Transgenic soybean event GM_CSM63714 and methods for its detection and use

JP2025516183A5Pending Publication Date: 2026-05-07MONSANTO TECHNOLOGY LLC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
MONSANTO TECHNOLOGY LLC
Filing Date
2023-04-25
Publication Date
2026-05-07

AI Technical Summary

Technical Problem

Current herbicide management in soybean production faces challenges due to weed resistance, necessitating the development of additional herbicide tolerance traits to maintain crop productivity and control weeds effectively.

Method used

The introduction of recombinant DNA molecules and transgenic soybean plants with the soybean event Gm_CSM63714, which confers tolerance to multiple herbicides including dicamba, glufosinate, 2,4-D, and β-triketone herbicides, providing a multi-gene event for commercial use.

Benefits of technology

The transgenic soybean plants with the Gm_CSM63714 event exhibit significant tolerance to multiple herbicide modes of action, enhancing weed control options and maintaining crop productivity while minimizing phytotoxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000075_0000
    Figure 00000075_0000
  • Figure 00000247_0000
    Figure 00000247_0000
  • Figure 00000247_0001
    Figure 00000247_0001
Patent Text Reader

Abstract

A transgenic soybean event, Gm_CSM63714, is provided. Transgenic plant cells, plant parts, plants, seeds, progeny plants, and agricultural and commercial products containing the event Gm_CSM63714 are also provided. Recombinant DNA molecules specific to the event Gm_CSM63714, as well as methods of using and detecting Gm_CSM63714, are also provided. Soybean plants containing the event Gm_CSM63714 exhibit tolerance to benzoic acid-type auxins, such as dicamba, phenoxy-type auxins, such as 2,4-D, inhibitors of glutamine synthetase, such as glufosinate, and P-triketone inhibitors of 4-hydroxyphenylpyruvate dioxygenase (HPPD), such as mesotrione.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 335,470, filed April 27, 2022, which is incorporated herein by reference in its entirety.

[0002] Incorporating a sequence listing The Sequence Listing contained in the 222 kilobyte (measured in MS-Windows) file entitled "MONS532WO_ST26.xml", created on February 13, 2023, is submitted herewith by electronic submission and is incorporated herein by reference in its entirety.

[0003] The present disclosure relates generally to the fields of agriculture, plant biotechnology, and molecular biology. More specifically, the present disclosure relates to compositions and methods for conferring herbicide resistance to transgenic soybean plants. More specifically, a recombinant DNA molecule of soybean event Gm_CSM63714 is provided. Also provided are transgenic soybean plants, plant parts, seeds, cells, and agricultural products comprising the soybean event Gm_CSM63714, as well as methods for producing and using transgenic soybean plants, plant parts, seeds, cells, and agricultural products comprising the soybean event Gm_CSM63714, methods for detecting the soybean event Gm_CSM63714, and methods for controlling weeds. Transgenic soybean plants, plant parts, seeds, and cells containing the soybean event Gm_CSM63714 exhibit tolerance to benzoate-type auxins, such as dicamba, inhibitors of glutamine synthetase, such as glufosinate, phenoxy-type auxins, such as 2,4-D, and β-triketone herbicides (inhibitors of 4-hydroxyphenylpyruvate dioxygenase, or HPPD), such as mesotrione. [Background technology]

[0004] Increasing sustainable crop production using limited natural resources is crucial to meet the need for food for a growing global population, feed for the increasing demand for animal-based diets in developing countries, and the expanding use of crop products to produce biofuels, fiber, and other agricultural commodities. In agricultural systems, effective management of weed species in fields is essential to maintaining favorable crop growing conditions and yields. Weeds compete with crops for space, nutrients, water, and light and can be introduced into crops, presenting one of the major challenges to sustainable crop production. In soybean alone, inadequate weed control can result in yield losses of up to 50% and annual losses of up to $16 billion in the United States (Weed Science Society of America). Selective herbicides were a major contributor to herbicide management before the development of herbicide-tolerant crops. Herbicide application provides an important tool for reducing weed problems, improving productivity, and increasing the safety of global crop production.

[0005] Soybean (Glycine max) is an important crop in many regions of the world. The introduction of genetically modified crops containing herbicide-tolerance traits has been successful in providing farmers with additional tools to better control weeds. Transgenic herbicide resistance allows for the use of herbicides in the crop's growing environment with no or minimal phytotoxicity (e.g., less than approximately 10%). Transgenic soybean traits have been used to confer tolerance to glyphosate and / or dicamba and are widely used for weed control in commercial soybean production. However, weeds are developing resistance to herbicides, and weed resistance currently represents a challenge in soybean production. Therefore, additional herbicide-tolerance trait options are needed to effectively manage weeds and maintain crop productivity. One solution is to use multiple herbicide modes of action.

[0006] Combining herbicide tolerance traits is desirable to provide producers with increased flexibility and weed control options, allowing them to use multiple herbicide mechanisms of action to control difficult weeds.Combining multiple desired traits in a genome can be achieved by crossing two parents that each have the desired traits and identifying progeny plants that have the desired combination of traits, or by retransforming a transgenic plant that contains one or more desired traits with one or more genes for additional desired traits through random or targeted integration of the one or more genes for the additional desired traits.Alternatively, combining multiple desired traits can be achieved by inserting multiple genes into a single position or locus in the genome as a single DNA molecule.The combination of multiple herbicide tolerance traits at a single locus in soybean provides a useful tool in weed control, which is much easier and less expensive to maintain during the subsequent breeding process to create a diverse pool of elite germplasm.

[0007] The expression of a transgene in a transgenic plant, plant part, seed, cell, or progeny, and therefore its effectiveness, can be affected by many factors, such as the regulatory elements used in the expression cassette of the transgene, the combination and / or interaction of those regulatory elements, the chromosomal location of the transgene insertion site, the chromatin structure of the genome at or near the transgene insertion site, and the presence or proximity of any endogenous cis- and / or trans-regulatory elements or genes near the transgene insertion site. Furthermore, the productivity of the trait in a transgenic plant becomes even more complicated when the transgenic insert contains multiple expression cassettes, each carrying a different transgene that confers a different trait. These differences or factors can lead to variations in the level of transgene expression or the spatial or temporal pattern of transgene expression between different transgenic insertion events of the same expression cassette. Furthermore, different transgenic events can vary in terms of the molecular nature of the event. For example, a transgenic event may contain two or more copies of a transgene insert at one or more chromosomal locations; the transgenic insert may be truncated relative to the intended insertion or may contain vector backbone sequences; the transgene may be inserted into an endogenous gene or within a repetitive region. Such characteristics may result in undesirable consequences, such as gene silencing, altered expression patterns and / or expression of the transgene, or altered expression patterns and / or expression of the endogenous gene. Additionally, there may be undesirable phenotypic or agronomic differences between various events.

[0008] Even in the case of targeted sequence insertion, variability in the level of transgene expression between independent but genetically identical targeted sequence insertion (TSI) events was observed in a subset of transgenic events (Verkest et al., 2019). This expression variability and silencing occurred independently of the transgene sequence and may have been due to DNA methylation, which further led to different DNA methylation mechanisms. The fact that significant variability in transgene expression was observed in a subset of clean TSI events indicates that even when integration events are targeted, selection, similar to that performed for random integration events, is still required to identify TSI events that stably express the gene of interest over generations.

[0009] Commercially useful multigene transgenic events require that each transgene in the transgenic insert be expressed in the manner necessary to achieve that trait, which involves rigorous testing, evaluation, and selection. After one or more resistance traits are selected, individual expression cassettes are designed and tested in vitro and / or in planta, and the best expression cassette for each trait is selected. Such testing includes testing different regulatory elements (e.g., promoters, introns, leaders, and 3'UTRs) and combinations of different regulatory elements for the desired spatial and temporal expression of the transgene, as well as determining whether the transgene product (protein) is targeted to a subcellular compartment, such as the chloroplast. The selected expression cassettes for each trait are then combined into a single construct, and the construct is tested to confirm that all of the expression cassettes function well and that each transgene is appropriately expressed. The selected combination of expression cassettes is then used in transformation to produce transgenic plants. Because Agrobacterium-mediated transformation with T-DNA constructs containing one or more transgene cassettes is largely variable and random in terms of where the transgene(s) may be inserted into the plant genome, each transgenic event is unique, with the transgenic DNA randomly and uniquely inserted at different plant genomic locations. Thus, using combinations of selected expression cassettes, hundreds of unique multigene transgenic events are produced, each resulting from the random insertion of foreign DNA at a different plant genomic location.

