.

[0060] [Figure 7B] FIG. 7B shows normalized binding curves of Fragment 3 (Fg3, green; lower line) and Fragment 4 (Fg4, red; upper line) at concentrations ranging from 850 nM to 13 nM in the presence of 50 nM recombinant PHGDH protein.

[0061] [Figure 7C] Figure 7C shows normalized binding curves of Fg3 (green; lower line) and mutant fragment 3 (muFg3, red; upper line) at concentrations ranging from 850 nM to 13 nM in the presence of 50 nM recombinant PHGDH protein. The data were fitted to the Kd model. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0062] Detailed Description The present invention relates to a method for the treatment of effector memory T cells (T EM ) compared with naive T cells (T NV ) is based in part on the discovery that PHGDH is differentially expressed in T NV It was expressed in cells, but not in T EM More specifically, the present inventors determined that the IL-1 gene was not expressed in CD8 +We have shown that PHGDH expression is downregulated during the transition from effector to memory of T cells. We have identified the non-metabolic role of PHGDH as an RNA-binding protein (RBP) that exhibits RNA-binding activity, which is involved in regulating cell differentiation and survival. We have shown that by forcing the expression of PHGDH in transplanted cells, such as immune cells transplanted as part of adoptive cell therapy, particularly T cells, preferably CAR T cells, an improved persistence of cell therapy can be achieved in vitro and in vivo.

[0063] Thus, the present invention addresses the above-mentioned needs in the art. For example, the present invention addresses the needs in the art of cell therapy by providing improved cell therapy, expression constructs, vectors, and methods for preparing and using same. In particular, the present invention addresses the problem of insufficient cell persistence in the field of regenerative medicine, particularly insufficient cell persistence of cell therapy, preferably adoptive cell therapy, preferably CAR T cell therapy. The present disclosure provides cell therapy that improves the persistence of transplanted cells. The present disclosure provides improved cell therapy in applications where it is important to increase the persistence of transplanted cells. In a preferred embodiment, the present disclosure provides improved adoptive immune cell therapy, where the immune cells are preferably lymphocytes, preferably T cells, preferably CAR T cells. Thus, the present disclosure provides improved cancer treatment or improved treatment for infectious diseases.

[0064] Phosphoglycerate dehydrogenase (PHGDH) is an enzyme that catalyzes the first and rate-limiting step of the L-serine biosynthetic pathway (SSP) in animal cells (also referred to herein as L-serine biosynthetic pathway catalytic enzyme activity or PHGDH catalytic activity). PHGDH may comprise or consist of the following amino acid sequence in humans: Human WT PHGDH (SEQ ID NO: 1) sp|O43175|SERA_Human D-3-phosphoglycerate dehydrogenase OS=Homo sapiens OX=9606 GN=PHGDH PE=1 SV=4 [ka]

[0065] Human WT PHGDH may be encoded by the following PHGDH genes in humans: Human PHGDH (WT) - NCBI reference sequence: NM_006623.4 (SEQ ID NO: 2) [ka] [ka]

[0066] PHGDH may contain one or more mutations that reduce L-serine biosynthetic pathway catalytic enzyme activity or completely knock out such activity (so-called "catalytically dead" variant of PHGDH - "PHGDH(CD)"). PHGDH catalytic activity can be measured using techniques known in the art, for example, using a commercially available PHGDH catalytic activity kit (Abcam, ab273328), or as described herein. PHGDH may contain one or more mutations in the catalytic domain of PHGDH to reduce or knock out PHGDH catalytic activity. For example, PHGDH may be PHGDH(CD) containing the R236E mutation (described in Mattani et al. Cancer & Metabolism (2015) 3:5; DOI: 10.1186 / s40170-015-0131-7). PHGDH(CD) may comprise or consist of the following amino acid sequence in humans: PHGDH(CD)R236E aa sequence (SEQ ID NO:3), the R236E mutation is highlighted [ka]

[0067] PHGDH(CD)R236E can be encoded by the following sequence: Human PHGDH (CD) (SEQ ID NO: 4) [ka] [ka]

[0068] Metabolic enzymes may also be involved in non-metabolic or "moonlighting" roles, which may lead to potential functional incompatibility at the cellular level. We have identified a non-metabolic or moonlighting role for PHGDH. In particular, we have shown that PHGDH is silenced during effector T cell contraction. We have shown that PHGDH has a moonlighting role as an RNA-binding protein that exhibits RNA-binding activity, and this property contributes to the regulation of persistence in T cells. We have shown how catalytically inactivated variants of PHGDH, such as PHGDH(CD)R236E, can retain RNA-binding activity. Investigations with such variants have helped to elucidate the non-metabolic RNA-binding role of PHGDH.

[0069] In one aspect, the invention provides cells genetically engineered to enforce expression of PHGDH.

[0070] The term "forced expression" and similar terms refer to both the transcription of a gene or transgene into messenger RNA (mRNA) by a cell, and the translation of that mRNA into a polypeptide (i.e., the gene or transgene product). Expression of a gene or transgene can be measured by techniques known in the art at the mRNA level (e.g., by sequence-specific quantification of the level of mRNA in the cell), or at the polypeptide level (e.g., by measuring the level of a polypeptide gene product using Western blot, densitometry, enzyme-linked immunosorbent assay (ELISA), immunofluorescence microscopy, or other means of quantifying a particular polypeptide). "Forced expression" refers to the expression of a gene, transgene, or polypeptide that is not expressed under normal conditions, or the expression of a gene or polypeptide in an amount that is greater than the amount expressed under normal conditions for a given cell, e.g., any of the cells described herein. Forced expression can be measured by comparing a test cell (e.g., a cell genetically engineered as described herein) with a reference or control cell (e.g., a cell that is not genetically engineered as described herein, or that is genetically engineered but contains an empty vector or otherwise does not contain a transgene as described herein) under the same or similar conditions. Suitably, the control cell is derived from the same population of cells as the test cell, the population of cells being for use in cell therapy, and the test cell being genetically engineered as described herein. Forced expression of PHGDH can be measured by comparing a cell or cells that do not express PHGDH, e.g., a T cell as described herein. EMThe forced expression of PHGDH may be a measure of an increase in the expression of PHGDH mRNA and / or polypeptide in the test cell or cells compared to a control cell or cells, preferably an increase of more than 1-fold, such as at least a 1.1-fold or more increase, such as a 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 3-fold, 4-fold, 5-fold, or at least a 10-fold increase, in the expression of PHGDH mRNA and / or polypeptide in the test cell or cells.

[0071] As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0072] Expression of PHGDH can be forced by genetically engineering cells to incorporate an exogenous polynucleotide sequence encoding PHGDH (e.g., using a vector comprising an exogenous polynucleotide sequence encoding PHGDH) or by altering endogenous expression of PHGDH (e.g., by preventing or reducing silencing of PHGDH expression, or by increasing expression of endogenous PHGDH, e.g., by increasing the activity of one or more endogenous promoter and / or enhancer regions associated with the PHGDH gene).

[0073] The data provided herein show that PHGDH may exhibit moonlighting role as an RNA-binding protein (RBP) with RNA-binding activity. PHGDH has been shown to exhibit RNA-binding activity in T cells, and this activity is involved in regulating cell differentiation and survival. Thus, expression of PHGDH can promote cell persistence and / or prevent cell death, for example, reducing the apoptosis of effector T cells during contraction phase.

[0074] RNA binding activity can be determined by methods known in the art and disclosed herein, for example, using one or more of RNA electrophoretic mobility shift assay (EMSA), RNA pull-down assay including RNA immunoprecipitation sequencing (RIPseq) and RNA sequencing (RNAseq), oligonucleotide-targeted RNase H protection assay, fluorescence in situ hybridization colocalization assay, and microscale thermophoresis (MST).In a preferred embodiment, the PHGDH described herein has RNA binding activity, and preferably, PHGDH binds to one or more mRNAs that code for the transcripts that regulate pro-apoptotic and / or pro-survival processes, and / or epigenetic modifiers and / or components of WNT signaling in cells, preferably cells described herein, preferably T cells. In a preferred embodiment, PHGDH binds to one or more mRNAs encoding transcripts selected from BBC3, MCL1, TP53BP2, NFKBIA, IRF1, BCL2, KDM3A, DOT1L, KAT2A, KDM6B, DVL1 and Jun; preferably one or more mRNAs encoding transcripts regulating pro-apoptotic and / or pro-survival processes, preferably selected from BBC3, MCL1, TP53BP2, NFKBIA, IRF1 and BCL2. In a preferred embodiment, PHGDH binds to one or more mRNAs encoding transcripts regulating pro-apoptotic processes, preferably IRF1, and preferably PHGDH reduces the stability and / or mRNA half-life of the mRNA encoding transcripts regulating pro-apoptotic processes, preferably IRF1. In one embodiment, PHGDH reduces the half-life of the mRNA described herein, preferably IRF1, by 90%, 80%, 70%, 60%, 50% or less. In one embodiment, PHGDH reduces the half-life of an mRNA described herein, preferably IRF1, to between 150 minutes and about 75 minutes. In another embodiment, PHGDH binds to one or more mRNAs that contain an AU-rich element (ARE), preferably multiple AREs, in the 3'UTR.In one embodiment, PHGDH is an ARE-binding protein (ARE-BP). mRNA can be detected by methods known in the art and described herein, preferably by RIPseq and / or RNAseq; PHGDH binding to mRNA can be detected by methods known in the art and described herein, preferably by actinomycin D tracking experiments and / or microscale thermophoresis.

[0075] In one embodiment, the PHGDH described herein has RNA binding activity, and PHGDH binds to RNA that (i) is enriched more than 2-fold in PHGDH-IP than input (whole cell lysate), and (ii) is enriched more than 2-fold in PHGDH-IP compared to control (isotype-IP) in the RIPseq assay described herein. Suitably, PHGDH binds to about 200 or more RNAs, for example, about 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or about 2000 or more RNAs, preferably about 1500 or more protein-coding RNAs in the RIPseq assay described herein, preferably in T cells.

[0076] In one embodiment, PHGDH may have RNA binding activity, but no or reduced PHGDH catalytic activity. In a preferred embodiment, PHGDH may contain one or more mutations in the catalytic domain of PHGDH to reduce or knock out PHGDH catalytic activity but retain RNA binding activity, as described herein. PHGDH catalytic activity can be measured by techniques known in the art and described herein, for example, by monitoring NADH fluorescence as a function of time using a Bioreader (excitation at 360 nm and emission at 460 nm; PSAT1 and its substrate glutamate are included to prevent inhibition of the production of PHGDH), as described in Xu H. et al., 2021, J. Biol. Chem. 296:100572, the entirety of which is incorporated herein by reference. In one embodiment, PHGDH may comprise a mutation at one or more positions selected from 108, 119, 121, 133, 135, 140, 163, 236, 279 and 283 of SEQ ID NO: 1; preferably selected from 108, 121, 236 and 283; preferably selected from 236 and 283; preferably 236. In one embodiment, PHGDH may comprise one or more mutations selected from E108A, R119A, I121A, W133A, R135A, R135W, G140R, R163Q, R236E, I279A, H283A; preferably selected from E108A, I121A, R236E and H283A; preferably selected from R236E and H283A; preferably R236E. In a preferred embodiment, PHGDH containing one or more mutations described herein results in PHGDH having a catalytic activity that is lower than that of PHGDH WT, e.g., about 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 4%, 3%, 2%, 1% or less of catalytic activity compared to PHGDH WT (SEQ ID NO:1).In a preferred embodiment, PHGDH may contain one or more mutations that catalytically inactivate PHGDH but retain RNA binding activity, preferably PHGDH(CD) containing the amino acid sequence of SEQ ID NO:3, and PHGDH has the RNA binding activity described herein.

[0077] The PHGDH described herein may comprise or consist of the amino acid sequence of SEQ ID NO: 1 or 3, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 1 or 3, where the polypeptide has the RNA binding activity described herein, or a functional fragment or variant thereof. Preferably, the PHGDH described herein comprises or consists of SEQ ID NO: 3, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 3, where the polypeptide has the RNA binding activity, or a functional fragment or variant thereof.

[0078] In one aspect, the present disclosure provides a cell that is genetically engineered to force expression of PHGDH, which is for the cell therapy described herein.The present disclosure provides a cell that is genetically engineered to force expression of PHGDH, which is useful or can be used in the cell therapy or method described herein.

[0079] Cell therapy is a therapy in which viable cells are provided or administered to a subject.Cells can be transplanted, for example, injected, grafted or infused, into a subject to treat a condition or disease.In particular, in adoptive cell therapy such as CAR T cell therapy, it is desirable to enhance the persistence of the cells transplanted into a subject as part of cell therapy to treat a condition or disease.

[0080] The cells described herein can be any cell useful for regenerative medicine, for example, cell therapy, as described herein. In a preferred embodiment, the cells described herein can be any cell useful for regenerative medicine, preferably cell therapy, preferably adoptive cell therapy, that benefits from increased cell persistence, that benefits from increased persistence of transplanted cells. In one embodiment, the cells can be any cell useful for regenerative medicine, preferably cell therapy, preferably adoptive cell therapy, in which PHGDH expression is downregulated or silenced with differentiation. Downregulation or silencing of PHGDH expression with differentiation can be determined by methods known in the art and described herein, such as Western blot, real-time reverse transcriptase PCR, epigenetic analysis, etc. In a preferred embodiment, the cells can be immune cells, neurons, or breast, prostate, or colon epithelial cells. In one embodiment, the cells can be any cell useful for regenerative medicine, preferably cell therapy, preferably adoptive cell therapy, that benefits from modulation of apoptosis and / or pro-survival processes.

[0081] Adoptive cell therapy, also known as cellular immunotherapy, is a form of cell therapy that uses the cells of mammalian immune system, preferably human immune system, to treat conditions or diseases, particularly cancer.In a preferred embodiment, any of the cells described herein, particularly the cells that are genetically engineered to force the expression of PHGDH described herein, can be any cell used in adoptive cell therapy, including tumor infiltrating lymphocyte (TIL) therapy, engineered T cell receptor (TCR) therapy, chimeric antigen receptor (CAR) T cell therapy or natural killer (NK) cell therapy, preferably CAR T cell therapy.

