Matrix-bound nanovesicles encapsulated in hydrogels

JP2025511871A5Pending Publication Date: 2026-04-14UNIV OF PITTSBURGH OF THE COMMONWEALTH SYST OF HIGHER EDUCATION
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
UNIV OF PITTSBURGH OF THE COMMONWEALTH SYST OF HIGHER EDUCATION
Filing Date
2023-04-07
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing ECM hydrogels lack the complex biochemistry of native tissue ECMs, limiting their therapeutic efficacy in tissue engineering applications.

Method used

Compositions comprising ECM hydrogels combined with matrix-bound nanovesicles (MBVs) that do not express CD63 and CD81, and are free of alkaline phosphatase, are used to enhance the activity of ECM hydrogels.

Benefits of technology

The combination of ECM hydrogels with MBVs provides synergistic effects, such as reduced inflammation, and induces a remodeling-enhanced macrophage phenotype, promoting tissue repair and anti-inflammatory responses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Disclosed herein are compositions comprising an extracellular matrix (ECM) hydrogel and matrix-bound nanovesicles (MBVs). These compositions provide a synergistic effect and are useful for treating subjects. In some embodiments, the compositions comprise a) a solubilized extracellular matrix and b) exogenous MBVs derived from the extracellular matrix, which do not express CD63 and CD81 or express CD63. lo CD81 lo and exogenous MBVs that are free of alkaline phosphatase.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to and the benefit of U.S. Provisional Patent Application No. 63 / 329,319, filed April 8, 2022, the entire contents of which are incorporated herein by reference.

[0002] Field of the Disclosure The present invention relates to the field of extracellular matrix (ECM) compositions, and in particular to compositions comprising both ECM hydrogels and matrix-bound nanovesicles (MBVs), and uses of these compositions.

[0003] Reference to Electronic Sequence Listing The contents of the electronic sequence listing (Sequences.xml; size: 3,955 bytes; and creation date: April 6, 2023) are incorporated herein by reference in their entirety. [Background technology]

[0004] background Hydrogels composed of purified ECM components such as collagen, hyaluronic acid, silk fibroin, laminin, and fibronectin are widely used for tissue engineering applications. However, these purified, single-component ECM biomaterials lack the complex biochemistry of native tissue ECM. Decellularization of whole tissues or organs provides an alternative method to recover ECM in which the biochemistry of native tissue ECM is preserved. A major advance in the use of decellularized ECM is its ability to form hydrogels, which has expanded the clinical applicability of decellularized ECM. However, there remains a need to enhance the activity of ECM hydrogels. Summary of the Invention [Means for solving the problem]

[0005] Summary of the Disclosure Disclosed herein are compositions comprising ECM hydrogels and MBVs, which provide a synergistic effect, for example, to reduce inflammation.

[0006] In some embodiments, the method comprises the steps of: a) solubilizing extracellular matrix; and b) exogenous MBV derived from the extracellular matrix, the exogenous MBV not expressing CD63 and CD81 or expressing CD63. lo CD81 lo and exogenous MBVs, wherein the exogenous MBVs are at least about 1×10 per mL in the ECM hydrogel. 5 pieces~1×10 20 particles. The composition may i) be shear thinning; ii) have a storage modulus (G') of about 50 Pa to about 200 Pa, and a loss modulus (G'') of about 5 Pa to about 20 Pa, with a ratio of G' to G'' at 37° C. of about 4:1 to about 15:1; and iii) have a 50% degradation rate of 24 hours to 14 days.

[0007] In another embodiment, an acidic solution comprising an exogenous acid protease and a solubilized extracellular matrix, e.g., intact ECM, and exogenous MBV derived from the extracellular matrix, which do not express CD63 and CD81 or express CD63. lo CD81 lo and exogenous MBV, which is free of alkaline phosphatase. The exogenous MBV is present in the composition at a concentration of at least about 1 x 10 per mL. 5 pieces~1×10 20 When present in a concentration of about 10 ...

[0008] In a further embodiment, a composition is disclosed that includes a solubilized extracellular matrix, e.g., intact ECM, a non-activated or inactivated exogenous acid protease, and exogenous MBV derived from the extracellular matrix. The MBV does not express CD63 and CD81 or expresses CD63. lo CD81 lo and does not contain alkaline phosphatase. These exogenous MBVs are present in the composition at a concentration of at least about 1 x 10 per mL. 5 ~1×10 20 The ECM is present in a concentration of about 100 to about 200 particles. The composition enters a liquid phase at temperatures below 25° C. and a gel phase at temperatures above 25° C., and has a pH between about 7 and about 7.8. The ECM may be solubilized by an acid protease.

[0009] The foregoing and other features and advantages of the present invention will become more apparent from the following detailed description of several embodiments which proceeds with reference to the accompanying drawings. [Brief description of the drawings]

[0010] [Figure 1] Figure 1 provides a schematic diagram of the study in which ulcerative colitis was induced in study animals and treatment regimens were performed. Animals were given 5.5% DSS water for 6 days, then regular water until day 4. Treatment was given as daily enemas from day 0 to day 4 or injections on days 0 and 2. On day 4, colon tissue was explanted from the test animals.

[0011] [Diagram 2]2A-2C are a series of photographs showing an exemplary enema delivery preparation and procedure. FIG. 2A shows the cut location to remove the SURFLO® winged injection catheter and needle used to perform the enema. FIG. 2B shows that the needle was cut from the catheter and two marks (black arrows) were made. One of the two marks was 8 cm from the end to ensure consistent depth between enemas, and the other was 4 cm from the end to ensure that the catheter was withdrawn horizontally once the material was injected. FIG. 2C is a digital image showing the insertion of the catheter through the anus and into the colon of a test animal and the slow delivery of 5 mL of enema material.

[0012] [Diagram 3] FIG. 3 provides graphs of food consumption (right) and water consumption (left) measured daily for each animal over the course of the study.

[0013] [Figure 4] 4 is a graph showing the percentage of initial body weight for animals over the study period. Each animal's body weight was measured daily and normalized to the animal's initial body weight on day -6.

[0014] [Diagram 5] Figure 5 provides a graph of the fecal consistency fraction score (left) and fecal blood content fraction (right) scored daily for each animal. Fecal blood content was determined and scored using visual observation and the COLOSCREEN® ES Lab Pack Fecal Occult test [0=no blood, 2=occult blood, 4=gross bleeding]. Fecal consistency was scored [0=normal, 2=loose, 4=diarrhea]. Fraction scores were determined by normalizing individual rat scores to the scores obtained on day 0.

[0015] [Figure 6]Figure 6 provides bar graphs of colon length (left) and gross anatomical scoring of colon explants (right). For the left bar, the length of each colon was measured from the cecum to the rectum after explantation. All groups receiving DSS appeared to have shorter colons than the healthy group. For the right bar, the explanted colons were scored by a blinded investigator for evidence of gross ulceration and inflammation. All treatment groups showed lower scores (less disease) than disease controls.

[0016] [Figure 7] Figures 7A-7G provide images of histological analysis of H&E stained rat colon tissue sections from test animals. The images in Figures 7A-F provide enlarged views of sections of the larger tissue sample shown in Figure 7G. Figures 7A and 7G(i) are images from healthy animals. Figures 7B and 7G(ii) are images from diseased animals. Figures 7C and 7G(vi) are images from diseased animals that received MBV in a saline enema. Figures 7D and 7G(iii) are images from diseased animals that received ECM hydrogel enemas. Figures 7E and 7G(v) are images from diseased animals that received ECM hydrogel enemas infused with MBV. Figures 7F and 7G(iv) are images from diseased animals that received MB by iv injection.

[0017] [Figure 8]Figures 8A-8B provide a comparison of surface markers for exosomes, bone microvesicles (MVs) and MBVs. These figures show the results of EXO-CHECK™ Exosome Antibody Arrays (System Biosciences) comparing the levels of various markers found in mouse exosomes, mouse bone matrix vesicles (bone MVs) and mouse matrix-bound nanovesicles (MBVs). Figure 8A provides a digital image of the arrays and Figure 8B is a graph showing the relative expression of each of the markers found in exosomes, bone MVs and MBVs. The data show that MBVs are distinct from exosomes and bone microvesicles (MVs) based on the surface marker profile. As shown in the bar graphs in the lower panel, MBVs do not express or have low expression of CD63, EpCAM, ANXA5, TSG101, GM130, FLOT1, ICAM1, ALIX and CD81 compared to the levels of these markers in bone MVs or exosomes.

[0018] [Figure 9] Figure 9 is a Western blot showing that bone MV markers Annexin V and tissue non-specific alkaline phosphatase (TNAP) are expressed by bone MV. Lysates prepared from 1711A cells were used as a positive control. The results of this experiment show that matrix-bound nanovesicles (MBVs) do not express any of the bone microvesicle markers TNAP and Annexin V. Plasma exosomes express Annexin V but not TNAP. These results clearly distinguish MBVs from both exosomes and bone microvesicles. Notably, the MBVs used were isolated from muscle tissue.

[0019] [Figure 10]Figure 10 is a bar graph showing the differential effect of exosomes, MV and MBV on macrophage activation gene expression. MBV has a differential immunomodulatory effect, i.e., MBV increases M2 macrophages when compared to exosomes or bone MV, which do not have this effect. Bone marrow derived macrophages (BMDM) collected from mice were not treated (M0) or treated for 24 hours with the following test articles: IFNγ+LPS (M1) to induce M1 phenotype, IL-4 (M2) to induce M2-like phenotype, exosomes from plasma, bone MV from 17A cells, or MBV isolated from muscle. After treatment, the fold change in expression of the indicated genes (Arg, CD206, Fixx, IL-6, INOS, and TNF) was evaluated by qPCR. Figure 10 shows that the downregulation of the pro-inflammatory markers IL-6 and TNF-α by MBV is clearly distinct from the downregulation of the same two inflammatory mediators by exosomes and bone MV. MBV had a strong anti-inflammatory effect; whereas exosomes and bone MV did not have this effect.

[0020] [Figure 11] Figures 11A-11E are high magnification histological (hematoxylin and eosin) images representing each treatment group of colon (Disease: Figure 11A; ECM hydrogel enema: Figure 11B; MBV+PBS enema: Figure 11C; ECM hydrogel enema infused with MBV: Figure 11D; dual MV iv injection: Figure 11E), which are representative of the results for each group.

[0021] [Figure 12-1] Figures 12A-E are bar graphs showing quantification of M2:M1 macrophage ratios in treatment samples in various layers: colon (Figure 12A), mucosa (Figure 12B), muscularis (Figure 12C), and submucosa (Figure 12D). Quantification of CD68+ cells for each treatment is shown in Figure 12E. [Figure 12-2] Same as above. [Figure 12-3] Same as above. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0022] Detailed Description MBVs are an integral component of the ECM, distinct from exosomes, and effectively redirect excessive inflammation in preclinical models (Hussey GS, et al. (2020) Lipidomics and RNA sequencing reveal a novel subpopulation of nanovesicles within extracellular matrix biomaterials. Sci Adv 6 (12): eaay4361;van der Merwe Y, et al. (2019) Matrix-bound nanovesicles prevent ischemia-induced retinal ganglion cell axon degeneration and death and preserve visual function. Sci Rep 9 (1): 3482). In some embodiments, MBVs contain immunomodulatory miRNAs, proteins, and lipids and are rapidly taken up by macrophages, triggering signaling cascades and modulating gene expression essential for phenotypic switching, a phenomenon that has been well-studied in the context of ECM-based biomaterials (Hussey GS, et al. (2019) Matrix bound nanovesicle-associated IL-33 activates a pro-remodeling macrophage phenotype via a non-canonical, ST2-independent pathway. J Immunol Regen Med 3: 26-35; Huleihel L, et al. (2017) Macrophage phenotype in response to ECM bioscaffolds. Semin Immunol 29: 2-13). Additionally, in some embodiments, administration of MBVs results in the induction of regulatory T cells (T REG) is upregulated. MBV rapidly and effectively induces reparative immune responses under challenging circumstances, including rheumatoid arthritis, traumatic muscle injury, ulcerative colitis, and esophageal cancer. (Huleihel L, et al. (2017) Matrix-Bound Nanovesicles Recapitulate Extracellular Matrix Effects on Macrophage Phenotype. Tissue Eng Part A 23 (21-22): 1283-1294;Dziki JL, et al. (2016) Immunomodulation and Mobilization of Progenitor Cells by Extracellular Matrix Bioscaffolds for Volumetric Muscle Loss Treatment. Tissue Eng Part A 22 (19-20): 1129-1139;Keane TJ, et al. (2017) Restoring Mucosal Barrier Function and Modifying Macrophage Phenotype with an Extracellular Matrix Hydrogel: Potential Therapy for Ulcerative Colitis. J Crohns Colitis 11 (3): 360-368;Saldin LT, et al. (2019) Extracellular Matrix Degradation Products Downregulate Neoplastic Esophageal Cell Phenotype. Tissue Eng Part A 25 (5-6): 487-498).

[0023] Cytokine cargo stored within MBVs supports reparative and regulatory M2 macrophages and controls bacterial infection and inflammation after acute lung injury (Liu Q, et al. (2019) IL-33-mediated IL-13 secretion by ST2+ T REGcontrols inflammation after lung injury. JCI Insight 4 (6)). ECM bioscaffolds are useful in a variety of clinical applications involving musculoskeletal, gastrointestinal, urogenital and CNS tissues (Badylak SF (2007) The extracellular matrix as a biologic scaffold material. Biomaterials. 28 (25): 3587-3593). The ECM consists of structural and functional molecules secreted by resident cells of each tissue that define tissue identity. Such xenogeneic scaffolds do not induce deleterious innate or adaptive immune responses, but instead support anti-inflammatory and reparative innate and adaptive immune responses (Brown BN, et al. (2009) Macrophage phenotype and remodeling outcomes in response to biologic scaffolds with and without a cellular component. Biomaterials. 30 (8): 1482-1491). The use of these naturally occurring biomaterials is typically associated with (at least) partial restoration of functional and site-appropriate tissue; a process termed "constitutive remodeling" (Badylak SF (2007) The extracellular matrix as a biologic scaffold material. Biomaterials. 28 (25): 3587-3593). ECM bioscaffolds, or their degradation products, have been shown to direct tissue repair by recruiting anti-inflammatory M2-like macrophages and type 2 helper T (Th2) cell responses, which are often associated with reduced local inflammation and constitutive crosstalk with progenitor cells.

[0024] Matrix-bound nanovesicles (MBVs) activate an M2-like, reparative and anti-inflammatory macrophage phenotype. Studies have shown that MBVs are a distinct class of extracellular vesicles that are distinct from exosomes found in bodily fluids (Hussey GS, et al. (2020) Lipidomics and RNA sequencing reveal a novel subpopulation of nanovesicle within extracellular matrix biomaterials. Sci Advances. 6 (12): eaay4361). Because MBVs survive stringent tissue decellularization processes, they may play fundamental roles in tissue and organ development and homeostasis across species, as well as regulatory roles in tissue responses to injury. MBVs can be derived from multiple, diverse tissue sources. MBVs are abundant, can be lyophilized, are highly stable, and can be easily administered by tracheal instillation or nebulization.

[0025] MBV can recapitulate the effect of ECM on promoting a pro-remodeling macrophage phenotype. The most representative regulatory / anti-inflammatory phenotype after treatment with MBV was macrophage gene and protein expression, cell surface markers, and functional capacity as determined by observed phagocytic activity, nitric oxide (NO) production, and antimicrobial activity. This is consistent with previous reports that described the effect of ECM-based bioscaffolds on macrophage phenotype and function (see, e.g., PCT Publication No. WO2017 / 151862A1). MBV has been shown to exert immunomodulatory effects through a combination of miRNA, protein, and phospholipid cargo. For example, compared to exosomes present in bodily fluids, MBVs are highly enriched in pro-resolving lipid mediators that are activated by different phospholipases depending on the pro- / anti-inflammatory context of the extracellular environment (Hussey GS, et al. (2020) Lipidomics and RNA sequencing reveal a novel subpopulation of nanovesicles within extracellular matrix biomaterials. Sci Adv 6 (12): eaay4361). Furthermore, MBVs are an abundant and stable source of IL-33, which signals immune cells towards a reparative M2-like phenotype, while also upregulating T cell proliferation in injured lungs. REG It also stimulates repair and regulatory functions by ST2+ T cells (Liu Q, et al. (2019) IL-33-mediated IL-13 secretion by ST2+ T cells). REGcontrols inflammation after lung injury. JCI Insight 4 (6)). IL-33 delivery reduces bacterial superinfection after H1N1 infection by improving bacterial clearance (Robinson KM, et al. (2018) Novel protective mechanism for interleukin-33 at the mucosal barrier during influenza-associated bacterial superinfection. Mucosal immunology. 11 (1): 199-208). Furthermore, MBV are enriched for miRNAs 125b-5p, 143-3p, and 145-5p. Inhibition of these miRNAs in macrophages is associated with gene and protein expression profiles consistent with a pro-inflammatory phenotype rather than an anti-inflammatory / regulatory phenotype (Huleihel L, et al. (2017) Matrix bound nanovesicles recapitulate extracellular matrix effects on macrophage phenotype. Tissue Eng Part A). Disclosed herein are compositions that include both MBVs and ECM hydrogels.

[0026] Disclosed herein are compositions comprising an extracellular matrix (ECM) hydrogel and matrix-bound nanovesicles (MBVs), which provide a synergistic effect and are useful for treating a subject.

[0027] term Unless otherwise noted, technical terms are used according to conventional usage. Definitions of many common terms in molecular biology can be found in Krebs et al. (eds.), Lewin's genes XII, published by Jones & Bartlett Learning, 2017. The following explanations of terms and methods are provided to better explain the present disclosure and to guide those skilled in the art in the implementation of the present disclosure. The singular forms "a", "an" and "the" refer to one or more than one, unless the context clearly indicates otherwise. For example, the term "comprising a MBV" includes single or multiple MBVs and is considered equivalent to the phrase "comprising at least one MBV". The term "or" refers to a single element of the indicated selection elements or a combination of two or more elements, unless the context clearly indicates otherwise. As used herein, "comprises" means "includes." Thus, "comprising A or B" means "including A, B, or A and B," without excluding additional elements. It should be further understood that all molecular weight or molecular mass values ​​or percentages given for compositions are approximate and provided for descriptive purposes, unless otherwise specified. The dates of GENBANK® Accession Numbers referred to herein are those of sequences available as of at least April 5, 2021, at the earliest. All references, patent applications and publications, and GENBANK® Accession Numbers cited herein are incorporated by reference. Unless otherwise specified, "about" indicates within 5 percent. In case of conflict, the present specification, including the explanation of terms, will control. In order to facilitate review of the various aspects of the present disclosure, the following explanations of certain terms are provided:

[0028] Acid protease: An enzyme that cleaves peptide bonds and has increased activity in cleaving peptide bonds at an acidic pH. For example and without limitation, acid proteases can include pepsin and trypsin.

[0029] Administration: The introduction of a composition (such as MBV or a pharmaceutical preparation containing MBV) into a subject by a selected route. The route may be local or systemic. For example, if the selected route is intravenous, the composition is administered by introducing the composition into the subject's vein. If the selected route is local, the composition may be administered by introducing the composition directly into the subject's tissue.

[0030] Animal: Living multi-cellular vertebrate organisms. This category includes, for example, mammals and birds. The term "mammal" includes both human and non-human mammals. Similarly, the term "subject" includes both human and veterinary subjects.

[0031] Biocompatible: Any material that, when implanted in a mammalian subject, does not induce an adverse response in the subject. A biocompatible material is capable of performing its intended function when introduced into an individual and is not toxic or injurious to the individual, nor does it induce immunological rejection of the material in the subject.

[0032] Centrifugation: The process by which a centrifugal force is applied to a mixture, causing denser components of the mixture to move away from the axis of the centrifuge relative to other less dense components in the mixture. The force applied to the mixture is a function of the speed and spin radius of the centrifuge rotor. In most applications, the force of the spin results in a sediment (pellet) that collects at the bottom of the centrifuge tube, and the remaining solution is appropriately called the "supernatant" or "liquid." In other similar applications, density-based separation or "gradient centrifugation" techniques are used to isolate specific species from mixtures that contain both denser and less dense components than the desired component.

[0033] In the circular motion of a centrifuge rotor, the applied force is the product of the radius of spin and the angular velocity, and this force is traditionally expressed as an acceleration corresponding to "g", the standard acceleration due to gravity at the Earth's surface. The applied centrifugal force is termed the "relative centrifugal force" (RCF) and is expressed as a multiple of "g".

[0034] Comminute (comminution and comminuting): The process of reducing large particles to smaller particles, including but not limited to by grinding, blending, crushing, slicing, milling, or chopping. ECM can be comminuted and can be in any form, including but not limited to wet, frozen, air-dried, lyophilized, powdered, or in sheet form. "Comminuted ECM" encompasses intact collagen. Comminuted ECM has not been subjected to ultrasound or enzymatic digestion with proteases, such as acid proteases.

[0035] Contact: The placement of a direct physical association, which may be in solid or liquid form.

[0036] Cytokine: The term "cytokine" is used as a collective term for a diverse group of soluble proteins and peptides that act as humoral regulators at nano- to picomolar concentrations to modulate the functional activity of individual cells and tissues, either under normal or pathological conditions. Such proteins also directly mediate cell-cell interactions and regulate processes occurring in the extracellular environment. Examples of cytokines include, but are not limited to, tumor necrosis factor-α, interleukin (IL)-6, IL-10, IL-12, transforming growth factor, and interferon-γ.

[0037] Diagnosis: The process of identifying a disease from its signs, symptoms, and the results of various tests. The conclusion reached by the process is also called a "diagnosis." Commonly performed forms of diagnostic testing include, but are not limited to, blood tests, medical imaging, and biopsies.

[0038] Enriched: A process in which a component of interest, such as a nanovesicle, in a mixture has an increased ratio of the amount of that component to the amount of other components in the mixture after the enrichment process compared to before the enrichment process.

[0039] Extracellular Matrix (ECM): A complex mixture of structural and functional biomolecules and / or biopolymers, including but not limited to structural proteins, specialized proteins, proteoglycans, glycosaminoglycans, and growth factors, that surrounds and supports cells in tissues, and is acellular unless otherwise noted. ECM preparations can be considered "decellularized" or "acellular," meaning that cells have been removed from the source tissue by processes known in the art and described herein. "ECM-derived material," such as "ECM-derived nanovesicles," "matrix-bound nanovesicles," "MBVs," or "ECM-derived nanovesicles," refers to nanovesicles prepared from native ECM or in vitro sources where ECM is produced by cultured cells. "Intact extracellular matrix" and "intact ECM" refer to an extracellular matrix that retains the activity of structural and non-structural biomolecules of the extracellular matrix, including, but not limited to, collagen, elastin, laminin, glycosaminoglycans, proteoglycans, antimicrobials, chemoattractants, cytokines, and growth factors, such as, but not limited to, the pulverized ECM described herein. The activity of the biomolecules within the ECM can be removed chemically or mechanically, for example, by crosslinking and / or dialysis of the ECM. An intact ECM is essentially not crosslinked and / or dialyzed prior to solubilization in the creation of an enzymatic ECM hydrogel, i.e., the ECM has not been subjected to conditions other than the dialysis and / or crosslinking process, or processes that occur naturally during storage and handling of the ECM. Thus, an ECM that has been substantially crosslinked and / or dialyzed (other than in a normal manner that does not substantially affect the gelation and functional characteristics of the ECM in the uses of the ECM described herein) is not considered "intact."

[0040] Exogenous: originating from a different source. Exogenous MBVs are produced separately, e.g., extracted from an ECM source, and added to the ECM hydrogel. Endogenous MBVs may or may not be present in the ECM hydrogel. Exogenous MBVs may be derived from the same tissue as the ECM used to make the ECM hydrogel, or from a different tissue. Exogenous MBVs may be derived from the same species as the ECM used to make the ECM hydrogel, or from a different species.

[0041] Gel: A state of matter between liquid and solid, generally defined as a cross-linked polymer network swollen in a liquid medium. Typically, a gel is a two-phase colloidal dispersion containing both solid and liquid, with the amount of solid being greater than that in two-phase colloidal dispersions called "sols". Thus, a "gel" has some of the properties of a liquid (i.e., shape is elastic and deformable) and some of the properties of a solid (e.g., shape is separate enough to maintain a third dimension on a two-dimensional surface). "Gelling time", also called "gel time", refers to the time it takes for a composition to become non-flowing under moderate stress.

[0042] Gelation: The formation of a gel from a sol.

[0043] Hydrogel: A network of polymer chains, hydrophilic and sometimes found as a colloidal gel, in which water is the dispersion medium. Hydrogels are highly absorbent natural or synthetic polymer networks. Hydrogels also have a degree of flexibility similar to that of natural tissue. "Acoustic" hydrogels, such as acoustic ECM hydrogels, are produced using ultrasonic energy. Characteristics of these hydrogels are disclosed herein. For hydrogels, G' (storage modulus) is typically about one order of magnitude greater than G'' (loss modulus). "Enzymatic" ECM hydrogels are produced by enzymatically digested ECM. The viscosity of enzymatic hydrogels increases upon warming to physiological temperatures approaching about 37°C. For example, enzymatic hydrogels are formed at temperatures below 37°C from an injectable solution that forms a gel at the physiological temperature of 37°C.

[0044] Inflammation: Inflammation is a localized defense response induced by injury to tissues that serves to sequester inflammatory substances. Inflammation is orchestrated by a complex biological response of vascular tissues to harmful stimuli, such as pathogens, damaged cells, or irritants. Inflammation is a protective attempt by the organism to remove the injurious stimuli as well as to initiate the tissue healing process. Inflammatory responses are characterized by the accumulation of leukocytes either systemically or locally at the site of inflammation. Inflammatory responses can be measured by a number of methods, including but not limited to measuring leukocyte counts, polymorphonuclear neutrophil (PMN) counts, measures of the degree of PMN activation, such as luminol-enhanced chemiluminescence, or measures of the amount of cytokines present. C-reactive protein is a marker of the systemic inflammatory response.

[0045] Inflammatory disorders are a genus of disorders in which inflammation disrupts normal or normal physiological functions. Inflammatory disorders may include a variety of conditions, such as autoimmune disorders (inappropriate inflammatory responses to endogenous antigens) and disorders caused by inflammation due to trauma or exogenous antigens. Primary inflammatory disorders are diseases or disorders caused by inflammation itself. Secondary inflammatory disorders are inflammation that is the result of another disorder. Inflammation can lead to inflammatory disorders, such as acute respiratory distress syndrome (ARDS).