[0010] For these reasons, the productivity of different transformation events from the same transformation construct can vary, and identification of transformation events that confer the most beneficial traits or characteristics and are free of other potential anomalies or concerns is necessary to select superior events for commercial exploitation. Therefore, to select events with superior commercial characteristics, it is necessary to produce and analyze large numbers of individual transgenic events, which can be a significant task involving analysis and selection among many different transformation events.

[0011] To establish a multigene event for commercial use, rigorous molecular characterization, greenhouse trials, and multi-year field trials are required in multiple locations and under various conditions, allowing for the acquisition of extensive agronomic, phenotypic, and molecular data. The data obtained is then analyzed, and events suitable for commercial purposes are selected. Once the commercial multigene event has been identified as having the desired transgene expression, molecular characteristics, efficacy, and field performance, it can be introgressed into other soybean genetic backgrounds using plant breeding techniques as a single locus with multiple herbicide tolerance traits. The resulting soybean variety contains the new trait in combination with other desired properties, such as native traits, disease resistance traits, insect control traits, high-yield germplasm or traits, and / or one or more other transgenic herbicide tolerance traits. Summary of the Invention

[0012] Recombinant DNA molecules are provided herein, including, for example, a sequence selected from the group consisting of SEQ ID NO:10, SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, a polynucleotide having a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9, and the complete complement of any of the above. In some embodiments, the recombinant DNA molecule is derived from a soybean plant, seed, plant part, plant cell, progeny plant, or commercial product comprising the soybean event Gm_CSM63714, and a representative sample of seeds comprising the event has been deposited under ATCC Accession No. PTA-127099. In some embodiments, the recombinant DNA is contained in a soybean plant, seed, plant part, plant cell, or progeny plant comprising the soybean event Gm_CSM63714, or a commercial product produced therefrom, and a representative sample of seeds comprising the event has been deposited under ATCC Accession No. PTA-127099. The recombinant DNA molecule can be formed by inserting a heterologous nucleic acid molecule into the genomic DNA of a soybean plant or soybean cell. The recombinant DNA molecule can comprise an amplicon used to diagnose the presence of the soybean event Gm_CSM63714.

[0013] Provided is a DNA molecule that can function as a DNA probe.An example of such a DNA molecule is a DNA molecule that comprises a polynucleotide segment of sufficient length to function as a DNA probe, and specifically hybridizes with the DNA of soybean event Gm_CSM63714 in a sample under stringent hybridization conditions.Detecting the hybridization of the DNA molecule under stringent hybridization conditions is used to diagnose the presence of soybean event Gm_CSM63714 in the sample.

[0014] Also provided is a DNA molecule comprising a polynucleotide segment of sufficient length to function as a DNA probe specific for detecting at least one of the following in a sample: the 5' junction sequence between the adjacent soybean genomic DNA and the transgenic insert of soybean event Gm_CSM63714, the 3' junction sequence between the transgenic insert of soybean event Gm_CSM63714 and the adjacent soybean genomic DNA, SEQ ID NO: 9, and a fragment of SEQ ID NO: 9 comprising consecutive nucleotides of SEQ ID NO: 9 of sufficient length to identify the sequence as a fragment of the transgenic insert of Gm_CSM63714.

[0015] The DNA probe may comprise SEQ ID NO: 16. Alternatively, the DNA molecule functioning as the DNA probe may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, and complements of any of the above. The sample may be derived from a soybean plant, a seed, a plant part, a plant cell, a progeny plant, or a commercial product.

[0016] A pair of DNA molecules is provided. The pair of DNA molecules includes a first DNA molecule and a second DNA molecule. The first and second DNA molecules comprise a fragment of SEQ ID NO:10 or its complement, and when used together in an amplification reaction with DNA containing soybean event Gm_CSM63714, function as DNA primers to produce an amplicon used in diagnosing soybean event Gm_CSM63714 in a sample. For example, the first and second DNA molecules can comprise SEQ ID NO:14 and SEQ ID NO:15. The amplicon can include a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, and a fragment of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8, which is at least 10 nucleotides in length and includes nucleotides 1,000 to 1,001 or 11,196 to 11,197 of SEQ ID NO:10.

[0017] Methods are provided for detecting the presence of soybean event Gm_CSM63714 in a sample derived from a soybean seed, plant, plant part, plant cell, progeny plant, or commercial product. In a first example of such a method, the method comprises: a) contacting the sample with any of the DNA molecules functioning as probes described herein; b) subjecting the sample and the DNA molecule functioning as a probe to stringent hybridization conditions; and c) detecting hybridization of the DNA molecule functioning as a probe to the DNA molecule in the sample. Hybridization of the DNA molecule functioning as a probe to the DNA molecule in the sample is used to diagnose the presence of soybean event Gm_CSM63714 in the sample.

[0018] Another method for detecting the presence of soybean event Gm_CSM63714 in a sample derived from a soybean seed, plant, plant part or plant cell, progeny plant, and commercial product is provided. The method comprises: a) contacting the sample with any pair of DNA molecules described herein; b) performing an amplification reaction sufficient to produce a DNA amplicon; and c) detecting the presence of the DNA amplicon, wherein the DNA amplicon comprises at least one of the following: a 5' junction sequence between the adjacent soybean genomic DNA and the transgenic insert of soybean event Gm_CSM63714, a 3' junction sequence between the adjacent soybean genomic DNA and the transgenic insert of soybean event Gm_CSM63714, SEQ ID NO:9, and a fragment of SEQ ID NO:9 comprising a sufficient length of consecutive nucleotides of SEQ ID NO:9 to identify the sequence as a fragment of the transgenic insert of Gm_CSM63714. The presence of the DNA amplicon indicates the presence of soybean event Gm_CSM63714 in the sample. The DNA amplicon can be at least 10 nucleotides in length, at least 11 nucleotides in length, at least 12 nucleotides in length, at least 13 nucleotides in length, at least 14 nucleotides in length, at least 15 nucleotides in length, at least 16 nucleotides in length, at least 17 nucleotides in length, at least 18 nucleotides in length, at least 19 nucleotides in length, at least 20 nucleotides in length, at least 25 nucleotides in length, at least 30 nucleotides in length, at least 35 nucleotides in length, at least 40 nucleotides in length, at least 45 nucleotides in length, at least 50 nucleotides in length, at least 60 nucleotides in length, at least 70 nucleotides in length, at least 80 nucleotides in length, at least 90 nucleotides in length, or at least 100 nucleotides in length.The DNA amplicon may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO:10, SEQ ID NO:9, SEQ ID NO:8, SEQ ID NO:7, SEQ ID NO:6, SEQ ID NO:5, SEQ ID NO:4, SEQ ID NO:3, SEQ ID NO:2, SEQ ID NO:1, and fragments of any of SEQ ID NO:10, SEQ ID NO:8, SEQ ID NO:7, SEQ ID NO:6, SEQ ID NO:5, SEQ ID NO:4, SEQ ID NO:3, SEQ ID NO:2, and SEQ ID NO:1, which fragments are at least 10 nucleotides in length and include nucleotides 1,000 to 1,001 or 11,196 to 11,197 of SEQ ID NO:10.

[0019] Further provided are methods for detecting the presence of soybean event Gm_CSM63714 in a sample of DNA derived from a soybean seed, plant, plant part, plant cell, progeny plant, or commercial product, comprising: a) contacting the sample with any of the DNA molecules described herein that function as a probe; and b) performing a sequencing reaction to produce a target sequence comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, the full complement of any of them, and a fragment of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:10, the fragment being at least 10 nucleotides in length and comprising nucleotides 1,000-1,001 or 11,196-11,197 of SEQ ID NO:10.

[0020] Another method for detecting the presence of soybean event Gm_CSM63714 in a sample derived from a soybean seed, plant, plant part, cell, progeny plant, or commercial product is provided, comprising: a) contacting the sample with at least one antibody specific for at least one protein encoded by soybean event Gm_CSM63714; and b) detecting binding of the antibody to the protein in the sample, wherein binding of the antibody indicates the presence of soybean event Gm_CSM63714 in the sample.

[0021] A DNA detection kit is provided for detecting the presence of soybean event Gm_CSM63714 in a sample. One example of such a DNA detection kit is a kit containing any of the DNA primer pairs described herein. Another example of a DNA detection kit is a kit containing any of the DNA molecules described herein that function as probes.

[0022] Also provided is a protein detection kit for detecting the presence of soybean event Gm_CSM63714 in a sample. One example of such a kit is a kit comprising at least one antibody specific to at least one protein encoded by soybean event Gm_CSM63714. Detecting binding of the at least one antibody to at least one protein encoded by soybean event Gm_CSM63714 in a sample is used to diagnose the presence of soybean event Gm_CSM63714 in the sample.