[0082] Cells of the immune system can be classified as lymphocytes (including T cells, B cells, and NK cells), neutrophils, and monocytes / macrophages. The cells described herein can be any immune cell, preferably lymphocytes. As used herein, the term "lymphocyte" refers to any of the mononuclear non-phagocytic white blood cells found in blood, lymph, and lymphoid tissues that are derived from lymphatic stem cells. Lymphocytes include T cells, natural killer (NK) cells, and B cells, CIK (cytokine-induced killer) cells, and combinations thereof.

[0083] T cells are a type of lymphocyte (T lymphocyte) that develop in the thymus gland and play a central role in immune responses. T cells can be distinguished from other lymphocytes by the presence of T cell receptors on the cell surface. These immune cells develop as progenitor cells derived from the bone marrow, and once they migrate to the thymus gland, they develop into several different types of T cells. Differentiation of T cells continues after they leave the thymus gland. The cells described herein can be any T cell, e.g., CD3 + Cells, helper CD4 + T cells, cytotoxic CD8 + T cells, memory T cells, regulatory CD4 + T cells, natural killer T cells or gamma delta T cells, or a combination thereof, preferably cytotoxic CD8 + It may be a T cell.

[0084] Natural killer cells, or NK cells, are a type of cytotoxic lymphocyte that are important to the innate immune system. The role played by NK cells is similar to that of cytotoxic T cells in the adaptive immune response of vertebrates. NK cells provide a rapid response against virus-infected cells and respond to tumor formation.

[0085] Tumor infiltrating lymphocytes (TILs) are white blood cells that have left the bloodstream and migrated towards the tumor. They include T cells and B cells and are part of a larger category of "tumor infiltrating immune cells" consisting of various proportions of both mononuclear and polymorphonuclear immune cells (e.g., T cells, B cells, natural killer cells, macrophages, neutrophils, dendritic cells, mast cells, eosinophils, basophils, etc.). Their abundance varies with the type and stage of the tumor and in some cases is associated with disease prognosis. TILs can be used for cell therapy, where TILs are isolated from the patient's tumor and expanded ex vivo. The expanded TILs can then be assayed for specific tumor recognition, and the tumor-specific TILs can then be reinfused into the patient after a further expansion step, if necessary.

[0086] In a preferred embodiment, the cells described herein, in particular the cells genetically engineered to enforce expression of the PHGDH described herein, are T cells, NK cells, B cells or combinations thereof; preferably T cells or NK cells, preferably T cells, preferably CD3 + Cells, preferably CD8 + T cells and / or CD4 + The cell is a T cell. In various embodiments, the cell can comprise CAR or modified TCR. In various embodiments, the cell can be an antigen-specific cell, preferably a tumor antigen-specific cell or a viral antigen-specific cell, preferably an antigen-specific T cell.

[0087] In one aspect, the present disclosure relates in part to a plurality of cells as described herein, in particular a plurality of cells genetically engineered to force expression of PHGDH as described herein. In a preferred embodiment, the plurality of cells is a plurality of T cells, NK cells, B cells, or a combination thereof; preferably a plurality of T cells, preferably CD3 + Cells, preferably CD8 + T cells and / or CD4 + It may comprise a T cell, and optionally a CAR.

[0088] The cell or cells described herein can be allogeneic (the cells are derived from a subject different from the subject receiving the transplanted cells), autologous (the cells are derived from the subject's own tissue), or xenogeneic (the cells are derived from another species). In a preferred embodiment, the cells are autologous.

[0089] In one embodiment, a cell or cells described herein can be engineered to force expression of PHGDH by incorporating an exogenous polynucleotide ("PHGDH transgene") encoding PHGDH into the cell. In another embodiment, a cell described herein can be engineered to force expression of PHGDH by enhancing endogenous expression of PHGDH. For example, endogenous PHGDH expression can be increased by changing the activity of one or more regulatory elements, for example, by increasing the activity of one or more endogenous promoters and / or enhancers, or by inhibiting the suppressor region associated with the PHGDH gene by methods known in the art. For example, the promoter of the endogenous gene encoding PHGDH can be modified so that the gene encoding PHGDH is constitutively expressed in the cell. Similarly, silencing of endogenous PHGDH expression can be prevented or reduced by inhibiting epigenetic silencing of PHGDH. Methods for genetic engineering are well known in the art and include the use of CRISPR / Cas9 or engineered nucleases such as meganucleases, zinc finger nucleases, or TALENs.

[0090] An exogenous polynucleotide, for example, a polynucleotide sequence encoding PHGDH as described herein, can be incorporated into one or more cells, for example, one or more cells as described herein, and expressed in said cells by techniques known in the art and disclosed herein. Methods for incorporating polynucleotides, such as genes and transgenes, into cells and expressing genes and transgenes are known in the art and include physical, chemical and biological methods. Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation. Chemical methods for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Biological methods for introducing a polynucleotide of interest into a host cell include the use of viral vectors.

[0091] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry and immunology, which are within the skill of the art. Such techniques are described in "Molecular Cloning: A Laboratory Manual", second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (MJ Gait, ed., 1984); "Animal Cell Culture" (RI Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (DM Weir & CC Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (JM Miller & MP Calos, eds., 1987); "Current Protocols in Molecular Biology" (FM Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction", (Mullis et al., eds., 1994); and "Current "Protocols in Immunology" (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0092] As used herein, the term "transgene" refers to a polynucleotide sequence inserted into a cell that encodes a polypeptide or a portion of a polypeptide that is expressed in the cell. A PHGDH transgene can include a nucleic acid sequence that is not naturally found in the cell (i.e., a heterologous nucleic acid sequence that encodes PHGDH); a nucleic acid sequence that is a variant or mutant of a nucleic acid sequence that is naturally found in the cell; or a nucleic acid sequence that is naturally present in the cell.

[0093] The term "encode" refers to the inherent property of a particular sequence of nucleotides within a polynucleotide, e.g., a coding sequence, gene, cDNA, or RNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes, having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined amino acid sequence and the biological properties resulting therefrom. Thus, a coding sequence or gene encodes a protein when a protein is produced in a cell or other biological system by transcription of the coding sequence or gene into mRNA and translation of the mRNA corresponding to the coding sequence or gene.

[0094] As used herein, "vector" refers to a macromolecule or an association of macromolecules that contains or associates with a polynucleotide and can mediate the delivery of the polynucleotide to a cell. Exemplary vectors include, for example, plasmids, viral vectors, liposomes, and other gene delivery vehicles. For example, viral vector approaches, such as retroviral and lentiviral (LV) vectors, utilize a large number of vectors and are well characterized in the art. One or more plasmid vectors can be used to transfect cells, preferably in vitro (e.g., in HEK-293 cells), to generate viral particles (viral vectors), for example, viral vectors (expression vectors) that contain the expression cassettes described herein.

[0095] A vector that contains a polynucleotide encoding a gene product of interest and results in the expression of the gene product in an intended target cell can be referred to as an "expression vector". An expression vector can contain control elements (e.g., promoters, enhancers, UTRs, miRNA targeting sequences, linkers, tags, etc.) operably linked to a polynucleotide or region encoding a gene product of interest to promote expression of the gene product in a target cell. The combination of control elements and the polynucleotide or region encoding a gene product of interest to which they are operably linked for expression is referred to herein as an "expression cassette". Many such control elements are known and available in the art or can be readily constructed from components available in the art.

[0096] Any of the cells, expression cassettes and vectors described herein may comprise a polynucleotide sequence encoding PHGDH described herein.Suitably, PHGDH is PHGDH WT, PHGDH with reduced catalytic activity described herein, or PHGDH (CD) with RNA binding activity, preferably, PHGDH is PHGDH with reduced catalytic activity described herein, or PHGDH with RNA binding activity (CD) described herein.In various embodiments, the polynucleotide sequence comprises SEQ ID NO: 2 or 4, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 2 or 4, and the sequence encodes a polypeptide with RNA binding activity, or a functional fragment or variant thereof. In a preferred embodiment, the polynucleotide sequence encoding PHGDH comprises SEQ ID NO:4, or a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO:4, which sequence encodes a polypeptide having RNA binding activity, or a functional fragment or variant thereof.

[0097] As used herein, "variant" or "mutant" refers to a polynucleotide or polypeptide that has less than 100% sequence identity with a reference polynucleotide or polypeptide, such as a "wild-type" polynucleotide or polypeptide, or a polynucleotide or polypeptide that is naturally found in a cell. A variant or mutant polynucleotide may contain at least one nucleotide difference (e.g., nucleotide substitution, nucleotide insertion, or nucleotide deletion) with respect to a reference polynucleotide sequence; a variant or mutant polypeptide may contain at least one amino acid difference (e.g., amino acid substitution, amino acid insertion, amino acid deletion) with respect to a reference polypeptide sequence. In some aspects, a variant or mutant polynucleotide encoding PHGDH or a variant or mutant PHGDH polypeptide retains the biological activity of wild-type PHGDH, including the L-serine biosynthetic pathway catalytic enzyme activity described herein and / or the RNA binding activity described herein; preferably the RNA binding activity.

[0098] In some aspects, the present disclosure provides an expression cassette comprising a polynucleotide sequence encoding phosphoglycerate dehydrogenase PHGDH as described herein.The expression cassette can be adapted to genetically modify cells, such as any of the cells useful in cell therapy described herein, preferably immune cells, preferably T cells.The expression cassette can be adapted to force the expression of PHGDH in cells, such as any of the cells useful in cell therapy described herein, preferably immune cells, preferably T cells.The expression cassette can be adapted to genetically modify cell therapy, preferably adoptive cell therapy, preferably T cell therapy, as described herein.

[0099] The expression cassette of the present disclosure may comprise a polynucleotide sequence encoding PHGDH as described herein and a control element that controls the expression of PHGDH in a cell, for example, any of the cells described herein, preferably a cell useful in cell therapy as described herein, preferably an immune cell, preferably a T cell. The control element may be selected from one or more of a promoter, an enhancer, an miRNA targeting sequence, a linker, and a tag, and preferably, the control element is operably linked to a polynucleotide or region that codes for a gene product of interest.

[0100] The expression cassette of the present disclosure can increase the expression of PHGDH in the cell of the present disclosure, preferably by expressing the PHGDH transgene in the cell. As used herein, "expression of the transgene" or "expressing the transgene" refers to both the transcription of the transgene into messenger RNA (mRNA) by the host cell and the translation of the mRNA into a polypeptide (i.e., the transgene product). Thus, the expression of PHGDH can be measured at the mRNA level (i.e., by sequence-specific quantification of the level of the mRNA in the cell), or at the polypeptide level (i.e., by measuring the level of the polypeptide gene product using Western blot, enzyme-linked immunosorbent assay (ELISA), immunofluorescence microscopy, or other means of quantifying a specific polypeptide).

[0101] The PHGDH transgene can be modified, or "codon-optimized," to enhance expression by replacing low-represented codons with highly represented codons. A coding sequence is a portion of an mRNA sequence that codes for an amino acid for translation. During translation, each of the 61 trinucleotide codons is translated into one of 20 amino acids, resulting in the degeneracy, or redundancy, of the genetic code. However, different cell types, and different animal species, utilize tRNAs (each with an anticodon) that code for the same amino acid at different frequencies. If a gene sequence contains a codon that is low-represented by the corresponding tRNA, the ribosomal translation machinery may slow down and prevent efficient translation. Expression can be improved by "codon optimization" for a particular species, where the coding sequence is altered to code for the same protein sequence, but utilizes highly represented codons and / or codons utilized by highly expressed human proteins (Cid-Arregui et al., 2003; J. Virol. 77: 4928).

[0102] As used herein, a "promoter" encompasses a nucleotide sequence that directs the binding of RNA polymerase, thereby facilitating RNA synthesis (i.e., initiating transcription). Expression of a promoter and the corresponding protein or polypeptide may be ubiquitous (meaning strongly active in a wide range of cells, tissues, and species), or cell type-specific, tissue-specific, or species-specific. A promoter may be "constitutive," meaning continuously active, or "inducible," meaning that the promoter can be activated or inactivated by the presence or absence of a biotic or abiotic factor.

[0103] As used herein, "enhancer" encompasses cis-acting elements that stimulate or inhibit the transcription of adjacent genes. Enhancers that inhibit transcription are also called "silencers". Enhancers are nucleic acid elements known in the art to enhance transcription and can be located anywhere associated with the genes they regulate (e.g., upstream, downstream, in an intron). Enhancers can function in either direction over distances up to several kilobase pairs (kb) from the coding sequence and downstream positions of the transcribed region. Enhancer sequences affect promoter-dependent gene expression.

[0104] Promoter and enhancer elements can be tissue-specific or stage-specific.For example, tissue-specific promoters or enhancers drive expression (or higher levels of expression) preferentially in one or more specific cell types.Stage-specific promoters or enhancers drive expression (or higher levels of expression) preferentially during one or more specific stages of cell cycle or development.

[0105] Any suitable promoter, such as promoter region or promoter sequence therein, can be used in the subject expression cassette, as long as the promoter promotes the expression of PHGDH in cells described herein, preferably eukaryotic cells, preferably mammalian cells, preferably human cells, preferably immune cells, preferably T cells.The promoter can be a constitutive promoter or an inducible promoter, preferably an inducible promoter.In a preferred embodiment, the promoter can be selected from CMV, EF1A, EFS, CAG, CBh, SFFV, MSCV, SV40, mPGK, hPGK, UBC or TRE promoter.

[0106] Any suitable enhancer may be used in the subject expression cassette, as long as it enhances the expression of PHGDH in the cells described herein, particularly when used in combination with any of the promoters described herein.

[0107] A polynucleotide sequence encoding PHGDH may be heterologous to (i.e., not naturally operably associated with) the promoter sequence to which it is operably linked, or may be endogenous to (i.e., naturally operably associated with) the promoter sequence to which it is operably linked.

[0108] In a preferred embodiment, the expression cassette described herein may include a sequence encoding a chimeric antigen receptor (CAR). The present disclosure provides an expression cassette comprising a polynucleotide sequence encoding phosphoglycerate dehydrogenase (PHGDH) and a polynucleotide sequence encoding a CAR described herein. The expression cassette is preferably a polycistronic expression cassette for expressing multiple proteins in a single vector. The polynucleotide sequence encoding PHGDH and the polynucleotide sequence encoding the CAR may be separated or flanked by one or more linkers, preferably selected from one or more internal ribosome entry sites (IRES), or one or more polynucleotides encoding "self-cleaving" peptides, such as a self-cleaving 2A peptide selected from P2A, T2A, E2A and F2A, or combinations thereof using techniques known in the art. The coding sequences separated by the IRES sequence are each translated independently. The 2A peptide is a viral oligopeptide of 18-22 amino acids in length that mediates the "cleavage" of a polypeptide during translation in eukaryotic cells.