[0046] In some embodiments, anti-inflammatory drugs are administered to treat inflammatory diseases or disorders, such as ARDS. Anti-inflammatory drugs include, but are not limited to, nonsteroidal anti-inflammatory drugs (NSAIDs, such as aspirin, ibuprofen, and naproxen), anti-leukotriene drugs, immunoselective anti-inflammatory derivatives (ImSAIDs), bioactive compounds, steroids (such as corticosteroids), and opioids.

[0047] Isolated: An "isolated" biological component (such as a nucleic acid, protein, cell, or nanovesicle) has been substantially separated or purified away from other biological components in the cells of an organism or the ECM where the component naturally occurs. "Isolated" nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. Isolated MBVs are removed from the fibrous material of the ECM. The term also encompasses nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.

[0048] Isotonic buffered solution: a solution that is buffered to a pH between 7.2 and 7.8 and has a balanced concentration of salts to promote an isotonic environment.

[0049] Lysyl oxidase (Lox): A copper-dependent enzyme that catalyzes the formation of aldehydes from lysine residues in collagen and elastin precursors. These aldehydes are highly reactive and spontaneously react with other lysyl oxidase-derived aldehyde residues or with unmodified lysine residues. In vivo, this results in collagen and elastin cross-linking, which plays a role in stabilizing collagen fibrils and for the integrity and elasticity of mature elastin. Complex cross-links are formed in collagen (pyridinoline derived from three lysine residues) and elastin (desmosine derived from four lysine residues), which differ in structure. Genes encoding Lox enzymes have been cloned from various organisms (Hamalainen et al., Genomics 11: 508, 1991; Trackman et al., Biochemistry 29: 4863, 1990; incorporated herein by reference). Residues 153-417 and 201-417 of the human lysyl oxidase sequence have been shown to be important for catalytic function. Four Lox-like isoforms exist, designated LoxL1, LoxL2, LoxL3 and LoxL4.

[0050] Macrophage: A type of white blood cell that engulfs and breaks down cellular debris, foreign bodies, microorganisms, and cancer cells. In addition to its role in phagocytosis, this cell plays a key role in development, tissue maintenance and repair, and in both innate and adaptive immunity in terms of recruiting and influencing other cells, including immune cells such as lymphocytes. Macrophages can exist in many phenotypes, including those that have been termed M1 and M2. Macrophages that perform primarily pro-inflammatory functions are referred to as M1 macrophages (CD86+ / CD68+), while macrophages that reduce inflammation and aid and regulate tissue repair are referred to as M2 macrophages (CD206+ / CD68+). Markers that identify the various phenotypes of macrophages vary between species. It is noted that macrophage phenotypes are represented by a spectrum that ranges from the extremes of M1 to the extremes of M2. F4 / 80 (encoded by the adhesion G protein-coupled receptor E1 (ADGRE1) gene) is a macrophage marker. See GENBANK® Accession Nos. NP_001243181.1, April 6, 2018, and NP_001965, March 5, 2018, both of which are incorporated herein by reference. Without wishing to be bound by theory, it is believed that MBV has the ability to modulate macrophage phenotype, resulting in an increase in M2-like, regulatory, or remodeling-promoting macrophages. The effect of MBV on macrophages is further characterized in PCT Publication No. WO2017 / 151862A1, the entirety of which is incorporated herein by reference. In some embodiments, the MBV of the present invention can be used to induce the M2 phenotype of macrophages and inhibit M1 macrophages in a subject.

[0051] MicroRNA: A small non-coding RNA, typically about 17 to about 25 nucleotide bases in length, that post-transcriptionally regulates gene expression by repressing target mRNA translation. MicroRNAs ("miRNAs" or "miRs") can function as negative regulators, such that higher amounts of a specific miRNA correlate with lower levels of target gene expression. There are three types of miRNAs, primary miRNAs (pri-miRNAs), immature miRNAs (pre-miRNAs) and mature miRNAs. Primary miRNAs (pri-miRNAs) are expressed as stem-loop transcripts of about several hundred bases to more than 1 kb. Pri-miRNA transcripts are cleaved in the nucleus by an RNase II endonuclease called Drosha, which cleaves both strands of the stem near the base of the stem-loop. Drosha cleaves the RNA duplex with staggered cuts, leaving a 5' phosphate and a two-nucleotide overhang at the 3' end. The cleavage product, immature miRNA (pre-miRNA), is about 60 to about 110 nucleotides long with a hairpin structure formed in a fold-back fashion. Pre-miRNA is transported from the nucleus to the cytoplasm by Ran-GTP and exportin-5. Pre-miRNA is further processed in the cytoplasm by another RNase II endonuclease called Dicer. Dicer recognizes the 5' phosphate and 3' overhang and cleaves off the loop at the stem-loop junction to form the miRNA duplex. The miRNA duplex binds to the RNA-induced silencing complex (RISC), where the antisense strand is preferentially degraded and the sense strand mature miRNA directs RISC to its target site. The biologically active form of miRNA is the mature miRNA, which is about 17 to about 25 nucleotides long.

[0052] Nanovesicles: Extracellular vesicles that are nanoparticles with a diameter of about 10 to about 1,000 nm. Nanovesicles are lipid membrane-bound particles that carry biologically active signaling molecules (e.g., microRNA, proteins) among other molecules. Generally, nanovesicles are bounded by a lipid bilayer, and biological molecules may be encapsulated and / or embedded in the bilayer. Thus, nanovesicles contain a lumen surrounded by a plasma membrane. Different types of vesicles can be distinguished based on diameter, subcellular origin, density, shape, sedimentation rate, lipid composition, protein markers, nucleic acid content, and origin, such as extracellular matrix-derived or secreted. Nanovesicles can be identified by their origin and / or miR content, such as ECM-derived matrix-bound nanovesicles (see above).

[0053] "Exosomes" or "fluid-phase extracellular vesicles (EVs)" are membrane vesicles secreted by cells, ranging in diameter from 10 to 150 nm. Generally, late endosomes or multivesicular bodies contain intralumenal vesicles formed by inward budding and cleavage of vesicles from the confined endosomal membrane into such enclosed vesicles. Such intralumenal vesicles are subsequently released from the multivesicular body lumen into the extracellular environment, typically bodily fluids such as blood, cerebrospinal fluid or saliva, in exocytosis after fusion with the plasma membrane. Exosomes are created within cells when segments of the membrane invaginate and become invaginated by the plasma membrane. The internalized segments, which break down into smaller vesicles and are eventually expelled from the cell, contain proteins and RNA molecules such as mRNA and miRNA. The majority of plasma-derived exosomes lack ribosomal RNA. Extracellular matrix-derived exosomes contain specific miRNA and protein components and have been shown to be present in virtually all bodily fluids, including blood, urine, saliva, semen, and cerebrospinal fluid. Exosomes can express CD11c, CD63, CD81, and / or CD9, and thus, CD11c + and / or CD63 + and / or C81 + and / or CD9 +Exosomes may not have high levels of lysyl oxidase on their surface.

[0054] "ECM-derived nanovesicles", "matrix-bound nanovesicles", "MBVs" or "ECM-derived nanovesicles" all refer to the same membrane-bound particles ranging in size from 10 nm to 1000 nm that reside in the extracellular matrix and contain biologically active signaling molecules such as proteins, lipids, nucleic acids, growth factors and cytokines that affect cell behavior. The terms are interchangeable and refer to the same vesicles. These nanovesicles are embedded within and bound to the ECM, and are not simply attached to a surface or circulating freely in body fluids. These nanovesicles are resistant to harsh isolation conditions such as freeze-thawing, and digestion with proteases such as pepsin, elastase, hyaluronidase, proteinase K, and collagenase, and detergent digestion. MBVs are distinct from other extracellular vesicles, including exosomes, and have a distinct phospholipid composition from exosomes. MBVs are distinct from bone matrix vesicles and do not express alkaline phosphatase. In certain circumstances, MBVs may also be distinguished from exosomes based on the absence of certain markers generally associated with exosomes.

[0055] In some embodiments, the MBVs are characterized by one or more of the following features of protein expression or lipid content: (i) MBVs do not express one or more of CD63 and / or CD81 and / or CD9, or express low or barely detectable levels of CD63 and / or CD81 and / or CD9 compared to other vesicles such as exosomes (CD63 lo and / or CD81 lo and / or CD9 lo) (see, e.g., Example 1). To distinguish between low, barely detectable, or absent expression of CD63 and / or CD81 and / or CD9 in MBVs, various methods can be used, e.g., antibody-based methods such as Western blotting or flow cytometry (see, e.g., Bashashati and Brinkman, Adv Bioinformatics, 2009: 584603). In some embodiments, expression of CD63 and / or CD81 and / or CD9 in MBVs is considered to be low or barely detectable compared to other vesicles, such as exosomes, when expression of CD63 and / or CD81 and / or CD9 in MBVs is at least one standard deviation or at least two standard deviations below the average expression of other vesicles, such as exosomes; (ii) the MBVs have a phospholipid content in which at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) the MBVs have a phospholipid content in which 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iv) the MBVs have a phospholipid content in which 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); (v) the MBV has a phospholipid content in which 15% or more of the total phospholipid content is composed of phosphatidylinositol (PI); Here, the percentages represent percentages relative to lipid concentration.

[0056] In some embodiments, the MBV is characterized by all of the following features: (i) do not express one or more of CD63 and / or CD81 and / or CD9, or express low or barely detectable levels of CD63 and / or CD81 and / or CD9 (CD63 lo and / or CD81 lo and / or CD9 lo) (as further described above); (ii) a phospholipid content in which at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (iii) phospholipid content in which 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iv) a phospholipid content in which 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); and (v) a phospholipid content in which 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0057] In some embodiments, the MBV is characterized by all of the following features: (i) a phospholipid content in which at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) phospholipid content in which 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iii) a phospholipid content in which 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); and (iv) a phospholipid content in which 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0058] In some embodiments, the MBV is characterized by one or more of the following features: (i) a phospholipid content in which at least 55% of the total phospholipids are composed of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI); (ii) phospholipid content in which 10% or less of the total phospholipids are composed of sphingomyelin (SM); (iii) a phospholipid content in which 20% or less of the total phospholipids are composed of phosphatidylethanolamine (PE); and (iv) a phospholipid content in which 15% or more of the total phospholipid content is phosphatidylinositol (PI).

[0059] In some embodiments, the MBV is characterized by one or more of the following features: (i) does not contain detectable levels of alkaline phosphatase; (ii) does not contain detectable levels of osteopontin; (iii) does not contain detectable levels of osteoprotegerin; (iv) does not contain detectable levels of complement C5; and / or (v) does not contain detectable levels of C-reactive protein.

[0060] In some embodiments, the MBV contains IL33 and + It is.

[0061] The ECM from which the MBVs are isolated may be tissue-derived ECM, produced by cells in culture, or purchased from a commercial source.

[0062] Pharmaceutically acceptable carriers: Pharmaceutically acceptable carriers useful in the claimed pharmaceutical preparations are conventional. Remington's Pharmaceutical Sciences, E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition, 1975, describes compositions and formulations suitable for pharmaceutical delivery of the fusion proteins disclosed herein.

[0063] Generally, the nature of the carrier will depend on the particular administration mechanism used. For example, parenteral formulations usually contain injectable fluids, such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, and the like, as a vehicle, and other pharma- ceutically and physiologically acceptable fluids. For solid compositions (e.g., in powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical preparations to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents, for example, sodium acetate or sorbitan monolaurate.

[0064] Pharmaceutical Product: A chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when properly administered to a subject or cell.

[0065] Phospholipid: A class of lipids whose structure consists of two hydrophobic fatty acid tails and a hydrophilic head consisting of a phosphate group. The major classes of phospholipids include phosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylinositol (PI), phosphatidylserine (PS), phosphatidylglycerol (PG), sphingomyelin (SM), cardiolipin (CL), phosphatidic acid (PA), and bis-monoacylglycerophosphate (BMP). Phospholipids can be measured in a variety of ways. For example, comprehensive lipidomics and redox lipidomics based on liquid chromatography-mass spectrometry (LC-MS) can be used. In some embodiments, a particular phospholipid content is shown as a percentage concentration relative to total phospholipids (such as, for example, total phospholipids in MBV), where the percentage concentration is weight / weight (w / w).

[0066] Polynucleotide: A nucleic acid sequence of any length (e.g., a linear sequence, etc.). Thus, polynucleotide includes oligonucleotides, including gene sequences found in chromosomes. An "oligonucleotide" is a plurality of linked nucleotides linked by native phosphodiester bonds. An oligonucleotide is a polynucleotide between 6 nucleotides and 300 nucleotides in length. An oligonucleotide analog refers to a moiety that functions similarly to an oligonucleotide, but has non-naturally occurring portions. For example, oligonucleotide analogs may contain non-naturally occurring portions, such as altered sugar moieties, or inter-sugar linkages, such as phosphorothioate oligodeoxynucleotides. Functional analogs of naturally occurring polynucleotides can bind to RNA or DNA, and include peptide nucleic acid (PNA) molecules.

[0067] Prophylactic: As used herein, refers to a drug or treatment designed and used to prevent a disease or disorder from occurring. As used herein, the terms "prophylactic" and "prevention" are used interchangeably.

[0068] Purified: The term "purified" is intended as a relative term, without requiring absolute purity. Thus, for example, a purified nucleic acid molecule preparation is a preparation in which the nucleic acid referred to is more pure than the nucleic acid in its natural environment in a cell. For example, a preparation of nucleic acid is purified such that the nucleic acid represents at least 50% of the total protein content of the preparation. Similarly, a purified MBV preparation is a preparation in which exosomes are more pure than the environment containing the cells, in which microvesicles and exosomes are present. A purified population of nucleic acid or MBV is more than about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% pure, or free of other nucleic acid or cellular components, respectively.

[0069] Preventing or Treating a Disease: "Preventing" a disease refers to inhibiting the onset of a disease, for example, in a person known to have a predisposition to the disease. Examples of people with a known predisposition are those who have a family history of the disease, or who have been exposed to factors that predispose the subject to the condition. "Treatment" refers to a therapeutic intervention that reverses the signs or symptoms of a disease or pathological condition after it has begun to develop.

[0070] Solubilized ECM: ECM that has been treated by ultrasonic cavitation or enzymatic digestion, which has caused microstructural changes, e.g. by physical disruption or digestion of protein aggregates, respectively.

[0071] Subject: Humans and non-human animals, including all vertebrates, such as mammals and non-mammals, such as non-human primates, mice, rabbits, sheep, dogs, cats, horses, cows, chickens, amphibians, and reptiles. In some embodiments of the described methods, the subject is a human. "Subject" is used interchangeably with the term "patient". The subject may be an individual diagnosed as being at high risk of developing a disease or disorder, such as an infectious disease or disorder (e.g., an immunocompromised individual, a health care worker), a person diagnosed with a disease or disorder, such as an infectious disease or disorder, a person who has previously suffered from a disease or disorder, such as an infectious disease or disorder, or an individual evaluated for symptoms or signs of a disease or disorder, such as an infectious disease or disorder.

[0072] Therapeutically effective amount: A quantity of a particular substance, such as MBV, sufficient to achieve a desired effect in a treated subject. A dosage is generally used that achieves a target tissue concentration (e.g., in the lungs) that has been shown to achieve the desired in vitro effect when administered to a subject.

[0073] Thermoreversible hydrogel: a hydrogel formed due to entanglement of polymer chains, which undergoes a change in viscosity at a characteristic gelation temperature. The acoustic ECM hydrogels of the present disclosure are thermoreversible hydrogels that exhibit gelation (sol-to-gel transition) upon cooling.

[0074] External application: Externally applied drugs are applied only to a specific area, not to the whole body.In a particular example, the composition is applied to the skin or eye in the area where hemostasis is desired.For example, the pharmaceutical composition can be applied as an external preparation to wounds, such as epithelial wounds or defects, such as traumatic wounds or surgical wounds, such as skin or corneal abrasions or surgical incisions.

[0075] Total phospholipid content: "Total phospholipids" or "total phospholipid content", as used herein with respect to MBVs, refers to the sum of all phospholipids present in a given quantity of isolated MBVs, i.e., MBVs isolated from ECM. MBVs can be isolated, for example, by enzymatic digestion and differential centrifugation of decellularized ECM. Total phospholipid content can be determined by methods such as LC-MS-based comprehensive lipidomics and redox lipidomics. Total phospholipid content is measured by weight. Percentages of total phospholipid content refer to percent concentrations on a weight / weight basis.

[0076] Implantation: The placement of a biocompatible matrix, such as MBV, into a subject in need thereof.

[0077] Treating, treatment, and therapy: Any success or indication of success regarding the attenuation or reversal of an injury, pathology, or condition, including any objective or subjective parameter, such as alleviation, remission, relief of symptoms, or making a condition more tolerable to a patient, slowing degeneration or decline, making the end point of degeneration less debilitating, or improving the physical or mental well-being of a subject. Treatment can be evaluated by objective or subjective parameters, including the results of a physical examination, neurological examination, or psychiatric evaluation.

[0078] Sonication: the process of exposure to ultrasound waves with frequencies greater than 20 kHz.

[0079] overview In some embodiments, the method comprises the steps of: a) solubilized extracellular matrix; and b) exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, the exogenous MBVs not expressing CD63 and CD81 or expressing CD63. lo CD81 lo and an extracellular matrix (ECM) hydrogel comprising MBV, wherein the MBV is at least about 1×10 per mL and does not contain alkaline phosphatase. The exogenous MBV is present in the ECM hydrogel at a concentration of less than 1 mg / mL. For example, the MBV is present in the ECM hydrogel at a concentration of at least about 1×10 per mL. 5 ~Approx. 1×10 20 In another example, MBVs may be present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 6 ~Approx. 1×10 12 The particles may be present in a concentration of

[0080] In some embodiments, the method comprises the steps of: a) solubilized extracellular matrix; and b) exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, the exogenous MBVs not expressing CD63 and CD81 or expressing CD63. lo CD81 lo and an extracellular matrix (ECM) hydrogel comprising MBV, wherein the MBV is at least about 1×10 per mL and does not contain alkaline phosphatase. The exogenous MBV is present in the ECM hydrogel at a concentration of less than 1 mg / mL. For example, the MBV is present in the ECM hydrogel at a concentration of at least about 1×10 per mL. 5 ~Approx. 1×10 20 In some embodiments, the composition has one or more of the following characteristics: i) is shear thinning; ii) has a storage modulus (G') of about 50 Pa to about 200 Pa, and a loss modulus (G'') of about 5 Pa to about 20 Pa, with a ratio of G' to G'' at 37° C. of about 4:1 to about 15:1; and / or iii) has a 50% degradation rate of 24 hours to 14 days.

[0081] In some embodiments, the method comprises the steps of: a) solubilized extracellular matrix; and b) exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix, the exogenous MBVs not expressing CD63 and CD81 or expressing CD63. lo CD81 lo and an extracellular matrix (ECM) hydrogel comprising MBV, wherein the MBV is at least about 1×10 per mL and does not contain alkaline phosphatase. The exogenous MBV is present in the ECM hydrogel at a concentration of less than 1 mg / mL. For example, the MBV is present in the ECM hydrogel at a concentration of at least about 1×10 per mL. 5 ~Approx. 1×10 20The composition may be present in a concentration of 0.01 to 0.15 particles. In some embodiments, the composition i) is shear thinning; ii) has a storage modulus (G') of about 50 Pa to about 200 Pa, and a loss modulus (G'') of about 5 Pa to about 20 Pa, with a ratio of G' to G'' at 37°C of about 4:1 to about 15:1; and iii) has a 50% degradation rate of 24 hours to 14 days. In some embodiments, the amount of solubilized ECM in the ECM hydrogel is between 1 mg / mL and 500 mg / mL. In some embodiments, the amount of solubilized ECM in the ECM hydrogel is from 1 mg / mL to 400 mg / mL, or from 1 mg / mL to 350 mg / mL, or from 1 mg / mL to 300 mg / mL, or from 1 mg / mL to 250 mg / mL, or from 1 mg / mL to 200 mg / mL, or from 1 mg / mL to 150 mg / mL, or from 1 mg / mL to 100 mg / mL, or from 1 mg / mL to 50 mg / mL, or from 5 mg / mL to 250 mg / mL, or from 20 mg / mL to 200 mg / mL, or from 5 mg / mL to 200 mg / mL, or from 5 mg / mL to 100 mg / mL. In further embodiments, the amount of solubilized ECM in the ECM hydrogel is between about 5 mg / ml and about 50 mg / ml, e.g., about 10 mg / ml to about 50 mg / ml, about 20 mg / ml to about 50 mg / ml, about 30 mg / ml to about 50 mg / ml, about 40 mg / ml to about 50 mg / ml, about 5 mg / ml to about 40 mg / ml, about 5 mg / ml to about 30 mg / ml, about 5 mg / ml to about 20 mg / mg, or about 5 mg / ml to about 10 mg / ml. The ECM hydrogel may contain solubilized ECM at a concentration of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 mg / ml. In one non-limiting example, the amount of solubilized ECM in the ECM hydrogel is between 10 mg / mL and 30 mg / mL. In one non-limiting example, the amount of solubilized ECM in the ECM hydrogel is between 4 mg / mL and 50 mg / mL.In some embodiments, the ECM in the ECM hydrogel or solubilized ECM is present at a concentration of about 5 to about 100 mg / mL, e.g., 50 to 100 mg / mL, 25 to 75 mg / mL, 60 to 80 mg / mL, 40 to 60 mg / mL, 50 to 80 mg / mL, or about 30 to about 60 mg / mL.

[0082] In some embodiments, exogenous MBVs are present in the ECM hydrogel at about 1 x 10 per mL. 5 ~Approx. 1×10 18 particles, e.g., about 1 x 10 per mL 5 ~Approx. 1×10 16 particles, e.g., about 1 x 10 per mL 5 ~Approx. 1×10 14 particles, or for example, about 1 x 10 per mL 5 ~Approx. 1×10 12 In some embodiments, the exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 6 ~Approx. 1×10 20 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 18 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 16 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 14 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 7 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 7 ~Approx. 1×10 11 particles, e.g., about 1 x 10 per mL 8 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 8 ~Approx. 1×10 11 particles, e.g., about 1 x 10 per mL 9 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 9 ~Approx. 1×10 11particles, e.g., about 1 x 10 per mL 10 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 10 ~Approx. 1×10 11 particles, e.g., about 1 x 10 per mL 11 ~Approx. 1×10 12 In one non-limiting example, exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 8 ~1×10 11 In one non-limiting example, exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 5 ~1×10 12 In one non-limiting example, exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 6 ~1×10 12 In some embodiments, the exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 6 pieces, about 1×10 7 pieces, about 1×10 8 pieces, about 1×10 9 pieces, about 1×10 10 pieces, about 1×10 11 pieces, about 1×10 12 pieces, about 1×10 14 pieces, about 1×10 16 pieces, about 1×10 18 pcs, or about 1×10 20 In other embodiments, the exogenous MBVs are present in the ECM hydrogel at a concentration of about 5×10 particles per mL. 6 pieces, about 5×10 7 pieces, about 5×10 8 pieces, about 5×10 9 pieces, about 5×10 10 pieces, about 5×10 11 Pieces, or about 5 x 10 12 In a specific, non-limiting example, the exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 11 In another non-limiting example, exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 12In a further non-limiting example, the exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 10 Approximately 1 x 10 particles or 1 mL 9 In some embodiments, the exogenous MBVs are present in the ECM hydrogel at a concentration of about 1 x 10 particles per mL. 6 ~1×10 18 particles, e.g., about 1×10 6 ~1×10 14 pieces, about 1×10 10 ~1×10 14 pieces, 1×10 12 ~1×10 18 pieces, 1×10 14 ~1×10 18 pcs or 1×10 10 ~1×10 18 In another non-limiting example, the exogenous MBV is present in the ECM hydrogel at a concentration of less than 1 mg / mL, e.g., ≦0.9 mg / mL, ≦0.8 mg / mL, ≦0.7 mg / mL, ≦0.6 mg / mL, ≦0.5 mg / mL, ≦0.4 mg / mL, ≦0.3 mg / mL, ≦0.2 mg / mL, ≦0.1 mg / mL, ≦90 μg / mL, ≦80 μg / mL, ≦70 μg / mL, ≦60 μg / mL, ≦50 μg / mL, ≦40 μg / mL, ≦30 μg / mL, ≦20 μg / mL, or ≦10 μg / mL, but greater than 0 μg / mL, e.g., greater than 0.1 μg / mL, or greater than 0.5 μg / mL, or greater than 1 μg / mL.

[0083] In some embodiments, the composition has a storage modulus (G') of about 50 Pa to about 200 Pa, e.g., about 75 Pa to about 200 Pa, about 100 Pa to about 200 Pa, about 125 Pa to about 200 Pa, about 150 Pa to about 200 Pa, about 175 Pa to about 200 Pa, about 50 Pa to about 75 Pa, about 50 to about 100 Pa, about 50 to about 125 Pa, about 50 to about 150 Pa, or about 50 to about 175 Pa. The composition may have a storage modulus of about 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 Pa. The composition may have a storage modulus of about 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 150-150, 150-160, 160-170, 170-180, 180-190, or 190-200 Pa.

[0084] In further embodiments, the composition has a loss modulus (G'') of about 5 Pa to about 20 Pa, e.g., about 10 Pa to about 20 Pa, about 15 to about 20 Pa, about 5 Pa to about 10 Pa, about 5 Pa to about 15 Pa. The composition can have a loss modulus of about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 Pa.

[0085] In further embodiments, the composition has a ratio of G' to G'' at 37° C. of about 4:1 to about 15:1. In some embodiments, the composition has a ratio of G' to G'' of about 4:1 to about 5:1, about 4:1 to about 6:1, about 4:1 to about 7:1, about 4:1 to about 8:1, about 4:1 to about 9:1, about 4:1 to about 10:1, about 4:1 to about 11:1, about 4:1 to about 12:1, about 4:1 to about 13:1, or about 4:1 to about 14:1. In other embodiments, the ratio of G' to G'' of the composition can be about 5:1 to about 15:1, about 6:1 to about 15:1, about 7:1 to about 15:1, about 8:1 to about 15:1, about 9:1 to about 15:1, about 10:1 to about 15:1, about 11:1 to about 15:1, about 12:1 to about 15:1, about 13:1 to about 15:1, or about 14:1 to about 15:1. The ratio of G' to G'' of the composition can be about 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, or 15:1.

[0086] In other embodiments, the compositions are shear thinning, and thus ease of delivery by injection is facilitated as the rate of injection (e.g., ml / sec) increases. In some non-limiting examples, the viscosity (expressed in Pa*sec) decreases as the shear rate (expressed in 1 / sec) increases.