[0023] Also provided are soybean plants, plant seeds, plant parts, and plant cells comprising a recombinant DNA molecule comprising a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, a polynucleotide having a sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9, and the complete complement of any of the foregoing. The soybean plant, plant seed, plant part, or plant cell may express at least one herbicide-tolerant gene selected from the group consisting of dicamba monooxygenase (DMO), phosphinothricin N-acetyltransferase (PAT), alpha-ketoglutarate-dependent non-heme iron dioxygenase variant FT_Tv7, triketone dioxygenase (TDO), and any combination thereof. The soybean plant, plant seed, plant part, or plant cell may be tolerant to at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, glutamine synthetase inhibitors, β-triketone HPPD inhibitors, and any combination thereof. The benzoic acid-type auxin can include dicamba, the phenoxy-type auxin can include 2,4-D, the glutamine synthetase inhibitor can include glufosinate, and the β-triketone HPPD inhibitor can be selected from the group consisting of mesotrione, benzobicyclon (BBC), tembotrione, sulcotrione, tefuryltrione, and any combination thereof. For example, the β-triketone HPPD inhibitor can include mesotrione. The soybean plant, plant seed, plant part, or plant cell can further include an additional transgene for tolerance to at least one additional herbicide. For example, the at least one additional herbicide is glyphosate.When the at least one additional herbicide is glyphosate, the additional transgene can comprise a polynucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 57. The soybean plant, plant seed, plant part, or plant cell can comprise the soybean event Gm_CSM63714, and a representative sample of seeds comprising the event has been deposited under ATCC accession number PTA-127099. The soybean plant, plant seed, plant part, or plant cell can further be defined as a progeny plant of any generation of a soybean plant comprising the soybean event Gm_CSM63714, or a soybean plant part, plant seed, or plant cell derived therefrom.

[0024] Additional soybean plants, plant parts, plant seeds, and plant cells are provided, including soybean event Gm_CSM63714, and a representative sample of seeds including soybean event Gm_CSM63714 has been deposited under ATCC Accession No. PTA-127099.

[0025] Any of the soybean plant parts described herein can include microspores, pollen, anthers, ovules, ovaries, flowers, pods, embryos, stems, leaves, roots, or callus.

[0026] A method for controlling or preventing the growth of weeds in an area is provided. One example of such a method includes planting soybeans containing event Gm_CSM63714 in the area and applying an effective amount of at least one herbicide selected from the group consisting of dicamba, glufosinate, 2,4-D, a β-triketone HPPD inhibitor, and any combination thereof, to control weeds in the area, with no phytotoxicity to the soybeans or less than about 10% phytotoxicity to the soybeans. Applying an effective amount of at least one herbicide can include applying at least two or more herbicides selected from the group consisting of dicamba, glufosinate, 2,4-D, a β-triketone HPPD inhibitor, and any combination thereof throughout the growing season. The β-triketone HPPD inhibitor can be selected from the group consisting of mesotrione, benzobicyclon (BBC), tembotrione, sulcotrione, tefuryltrione, and any combination thereof. An effective amount of dicamba can be from about 0.5 lb / acre to about 2 lb / acre throughout the growing season. An effective amount of glufosinate can be from about 0.4 lb / acre to about 1.6 lb / acre throughout the growing season. An effective amount of 2,4-D can be from about 0.5 lb / acre to about 4 lb / acre throughout the growing season. When the β-triketone HPPD inhibitor includes mesotrione, an effective amount of mesotrione can be from about 0.09 lb / acre to about 0.36 lb / acre throughout the growing season.

[0027] Methods for controlling volunteer soybean, including soybean event Gm_CSM63714, in an area are provided. One example of such a method includes applying a herbicidally effective amount of at least one herbicide other than dicamba, glufosinate, 2,4-D, or a β-triketone HPPD inhibitor, where application of the herbicide prevents growth of soybean including soybean event Gm_CSM63714. The herbicide other than dicamba, glufosinate, 2,4-D, or a β-triketone HPPD inhibitor can be selected from the group consisting of atrazine, bromoxynil (3,5-dibromo-4-hydroxybenzonitrile), clopyralid, pyrithiobac, isoxaflutole, topramezone, fluometuron, trifloxysulfuron, monosodium methylarsenate (MSMA), inhibitors of protoporphyrinogen oxidase (PPO), and any combination thereof. Examples of inhibitors of protoporphyrinogen oxidase (PPO) include saflufenacil, flumioxazin, sulfentrazone, and any combination thereof.

[0028] Methods for obtaining soybean seeds or soybean plants that are tolerant to benzoic acid-type auxins, phenoxy-type auxins, inhibitors of glutamine synthetase, β-triketone-based HPPD inhibitors, or any combination thereof are provided. In one example of such a method, the method comprises: a) obtaining a population of progeny seeds or plants grown therefrom, at least one of which contains the soybean event Gm_CSM63714; and b) identifying at least a first progeny seed or plant grown therefrom that contains the soybean event Gm_CSM63714. Identifying progeny seeds or plants grown therefrom containing the soybean event Gm_CSM63714 can include: a) growing the progeny seeds or plants to produce progeny plants; b) treating the progeny plants with an effective amount of at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, glutamine synthetase inhibitors, β-triketone HPPD inhibitors, and any combination thereof; and c) selecting progeny plants that are tolerant to at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, glutamine synthetase inhibitors, β-triketone HPPD inhibitors, and any combination thereof. The benzoic acid-type auxin can include dicamba. The phenoxy-type auxin can include 2,4-D. The glutamine synthetase inhibitor can include glufosinate. The β-triketone HPPD inhibitor may be selected from the group consisting of mesotrione, benzobicyclone (BBC), tembotrione, sulcotrione, tefuryltrione, and any combination thereof. For example, the β-triketone HPPD inhibitor may include mesotrione. Alternatively or additionally, identifying progeny seeds containing the soybean event Gm_CSM63714 or plants grown therefrom includes detecting the presence of the soybean event Gm_CSM63714 in a sample derived from the progeny seeds or plants grown therefrom.Alternatively or additionally, identifying progeny seeds or plants grown therefrom containing the soybean event Gm_CSM63714 may comprise detecting the presence of at least one protein encoded by the soybean event Gm_CSM63714 in a sample derived from the progeny seeds or plants grown therefrom.

[0029] Methods for determining the zygosity of a soybean plant, plant part, plant seed, or plant cell containing the soybean event Gm_CSM63714 are provided. One example of such a method includes: a) contacting a sample containing DNA derived from the soybean plant, plant part, plant seed, or plant cell with a primer set capable of producing a first amplicon used to diagnose the presence of the soybean event Gm_CSM63714 and a second amplicon used to diagnose wild-type soybean genomic DNA that does not contain the soybean event Gm_CSM63714; b) performing a nucleic acid amplification reaction; and c) detecting the first amplicon and the second amplicon. The presence of both amplicons indicates that the plant, plant part, seed, or cell is heterozygous for the soybean event Gm_CSM63714. The presence of only the first amplicon indicates that the plant, plant part, seed, or cell is homozygous for the soybean event Gm_CSM63714. A specific example of a primer set that can be used is the primer set comprising SEQ ID NO:14, SEQ ID NO:15 and SEQ ID NO:20.

[0030] Another method for determining the zygosity of a soybean plant, plant part, plant seed, or plant cell containing soybean event Gm_CSM63714 is provided. The method includes: (a) contacting a sample containing DNA derived from the soybean plant, plant part, plant seed, or plant cell with a probe set including at least a first probe that specifically hybridizes to soybean event Gm_CSM63714 and at least a second probe that specifically hybridizes to soybean genomic DNA disrupted by the insertion of heterologous DNA in soybean event Gm_CSM63714 but does not hybridize to soybean event Gm_CSM63714; and (b) hybridizing the probe set to the sample under stringent hybridization conditions. Detecting hybridization of only the first probe under the hybridization conditions is used to diagnose a soybean plant, plant part, seed, or plant cell that is homozygous for soybean event Gm_CSM63714. Detecting hybridization of both the first probe and the second probe under the hybridization conditions is diagnostic of a soybean plant, plant part, seed, or plant cell heterozygous for the soybean event Gm_CSM63714. An example of a probe set that can be used is the probe set comprising SEQ ID NO: 16 and SEQ ID NO: 21.