[0109] The expression cassette of the present disclosure may comprise the following general structure: 5'-promoter-CAR-linker-PHGDH-3'; 5'-promoter-PHGDH-linker-CAR-3'; where the promoter may be any of the promoters described herein, the CAR may be any of the CARs described herein, the PHGDH may be any of the polynucleotide sequences encoding PHGDH described herein, and the linker may be any of the linker sequences or polynucleotides encoding linker sequences described herein. The expression cassette may comprise additional polynucleotide sequences at the 5' end, the 3' end, and in the region between one or more of the promoter, PHGDH, linker, and CAR sequences. For example, the expression cassette described herein may comprise one or more tags, preferably at the 3' end, selected from mCherry, GFP, any fluorescent tag, CD34, FLAG, and C-Myc. The expression cassette may comprise, for example, one or more linkers described herein, separating the 3'CAR or PHGDH sequence from the tag.

[0110] In an alternative aspect, the present disclosure relates to an expression cassette as disclosed herein, comprising a polynucleotide sequence encoding PHGDH as described herein and a separate expression cassette comprising a sequence encoding a chimeric antigen receptor (CAR) as described herein, wherein the expression cassette is adapted to genetically modify a cell as described herein, preferably an immune cell, preferably a T cell. The expression cassette can be adapted to force expression of PHGDH and express CAR in a cell as described herein, preferably an immune cell, preferably a T cell. The expression cassette can be adapted to genetically modify a cell therapy as described herein, preferably an adoptive cell therapy, preferably a T cell therapy.

[0111] CAR is an engineered synthetic receptor that can be expressed in immune cells and functions to redirect immune cells, preferably lymphocytes, most commonly T cells, to recognize and eliminate cells expressing a specific target antigen. CAR binding to the target antigen expressed on the cell surface is independent of MHC receptors, resulting in vigorous T cell activation and strong anti-tumor responses. CAR is a modular synthetic receptor, the structure of which has been well characterized in the art. CAR consists of three main components: (1) an extracellular target antigen binding domain (ABD), (2) a transmembrane domain, and (3) one or more intracellular signaling domains. CAR may also include a hinge region that extends the ABD from the transmembrane domain.

[0112] The antigen-binding domain (ABD) (or ectodomain) is the portion of the CAR that confers target antigen specificity. Typically, the antigen-binding domain is derived from the variable heavy (VH) and variable light (VL) chains of a monoclonal antibody, linked via a flexible linker to form a single-chain variable fragment (scFv).

[0113] The transmembrane domain links the ABD and the intracellular signaling domain and functions to anchor the CAR to the cell membrane. The transmembrane domain is usually derived from a transmembrane receptor protein. Most transmembrane domains are derived from natural proteins, including CD3ζ, CD4, CD8α, or CD28, but the transmembrane domain can also be derived from synthetic sources.

[0114] The intracellular signaling domain (or cytoplasmic signaling domain) is responsible for activating at least one of the normal effector functions of the immune cell in which the CAR is expressed. "Effector function" refers to a specialized function of a cell. For example, the effector function of a T cell can be cytolytic activity or helper activity, including secretion of cytokines. A CAR can contain one or more intracellular signaling domains (e.g., a second generation CAR can contain two intracellular signaling domains; a third generation CAR can contain three intracellular signaling domains), and cell activation is mediated by the following different classes of intracellular signaling domains: at least one intracellular signaling domain that initiates antigen-dependent primary activation via the TCR (primary intracellular signaling domain), and one or more intracellular signaling domains that act antigen-independently to provide secondary or costimulatory signals (costimulatory intracellular signaling domains).

[0115] A primary intracellular signaling domain regulates primary activation of the TCR complex in a stimulatory or inhibitory manner. A primary intracellular signaling domain that acts in a stimulatory manner may contain a signaling motif known as an immunoreceptor tyrosine-based activation motif (ITAM).

[0116] A costimulatory intracellular signaling domain refers to a portion of a CAR that contains the intracellular domain of a costimulatory molecule, which is a cell surface molecule other than an antigen receptor or its ligand that is required for an efficient response of lymphocytes to antigens.

[0117] The expression cassettes described herein can include a sequence encoding a CAR that includes one or more ABDs described herein, a transmembrane domain described herein, and one or more intracellular signaling domains described herein, preferably two or more intracellular signaling domains.

[0118] One or more ABDs can be any domain known in the art that can specifically bind to a particular antigen.In a preferred embodiment, ABD is an antibody or an antigen-binding fragment of an antibody that specifically binds to an antigen, preferably ScFV.In a preferred embodiment, the antigen can be one or more of cancer-associated antigens, preferably BCMA, CD19, CD22, CD30, CD33, CD56, CD123, CEA, EBV-associated antigen, EGFR, GD2, GPC3, HER2, HPV-associated antigen, MAGE antigen, mesothelin, MUC-1, NY-ESO-1, PSCA, PSMA, ROR1, WT1, and claudin 18.2; preferably one or more of CD19, BCMA, CD30, CD33, CD123, or FLT3.In one embodiment, CAR can comprise more than one ABD, for example two or more ABDs, as described herein. In one embodiment, the CAR may be a bispecific CAR comprising two or more ABDs (wherein one ABD specifically binds to an antigen described herein and one ABD specifically binds to a different antigen described herein); preferably a bispecific CAR comprising a CD19 ABD and a CD22 ABD; a bispecific CAR comprising a CD19 ABD and a CD20 ABD; a bispecific CAR comprising a CD19 ABD and a BCMA ABD; a bispecific CAR comprising a HER2 ABD and an IL13Ra2 ABD; or a bispecific CAR comprising a HER2 ABD and a MUC1 ABD. Approved CAR T cell therapies include CARs comprising an ABD that specifically binds to CD19 or BCMA. In a preferred embodiment, the antigen is CD19 or BCMA. The expression cassettes described herein may comprise sequences encoding CD19 ScFV, preferably sequences encoding ScFV FM63 (ref.) or BCMA ScFV. In another embodiment, the antigen may be a viral antigen. The viral antigen may be any component of the viral particle that is accessible to the CAR, for example an antigen that forms part of the surface and / or protein coat of the virus.Preferably, the viral antigen recognized by the CAR is an antigen derived from human immunodeficiency virus (HIV), adenovirus, polyomavirus, influenza virus, hepatitis B, or human herpesvirus, in particular a human herpesvirus, which is cytomegalovirus (CMV), Epstein-Barr virus (EBV), herpes simplex virus (HSV), varicella zoster virus (VZV) or human herpesvirus 8 (HHV8), preferably the viral antigen is an EBV antigen.

[0119] The transmembrane (TM) domain may be derived from a natural or synthetic source. If the origin is natural, the domain may be derived from any membrane-bound or transmembrane protein. The transmembrane region may include at least the transmembrane region(s) of the alpha, beta or zeta chain of the T-cell receptor, CD28, CD8, CD3 epsilon, CD45, CD4, CD5, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154 or a portion thereof. Alternatively, the transmembrane domain may be synthetic, in which case it mainly comprises hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan, and valine is found at each end of the synthetic transmembrane domain.

[0120] In a preferred embodiment, the transmembrane region is derived from CD8, and optionally, the hinge region, if present, is derived from CD8.

[0121] The primary intracellular signaling domain may be selected from intracellular signaling domains derived from CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d. In a preferred embodiment, the intracellular signaling domain of the CAR described herein comprises an intracellular signaling domain derived from CD3 zeta.

[0122] The costimulatory intracellular signaling domain may be selected from one or more of CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, MYD88, B7-H3, and a ligand that specifically binds to CD83. In a preferred embodiment, the costimulatory intracellular signaling domain is CD28 or 4-1BB, or a combination thereof.

[0123] The CARs described herein may comprise a short oligo- or polypeptide linker, preferably between 2 and 10 amino acids in length, preferably a glycine-serine doublet linker, that forms the link between the transmembrane domain and the intracellular signaling domain(s) of the CAR.

[0124] In a preferred embodiment, the expression cassette according to the present disclosure comprises a polynucleotide sequence encoding a promoter, preferably the EF-1 alpha promoter; a polynucleotide sequence encoding a CAR (preferably, the CAR comprises a CD19 ScFV, a CD8 hinge and CD8 TM region, a 4-1BB costimulatory region, a CD3 zeta primary intracellular region); a polynucleotide sequence encoding a P2A self-cleaving linker; and a polynucleotide sequence encoding PHGDH, preferably comprising SEQ ID NO:4 or a sequence having 95% identity to SEQ ID NO:4 and encoding PHGDH having RNA-binding activity.

[0125] In some aspects, the disclosure provides a vector comprising any of the polynucleotide sequences described herein or any of the expression cassettes described herein. A vector comprising an expression cassette may be referred to as an expression vector.

[0126] Any vector system known in the art and described herein can be utilized to introduce the polynucleotide sequence described herein into a cell, preferably a mammalian cell, and preferably to express the polynucleotide sequence encoding PHGDH described herein in a cell, preferably an immune cell, preferably a T cell. For example, the vector can comprise single-stranded or double-stranded nucleic acid, such as single-stranded or double-stranded DNA. For example, the vector can be DNA, such as naked DNA, such as a plasmid, a minicircle, etc. The vector can comprise single-stranded or double-stranded RNA, including modified forms of RNA. In another example, the vector can be RNA, such as mRNA or modified mRNA. Methods for transfecting cells with mRNA include electroporation, chemical transfection methods, such as lipofection, or cationic polymers. As another example, the gene delivery vector may be a viral vector derived from a virus, such as adenovirus, adeno-associated virus, LV, herpes virus, alphavirus, or retrovirus, such as Moloney murine leukemia virus (M-MuLV), Moloney murine sarcoma virus (MoMSV), Harvey murine sarcoma virus (HaMuSV), mouse mammary tumor virus (MuMTV), gibbon ape leukemia virus (GaLV), feline leukemia virus (FLV), spumavirus, Friend murine leukemia virus, murine stem cell virus (MSCV), or Rous sarcoma virus (RSV). Although an embodiment that includes the use of LV is described in more detail below, it is expected that a person skilled in the art will understand that similar knowledge and techniques in the art can be applied to gene therapy vectors other than LV. In particular, viral vectors include, for example, retroviral vectors for stable gene expression in target cells; and adenoviral or adeno-associated viral vectors for transient gene expression in target cells. Retroviral vectors include gamma-retroviruses, lentiviruses, and NILV-S / MAR vectors (which use non-integrating lentiviral (NILV) vectors containing scaffold / matrix attachment region (S / MAR) elements).Non-viral vectors include mRNA vectors, transposons, and lipid nanoparticles.Vector can also include sequences that code proteins for transgene expression or target gene silencing, such as transposase enzymes (e.g., sleeping beauty, piggyBac); and endonuclease enzymes (e.g., zinc finger nuclease, TALEN, CRISPR / Cas9).Methods for delivering vectors and transgenes include electroporation, lipid nanoparticles, nucleofection, hydrodynamic delivery, and cell-penetrating peptides.

[0127] Gamma retroviruses and lentiviruses are mostly used in producing CAR T cells due to their high transduction efficiency.In a preferred embodiment, the vector described herein is a retroviral vector, preferably a lentiviral vector (LV) that comprises the polynucleotide encoding PHGDH described herein, preferably an LV expression vector that comprises an expression cassette that comprises the polynucleotide encoding PHGDH described herein.The LV expression vector can be a self-limiting LV expression vector, a self-inactivating LV expression vector, or a non-integrating LV expression vector.

[0128] As used herein, "lentivirus" refers to a genus of the Retroviridae family.Lentiviruses are unique among retroviruses that can infect non-dividing cells; they can deliver a significant amount of genetic information to the DNA of host cells, making them one of the most efficient methods of vector gene delivery.HIV, SIV, and FIV are all examples of lentiviruses.Vectors derived from lentiviruses provide a means to achieve significant levels of gene transfer in vivo.LV vectors have been well characterized, and their generation is known in the art.

[0129] One or more LV vectors are used to generate LV expression vectors that contain an expression cassette that includes a polynucleotide encoding a gene of interest. The following LV plasmid vectors are typically used to generate LV expression vectors: 1) a transfer plasmid that contains a polynucleotide encoding a gene of interest, 2) one or more packaging plasmid(s), and 3) an envelope plasmid. The LV plasmid vector is then transfected into cells, preferably in vitro (e.g., in HEK-293 cells), to generate an LV expression vector that contains an expression cassette that can be used to transduce cells to express the gene of interest (i.e., an LV particle that contains an expression cassette that can be used to transduce cells to express the gene of interest).

[0130] The vectors described herein may include any of the LV plasmid vectors described herein or combinations thereof. The LV plasmid vectors described herein may include a transfer plasmid comprising a polynucleotide encoding PHGDH as described herein. The transfer plasmid may be any of the transfer plasmids known in the art and described herein. Preferably, the transfer plasmid is an HIV-1 replication-incompetent transfer plasmid, preferably selected from a second or third generation transfer plasmid, preferably a third generation transfer plasmid, preferably selected from pLV-mcherry and pSFFV. The packaging and envelope plasmids may be selected from any of the plasmids known in the art and described herein based on their compatibility for use with the transfer plasmids described herein. For example, a second generation transfer plasmid must be used with a second generation packaging plasmid. A third generation transfer plasmid may be used with a second or third generation packaging plasmid. In a preferred embodiment, the packaging plasmid is a second generation packaging plasmid, preferably selected from psPAX2 or pCMVR.8.74. The envelope plasmid is exchangeable and typically encodes VSV-G. In a preferred embodiment, the envelope plasmid is pMD2G or pCMV.

[0131] In one aspect, the present disclosure provides a kit comprising one or more of the vectors described herein, preferably an LV vector described herein, preferably a transfer plasmid described herein, and one or more LV vectors described herein selected from one or more packaging plasmids described herein and / or an envelope plasmid described herein.