[0087] In further embodiments, the composition has a 50% degradation rate of 24 hours to 14 days. The composition may have a 50% degradation rate of about 1 to about 13 days, about 1 to about 12 days, about 1 to about 11 days, about 1 to about 10 days, about 1 to about 9 days, about 1 to about 8 days, about 1 to about 7 days, about 1 to about 6 days, about 1 to about 5 days, about 1 to about 4 days, about 1 to about 3 days, or about 1 to about 2 days. The composition may have a 50% degradation rate of about 2 to about 14 days, about 3 to about 14 days, about 4 to about 14 days, about 5 to about 14 days, about 6 to about 14 days, about 7 to about 14 days, about 8 to about 14 days, about 9 to about 14 days, about 10 to about 14 days, about 11 to about 14 days, about 12 to about 14 days, or about 13 to about 14 days. The composition may have a 50% degradation rate of about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 01 day, about 11 days, about 12 days, about 13 days, or about 14 days. The release rate of MBV from the hydrogel after delivery to the anatomical site may depend on the degradation profile of the hydrogel, the anatomical site, and the degree of inflammation in the tissue.

[0088] In some embodiments, the ECM hydrogel can be an acoustic ECM hydrogel. Acoustic hydrogels suitable for use according to the present application are disclosed, for example, in PCT Publication No. WO2020 / 186082, which is incorporated herein by reference. In other embodiments, the ECM hydrogel can be an enzymatic ECM hydrogel. Enzymatic ECM hydrogels suitable for use according to the present application are disclosed, for example, in U.S. Patent No. 8,361,503, which is incorporated herein by reference in its entirety.

[0089] In another embodiment, an acidic solution comprising an exogenous acid protease and a solubilized extracellular matrix, e.g., a solubilized intact ECM; and exogenous MBV derived from the extracellular matrix, which do not express CD63 and CD81 or express CD63. lo CD81 lo and an exogenous MBV that does not contain alkaline phosphatase. The exogenous MBV is present in the composition in an amount of less than 1 mg / mL. For example, the MBV is present in the composition at about 1 x 10 per ml. 5 ~Approx. 1×10 20and the acidic solution forms a gel when neutralized to a pH between about 7.0 and about 7.8 at a temperature above 25° C. In some embodiments, the acidic protease is pepsin and / or trypsin. In some embodiments, the pH of the composition is less than 7.0.

[0090] In a further embodiment, a composition is disclosed that includes a solubilized extracellular matrix, e.g., intact ECM, digested with an acid protease, a non-activated exogenous acid protease, and exogenous MBV derived from the extracellular matrix. The MBV do not express CD63 and CD81 or express CD63. lo CD81 lo and does not contain alkaline phosphatase. These exogenous MBVs are present in the composition in an amount of less than 1 mg / mL. For example, MBVs are present in the composition at about 1 x 10 per ml. 5 ~Approx. 1×10 20 The composition is present in an amount of about 10000000000 particles. The composition enters a liquid phase at temperatures below 25°C and a gel phase at temperatures above 25°C and has a pH between 7 and 7.8, e.g., about 7.2 to about 7.8, about 7.3 to 7.8, 7.4 to 7.8, or about 7.5 to 7.8. The composition can have a pH of, e.g., about 7.2, about 7.3, about 7.4, about 7.5, or about 7.6. In some embodiments, the acid protease is pepsin and / or trypsin. In other embodiments, the composition has a pH of about 7.2. In further embodiments, the composition has a pH within the range of 7.2 to 7.4, e.g., about 7.2, 7.3, or 7.4.

[0091] In some embodiments, the amount of solubilized ECM in the compositions of the present disclosure is between 1 mg / mL and 500 mg / mL. In some embodiments, the amount of solubilized ECM in the compositions of the present disclosure is between 1 mg / mL and 400 mg / mL, or between 1 mg / mL and 350 mg / mL, or between 1 mg / mL and 300 mg / mL, or between 1 mg / mL and 250 mg / mL, or between 1 mg / mL and 200 mg / mL, or between 1 mg / mL and 150 mg / mL, or between 1 mg / mL and 100 mg / mL, or between 1 mg / mL and 50 mg / mL, or between 5 mg / mL and 250 mg / mL, or between 20 mg / mL and 200 mg / mL, or between 5 mg / mL and 200 mg / mL, or between 5 mg / mL and 100 mg / mL. In further embodiments, the amount of solubilized ECM in the compositions of the present disclosure is between about 5 mg / ml and about 50 mg / ml, e.g., about 10 mg / ml to about 50 mg / ml, about 20 mg / ml to about 50 mg / ml, about 30 mg / ml to about 50 mg / ml, about 40 mg / ml to about 50 mg / ml, about 5 mg / ml to about 40 mg / ml, about 5 mg / ml to about 30 mg / ml, about 5 mg / ml to about 20 mg / mg, or about 5 mg / ml to about 10 mg / ml. The compositions of the present disclosure may contain solubilized ECM at a concentration of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 mg / ml. In one non-limiting example, the amount of solubilized ECM in the compositions of the present disclosure is between 10 mg / mL and 30 mg / mL. In one non-limiting example, the amount of solubilized ECM in the compositions of the present disclosure is between 4 mg / mL and 50 mg / mL. In some embodiments, the ECM in the composition or solubilized ECM of the present disclosure is present at a concentration of about 5 to about 100 mg / mL, e.g., 50 to 100 mg / mL, 25 to 75 mg / mL, 60 to 80 mg / mL, 40 to 60 mg / mL, 50 to 80 mg / mL, or about 30 to about 60 mg / mL.

[0092] In some embodiments, exogenous MBV is present in a composition of the present disclosure at about 1×10 per mL. 5 ~Approx. 1×10 20 particles, e.g., about 1 x 10 per mL 5 ~Approx. 1×1018 particles, e.g., about 1 x 10 per mL 5 ~Approx. 1×10 16 particles, e.g., about 1 x 10 per mL 5 ~Approx. 1×10 14 particles, or for example, about 1 x 10 per mL 5 ~Approx. 1×10 12 In some embodiments, the exogenous MBV is present in the compositions of the present disclosure at a concentration of about 1 x 10 particles per mL. 6 ~Approx. 1×10 20 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 18 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 16 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 14 particles, e.g., about 1 x 10 per mL 6 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 7 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 7 ~Approx. 1×10 11 particles, e.g., about 1 x 10 per mL 8 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 8 ~Approx. 1×10 11 particles, e.g., about 1 x 10 per mL 9 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 9 ~Approx. 1×10 11 particles, e.g., about 1 x 10 per mL 10 ~Approx. 1×10 12 particles, e.g., about 1 x 10 per mL 10 ~Approx. 1×10 11 particles, e.g., about 1 x 10 per mL 11 ~Approx. 1×10 12 In one non-limiting example, the exogenous MBV is present in a composition of the present disclosure at a concentration of about 1 x 10 particles per mL. 8 ~1×10 11In one non-limiting example, the exogenous MBV is present in a composition of the present disclosure at a concentration of about 1 x 10 particles per mL. 5 ~1×10 12 In one non-limiting example, the exogenous MBV is present in a composition of the present disclosure at a concentration of about 1 x 10 particles per mL. 6 ~1×10 12 In some embodiments, the exogenous MBV is present in the compositions of the present disclosure at a concentration of about 1 x 10 particles per mL. 6 , 1×10 7 , 1×10 8 , 1×10 9 , 1×10 10 , 1×10 11 , 1×10 12 , 1×10 14 , 1×10 16 , 1×10 18 , or approximately 1 × 10 20 In other embodiments, the exogenous MBV is present in the compositions of the present disclosure at a concentration of about 5 x 10 particles per mL. 6 pieces, about 5×10 7 pieces, about 5×10 8 pieces, about 5×10 9 pieces, about 5×10 10 pieces, about 5×10 11 Pieces, or about 5 x 10 12 In a specific, non-limiting example, the exogenous MBV is present in the composition of the present disclosure at a concentration of about 1 x 10 particles per mL. 11 In another non-limiting example, the exogenous MBV is present in the composition of the present disclosure at a concentration of about 1 x 10 particles per mL. 12 In a further non-limiting example, the exogenous MBV is present in the composition of the present disclosure at a concentration of about 1 x 10 particles per mL. 10 Approximately 1 x 10 particles or 1 mL 9 In some embodiments, the exogenous MBV is present in the compositions of the present disclosure at a concentration of about 1 x 10 particles per mL. 6 ~1×10 18 particles, e.g., about 1×10 6 ~1×10 14 pieces, about 1×10 10 ~1×10 14 pieces, 1×1012 ~1×10 18 pieces, 1×10 14 ~1×10 18 pcs or 1×10 10 ~1×10 18 In another non-limiting example, the exogenous MBV is present in the ECM hydrogel at a concentration of less than 1 mg / mL, e.g., ≦0.9 mg / mL, ≦0.8 mg / mL, ≦0.7 mg / mL, ≦0.6 mg / mL, ≦0.5 mg / mL, ≦0.4 mg / mL, ≦0.3 mg / mL, ≦0.2 mg / mL, ≦0.1 mg / mL, ≦90 μg / mL, ≦80 μg / mL, ≦70 μg / mL, ≦60 μg / mL, ≦50 μg / mL, ≦40 μg / mL, ≦30 μg / mL, ≦20 μg / mL, or ≦10 μg / mL, but greater than 0 μg / mL, e.g., greater than 0.1 μg / mL, or greater than 0.5 μg / mL, or greater than 1 μg / mL.

[0093] In some embodiments, the ECM hydrogel or solubilized ECM of the composition of the present disclosure is derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In further embodiments, the ECM hydrogel or solubilized ECM of the composition of the present disclosure is derived from the urinary bladder matrix (UBM), small intestine submucosa (SIS), or urinary bladder submucosa (UBS). In further embodiments, the ECM hydrogel or solubilized ECM of the composition of the present disclosure is derived from a mammalian vertebrate selected from human, monkey, pig, cow, or sheep. In yet other embodiments, the ECM hydrogel or solubilized ECM of the composition of the present disclosure is derived from a non-human mammal. In some embodiments, the ECM hydrogel or solubilized ECM of the composition of the present disclosure is not derived from a UBM.

[0094] In some embodiments, the MBVs do not express CD63 and CD81 or do not express CD63 lo CD81 loand the MBVs do not contain detectable alkaline phosphatase. In some embodiments, expression of CD63, CD81, and / or CD9 cannot be detected in the MBVs. Thus, in some embodiments, the MBVs do not express CD63 and / or CD81 and / or CD9. In one specific example, CD63, CD81, and CD9 cannot be detected in the nanovesicles. In other embodiments, the MBVs have barely detectable levels of CD63, CD81, and CD9, such as those detectable by Western blot. These MBVs do not express CD63, CD81, and CD9. lo CD81 lo CD9 lo In other embodiments, the MBV does not express detectable levels of one or more of CD63, CD81, or CD9. In further embodiments, the MBV does not contain detectable alkaline phosphatase, osteopontin, osteoprotegerin, complement C5, and / or c-reactive protein.

[0095] In further embodiments, the MBV, e.g., exogenous MBV, is derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, and / or esophagus. In further embodiments, the MBV, e.g., exogenous MBV, is derived from the extracellular matrix of the bladder, small intestine, dermis, liver, kidney, uterus, brain, blood vessel, lung, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, and / or esophagus. In specific, non-limiting examples, the MBV, e.g., exogenous MBV, is derived from the urinary bladder matrix (UBM), small intestine submucosa (SIS), or urinary bladder submucosa (UBS). In one embodiment, the MBV, e.g., exogenous MBV, is derived from the dermis. In another embodiment, the MBV, e.g., exogenous MBV, is derived from the UBM. In further embodiments, the MBV, e.g., exogenous MBV, is derived from an extracellular matrix from a mammalian vertebrate selected from human, monkey, pig, cow, or sheep. In specific, non-limiting examples, the MBV, e.g., exogenous MBV, is derived from a non-human mammal. In some embodiments, the MBV, e.g., exogenous MBV, is not derived from bone ECM. In some embodiments, the MBV, e.g., exogenous MBV, is not derived from heart (cardiac) ECM. In some embodiments, the MBV, e.g., exogenous MBV, is not derived from heart (cardiac) ECM or bone ECM.

[0096] In some embodiments, the composition may include pulverized ECM, hi other embodiments, the composition may include trehalose.

[0097] The compositions of the present disclosure can be formulated for external administration. These external compositions are useful for treating inflammation. For example, the compositions of the present disclosure can be used to treat inflammation of the esophagus, such as esophagitis or esophageal ulcers. In one embodiment, the compositions of the present disclosure are applied externally to coat esophageal tissue. The compositions of the present disclosure can be used to treat anal fistula. The compositions of the present disclosure can be used as submucosal cushions.

[0098] Disclosed herein are methods for treating a subject with inflammatory bowel disease or esophageal inflammation. These methods include administering an effective amount of the disclosed composition to the affected organ of the subject, thereby treating inflammatory bowel disease or esophageal inflammation in the subject. In some aspects, the subject has inflammatory bowel disease, and the affected organ is the intestine. In other aspects, the subject has ulcerative colitis, and the affected organ is the colon. In further aspects, the subject has esophageal inflammation, and the affected organ is the esophagus. In some non-limiting examples, the subject is a human.

[0099] The compositions can also be used to treat inflammation in the throat or stomach or promote wound healing by topically applying the compositions disclosed herein to the throat or stomach of a subject suffering from throat or stomach inflammation or wounds, such as gastric or throat ulcers. The compositions can be topically applied by enteral administration, for example, by mouth, or by application by surgical procedures, for example, using a catheter or endoscope, or by injection to achieve local administration to the site of inflammation, ulcer, or wound.

[0100] Matrix-bound nanovesicles derived from extracellular matrix (ECM) Nanovesicles derived from ECM (also referred to as matrix-bound nanovesicles, "MBVs") are generally described in PCT Publication Nos. WO2017 / 151862, WO2018 / 204848, and WO2019 / 213482, which are incorporated herein by reference. It has been disclosed that MBVs are embedded in extracellular matrix. These MBVs can be isolated and are biologically active. MBVs do not express CD63 and CD81 or express CD63. lo CD81 lo and does not contain alkaline phosphatase. The MBV may contain IL-33. These MBVs can be used for therapeutic purposes. In some embodiments, the MBV does not contain alkaline phosphatase, osteopontin, osteoprotegerin, complement C5, and / or c-reactive protein.

[0101] Extracellular matrix is ​​a complex mixture of structural and functional biomolecules and / or biopolymers, including but not limited to structural proteins, specialized proteins, proteoglycans, glycosaminoglycans and growth factors, that surrounds and supports cells in mammalian tissues and is acellular unless otherwise specified. In general, the disclosed MBVs are embedded in any type of extracellular matrix (ECM) and can be isolated from this location. Thus, MBVs are not detachably present on the surface of ECM and are not exosomes (also known as extracellular vesicles or EVs).

[0102] Extracellular matrices can be prepared by any of the methods described, for example and without limitation, in U.S. Pat. Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,41 4; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273; 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666. However, ECM can be produced from any tissue or from any in vitro source in which the ECM is produced by cultured cells and contains one or more polymeric components of native ECM. ECM preparations can be considered "decellularized" or "acellular," meaning that cells have been removed from the source tissue or culture.

[0103] In some embodiments, the ECM is isolated from a vertebrate, for example, from a mammalian vertebrate, including but not limited to, human, monkey, pig, cow, sheep, etc. The ECM can be derived from any organ or tissue, including, but not limited to, the bladder, intestine (e.g., small intestine or large intestine), heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus. In specific, non-limiting examples, the extracellular matrix is ​​isolated from esophageal tissue, bladder (e.g., bladder matrix or bladder submucosa), small intestinal submucosa, dermis, umbilical cord, pericardium, cardiac tissue, or skeletal muscle. The ECM can include any part or tissue obtained from an organ, including, for example, but not limited to, submucosa, epithelial basement membrane, lamina propria, etc. In one non-limiting embodiment, the ECM is isolated from the bladder. In some embodiments, the ECM is derived from a human subject. In other embodiments, the ECM is derived from a porcine subject. In some embodiments, the ECM is not porcine ECM. In some embodiments, the ECM is not porcine UBM.

[0104] The ECM may or may not include a basement membrane. In another non-limiting embodiment, the ECM includes at least a portion of a basement membrane. The ECM material may or may not retain some of the cellular elements that made up the original tissue, such as capillary endothelial cells or fibrocytes. In some embodiments, the ECM contains both basement membrane and non-basement membrane surfaces.

[0105] In some embodiments, ECM is collected from porcine bladder (also known as urinary bladder matrix or UBM). Briefly, ECM is prepared by removing bladder tissue from a mammal, such as a pig, and trimming any remaining external connective tissue, including adipose tissue. Any residual urine is removed by repeated rinsing with tap water. The tissue is delaminated by first immersing the tissue in a de-epithelialization solution, such as, but not limited to, hypertonic saline (e.g., 1.0 N saline), for a period ranging from 10 minutes to 4 hours. Exposure to the hypertonic saline solution removes the epithelial cells from the underlying basement membrane. Optionally, a calcium chelator can be added to the saline solution. The tissue remaining after the initial delamination procedure includes the epithelial basement membrane and the tissue layer abluminal to the epithelial basement membrane. The relatively fragile epithelial basement membrane is inevitably damaged and removed by any mechanical abrasion at the luminal surface. The tissue is then subjected to further processing to remove most of the abluminal tissue but maintain the epithelial basement membrane and lamina propria. The outer serosa, adventitia, tunica muscularis mucosa, tunica submucosa and most of the muscularis mucosa are removed from the remaining de-epithelialized tissue by mechanical scraping or by a combination of enzymatic treatments (e.g., using trypsin or collagenase) followed by hydration and scraping. Mechanical removal of these tissues is accomplished by, for example and without limitation, removal of the mesenteric tissue with Adson-Brown forceps and Metzenbaum scissors and wiping of the muscularis and submucosa using a longitudinal wiping motion with a scalpel handle or other firm object wrapped in moist gauze. Automated robotic procedures involving cutting blades, lasers and other tissue separation methods are also contemplated. After these tissues are removed, the resulting ECM will consist primarily of the epithelial basement membrane and underlying lamina propria.

[0106] In another embodiment, ECM is prepared by scraping porcine bladder tissue to remove the outer layers, including both the serosa and muscularis, using a longitudinal wiping motion with a scalpel handle and moistened gauze. After eversion of the tissue segment, the same wiping motion is used to delaminate the luminal portion of the mucosa from the underlying tissue. Care is taken to prevent perforation of the submucosa. After these tissues are removed, the resulting ECM is primarily from the submucosa (see FIG. 2 of U.S. Pat. No. 9,277,999, incorporated herein by reference).

[0107] ECM can also be prepared as a powder. Such powder can be made according to the method of Gilbert et al., Biomaterials vol. 26 (2005) pp. 1431-1435, the entirety of which is incorporated herein by reference. For example, UBM sheets can be freeze-dried and then chopped into small sheets for immersion in liquid nitrogen. The flash-frozen material is then finely ground to make the particles small enough to be placed in a rotary knife mill, where the ECM is powdered. Similarly, the NaCl in the ECM tissue can be precipitated to break the material into uniformly sized particles, which can be flash-frozen, freeze-dried, and powdered.

[0108] In one non-limiting embodiment, the ECM is derived from small intestinal submucosa or SIS. Commercially available preparations include, but are not limited to, SURGISIS™, SURGISIS-ES™, STRATASIS™, and STRATASIS-ES™ (Cook Urological Inc.; Indianapolis, Ind.) and GRAFTPATCH™ (Organogenesis Inc.; Canton Mass.). In another non-limiting embodiment, the ECM is derived from the dermis. Commercially available preparations include, but are not limited to, PELVICOL™ (sold as PERMACOL™ in Europe; Bard, Covington, Ga.), REPLIFORM™ (Microvasive; Boston, Mass.), and ALLODERM™ (LifeCell; Branchburg, NJ). In another embodiment, the ECM is derived from the urinary bladder. Commercially available preparations include, but are not limited to, UBM (ACell Corporation; Jessup, Md.).

[0109] MBVs can be obtained (released) from the extracellular matrix using the methods disclosed below. For example, MBVs can be obtained from the extracellular matrix according to the methods disclosed in US Patent Application Publication No. 2019 / 0117837, the contents of which are incorporated herein by reference for all purposes. In some embodiments, the ECM is digested with enzymes such as pepsin, collagenase, elastase, hyaluronidase, and / or proteinase K to isolate the MBVs. In other embodiments, the MBVs are released and separated from the ECM by changing the pH of the solution, such as glycine HCL, citric acid, ammonium hydroxide, by the use of chelating agents, including but not limited to EDTA, EGTA, etc., by ionic strength and / or chaotropic effects by the use of salts, including but not limited to potassium chloride (KCl), sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, etc., or by exposing the ECM to denaturing conditions such as guanidine HCl or urea.

[0110] The MBVs may be derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, and / or esophagus. In specific, non-limiting examples, the MBVs are derived from the urinary bladder matrix (UBM), small intestine submucosa (SIS), or urinary bladder submucosa (UBS). In one embodiment, the MBVs are derived from the dermis. In another embodiment, the MBVs are derived from the UBM. In further embodiments, the MBVs are derived from an extracellular matrix from a mammalian vertebrate selected from human, monkey, pig, cow, or sheep. In specific, non-limiting examples, the MBVs are derived from a non-human mammal. In some embodiments, the MBVs are not derived from bone ECM. In some embodiments, the MBVs are not derived from heart (cardiac) ECM. In some embodiments, the MBVs are not derived from heart (cardiac) ECM or bone ECM. In certain embodiments, the MBVs are prepared following digestion of the ECM with enzymes such as pepsin, elastase, hyaluronidase, proteinase K, saline, and / or collagenase, or combinations thereof. The ECM can also be freeze-thawed or subjected to mechanical degradation.

[0111] In some embodiments, the expression of CD63, CD81, and / or CD9 cannot be detected in the MBVs. Thus, in some embodiments, the MBVs do not express CD63 and / or CD81 and / or CD9. In one specific example, CD63, CD81, and CD9 cannot be detected in the nanovesicles. In other embodiments, the MBVs have barely detectable levels of CD63, CD81, and CD9, such as those detectable by Western blot. These MBVs do not express CD63 lo CD81 lo CD9 lo In other embodiments, the MBV does not express one or more of CD63, CD81, or CD9 at detectable levels. In other embodiments, the MBV expresses one or more of CD63, CD81, or CD9 at barely detectable levels. Those skilled in the art will recognize that CD63 loand / or CD81 lo and / or CD9 lo MBVs that are specific for CD63, CD81, and CD9 can be easily identified, for example, using antibodies that specifically bind CD63, CD81, and CD9. Low levels of these markers can be established using procedures such as fluorescence-activated cell sorting (FACS) and fluorescently labeled antibodies to determine thresholds for low and high amounts of CD63, CD81, and CD9. Because MBVs are bound to ECM in vivo and are not found in biological fluids, the MBVs of the present disclosure are different from nanovesicles such as exosomes that may be transiently attached to the surface of ECM due to their presence in biological fluids.

[0112] MBVs have a unique phospholipid content, for example, compared to exosomes. In some embodiments, the total phospholipid content of MBVs is at least 50%, 55%, 60%, 65%, 70%, 75%, 85%, or 90%, or about 50%-90%, 50%-65%, 50%-60%, 50%-70%, 60%-70%, 60%-90%, or 70%-90% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In specific embodiments, the total phospholipid content of MBVs is at least 55% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In specific embodiments, the total phospholipid content of MBVs is at least 60% of a combination of phosphatidylcholine (PC) and phosphatidylinositol (PI). In some embodiments, the phospholipid content of the MBV comprises a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of less than 8:1 (e.g., less than 7:1, less than 6:1, less than 5:1, less than 4:1, less than 3:1, or less than 2:1). In some embodiments, the phospholipid content of the MBV comprises a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) within the range of 0.5-1:1, or within the range of 1:0.5-1, or within the range of 0.5-1:2, or within the range of 2:0.5-1, or within the range of 0.8-1:1, or within the range of 1:0.8-1. In one embodiment, the phospholipid content of the MBV comprises a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of about 1:1. In a specific embodiment, the phospholipid content of the MBVs is comprised in a ratio of phosphatidylcholine (PC) to phosphatidylinositol (PI) of about 0.9:1.

[0113] In some embodiments, the total phospholipid content of the MBV is 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4% or less, or about 5%-10%, 5%-15%, 10%-15%, or 8%-12% sphingomyelin (SM). In specific embodiments, the total phospholipid content of the MBV is 10% or less sphingomyelin (SM). In some embodiments, the total phospholipid content of the MBV is 15% or less sphingomyelin (SM), 14% or less sphingomyelin, 13% or less sphingomyelin, 12% or less sphingomyelin, 11% or less sphingomyelin, 10% or less sphingomyelin, 9% or less sphingomyelin, 8% or less sphingomyelin, 7% or less sphingomyelin, 6% or less sphingomyelin, 5% or less sphingomyelin, or 4% or less sphingomyelin.

[0114] In some embodiments, the total phospholipid content of the MBV is 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, or 10% or less, or about 10%-20%, 15%-20%, 14%-18%, or 12%-16% phosphatidylethanolamine (PE). In specific embodiments, the total phospholipid content of the MBV is 20% or less phosphatidylethanolamine (PE).

[0115] In some embodiments, the total phospholipid content of the MBV is 5%, 10%, 12%, 15%, 18%, 20%, 25%, or 30% or more, or is about 5%-30%, 10%-20%, 10-25%, 15%-25%, or 12%-18% phosphatidylinositol (PI). In specific embodiments, the MBV comprises a phospholipid content of 15% or more phosphatidylinositol (PI).

[0116] In a specific embodiment, the total phospholipid content of the MBV comprises 15% or more phosphatidylinositol, 20% or less phosphatidylethanolamine, and 10% or less sphingomyelin. In a specific embodiment, the total phospholipid content of the MBV is 15% or more phosphatidylinositol and 20% or less phosphatidylethanolamine. In a specific embodiment, the total phospholipid content of the MBV is 15% or more phosphatidylinositol and 10% or less sphingomyelin. In a specific embodiment, the total phospholipid content of the MBV comprises 20% or less phosphatidylethanolamine and 10% or less sphingomyelin. In a specific embodiment, the total phospholipid content of the MBV is greater than 15% phosphatidylinositol, less than 20% phosphatidylethanolamine, less than 10% sphingomyelin, and at least 55% combination of phosphatidylinositol and phosphatidylcholine. In one embodiment, the total phospholipid content of the MBV is at least 55% combination of phosphatidylcholine (PC) and phosphatidylinositol (PI) and less than 10% sphingomyelin (SM). In a specific embodiment, the total phospholipid content of the MBV is at least 55% combination of phosphatidylinositol and phosphatidylcholine and greater than 15% phosphatidylinositol. In a specific embodiment, the total phospholipid content of the MBV is 55% combination of phosphatidylinositol and phosphatidylcholine and less than 20% phosphatidylethanolamine.