[0031] A DNA construct is provided. One example of such a DNA construct is a DNA construct comprising a first expression cassette, a second expression cassette, a third expression cassette, and a fourth expression cassette. The first expression cassette comprises, in operable linkage, i) a ubiquitin (UB3) promoter, leader, and intron sequence derived from Arabidopsis thaliana, ii) a chloroplast transit peptide coding sequence of APG6 (Albino and Pale Green 6) derived from Arabidopsis thaliana, iii) a codon-optimized dicamba monooxygenase coding sequence (DMO) derived from Stenotrophomonas maltophilia, and iv) a 3'UTR sequence of the aluminum-induced Sali3-2 protein derived from Medicago truncatula. The second expression cassette comprises, in operable linkage, i) promoter and intron sequences derived from multiple promoter and intron sequences from Arabidopsis thaliana, ii) a codon-optimized phosphinothricin N-acetyltransferase (PAT) coding sequence from Streptomyces viridochromogene, and iii) a 3'UTR of a small heat shock protein (Hsp20) from Medicago truncatula. The third expression cassette comprises, in operable linkage, i) a polyubiquitin (UBQ10) promoter, leader, and intron sequence from Arabidopsis thaliana, ii) an alpha-ketoglutarate-dependent non-heme iron dioxygenase variant coding sequence (FT_Tv7) from Sphingobium herbidovorans, and iii) a 3'UTR sequence of a putative protein from Medicago truncatula. The fourth expression cassette comprises, in operable linkage, i) a promoter, leader, and intron sequence derived from multiple promoter, leader, and intron sequences of Arabidopsis thaliana, ii) a codon-optimized coding sequence for triketone dioxygenase (TDO) from Oryza sativa, and iii) a 3'UTR sequence derived from multiple 3'UTR sequences of Zea mays. For example, the DNA construct can comprise SEQ ID NO:9.The DNA construct may further comprise a) at least 50 contiguous nucleotides of SEQ ID NO:11 or SEQ ID NO:98, and / or b) at least 50 contiguous nucleotides of SEQ ID NO:12 or SEQ ID NO:99 at the 5' or 3' end of the construct.

[0032] Another DNA construct is provided. The DNA construct comprises a first expression cassette, a second expression cassette, a third expression cassette, and a fourth expression cassette. The first expression cassette comprises a dicamba monooxygenase coding sequence, the second expression cassette comprises a phosphinothricin N-acetyltransferase (PAT) coding sequence, the third expression cassette comprises an alpha-ketoglutarate-dependent non-heme iron dioxygenase variant coding sequence (FT_Tv7) capable of degrading 2,4-D, and the fourth expression cassette comprises a triketone dioxygenase (TDO) coding sequence. The DNA construct further comprises (i) at least 50 contiguous nucleotides of SEQ ID NO:11 or SEQ ID NO:98 and / or (ii) at least 50 contiguous nucleotides of SEQ ID NO:12 or SEQ ID NO:99 at the 5' or 3' end of the construct.

[0033] Further provided are DNA constructs comprising a polynucleotide having a sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the entire length of SEQ ID NO: 9. The DNA construct comprises (i) at least 50 contiguous nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98, and / or (ii) at least 50 contiguous nucleotides of SEQ ID NO: 12 or SEQ ID NO: 99 at the 5' or 3' end of the construct.

[0034] Any of the DNA constructs described herein may comprise at least 50 contiguous nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98 at the 5' end of the construct and at least 50 contiguous nucleotides of SEQ ID NO: 12 or SEQ ID NO: 99 at the 3' end of the construct. Any of the DNA constructs described herein may comprise at the 5' end of the construct one or more nucleotide sequences selected from SEQ ID NOs: 58-77 and 100-139. Any of the DNA constructs described herein may comprise at the 3' end of the construct one or more nucleotide sequences selected from SEQ ID NOs: 78-97 and 140-179.

[0035] A soybean plant, plant seed, plant part, or plant cell comprising any of the DNA constructs described herein is provided.

[0036]

[0003] Provided is a method for improving tolerance in soybean plants to at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, inhibitors of glutamine synthetase, β-triketone HPPD inhibitors, and any combination thereof. The method comprises: a) inserting any of the DNA constructs described herein into the genome of a soybean cell; b) generating a soybean plant from the soybean cell; and c) selecting a soybean plant containing the DNA construct. The selecting step may comprise treating the soybean cell or plant with an effective amount of at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, inhibitors of glutamine synthetase, β-triketone HPPD inhibitors, and any combination thereof. The benzoic acid-type auxin can include dicamba, the phenoxy-type auxin can include 2,4-D, the glutamine synthetase inhibitor can include glufosinate, and the β-triketone HPPD inhibitor can be selected from the group consisting of mesotrione, benzobicyclon (BBC), tembotrione, sulcotrione, tefuryltrione, and any combination thereof. For example, the β-triketone HPPD inhibitor can include mesotrione.

[0037] Also provided is a soybean plant, plant seed, plant part, or plant cell that is tolerant to herbicides having at least three different herbicide modes of action at a single genomic location, wherein the soybean plant, plant seed, plant part, or plant cell comprises any of the DNA constructs described herein.

[0038] Also provided is a soybean plant, plant seed, plant part, or plant cell that is tolerant to at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, glutamine synthetase inhibitors, β-triketone HPPD inhibitors, and any combination thereof. The soybean plant, plant seed, plant part, or plant cell contains any of the DNA constructs provided herein. The benzoic acid-type auxin can include dicamba, the phenoxy-type auxin can include 2,4-D, the glutamine synthetase inhibitor can include glufosinate, and the β-triketone HPPD inhibitor can be selected from the group consisting of mesotrione, benzobicyclon (BBC), tembotrione, sulcotrione, tefuryltrione, and any combination thereof. For example, the β-triketone HPPD inhibitor can be mesotrione.

[0039] Any of the soybean seeds, plants, plant parts, or cells can be obtained by any of the methods provided herein for improving tolerance in a soybean plant to at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, inhibitors of glutamine synthetase, β-triketone HPPD inhibitors, and any combination thereof.

[0040] Any of the soybean plants, plant seeds, plant parts, or plant cells can be tolerant to at least an additional herbicide. For example, the at least an additional herbicide can include glyphosate.

[0041] A method for producing progeny soybean plants comprising the soybean event Gm_CSM63714 is provided. The method includes: a) sex-crossing a first soybean plant comprising the soybean event Gm_CSM63714 with itself or with a second soybean plant; b) collecting one or more seeds produced from the cross; c) growing the one or more seeds to produce one or more progeny plants; and d) selecting at least a first progeny plant or seed comprising the soybean event Gm_CSM63714. Inbred and hybrid soybean plants and seeds comprising the soybean event Gm_CSM63714 produced by the method are also provided.

[0042] Non-living and non-regenerable soybean plant material is also provided, which may include any of the recombinant DNA molecules or DNA constructs described herein.

[0043] Also provided is non-living or non-regenerable soybean plant material comprising soybean event Gm_CSM63714, a representative sample of seeds comprising said soybean event Gm_CSM63714 having been deposited under ATCC Accession No. PTA-127099.

[0044] Commercial products are also provided. Examples of such commercial products are those that contain any of the recombinant DNA molecules or DNA constructs described herein. The commercial products can be produced from transgenic soybean plants, plant parts, plant seeds, or plant cells that contain the soybean event Gm_CSM63714. The commodity products can include, for example, whole seeds or processed seeds, viable or non-viable seeds, viable plant parts (e.g., roots and leaves), viable plant cells, processed plant parts, processed plant tissue, dried plant tissue, dried plant parts, frozen plant tissue, frozen plant parts, human foods such as soybean oil, soy milk, soy flour, ground soybeans, soy protein, soy protein concentrate, plant protein hydrolysates, processed soy protein, lecithin, curd, tofu, vegetable soy (edamame), bean sprouts, soy film (yuba), roasted soybeans, miso, tempeh, soy sauce, or natto, plant parts processed for animal feed such as soybean meal, soy fiber, biodiesel, biocomposite building materials such as particle board, laminated plywood, or lumber products, soybean oil-based solvents, soybean oil-based industrial lubricants, soy ink, soy candles, soy crayons, soy-based hydraulic fluid, or soy-based foam.

[0045] Methods for producing a commodity product are provided, the methods comprising: a) obtaining a transgenic soybean plant, plant part, or plant seed comprising soybean event Gm_CSM63714, and b) producing a commodity product from the transgenic soybean plant, plant part, or plant seed.

[0046] A method for controlling, preventing, or reducing the occurrence of herbicide-resistant weeds is provided. The method comprises cultivating, in a crop growing environment, soybean plants containing a transgene at a single genomic location that confers tolerance to herbicides having at least three different herbicide mechanisms of action. The at least three different herbicide mechanisms of action may be selected from the group consisting of inhibition of glutamine synthetase, inhibition of 4-hydroxyphenylpyruvate dioxygenase (HPPD), phenoxy-type auxins, and benzoate-type auxins.