[0132] In a preferred aspect, the present disclosure relates to a vector as described herein, preferably an LV expression vector, comprising an expression cassette comprising a polynucleotide sequence encoding PHGDH and a polynucleotide sequence encoding a CAR as described herein.

[0133] In an alternative aspect, the disclosure relates to a vector as described herein, preferably an LV expression vector, comprising an expression cassette comprising a polynucleotide sequence encoding a PHGDH as described herein, and a separate vector comprising an expression cassette comprising a polynucleotide sequence encoding a CAR as described herein.

[0134] The vector disclosed herein can also be used to introduce polynucleotide sequences or polypeptides that increase the expression of endogenous PHGDH.For example, the activity of one or more endogenous promoters and / or enhancer regions associated with PHGDH gene can be increased by methods known in the art.The silencing of endogenous PHGDH expression can be prevented or reduced by, for example, introducing polynucleotide sequences that code siRNA, antisense, ribozyme, shRNA, methylating the CpG nucleotides of PHGDH gene in the promoter region, non-coding RNA-associated gene silencing.

[0135] The present disclosure also provides a cell, e.g., one or more cells, comprising any of the polynucleotide sequences, expression cassettes, vectors and / or expression vectors disclosed herein. The cell can be any cell useful in recombinant genetic techniques, e.g., for preparing the polynucleotide sequences, expression cassettes, vectors, expression vectors and / or cells described herein. In a preferred embodiment, the cell can be any cell for producing an expression vector, preferably an LV expression vector (i.e., an LV particle comprising an expression cassette that can be used to transduce cells to express PHGDH), comprising an expression cassette that can be used to transduce cells to express PHGDH. The cell can be selected from mammalian cells (e.g., 293 cells), insect cells (e.g., SF9 cells), microorganisms and yeast. The cell can be a packaging cell in which the LV vector gene is stably maintained, or a producer cell in which the LV vector genome is stably maintained and packaged. Exemplary packaging and producer cells are derived from SF-9, 293, A549 or HeLa cells. The LV vector can be purified and formulated using standard techniques known in the art. The cell can be transduced by a viral vector comprising the expression cassette disclosed herein, or can have the expression cassette disclosed herein integrated into the genome of the cell. In certain embodiments, the cell is a cell used to produce a viral gene delivery vector (e.g., an LV particle comprising an expression cassette that can be used to transduce cells to express PHGDH). In other embodiments, the cell is any cell useful for regenerative medicine, e.g., cell therapy as described herein. Preferably, the cell is for delivery to a subject.

[0136] The present disclosure also provides a composition comprising any of the polynucleotide sequences, expression cassettes, vectors, expression vectors and / or cells disclosed herein.In a preferred embodiment, the composition may be a pharmaceutical composition, suitably comprising one or more pharma-ceutically acceptable carriers, diluents and / or excipients.The composition may comprise a buffer, such as neutral buffered saline, phosphate buffered saline; a carbohydrate, such as glucose, mannose, sucrose or dextran, mannitol; a protein; an amino acid, such as a polypeptide or glycine; an antioxidant; a chelating agent, such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); and a preservative.

[0137] The polynucleotides, expression cassettes, vectors and compositions disclosed herein may be used in methods for forcing expression of PHGDH in cells. The polynucleotides, expression cassettes, vectors and compositions may be used in methods for expressing a PHGDH transgene in a cell disclosed herein. In one aspect, the disclosure provides a method for generating a cell genetically engineered to force expression of PHGDH, comprising contacting one or more cells with a polynucleotide, expression cassette, vector or composition disclosed herein. The method may be, for example, a research method for determining the effect of PHGDH on cell survival and / or function, or a medical method for, for example, treating or preventing a disease or disorder disclosed herein, or preparing a cell or composition disclosed herein for treating or preventing a disease or disorder disclosed herein. In some embodiments, the contacting is performed in vitro or ex vivo. In some aspects, the contacting is performed in vivo, i.e., a polynucleotide, expression cassette, vector or composition disclosed herein may be administered to a subject. In a preferred aspect, the contacting is performed in vitro or ex vivo.

[0138] In a preferred embodiment, the one or more cells can be any cell useful for regenerative medicine, preferably cell therapy as disclosed herein, preferably adoptive cell therapy, preferably CAR T cell therapy. In this embodiment, the cell, preferably the cell genetically engineered to force expression of PHGDH, or the composition comprising such a cell, can be administered to a subject in need thereof. In a preferred embodiment, the one or more cells can be immune cells, preferably lymphocytes, preferably T cells, preferably CD3 + Cells, preferably CD8 + T cells and / or CD4 + T cells, e.g., CD8 + T cells and CD4 + It is bulk T cells that contain T cells.

[0139] The cells can be obtained from a subject. In a preferred embodiment, the cells can be obtained from the subject to be treated by cell therapy (autologous), for example, the cells can be obtained from the subject before cell therapy. In another embodiment, the cells can be obtained from a subject other than the subject to be treated by cell therapy (for example, allogeneic from a donor). Preferably, the cells are mammalian cells, preferably human cells.

[0140] The cells described herein can be obtained from a subject from any source using methods known in the art. In a preferred embodiment, the immune cells disclosed herein, preferably one or more lymphocytes, can be obtained from a subject from several sources, including peripheral blood, mononuclear cells, bone marrow, lymph node tissue, blood, thymus tissue, tissue from an infection site, ascites, pleural effusion, spleen tissue, and tumor. Any type of lymphocyte available in the art and described herein can be used. In general, a person skilled in the art knows how to isolate a certain type of lymphocyte from an appropriate source. In a preferred embodiment, the method includes obtaining peripheral blood mononuclear cells (PBMCs) from a subject by methods known in the art, preferably from blood. Preferably, the PBMCs are non-mobile. The PBMCs can be obtained from a blood sample from a subject by methods known in the art, for example, by density gradient centrifugation protocols with Ficoll™ separation (Lymphoprep; Fresenius Kabi) or by apheresis, preferably leukapheresis. The cells obtained by apheresis can be washed to remove the plasma fraction and the cells can be placed in an appropriate buffer or medium for subsequent processing steps. In a preferred embodiment, T cells can be obtained from PBMCs by methods known in the art.

[0141] Ex vivo or in vitro cell therapy methods are known in the art and include one or more of cell isolation, enrichment, activation, and expansion. One or more ex vivo cell therapy methods may be performed after obtaining the cells from a subject and / or prior to administering the cells to the subject.

[0142] The cells may be isolated and / or enriched by positive or negative selection techniques known in the art and described herein, such as using density gradient centrifugation and / or magnetic beads. In the methods described herein, the isolation and / or enrichment may be performed before or after contacting one or more cells with a polynucleotide, expression cassette, vector or composition disclosed herein. Lymphocytes are well characterized, and it is known in the art what surface antigens may be present on different types of lymphocytes. One skilled in the art can select conditions for positive or negative selection that allow enrichment or isolation of a particular type of cell, particularly a particular type of lymphocyte. In addition, commercially available kits for enriching and / or isolating specific cells, particularly lymphocytes, are readily available. In a preferred embodiment, the method comprises: + , CD28 + , CD4 + , CD8 + , CD45RA + , and CD45RO + T cells, CD16 + , and CD56 + NK cells, or CD3 + , CD56 + , and CD161 + NKT cells; preferably CD3 + Cells, preferably CD8 + Cells, and / or CD4 + Cells, preferably CD8 + The present invention includes isolating and / or enriching subpopulations of lymphocytes, such as lymphocytes.

[0143] The cells may be activated and / or expanded by techniques known in the art and described herein before they are administered to a subject, for example, using antibody-coated microbeads, such as anti-CD3 / anti-CD28 coated microbeads. In the methods described herein, activation and / or expansion may be performed before or after contacting one or more cells with a polynucleotide, expression cassette, vector, or composition disclosed herein. Activation and / or expansion may be performed before or after isolation and / or enrichment. The cells may also be activated and / or expanded after they are administered to a subject by techniques known in the art.

[0144] The NK cells described herein can be activated by culturing the cells in an appropriate medium (e.g., Minimum Essential Medium or RPMI Medium 1640, or X-vivo 15, (Lonza), CellGro Medium (Cellgenix), IMDM (Gibco)) that may contain factors necessary for proliferation and survival, including serum (e.g., fetal bovine serum, human serum, or horse serum) supplemented with IL-15 and / or IL-12 and / or IL-18. Activation of NK cells can also be achieved by supplementing the medium with IL-2. Activation of NK cells can be improved by adding a feeder cell line to the culture.

[0145] The T cells described herein can be activated by contact with a surface to which an agent that stimulates CD3 / TCR complex-associated signals and a ligand that stimulates costimulatory molecules on the surface of T cells are attached.In particular, a T cell population can be stimulated by contact with an anti-CD3 antibody or its antigen-binding fragment, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g., bryostatin) in combination with a calcium ionophore.For costimulation of accessory molecules on the surface of T cells, a ligand that binds to the accessory molecule can be used.For example, a T cell population can be contacted with an anti-CD3 antibody and an anti-CD28 antibody under conditions suitable for stimulating T cell proliferation.

[0146] In a preferred embodiment, the methods described herein include obtaining cells from a subject by leukapheresis of non-mobilized peripheral blood mononuclear cells, enriching and selecting ex vivo for T cells expressing CD3, preferably T cells expressing CD8 and CD4, and activating the T cells using anti-CD3 and / or anti-CD28 antibodies in the presence of IL2.

[0147] The present disclosure provides one or more cells as disclosed herein transduced with a vector comprising a polynucleotide encoding PHGDH and optionally a polynucleotide encoding a CAR as disclosed herein; or one or more cells as disclosed herein transduced with a vector comprising a polynucleotide encoding PHGDH and optionally a separate vector comprising a polynucleotide encoding a CAR as disclosed herein. The one or more cells may comprise a control switch, such as a suicide switch, an endogenous switch or an exogenous switch. Thus, the present invention provides a method of transducing one or more cells as disclosed herein with a vector comprising a polynucleotide encoding PHGDH and optionally a polynucleotide encoding a CAR as disclosed herein; or a vector comprising a polynucleotide encoding PHGDH and a separate vector comprising a polynucleotide encoding a CAR as disclosed herein. In various aspects, the methods described herein may include isolation and / or enrichment after contacting one or more cells with a polynucleotide, expression cassette, vector, or composition as disclosed herein. In one aspect, the method comprises isolating and / or enriching cells transduced with a vector comprising a polynucleotide encoding PHGDH, and optionally a polynucleotide encoding a CAR disclosed herein; or isolating and / or enriching cells transduced with a vector comprising a polynucleotide encoding PHGDH, and optionally a separate vector comprising a polynucleotide encoding a CAR disclosed herein.

[0148] As used herein, the terms "transduced" or "transfected" refer to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transduced" cell is a cell that has been transfected or transduced with exogenous nucleic acid.

[0149] The present disclosure also provides a method of treatment comprising administering any of the cells disclosed herein, or any of the compositions, polynucleotide sequences, expression cassettes, vectors and / or expression vectors disclosed herein to a subject in need thereof. In a preferred embodiment, the method of treatment comprises any treatment in which enhanced cell persistence is required, such as any treatment in the field of regenerative medicine, preferably cell therapy as described herein, preferably adoptive cell therapy as described herein.

[0150] The present disclosure also provides any of the cells disclosed herein, or any of the compositions, polynucleotide sequences, expression cassettes, vectors and / or expression vectors disclosed herein for use in any of the methods described herein, particularly for use in any of the treatment methods described herein.

[0151] The present disclosure also provides the use of any of the cells disclosed herein, or any of the compositions, polynucleotide sequences, expression cassettes, vectors and / or expression vectors disclosed herein in the manufacture of a medicament for any of the methods described herein, particularly the methods of treatment described herein.

[0152] As used herein, the terms "treat", "treatment" and the like are generally used to mean obtaining a desired pharmacological and / or physiological effect. The effect may be preventative in that it completely or partially prevents a disease or condition, and / or may be therapeutic in that it partially or completely cures a disease or condition and / or the adverse effects caused by the disease. As used herein, "treatment" covers any treatment of a disease or condition in a mammal, preferably a human, and includes ameliorating a disease, disorder or condition (i.e., delaying or arresting or reducing the onset of a disease, disorder or condition, or at least one of its clinical symptoms); alleviating or improving at least one physical parameter, including those that are not discernible by the patient; modulating a disease, disorder or condition, physically (e.g., stabilizing a discernible symptom), physiologically (e.g., stabilizing a physical parameter), or both; or preventing or delaying the onset, onset or progression of a disease, disorder or condition, or one or more clinical symptoms thereof.

[0153] As used herein, the phrase "ameliorating at least one symptom of" refers to reducing one or more symptoms of the disease or condition for which the subject is being treated. The disease or condition being treated may be selected from any of the diseases or conditions disclosed herein.

[0154] In a preferred embodiment, the present disclosure provides improved cell therapy, and polynucleotides, expression vectors, and methods for preparing and using the same. In particular, the present disclosure provides improved cell therapy, preferably any of the cell therapy disclosed herein, comprising one or more cells as described herein, transplanted into a subject suffering from a disease or condition to treat the disease or condition, and the present disclosure improves the persistence and / or survival rate of the transplanted cells. In a preferred embodiment, the present disclosure provides improved adoptive cell therapy, wherein the one or more transplanted cells are immune cells, preferably lymphocytes, preferably T cells as described herein, and optionally include one or more CARs as described herein. In a preferred embodiment, the present disclosure provides improved CAR T cell therapy, particularly CAR T cell therapy as described herein. In a preferred embodiment, the method of treating any of the diseases or conditions described herein can include administering any of the cells or pharmaceutical compositions as described herein to a subject in need thereof.

[0155] Several cell therapies have received regulatory approval for the treatment of various diseases and conditions. CAR T cell therapy has been approved to treat diseases including cancer, particularly hematological or blood cancers. Hematopoietic progenitor cell (HPC) transplantation (stem cell or bone marrow transplantation, also known as HSCT) has been approved to treat diseases including amyloidosis, germ cell tumors (e.g., testicular cancer), acute leukemia, amegakaryocytosis or congenital thrombocytopenia, aplastic or refractory anemia, chronic lymphocytic leukemia, familial erythrophagocytic lymphohistiocytosis, another myelodysplastic disorder myelodysplastic syndrome, osteopetrosis, paroxysmal nocturnal hemoglobinuria, and Wiskott-Aldrich syndrome. HSCT can be autologous or allogeneic, such as salvage allogeneic HSCT. Other approved cell therapies include treatments for melanoma, prostate cancer, mucogingival conditions, retinal conditions and diseases, cartilage defects, athymia, burns, and muscle wasting disorders.