[0117] MBV may also contain lysyl oxidase (Lox). In general, nanovesicles derived from ECM have higher Lox content than exosomes. Lox is expressed on the surface of MBV. Nano-LC MS / MS proteomics analysis can be used to detect Lox protein. Quantification of Lox can be performed (see, for example, Hill RC, et al., Mol Cell Proteomics. 2015; 14 (4): 961-73, the entirety of which is incorporated herein by reference).

[0118] In certain embodiments, the MBV comprises one or more miRNAs. In a specific, non-limiting example, the MBV comprises one, two, or all three of miR-143, miR-145, and miR-181. MiR-143, miR-145, and miR-181 are known in the art.

[0119] The miR-145 nucleic acid sequence is provided in MiRbase Accession No. MI0000461, which is incorporated herein by reference. The miR-145 nucleic acid sequence is CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU (SEQ ID NO: 1). The miR-181 nucleic acid sequence is provided in miRbase Accession No. MI0000269, which is incorporated herein by reference. The miR-181 nucleic acid sequence is AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA (SEQ ID NO: 2). The miR-143 nucleic acid sequence is provided in NCBI Accession No. NR_029684.1, March 30, 2018, which is incorporated herein by reference. The DNA encoding the miR-143 nucleic acid sequence is GCGCAGCGCC CTGTCTCCCA GCCTGAGGTG CAGTGCTGCA TCTCTGGTCA GTTGGGAGTC TGAGATGAAG CACTGTAGCT CAGGAAGAGA GAAGTTGTTC TGCAGC (SEQ ID NO: 3).

[0120] After administration, MBV maintains the expression of F4 / 80 (a macrophage marker) and CD-11b in the subject's macrophages. Nanovesicle-treated macrophages are predominantly F4 / 80+Fizz1+, indicating an M2 phenotype.

[0121] The MBV disclosed herein can be formulated into a composition for pharmaceutical delivery. MBV is further disclosed and described in PCT Publication No. WO2017 / 151862, which is incorporated herein by reference.

[0122] Isolation of MBVs from ECM To produce MBV, the ECM can be produced by any cell of interest or from a commercial source, as described above. The MBV can be produced from the same species as the subject being treated, or from a different species. In some embodiments, the methods include digesting the ECM with an enzyme to produce a digested ECM. In a specific embodiment, the ECM is digested with one or more of pepsin, elastase, hyaluronidase, collagenase, metalloproteinase, and / or proteinase K, or a combination thereof. In a specific, non-limiting example, the ECM is digested with elastase and / or metalloproteinase only. In another non-limiting example, the ECM is not digested with collagenase and / or trypsin and / or proteinase K. In other embodiments, the ECM is treated with a detergent. In a further embodiment, the method does not include the use of enzymes. In a specific, non-limiting example, the method utilizes chaotropic agents or ionic strength, such as salts, such as potassium chloride, to isolate MBVs. In additional embodiments, the ECM can be manipulated to increase MBV content prior to MBV isolation. Techniques for isolating MBVs from ECM are described, for example, in US Patent Publication No. 2019 / 0117837, the contents of which are incorporated herein by reference for all purposes. Techniques for isolating MBVs are also disclosed in Quijano et al., Tissue Eng Part C Methods. 2020 Oct; 26 (10): 528-540, also incorporated herein by reference.

[0123] In some embodiments, the ECM is enzymatically digested. The ECM can be enzymatically digested for about 12 to about 48 hours, such as about 12 to about 36 hours. The ECM can be enzymatically digested for about 12, about 24, about 36, or about 48 hours. In one specific, non-limiting example, the ECM is enzymatically digested at room temperature. However, digestion can be performed at about 4° C. or any temperature between about 4° C. and 25° C. In general, the ECM is enzymatically digested for any length of time and at any temperature sufficient to remove collagen fibrils. The digestion process can vary depending on the tissue source. Optionally, the ECM is treated by freezing and thawing either before or after enzymatic digestion. The ECM can be treated with detergents, including ionic detergents and / or nonionic detergents.

[0124] The digested ECM is then processed, such as by centrifugation, to isolate a fibril-free supernatant. In some embodiments, the digested ECM is centrifuged, for example, at about 300 to about 1000 g for the first step. Thus, the digested ECM can be centrifuged at about 400 g to about 750 g, such as about 400 g, about 450 g, about 500 g, or about 600 g. This centrifugation can be carried out for about 10 to about 15 minutes, such as about 10, about 11, about 12, about 14, about 14, or about 15 minutes, such as about 10 to about 12 minutes. The supernatant containing the digested ECM is collected.

[0125] In some aspects, the MBVs comprise Lox. In some aspects, methods for isolating such MBVs include digesting extracellular matrix with elastase and / or metalloproteinase to produce digested extracellular matrix, centrifuging the digested extracellular matrix to remove collagen fibril remnants, thereby producing a fibril-free supernatant, centrifuging the fibril-free supernatant to isolate solid material, and suspending the solid material in a carrier.

[0126] In some embodiments, the digested ECM can also be centrifuged at about 2000 g to about 3000 g for the second step. Thus, the digested ECM can be centrifuged at about 2,500 g to about 3,000 g, such as about 2,000 g, 2,500 g, 2,750 g, or 3,000 g. This centrifugation can be carried out for about 20 to about 30 minutes, such as about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or about 30 minutes, such as about 20 to about 25 minutes. The supernatant containing the digested ECM is collected.

[0127] In additional embodiments, the digested ECM can be centrifuged at about 10,000 to about 15,000 g for the third step. Thus, the digested ECM can be centrifuged at about 10,000 g to about 12,500 g, such as about 10,000 g, 11,000 g, or 12,000 g. This centrifugation can be performed for about 25 to about 30 minutes, such as about 25, about 26, about 27, about 28, about 29, about 30, about 31, about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, or about 40 minutes. The supernatant containing the digested ECM is collected. One, two, or all three of these centrifugation steps can be utilized independently. In some embodiments, all three centrifugation steps are utilized. The centrifugation steps can be repeated, such as 2, 3, 4, or 5 times. In one embodiment, all three centrifugation steps are repeated three times.

[0128] In some embodiments, the digested ECM is centrifuged at about 500g for about 10 minutes, at about 2,500g for about 20 minutes, and / or at about 10,000g for about 30 minutes. These step(s) are repeated 2, 3, 4, or 5 times, such as three times, such as all three steps. Thus, in one non-limiting example, the digested ECM is centrifuged at about 500g for about 10 minutes, at about 2,500g for about 20 minutes, and at about 10,000g for about 30 minutes. These three steps are repeated three times. This produces a fibril-free supernatant. The fibril-free supernatant is then centrifuged to isolate the MBVs. In some embodiments, the fibril-free supernatant is centrifuged at about 100,000g to about 150,000g. Thus, the fibril-free supernatant is centrifuged at about 100,000g to about 125,000g, such as about 100,000g, about 105,000g, about 110,000g, about 115,000g or about 120,000g. This centrifugation can be carried out for about 70 to about 80 minutes, such as about 60, about 65, about 70, about 75, about 80, about 85 or about 90 minutes. In one non-limiting example, the fiber-free supernatant is centrifuged at about 100,000g for about 70 minutes. The solid material, which is the MBV, is collected. Such MBVs can then be resuspended in any desired carrier, including but not limited to a buffer.

[0129] In further embodiments, the ECM is not digested with enzymes. In such methods, the ECM is suspended in an isotonic saline solution, such as phosphate buffered saline. Salt is then added to the suspension such that the final concentration of salt is greater than about 0.1M. The concentration can be, for example, up to about 3M, such as about 0.1M salt to about 3M or about 0.1M to about 2M. The salt can be, for example, about 0.1M, 0.15M, 0.2M, 0.3M, 0.4M, 0.7M, 0.6M, 0.7M, 0.8M, 0.9M, 1.0M, 1.1M, 1.2M, 1.3M, 1.4M, 1.5M, 1.6M, 1.7M, 1.8M, 1.9M, or 2M. In some non-limiting examples, the salt is potassium chloride, sodium chloride, or magnesium chloride. In other embodiments, the salt is sodium chloride, magnesium chloride, sodium iodide, sodium thiocyanate, a sodium salt, a lithium salt, a cesium salt, or a calcium salt.

[0130] In some embodiments, the ECM is suspended in the salt solution for about 10 minutes to about 2 hours, such as about 15 minutes to about 1 hour, about 30 minutes to about 1 hour, or about 45 minutes to about 1 hour. The ECM can be suspended in the salt solution for about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 120 minutes. The ECM can be suspended in the salt solution at a temperature of 4°C to about 50°C, including, but not limited to, about 4°C to about 25°C or about 4°C to about 37°C. In a specific, non-limiting example, the ECM is suspended in the salt solution at about 4°C. In another specific, non-limiting example, the ECM is suspended in the salt solution at about 22°C or about 25°C (room temperature). In a further non-limiting example, the ECM is suspended in a salt solution at about 37°C.

[0131] In some aspects, the method includes the steps of incubating the extracellular matrix at a salt concentration greater than about 0.4 M; centrifuging the digested extracellular matrix to remove collagen fibril remnants and isolating the supernatant; centrifuging the supernatant to isolate the solid material; and suspending the solid material in a carrier, thereby isolating the MBVs from the extracellular matrix.

[0132] After incubation in the salt solution, the ECM is centrifuged to remove collagen fibrils. In some embodiments, the digested ECM can be centrifuged at about 2000 g to about 5000 g. Thus, the digested ECM can be centrifuged at about 2,500 g to about 4,500 g, such as about 2,500 g, about 3,000 g, 3,500, about 4,000 g, or about 4,500 g. In a specific, non-limiting example, the centrifugation is at about 3,500 g. This centrifugation can be performed for about 20 to about 40 minutes, such as about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33, about 34, or about 35 minutes, such as about 25 to about 35 minutes. The supernatant is then collected.

[0133] In additional embodiments, the supernatant can then be centrifuged at about 100,000 to about 150,000 g for the third step. Thus, the digested ECM can be centrifuged at about 100,000 g to about 125,000 g, such as about 100,000 g, 110,000 g, or 120,000 g. This centrifugation can be carried out for about 1 hour to about 3 hours, for example, about 30 minutes to about 2.5 hours, such as about 30 minutes, about 45 minutes, about 60 minutes, about 90 minutes, or about 120 minutes (2 hours). The solid material is collected and suspended in a solution, such as buffered saline, thereby isolating the MBVs.

[0134] In yet other embodiments, the ECM is suspended in an isotonic buffered salt solution, such as, but not limited to, phosphate buffered saline. Centrifugation or other methods can be used to remove large particles (see below). Ultrafiltration is then used to isolate the MBVs from the ECM, the particles being between about 10 nm and about 10,000 nm, such as between about 10 nm and about 300 nm, such as between about 10 and about 1,000 nm.

[0135] In a specific, non-limiting example, the isotonic buffered saline solution has a total salt concentration of about 0.164 mM and a pH of about 7.2 to about 7.4. In some embodiments, the isotonic buffered saline solution contains 0.002 M KCl to about 0.164 M KCL (the concentration of KCL in phosphate buffered saline), such as about 0.0027 M KCl. The suspension is then processed by ultracentrifugation.

[0136] After incubation in the isotonic buffered salt solution, the ECM is centrifuged to remove collagen fibrils. In some embodiments, the digested ECM can be centrifuged at about 2000 g to about 5000 g. Thus, the digested ECM can be centrifuged at about 2,500 g to about 4,500 g, such as about 2,500 g, about 3,000 g, 3,500, about 4,000 g, or about 4,500 g. In one specific, non-limiting example, the centrifugation is at about 3,500 g. The centrifugation can be performed for about 20 to about 40 minutes, such as about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 minutes, about 31, about 32, about 33, about 34, or about 35 minutes, such as about 25 to about 35 minutes.

[0137] Microfiltration and centrifugation can be used and combined to remove large molecular weight materials from the suspension. In one embodiment, large size molecular materials, such as over 200 nm, are removed using microfiltration. In another embodiment, large size materials are removed by using centrifugation. In a third embodiment, both microfiltration and ultracentrifugation are used to remove large molecular weight materials. Large molecular weight materials, such as materials over about 10,000 nm, over about 1,000 nm, over about 500 nm, or over about 300 nm, are removed from the suspended ECM.

[0138] The effluent or supernatant of the microfiltration is then subjected to ultrafiltration. Thus, the effluent containing particles less than about 10,000 nm, less than about 1,000 nm, less than about 500 nm, or less than about 300 nm is collected and utilized. This effluent is then subjected to ultrafiltration with a membrane having a molecular weight cutoff (MWCO) of 3,000 to 100,000. In this example, a 100,000 MWCO was used.

[0139] Preparation of extracellular matrix (ECM) hydrogel Any type of extracellular matrix can be used to produce mammalian ECM hydrogels (see U.S. Patent Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; 5,866,414, etc., relating to ECM). (see, for example, US Pat. Nos. 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273; 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666). In certain embodiments, the ECM is isolated from a vertebrate, such as, but not limited to, a mammal, including, but not limited to, a human, monkey, horse, pig, cow, and sheep. In a specific, non-limiting example, the ECM is porcine.

[0140] The ECM can be derived from any organ or tissue, including, but not limited to, the bladder, intestine (such as the small or large intestine), heart, kidney, uterus, brain, blood vessels, lung, bone, muscle, pancreas, stomach, spleen, adipose tissue, liver, esophagus, and dermis. The ECM can be obtained from cell culture. In one embodiment, the ECM is isolated from the bladder. In another embodiment, the ECM is derived from the esophagus. In another embodiment, the ECM is derived from the dermis. In another embodiment, the ECM is derived from the small intestinal submucosa (SIS). The ECM may or may not include the basement membrane portion of the ECM. In certain embodiments, the ECM includes at least a portion of the basement membrane. To produce the ECM, the tissue can be decellularized to remove cells and cellular material, for example, from the source tissue or organ. When the ECM is implanted into a subject, for example as a hydrogel component as disclosed herein, it is desirable to use decellularized material to prevent immune response. Removal of cellular material, such as when ECM is used to form a hydrogel, prevents such immune responses.

[0141] U.S. Patent No. 8,361,503 (incorporated herein by reference in its entirety for all purposes) discloses the preparation of bladder ECM, such as porcine bladder ECM, prepared by scraping bladder tissue and removing the outer layers, including both the serosa and muscularis, using a longitudinal wiping motion with a scalpel handle and moistened gauze. After eversion of the tissue segments, the same wiping motion is used to delaminate the luminal portion of the mucosa from the underlying tissue. In some embodiments, care is taken to prevent perforation of the submucosa. After these tissues are removed, the resulting ECM is primarily from the submucosa.

[0142] The production of hydrogels from skin ECM is disclosed in Wolf et al., Biomaterials 33: 7028-7038, 2012, which is incorporated herein by reference. The production of ECM from esophageal tissue is disclosed, for example, in Badylak et al. J Pediatr Surg. 35 (7): 1097-103, 2000 and Badylak et al., J Surg Res. 2005 September; 128 (1): 87-97, 2005, which are both incorporated herein by reference. U.S. Patent No. 6,893,666, which is incorporated herein by reference, discloses the production of ECM from the bladder, skin, esophagus and small intestine. ECM may be produced from any of these tissues.

[0143] Commercially available ECM preparations can also be used. In one embodiment, the ECM is derived from small intestinal submucosa or SIS. Commercially available preparations include, but are not limited to, SURGISIS™, SURGISIS-ES™, STRATASIS™, and STRATASIS-ES™ (Cook Urological Inc.; Indianapolis, Ind.) and GRAFTPATCH™ (Organogenesis Inc.; Canton Mass.). In another embodiment, the ECM is derived from the dermis. Commercially available preparations include, but are not limited to, PELVICOL™ (sold as PERMACOL™ in Europe; Bard, Covington, Ga.), REPLIFORM™ (Microvasive; Boston, Mass.), and ALLODERM™ (LifeCell; Branchburg, NJ). In another embodiment, the ECM is derived from the urinary bladder. Commercially available preparations include, but are not limited to, UBM (Acell Corporation; Jessup, Md.).

[0144] Tissues for preparing ECM can be collected in a variety of ways, and once collected, various parts of the collected tissue can be used. ECM has also been prepared from the esophagus and small intestine, see, for example, Keane et al., Tissue Eng. Part A, 21(17-18): 2293-2300, 2015, which is incorporated herein by reference. Esophageal ECM can be prepared by mechanically separating the mucosa and submucosa from the muscularis externa, digesting the mucosa with a buffer containing trypsin, followed by exposure to sucrose, TRITON®-X100®, deoxycholic acid, peracetic acid, and DNAse. Small intestinal submucosa (SIS) can be prepared from intact small intestine by mechanically removing the superficial layer of mucosa, serosa, and muscularis externa, leaving the submucosa, muscularis mucosa, and stratum densa basalis intact. The SIS is then treated with peracetic acid. Exemplary protocols are provided in Keane et al. Skin hydrogels can be produced, for example, as disclosed in Wolf et al, J Biomed Mater Res A. 2013. 35 (25): 6838-49. PMID:23873846. PMCID:3808505, which is incorporated herein by reference.

[0145] In one embodiment, ECM is isolated from harvested porcine bladders to prepare urinary bladder matrix (UBM). Excess connective tissue and residual urine are removed from the bladder. The serosa, muscularis externa, submucosa, and most of the muscularis mucosa can be removed by mechanical scraping or by a combination of enzyme treatment, hydration, and scraping. Mechanical removal of these tissues can be achieved by scraping using a longitudinal wiping motion to remove the outer layer (particularly the abluminal smooth muscle layer) and even the luminal portion of the mucosa (the epithelial layer). Mechanical removal of these tissues can be achieved, for example, by removal of the mesenteric tissue with Adson-Brown forceps and Metzenbaum scissors, and wiping of the muscularis and submucosa using a longitudinal wiping motion with a scalpel handle or other rigid object wrapped in moist gauze. Epithelial cells of the mucosa can also be dissociated by immersing the tissue in a de-epithelialization solution, for example, but not limited to, hypertonic saline. The resulting UBM, which contains the basement membrane of the mucosa and the adjacent lamina propria, is further treated with peracetic acid, lyophilized, and powdered (see U.S. Patent No. 8,361,503, incorporated herein by reference).

[0146] Dermal slices can be used to prepare ECM hydrogels, see PCT Application No. 2015 / 15164728, incorporated herein by reference. In a specific, non-limiting example, the dermis can be decellularized with 0.25% trypsin / 1% TRITON®-X®-100 (i.e., no SDS) in the following solutions at room temperature on a vortex shaker at 300 RPM: 0.25% trypsin, 6 hours, 1×; deionized water, 15 minutes, 3×; 70% ethanol, 10-12 hours, 1×; 3% H202, 15 minutes, 1×, deionized water, 15 minutes, 2×; 1% TRITON®-X®-100 in 0.26% EDTA / 0.69% Tris, 6 hours, 1×, and then overnight, 1×; deionized water, 15 minutes, 3×; 0.1% peracetic acid / 4% ethanol, 2 hours, 1×; PBS, 15 minutes, 2×; and finally deionized water, 15 minutes, 2×. The dermal sheets are then freeze-dried and then converted into a particulate form using a Waring blender and a Wiley Mill with a #20 mesh screen.

[0147] In some embodiments, epithelial cells can be first delaminated by first immersing the tissue in a de-epithelialization solution, such as hypertonic saline, for example, but not limited to, 1.0N saline, for a period ranging from 10 minutes to 4 hours. Exposure to hypertonic saline effectively removes the epithelial cells from the underlying basement membrane. The tissue remaining after the initial delamination procedure includes the epithelial basement membrane and the tissue layer abluminal to the epithelial basement membrane. The tissue is then subjected to further processing that removes most of the abluminal tissue but not the epithelial basement membrane. The outer serosa, adventitia, smooth muscle tissue, submucosa and most of the muscularis mucosa are removed from the remaining de-epithelialized tissue by mechanical abrasion or a combination of enzymatic treatment, wetting, and abrasion.

[0148] In some embodiments, the ECM itself can be sterilized by a number of standard techniques, including but not limited to exposure to peracetic acid, low-dose gamma radiation, gas plasma sterilization, ethylene oxide treatment, or electron beam treatment. More typically, sterilization of the ECM is achieved by immersion in 0.1% (v / v) peracetic acid, 4% (v / v) ethanol, and 95.9% (v / v) sterile water for 2 hours. Residual peracetic acid is removed by washing twice with PBS (pH=7.4) for 15 minutes and twice with sterile water for 15 minutes. The ECM material can be sterilized by propylene oxide or ethylene oxide treatment, gamma radiation treatment (0.05-4 mRad), gas plasma sterilization, peracetic acid sterilization, or electron beam treatment. ECM can also be sterilized by treatment with glutaraldehyde, which causes cross-linking of protein materials, but this treatment effectively alters the material to be slowly or not resorbed at all, driving a different type of host remodeling that more closely resembles scar tissue formation or encapsulation rather than constitutive remodeling. Cross-linking of protein materials can also be induced by carbodiimide or dehydrogenation heat treatment or photo-oxidation methods. As disclosed in U.S. Pat. No. 8,361,503, ECM is disinfected by immersion in 0.1% (v / v) peracetic acid (a), 4% (v / v) ethanol, and 96% (v / v) sterile water for 2 hours. The ECM material is then washed twice with PBS (pH=7.4) for 15 minutes and twice with deionized water for 15 minutes.

[0149] Generally, after isolation of the tissue of interest, decellularization is performed by various methods, including but not limited to exposure to hypertonic saline, peracetic acid, TRITON®-X® or other detergents. Sterilization and decellularization can be performed simultaneously. For example and without limitation, sterilization with peracetic acid as described above can also be used for decellularization. The ECM can then be dried, lyophilized (freeze-dried) or air-dried. The dried ECM can be pulverized by methods including but not limited to tearing, milling, cutting, grinding, and shearing. The pulverized ECM can also be further processed by methods such as, but not limited to, grinding or milling in a frozen or freeze-dried state to obtain a powdered form.

[0150] Mammalian ECMs are also commercially available. These include AVITENE™, MICROMATRIX™, and XENMATRIX™. These commercially available products can also be used to produce mammalian acoustic ECM hydrogels.

[0151] Acoustic ECM hydrogel In some embodiments, to prepare acoustic ECM hydrogel, pulverized ECM, for example, mammalian ECM, is diluted in liquid. The ECM may or may not be freeze-dried before pulverization. The ECM may be pulverized, for example, by grinding, chopping or chopping the ECM. The ground ECM should have particles in the range of about 10 μm to about 5000 μm, about 10 μm to about 4000 μm, about 10 μm to about 3000 μm, about 10 μm to about 2000 μm, about 10 μm to about 1000 μm, about 10 μm to about 500 μm, about 30 μm to about 300 μm, about 40 to about 400 μm, about 25 μm to about 500 μm, about 50 μm to about 500 μm, about 100 μm to about 300 μm, about 10 μm to about 50 μm, or about 10 μm to about 100 μm. In one embodiment, the ECM is provided in particles having a range of about 10 μm to about 1000 μm. In another preferred embodiment, the ECM is provided in particles having a range of about 10 μm to about 2000 μm. In one non-limiting example, the pieces have a size range of about 30 μm to about 300 μm. The liquid may be a buffer solution at a neutral pH, for example, a pH of about 7.0 to about 7.6, for example, about 7.1 to about 7.5, for example, about 7.2 to about 7.4, for example, about 7.0 to 7.2, for example, about 7.0 to 7.4, for example, about 7.1, 7.2, 7.3, 7.4, 7.5 or 7.6. The ECM may be diluted in an isotonic buffered saline solution, for example, but not limited to, phosphate buffered saline (PBS) or Tris buffered saline. In some embodiments, the osmolality of the buffered saline solution is about 290 mOsm / L. The liquid may be water. In some embodiments, an isotonic buffer solution, including but not limited to, phosphate buffered saline (PBS), may be used to bring the solution to a target pH or to maintain the pH and ionic strength of the gel at a target level, such as physiological pH and ionic conditions. This forms a liquid ECM solution.

[0152] Methods for preparing acoustic hydrogels generally do not involve the use of acidic proteases, including pepsin, trypsin, or hyaluronidase, nor enzymatic digestion of ECM tissue. See PCT Application No. WO2015 / 164728, incorporated herein by reference. Generally, the solubilized ECM in liquid is not contacted with the acidic protease.

[0153] Methods for preparing extracellular matrix hydrogels by applying acoustic techniques, such as ultrasonic frequencies, can be found in US Patent Application Publication No. 2022 / 0143265, the contents of which are incorporated herein by reference for all purposes. In some embodiments, the ECM is utilized in a liquid at a concentration of greater than about 25 mg / ml. The ECM can be utilized in a liquid, such as a buffer, at a concentration of about 25 mg / ml to about 600 mg / ml. Suitable concentrations also include about 25 mg / ml to about 300 mg / ml, about 25 mg / ml to about 200 mg / ml, and about 25 mg / ml to about 150 mg / ml. The ECM can be utilized in a liquid, such as a buffer, at a concentration of about 50 mg / ml to about 600 mg / ml. Suitable concentrations also include about 50 mg / ml to about 300 mg / ml, about 50 mg / ml to about 200 mg / ml, and about 50 mg / ml to about 150 mg / ml. Suitable concentrations include about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200 mg / ml. Exemplary concentrations include about 25 mg / ml, 100 mg / ml, and 150 mg / ml. In a non-limiting example, the ECM is at a concentration of about 25 mg / ml to about 150 mg / ml in the liquid. In a non-limiting example, the ECM is at a concentration of 100 mg / ml in the liquid.

[0154] The ECM in a liquid, such as a buffered saline solution, is treated with an ultrasonic frequency. In one embodiment, the ultrasonic frequency is about 20 kHz to about 100 kHz. The ECM in the liquid can be treated with ultrasonic frequencies of about 20 kHz to about 30 kHz, about 20 kHz to about 40 kHz, about 20 kHz to about 50 kHz, about 20 kHz to about 60 kHz, about 20 kHz to about 70 kHz, about 20 kHz to about 80 kHz, or about 20 kHz to about 90 kHz. The ECM in the liquid can be treated with ultrasonic frequencies of about 20 kHz, 30 kHz, 40 kHz, 50 kHz, 60 kHz, 70 kHz, 80 kHz, 90 kHz, or 100 kHz. In a non-limiting example, the ECM in the liquid can be treated with ultrasonic frequencies of about 20 kHz.