[0047] Also provided is a method for controlling, preventing, or reducing the occurrence of herbicide-resistant weeds. The method includes: a) cultivating, in a crop growing environment, a soybean plant containing any of the DNA constructs described herein for conferring tolerance to herbicides having at least three different herbicide modes of action at a single genomic location; and b) applying to the crop growing environment at least one herbicide selected from the group consisting of dicamba, glufosinate, 2,4-D, β-triketone HPPD inhibitors, and any combination thereof, wherein the soybean plant is tolerant to the at least one herbicide. The soybean plant may further contain at least one additional transgene for an additional herbicide mode of action. For example, the at least one additional transgene may be EPSPS for conferring tolerance to glyphosate. The EPSPS transgene may contain a polynucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 57.

[0048] A method for reducing soybean breeding loci by inserting transgenes at a single genomic location for tolerance to at least three different classes of herbicides is provided. The transgenes can be inserted as a single molecularly linked transgenic insert. The single molecularly linked transgenic insert can confer commercial-level tolerance to at least one herbicide for each herbicide mechanism of action.

[0049] Further provided are soybean plants, plant cells, plant parts, and plant seeds. The soybean plants, plant cells, plant parts, and plant seeds contain a recombinant DNA construct integrated into chromosome 13. The recombinant DNA construct confers tolerance to at least one herbicide selected from the group consisting of benzoic acid-type auxins, phenoxy-type auxins, glutamine synthetase inhibitors, β-triketone HPPD inhibitors, and any combination thereof. The recombinant DNA construct is integrated into the chromosome at a location flanked by at least 50 consecutive nucleotides of SEQ ID NO:11 and 50 consecutive nucleotides of SEQ ID NO:12. The benzoic acid-type auxin can include dicamba, the phenoxy-type auxin can include 2,4-D, the glutamine synthetase inhibitor can include glufosinate, and the β-triketone HPPD inhibitor can be selected from the group consisting of mesotrione, benzobicyclon (BBC), tembotrione, sulcotrione, tefuryltrione, and any combination thereof. For example, the β-triketone HPPD inhibitor can be mesotrione. The at least 50 contiguous nucleotides of SEQ ID NO:11 can comprise one or more nucleotide sequences selected from SEQ ID NOs:58-77. The at least 50 contiguous nucleotides of SEQ ID NO:12 can comprise one or more nucleotide sequences selected from SEQ ID NOs:78-97. [Brief explanation of the drawings]

[0050] [Figure 1]1 shows the sequence of soybean event Gm_CSM63714. The horizontal lines correspond to the positions of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:11, and SEQ ID NO:12 relative to SEQ ID NO:10. The horizontal arrows (SEQ ID NO:14 and SEQ ID NO:15) represent the approximate location of an exemplary primer pair that can be used to detect soybean event Gm_CSM63714. The horizontal line labeled SEQ ID NO:16 represents the approximate location of an exemplary DNA probe that can be used to detect soybean event Gm_CSM63714. "RB" refers to the right border of the Agrobacterium T-DNA, and "LB" refers to the left border of the Agrobacterium T-DNA. "P" represents a promoter element, "L" represents a leader (5'UTR) element, "I" represents an intron element, "CTP" represents a chloroplast transit peptide element, and "T" represents a 3'UTR. "DMO" represents the dicamba monooxygenase coding element, "PAT" represents the phosphinothricin N-acetyltransferase coding element, "FT-Tv7" represents the dioxygenase variant coding element, and "TDO" represents the triketone dioxygenase coding element. The horizontal line labeled SEQ ID NO: 13 represents the relative placement or position in the wild-type soybean genome into which the transgene (SEQ ID NO: 9) was inserted. The dashed line represents a 40-nucleotide deletion in the soybean genome at the transgene (SEQ ID NO: 9) insertion site. [Figure 2] The approximate timing of the creation, greenhouse and field testing, molecular characterization, and selection of soybean event Gm_CSM63714 is shown.

[0051] A brief description of arrays SEQ ID NO:1 is a 30-nucleotide sequence representing the 5' junction region of soybean genomic DNA and the integrated transgene insert. SEQ ID NO:1 corresponds to nucleotide positions 986 to 1,015 of SEQ ID NO:10.

[0052] SEQ ID NO:2 is a 30-nucleotide sequence representing the 3' junction region of the integrated transgene insert and soybean genomic DNA. SEQ ID NO:2 corresponds to nucleotide positions 11,182 to 11,211 of SEQ ID NO:10.

[0053] SEQ ID NO:3 is a 60-nucleotide sequence representing the 5' junction region of soybean genomic DNA and the integrated transgene insert. SEQ ID NO:3 corresponds to nucleotide positions 971 to 1,030 of SEQ ID NO:10.

[0054] SEQ ID NO:4 is a 60 nucleotide sequence representing the 3' junction region of the integrated transgene insert and soybean genomic DNA. SEQ ID NO:4 corresponds to nucleotide positions 11,167 to 11,226 of SEQ ID NO:10.

[0055] SEQ ID NO:5 is a 100-nucleotide sequence representing the 5' junction region of soybean genomic DNA and the integrated transgene insert. SEQ ID NO:5 corresponds to nucleotide positions 951 to 1,050 of SEQ ID NO:10.

[0056] SEQ ID NO:6 is a 100 nucleotide sequence representing the 3' junction region of the integrated transgene insert and soybean genomic DNA. SEQ ID NO:6 corresponds to nucleotide positions 11,147 to 11,246 of SEQ ID NO:10.

[0057] SEQ ID NO:7 is a 1,050 nucleotide sequence representing the 5' genomic flanking region of soybean genomic DNA and the 50 bp integrated transgene insert. SEQ ID NO:7 corresponds to nucleotide positions 1 to 1,050 of SEQ ID NO:10.

[0058] SEQ ID NO:8 is a 1,050 nucleotide sequence representing the 50 bp 3' junction region of the integrated transgene insert and the 3' genomic flanking region of soybean genomic DNA. SEQ ID NO:8 corresponds to nucleotide positions 11,147 to 12,196 of SEQ ID NO:10.

[0059] SEQ ID NO: 9 is the 10,196 nucleotide sequence corresponding to the transgene insert of soybean event Gm_CSM63714. SEQ ID NO: 9 corresponds to nucleotide positions 1,001 to 11,196 of SEQ ID NO: 10.

[0060] SEQ ID NO:10 is a 12,196 nucleotide sequence corresponding to the contiguous nucleotide sequence of the 5' soybean genomic DNA sequence (SEQ ID NO:11), the transgene insert in event Gm_CSM63714 (SEQ ID NO:9), and the 3' soybean genomic DNA sequence (SEQ ID NO:12).

[0061] SEQ ID NO:11 is a 1,000 nucleotide sequence representing the 5' flanking soybean genomic DNA to the transgene insert (SEQ ID NO:9). SEQ ID NO:11 corresponds to nucleotide positions 1 to 1,000 of SEQ ID NO:10.

[0062] SEQ ID NO:12 is a 1,000 nucleotide sequence representing the 3' flanking soybean genomic DNA after the transgene insert (SEQ ID NO:9). SEQ ID NO:12 corresponds to nucleotide positions 11,197 to 12,196 of SEQ ID NO:10.

[0063] SEQ ID NO:13 is a 2,040 nucleotide sequence representing wild-type soybean genomic DNA at the position where the transgenic sequence (SEQ ID NO:9) was inserted into event Gm_CSM63714. A 40 nucleotide fragment of SEQ ID NO:13 (nucleotides 1,001 to 1,040) was deleted in event Gm_CSM63714 by the insertion of the T-DNA.

[0064] SEQ ID NO: 14 is a 30-nucleotide sequence corresponding to a thermal amplification primer designated SQ21524 used in event-specific and zygosity assays to detect DNA of the soybean event Gm_CSM63714 in samples, and is identical to the nucleotide sequence corresponding to positions 11,075 to 11,104 of SEQ ID NO: 10.

[0065] SEQ ID NO: 15 is a 27-nucleotide sequence corresponding to a thermal amplification primer designated SQ51589 used in event-specific and zygosity assays to detect DNA of the soybean event Gm_CSM63714 in samples, and is identical to the reverse complementary sequence of the nucleotide sequence corresponding to positions 11,201 to 11,227 of SEQ ID NO: 10.