[0156] Approved CAR T cell therapies include: Idecabtagemic bicelucel (trade name: ABECMA; STN: BLA 125736; Celgene Corporation) is approved for the treatment of adult patients with relapsed or refractory multiple myeloma after four or more prior therapies, including an immunomodulatory agent, a proteasome inhibitor, and an anti-CD38 monoclonal antibody.

[0157] Lisocabtagene maraleucel (trade name: BREYANZI; STN# BLA 125714; Juno Therapeutics, Inc.) is approved for the treatment of adult patients with relapsed or refractory large B-cell lymphoma after two or more prior systemic therapies, including diffuse large B-cell lymphoma (DLBCL) not otherwise specified (including DLBCL arising from indolent lymphoma), high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and grade 3B follicular lymphoma.

[0158] Tisagenlecleucel (trade name: KYMRIAH; STN: 125646; Novartis) is approved for the treatment of pediatric and young adult patients (ages 3 to 25 years) with refractory or second or subsequent relapsed B-cell precursor acute lymphoblastic leukemia (ALL).Adult patients with relapsed or refractory (r / r) large B-cell lymphoma after two or more systemic therapies, including diffuse large B-cell lymphoma not otherwise specified (DLBCL), high-grade B-cell lymphoma, and DLBCL arising from follicular lymphoma.

[0159] Brexcavtagene outrucel (Trade name: TECARTUS; STN: BL 125703; Kite Pharma, Inc.) is approved to treat adult patients with relapsed or refractory mantle cell lymphoma (MCL). A new indication for this supplement: adult patients with relapsed or refractory (r / r) B-cell precursor acute lymphoblastic leukemia (ALL).

[0160] Axicabtagene siloleucel (trade name: YESCARTA; STN: BL 125643; Kite Pharma Inc.) is approved for the treatment of adult patients with relapsed or refractory large B-cell lymphoma after two or more prior systemic therapies, including diffuse large B-cell lymphoma not otherwise specified (DLBCL), primary mediastinal large B-cell lymphoma, high-grade B-cell lymphoma, and DLBCL arising from follicular lymphoma. Axicabtagene siloleucel is not indicated for the treatment of patients with primary central nervous system lymphoma.

[0161] The terms "patient," "subject," "individual," and the like are used interchangeably herein and refer to any animal, or cells thereof, whether in vitro or in situ, according to the methods described herein. In certain non-limiting embodiments, the patient, subject, or individual is a human.

[0162] In a preferred embodiment, the method of treating a disease or condition described herein may include treating cancer. As used herein, the term "cancer" refers to a disease characterized by rapid and uncontrollable growth of abnormal cells. Cancer cells may spread locally or through the bloodstream and lymphatic system to other parts of the body.

[0163] Hematological cancers are cancers of the blood or bone marrow. Examples of hematological (or hematologic) cancers include leukemias including acute leukemia (such as acute lymphocytic leukemia, acute myelocytic leukemia, acute myelogenous leukemia, and myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia), chronic leukemia (such as chronic myelocytic (granulocytic) leukemia, chronic myelocytic (myclogcnous) leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphoma, Hodgkin's disease, non-Hodgkin's lymphoma (indolent and aggressive forms), mantle cell lymphoma, multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia, and myelodysplasia.

[0164] A solid tumor is an abnormal mass of tissue that usually does not contain cysts or liquid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named for the type of cells that form them (such as sarcoma, carcinoma, and lymphoma). Examples of solid tumors include fibrosarcoma, myosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, lymphoid malignancies, pancreatic cancer, breast cancer, lung cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, medullary thyroid carcinoma, papillary thyroid carcinoma, pheochromocytoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, liver cancer, cholangiocarcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, seminoma, bladder cancer, melanoma, and CNS tumors, such as gliomas (such as brain stem glioma and mixed glioma), glioblastoma (also known as glioblastoma multiforme), astrocytoma, CNS lymphoma, germinoma, medulloblastoma, Schwannoma craniopharyngioma, craniopharyogioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuron, oligodendroglioma, meningioma, neuroblastoma, retinoblastoma, and brain metastases.

[0165] The cancer may be a hematological cancer as described herein, preferably selected from acute lymphocytic leukemia, diffuse large B-cell lymphoma, Hodgkin's lymphoma, acute myeloid leukemia, multiple myeloma, and mantle cell lymphoma; or a solid tumor, preferably selected from colon cancer, breast cancer, pancreatic cancer, ovarian cancer, hepatocellular carcinoma, lung cancer, neuroblastoma, glioblastoma, or sarcoma.

[0166] In a preferred embodiment, the method of treating the disease or condition described herein may comprise administering to a subject any of the cells or pharmaceutical compositions described herein, particularly cells, preferably T cells, genetically engineered to force expression of the PHGDH described herein, preferably the cells comprise the CAR or modified TCR disclosed herein.In one embodiment, the CAR or TCR may comprise one or more antigen binding domains (ABDs) that specifically bind to one or more of BCMA, CD19, CD22, CD30, CD33, CD56, CD123, CEA, EBV-associated antigen, EGFR, GD2, GPC3, HER2, HPV-associated antigen, MAGE antigen, mesothelin, MUC-1, NY-ESO-1, PSCA, PSMA, ROR1, WT1, and claudin 18.2; preferably one or more antigen binding domains (ABDs) that specifically bind to one or more of CD19, BCMA, CD30, CD33, CD123, or FLT3; preferably ABDs that specifically bind to CD19 or BCMA.

[0167] In one embodiment, the CAR or TCR can comprise a CD19 ABD and the method includes treating a cancer arising from a B cell, preferably a B cell lymphoma, acute lymphocytic leukemia (ALL), or chronic lymphocytic leukemia (CLL). In preferred embodiments, the methods include treating adult patients with relapsed or refractory (r / r) large B-cell lymphoma, including diffuse large B-cell lymphoma (DLBCL), not otherwise specified (DLBCL), DLBCL arising from high-grade B-cell lymphoma and follicular lymphoma, DLBCL arising from indolent lymphoma, high-grade B-cell lymphoma, primary mediastinal large B-cell lymphoma, and follicular lymphoma grade 3B; pediatric and young adult patients (ages 3-25) with B-cell precursor acute lymphoblastic leukemia (ALL), which may be refractory or in second or subsequent relapse; adult patients with relapsed or refractory mantle cell lymphoma (MCL); adult patients with r / r ALL.

[0168] In another embodiment, the CAR or TCR can comprise a BCMA ABD and the method comprises treating a hematological cancer, preferably multiple myeloma. In a preferred embodiment, the method comprises treating an adult patient with relapsed or refractory multiple myeloma, such as after four or more prior therapies, including an immunomodulatory agent, a proteasome inhibitor, and an anti-CD38 monoclonal antibody.

[0169] In one embodiment, the method of treating a disease or condition described herein can include treating an infection in a subject, preferably a viral infection, such as a viral infection or fungal infection. In a preferred embodiment, the method of treating a disease or condition described herein can include administering any of the cells or pharmaceutical compositions described herein, particularly a cell, preferably a T cell, that is genetically engineered to force the expression of PHGDH described herein, and preferably the cell comprises a CAR or modified TCR disclosed herein. In one embodiment, the CAR or TCR can comprise one or more ABDs that specifically bind to one or more viral antigens. The viral antigen can be any component of a viral particle that is accessible to the CAR or TCR, for example, an antigen that forms part of the surface and / or protein coat of the virus. Preferably, the viral antigen is an antigen derived from human immunodeficiency virus (HIV), adenovirus, polyomavirus, influenza virus, hepatitis B virus (HBV), or human herpes virus, in particular, the human herpes virus is cytomegalovirus (CMV), Epstein-Barr virus (EBV), herpes simplex virus (HSV), varicella zoster virus (VZV), or human herpes virus 8 (HHV8).

[0170] In a preferred embodiment, the method of treating a disease or condition described herein may comprise administering to a subject any of the cells or pharmaceutical compositions comprising the cells described herein as part of cell therapy. Administering to a subject any of the cells or pharmaceutical compositions comprising the cells described herein as part of cell therapy may be referred to herein as cell transplantation or grafting. In particular, cells, preferably immune cells, preferably T cells, genetically engineered to enforce expression of PHGDH as described herein, preferably the cells comprise CAR or modified TCR as disclosed herein, may be administered to a subject as part of cell therapy. The cells may be autologous or allogeneic, preferably autologous. The method of treating a disease or condition may comprise obtaining cells from a subject, for example, the method may comprise obtaining PBMCs from a subject, preferably by leukapheresis of non-mobilized PBMCs and PBMC isolation, by methods known in the art and described herein. The method may further comprise any of the ex vivo or in vitro cell therapy methods known in the art and described herein, and may comprise one or more of cell isolation, enrichment, activation and expansion as disclosed herein. The methods may include methods of activating and / or expanding cells in vivo by methods known in the art and disclosed herein. One or more ex vivo or in vitro cell therapy methods may be performed after obtaining the cells from the subject and / or before administering the cells to the subject. In a preferred embodiment, the method comprises the step of: activating and / or expanding cells in vivo by methods known in the art and disclosed herein. One or more ex vivo or in vitro cell therapy methods may be performed after obtaining the cells from the subject and / or before administering the cells to the subject. In a preferred embodiment, the method comprises the step of activating and / or expanding cells in lymphocytes, preferably T cells, preferably CD3 + Cells, preferably CD8 + Cells and / or CD4 + Cells, preferably CD8 + and isolating and / or enriching a subpopulation of cells. In a preferred embodiment, the method comprises activating cells, preferably T cells, using anti-CD3 and / or anti-CD28 antibodies.

[0171] The method of treating the disease or condition described herein may include administering to a subject in need thereof the cells disclosed herein, or any of the compositions, polynucleotide sequences, expression cassettes, vectors and / or expression vectors disclosed herein in combination with one or more other therapeutic agents or modalities. The compositions described herein may include an effective amount of the cells disclosed herein, or any of the compositions, polynucleotide sequences, expression cassettes, vectors and / or expression vectors disclosed herein in combination with one or more other therapeutic agents or modalities. The other therapeutic agents or modalities may be selected from other known treatments for the diseases disclosed herein.

[0172] All of the features described herein (including any of the accompanying claims, abstracts and drawings) and / or all of the steps of any method disclosed in such a manner may be combined with any of the above-mentioned embodiments in any combination, except combinations in which at least some of such features and / or steps are mutually exclusive.Specifically, any of the active agents and compositions described herein may be used in any of the described treatment methods.Any and all such combinations are expressly contemplated as forming part of the present invention. EXAMPLES

[0173] Example 1 Metabolic pruning is a hallmark of memory T cell differentiation The focus of this study was on CD8 + T NV and T EM Specifically, the metabolic programs of CD8 + T cells were isolated from buffy coats from healthy donors and sorted by flow cytometry, followed by RNAseq and proteomics (Figure 1A). + T EM Against T NVPHGDH was the most significantly enriched GO term among downregulated RNA species in cells (Figure 1B). At the transcript and protein levels, PHGDH was EM It was the most downregulated metabolic transcript in CD8 cells and one of the most differentially expressed proteins overall (Figure 1C). + T EM and T NV The differential expression of PHGDH between was confirmed by Western blotting (Figure 1D).

[0174] Naive mouse T cells induce components of the serine synthesis pathway (SSP) upon activation, i.e., in primary effector cells (Figure 1E). This led us to propose that SSP induces components of the serine synthesis pathway (SSP) in secondary effector cells, i.e., CD8 + T CM and T EM We decided to test whether expression of PHGDH, PSAT1, and PSPH was also upregulated in cells derived from T cells. After stimulation with anti-CD3 / CD28, NV Compared with cells, T EM Cells and T CM Only a slight induction of PHGDH was detected in T cells (Fig. 1F). NV In cells, the abundance of PHGDH was further increased ( Fig. 1F ).

[0175] CD8 + T CM and T EM Given that the cells did not express PHGDH, we reasoned that extracellular serine might also affect their ability to selectively proliferate. Indeed, in the absence of serine, activated T CM and T EM Neither of the two proliferated, whereas T NV Cell proliferation was largely unaffected (Fig. 1G).

[0176] These data suggest that CD8 + T EMWe identified selective silencing of PHGDH expression in T cells, a property that was maintained when these cells were restimulated to become secondary effectors. EM The cells are strictly dependent on exogenous serine for growth and are therefore serine auxotrophic.

[0177] Example 2 PHGDH is an RNA-binding protein To explore the concept of the moonlighting role of PHGDH, we compared its structure in silico with the non-canonical RNA-binding protein (RBP) GAPDH; both bind NAD + GAPDH is a dinucleotide-dependent dehydrogenase. + Several regions that bind RNA have been proposed, including a supersecondary structure responsible for interactions with β-actin, a positively charged substrate-binding groove, and a dimer interface. Several similarities were observed between the two enzymes: besides the Rossmann fold, PHGDH also exhibited a positively charged substrate groove, and a dimer interface with basic and aromatic residues (Figure 2A).

[0178] To directly explore the potential RNA-binding role of PHGDH in T cells, we performed RNA immunoprecipitation sequencing (RIPseq) experiments using primary human effector T cells. The specificity of the PHGDH-immunoprecipitating (IP) antibody was confirmed by the PHGDH KOValidation was performed using lysates from Jurkat T cells (Figure 2B, left panel). In addition, IP of PHGDH was confirmed for each sample, followed by sequencing of co-precipitated RNA and isotype-matched antibody control (Figure 2B, right panel). Compared to the input sample, 4419 transcripts were significantly enriched in PHGDH-IP, whereas 927 were enriched in isotype-IP (Figure 2C). To visualize the filtering strategy, transcripts enriched by isotype-IP over input material were plotted against transcripts enriched in PHGDH-IP over input material. RNA species that (i) were more than 2-fold enriched in PHGDH-IP over input and (ii) were more than 2-fold enriched in PHGDH-IP compared to isotype-IP were considered to specifically interact with PHGDH. This filtering process selected 1639 protein-coding transcripts (Figure 2D), suggesting the RNA-binding characteristics of PHGDH in primary human T cells, i.e., the functional characteristics of RBPs. Because PHGDH expression is a feature of undifferentiated cells (data not shown), we speculated that its RNA-binding properties might be involved in maintaining survival. Surprisingly, among the RNA species bound by PHGDH in the RIPseq experiment, pro-survival genes, i.e., BBC3, MCL1, and TP53BP2, were detected (Figure 2E).