[0155] The ECM in the liquid, such as a buffered saline solution, is treated with ultrasound for at least 20 seconds, e.g., at least 30 seconds. The ECM in the liquid, such as a buffered saline solution, is treated with ultrasound for at least 60 seconds. In some embodiments, the ECM in the liquid is treated with ultrasound for at least 60 seconds to about 1 hour. In further embodiments, the ECM in the liquid is treated with ultrasound for at least 60 seconds to about 30 minutes. In further embodiments, the ECM in the liquid is treated with ultrasound for at least 30 seconds to about 30 minutes. In further embodiments, the ECM in the liquid is treated with ultrasound for at least 60 seconds to about 15 minutes. In further embodiments, the ECM in the liquid is treated with ultrasound for at least 30 seconds to about 15 minutes. In some embodiments, the ECM in the liquid is treated with ultrasound for at least 60 seconds to about 10 minutes. In some embodiments, the ECM in the liquid is treated with ultrasound for at least 30 seconds to about 10 minutes. In some embodiments, the ECM in the liquid is treated with ultrasound for at least 60 seconds to about 5 minutes. In some embodiments, the ECM in the liquid is treated with ultrasound for at least 30 seconds to about 5 minutes. The ECM in the liquid can be treated with ultrasound for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 minutes. In some embodiments, the ECM in the liquid is treated with ultrasound in pulses for the total times listed herein. Thus, in some embodiments, the ECM in a liquid, such as a buffered saline solution, is treated with pulses of at least about 30 seconds in length, e.g., about 30 seconds, about 40 seconds, or about 60 seconds in length, etc. The ECM in a liquid, such as a buffered saline solution, can be treated with ultrasound 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 times, such that the total treatment time is from 60 seconds to 1 hour, or any of the total times listed.The ECM in a liquid, such as a saline solution, can be treated for 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 seconds. The ECM in a liquid, such as a saline solution, can be treated for at least 30 seconds. Generally, if multiple treatments are used, they are performed within a period of less than 1 hour. An exemplary method is a 30 second pulse of ultrasound, followed by 30-45 seconds of no treatment, followed by another treatment. The treatment is applied 2, 3, 4, 5, 6, 7, 8, 9, or 10 times or more. One exemplary, non-limiting method is treating with ultrasound for 30 seconds, such as 6 pulses at about 20 kHz, followed by 45 seconds off (for 6 repetitions), for a total of 3 minutes.

[0156] The amplitude of the ultrasound can be from about 20 μm to about 320 μm. Generally, the amplitude is measured from the center of the probe used to generate the ultrasound. The amplitude of the vibration plane of the probe is the distance between the fully extended position and the fully retracted position of the probe, measured in microns (μm). In some embodiments, the amplitude is from about 30 μm to about 200 μm. In further embodiments, the amplitude is from about 36 μm to about 180 μm. The amplitude can be about 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 150, 160, 70, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 μm. In some embodiments, the amplitude is about 30 to 40 μm, 40 to 50 μm, 50 to 60 μm, 60 to 70 μm, 70 to 80 μm, 80 to 90 μm, 90 to 100 μm, 100 to 110, 110 to 120 μm, 120 to 130 μm, 130 to 140 μm, 140 to 150 μm, 150 to 160 μm, 160 to 170 μm. , 170-180 μm, 180-190 μm, 190-200 μm, 200-210 μm, 210-220 μm, 220-230 μm, 230-240 μm, 240-250 μm, 250-260 μm, 260-270 μm, 270-280 μm, 280-290 μm, or 290-300 μm. In a specific, non-limiting example, the frequency of the ultrasound is about 20 kHz and the amplitude is about 36 μm to about 180 μm. In a further non-limiting example, the frequency of the ultrasound is about 20 kHz and the amplitude is about 36 μm to about 180 μm, and the treatment lasts for a total of about 1, 2, 3, 4, or 5 minutes, for example about 3 minutes. The sonication may be for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 minutes. The sonication may be for about 30 seconds to about 5 minutes. The sonication may be for, for example, about 1 to about 5 minutes. The sonication may be for, for example, about 1 to about 10 minutes. The sonication may be for, for example, 1 to about 20 minutes. In further embodiments, the sonication may be for less than about 1 hour, less than about 30 minutes, less than about 20 minutes, or less than about 10 minutes. In some embodiments, the sonication may be for at least 30 seconds.In other embodiments, sonication can be for about 10 minutes to about 24 hours, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours. In some embodiments, sonication can be for up to 48 hours.

[0157] In some embodiments, the ECM in the liquid is treated with ultrasound at a temperature ranging from about 30°C to about 43°C. In one embodiment, the ECM in the liquid is treated with ultrasound at a temperature ranging from about 35°C to about 40°C. In one embodiment, the ECM in the liquid is treated with ultrasound at a temperature ranging from about 36°C to about 38°C. In another embodiment, the ECM in the liquid is treated with ultrasound at a temperature ranging from about 37°C or greater, e.g., from about 37°C to about 55°C, e.g., from about 37°C to about 50°C, e.g., from about 37°C to about 45°C, e.g., from about 37°C to about 40°C. The ECM in the liquid is treated with ultrasound at a temperature of about 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55°C. In a further embodiment, the ECM in the liquid is treated with ultrasound at above about 38°C, such as from about 38°C to about 50°C, such as from about 38°C to about 45°C, such as from about 38°C to about 40°C.

[0158] In some embodiments, treatment with ultrasound produces an acoustic ECM hydrogel. The acoustic ECM hydrogel generally undergoes a sol-to-gel phase transition near 37°C, thus transitioning to a liquid phase above 37°C and to a gel phase below 37°C. At 37°C, the acoustic ECM hydrogel is sufficiently viscous to resemble a gel, but as the temperature increases above 37°C, the gel transitions to a sol. The acoustic ECM hydrogel forms a gel (sol-to-gel transition) when the temperature drops below 37°C. Thus, in some embodiments, after ultrasonic treatment, the acoustic ECM hydrogel is cooled to a temperature below 37°C, for example, about 4°C to about 36°C. The acoustic ECM hydrogel can be cooled to room temperature, which is typically about 25°C. In some embodiments, the acoustic ECM hydrogel is cooled to about 15°C to about 25°C. The acoustic ECM hydrogel can be cooled to about 23°C to about 27°C. The acoustic ECM hydrogel can be cooled to about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 °C to induce a gel phase.

[0159] In some embodiments, exogenous MBV can be added to the ECM solution prior to sonication. In yet other embodiments, exogenous MBV can be added to the acoustic ECM hydrogel after sonication. Exogenous MBV can be added to the ECM hydrogel prior to the transition of the hydrogel to gel (e.g., while the ECM hydrogel is in liquid phase); thus, in one embodiment, exogenous MBV is added to the acoustic ECM hydrogel at a temperature above 37°C to produce a composition comprising the acoustic hydrogel disclosed herein containing exogenous MBV. In another embodiment, exogenous MBV is added to the acoustic ECM hydrogel while the ECM hydrogel is in gel phase, e.g., at a temperature below 37°C. For example, acoustic ECM hydrogels comprising exogenous MBV are disclosed herein.

[0160] In some embodiments, acoustic mammalian ECM hydrogels are disclosed, where the hydrogels are thermoreversible, the hydrogels being in a solid (gel) phase at temperatures below about 37° C. and in a liquid (sol) phase at temperatures above 37° C. The acoustic hydrogels can be produced using any of the methods disclosed herein. In some embodiments, the storage modulus (G') of the acoustic ECM hydrogel is about one order of magnitude higher than the loss modulus (G''). In further embodiments, the viscosity of the acoustic ECM hydrogel decreases with increasing stress at temperatures between about 15 and about 37° C., e.g., at about 15, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, and / or 36° C. In further embodiments, the viscosity of the acoustic ECM hydrogel decreases with increasing stress at room temperature and / or at about 23° C. to about 27° C. and / or at about 15° C. to about 25° C. In one embodiment, the gel to sol transition of the acoustic ECM hydrogel occurs at about 37° C., thus allowing the hydrogel to be used as a submucosal cushion since the hydrogel is sufficiently viscous at body temperature.

[0161] These acoustic ECM hydrogels can be made from any mammalian ECM disclosed above. In a specific, non-limiting example, the ECM is human ECM. In other non-limiting examples, the ECM is bladder ECM, small intestine submucosa ECM, esophageal ECM, or skin ECM. In one embodiment, the ECM is bladder ECM. In another embodiment, the ECM is skin ECM. In yet another embodiment, the ECM is esophageal ECM. The source of the ECM can be, for example, porcine, bovine, or ovine.

[0162] In some embodiments, the acoustic ECM hydrogel comprises ECM at a concentration of about 25 mg / ml to about 600 mg / ml. In further embodiments, the acoustic ECM hydrogel comprises ECM at a concentration of about 20 mg / ml to about 600 mg / ml, about 25 mg / ml to about 300 mg / ml, about 25 mg / ml to about 200 mg / ml, and about 25 mg / ml to about 150 mg / ml. In further embodiments, the acoustic ECM hydrogel comprises ECM at a concentration of about 50 mg / ml to 600 mg / ml in a liquid, such as a buffer solution. The ECM concentration of the acoustic ECM hydrogel may be about 50 mg / ml to about 300 mg / ml, about 50 mg / ml to about 200 mg / ml, about 50 mg / ml to about 150 mg / ml, about 50 to 100 mg / ml, or about 100 to 150 mg / ml. In some non-limiting examples, the acoustic ECM hydrogel comprises ECM at a concentration of about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200 mg / ml. In some non-limiting examples, the acoustic ECM hydrogel can comprise an ECM having a thickness of about 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, 95-100, 100-105, 105-110, 110-115 , 115-120, 120-125, 125-130, 130-135, 135-140, 140-145, 145-150, 150-155, 155-160, 160-165, 165-170, 170-175, 175-180, 180-185, 185-190, 190-195, and 195-200 mg / ml. Exemplary non-limiting ECM concentrations include about 25 mg / ml, 100 mg / ml, and 150 mg / ml. In one non-limiting example, the acoustic ECM hydrogel includes ECM at a concentration of about 25 mg / ml to about 150 mg / ml. In one embodiment, the ECM concentration is about 100 mg / ml.

[0163] In some embodiments, the acoustic ECM hydrogel has a viscosity of about 1400 Pa*s at 15° C. and a viscosity of about 400 Pa*s at a temperature of 25° C. when the ECM is at a concentration of about 150 mg / mL. In other embodiments, the acoustic ECM hydrogel has a storage modulus of approximately 2700 Pa*s at 15° C., approximately 800 Pa*s at 25° C., and 600 Pa*s at 37° C. when the ECM is at a concentration of about 150 mg / mL.

[0164] The acoustic ECM hydrogel in the liquid phase can be placed into a three-dimensional mold and cooled or spread onto a TEFLON® sheet to form a film. The high concentration of ECM in the acoustic ECM hydrogel (50-600 mg / ml) allows for the formation of very thin sheets, e.g., sheets as thin as 4 microns. The acoustic ECM hydrogel can be shaped to any size greater than 4 microns and into any two- or three-dimensional shape. In some embodiments, sheets are formed that are about 4 to about 10 microns thick, e.g., about 4, 5, 6, 7, 8, 9, or 10 microns thick. The acoustic ECM hydrogel can be formed into any three-dimensional shape, including, but not limited to, cylinders, spheres, ellipsoids, disks, sheets, cubes, cuboids, cones, triangular or rectangular prisms, as well as hollow spheres, hollow ellipsoids, and open-ended hollow cylinders. The acoustic ECM hydrogel can also be used as an injectable, for example, by placing it in a syringe and extruding it from the syringe in either the gel or sol phase.

[0165] In some embodiments, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration greater than about 0.1 mg / ml. The mammalian acoustic ECM hydrogel may comprise solubilized ECM at a concentration between about 0.1 mg / ml and about 1,000 mg / ml. Suitable concentrations include about 1 mg / ml to about 1,000 mg / ml, 1 mg / ml to about 500 mg / ml, 1 mg / ml to about 300 mg / ml, 1 mg / ml to about 200 mg / ml, about 1 mg / ml to about 100 mg / ml, about 10 mg / ml to 100 mg / ml, about 10 mg / ml to about 200 mg / ml, about 100 mg / ml to about 500 mg / ml, about 50 mg / ml to about 150 mg / ml, about 20 mg / ml to about 70 mg / ml, about 4 mg / ml to about 20 mg / ml, or about 40 mg / ml to about 66 mg / ml of solubilized ECM. Mammalian acoustic ECM hydrogels may contain solubilized ECM in a liquid such as a buffer solution at a concentration of about 10 mg / ml to about 500 mg / ml. The mammalian acoustic ECM hydrogel may comprise 10, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200 mg / ml of solubilized ECM. Exemplary concentrations include about 20 mg / ml, 40 mg / ml, 66 mg / ml, 70 mg / ml, and 150 mg / ml of solubilized ECM. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises a concentration of solubilized ECM of about 20 mg / ml to about 70 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 40 mg / ml or about 66 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 10 mg / ml to about 100 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 50 mg / ml to about 150 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 10 mg / ml to about 200 mg / ml. In one non-limiting example, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 10 mg / ml to about 500 mg / ml.

[0166] Exemplary concentrations include about 20 mg / ml, 40 mg / ml, 66 mg / ml, 70 mg / ml, and 150 mg / ml of solubilized ECM. In one non-limiting example, the mammalian acoustic ECM hydrogel contains about 20 mg / ml to about 70 mg / ml of solubilized ECM. In one non-limiting example, the mammalian acoustic ECM hydrogel contains about 40 mg / ml or about 66 mg / ml of solubilized ECM.

[0167] In some embodiments, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 25 mg / ml to about 600 mg / ml. In further embodiments, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 20 mg / ml to about 600 mg / ml, about 25 to about 500 mg / ml, about 25 to about 400 mg / ml, about 25 mg / ml to about 300 mg / ml, about 25 mg / ml to about 200 mg / ml, and about 25 mg / ml to about 150 mg / ml. In further embodiments, the mammalian acoustic ECM hydrogel comprises solubilized ECM at a concentration of about 50 mg / ml to about 600 mg / ml. Mammalian acoustic ECM hydrogels may contain solubilized ECM at a concentration of about 50 mg / ml to about 300 mg / ml, about 50 mg / ml to about 200 mg / ml, about 50 mg / ml to about 150 mg / ml, about 50-100 mg / ml, or about 100-150 mg / ml. In some non-limiting examples, mammalian acoustic ECM hydrogels contain solubilized ECM at a concentration of about 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 85-90, 90-95, 95-100, 100-105, 105-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, 190-200, 200-210, 210-220, 220-230, 230-240, 240-250, 250-260, 260-270, 270-280, 280-290, 290-300, 300-350, 350-40, 40-45, 45-50, 50-55, 55-60, 60-65, 65-70, 70-75, 75-80, 80-85, 8 Includes concentrations of 115, 115-120, 120-125, 125-130, 130-135, 135-140, 140-145, 145-150, 150-155, 155-160, 160-165, 165-170, 170-175, 175-180, 180-185, 185-190, 190-195, and 195-200 mg / ml.

[0168] In some embodiments, a composition comprising a mammalian acoustic ECM hydrogel and trehalose is produced. In further embodiments, the composition comprises from about 0.1 mg / ml to about 700 mg / ml of trehalose. In some embodiments, the composition comprises from about 1 mg / ml of trehalose to about 700 mg / ml of trehalose. In further embodiments, the composition comprises from 50 mg / ml to about 500 mg / ml of trehalose. In other embodiments, the composition comprises from about 10 mg / ml of trehalose to about 600 mg / ml, from about 10 mg / ml to about 500 mg / ml, from about 10 mg / ml to about 400 mg / ml, from about 10 mg / ml to about 300 mg / ml, from about 10 mg / ml to about 200 mg / ml, or from about 10 mg / ml to about 100 mg / ml of trehalose. In further embodiments, the composition may comprise about 0.1 to about 100 mg / ml of trehalose, about 0.1 to about 10 mg / ml of trehalose, or about 0.1 to about 1 mg / ml of trehalose. In further embodiments, the composition may comprise about 50 mg / ml to about 400 mg / ml of trehalose, about 50 mg / ml to about 300 mg / ml of trehalose, about 50 mg / ml to about 200 mg / ml of trehalose, or about 50 mg / ml to about 100 mg / ml of trehalose. In some embodiments, the composition comprises about 20 mg / ml to about 70 mg / ml of trehalose. In some embodiments, the composition comprises about 10 mg / ml to about 100 mg / ml of trehalose. In some embodiments, the composition comprises 15 to 30 mg / ml of trehalose. In some embodiments, the composition comprises 60 to 70 mg / ml of trehalose. In some embodiments, the composition comprises 20 mg / ml trehalose. In some embodiments, the composition comprises 66 mg / ml trehalose. In other embodiments, the composition may comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 66, 70, 80, 90, 100, 200, 300, 400, 500, or 600 mg / ml trehalose. In other embodiments, the composition comprises about 100 mg / ml to about 700 mg / ml trehalose, e.g., about 100, 150, 20, 250, 300, 350, 400, 450, 500, 550, or 600 mg.ml trehalose.In further embodiments, the composition may comprise about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9 or 1 mg / ml of trehalose.

[0169] In a further embodiment, the composition comprises a mammalian acoustic ECM hydrogel comprising solubilized ECM, additional milled mammalian ECM, and optionally trehalose. The milled ECM is not sonicated and is not solubilized in the hydrogel. The milled ECM is a separate additive to the composition that also comprises a mammalian ECM hydrogel. The composition may comprise about 1 to about 30% by weight per volume (w / v) of milled ECM that is not solubilized in the acoustic ECM hydrogel. Without being bound by theory, milled ECM generally has intact collagen particles, whereas acoustic ECM hydrogel has collagen that has been disrupted by ultrasound, resulting in an increased soluble collagen content (Hussey et al., Ultrasonic cavitation to prepare ECM hydrogels Acta Biomater. 2020 May;108:77-86, incorporated herein by reference in its entirety). Thus, the acoustic ECM hydrogel composition containing additional disrupted mammalian ECM contains both intact and disrupted collagen.

[0170] The composition may comprise about 5% to about 30% w / v, about 10% to about 30%, about 15% to about 30%, about 20% to about 30%, about 25% to about 30%, about 1% to about 20%, about 5% to about 20%, about 10% to about 20%, about 15% to about 20%, or about 15% to about 20% of the ground ECM (w / v). The composition may comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30% of the ground ECM (w / v). The composition may comprise 1% or less, 2% or less, 3% or less, 4% or less, 5% or less, 6% or less, 7% or less, 8% or less, 9% or less, 10% or less, 15% or less, 20% or less, 25% or less, or 30% or less of ground ECM (w / v).The composition may comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30% ground ECM (w / v).

[0171] The milled ECM can be from the same species as the mammalian acoustic ECM hydrogel. In one specific, non-limiting example, the mammalian acoustic ECM hydrogel and the milled ECM are both porcine. In another non-limiting example, the mammalian acoustic ECM hydrogel and the milled ECM are both human.

[0172] The ground ECM can be derived from the same or different tissue as the mammalian acoustic ECM hydrogel. In one embodiment, the mammalian acoustic ECM hydrogel and the ground ECM are derived from the same tissue. In one embodiment, the mammalian acoustic ECM hydrogel and the ground ECM are dermal ECM. In one embodiment, the mammalian acoustic ECM hydrogel and the ground ECM are porcine dermal ECM.

[0173] The composition can be sterilized prior to application to a subject. The composition can be sterilized using any method known to those skilled in the art, including filtration and irradiation. In some embodiments, the composition is sterilized using ionizing radiation, such as e-beam or gamma radiation. The composition can be sterilized using gamma radiation, for example, the composition is sterilized using 10-50 kGy of irradiation, for example, 15-45 kGy of irradiation, 20-40 kGy of irradiation, or 10-30 kGy of irradiation. In some non-limiting examples, the composition is sterilized using 10, 15, 20, 25, 30, 35, 40, 45, or 50 kGy of irradiation. In general, the composition is sterilized for a sufficient time to achieve the absence of detectable viable pathogens, such as, but not limited to, viruses and bacteria.

[0174] Enzymatic ECM hydrogel Methods for preparing ECM hydrogels are disclosed, for example, in U.S. Patent No. 8,361,503, the contents of which are incorporated herein by reference for all purposes. Any type of extracellular matrix tissue can be used to produce hydrogels that can be used in the methods disclosed herein (see U.S. Patent Nos. 4,902,508; 4,956,178; 5,281,422; 5,352,463; 5,372,821; 5,554,389; 5,573,784; 5,645,860; 5,771,969; 5,753,267; 5,762,966; (See US Patent Nos. 5,866,414; 6,099,567; 6,485,723; 6,576,265; 6,579,538; 6,696,270; 6,783,776; 6,793,939; 6,849,273; 6,852,339; 6,861,074; 6,887,495; 6,890,562; 6,890,563; 6,890,564; and 6,893,666). In certain embodiments, the ECM is isolated from a vertebrate, for example, but not limited to, a warm-blooded mammalian vertebrate, including, but not limited to, a human, monkey, horse, pig, cow, and sheep. In specific, non-limiting examples, the ECM is porcine or human.

[0175] ECM can be derived from any organ or tissue, including but not limited to bladder, intestine, liver, esophagus and dermis.For example, ECM can be derived from bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessel, lung, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue and / or esophagus. ECM can be obtained from cell culture.In one embodiment, ECM is isolated from bladder.In another embodiment, ECM is derived from esophagus. ECM may or may not include basement membrane part of ECM.In certain embodiments, ECM includes at least a portion of basement membrane.

[0176] In some embodiments, bladder ECM, such as porcine bladder ECM, is prepared by scraping bladder tissue using a longitudinal wiping motion with a scalpel handle and moistened gauze to remove the outer layers, including both the serosa and muscularis. After eversion of the tissue segment, the same wiping motion is used to delaminate the luminal portion of the mucosa from the underlying tissue. In some embodiments, perforation of the submucosa is prevented. After these tissues are removed, the resulting ECM is primarily from the submucosa. Production of hydrogels from decellularized skin ECM is disclosed in Wolf et al., Biomaterials 33: 7028-7038, 2012, which is incorporated herein by reference. Production of ECM from esophageal tissue is disclosed, for example, in Badylak et al. J Pediatr Surg. 35 (7): 1097-103, 2000 and Badylak et al., J Surg Res. 2005 September; 128 (1): 87-97, 2005, both of which are incorporated herein by reference. U.S. Patent No. 6,893,666, which is incorporated herein by reference, discloses production of ECM from the bladder, skin, esophagus and small intestine.

[0177] Commercially available ECM preparations can also be used in the methods, devices and compositions described herein. In one embodiment, the ECM is derived from small intestinal submucosa or SIS. Commercially available preparations include, but are not limited to, SURGISIS™, SURGISIS-ES™, STRATASIS™, and STRATASIS-ES™ (Cook Urological Inc.; Indianapolis, Ind.) and GRAFTPATCH™ (Organogenesis Inc.; Canton Mass.). In another embodiment, the ECM is derived from the dermis. Commercially available preparations include, but are not limited to, PELVICOL™ (sold as PERMACOL™ in Europe; Bard, Covington, Ga.), REPLIFORM™ (Microvasive; Boston, Mass.) and ALLODERM™ (LifeCell; Branchburg, NJ). In another embodiment, the ECM is derived from the urinary bladder. Commercially available preparations include, but are not limited to, UBM (Acell Corporation; Jessup, Md.).

[0178] Tissues for preparing ECM can be collected in a wide variety of ways, and once collected, various parts of the collected tissue can be used. ECM has also been prepared from the esophagus and small intestine, and hydrogels have been prepared from this ECM, see, for example, Keane et al., Tissue Eng. Part A, 21(17-18): 2293-2300, 2015, which is incorporated herein by reference. Esophageal ECM can be prepared by mechanically separating the mucosa and submucosa from the muscularis externa, digesting the mucosa layer with a buffer containing trypsin, followed by exposure to sucrose, TRITON®-X100®, deoxycholic acid, peracetic acid, and DNAse. Small intestinal submucosa (SIS) can be prepared from intact small intestine by mechanically removing the superficial layer of mucosa, serosa, and muscularis externa, leaving the submucosa, muscularis mucosa, and stratum densa basalis intact. The SIS is then treated with peracetic acid. Exemplary protocols are provided in Keane et al. Skin hydrogels can be produced, for example, as disclosed in Wolf et al, J Biomed Mater Res A. 2013. 35 (25): 6838-49. PMID: 23873846. PMCID: 3808505, which is incorporated herein by reference.

[0179] In one embodiment, ECM is isolated from harvested porcine bladders to prepare urinary bladder matrix (UBM). Excess connective tissue and residual urine are removed from the bladder. The serosa, muscularis externa, submucosa and most of the muscularis mucosa can be removed by mechanical scraping or by a combination of enzyme treatment, wetting and scraping. Mechanical removal of these tissues can be achieved by scraping using a longitudinal wiping motion to remove the outer layer (particularly the abluminal smooth muscle layer) and even the luminal portion of the mucosa (epithelial layer). Mechanical removal of these tissues is achieved, for example, by removal of mesenteric tissue by wiping the muscularis and submucosa using Adson-Brown forceps and Metzenbaum scissors and a longitudinal wiping motion with a scalpel handle or other rigid object wrapped in moist gauze. Epithelial cells of the mucosa can be dissociated by immersing the tissue in a de-epithelialization solution, for example, but not limited to, hypertonic saline. The resulting UBM, which contains the basement membrane of the mucosa and the adjacent lamina propria, is further treated with peracetic acid, lyophilized, and powdered (see U.S. Patent No. 8,361,503, incorporated herein by reference).

[0180] Dermal slices can be used for the preparation of enzymatic ECM hydrogels, see PCT Application No. 2015 / 15164728, which is incorporated herein by reference. In a specific, non-limiting example, the dermis can be decellularized with 0.25% trypsin / 1% Triton® X-100 (i.e., no SDS) in the following solutions on a vortex shaker at room temperature at 300 RPM: 0.25% trypsin, 6 hours, 1×; deionized water, 15 minutes, 3×; 70% ethanol, 10-12 hours, 1×; 3% H202, 15 minutes, 1×, deionized water, 15 minutes, 2×; 1% Triton® X-100 in 0.26% EDTA / 0.69% Tris, 6 hours, 1×, then overnight, 1×; deionized water, 15 minutes, 3×; 0.1% peracetic acid / 4% ethanol, 2 hours, 1×; PBS, 15 minutes, 2×; and finally deionized water, 15 minutes, 2×. The dermal sheets are then freeze-dried and then converted into a particulate form using a Waring blender and a Wiley Mill with a #20 mesh screen.

[0181] In some embodiments, epithelial cells can be delaminated by first immersing the tissue in a de-epithelialization solution, such as hypertonic saline, for example, but not limited to, 1.0N saline, for a period ranging from 10 minutes to 4 hours. Exposure to hypertonic saline effectively removes the epithelial cells from the underlying basement membrane. The tissue remaining after the initial delamination procedure includes the epithelial basement membrane and the tissue layer abluminal to the epithelial basement membrane. The tissue is then subjected to further processing that removes most of the abluminal tissue but not the epithelial basement membrane. The outer serosa, adventitia, smooth muscle tissue, submucosa and most of the muscularis mucosa are removed from the remaining de-epithelialized tissue by mechanical abrasion or a combination of enzymatic treatment, wetting, and abrasion.