[0066] Sequence number 16 is a 16-nucleotide sequence corresponding to a probe called PB10269 used in event-specific assays and zygosity assays to detect DNA of the soybean event Gm_CSM63714 in samples, and is identical to the nucleotide sequence corresponding to positions 11,108 to 11,123 of sequence number 10.

[0067] SEQ ID NO: 17 is the 20 nucleotide sequence corresponding to the thermal amplification primer designated SQ546 used as an internal control for the event assay of soybean event Gm_CSM63714, which hybridizes to a region of the soybean genome.

[0068] SEQ ID NO: 18 is the 20 nucleotide sequence corresponding to the thermal amplification primer designated SQ549 used as an internal control for the event assay of soybean event Gm_CSM63714, which hybridizes to a region of the soybean genome.

[0069] SEQ ID NO: 19 is a 16 nucleotide sequence corresponding to a probe called PB50207 used as an internal control for the event assay of soybean event Gm_CSM63714, which hybridizes to a region of the soybean genome.

[0070] SEQ ID NO:20 is the 26-nucleotide sequence corresponding to the thermal amplification primer designated SQ52071 used in the zygosity assay of the DNA of soybean event Gm_CSM63714 in the sample, which hybridizes to a region of the soybean genome corresponding to positions 949-974 of SEQ ID NO:10.

[0071] SEQ ID NO: 21 is the 16 nucleotide sequence corresponding to the probe designated PB50681 used in a zygosity assay of the DNA of soybean event Gm_CSM63714 in a sample, which hybridizes to a region of the soybean genome deleted by the T-DNA insertion.

[0072] SEQ ID NOs:22-43 are the nucleotide sequences of the genetic elements in the transgenic insert of soybean event Gm_CSM63714 and are further described in Table 1 below.

[0073] SEQ ID NOs: 44-45 are the nucleotide and amino acid sequences, respectively, of Cas12a of Lachnospiraceae bacterium ND2006 (LbCas12a, also known as LbCpf1).

[0074] SEQ ID NO: 46 is the amino acid sequence of LbCas12a_V1 (G532R / K595R).

[0075] SEQ ID NO: 47 is the amino acid sequence of LbCas12a_V2 (G532R / K538V / Y542R).

[0076] SEQ ID NO: 48 is the amino acid sequence of Cas12a (FnCas12a) of Francisella novicida.

[0077] SEQ ID NO: 49 is the nucleotide sequence of the gRNA repeat of LbCas12a.

[0078] SEQ ID NO: 50 is the nucleotide sequence of the gRNA repeat of FnCas12a.

[0079] SEQ ID NO: 51 is the nucleotide sequence of gRNA gRNA_5F-65.

[0080] SEQ ID NO: 52 is the nucleotide sequence of gRNA gRNA_TI-605.

[0081] SEQ ID NO: 53 is the nucleotide sequence of gRNA gRNA_TI-934.

[0082] SEQ ID NO: 54 is the nucleotide sequence of gRNA gRNA_TI-946.

[0083] SEQ ID NO: 55 is the nucleotide sequence of gRNA gRNA_3F-41.

[0084] SEQ ID NOs: 56 and 57 are the codon-optimized coding sequence and amino acid sequence, respectively, of the aroA gene (also known as 5-enoylpyruvinylshikimate-3-phosphate synthase (EPSPS)) derived from Agrobacterium strain CP4.

[0085] SEQ ID NOs: 58-77 are the sequences of 50 nucleotides in the 5' flanking genomic sequence of event Gm_CSM63714.

[0086] SEQ ID NOs: 78-97 are the sequences of 50 nucleotides in the 3' flanking genomic sequence of event Gm_CSM63714.

[0087] SEQ ID NO:98 is a 5,000 nucleotide sequence representing soybean genomic DNA adjacent to the transgenic insert at its 5' end. Nucleotides 4,001-5,000 of SEQ ID NO:98 are identical to nucleotides 1-1,000 of SEQ ID NO:11. The remaining nucleotides of SEQ ID NO:98 (nucleotides 1-4,000) are based on the genomic sequence of the Williams 82 soybean variety.

[0088] SEQ ID NO:99 is a 5,000 nucleotide sequence representing soybean genomic DNA adjacent to the transgenic insert at its 3' end. Nucleotides 1-1,000 of SEQ ID NO:99 are identical to nucleotides 1-1,000 of SEQ ID NO:12. The remaining nucleotides of SEQ ID NO:99 (nucleotides 1,001-5,000) are based on the genomic sequence of the Williams 82 soybean variety.

[0089] SEQ ID NOs:100-139 are the sequence of an additional 50 nucleotides in the 5' flanking genomic sequence of event Gm_CSM63714, based on the genomic sequence of Williams 82 soybean variety.

[0090] SEQ ID NOs:140-179 are the sequence of an additional 50 nucleotides in the 3' flanking genomic sequence of event Gm_CSM63714, based on the genomic sequence of Williams 82 soybean variety. DETAILED DESCRIPTION OF THE INVENTION

[0091] The following definitions, explanations, and methods are provided to better define the present invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the relevant art.

[0092] Herbicide tolerance is an important agronomic trait for effective weed control to maintain favorable crop growing conditions and crop yields, and is achieved by engineering herbicide resistance transgenes into crops using modern plant biotechnology techniques. The soybean event Gm_CSM63714 provides tolerance to five different herbicide chemistries through distinct mechanisms of action for weed control and herbicide-resistant herbicide management.

[0093] Soybean event Gm_CSM63714 is provided. Event Gm_CSM63714 was produced by Agrobacterium-mediated transformation of soybean seed-derived embryonic explants with a DNA construct containing two T-DNAs. The first T-DNA encodes dicamba monooxygenase (DMO), phosphinothricin N-acetyltransferase (PAT), alpha-ketoglutarate-dependent non-heme iron dioxygenase variant (FT_Tv7, also referred to as FT_T.1), and triketone dioxygenase (TDO), which are responsible for the production of dicamba (3,6-dichloro-2-methoxybenzoic acid), glufosinate (2-amino-4-(hydroxymethylphosphinyl)butanoic acid, 2,4-D (2,4-dichlorophenoxyacetic acid), and ketone dioxygenase (TDO), respectively. The second T-DNA contains four transgene cassettes that confer resistance to β-triketone herbicides (inhibitors of HPPD), such as mesotrione (2-[4-(methylsulfonyl)-2-nitrobenzoyl]-1,3-cyclohexanedione). The second T-DNA contains two transgene cassettes, one encoding an aminoglycoside (3") adenylyltransferase (aadA) for selection of transformed soybean cells using spectinomycin / streptomycin as selection, and the other encoding sucrose phosphorylase (splA) from Agrobacterium tumefaciens (GenBank accession AE009432), which serves as a marker gene to identify the presence of the linked selectable marker.

[0094] Plant transformation techniques, such as Agrobacterium-mediated or biolistic transformation, can be used to randomly insert foreign DNA (also known as transgenic DNA) into plant cell chromosomes to produce genetically engineered plant cells, also called "transgenic" or "recombinant" cells. These transformation techniques can be used to transform many individual cells, each of which produces a unique "transgenic event" or "event" resulting from the random insertion of foreign DNA into the genome. Transgenic plants can then be regenerated from the individual transgenic cells. As a result, all cells of the transgenic plant contain the uniquely inserted transgenic event as a stable part of its genome. The transgenic plants can then be used to produce progeny plants, each of which contains a unique transgenic event. The term "transgenic" refers to a plant, plant part, plant cell, seed, progeny plant, or DNA molecule, construct, or sequence containing a transgene. For example, a "transgenic cell" refers to a cell containing a transgene.

[0095] The soybean event Gm_CSM63714 was produced and identified through a complex research and development process. This process included: (i) design and selection of a DNA construct containing four transgene cassettes based on the design and testing of individual transgene cassettes combining different expression elements, followed by design and testing of different combinations of the individual transgene cassettes in different positions and orientations relative to each other; (ii) transformation of thousands of soybean cells with the DNA construct composed of the four expression cassettes; (iii) regeneration of large populations of transgenic plants, each containing a unique transgenic event; and (iv) rigorous multi-year selection of constructs and events, including molecular characterization of the large number of transgenic events and greenhouse and field testing of thousands of events across tens of thousands of plants for herbicide resistance efficacy and agronomic performance in different locations and different terrains. The soybean event Gm_CSM63714 was thus produced and selected as a unique, superior event useful for large-scale agronomic commercial purposes. FIG. 2 shows the approximate timing of the creation, greenhouse and field testing, molecular characterization, and selection of the soybean event Gm_CSM63714.