[0179] To further explore this concept, we used CRISPR / CAS9 to generate selected primary human T NVWe designed a PHGDH knockout experiment with cells (Figure 2F). To ensure that the loss of PHGDH mainly affects the RNA-binding properties of the enzyme and to block metabolic stress responses, the experiment was performed in the presence of abundant extracellular serine. PHGDH mRNA at day 3 after activation was the most downregulated transcript among 1425 differentially expressed transcripts / genes (DEGs) (Figure 2G), and their small fold changes were consistent with post-transcriptional interference described for RBPs (Lu et al., 2014, Cell Rep. 9, 2330-2343; Diaz-Munoz et al., 2015, Nature Immunology. 16, 415-425; and Monzon-Casanova et al., 2020, eLife. 9, 613-28). Among these DEGs, approximately 10% (177) were also specifically pulled down in the RIPseq experiment, including RNA species encoding epigenetic modifiers (KDM3A, DOT1L, KAT2A, and KDM6B), components of WNT signaling (DVL1 and Jun), and transcripts that affect survival (NFKBIA and IRF1) ( Figure 2H ).

[0180] Taken together, these data suggested that PHGDH moonlights as an RBP, a finding consistent with the notion that, through RNA binding, PHGDH may contribute to regulating T cell differentiation or survival.

[0181] Example 3 Forced expression of PHGDH enhances T cell persistence in vivo To further explore the role of PHGDH in regulating T cell survival, we established an in vivo mouse infection model. Analysis of RNAseq data from the ImmGen Consortium (immgen.org) revealed that mouse CD8 + The expression patterns of PHGDH among naive, central memory, and effector memory T cells in human CD8 +The expression level of PHGDH was measured by Western blot and FACS in mouse T NV and T EM These experiments confirmed the decreased expression of PHGDH in memory cells (Figure 3B). To test the in vivo relevance, we used ovalbumin-specific CD8 T cells that overexpress PHGDH. + T cells (OT-I) were generated with MigR1-PHGDH-IRES-EGFP (OE-PHGDH), or empty vector (EV) as a control (Figure 3C). Overexpression was forced by retroviral transduction. The plasmid constructs were MigR1-PHGDH-IRES-EGFP (OE-PHGDH), and MigR1-IRES-EGFP (EV) vectors (addgene).

[0182] Overexpression of PHGDH in OT-I CD8 + To examine whether OE or EV OT-I cells affect T cell proliferation or survival, we adoptively transferred OE or EV OT-I cells into C57BL / 6 recipients (Figure 3D). One day after transplantation, recipient mice were infected with LmOVA and the proliferation of transferred T cells in the blood was followed. At the peak of proliferation (7 dpi), OE and EV OT-I cells were detected at comparable levels (Figure 3E). However, OE-PHGDH OT-I T cells did not contract to the same extent as control cells, resulting in higher frequencies at 14, 21, 28 and 35 dpi (Figure 3E).

[0183] To analyze whether the canonical or latent mRNA-binding capacity of PHGDH led to the observed phenotype, we generated OT-I T cells overexpressing wild-type (OE-WT) or catalytically inactivated (OE-CD) variants of PHGDH. OE-WT, OE-CD, or EV OT-I T cells were transplanted into recipients that were later infected with LmOVA. As in the previous experiments, the frequency of transplanted cells at 7 dpi was comparable, but at different numbers at subsequent time points. As before, PHGDH-overexpressing cells were detected at a much higher frequency, and surprisingly, OE-CD OT-I T cells persisted at an even increased number compared to OE-WT OT-I T cells (Figure 3F). To test whether OE-CD OT-I T cells could respond to a second stimulus, we rechallenged the recipients with LmOVA. No effect of increased persistence on the ability of OE-CD OT-I cells to repopulate was observed (Figure 3G).

[0184] These data provide evidence that blocking silencing of PHGDH at the effector-to-memory transition stage can increase T cell persistence.

[0185] Example 4 Forced expression of PHGDH enhances T cell persistence in vitro and in vivo. Based on previous data, we reasoned that overexpression of PHGDH could improve the persistence and therefore the therapeutic potential of human (CAR) T cells.

[0186] To further explore the role of PHGDH in regulating T cell persistence, we used CRISPR / Cas to transfect human naïve CD8 +We knocked out PHGDH in T cells and activated the cells with anti-CD3 / CD28 24 hours later. Knockout of PHGDH was confirmed by flow cytometry 96 hours after activation (Figure 4A). Interestingly, knockout of PHGDH increased the frequency of late and early apoptotic cells and significantly decreased the frequency of viable cells compared to control cells (Figure 4B, right panel).

[0187] We next tested how enforced PHGDH expression affects the persistence of primary human T cells expressing CAR. For these experiments, we used a CD19-targeted CAR T cell model. Bulk T cells were lentivirally transduced with either i) a vector encoding CD19 CAR and mCherry (CD19 CAR), or ii) a vector encoding CD19 CAR and mCherry, as well as a vector encoding a catalytically inactivated variant of PHGDH and GFP (CD19 CAR_PHGDH(CD)). To obtain a pure CAR T cell population, cells were sorted according to their expression of mCherry and GFP (Figure 4C, left panel). We then assessed persistence under non-activating conditions in vitro in the presence of IL-2. CD19 CAR_PHGDH(CD) cell numbers were significantly enriched at days 6–7 compared to cells expressing CAR only (Figure 4C, right panel).

[0188] We next further investigated whether forced expression of PHGDH similarly affected the persistence of CAR T cells in vivo. Overexpression of PHGDH in CAR T cells was confirmed by Western blot in two different donors compared to CAR T cells (Figure 4D). To test persistence in vivo, CD19 CAR T cells or CD19 CAR_PHGDH T cells were adoptively transferred into NSG mice bearing established tumors (Figure 4E, left panel). Indeed, 8 days after adoptive transfer, the frequency of CD19 CAR_PHGDH T cells was significantly increased in the spleen compared to CD19 CAR T cells (Figure 4E, right panel).

[0189] Overall, these data establish the importance of PHGDH in regulating human T cell persistence. Moreover, overexpression of PHGDH, as well as WT and CD variants, is associated with increased persistence of T cells, particularly following cell therapy in vitro and in vivo.

[0190] Example 5 Forced expression of PHGDH enhances T cell persistence in vivo Experiments were performed to confirm that forced expression of PHGDH affects CAR T cell persistence in vivo. CD19 CAR T cells or CD19 CAR_PHGDH T cells were adoptively transferred into NSG mice bearing established tumors (Figure 5A). Eight days after adoptive transfer, the frequency of splenic CD19 CAR_PHGDH CD3+ T cells was significantly increased compared to CD19 CAR T cells (Figure 5B, left panel). CD8+ T cells were significantly enriched in the bulk CD3+ T cell fraction (Figure 5B, middle panel), and a similar trend was observed within the CD4+ T cell fraction (Figure 5B, right panel).

[0191] Example 6 Knockout of PHGDH increases the half-life of IRF1 mRNA Upon overlaying the RIP-seq data with the transcriptome data to identify transcripts bound and regulated by PHGDH, the analysis identified the pro-apoptotic transcription factor IRF1 as a likely candidate, which was selected for further analysis ( Fig. 2H ).

[0192] PHGDH-depleted CD8+ T cells NV In CD8+ T cells, IRF1 mRNA and protein expression was increased (Figures 6A and 6B). This expression pattern suggested a role for PHGDH in controlling IRF1 mRNA stability. To experimentally test this, we performed actinomycin D chasing experiments. We used CRISPR-Cas9 to translocate IRF1 mRNA from CD8+ T cells.NV We deleted PHGDH in CD8+ T cells, activated the cells for 3 days, and measured mRNA stability in the presence of actinomycin D to shut off transcription at the indicated times (Figure 6C). NV Knockout of PHGDH in cells was confirmed by Western blot (Figure 6D). The mRNA half-life of IRF1 was reduced in PHGDH-expressing cells compared to their PHGDH-depleted counterparts (Figure 6E).

[0193] Example 7 PHGDH binds to IRF1 mRNA Notably, IRF1 mRNA has multiple AU-rich elements (AREs) in the 3'UTR, which are cis-acting sequence motifs that typically reduce the stability of the transcript upon RBP binding (White MR et al., 2016, Wiley Interdiscip Rev RNA; 7(1):53-70). To test the direct binding of PHGDH to IRF1 mRNA, we performed microscale thermophoresis experiments using recombinant PHGDH and 3'UTR fragments of IRF1 transcripts, as shown in Figure 7A. Fragment 3 contains multiple AU-rich elements, whereas fragment 4 lacks AU-rich elements.

[0194] Microscale thermophoresis assays demonstrated direct binding of PHGDH to fragment 3 (Fg3), characterized by a high response amplitude, thus validating its affinity for mRNA sequences containing AU-rich elements, and classifying PHGDH as an ARE-binding protein (ARE-BP; green curve, Figures 7B and 7C). In contrast, fragment 4 (Fg4) did not bind PHGDH, characterized by a low response amplitude (red curve; Figure 7B). A mutant form of Fg3 similarly prevented PHGDH binding (red curve; Figure 7C).

[0195] These data indicate the importance of PHGDH in regulating the persistence of human (CAR) T cells. These data also indicate that PHGDH is an RBP that regulates the stability of transcripts involved in T cell survival.

[0196] method Healthy Blood Donors Blood samples were obtained as buffy coats from healthy female and male donors (aged 16–65 years) after written consent (Blood donation center, University Hospital Basel).

[0197] Human cell isolation Peripheral blood mononuclear cells (PBMCs) were isolated from female and male healthy donors by standard density gradient centrifugation protocols (#1114547, Lymphoprep Fresenius Kabi). CD8 + T cells are magnetic CD8 + Cells were enriched by positive selection using beads (#130-045-201, Miltenyi Biotec) and quiesced overnight in R10 FBS before FACS sorting (see below).

[0198] Human T cell activation Human CD8 + T cell activation was performed as previously described 1、2 , performed using in-house generated anti-CD3 / anti-CD28 coated microbeads. All T cell activations were performed using a 2:1 bead to cell ratio unless otherwise indicated and were performed in flat-bottom 96-well plates (2.5×105 cells / well; 5×105 beads / well).

[0199] Flow cytometry Cell proliferation Prior to activation + / - serine, cells were loaded with the cell proliferation dye CFSE (1 μM, Molecular probes, USA) and seeded in 96-well plates. CFSE dilution was analyzed 5 d after stimulation by flow cytometry. Fixable Viability Dye (eBioscience or Zombie Aqua, Biolegend) was used to exclude dead cells before sample acquisition.

[0200] Viability and Annexin V staining Cells were harvested and washed once with PBS before staining with Aqua Zombie fixable viability dye (BioLegend) and Annexin V (ThermoFisher) in Annexin Binding Buffer for 15 min at RT. Staining was quenched with Annexin Binding Buffer or FACS Buffer and cells were either directly analyzed by flow cytometry or washed prior to further intracellular staining.

[0201] Intracellular staining After staining cells using Aqua Zombie and Annexin V, cells were fixed and permeabilized using Intracellular Fixation and Permeabilization Buffer (ThermoFisher) according to the manufacturer's instructions. Cells were then stained with anti-PHGDH (#66350, D8F30, Cell Signaling) diluted in perm buffer for 45 min on ice, followed by incubation with anti-rabbit-Alexa Fluor 594 (ThermoFisher) for 30 min on ice. Cells were washed twice using perm buffer and resuspended in FACS buffer before sample acquisition.

[0202] All flow data were acquired on a CytoFLEX flow cytometer (Beckman Coulter) and analyzed using Flowjo 10.3 (Tree Star) unless otherwise indicated.

[0203] FACS sorting For fluorescence-activated cell sorting (FACS), CD8 +T cells were stained with anti-CD62L-APC (#21279626, LT-TD180, ImmunoTools) or anti-CD62L-PeCy7 (#304821, DREG-56, BioLegend) and anti-CD45RA-PB (#A74765, J.33, Beckman Coulter) antibodies. NV , T CM , and T EM CD8 + T cells were classified into CD62L + CD45RA + , CD62L + CD45RA - , and CD62L - CD45RA - Populations were identified and sorted by using a BD influx cell sorter (BD Bioscience). Cells were quiescent in R10 FBS at 37° C. for a minimum of 4 hours prior to the experiment.

[0204] Western blotting Cells were washed twice with PBS and lysed in ice-cold RIPA buffer (#89900, Thermo) supplemented with protease inhibitors (#4693159001, Roche) and phosphatase inhibitors (#4906845001, Roche). Lysates were cleared by centrifugation and protein concentrations were assessed using the Pierce BCA Protein Assay Kit (#23227, Thermo). Equal amounts of protein were loaded onto precast mini-PROTEAN TGX gels (#4568095, Biorad) and fractionated by SDS-PAGE. After electrophoresis, total protein was assessed by Biorad's stain-free protocol (UV activation for 5 min followed by imaging with the GelDoc system). Proteins were then transferred to nitrocellulose membranes (#1704158, Biorad) and blocked in 5% BSA or milk in TBST for 1 h at RT. Membranes were incubated with the indicated primary antibodies overnight at 4°C, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibodies (1 h at RT). Western blots were developed using Enhanced chemiluminescence (ECL), imaged using the Geldoc system, and quantified using ImageLab software (all from Biorad).

[0205] The following primary antibodies were used: anti-PHGDH (#66350, D8F30, Cell Signaling), anti-PHGDH (ab57030, abcam, used after IP of PHGDH), anti-PSAT1 (ab154055, abcam), anti-PSPH (ab211418, abcam), anti-SLC1A4 (#8442, Cell Signaling), anti-SLC1A5 (ASCT2) (#8057, D7C12, Cell Signaling), anti-SHMT1 (#12612, Cell Signaling), anti-SHMT2 (ab155230, abcam), and anti-beta-actin (#3700, 8H10D10, Cell Signaling). The following secondary antibodies were used: anti-rabbit IgG (#111-035-144, Jackson ImmunoResearch) and anti-mouse IgG (#115-035-003, Jackson ImmunoResearch).