[0182] ECM can be sterilized by a number of standard techniques, including but not limited to exposure to peracetic acid, low-dose gamma radiation, gas plasma sterilization, ethylene oxide treatment, or electron beam treatment. More typically, sterilization of ECM is achieved by immersion in 0.1% (v / v) peracetic acid, 4% (v / v) ethanol, and 95.9% (v / v) sterile water for 2 hours. Residual peracetic acid is removed by washing twice for 15 minutes with PBS (pH=7.4) and twice for 15 minutes with sterile water. ECM material can be sterilized by propylene oxide or ethylene oxide treatment, gamma radiation treatment (0.05-4 mRad), gas plasma sterilization, peracetic acid sterilization, or electron beam treatment. ECM can also be sterilized by treatment with glutaraldehyde, which causes cross-linking of protein materials, but this treatment effectively alters the material to be slowly or not resorbed at all, driving a different type of host remodeling that more closely resembles scar tissue formation or encapsulation rather than constitutive remodeling. Cross-linking of protein materials can also be induced by carbodiimide or dehydrogenation heat treatment or photo-oxidation methods. As disclosed in U.S. Pat. No. 8,361,503, ECM is disinfected by immersion in 0.1% (v / v) peracetic acid (a), 4% (v / v) ethanol, and 96% (v / v) sterile water for 2 hours. The ECM material is then washed twice with PBS (pH=7.4) for 15 minutes and twice with deionized water for 15 minutes.

[0183] After isolation of the tissue of interest, decellularization is performed by various methods, including but not limited to exposure to hypertonic saline, peracetic acid, TRITON®-X® or other detergents. Sterilization and decellularization can be performed simultaneously. For example and not limited to, sterilization with peracetic acid as described above can also aid in decellularization of the ECM. The decellularized ECM can then be dried, lyophilized (freeze-dried) or air-dried. The dried ECM can be pulverized by methods including but not limited to tearing, milling, cutting, grinding, and shearing. The pulverized ECM can also be further processed into a powdered form, including but not limited to, grinding or milling in a frozen or freeze-dried state. To prepare the solubilized ECM tissue, the pulverized ECM is digested with an acid protease in an acidic solution to form a digest solution. The acid protease can be trypsin and / or pepsin, for example, or a combination thereof.

[0184] In one embodiment, the decellularized ECM material is partially digested by an acid protease. In one example, the decellularized ECM material is not as completely digested as 1 mg / mL freeze-dried powdered ECM material is digested with 1 mg / mL pepsin in 0.01 M HCl for 48 hours. In another example, the decellularized ECM material is not as completely digested as 10 mg / mL freeze-dried powdered ECM material is digested with 1 mg / mL pepsin in 0.01 M HCl for 48 hours. In a further embodiment, the hyaluronic acid in the ECM material is digested to less than 50%, less than 40%, less than 30%, less than 25%, less than 20%, or less than 10% compared to undigested ECM material. See PCT Application No. WO2015 / 164728, incorporated herein by reference.

[0185] The digestion solution of ECM is typically kept at room temperature with constant stirring for a certain amount of time.The digestion solution of ECM can be used immediately, stored at -20°C, or frozen, for example but not limited to, at -20°C or -80°C.The digestion solution of ECM can thus be kept in a solubilized form.Methods for keeping hydrogel in a solubilized form are disclosed, for example, in PCT Application No. PCT / US16 / 52261, filed September 10, 2016, which is incorporated herein by reference.

[0186] Once the ECM is solubilized (typically substantially completely), the pH of the solution is raised to between 7.2 and 7.8, and in one embodiment to pH 7.4. The pH can be raised to about 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, or 7.8. A base can be used to raise the pH of the solution, such as a base containing hydroxyl ions, including NaOH. Similarly, a buffer can be used, such as an isotonic buffer, including but not limited to phosphate buffered saline (PBS), to bring the solution to a target pH or to help maintain the pH and ionic strength of the gel at a target level, such as physiological pH and ionic conditions. This forms a "pre-gel" solution, which is a solubilized ECM hydrogel. The neutralized digest solution (pre-gel, solubilized ECM hydrogel) can be gelled at a lower critical solution temperature. See PCT Publication No. 2015 / 164728, incorporated herein by reference.

[0187] ECM hydrogels form gels (sol-to-gel transition) as the temperature is increased. The lower critical solution temperature (LCST) of a reverse gel is the temperature below which the reverse-gelling polymer is soluble in its solvent (e.g., water or an aqueous solvent). As the temperature is increased above the LCST of the reverse gel, a hydrogel is formed. The general concept of reverse gelation of a polymer and its relationship to its LCST are widely known in the chemical arts. The ECM gels described herein are prepared, for example, from intact ECM that has been decellularized as described below, by digesting the ECM material with an acid protease, neutralizing the material to form a pregel, and increasing the temperature of the pregel above the LCST of the pregel to gel the pregel, e.g., to form a hydrogel. The solution-to-gel transition temperature of the acid protease digest typically falls in the range of 10°C to 40°C and any increments or ranges therebetween, e.g., 20°C to 35°C. For example, the pregel can be warmed to 37° C. to form a hydrogel.

[0188] Thus, the ECM may typically be derived from one of mammalian tissues, such as, but not limited to, the bladder, the esophagus, or the small intestine. In one specific, non-limiting example, the ECM is derived from the bladder. According to one embodiment, the decellularized ECM material prepared from the tissue is not dialyzed prior to partial or complete digestion with an acid protease, and / or is not dialyzed after digestion with an acid protease prior to gelation of the neutralized, digested ECM material.

[0189] In one non-limiting embodiment, the ECM is freeze-dried and pulverized. The ECM is then solubilized with an acidic protease in an acidic solution to produce digested ECM, e.g., bladder ECM. The acidic protease may be, but is not limited to, pepsin or trypsin, or a combination thereof. The ECM can then be solubilized in, e.g., 0.01 M HCl solution at an acidic pH suitable or optimal for the protease, e.g., above about pH 2, or between pH 2 and 4. The ECM is typically solubilized with mixing (stirring, agitation, admixing, blending, rotating, tilting, etc.) for about 12 to about 48 hours (see, e.g., Examples below) depending on the tissue type. The ECM hydrogel is prepared by (i) grinding the extracellular matrix, (ii) solubilizing the intact, undialyzed or uncrosslinked extracellular matrix by digestion with an acidic protease in an acidic solution to produce a digesta solution, (iii) increasing the pH of the digesta solution to between pH 7.2-7.8 to produce a neutralized digesta solution (pre-gel solution), and (iv) gelling the solution.

[0190] Thus, disclosed is a composition containing exogenous MBV of ECM enzymatically digested with acid proteases in an acidic solution. When neutralized, for example to pH 7.0-7.8, and warmed to about 37° C., the composition forms a gel and the proteases are inactivated. In one embodiment, the exogenous MBV is not derived from bone or cardiac tissue. In a further embodiment, the concentration of exogenous MBV in the composition is greater than 5 mg / mL.

[0191] Also disclosed is a composition of enzymatically digested ECM in a neutral solution, for example, pH 7.0-7.8, where the solution contains an inactivated acid protease, for example, inactivated pepsin and / or trypsin, or another inactivated acid protease that in its active form is suitable for digesting ECM, and the composition also contains exogenous MBV. The solution forms a gel upon warming to about 37°C. In one embodiment, the exogenous MBV is not derived from bone or cardiac tissue. In a further embodiment, the concentration of exogenous MBV in the composition is greater than 5 mg / mL. The acid protease may be inactivated or deactivated, for example, due to a change in pH.

[0192] In further embodiments, the ECM hydrogel can be centrifuged and the soluble fraction collected. Exemplary methods for fractionating ECM hydrogels are disclosed, for example, in PCT Publication No. WO2015 / 164728, which is incorporated herein by reference. The method disclosed in this PCT Publication includes partially or completely digesting decellularized ECM material prepared from tissue with an acid protease such as pepsin, neutralizing the digested ECM material to a pH of 7.0-8.0, 7.2-7.8, or 7.4, gelling the neutralized, digested ECM material at a temperature above its lower critical solution temperature, centrifuging the gelled ECM material to produce a pellet and a supernatant, and separating the supernatant and pellet, thereby separating the structural and soluble fractions of the ECM material.

[0193] The ECM hydrogel forms a gel when exposed to a temperature above the lower critical solution temperature, for example, at about 37° C. The ECM hydrogel in the "pre-gel" form (solubilized ECM hydrogel) can be frozen and stored, for example, but not limited to, at −20° C. or −80° C. The ECM hydrogel in the "pre-gel" form can be stored at room temperature, such as about 25° C. In some non-limiting examples, the ECM hydrogel is in the pre-gel form below 37° C., for example, at 25° C., 24° C., 23° C., 22° C., 21° C., 20° C., 19° C., 18° C., 17° C., 16° C., 15° C., 14° C., 13° C., 12° C., 11° C., 10° C., 9° C., 8° C., 7° C., 6° C., 5° C., 4° C. The ECM hydrogel can be frozen for storage and thus stored below 0° C. As used herein, the term "pregel form" or "pregel" refers to an ECM hydrogel that has an elevated pH but has not gelled. For example, and not by way of limitation, the pH of an ECM hydrogel in pregel form is between 7.2 and 7.8. In some embodiments, a solubilized ECM hydrogel is used in the methods disclosed herein. Methods for retaining hydrogels in solubilized form are disclosed, for example, in PCT Application No. PCT / US16 / 52261, filed September 10, 2016, which is incorporated herein by reference. In some embodiments, an ECM composition prepared by any of the methods described herein is absorbed into, adsorbed onto, or otherwise dispersed on or within a biocompatible substrate. Non-limiting examples of biocompatible substrates include meshes, non-woven, decellularized tissues, polymeric compositions, polymeric structures, cell growth scaffolds, implants, orthopedic implants, and intraocular lenses, sutures, intravascular implants, stents, and grafts. The compositions described herein can be applied or incorporated by any suitable method onto non-woven materials such as bandages, sutures, implants such as ceramic, metallic, or polymeric implants, e.g., prostheses, artificial or otherwise modified blood vessels, valves, intraocular lenses, or tissue implants.As used herein, the term "coating" and related cognates such as "coated" and "coating" refer to a process that includes partially or completely covering an inorganic structure with a composition described herein. For example, but not by way of limitation, coating an inorganic structure with a solubilized fraction can include methods such as pouring, embedding, layering, dipping, spraying, and the like. Ultrasonic treatment can be used to assist in coating the inorganic structure.

[0194] Useful compositions include ECM hydrogels that are "enzymatic" ECM hydrogels containing exogenous MBV. Exogenous MBV is added to enrich the bioactive properties of ECM hydrogels and improve their therapeutic efficacy in terms of reducing inflammation and enhancing tissue growth and repair when administered or implanted into a subject. Enzymatic ECM hydrogels are made from solubilized ECM. To prepare solubilized ECM tissue, ground ECM is digested with acidic proteases in an acidic solution to form a digesta solution. As used herein, the term "acidic proteases" refers to enzymes that cleave peptide bonds, where the activity of the enzymes to cleave peptide bonds increases at acidic pH. For example and without limitation, acidic proteases can include pepsin and trypsin. In one embodiment, the ECM is freeze-dried prior to grinding.

[0195] The ECM digest solution is typically held at room temperature with constant stirring for a certain amount of time. The ECM digest can be used immediately or stored at -20°C or frozen, for example, but not limited to, -20°C or -80°C. The pH of the digest solution is raised to between pH 7.2 and 7.8 to form a "pre-gel" solution. The pH can be raised by adding one or more of a base or an isotonic buffer solution, for example, but not limited to, NaOH or PBS, pH 7.4. This method typically does not include a dialysis step prior to gelation and typically results in a more intact ECM-like matrix that gels slower at 37°C than comparable collagen or dialyzed ECM preparations. The gel is therefore more suitable for injection into patients and also has better retention of the quality of the native ECM due to the retention of many native soluble factors, such as, but not limited to, cytokines.

[0196] As used herein, the term "isotonic buffered solution" refers to a solution that is buffered to between pH 7.2-7.8 and has an equilibrium concentration of salt to promote an isotonic environment. As used herein, the term "base" refers to any compound or solution of a compound that has a pH greater than 7. For example and without limitation, the base is an alkali hydroxide or an aqueous solution of an alkali hydroxide. In certain embodiments, the base is NaOH or NaOH in PBS.

[0197] This "pregel" solution may gel upon incubation at an appropriately mild temperature, such as, but not limited to, about 37°C. The pregel may be frozen and stored, such as, but not limited to, at -20°C or -80°C. As used herein, the term "pregel solution" or "pregel" refers to a digesta solution with an elevated pH. For example, but not limited to, the pH of the pregel is between 7.2 and 7.8. The ECM hydrogel composition of the present invention may include an inactivated acid protease. The pH of the ECM hydrogel composition of the present invention may be between 7.2 and 7.8. The "pregel" may contain exogenous MBV. In one embodiment, the exogenous MBV is not derived from cardiac or bone ECM.

[0198] The ECM hydrogel, digesta solution, or pregel may contain solubilized ECM at a concentration between 1 mg / mL and 500 mg / mL. In some embodiments, the amount of solubilized ECM in the ECM hydrogel, digesta solution, or pregel is between 1 mg / mL and 400 mg / mL, e.g., 1 mg / mL and 350 mg / mL, or 1 mg / mL and 300 mg / mL, or 1 mg / mL and 250 mg / mL, or 1 mg / mL and 200 mg / mL, or 1 mg / mL and 150 mg / mL, or 1 mg / mL and 100 mg / mL, or 1 mg / mL and 50 mg / mL, or 5 mg / mL and 250 mg / mL, or 20 mg / mL and 200 mg / mL, or 5 mg / mL and 200 mg / mL, or 5 mg / mL and 100 mg / mL. In further embodiments, the amount of solubilized ECM in the ECM hydrogel, digesta solution, or pregel is between about 5 mg / ml and about 50 mg / ml, e.g., about 10 mg / ml to about 50 mg / ml, about 20 mg / ml to about 50 mg / ml, e.g., about 30 mg / ml to about 50 mg / ml, about 40 mg / ml to about 50 mg / ml, about 5 mg / ml to about 40 mg / ml, about 5 mg / ml to about 30 mg / ml, about 5 mg / ml to about 20 mg / mg, or about 5 mg / ml to about 10 mg / ml. For example, the ECM hydrogel, digest solution, or pregel may contain solubilized ECM at a concentration of about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, 350, 400, 450, or 500 mg / ml. In one non-limiting example, the amount of solubilized ECM in the ECM hydrogel, digest solution, or pregel is between 10 mg / mL and 30 mg / mL. In another non-limiting example, the amount of solubilized ECM in the ECM hydrogel, digest solution, or pregel is between 1 mg / mL and 20 mg / mL. In yet another non-limiting example, the amount of solubilized ECM in the ECM hydrogel, digest solution, or pregel is between 4 mg / mL and 20 mg / mL. In another non-limiting example, the amount of solubilized ECM in the ECM hydrogel, digesta solution or pregel is between 1 mg / mL and 50 mg / mL.In some embodiments, the amount of solubilized ECM in the ECM hydrogel, digesta solution, or pregel is about 5 to about 100 mg / mL, e.g., 50 to 100 mg / mL, 25 to 75 mg / mL, 60 to 80 mg / mL, 40 to 60 mg / mL, 50 to 80 mg / mL, or about 30 to about 60 mg / mL.

[0199] Additional Considerations In some aspects, the disclosed compositions are absorbed into, adsorbed onto, or otherwise dispersed on or in a biocompatible substrate. Non-limiting examples of biocompatible substrates include meshes, non-woven, decellularized tissues, polymeric compositions, polymeric structures, cell growth scaffolds, implants, orthopedic implants, and intraocular lenses, sutures, intravascular implants, stents, and grafts. In some aspects, the substrate is synthetic. In other aspects, the substrate is natural. The compositions of the present disclosure can be applied or incorporated into non-woven materials such as bandages, implants such as sutures, ceramic, metal, or polymeric implants, for example, prostheses, artificial or otherwise modified blood vessels, valves, intraocular lenses, or tissue implants, by any suitable method. As used herein, the term "coating" and related cognates such as "coated" and "coating" refer to a process that includes partially or fully covering an inorganic structure with a composition as described herein. For example, and not by way of limitation, coating of inorganic structures with the disclosed compositions in a liquid phase can include methods such as pouring, embedding, layering, dipping, spraying, and the like.

[0200] In another embodiment, the disclosed compositions are coated in liquid phase onto biocompatible structural materials, such as metals, inorganic calcium compounds such as calcium hydroxide, calcium phosphate or calcium carbonate, or ceramic compositions. Non-limiting examples of suitable metals are cobalt-chromium alloys, stainless steel alloys, titanium alloys, tantalum alloys, titanium-tantalum alloys, and may include both non-metallic and metallic components, such as molybdenum, tantalum, niobium, zirconium, iron, manganese, chromium, cobalt, nickel, aluminum, and lanthanum, including, but not limited to, various grades of CP Ti (commercially pure titanium) or Ti 6A1 4V (90% wt. Ti, 6% wt. Al, and 4% wt. V), stainless steel 316, Nitinol (nickel-titanium alloy), titanium alloys coated with hydroxyapatite. Metals are useful due to their high strength, flexibility, and biocompatibility. Metals can also be formed into complex shapes, and many can resist corrosion in biological environments, reduce wear, and do not damage tissue. Other compositions include, but are not limited to, ceramics, calcium compounds, such as aragonite. Combinations of metals, ceramics, and / or other materials may also be useful.

[0201] Any useful agent can be mixed, co-delivered, co-applied, or otherwise combined with any of the compositions described herein. For example, and without limitation, useful agents include interferons, interleukins, chemokines, monokines, hormones, coagulants, chemotherapeutic agents, and antibiotics.

[0202] Antibiotics or antibacterial agents can be added to the composition to reduce the potential for infection at the treatment site.A variety of antibiotics are known, including those that target bacterial cell walls (e.g., penicillins and cephalosporins) or cell membranes (e.g., polymyxins), or those that interfere with essential bacterial enzymes (e.g., quinolones and sulfonamides). Antibiotics include, but are not limited to, clindamycin, erythromycin, tetracycline, minocycline, doxycycline, penicillin, ampicillin, carbenicillin, methicillin, cephalosporins, vancomycin, and bacitracin, streptomycin, gentamicin, chloramphenicol, fusidic acid, ciprofloxacin and other quinolones, sulfonamides, trimethoprim, dapsone, isoniazid, teicoplanin, avoparcin, sinacid, virginiamycin, cefotaxime, ceftriaxone, piperacillin, ticarcillin, cefepime, cefpirome, rifampicin, pyrazinamide, ciprofloxacin, levofloxacin, enrofloxacin, amikacin, netilmicin, imipenem, meropenem, linezolid, pharma- ceutically acceptable salts thereof, and prodrugs thereof. Antibacterial agents also include cyclic lipopeptides (e.g., daptomycin, etc.), glycylcyclines (e.g., tigecycline, etc.), and oxazolidinones (e.g., linezolid, etc.). Antibiotics may be narrow or broad spectrum antibiotics. Antibiotics may target gram-negative or gram-positive bacteria. Topical antibiotics may be included, such as macrolide antibiotics (e.g., erythromycin, etc.), sulfa antibiotics (e.g., sulfacetamide, etc.), cyclic peptides (e.g., bacitracin, polymyxin, etc.), pseudomonic acids (e.g., mupirocin, etc.), aminoglycosides (e.g., neomycin, etc.), or quinolones (e.g., ciprofloxacin or ofloxacin, etc.), nitroimidazoles (e.g., metronidazole, etc.), or drug combinations (e.g., bacitracin / polymyxin or neomycin / polymyxin B / bacitracin, etc.).

[0203] Additionally, a local anesthetic, such as lidocaine, can be added to the composition to minimize discomfort. Any suitable additive can be utilized so long as it is compatible with the composition and the particular patient and condition being treated.

[0204] In some embodiments, the composition, e.g., a sterile composition, is injectable through a 5Fr / 16G catheter. In one embodiment, the composition is injectable through a 5Fr / 16G catheter at room temperature or at both room temperature and about 37°C.

[0205] How to use Macrophages have been shown to be important regulators of normal healing after injury and normal tissue development. The compositions of the present disclosure can reproduce the effect of the whole ECM on macrophage phenotype, resulting in an increase in M2-like, regulatory, or remodeling-promoting macrophages. Thus, any of the compositions disclosed herein can be used to modify macrophage phenotype, such as to induce regulatory M2 macrophages. For example, ECM hydrogels, whether acoustic or enzymatic, can be combined with exogenous MBV to provide compositions for modifying macrophage phenotype.

[0206] In some aspects, a method is disclosed for inducing M2 macrophages in a subject by administering a therapeutically effective amount of a composition disclosed herein, thereby inducing M2 macrophages in the subject. In a further aspect, a method is disclosed for reducing M1 (pro-inflammatory) macrophages in a subject. The method includes administering a therapeutically effective amount of a composition disclosed herein, thereby inhibiting M1 macrophages in the subject. The subject may be any subject of interest, including human and veterinary subjects.

[0207] The compositions of the present disclosure increase hemostasis in a lesion in a subject. Accordingly, methods for accelerating clotting and / or shortening wound bleeding time are also disclosed. In some embodiments, hemostasis is induced within about 10 to about 100 seconds, e.g., within about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 seconds, after administering an acoustic ECM hydrogel containing exogenous MBV to a subject. The compositions of the present disclosure are useful for treating stroke.

[0208] In some aspects, a therapeutically effective amount of the composition can be administered locally to the site in the subject where hemostasis should be induced. The subject can have a wound. The wound can be an external wound or an internal wound that cannot be reached from the outside of the patient. The composition of the present disclosure is useful as a hemostatic agent in any type of wound. The method can include the step of selecting any one of the subjects of interest, such as a subject with any wound.

[0209] In some embodiments, a method for treating a subject having inflammation or a wound is disclosed. The method includes topically applying a therapeutically effective amount of a composition to the inflammation or wound. In some embodiments, the inflammation or wound is in the stomach, such as an ulcer. In some embodiments, the inflammation or wound is in the throat, such as an ulcer. The compositions disclosed herein can be applied to the area of ​​inflammation or wound or inflammation or ulcer in the stomach by local administration, such as topical administration, injection, or by oral ingestion, or by enteral administration. In some non-limiting examples, the subject has an inflammatory disorder, such as, but not limited to, inflammatory bowel disease, ulcerative colitis, Crohn's disease, or rheumatoid arthritis. The method can include applying an ECM hydrogel to a tissue surface.

[0210] For example, disclosed are methods for treating inflammatory bowel disease, such as ulcerative colitis or Crohn's disease, in a subject by administering to the subject an effective amount of an ECM hydrogel composition containing exogenous MBV disclosed herein. The composition can be administered to the subject, e.g., a human subject, for example, by enema, by oral ingestion, local administration to the intestine, e.g., by local injection, or by systemic administration, e.g., intravenous administration. For example, administration can be enteral, e.g., by mouth. For example, administration can be directly to the intestine by enema. The composition is administered in an amount sufficient to reduce inflammation associated with inflammatory bowel disease, such as ulcerative colitis or Crohn's disease, in the intestine. For example, the composition is administered in an amount that reduces inflammation in the intestine compared to the level of inflammation before administration of the composition. The composition can be administered to the subject, for example, weekly, biweekly, monthly, bimonthly, or trimonthly. This method can also reduce symptoms associated with inflammatory bowel disease.

[0211] The compositions and methods of the present disclosure can be used to treat Crohn's disease. Various types of Crohn's disease, including ileocolonic Crohn's disease, Crohn's colitis, gastroduodenal Crohn's disease, and jejunoileitis, can be treated using the methods and compositions of the present disclosure. Crohn's disease caused by agents can be treated, such as Crohn's disease caused by immune system dysfunction (e.g., autoimmune or innate immune disorders), genetic factors, changes in gut bacteria, and environmental factors. A variety of techniques can be used to identify subjects with Crohn's disease. For example, tests for Crohn's disease can include endoscopy (e.g., colonoscopy, etc.), imaging (e.g., using barium follow-through x-rays, CT scans, and MRI scans), and blood tests (e.g., to identify iron, vitamin D, or vitamin B12 deficiencies; erythrocyte sedimentation rate (ESR); and C-reactive protein levels). The method of administering the compositions disclosed herein can reduce the severity or frequency of Crohn's disease flare-ups. This method can also result in clinical and endoscopic remission of Crohn's disease. For example, in some embodiments, administration of the compositions of the present disclosure results in a decrease in the Crohn's Disease Activity Index (CDAI) compared to the score before treatment. In one embodiment, the patient experiences a decrease in the CDAI score to less than 150 and experiences remission. In another embodiment, the patient experiences a decrease in the CDAI score to a score less than or equal to 450 (scores of 450 or higher indicate severe disease). In another embodiment, the patient experiences a decrease in the CDAI score of at least 70 points as a result of receiving treatment according to the disclosed method (indicating a therapeutic response). For example, in another embodiment, the patient experiences a decrease in the CDAI score of at least 70 points as a result of treatment from the time of administration of the compositions of the present disclosure, which remains decreased for one month, two months, or three months or more after administration (indicating a therapeutic response). In one embodiment, the subject experiences a decrease in the CDAI score from the time of administration of the compositions of the present disclosure, which remains decreased for one month, two months, or three months after administration.In one embodiment, the subject's CDAI score is reduced within 1 month, 2 months, or 3 months of treatment with the disclosed compositions. In one embodiment, the therapeutic effect in treating Crohn's disease extends beyond the duration of the treatment course, for example, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, or longer.

[0212] The compositions of the present disclosure can be used to treat subjects with ulcerative colitis. A variety of techniques can be used to identify subjects with ulcerative colitis. For example, tests for ulcerative colitis can include complete blood count (e.g., to identify anemia or thrombocytosis), electrolyte or renal function tests (e.g., to identify hypokalemia, hypomagnesemia, or prerenal renal failure), liver function tests (e.g., to identify primary sclerosing cholangitis), x-rays, urinalysis, stool culture (e.g., to identify parasites or infectious agents), erythrocyte sedimentation rate or C-reactive protein measurement (e.g., to identify inflammation), or sigmoidoscopy (e.g., to identify ulcers in the colon). In some embodiments, a clinical colitis activity index can be used to assess the severity of ulcerative colitis. In some embodiments, the compositions of the present disclosure are administered by oral administration. The composition of the present disclosure can be administered locally, for example, to the digestive tract or intestine, for example, enterally or by enema or injection. This method can reduce the severity or frequency of ulcerative colitis relapse. This method can also result in clinical and endoscopic remission of ulcerative colitis disease. For example, in some embodiments, administration of the composition of the present disclosure results in a decrease in the Mayo score or Ulcerative Colitis Disease Activity Index (UCDAI) for ulcerative colitis compared to the score before treatment. In one embodiment, the patient experiences a decrease in Mayo score to 2 or less and experiences remission. In another embodiment, the patient experiences a decrease in Mayo score to 5 or less. In another embodiment, the patient experiences a decrease in Mayo score to less than 10. In one embodiment, the subject experiences a decrease in Mayo score or UCDAI score within a certain period of time after receiving treatment with the composition of the present disclosure, for example, within 1 month, 2 months, or 3 months after administration. In one embodiment, the therapeutic effect in treating ulcerative colitis extends beyond the duration of the treatment course, for example, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or more from the time treatment is received.