[0096] Detailed molecular characterization was performed on the transgenic event. Event Gm_CSM63714 was selected based on stringent molecular criteria as well as other selection criteria, such as herbicide resistance efficacy and agronomic productivity. The results of this molecular analysis confirmed the following: (1) Event Gm_CSM63714 contains a single T-DNA insert with one copy of the transgenic insert containing the four expression cassettes; (2) No additional elements from the transformation construct other than the four expression cassettes, such as the backbone sequence of the transformation construct or the second T-DNA containing the aadA / splA cassette, are present between the left and right borders of the first T-DNA; (3) The transgenic DNA was inserted into an intergenic region, far from any endogenous genes or repetitive regions; and (4) the transgenic event produced transcripts and proteins of sizes consistent with the four transgenes by Northern and Western hybridization, respectively. Further DNA sequence analysis was performed to (1) identify the 5' and 3' junctions of the transgenic insert with the plant genome, (2) confirm the organization of elements within the insert, and (3) verify the complete nucleotide sequence of the inserted transgenic DNA (SEQ ID NO: 9). Additionally, primers and probes were designed and a thermal amplification assay was developed to produce specific amplicons used to diagnose the presence of event Gm_CSM63714 in a sample. As used herein, the 5' and 3' designations for the junction, orientation, and side of the insertion of a transgenic event refer to the 5' to 3' direction of the transgene, with the 5' junction and genomic sequence being upstream of the transgene and the 3' junction and genomic sequence being downstream of the transgene.

[0097] As used herein, an "expression cassette" or "cassette" or "transgene cassette" is a recombinant DNA molecule or sequence that contains a combination of different elements for expressing RNA and / or protein encoded by the coding sequence of a transgene in a transformed plant cell or transformed plant containing the transgene. As provided herein, an "expression cassette" or "cassette" or "transgene cassette" comprises one or more regulatory element(s) operably linked to a coding or transcribable DNA sequence. The regulatory elements may include a promoter, leader, 5' untranslated region (5' UTR), introns, and / or 3' untranslated region (3' UTR) region. The "expression cassette" or "cassette" or "transgene cassette" is recombinant and heterologous with respect to the transformed plant cell genome. For purposes of this disclosure, such an "expression cassette" or "cassette" or "transgene cassette" is a recombinant DNA molecule or sequence that encodes a protein that confers tolerance to at least one class of herbicide as described herein. Table 1 provides a list of the genetic elements contained in the four transgene cassettes in the transgenic insert of soybean event Gm_CSM63714 (SEQ ID NO: 9).

[0098] Insertion of transgenic DNA into the genome of a soybean plant is accomplished by plant transformation methods known in the art, creating a new transgenic genomic DNA sequence known as a "transgenic event" or "event." The DNA sequence of the event consists of the inserted foreign DNA (termed the "transgenic insert") and genomic DNA adjacent to, or "flanking," the transgenic insert on either side of the insertion site. As used herein, the term "flanking," with respect to a transgenic event, refers to the plant's genomic sequence(s) adjacent to the transgenic DNA insert in the genome of the transformed plant, plant part, plant tissue, or plant cell that contains the transgenic event at the 5' and / or 3' end(s) of the transgenic event's insertion. Similarly, "flanking DNA" refers to a length of genomic DNA sequence adjacent to the transgenic DNA insert in the genome of the transformation event at the 5' and / or 3' end(s) of the insertion. Thus, "5'-flanking" refers to the maize genomic DNA sequence adjacent to and upstream (or on the 5'-end) of the transgenic DNA insert. For example, "5'-flanking" can include the maize genomic DNA sequence immediately adjacent and upstream (on the 5'-end) of the transgenic insert, or any maize genomic DNA sequence upstream (on the 5'-end) of the transgenic insert that is not immediately adjacent to the transgenic insert but is within about 5000 nucleotides, about 3000 nucleotides, or about 1000 nucleotides upstream of the transgenic insert. Similarly, "3'-flanking" refers to the maize genomic DNA sequence adjacent to and downstream (or on the 3'-end) of the transgenic insert.For example, "3'-flanking" can include maize genomic DNA sequences immediately adjacent and downstream (toward the 3' end) of the transgenic insert, or any maize genomic DNA sequence downstream (toward the 3' end) of the transgenic insert that is not immediately adjacent to the transgenic insert but is within about 5,000, 3,000, or 1,000 nucleotides downstream of the transgenic insert. The DNA sequence of the event is unique and specific to the event and can be easily identified when compared to other DNA sequences, for example, sequences of other events or sequences of untransformed maize genomic DNA. Soybean event Gm_CSM63714 has a novel and unique DNA sequence provided as SEQ ID NO: 10, which comprises a contiguous sequence including the 5' maize genomic flanking sequence provided as SEQ ID NO: 11, the transgenic insert sequence provided as SEQ ID NO: 9, and the 3' maize genomic flanking sequence provided as SEQ ID NO: 12 (Figure 1). Thus, the soybean event Gm_CSM63714 is an integral part of the chromosome of transgenic soybean cells and plants containing the event, and is therefore a DNA molecule that can be fixed and passed on to progeny cells and plants. As further described in the Examples below, various gene editing tools exist that allow for modification of the transgenic insert and / or adjacent genomic DNA of the soybean event Gm_CSM63714, for example, deleting, inserting, translocating, or substituting nucleic acid sequence(s), yet the event is specifically characterized by the presence of heterologous DNA at a specific location within the genome occupied by the soybean event Gm_CSM63714 relative to the adjacent regions of the native soybean genome. [Table 1-1] [Table 1-2] [Table 1-3]

[0099] Progeny of the original transformed cells and plants containing the soybean event Gm_CSM63714 are provided. Such progeny can be produced by selfing a soybean plant containing the soybean event Gm_CSM63714, or by sex-crossing or outcrossing between a soybean plant containing the soybean event Gm_CSM63714 and another plant that may or may not contain the event, or by any other method known in the art, including any plant cell or tissue culture method, and the progeny contain the soybean event Gm_CSM63714. The other plant may be a transgenic or non-transgenic plant containing the same and / or different event(s), and each parent plant in a cross or outcross may be the same germplasm or breeding line or a different germplasm or breeding line. The soybean event Gm_CSM63714 is passed down through each generation from the original parent to the progeny. A "transgenic plant" or "plant" may therefore be the original transformed plant regenerated from a transformed plant cell and containing transgenic DNA and events, or a progeny plant of the original transformed plant, which may be separated from the transformant one or more times over and retains the transgenic DNA and events in the same specific location and sequence relationship within the plant's genome. The transformant or progeny plant may be homozygous or heterozygous for the Gm_CSM63714 event. Furthermore, a "transgenic plant" may include a plant having a transgene stably inserted into the genome of at least one cell of the plant (i.e., the soybean event Gm_CSM63714 in at least one cell of the plant), and the plant may be chimeric or non-chimeric with respect to the transgene and / or event. A transgenic plant is chimeric with respect to a transgene if not all cells of the plant contain the transgene.

[0100] This disclosure describes the introduction of event Gm_CSM63714 into soybean, and thus the term "soybean event Gm_CSM63714" is used herein to refer to that event. However, one of skill in the art will understand that event Gm_CSM63714 can be introduced into other varieties or related soybean species, such as Glycine soja and Glycine tomentella, by crossing.

[0101] Soybean event Gm_CSM63714 confers resistance to soybean cells, plants, plant parts, seeds, and progeny containing the event to benzoate-type auxin herbicides, such as dicamba, which function to increase the plant's growth rate, resulting in senescence and cell death; inhibitors of glutamine synthetase, such as glufosinate; phenoxy-type auxins, such as 2,4-dichlorophenoxyacetic acid (2,4-D), which mimic the action of plant growth regulator auxins, resulting in unrestrained growth and ultimately death in susceptible plants; and β-triketone herbicides, such as mesotrione.

[0102] Soybean event Gm_CSM63714 is characterized as a single-copy insertion at a locus in the soybean genome, resulting in two new loci or junction sequences (e.g., the sequences set forth in SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, and 8) spanning the inserted DNA and portions of the soybean genomic DNA that are not known to naturally appear or exist in the soybean genome or other transgenic soybean events, i.e., unique to event Gm_CSM63714. SEQ ID NOs: 1, 3, 5, and 7 span the 5' junction of the soybean genomic sequence and the transgenic DNA insert, and SEQ ID NOs: 2, 4, 6, and 8 span the 3' junction. These junction sequences are useful for detecting the presence of event Gm_CSM63714 in soybean cells, seeds, plants, plant parts, progeny, and plant products, such as commercial soybean crops. Polynucleotide or DNA molecular probes and / or primer pairs are described herein for use in identifying the presence of these various junction sequences in biological samples that contain, are derived from, or are suspected to contain or be derived from soybean cells, seeds, plants, plant parts, progeny, or commercial products containing event Gm_CSM63714.