[0206] PHGDH activity assay Jurkat T cells expressing the indicated PHGDH variants were washed once in ice-cold PBS, flash frozen in liquid nitrogen and stored at -80°C until further use. On the day of the assay, cell pellets were thawed, homogenized in lysis buffer (0.5M Tris pH 8.5, 1mM EDTA, 0.02% Triton-X, 10mM NAD) and cellular debris removed by centrifugation (10 min, 16000xg at 4°C). Protein concentration of the clarified lysates was measured using the Pierce BCA Protein Assay Kit (#23227, Thermo). Protein amount was adjusted with assay buffer (50mM Tris pH 7.1, 10mM NAD) to have 50μg total protein in 150μl buffer. PHGDH activity was measured in duplicate wells for every sample, once in the presence and once in the absence of the substrate 3-phospho-D-glycerate (3PG) (20 mM, P8877, Sigma), the final volume was always 200 μl. NADH formation due to the catalytic activity of PHGDH was measured at 340 nm and RT using a Sinergy H1 microplate reader (Biotek). PHGDH activity was then calculated by subtracting the absorbance values ​​obtained in the absence of 3PG from those obtained in the presence of 3PG.

[0207] In silico comparison of GAPDH and PHGDH (1) Rossmann fold: The Rossmann fold was highlighted based on the existing literature. In GAPDH, this supersecondary structure is formed by residues 1–150 and 317–335 (White and Garcin, 2015). In PHGDH, the consecutive residues 102–288 adopt a classical Rossmann fold, which contains a six-stranded parallel β-sheet flanked on both sides by α-helices. The crystal structure of human 3-phosphoglycerate dehydrogenase is available online at https: / / www.thesgc.org / sites / default / files / activeISee / PHGDHA_2g76_v5_351m / PHGDHA_2g 76_v5_351m_Annotation.html Deposition Authors: Turnbull AP, Salah E, Savitsky P, Gileadi O, von Delft F, Edwards A, Arrowsmith C, Weigelt J, Sundstrom M, Oppermann (2006). (2) Electrostatic potential: Adaptive Poisson-Boltzmann Solver plugin 3 , Visual Molecular Dynamics (VMD) 4 and calculated the electrostatic potential. (3) Dimer interface: We defined the dimer interface of GAPDH as an antiparallel five-stranded β-sheet from adjacent subunits. 5 For PHGDH, no consensus definition of the dimer interface in terms of residues or secondary structure was found in the literature. Importantly, the tetrameric forms of PHGDH are arranged in different ways in different organisms, i.e., they form either type I, type II, or type III complexes. 6 Human PHGDH adopts a complex type I structure, in which three distinct dimer interfaces can be defined. Here, we show that 6We define the interface as residues located within 2.5 Å of adjacent subunits in the IR region defined by and highlight residues that form secondary structures involving these interacting residues.

[0208] RNA immunoprecipitation sequencing (RIPseq) experiments Immunoprecipitation: PHGDH-RNA complexes were isolated using the Magna-RIP kit (#17-701, Millipore) according to the manufacturer's instructions. Briefly, approximately 10-15 Mio of sorted T cells from three different human donors were NV Cells were activated for 36 h, washed once with PBS, resuspended in 210 μl of RIP lysis buffer provided in the kit, and frozen at -80°C. After thawing, lysed cells were centrifuged at 14000 rpm for 10 min at 4°C to clear the lysate. 10 μl, representing the input sample, was removed before the resulting supernatant was distributed equally between two tubes. For IP, 4 μg of anti-PHGDH antibody (#66350, D8F30, Cell Signaling) or rabbit isotype-matched IgG (ab172730, abcam) was used against 50 μL of magnetic protein A / G beads. Beads conjugated with PHGDH antibody and isotype control antibody were added to one of two tubes per donor, and IP was performed overnight at 4°C. After several washes, an aliquot of each sample was taken to test the efficiency of IP by Western blotting using mouse anti-PHGDH (ab57030, abcam) antibody. From this point on, the input RNA was treated again in the same way. After proteinase K digestion, RNA was isolated using TRIzol reagent (#15596026, Thermo) and Direct-zol RNA Microprep kit (#R2062, Zymo). RNA was eluted in 6ul RNase-free water.

[0209] RNA Integrity and Quantification: RNA molecules were quality checked on a Bioanalyzer instrument (Agilent) using an RNA 6000 Pico Chip (#5067-1513, Agilent). The amount of RNA was quantified by fluorometric quantification using the QuantiFluor RNA System (#E3310, Promega). Library preparation was performed starting from 1 ng of total RNA using the SMART-Seq Stranded Kit (#634444, Takara Bio). Libraries were loaded at a final concentration of 400 pM in the Flow-Lane and sequenced for paired-end 51 bases (plus 8 bases for index 1 and 8 bases for index 2) using a NovaSeq 6000 instrument (Illumina) and an SP Flow-Cell with 1% PhiX. Primary data analysis was performed using Illumina RTA version 3.4.4. On average, 38.3 million ± 18.8 million pass filter reads per sample were collected on one SP Flow-Cell.

[0210] RNA sequencing data analysis: Read alignment was performed and count tables were obtained as described above. Data were normalized by applying the TMM method from the Bioconductor edgeR package (version 3.28.1). 7 Only genes with a log2 CPM count greater than 0 in at least two samples were retained for further analysis. Principal component analysis was based on the 25% of most variable genes in the dataset. Differentially expressed genes were analyzed using the quasi-likelihood (QL) method implemented in the edgeR package (version 3.28.1) with replicate ID as a covariate. 8 was identified using

[0211] Gene editing of primary human T cells prior to RNAseq After selection, T NVCells were allowed to rest for 4 hours. 2Mio cells were harvested twice from each donor, washed once with PBS, and resuspended in 20 μl of electroporation buffer from a P3 Primary Cell 96-well Nucleofector Kit (V4XP-3032, Lonza). 3 μM RNP was added and electroporated using the 4D-Nucleofector (Amaxa-Lonza) program EH115. Immediately after electroporation, pre-warmed R10FBS containing IL-2 (150 U / ml, Proleukin) was added to the cells and the cells were incubated for 24 hours.

[0212] Activated PHGDH-KO T NV Cellular RNA sequencing (RNAseq) Total RNA was extracted from 2 Mio cells per condition from five human donors. RNA was extracted using the RNeasy Mini Kit (#74106, Qiagen) according to the manufacturer's protocol, including on-column DNAse (#79254, Qiagen) treatment.

[0213] Sample preparation and sequencing: RNA integrity was checked on a TapeStation instrument (Agilent) using an RNA ScreenTape (#5067-5576, Agilent) and quantified fluorometrically using the QuantiFluor RNA System (#E3310, Promega). Library preparation was performed starting with 200ng of total RNA using the TruSeq Stranded mRNA Library Kit (#20020595, Illumina), TruSeq RNA UD Indexes (#20022371, Illumina) and TruSeq RNA CD Index Plate (#20019792, Illumina). 15 cycles of PCR were performed. The resulting libraries were sequenced for paired-end 101 bases (plus: 8 bases for index 1 and 8 bases for index 2) using a NovaSeq 6000 instrument (Illumina) and an S2 Flow-Cell loaded at a final concentration of 380 pM per Flow-lane and containing 1% PhiX. Primary data analysis was performed using Illumina RTA version 3.4.4. On average, 69.1 million ± 11.5 million pass filter reads per sample were collected on one S2 Flow-Cell.

[0214] RNA sequencing data analysis: Reads were analyzed using STAR (version 2.7.0c) with default parameters except for allowing up to 10 hits to the genome (outFilterMultimapNmax 10), reporting only one position for equal-scoring multi-mapping reads (outSAMmultNmax 1), and filtering reads with no evidence in the splice junction table (outFilterType "BySJout"). 9 The sequences were aligned to the human genome (UCSC version hg38 analysis set) using the samtools (v1.9) 10Strand-specific coverage tracks for each sample were generated by tiling the genome in 20 bp windows and counting the 5' ends of reads per window using the function bamCount from the Bioconductor package bamsignals (v1.18.0). These window counts were then combined with the Bioconductor package rtracklayer (v1.46.0) to generate a coverage map of the genome. 11 The quality of the reads and alignments was verified using the Bioconductor package QuasR (v1.26.0). 12 The QC was evaluated using the qQCReport function in the Bioconductor package subreads (v2.0.1). 13 The featureCounts function from was used to count the number of reads (at the 5′ end) that overlap with exons of each gene, assuming an exon union model (with gene models used provided by ensembl v96).

[0215] Generation of recombinant lentiviruses 24 hours before transfection, HEK-293 cells were seeded in a 10-cm dish (5 × 10 6 Cells / 5 ml medium). All plasmid DNA was purified using an Endotoxin-free Plasmid Midiprep Kit (Qiagen). HEK-293T cells were transfected with 9.15 μg pmol of psPAX2 (lentiviral packaging plasmid) and 2.77 μg of pMD2G (VSV-G envelope expression plasmid) and 9.2 μg of pLV-CAR:FMC63-BBZ-P2A-mCherry (CAR-mC) or pLV-CAR:FMC63-BBZ-P2A-PHGDH-P2A-mCherry (CAR-PHGDH-mC) using Lipofectamine 2000 (Invitrogen) and Optimem medium (Invitrogen, Life Technologies).

[0216] In some experiments, HEK-293T cells were transfected with 7.2 μg of pCMVR8.74 (lentiviral packaging plasmid) and 2.8 μg of pCMV-VSV-G (VSV-G envelope expression plasmid) and 6 μg of pSFFV-PHGDH-IRES-GFP (encoding either the wild-type or catalytically inactivated variant) using Lipofectamine 2000 (Invitrogen) and Optimem medium (Invitrogen, Life Technologies).

[0217] Viral supernatants were harvested 48 and 72 hours after transduction. Viral particles were concentrated using VIVASPIN 20 (Sartorius) and viral supernatants were stored at -80°C. Lentiviral particles of CAR constructs were generated as previously described.

[0218] Lentiviral transduction protocol Blood samples were obtained from healthy donors after written informed consent. Peripheral blood mononuclear cells (PBMCs) were isolated by a standard density gradient centrifugation protocol (Lymphoprep; Fresenius Kabi). CD3 + T cells were positively selected using magnetic beads (Miltenyi Biotec). + T cells were plated in 24-well cell culture plates and stimulated with anti-CD3 and anti-CD28 monoclonal antibody-coated beads (Invitrogen, Life Technologies) in a 1:1 ratio or with ImmunoCult human CD3 / CD28 T cell activator (Stemcell) in R10AB containing IL-2 (150 U / ml). T cells were transduced with lentiviral particles 18-22 h after activation in cell culture plates coated with polybrene (Sigma, 6 μg / ml), followed by a spinoculation step at 1000 × g for 60 min at 30 °C.

[0219] The medium was replaced with fresh IL-2 (150 U / ml) every 2 days. Five days after transduction, cells were analyzed for transduction efficiency by analyzing mCherry or GFP expression by flow cytometry. Samples were acquired using a CytoFLEX flow cytometer (Beckman Coulter). Data were analyzed using Flowjo®_V10.5 (Tree Star, USA).

[0220] To achieve a pure CAR T cell population, cells were sorted according to mCherry expression (CD19-CAR) or both mCherry and GFP (CD19-CAR_PHGDH). In experiments where cells were transduced with both pSFFV-PHGDH-IRES-GFP and pLV-CAR:FMC63-BBZ-P2A-mCherry, construct double positive cells were sorted using a BD influx cell sorter (BD Bioscience).

[0221] Expansion of transduced T cells Sorted T cells expressing CD19 CAR or CD19 CAR_PHGDH(CD) were cultured in equal numbers (2 × 10 5 Cells were plated at 1000 x 1000 cells / well in 96-well plates in R10 FBS containing IL-2 (150 U / ml). Cell numbers were determined by counting the cells at the indicated time points.

[0222] animal C57BL / 6 (CD45.1 and CD45.2, and Thy1.1 and Thy1.2) were purchased from Charles River Laboratories. OT-I mice were purchased from The Jackson Laboratory (Bar Harbor, ME). Mice were housed under specific pathogen-free conditions at McGill University (Canada), Van Andel Institute (USA) and University of Basel according to approved protocols. NOD.Cg-Prkdc <scid>Il2rg <tm1wjl>SzJ (NSG) mice were housed under specific pathogen-free (SPF) conditions at the University of Basel. Experiments were performed when mice were 6–20 weeks of age.

[0223] Isolation of mouse T cells After euthanasia in a CO2 chamber, spleens were harvested and forced through a 70 μm cell strainer (#431751, Corning). Red blood cells (RBCs) were then removed from the single cell suspension using RBC lysis buffer (154 mM NH4CL, 10 mM KHCO3, and 0.1 mM EDTA) and, where indicated, CD8a-MicroBeads (#130-117-004, Miltenyi Biotec) were used to lyse the RBCs. + T cells were MACS isolated.

[0224] FACS sorting of T cell subsets Mouse MACS enriched CD8 + T cells were stained with the following antibodies for 30 min on ice: anti-CD8a-BV510, anti-CD44-AF647, and CD62L-BV421. After washing twice with FACS buffer, cells were analyzed for T cells on a BD FACS-Aria. NV (CD8 + CD62L + CD44 - ) and T EM cells (CD8 + CD62L - CD44 + ) were selected.

[0225] Adoptive transfer experiments Plasmid constructs containing WT PHGDH (MigR1-PHGDH-IRES-EGFP; OE-PHGDH or OE-WT), or CD PHGDH (MigR1-PHGDH-IRES-EGFP; OE-CD) and a control vector (MigR1-IRES-EGFP; EV) were used to transfect 293T cells together with pCMV-VSVG (Addgene). Retrovirus-containing supernatants were removed by 0.45 μm filtration and mixed with polybrene. Naïve CD8 + Thy1.1 + OT-I T cells were stimulated with plate-bound anti-CD3 (2ug / ml) and anti-CD28 (1ug / ml) for 1 day. Activated T cells were spin-transduced with EV or OE-PHGDH / OE-WT or OE-CD retroviral particles. After 24 hours of incubation, cell culture medium containing 50U / ml IL-2 was replaced and cells were expanded for another 24 hours before GFP-FACS sorting. Cells were rested for 24 hours and then adoptively transferred into C57BL / 6 mice (5000 cells / mouse). One day after transfer, mice were infected intravenously with attenuated LmOVA. Blood was taken at the indicated time points post-infection to determine total CD8 + Among T cells, adoptively transferred Thy1.1 + GFP + Cell frequencies were analyzed by flow cytometry using an LSR Fortessa (BD Biosciences) flow cytometer.