[0213] The compositions of the present disclosure can be effective in increasing the number, ratio, or proportion of M2 macrophages in the gastrointestinal tract of a subject compared to M1 macrophages to treat inflammatory bowel disease, such as Crohn's disease or ulcerative colitis.For example, treating a subject with the compositions of the present disclosure increases the number, ratio, or proportion of M2 macrophages to M1 macrophages in the gastrointestinal tract, such as the colon, of the subject.This increase can occur, for example, within at least one week, two weeks, or one month after administering the compositions disclosed herein.

[0214] As a result, for example, upon treatment with the compositions and methods disclosed herein, histopathological evaluation of the subject's gastrointestinal tissue, e.g., colonic tissue, shows less inflammation and phenotypic features characteristic of disease (e.g., mucosal destruction, absence of a dense layer of epithelial cells, increased cellularity in the lamina propria and submucosa) and more phenotypic features more characteristic of healthy intestinal tissue, e.g., colonic tissue (e.g., intact muscularis mucosa, presence of healthy dense layer mucosal epithelial cells, and normal cellularity in the lamina propria and submucosa). In other non-limiting examples, the subject is a subject with a wound, such as, but not limited to, an organ transplant recipient, a subject with graft-versus-host disease, a subject with myocardial infarction, or a subject with a surgical or non-surgical traumatic wound. Thus, disclosed are methods for accelerating wound healing and / or increasing hemostasis in an individual in need thereof, comprising administering a therapeutically effective amount of a composition disclosed herein. Administration may be local to the site of the wound or graft.

[0215] The composition can be applied to any wound site to increase hemostasis and / or increase wound healing. The wound can be a skin wound or a wound on any surface, including but not limited to the eye. Methods are also provided for wounds resulting from ischemia and ischemic injury, such as chronic venous leg ulcers resulting from dysfunction and / or insufficiency of venous circulation return. Thus, the method can utilize topical administration to the skin or eye.

[0216] Generally, in these applications, the composition is formulated for topical administration. The hydrogel can be applied to the tissue surface of any organ. For example, the composition disclosed herein can be applied to the esophagus to treat esophagitis. When the composition disclosed herein is administered to a subject suffering from esophagitis, for example, administered to the esophagus, inflammation of the esophagus can be reduced. Furthermore, the composition disclosed herein can be effective in increasing the number, ratio, or proportion of M2 macrophages in the esophagus of a subject compared to M1 macrophages to treat esophagitis. For example, treating a subject with the composition disclosed herein increases the number, proportion, or ratio of M2 macrophages to M1 macrophages in the esophageal tissue of the subject. This increase can occur, for example, within at least one week, two weeks, or one month after administration of the composition disclosed herein.

[0217] Disclosed herein is an external composition for healing wounds, such as skin wounds.The wounds suitable for treatment can be superficial or deep, involving damage to the dermis and epidermis of the skin.The wound can also be a surgical wound.Therefore, provided is a method for promoting wound healing in a subject and / or promoting coagulation (increasing hemostasis) in a subject.

[0218] The composition can be applied directly to the target location, for example, as a topical preparation, such as a sheet, plug, or the like, or as part of a dressing or bandage. Bandages and wound dressings can contain the composition. These can be prepared by applying the composition, together with any other desired additives, to a bandage or wound dressing. These sheets, plugs, bandages, or bandages can be used to shorten clotting time and / or increase wound healing. The acoustic hydrogel can be administered as a solid, for example, in gel phase, by injection into the target location to promote wound healing, or the temperature can be raised above 37°C prior to administration, so that the hydrogel is administered in liquid phase.

[0219] The composition can be applied once. Alternatively, the acoustic ECM hydrogel can be applied periodically to the affected area, typically about once to about 10 times daily, for example, for a period of about 3 to about 14 days, depending on the nature of the wound. In some cases, it may be desirable to apply the composition indefinitely. For example, the ECM hydrogel, whether acoustic or enzymatic, can be combined with exogenous MBV and applied locally, e.g., externally, to a tissue of the subject's body, whether the tissue is external, such as the skin, or internal, such as the colon, small intestine, esophagus, throat, or stomach.

[0220] In some embodiments, the composition increases hemostasis and / or wound healing by at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 100%, or at least 200% compared to a control, such as a standard value, the rate of wound healing or hemostasis achieved without treatment, or by treatment with ECM hydrogel alone or MBV alone.

[0221] The composition of the present disclosure can also be used to treat surgical wounds and other intentional interventions, in which case the composition can be applied immediately after the completion of surgery.Methods are provided for stimulating wound healing and increasing hemostasis at wound sites, including surgical wounds, excision wounds, deep wounds with dermal and epidermal damage, eye tissue wounds, dental tissue wounds, oral wounds, diabetic ulcers, skin ulcers, elbow ulcers, arterial ulcers, venous stasis ulcers, and burns caused by heat exposure or chemicals.

[0222] The subject may be any mammalian subject of interest, including a human or veterinary subject. The subject may be a pediatric subject or an adult subject, such as a young, middle-aged, or elderly adult subject. In humans, an adult subject is older than 18 years of age, a young adult is about 18 to about 35 years of age, a middle-aged adult is generally considered to be about 35 to about 55 years of age, and an elderly (or geriatric) human subject is older than about 55 years of age, such as older than 60 years of age, older than 65 years of age, older than 70 years of age, older than 75 years of age, or older than 80 years of age.

[0223] The subject may be one whose wounds heal at a normal rate or one whose healing is impaired. Several afflictions and conditions may result in healing impairment. These include diabetes (e.g., type II diabetes), treatment with both steroids and other pharmacological agents, and ischemic blockade or injury (such as in peripheral vascular disease or traumatic vascular occlusion). Conditions that induce abnormal wound healing include, but are not limited to, uremia, nutritional disorders, vitamin deficiencies, obesity, infections, immunosuppression, and complications associated with systemic treatment with steroids, radiation therapy, and antineoplastic and antimetabolites. Steroids that have been shown to impair wound healing include cortisone, hydrocortisone, dexamethasone, and methylprednisolone. Nonsteroidal compounds such as octreotide acetate have also been shown to impair wound healing (Waddell et al., Am. Surg. 63: 446 449, 1997).

[0224] The subject may have a coagulation disorder or may be undergoing treatment with an anticoagulant, such as, but not limited to, warfarin or PLAAVIX®. The subject may have a factor II, factor V, factor VII, factor X, or factor XII deficiency. The subject may have hemophilia A, hemophilia B, von Willebrand's disease, fibrinogen or prothrombin deficiency or structural abnormality. Thus, in some embodiments, these subjects are selected for treatment.

[0225] Also provided herein is a method for increasing the adhesion of skin grafts to a wound bed to stimulate re-epithelialization from the wound bed. Types of grafts include, but are not limited to, autologous skin grafts, artificial skin, allografts, autologous skin grafts, autologous epidermal grafts, avacular grafts, Blair-Brown grafts, bone grafts, brephoplastic grafts, cutis grafts, delayed grafts, dermal grafts, epidermal grafts, fascial grafts, full thickness grafts, xenografts, xenografts, allografts, proliferative grafts, lamellar grafts, mesh grafts, mucosal grafts, Ollier-Thiersch grafts, omenpal grafts, patch grafts, pedicled grafts, permeable grafts, split thickness skin grafts, and split thickness grafts. The method includes administering to a subject having a graft a therapeutically effective amount of a composition disclosed herein, thereby increasing the adhesion and tolerance of the graft and controlling or eliminating bacterial growth. In some aspects, the composition-treated cells or tissue are transplanted into the subject. In one specific, non-limiting example, the composition is administered to the graft, such as a skin graft, prior to transplantation.

[0226] Also provided is a method for treating blisters and burns caused by abrasion or chemical injury.Such methods include treating skin or internal organs.Such methods include treating ovarian injury caused by chemotherapy or cyclophosphamide treatment; radiation or chemotherapy-induced cystitis; or high-dose chemotherapy-induced intestinal injury.This method includes administering to a subject a therapeutically effective amount of the composition disclosed herein to promote the healing of blisters or burns and reduce or eliminate bacterial growth.

[0227] Methods are provided for promoting the healing of anastomosis and other wounds resulting from surgical procedures in an individual. These methods include administration of an effective amount of the compositions disclosed herein after and / or during anastomosis or other surgery. An anastomosis is the connection of two tubular structures, for example, when the middle portion of the intestine is removed and the remaining portions are joined together to reconstitute the intestinal tract. Unlike cutaneous healing, the healing process of anastomosis wounds is generally obscured from view. Furthermore, wound healing occurs rapidly in the absence of complications, at least in the gastrointestinal tract; however, complications often require correction by additional surgery (Thornton and Barbul, Surg. Clin. North Am. 77: 549 573 (1997)). The method may include the step of selecting a subject in need of anastomosis wound healing. The subject may be a subject with impaired wound healing due to one of the above conditions, or a subject with normal wound healing, such as a subject without any of the conditions listed above.

[0228] In some embodiments, the composition is used to treat or prevent surgical adhesions, such as the formation of bands of scar tissue that connect tissues or organs that are not normally connected. The composition disclosed herein, including the ECM hydrogel containing exogenous MBVs, can be placed on the surface of tissues or between tissues where adhesions are undesirable, for example, by topical application or injection during a surgical procedure. The surgical procedure can be an abdominal surgical procedure, such as a hernia procedure, a cesarean section, an appendectomy, or the resection of any part of the gastrointestinal tract, such as the colon, rectum, or anus. For example, the composition disclosed herein is applied to the abdominal wall and the tissue or organ responsible for the hernia, such as the small intestine, large intestine, or stomach. To prevent adhesions after a cesarean section, the composition disclosed herein is applied to the uterus and surrounding tissues.

[0229] In some embodiments, the composition is subjected to sterilization. Sterilization is important to ensure that the composition is sufficiently free of pathogen contamination and is suitable for medical use, such as implantation in the human or animal body. Methods such as gamma irradiation, ethylene oxide, supercritical CO2, hydrogen peroxide gas plasma, or ozone may be suitable for sterilization, but other sterilization methods known in the art may be suitable as well. Sterilization by gamma irradiation is an acceptable sterilization method.

[0230] Use as a submucosal cushion Endoscopy is a procedure that allows the inside of hollow organs or cavities of the body to be examined with an instrument called an endoscope without invasive surgery. Endoscopy can be used for surgical procedures such as cauterizing bleeding blood vessels, removing polyps, adenomas and small tumors, performing biopsies, or removing foreign objects. Endoscopic procedures can be performed in the gastrointestinal tract, airways, ears, urinary tract, female reproductive system, and through small incisions in normally closed body cavities such as the abdominal or pelvic cavities (laparoscopy), inside joints (arthroscopy), and organs of the chest (thoracoscopy and mediastinoscopy). Endoscopy can be performed in the upper or lower gastrointestinal tract. An endoscope is an illuminated, usually fiber-optic, flexible or rigid tubular instrument for visualizing the interior of a hollow organ or part (e.g., bladder, esophagus, stomach, intestine, etc.) for diagnostic or therapeutic purposes, typically having one or more working channels to allow the passage of an instrument (e.g., forceps, electrocautery, endoscopic needle, or scissors, etc.) or to facilitate the removal of a biopsy sample. Endoscopes contain appropriate lamps and imaging devices in the distal portion and can be inserted through naturally occurring openings in the body, such as the mouth, anus, ear, nose, etc., or through a small surgical incision. Given the wide variety of body organs or cavities that can be examined using endoscopic procedures, there are several types of specialized endoscopes, such as laryngoscopes, thoracoscopes, angioscopes, colonoscopes, enteroscopes, sigmoidoscopes, rectoscopes, anorectoscopes, anoscopes, arthroscopes, nasoscopes, laparoscopes, hysteroscopes, encephaloscopes, nephroscopes, esophagoscopes, bronchoscopes, gastroscopes, amnioscopes, cystoscopes.

[0231] Endoscopic procedures are widely applied in the gastrointestinal tract, including the upper and lower gastrointestinal tract. For example, endoscopic procedures can be used to inspect the mucosa lining the gastrointestinal cavity and to detect small and large pathological lesions, such as inflammatory tissue, polyps, pseudopolyps, serrated lesions, adenomas, ulcerations, dysplasia, preneoplasia and neoplasia, and tumors. Endoscopic procedures can be used for biopsy and removal of pathological lesions (polyps, adenomas, dysplasia, preneoplasia and neoplasia, tumors). Surgical intervention includes two types of endoscopic resection procedures commonly used to remove pathological lesions in gastrointestinal endoscopy: endoscopic mucosal resection (EMR) and endoscopic submucosal dissection (ESD). These two techniques allow for minimally invasive treatment of gastrointestinal polyps, adenomas, dysplasia, and early cancers with minimal risk of lymph node metastasis.

[0232] Disclosed herein is a method for dissecting mucosa and submucosa from the muscularis propria from a region of an organ of a subject. The organ may be in the gastrointestinal tract, such as the esophagus, duodenum, stomach, small intestine, large intestine (colon) or rectum. The organ may be the bladder, organs of the oral-respiratory system (lungs, throat (pharynx), tongue, nasal passages, paranasal sinuses), skin, or the uterus and vaginal canal. Examples of specific tissues are respiratory epithelium, nasal epithelium, skin or epidermal tissue, and uterine epithelium. One exemplary organ is the esophagus. Another exemplary organ is the colon. This method is useful for any organ that has mucosa and submucosa and in which superficial lesions, such as malignant or premalignant lesions, may form.

[0233] These methods include submucosally injecting an ECM hydrogel composition containing exogenous MBVs of the present disclosure into an organ of a subject to form a cushion between the submucosa and the underlying muscularis propria in the region of the organ. In one embodiment, the organ is not the esophagus. In another embodiment, the organ is the esophagus. In another embodiment, the organ is the large intestine (colon). The method can be an endoscopic mucosal resection (EMR) or an endoscopic submucosal dissection (ESD).

[0234] EMR is an endoscopic technique developed to remove sessile or flat neoplasms that are confined to the superficial layers (mucosa and submucosa) of the gastrointestinal (GI) tract. EMR is typically used for the removal of lesions smaller than 2 cm, or for the incremental removal of larger lesions. EMR also plays an important role in the evaluation of resected specimens for accurate pathological staging. In contrast to polypectomy, EMR involves lifting the lesion off the muscular layer by injecting a fluid agent, commonly normal saline (NS) solution, into the submucosa. EMR is also useful for obtaining specimens for accurate histopathological staging to determine the risk of lymph node metastasis. EMR allows for complete removal of the diseased mucosa by resection through the middle or deeper parts of the intestinal wall submucosa. Various EMR techniques have been described, and four methods involving resection with a snare are commonly used: (1) inject and cut method; (2) inject, lift and cut method; (3) cap-assisted EMR (EMRC); and (4) EMR with ligature (EMRL). In the injection and excision technique, diseased mucosa is lifted from the muscular layer by creating a submucosal fluid cushion of an ECM hydrogel composition containing exogenous MBV, captured, tied off using an electric snare, and then excised.However, injection into the thin submucosa is a delicate process, the injected solution dissipates quickly, flat concave lesions are more difficult to capture with a snare than protruding lesions, and large or awkwardly located lesions may be difficult to remove (Uraoka et al., Drug Design, Development and Therapy 2008: 2 131-138).Injection-assisted EMR is frequently used for large and flat colonic polyps.

[0235] Endoscopic submucosal dissection (ESD) was specifically developed to remove larger lesions. An electric scalpel is used to cut the lesion directly along the submucosa, resulting in en bloc resection of larger lesions. ESD is predicted to replace conventional surgery for the treatment of certain cancer stages, but it has a higher rate of perforation and bleeding complications than conventional EMR, so it requires a higher degree of endoscopic skill and more experience than EMR. A number of electric scalpels can be used in ESD, including the insulation-tipped diathermic knife (IT knife), needle knife, hook knife, flex knife, triangle tipped knife, flush knife, splash needle, and small-caliber tip transparent hood (ST hood). These scalpels can be used with a high-frequency electrosurgical current (HFEC) generator. ESD is characterized by three steps: (1) injecting a material such as an ECM hydrogel composition containing exogenous MBV to form a submucosal cushion and elevate the lesion from the muscular layer; (2) cutting the mucosal periphery of the lesion; and (3) cutting the submucosal connective tissue beneath the lesion (see Kakushima et al., Wold J. Gstroenterol. 14 (9): 2962-2967, 2008, incorporated herein by reference). Although various submucosal injection solutions have been previously developed and shown to be sufficient for use during EMR, introduction into prolonged ESD procedures requires a longer-lasting solution to aid in identifying the cut line during submucosal dissection (Uraoka et al., Drug Design, Development and Therapy 2008: 2 131-138). The method of the present disclosure meets this need.

[0236] Submucosal injection is used in EMR because injection of fluid into the submucosal tissue cushion facilitates the isolation of the tissue to be removed just prior to capture of the target lesion, for example, with a snare, which reduces the risk of burns and perforation and bleeding, while also facilitating resection. Submucosal injection plays an important role in EMR procedures, as the solution must be held in place for a sufficient duration and must form a hemispherical shape to facilitate capture with the snare. Furthermore, a sufficiently high submucosal elevation provides a safe submucosal cut during the ESD procedure (Uraoka et al., Drug Design, Development and Therapy 2008: 2 131-138). Furthermore, since the procedure causes inflammation, any cushion retained at the procedure site should have anti-inflammatory properties. The disclosed composition of ECM hydrogel with exogenous MBV reduces stricture and promotes re-epithelialization. The disclosed method also meets this need.

[0237] In some embodiments, the disclosed compositions have anti-inflammatory properties, are inexpensive, non-toxic, easy to inject, and provide a high, long-lasting submucosal cushion. The compositions are administered in a gel state to the injection site to form a cushion. The cushion can be cut during the procedure so that some hydrogel remains on the underlying muscularis propria, which aids healing. The disclosed compositions facilitate the closure of the wound created by the removal of excised mucosa / submucosa. In some embodiments, the procedure is ESD. In other embodiments, the procedure is EMR.

[0238] While saline solution (NS) and diluent solutions (e.g., ELEVIEW™, see U.S. Pat. No. 9,226,996, incorporated herein by reference) have been used as submucosal cushions for endoscopic resection, the inherent characteristics of these solutions make it difficult to generate a suitable submucosal fluid cushion, maintain a desired height, and retain the cushion in a desired position as the solutions disperse quickly. Furthermore, in ESD, these agents are not retained on the underlying muscularis propria once the mucosa / submucosa is removed. Furthermore, these agents do not aid in the healing process, for example, by reducing inflammation. Use of the disclosed compositions comprising ECM hydrogels containing exogenous MBVs meets these needs.

[0239] Compositions such as MBV-incorporated ECM hydrogels disclosed herein can be used for any ESD or ESR. As disclosed in U.S. Pat. No. 9,364,580, incorporated herein by reference, an endoscopic injection needle is a device that includes a relatively long catheter, which may be long (up to about 230 cm), with an internal injection tube with a distal injection needle slidably disposed therein. A proximal actuation handle is connected to the catheter and the injection tube for moving one relative to the other, if necessary. Fluid access to the injection tube is typically provided by a rear connector on the handle. An endoscopic injection needle device is typically delivered to an injection site through a working channel of an endoscope. To protect the lumen of the endoscope working channel from damage, the handle of the injection needle device is manipulated to retract the distal injection needle into the lumen of the catheter before inserting the device into the endoscope. This prevents the sharp tip of the injection needle from being exposed as the device moves through the lumen of the endoscope. Once the distal end of the endoscopic needle device is positioned at the injection site, the handle is again manipulated to move the needle distally out of the catheter lumen, so that when advanced to its most distal position, the exposed portion of the needle will be approximately 4-6 mm long.

[0240] Once the injection site is penetrated, a composition including ECM hydrogel (e.g., enzymatically or acoustically produced ECM hydrogel) and MBVs, typically contained in a 5 ml to 10 ml syringe with a Luer lock fitting connected to the handle of the needle, can be delivered through the injection tube and needle to the injection site, such as between the submucosa and the underlying muscularis propria.

[0241] Injection needles and other accessories commonly used during endoscopic procedures, such as polypectomy snares, clipping devices, biopsy forceps, and the like, pass through one or more specific channels of the endoscope, usually referred to as the working channel or operation channel. Depending on the type of endoscope used for GI endoscopy (e.g., gastroscope, enteroscope, colonoscope, duodenoscope, sigmoidoscope, and the like), the inner diameter of the working channel can vary considerably. However, the most common endoscopes used for GI endoscopy have working channels with inner diameters ranging from about 2 mm to about 5 mm. Generally, manufacturers of endoscope accessories manufacture accessories with outer diameters that fit all working channels. In some embodiments, the outer diameter of an endoscopic injection needle catheter ranges from 1.9 mm to 2.3 mm, such as about 1.9, 2.0, 2.1, 2.2, or 2.3 cm. Thus, considering that the inner injection tube is contained within the outer catheter, its inner diameter is usually 1 mm or less. The ECM hydrogels of the present disclosure, in gel or liquid form, can easily pass through these catheters.

[0242] The composition comprising ECM hydrogel and exogenous MBV can be used in an endoscopic resection procedure as follows: a volume of hydrogel is drawn from its primary container with a syringe and an appropriate volume of said hydrogel is injected with an endoscopic needle inserted into the working channel of the endoscope just below the superficial mucosal layer to deposit the composition within the submucosal layer where it cushions in place: the elevated mucosal surface allows the endoscopist to perform easy resection on mucosal lesions found during the performance of an endoscopic procedure, even if the lesion is flat and therefore does not protrude into a lumen such as the intestinal, esophageal or gastric lumen. At body temperature, the acoustic ECM hydrogel is a viscous but still flowable gel in transition to a liquid phase and can be easily injected below the superficial mucosal layer to form a cushion for this procedure. Because the gel-sol transition takes time, the cushion remains in place for a sufficient time to perform the resection. Enzymatic ECM hydrogels containing exogenous MBVs are also suitable for such endoscopic procedures because they begin to solidify at body temperature, providing sufficient support for tissue resection and remaining in place to promote healing at the resection site.

[0243] The presence of at least one dye in the cushion can assist the endoscopist in visualizing the structures beneath the mucosa (e.g., the submucosa and the outer muscularis wall), thereby reducing the risk that the endoscopist performing the resection procedure may cause damage to said structures. The use of dye can allow visualization of the cushion cavity and mucosal base. Mucosal wounds are created by removing the lesion from the mucosal surface. The persistence of the cushion created by the injected volume of pharmaceutical composition allows the endoscopic resection procedure to be performed without the need for reinjection. The acoustic ECM hydrogel is injected submucosally into the region of interest within the subject's organ, e.g., the region of the lesion or tumor, to form a cushion between the submucosa and the underlying muscularis propria in the region of the organ. The cushion can be cut so that a portion of the composition remains on the underlying muscularis propria, aiding the healing process.

[0244] The method of the present disclosure is useful, for example, in the esophagus.In a non-limiting example, the method includes a method of cutting esophageal cancer or adenocarcinoma from the esophagus.In another non-limiting example, the method includes a step of cutting mucosa and submucosa from the esophagus of a subject with Barrett's esophagus.In these embodiments, the ECM hydrogel can be made from bladder ECM, small intestine submucosa (SIS) ECM, esophageal ECM, tracheal ECM, liver ECM or skin ECM.

[0245] The method of the present disclosure is also useful in other organs. The organ may be any organ of interest, such as an organ of the gastrointestinal tract. The organ may be in the upper gastrointestinal tract, for example, the pharynx, tongue, or mouth. The organ may be the bladder, vaginal tract, or uterus. In some embodiments, the organ is the colon, duodenum, stomach, cecum, colon, sigmoid colon, rectum, small intestine, or large intestine. In one non-limiting example, the organ is the stomach, small intestine, or large intestine, and the method includes cutting a carcinoma or adenocarcinoma from the stomach. In a further non-limiting example, the organ is the colon, and the method includes cutting a polyp or carcinoma from the colon. In these embodiments, the composition may include an acoustic ECM hydrogel, which may be a bladder, small intestine submucosa, esophagus, trachea, liver, or skin acoustic ECM hydrogel. The MBV may be derived from the same or different sources.

[0246] The composition disclosed herein comprising an ECM hydrogel and exogenous MBVs is maintained at or below the temperature at which it gels, for application as a submucosal cushion.

[0247] A composition comprising an ECM hydrogel (e.g., an acoustic hydrogel) and exogenous MBVs can be maintained, for example, at about 4° C. or at about room temperature prior to administration. In one embodiment, the acoustic ECM hydrogel can be administered, for example, at a temperature between 4° C. and less than 37° C., or between 4° C. and 25° C. In one embodiment, the composition is administered at a temperature less than 37° C. An effective amount of the composition is then utilized as a gel. The composition comprising an acoustic ECM hydrogel and exogenous MBVs remains as a gel in the tissue of the subject, which is at a temperature of approximately 37° C. In one embodiment, the gel-to-sol transition of the acoustic ECM hydrogel with exogenous MBVs is about 37° C., such that the composition is sufficiently viscous at body temperature that the composition can be used as a submucosal cushion.

[0248] In some embodiments, the ECM concentration in the hydrogel is 25 mg / ml to about 200 mg / ml, e.g., about 25 mg / ml to about 100 mg / ml. In other embodiments, the ECM concentration in the hydrogel is about 50 to about 150 mg / ml, e.g., about 75 to about 125 mg / ml, e.g., about 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, or 125 mg / ml. In a specific, non-limiting example, the ECM concentration in the hydrogel is about 100 mg / ml.

[0249] The composition can be provided in lyophilized form, either at room temperature, at low temperature (e.g., about 4° C.), or frozen (e.g., about −20° C.), and reconstituted immediately prior to administration to the anatomical region of interest within a subject.

[0250] The disclosed method is useful in any subject, including human and veterinary subjects. The subject may be of any age. The subject may be adult or juvenile. In one embodiment, a composition comprising an ECM hydrogel is injected into a target tissue of an organ to form a cushion that is then optionally subjected to an endoscopic surgical procedure, such as a resection procedure. The ECM may be from the same species as the subject being treated, or from a different species. In some embodiments, the subject is human, and the ECM hydrogel and / or MBVs are derived from human or porcine ECM. In other embodiments, the ECM hydrogel and / or MBVs are derived from non-human primates, dogs, cats, horses, or cows. The ECM may also be from a commercial source. In some embodiments, the ECM hydrogel and MBVs may be derived from any mammalian tissue, such as, but not limited to, in some embodiments, porcine or human tissue, and in some non-limiting examples, from the bladder, small intestine, or esophagus.