[0226] In vivo infection model For memory re-challenge experiments, EV and OE-PHGDH-CDCD8 + Thy1.1 + After adoptive transfer of T cells, mice were immunized with a sublethal dose of recombinant attenuated Listeria monocytogenes (Lm) expressing OVA (attLmOVA, 2 x 106 CFU). Thirty-five days after primary infection, animals were reinfected with a lethal dose of recombinant virulent LmOVA (virLmOVA, 1 x 106 CFU) and blood was collected at the indicated time points. Th1.1 + GFP + CD8 + The frequency of Thy1.1+ T cells was determined by flow cytometry using an LSR Fortessa (BD Biosciences) flow cytometer.

[0227] In vivo experiments with anti-CD19 CAR T cells CAR-mC and CAR-PHGDH-mC T cells were generated as described above and expanded for 12 days, with medium replaced with fresh IL-2 (150 U / ml) every 2 days. CAR T cells were analyzed for transduction efficiency by analyzing mCherry expression by flow cytometry.

[0228] Female NSG mice (6–9 weeks) were treated with 5 × 10 5 Ramos cells (ATCC) were injected subcutaneously. On the day of adoptive transfer, CAR cells were counted and cell numbers were adjusted to 1 × 10 per condition. 6 CAR T cells were prepared for adoptive transfer.

[0229] To assess CAR T cell persistence in vivo, spleens were harvested and single cell suspensions were generated. Spleens were manually homogenized in PBS and passed through a 70 μm cell strainer (BD Biosciences). Red blood cells were lysed using ACK (Ammonium-Chloride-Potassium) lysis buffer (BD Biosciences). Single cell suspensions were analyzed by flow cytometry to determine the number of CAR T cells.

[0230] Gene editing of primary human T cells prior to deep proteomic profiling After selection, T NV Cells were allowed to rest for 4 hours. 2Mio cells were harvested twice from each donor, washed once with PBS, and resuspended in 20 μl of electroporation buffer from a P3 Primary Cell 96-well Nucleofector Kit (V4XP-3032, Lonza). 3 μM RNP was added and electroporated using the 4D-Nucleofector (Amaxa-Lonza) program EH115. Immediately after electroporation, pre-warmed R10FBS containing IL-2 (150 U / ml, Proleukin) was added to the cells and the cells were incubated for 24 hours.

[0231] 16-plex TMT-based deep proteome profiling Proteins were extracted from approximately 4 million T cells using 50 μL of lysis buffer and sonication (30 sec on, 30 sec off, 10 cycles = 10 min). Samples were then heated at 95°C for 10 min and cooled to room temperature. Protein alkylation was performed by adding 1 μL of 0.75 M chloroacetamide solution and incubating at 37°C for 30 min at 500 rpm.

[0232] Protein digestion was performed by adding trypsin at a final enzyme to protein ratio of 1:50 and digesting overnight at 37° C. 50 μL of 5% TFA was then added to the samples, vortexed and transferred to a PreOmics 96 plate cartridge. Peptides were automatically desalted using a Tecan A200 and then dried.

[0233] The solid phase in the cartridge was washed by loading 200 μL of wash buffer and spinning at 2,000×g for 4 min. This step was repeated twice. The cartridge was then placed in a new plate and the peptides were eluted with 2×100 μL of elution buffer (2,000×g, 2 min) and dried in a speed vac.

[0234] For TMT labeling of peptides, 10 μg total protein / peptide was used per sample. Samples were dissolved in 10 μL labeling buffer and 0.5 μL ProtMix1 was added to sample 1, 0.5 μL ProtMix2 to sample 2, etc. Then, 2.5 μL TMTpro reagent was added and the samples were left in a thermomixer at 25 °C and 500 rpm for 1 h. The reaction was stopped by adding 0.75 μL stop solution. Then, all samples were combined at once in a single 2 ml Eppendorf tube and 110 μL high pH buffer was added. To neutralize the high pH buffer, 110 μL 2M HCl was added to the 2 ml Eppendorf 16plex sample and 27.5 μL 5% TFA was added. For solid phase extraction of TMT-labeled peptides, a C18 column was conditioned with 400 μL acetonitrile and equilibrated with buffer. The sample was then loaded onto the column and washed with buffer. The peptides were eluted, dried, and resuspended in 16 μL of chromatography buffer (0.5 μg / μL). 1.6 μL of 1:10 iRT-peptide mix was added and subjected to LC-MS / MS analysis.

[0235] Actinomycin D chasing experiments - RNA stability assay Sorted CD8 + T NV Cells were rested at 37°C for 4 hours prior to PHGDH CRISPR KO. 24 hours after CRISPR, cells were stimulated with anti-CD3 and anti-CD28 monoclonal antibody coated beads for 3 days, after which the beads were removed. Cells were treated with actinomycin D (5μg / ml) and harvested at 0, 1, 2, and 3 hours after treatment. Total RNA was extracted from cells.

[0236] RNA was isolated from T cells using RNeasy Mini Kit (#74106, Qiagen) according to the manufacturer's protocol and then purified using RNeasy RNA Purification Mini Kit (QIAGEN, Germany). RNA concentration was determined using NanoDrop 2000C (Thermo Fisher Scientific). cDNA was synthesized from equal amounts of purified RNA using the reverse transcriptase kit GoScript™ Reverse Transcriptase (Promega). Quantitative PCR for IRF1 mRNA was performed in triplicate using the following primer pairs: fw: GTACCGGATGCTTCCACCTC (SEQ ID NO: 5), rev: GTCCGGCACAACTTCCACT (SEQ ID NO: 6). PCR reactions were performed using Go Tag G2 Green Master Mix (Promega) according to the manufacturer's protocol. Half-lives were determined relative to time point 0 of actinomycin D treatment.

[0237] Microscale thermophoresis-RNA binding assay Recombinant human PHGDH was purchased from Abcam (ab198455). A single-stranded RNA fragment encoding part of the 3'UTR of IRF1 was purchased from IDT using IDT's RNA oligo dedicated tool: Fragment 3: 5'-AGGAAUUGAACUUUUAAUUGCAUUUAATAAACUGUAUGUAAAUAGUCA-3' (SEQ ID NO: 7) Fragment fg4: 5'-ACAUGUGCCAGCUAAGCACUUGAAAUGUGGCCAGUGCAAUA-3' (SEQ ID NO: 8) Mutant fragment 3: 5'-AGGAAUUGAACCCUUAAUUGCAUUUAAUAAACUGUAUGUAAAUAGUCA-3' (SEQ ID NO: 9). Fragments were resuspended in IDTE buffer (30 mM HEPES, pH 7.5, 100 mM potassium acetate).

[0238] Microscale thermophoresis experiments were performed using a NanoTemper® Monolith NT.115 (NanoTemper Tenchologies, Germany) with blue and red filters. His-tagged PHGDH protein was labeled using the Monolith His-Tag labeling Kit RED-Tris-NTA 2nd generation (SKU: MO-L018) according to the manufacturer's protocol (step B, step C). Briefly, 90 μl of PHGDH protein (200 nM) was mixed with 90 μl of dye (100 nM) and incubated for 30 min at RT. Samples were centrifuged at 15.000 × g for 10 min at 4 °C and transferred to new tubes. RNA was brought to a concentration of 1700 nM and serially diluted 1:2 over 16 steps in binding buffer (10 mM Tris HCl, 50 mM KCl, 0.5 mM EDTA, 0.1 mg / ml BSA, 10% (v / v) Rnase / Dnase-free glycerol). Fluorescently labeled proteins were added to each tube at a final concentration of 50 nM. 16 capillaries were loaded with IRF1 3'UTR RNA (maximum concentration 850 nM) and PHGDH protein (50 nM). Samples were measured with the following settings: 20% LED / excitation and medium MST power. At a final dye concentration of 25 nM, the expected fluorescence intensity at 20% LED / excitation is approximately 300 counts on a Monolith NT.115.

[0239] Quantitative and statistical analysis All plots, curve fitting, and statistical analyses were performed using GraphPad Prism. A P value of <0.05 was considered statistically significant.

[0240] References 1) Bantug et al., 2018 (doi: 10.1016 / j.immuni.2018.02.012) 2) Fischer et al., 2018 (doi: 10.1002 / eji.201747443) 3) Baker et al., 2001(doi.org / 10.1073 / pnas.181342398) 4) Humphrey et al., 1996 (doi: 10.1016 / 0263-7855(96)00018-5) 5) White and Garcin, 2015 (doi: 10.1002 / wrna.1315) 6) Grant, 2018 (doi: 10.3389 / fmolb.2018.00110) 7) Robinson et al., 2010 (doi: 10.1093 / bioinformatics / btp616) 8) Lund et al., 2012 (doi: 10.1515 / 1544-6115.1826) 9) Dobin et al., 2013 (doi.org / 10.1093 / bioinformatics / bts635) 10) Li et al., 2009 (doi: 10.1093 / bioinformatics / btp352) 11) Lawrence et al., 2009 (doi: 10.1093 / bioinformatics / btp328) 12) Gaidatzis et al., 2015 (doi.org / 10.1093 / bioinformatics / btu781) 13) Liao et al., 2019 (doi: 10.1093 / nar / gkz114) All publications, patents, and patent applications, including any drawings and appendices, are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent or patent application, drawing or appendix was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0241] Any reference in this specification to any prior publication (or information derived therefrom), or to any publicly known matter, is not, and should not be construed as, any form of acknowledgement or admission or suggestion that the prior publication (or information derived therefrom), or publicly known matter forms part of the common general knowledge in the field to which this specification pertains. < / scid>

Claims

1. Cells that have been genetically engineered to force the expression of phosphoglycerate dehydrogenase (PHGDH).

2. The cell according to claim 1, wherein the cell is an immune cell.

3. The cell according to claim 2, wherein the cell is a T cell.

4. The cell according to claim 3, wherein the cell comprises a chimeric antigen receptor (CAR) or a modified T cell receptor (TCR).

5. The cell according to claim 4, wherein the CAR or modified TCR comprises one or more antigen-binding domains (ABDs) that specifically bind to CD19 or BCMA.

6. The cell according to claim 3, wherein the PHGDH comprises one or more mutations in the catalytic domain that reduce or knock out the PHGDH catalytic activity.

7. The cell according to claim 6, wherein the PHGDH includes a mutation at one or more positions selected from 108, 119, 121, 133, 135, 140, 163, 236, 279 and 283 of SEQ ID NO:

1.

8. The cell according to claim 6, wherein the PHGDH comprises the amino acid sequence of SEQ ID NO: 3 or a sequence having at least 80% identity thereto, and the PHGDH has RNA-binding activity.

9. The cell according to claim 1, comprising an exogenous polynucleotide sequence encoding PHGDH.

10. The cell according to claim 9, wherein the polynucleotide sequence includes sequence number 4 or a sequence having 95% identity with sequence number 4, and the sequence encodes a polypeptide having RNA-binding activity, or a variant or functional fragment thereof.

11. The cell according to claim 9, comprising a polynucleotide sequence encoding CAR.

12. An expression cassette containing a polynucleotide sequence encoding phosphoglycerate dehydrogenase (PHGDH).

13. The expression cassette according to claim 12, wherein the PHGDH comprises one or more mutations in the catalytic domain that reduce or knock out the PHGDH catalytic activity.

14. The expression cassette according to claim 12, wherein the polynucleotide sequence includes sequence number 4 or a sequence having 95% identity with sequence number 4, and the sequence encodes a polypeptide having RNA-binding activity, or a variant or functional fragment thereof.

15. The aforementioned polynucleotide sequence is arranged in the following order from 5' to 3': a) Promoter sequence, and b) Sequence encoding PHGDH An expression cassette according to claim 12, comprising:

16. The expression cassette according to claim 12, further comprising a polynucleotide sequence encoding a chimeric antigen receptor (CAR).

17. The expression cassette according to claim 16, wherein the CAR comprises one or more antigen-binding domains (ABDs), and the ABDs specifically bind to CD19 or BCMA.

18. A vector comprising a polynucleotide sequence encoding phosphoglycerate dehydrogenase (PHGDH), wherein the polynucleotide sequence optionally comprises a sequence having 95% identity with SEQ ID NO: 4 or SEQ ID NO: 4, and the sequence encodes an RNA-binding polypeptide, a variant thereof, or a functional fragment thereof.

19. A vector comprising the expression cassette described in claim 12.

20. The vector according to claim 18 or 19, wherein the vector is a lentiviral vector (LV), preferably an LV expression vector.

21. A cell comprising the expression cassette described in claim 12.

22. A cell comprising the vector according to claim 18.

23. A cell comprising the vector according to claim 19.

24. A composition comprising the cells according to claim 1 or any one of claims 21 to 23, the expression cassette according to claim 12, or the vector according to claim 18 or 19.

25. The composition according to claim 24 for treating a disease or condition in an object requiring treatment of a disease or condition.

26. The composition according to claim 25, wherein the disease or condition is cancer or an infectious disease.

27. ​​The composition according to claim 25 for use in a method of cell therapy.

28. A composition for use in a method for generating cells genetically engineered to compel the expression of phosphoglycerate dehydrogenase (PHGDH), comprising the vector according to either claim 18 or 19, wherein the method comprises contacting one or more cells with the vector.

29. A composition for use in a method of treating a disease or condition in a subject requiring treatment of a disease or condition, comprising the cells described in Claim 1, wherein the method comprises administering the subject to the subject, and the cells are T cells.

30. The composition according to claim 29, wherein the cells comprise a chimeric antigen receptor (CAR) or a modified T cell receptor (TCR), and the CAR or modified TCR comprises one or more antigen-binding domains (ABDs) that specifically bind to CD19 or BCMA.