[0251] The method of the present disclosure is invasive because it requires injection to cut mucosa and submucosa from the muscularis propria from the region of the intestinal organ of the subject.In some aspects, the composition is not applied to the surface of the organ, such as the esophagus, of the digestive organ.The method of the present disclosure can be used in the esophagus, but can also be used in other tissues.In other aspects, the composition is applied to the surface of the organ.

[0252] Any of the methods disclosed herein may include submucosally injecting a pharmaceutical composition comprising ECM hydrogel and exogenous MBV into an organ of a subject to form a cushion between the submucosa and the underlying muscularis propria in the region of the organ. The composition gels, severing the mucosa and submucosa from the underlying muscularis propria, and inhibiting inflammation in the region of the organ of the subject. The composition can be administered endoscopically or by catheter as a gel. In some embodiments, the organ is the esophagus, colon, stomach, cecum, colon, sigmoid colon, rectum, small intestine, or large intestine. The composition can be administered endoscopically or by catheter as a gel or sol.

[0253] In some aspects, the resection procedure is an endoscopic mucosal resection or esophageal endoscopic submucosal dissection, which includes dissecting esophageal cancer or adenocarcinoma from the esophagus. In further aspects, the method includes dissecting mucosa and submucosa from the esophagus of a patient with dysplasia. In further aspects, the method includes dissecting mucosa and submucosa from the esophagus of a subject with Barrett's esophagus.

[0254] In some aspects, the resection procedure is an endoscopic mucosal resection or an endoscopic submucosal dissection. In further aspects, the organ is the stomach, small intestine or large intestine, and the method includes severing a polyp, carcinoma or adenocarcinoma from the colon. In further aspects, the method includes severing mucosa and submucosa from an organ of a patient with dysplasia. In a specific, non-limiting example, the method includes severing a polyp or carcinoma from the colon.

[0255] The method may also include performing an endoscopic resection procedure on the cushion. In some aspects, the method includes dividing the cushion such that the hydrogel is retained on the underlying muscularis propria of the esophagus and the mucosa and submucosa are removed from the region of the esophagus. In some non-limiting examples, the portion of the hydrogel cushion that is retained on the underlying muscularis propria downregulates pro-inflammatory macrophage activation in the esophagus.

[0256] The following examples are provided to illustrate particular features of certain embodiments of the present disclosure, and the claims are not intended to be limited to the exemplified features. EXAMPLES

[0257] Example 1 Treatment of Ulcerative Colitis To demonstrate the effect of using ECM hydrogel in combination with MBV, a study was conducted to evaluate colonic healing following DSS-induced ulcerative colitis in rats.

[0258] Overview of study design The study population was 15 female Sprague-Dawley rats. Rats were randomly assigned to healthy control (N=3) or dextran sulfate sodium (DSS)-treated (N=12). Animals exposed to DSS were further divided into five subgroups: (1) untreated control (N=3), (2) MBV enema (N=2), ECM hydrogel enema (N=2), MBV-infused cutaneous ECM acoustic hydrogel enema (N=2), and multiple intravenous injections of MBV (N=3). Table 1. Experimental groups and descriptions [Table 1]

[0259] Ulcerative colitis (UC) in rats was induced by exposing the rats to 5.5% dextran sulfate sodium (DSS) in drinking water and continued free drinking for 6 days before treatment. Throughout disease induction, animals were evaluated for weight loss, food and water consumption, fecal consistency, and fecal blood content. Treatment was performed with the regimen shown in Figure 1, and on day 4, the colons of the animals were explanted for histological analysis.

[0260] DETAILED STEPS Animals and Care: Animal studies were conducted in accordance with all regulations for the humane treatment of laboratory animals established by the University of Pittsburgh's Institutional Animal Care and Use Committee. Female Sprague Dawley rats aged 8-12 weeks were obtained from a certified vendor (Jackson Labs). After shipping, rats were allowed to acclimate for 7-10 days. Animals were housed under standard laboratory conditions at temperatures of 21-23°C and a 12-h dark / light cycle. Rats had free access to food and water. During the study, animals were housed individually for proper data collection.

[0261] Preparation and administration of dextran sulfate sodium: Dextran sulfate sodium (DSS) salt (molecular weight 36,000-50,000) was obtained from MP Biomedical. A 5.5% DSS solution was prepared in autoclaved tap water and administered via ad libitum drinking for 6 days.

[0262] MBV Isolation: Porcine bladder extracellular matrix (ubECM) powder was obtained from ECM Therapeutics (Warrendale, PA). Enzymatic digestion of the UBM-ECM powder was performed for 3 hours at 37°C (0.05 mg / mL Liberase, 5 mM CaCl2 in 1x PBS). The enzymatically digested ECM was subjected to centrifugation at 10,000 x g for 30 minutes at 4°C. The supernatant was ultracentrifuged at 28,000 x g for 70 minutes. The pellet was washed once with PBS and then resuspended in particle-free 1x PBS. The average particle size and concentration of the MBV suspension were determined by Nanoparticle Tracking Analysis (NTA) using a NanoSight NS500. The MBV suspension (238 nm, 1.10 x 10 per mL) was 0.01 mg / mL. 12 The pellets (1000 particles) were stored at -20°C until use.

[0263] MBV enema: The volume of the MBV suspension is increased to 5 mL in 1x PBS and placed in a 5 mL syringe to give a concentration of 1.38 x 10 per mL. 11 particles, or 6.9 x 10 per enema 11 The particles were then split into individual particles.

[0264] Dermal ECM Acoustic Hydrogel Enema: Dermal ECM powder was supplied by ECM Therapeutics (Warrendale, PA). A 50 mg / mL solution of dermal ECM powder in PBS was produced by sonicating the ECM at 40% amplitude for 5 minutes. The solution was then added to a 5 mL syringe and allowed to sit at 4° C. The syringe containing the 5 mL volume of dermal ECM acoustic hydrogel was stored at 4° C. until use.

[0265] Dermal ECM acoustic hydrogel enemas infused with MBV: Dermal ECM powder was supplied by ECM Therapeutics (Warrendale, PA). A 50 mg / mL solution of dermal ECM powder in PBS was made and sonicated for 5 min at 40% amplitude. After cooling at room temperature for 5-10 min, 5 mL of the MBV suspension was added to 35 mL of the sonicated solution and mixed gently, resulting in an MBV concentration of 1.38 × 10 per mL. 11 The solution was then added to a 5 mL syringe and allowed to gel, providing 6.9 x 10 particles per enema. 11 The syringe containing the hydrogel was stored at 4° C. until use.

[0266] MBV intravenous injection: MBV suspension in 1x PBS, volume 300 µL, 1.10 x 10 per mL 12 particles, or 3.3 x 10 per injection 11 The particles were placed into a 1 mL syringe containing 100 μl of the solution.

[0267] Enema delivery: Rats were anesthetized with 0.5-5% isoflurane by inhalation and enemas were administered using a flexible SURFLO® winged infusion catheter (Terumo, OD=2 mm) (Figure 2A-C). Enema solution was administered along the length of the colon using a syringe attached to the catheter; specifically, starting 8 cm from the anus and gradually removing the catheter for an approximate total infusion time of 60 seconds. The syringe contained a total of 5 mL of the designated treatment material. The rate of enema delivery and the volume of enema material were intended to ensure complete coverage of the proximal to distal colon. Treatment groups received daily enemas for 4 days, beginning immediately after removal of 5.5% DSS from the drinking water.

[0268] MBV injection delivery: Rats were anesthetized with inhaled 0.5-5% isoflurane and a volume of 300uL of material was administered into the lateral tail vein. Injections were performed in appropriate groups immediately after removal of 5.5% DSS from the drinking water and 2 days after DSS removal.

[0269] In-life observations: The following data were recorded daily by trained personnel: (1) food consumption, (2) water consumption, (3) animal weight, (4) fecal consistency, and (5) presence of blood in the feces. Feces were scored based on consistency (0=normal, 2=loose, 4=diarrhea) and presence of blood (0=none, 2=occult blood, 4=gross bleeding). Occult blood was tested using ColoScreen ES Lab Pack Fecal Occult Tests.

[0270] Colon explant protocol: Animals were sacrificed on day 4 as shown in Figure 1. Euthanasia was achieved by CO2 inhalation followed by cervical dislocation according to the American Veterinary Medical Association (AVMA). After euthanasia, the colon was excised by accessing it through a midline incision. The colon was incised longitudinally from the rectum to the cecum to expose the luminal surface and rinsed with PBS before gross scoring of the tissue. The explanted colon was photographed and scored. The distal 8 cm of the colon was fixed in 10% neutral buffered formalin for 2 days and subjected to paraffin embedding and tissue sectioning (5 um). Samples were stained with hematoxylin and eosin, representative images were obtained, and histological examination and scoring were performed.

[0271] Macroscopic Scoring of Colonic Tissue: Colons were macroscopically assessed for damage according to the metrics outlined in Table 2. Scoring was performed by an investigator blinded to treatment groups. Table 2. Gross anatomical scoring criteria [Table 2]

[0272] Histological evaluation: Explanted tissues were processed for microscopic analysis as previously described. H&E stained sections were scored for morphological changes in colonic tissue as described in Table 3. Each tissue section was scored separately for the degree of ulceration, mild mucosal inflammation, severe mucosal inflammation, mild submucosal inflammation, and severe submucosal inflammation. Scoring was performed by an investigator blinded to the treatment groups. To ensure uniformity in scoring, a guidance document was provided to each scorer in which the scoring criteria were defined and examples were provided. Table 3. Histological scoring criteria for H&E stained sections. [Table 3]

[0273] Macrophage analysis by immunofluorescence staining: Explanted colons were analyzed by immunofluorescence staining of macrophages. Slides were deparaffinized by a series of xylene and ethanol washes followed by water washes. Antigen retrieval of tissue sections was promoted by placing citrate antigen retrieval buffer (10 mM citrate, pH 6.0) in a high power microwave for 15 minutes and cooled in copper sulfate buffer (10 mM CuSO4, 50 mM ammonium acetate). Blocking solutions (Pierce Protein-free Blocking Buffer, 4% goat serum, 2% BSA, 0.1% Triton®, 0.1% Tween®; Pierce Protein-free Blocking Buffer) were incubated on the slides for 10 minutes each. The tissue was then microwaved with primary antibodies (goat anti-CD206 1:100; rabbit anti-TNFα 1:100; mouse anti-CD68 1:100) for 3 min at medium-low power setting, incubated for 3 min, followed by washing in TBS-T. Secondary antibodies (rabbit anti-goat HRP 1:100; goat anti-rabbit HRP 1:100; goat anti-mouse HRP 1:100) were microwaved with tissue for 3 min at medium-low power setting, incubated for 3 min, followed by washing. Opal reagent (green, red, and blue, 1:100 in appropriate diluent) was incubated with tissue for 10 min in the dark, followed by washing. Antigen retrieval and antibody incubation were repeated for each dye. DRAQ5 was used as a nuclear marker. Tissue sections were then mounted with antifade reagent and imaged.

[0274] Results – In-life observations Food and water consumption: Food and water consumed by each rat was measured daily from day -5 to day 4 (Figure 3). Water intake appeared to increase in the group that underwent disease induction on day 1, after the DSS water was removed and they received regular water. Overall, food consumption remained stable throughout the study.

[0275] Body weight change: Rats were weighed once daily from day -6 to day 4. Individual rat body weights were normalized to their starting body weight on day -6 (Figure 4). Overall, rats appeared to lose weight over the first 3 days of exposure to DSS. Overall, body weights appeared to stabilize once the DSS water was removed and treatment was initiated.

[0276] Fecal consistency and blood content: Fecal consistency and blood scores were determined daily for each rat. The scoring system for both metrics indicates higher scores indicating higher levels of disease. Individual rat scores for fecal consistency and blood content were normalized to the score obtained on day 0 to determine the change from the end of disease induction to the end of treatment (Figure 5). All treatment groups appeared to demonstrate mitigation of disease progression.

[0277] Clinical and histological outcomes After explantation, the length of the colon from the cecum to the rectum was measured as an index of disease activity. A shorter colon corresponds to a more severe disease state. Overall, as expected, all animals that received DSS appeared to have shorter colons than healthy controls. The colons were macroscopically examined for evidence of congestion, inflammation and ulceration. Overall, treated animals appeared to have lower macroscopic scores than untreated animals, as shown in Figure 6.

[0278] Histological analyses are shown in Figures 7A-7G and are discussed in detail below.

[0279] Normal and healthy colon tissue: The colon tissue shown in Figure 7A and Figure 7G(i) was collected from a healthy animal and is characterized by a uniformly thick mucosa with a dense layer of epithelial cells. The lamina propria has normal cellularity and there is a clearly defined underlying muscularis mucosa. The submucosa contains normal numbers of mononuclear cells, the majority of which are quiescent macrophages. The deepest layer is a thick muscularis layer called the muscularis externa. This tissue section is representative of normal and healthy colon tissue.

[0280] Diseased colon: Colon tissue shown in Figure 7B and Figure 7G(ii) was collected from an animal treated with 5.5% DSS for 6 days and then not receiving any therapeutic intervention. Mucosal morphology was significantly disrupted. There were small clusters of mucosal epithelial cells scattered widely, as evidence of attempts to regenerate the mucosal epithelium and restore the normal barrier function of the mucosal layer. Unlike normal healthy colon, there was no dense layer of any epithelial cells. The lamina propria showed increased cellularity, indicating a host inflammatory response to tissue injury and infiltration of toxic colonic contents. There was a marked disruption of the muscularis mucosae layer, which normally separates the mucosa from the underlying submucosa. Cellularity of both the lamina propria and submucosa was significantly increased, and two nodules of lymphoid cell accumulation could be seen within the submucosa of the diseased colon (dark circular areas). The muscularis externa was normal (similar for all specimens).

[0281] ECM hydrogel treated group: Colon tissue shown in FIG. 7D and FIG. 7G(iii) was collected from an animal treated with ECM acoustic hydrogel made from skin ECM. Partial restoration of the colon mucosa is observed as evidenced by an increased number of mucosal epithelial cells compared to the diseased colon group. The cellularity of the lamina propria and submucosa is less than that of the diseased group, but not as low as that of the normal colon group. A clearly demarcated and intact muscularis mucosa is observed. This histological appearance represents partial healing of the colonic mucosa.

[0282] MBV + saline treatment group: The histological appearance of colonic tissue from this group was very similar to the ECM hydrogel treatment group, as shown in Figure 7C and Figure 7G(vi). There was partial restoration of the colonic mucosa, maintenance of an intact muscularis mucosa, and submucosa containing slightly increased numbers of macrophages.

[0283] ECM hydrogel + MBV treatment group: Exemplary tissue from this group is shown in Figure 7E and Figure 7G (v) and shows a remarkable, almost complete replacement of the mucosa, muscularis mucosa and submucosa. It was clearly different from the diseased colon group. There was a nearly complete replacement of the mucosal epithelial cell population, as well as near normal cellularity of the lamina propria and submucosa. The muscularis mucosa was intact. Surprisingly and unexpectedly, the histological specimens from the ECM hydrogel + MBV group were nearly indistinguishable from normal and healthy colonic mucosa, indicating that the combination of ECM hydrogel + MBV had a synergistic effect on colonic tissue healing that was not seen with ECM hydrogel or MBV alone, either by enema or intravenous administration.

[0284] Conclusion: Groups that did not receive ECM in any way induced a significant destructive outcome with only minimal attempts at repair in terms of colonic mucosa replacement. All MBV groups showed partial replacement of the colonic mucosa in contrast to minimal, if any, replacement in the disease-only groups. The combination of ECM hydrogel and MBV induced a near complete repair of the colonic mucosa. The combination of IV MBV plus ECM hydrogel far surpassed the results of all other MBV groups.

[0285] Further histological evaluation Histological samples of the treated tissues described above were evaluated microscopically at high magnification, and visual observation indicated that the treated samples had less inflammation than the diseased samples. Treated animals appeared to have qualitatively healthier mucosa in relation to the presence and organization of crypts. Visual observation of hematoxylin and eosin stained samples showed healthier mucosa and submucosa as indicated by well-organized intestinal crypts and minimal cellular infiltration in the ECM hydrogel and MBV combination treated samples (Figure 11D). In the diseased samples (Figure 11A), intestinal crypts were completely absent in many areas, whereas in the treated samples (Figures 11B-11E), cells appeared to be beginning to reorganize into the orientation and structure typically seen in healthy (Figure 7A) colonic mucosa and submucosa.

[0286] Furthermore, as demonstrated in FIG. 11D, the effect of local administration of MBV-infused ECM hydrogel to rat colon resulted in healthier mucosa and submucosa than local administration of MBV+PBS (FIG. 11C) or ECM hydrogel alone (FIG. 11B), as demonstrated by histology, suggesting that this combination may have a synergistic effect on colon healing.

[0287] MBV treatment modulates macrophages toward an M2 or pro-remodeling phenotype MBV has previously been shown to modulate macrophages toward a pro-healing, anti-inflammatory phenotype. This was further demonstrated in the treatment of DSS-induced ulcerative colitis. The M2:M1 macrophage ratios throughout various tissue layers from treated rats are further demonstrated in Figures 12A-12E. The data show that systemic MBV administration or an enema of the ECM hydrogel-MBV combination promoted dramatically higher M2:M1 ratios in colonic tissue compared to ECM hydrogel enema alone or MBV enema alone. The M2:M1 ratios in colonic tissue treated with MBV hydrogel enema were greater (even when combined) than the effects on colonic tissue treated with MBV enema or hydrogel enema alone, suggesting that the combination of MBV and hydrogel has a synergistic effect on modulating macrophages toward the M2 phenotype in colonic tissue, and thus on the M2:M1 macrophage ratio. In addition to counting M2 and M1 cells throughout the colon (FIG. 12A), we also counted the number of M2 (CD68+, CD206+) or M1 (CD68+, TNFa+) macrophages in the various histological layers of colonic tissue (i.e., mucosa, muscularis, submucosa, see FIG. 12B, FIG. 12C, and FIG. 12D, respectively). Overall, the data indicate that adding MBV to ECM hydrogels has a synergistic, rather than merely additive, effect on the M2:M1 ratio. Furthermore, MBV administered either systemically or in ECM hydrogels dramatically reduced the number of CD68+ cells (FIG. 12E), indicating that the total number of macrophages in those tissues was reduced.

[0288] summary As demonstrated above, disease progression during the study was followed by in-life observations including water consumption, food consumption, body weight, fecal consistency, and the presence of blood in the feces. Successful stimulation of DSS-induced ulcerative colitis in the test animals was confirmed by loss of body weight, increase in fecal consistency score, and the presence of blood in the stool.

[0289] Overall, the data show that ECM hydrogels supplemented with exogenous MBV result in increased healing rates in a DSS-induced ulcerative colitis (UC) rat model based on in-life observations, histological analysis, and macrophage polarization analysis. In-life observations showed faster recovery in all treatment groups compared to disease controls. Macroscopic scoring and histology confirmed the in-life observations macroscopically and microscopically indicating less severe disease in the colon. Organization and density of mucosa and submucosa in the treatment groups showed signs of increased healing rates with lower levels of inflammation and higher levels of mucosal organization due to the presence of intestinal crypts. Macrophages in the treatment groups showed a greater shift to a remodeling phenotype than the disease group alone, further confirming the ability and outcome of increased healing rates due to treatment.

[0290] The results of the above studies suggest that MBV-infused ECM hydrogels have strong therapeutic potential for treating intestinal inflammatory diseases, e.g., inflammatory bowel diseases such as Crohn's disease and ulcerative colitis.

[0291] In view of the many possible embodiments to which the principles of our invention may be applied, it should be recognized that the illustrated embodiments are merely examples of the invention and should not be construed as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

Claims

1. a) Solubilized extracellular matrix (ECM), b) Exogenous matrix-bound nanovesicles (MBVs) derived from the extracellular matrix that do not express CD63 and CD81 or express CD63 lo CD81 lo MBV and which does not contain alkaline phosphatase A composition comprising an extracellular matrix (ECM) hydrogel containing, The exogenous MBV is present in the ECM hydrogel at a concentration of at least about 1 × 10 per mL. 5 ~1 x 10 20 It exists at the concentration of individual particles, The composition is i) It is shear-induced viscosity reduction, ii) Having a storage modulus (G') of approximately 50 Pa to approximately 200 Pa, and a loss modulus (G'') of approximately 5 Pa to approximately 20 Pa, and the ratio of G' to G'' at 37°C is approximately 4:1 to approximately 15:1, and iii) Has a 50% decomposition rate of 24 hours to 14 days, composition.

2. The composition according to claim 1, wherein the ECM hydrogel is an acoustic hydrogel.

3. The composition according to claim 1, wherein the ECM hydrogel is an enzymatic hydrogel.

4. An acidic solution containing exogenous acidic protease and soluble extracellular matrix, Exogenous MBV derived from the extracellular matrix that does not express CD63 and CD81 or CD63 lo CD81 lo Furthermore, it does not contain alkaline phosphatase, and is an exogenous MBV and A composition comprising, The exogenous MBV in the composition is at least about 1 × 10 per mL. 5 ~Approx. 1×10 20 It exists at the concentration of individual particles, When the aforementioned acidic solution is neutralized to a pH between approximately 7.0 and approximately 7.8 at a temperature above 25°C, it forms a gel. composition.

5. Solubilized extracellular matrix and Inactivated exogenous acid proteases, An exogenous MBV derived from the extracellular matrix that does not express CD63 and CD81 or CD63 lo CD81 lo and does not contain alkaline phosphatase, an exogenous MBV A composition comprising, The exogenous MBV in the composition is at least about 1 × 10 per mL. 5 ~1 x 10 20 It exists at the concentration of individual particles, The composition enters the liquid phase at temperatures below 25°C and the gel phase at temperatures above 25°C. The composition has a pH between approximately 7 and approximately 7.

8. composition.

6. The composition according to any one of claims 1 to 5, further comprising ground ECM.

7. The exogenous MBV present in the composition is approximately 1 × 10 6 ~1 x 10 - The composition according to any one of claims 1 to 5, which is present at the concentration of [a certain value].

8. The composition according to any one of claims 1 to 3, wherein the solubilized ECM is present in the ECM hydrogel in an amount of 1 mg / mL to 500 mg / mL.

9. The composition according to claim 4 or 5, wherein the solubilized ECM is present in the composition in an amount of 1 mg / mL to 500 mg / mL.

10. The composition according to claim 9, wherein the solubilized ECM is present in an amount of 5 mg / mL to 50 mg / mL.

11. The composition according to any one of claims 1 to 5, wherein the ECM hydrogel or the solubilized ECM comprises intact ECM.

12. The composition according to any one of claims 1 to 5, wherein the MBV is derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus.

13. The composition according to any one of claims 1 to 5, wherein the MBV does not originate from either the bone ECM or the cardiac ECM.

14. The composition according to any one of claims 1 to 5, wherein the MBV is derived from the extracellular matrix of the bladder, small intestine, dermis, liver, kidney, uterus, brain, blood vessels, lungs, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus.

15. The composition according to any one of claims 1 to 5, wherein the MBV is derived from the bladder matrix (UBM), the submucosal tissue of the small intestine (SIS), or the submucosal tissue of the bladder (UBS).

16. The composition according to any one of claims 1 to 5, wherein the MBV is derived from the extracellular matrix of a mammalian vertebrate selected from humans, monkeys, pigs, cattle, or sheep.

17. The composition according to any one of claims 1 to 5, wherein the ECM hydrogel is derived from the extracellular matrix of the bladder, small intestine, heart, dermis, liver, kidney, uterus, brain, blood vessels, lungs, bone, muscle, pancreas, placenta, stomach, spleen, colon, adipose tissue, or esophagus.

18. The composition according to any one of claims 1 to 5, wherein the ECM hydrogel is derived from bladder matrix (UBM), small intestinal submucosal tissue (SIS), or bladder submucosal tissue (UBS).

19. The composition according to any one of claims 4 or 5, wherein the acidic protease is pepsin, trypsin, or a combination thereof.

20. The composition according to claim 5, having a pH of approximately 7.

2.

21. The composition according to claim 5, having a pH in the range of 7.2 to 7.

4.

22. The composition according to any one of claims 1 to 5, wherein the solubilized ECM is present in the composition in an amount between 10 mg / mL and 30 mg / mL.

23. The exogenous MBV in the composition is a) about 1 × 10 per 1 mL 12 Individual particles; b) Approximately 1 × 10⁶ particles per 1 mL 11 Individual particles; c) Approximately 1 × 10⁶ particles per 1 mL 10 Individual particles; d) Approximately 1 × 10⁶ particles per 1 mL 9 individual particles; or approximately 1 × 10⁻⁶ particles. 8 ~Approx. 1×10 11 The composition according to any one of claims 1 to 5, which is present at the concentration of [a certain value].

24. A composition according to any one of claims 1 to 5, formulated for external administration or for administration as an enema.

25. A composition according to any one of claims 1 to 5 for treating a subject having inflammatory bowel disease.

26. The composition according to claim 25, characterized in that the composition is administered to the intestines of the subject by enema.

27. The composition according to claim 25, characterized in that the composition is administered orally.

28. The composition according to claim 25, which reduces inflammation in the colon of the subject.

29. The composition according to claim 25, wherein the subject has ulcerative colitis.

30. The composition according to claim 29, wherein the Mayo score or ulcerative colitis disease activity index score of the subject decreases after administration of the composition.

31. The composition according to claim 30, wherein the score decreases within one month, two months, three months, or later after receiving the composition.

32. The composition according to claim 25, wherein the subject has Crohn's disease.

33. The composition according to claim 32, wherein the Crohn's disease activity index score of the subject decreases after administration of the composition.

34. The composition according to claim 33, wherein the Crohn's disease activity index score decreases within one month, two months, three months, or later after receiving the composition.

35. A composition according to any one of claims 1 to 5 for treating a subject having esophageal inflammation.

36. The composition according to claim 35, characterized in that the composition is administered externally to the esophagus.

37. The composition according to claim 25, wherein the subject is a human.

38. The composition according to claim 25, wherein when the composition is administered to the subject, the number of M2 macrophages increases in the subject's intestines compared to M1 macrophages.

39. The composition according to claim 38, wherein the intestine of the subject is the colon of the subject.

40. The composition according to claim 35, wherein when the composition is administered to the subject, the number of M2 macrophages in the subject's esophagus increases compared to the number of M1 macrophages.

41. The composition according to claim 35, wherein the subject is a human.