[0103] As used herein, the term "derived from" or "derived from" in reference to a particular DNA molecule, amplicon, or sequence in the context of a soybean plant, plant part, seed, progeny, cell, and / or soybean plant product, e.g., a commodity product, means that the DNA molecule, amplicon, or sequence is harvested, purified, isolated, or produced, directly or indirectly, from such soybean plant, plant part, seed, progeny, cell, and / or soybean plant product, e.g., a commodity product. Alternatively, the term "derived from" or "derived from" in reference to a soybean plant, plant part, seed, progeny, or cell in reference to a soybean plant product, e.g., a commodity product, means that the soybean plant product is harvested, purified, isolated, or produced, directly or indirectly, from such soybean plant, plant part, seed, progeny, or cell.

[0104] "Detectable" refers to the ability of a particular DNA molecule, segment, or sequence to be detected in a sample by amplification and determination of its presence, size, or sequence, e.g., DNA sequence analysis, and / or binding of a probe to said target DNA molecule, segment, or sequence.

[0105] The term "sample" is intended to refer to any composition that contains or is derived from a biological sample, source, or material, either directly or indirectly. The sample may generally contain soybean DNA and / or substantially or completely pure, purified, or isolated soybean DNA. A "biological sample" includes biological materials, including, but not limited to, DNA obtained or derived directly or indirectly from the genome of soybean cells, tissues, seeds, plants, plant parts, and / or soybean plant product(s), such as commodity product(s). Such soybean cells, tissues, seeds, plants, plant parts, and / or soybean plant product(s), such as commodity product(s), may contain soybean event Gm_CSM63714, or DNA molecule(s) and / or DNA segment(s) comprising soybean event Gm_CSM63714. In some embodiments, the sample or biological sample may comprise soybean cell(s), soybean tissue(s), soybean seed(s), soybean plant(s), soybean plant part(s), and / or soybean plant product(s) whose cells or cell membranes have been disrupted (e.g., disrupted or liberated) to release the contents of the soybean cell(s) containing genomic DNA or proteins and / or to make the contents of the soybean cell(s) containing genomic DNA or proteins accessible or usable for assay or testing. "Direct" refers to obtaining DNA directly from the soybean genome by one of skill in the art by disrupting the soybean cells (or obtaining a soybean sample containing disrupted soybean cells) and exposing or using genomic DNA or proteins from the soybean cells for detection. "Indirectly" refers to a person skilled in the art obtaining a target or specific reference DNA contained in a particular sample (e.g., the novel and unique junction segment(s) described herein used to diagnose the presence of the event Gm_CSM63714) directly through the disruption of soybean cells or by a method other than obtaining a soybean sample containing disrupted soybean cells.Such indirect means include, but are not limited to, the amplification of DNA segments containing DNA sequences targeted by specific probe(s) and / or primer set(s) designed to specifically bind to or in the vicinity of the target sequence, or the amplification of DNA segments containing all or a portion of the target sequence that can be measured and characterized (e.g., measured by displacement or separation from other segments of DNA and / or by identification in a validated matrix, such as an agarose or acrylamide gel, or characterized by direct sequence analysis of the amplicon(s), or by cloning the amplicon(s) into vector(s) and directly sequencing the inserted amplicon(s) present within such vector(s)).

[0106] As used herein, the term "recombinant" refers to non-naturally occurring DNA, protein, combination, or organism created by human intervention that is not found or does not exist in nature. As used herein, a "recombinant DNA molecule" is a DNA molecule that contains a combination of DNA molecules that do not occur together in nature and are the result of human intervention. Two or more elements of such a combination of DNA sequences may be operably linked to each other. For example, a recombinant DNA molecule may include a combination of at least two DNA molecules that are heterologous to each other, such as a DNA molecule containing a coding sequence operably linked to a heterologous promoter and / or other regulatory expression element(s), and / or a transgene, and heterologous plant genomic DNA flanking the transgene, and / or a DNA molecule containing a polynucleotide sequence that is artificially synthesized and deviates from any polynucleotide sequence normally found in nature. A recombinant DNA molecule may include all or a portion of the junction sequence of the event's genome, and all or a portion of the transgenic insert of the event's genome, and / or may include recombinant or heterologous DNA fragments of soybean event Gm_CSM63714. An example of a recombinant DNA molecule is a DNA molecule comprising at least one polynucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10. As used herein, a "recombinant" with respect to a plant, plant part, seed, plant cell, or progeny is a plant, plant part, seed, plant cell, or progeny that contains a transgenic DNA molecule that does not normally occur in nature, is the result of human intervention, and has been stably integrated into the genome of the plant, plant part, seed, plant cell, or progeny. As a result of such genomic insertion, the recombinant or transgenic plant, plant part, seed, plant cell, or progeny is novel and distinct from any related wild-type or naturally occurring plant, plant part, seed, plant cell, or progeny. An example of a recombinant plant is a soybean plant comprising soybean event Gm_CSM63714.

[0107] As used herein, the term "transgene" refers to a DNA molecule that has been artificially integrated into the genome of an organism as a result of human intervention, for example, by plant transformation methods. The transgene may be heterologous to the organism. As used herein, the term "transgenic insert" refers to a foreign or heterologous DNA that has been inserted into the soybean genome by plant transformation techniques to produce the soybean event Gm_CSM63714. The sequence of the transgenic insert of the soybean event Gm_CSM63714 is provided as SEQ ID NO:9.

[0108] As used herein, the term "heterologous," with respect to a combination of two or more DNA sequences or elements, means that the two or more DNA sequences or elements do not normally exist together in such a combination in nature without human intervention. For example, a DNA molecule can be derived from a first species or a recombinant DNA molecule and inserted into the genome of a second species. The DNA molecule is therefore heterologous to the genome and organism. As used herein, the term "heterologous," with respect to a DNA molecule, construct, sequence, or protein associated with a plant, microorganism, plant cell, or plant genome, means that the DNA molecule, construct, sequence, or protein does not naturally exist as part of such plant, microorganism, plant cell, or plant genome and / or does not naturally exist in the same physical or genomic location, context, or orientation as part of such plant, microorganism, plant cell, or plant genome without human intervention.

[0109] As used herein, the term "chimera" refers to a single DNA molecule produced by fusing a first DNA molecule to a second DNA molecule, where neither the first nor the second DNA molecule is normally found fused to the other. Thus, the chimeric DNA molecule is a novel DNA molecule not normally found in nature. An example of a chimeric DNA molecule is a DNA molecule comprising at least one sequence selected from SEQ ID NOs: 1-10.

[0110] As used herein, the term "isolated" with respect to a molecule means that the molecule is at least partially separated from other molecules with which it is normally associated in its native or natural state. In some embodiments, the term "isolated" refers to a DNA molecule that has been at least partially separated from nucleic acids or polynucleotides or DNA sequence(s) that normally flank and covalently link the sequence of the DNA molecule in its native or natural state. An "isolated" DNA molecule may have a DNA sequence corresponding to a portion of the genome of a plant cell that does not naturally contain the DNA sequence(s) that normally flank and covalently link the sequence to other genomic DNA sequences. Such an "isolated" DNA molecule may contain all or a portion of a transgene and / or transgenic event, which may include the soybean event Gm_CSM63714 described herein or all or a portion of a transgene or expression cassette. A nucleic acid sequence or element naturally found in the DNA of the genome of an organism, e.g., a coding sequence, intron sequence, 5' UTR, promoter sequence, 3' UTR, etc., is not considered "isolated" so long as the element is in the genome of the organism and in the location in the genome in which it is naturally found. However, each of these elements, and subportions of these elements, is "isolated" within the scope of this disclosure so long as the element or subportion is not within the genome of the organism and is not in the location in the genome of the organism in which it is found in nature. An "isolated" DNA molecule may be any recombinant DNA molecule or amplification product or amplicon, and / or may include any DNA sequence that has been removed from its natural or biological state and covalently fused to another DNA molecule or sequence with which it is not naturally associated. Such isolated DNA molecules may be created by using biotechnology techniques, for example, by making recombinant DNA or by integrating a foreign or heterologous DNA molecule into the chromosome of a cell, plant, or seed.Thus, any DNA molecule containing a transgenic, recombinant, chimeric, or artificial nucleotide sequence, transgene, or expression cassette, whether or not these sequences, transgene, or expression cassette are present in the genome of a plant, plant part, plant tissue, plant cell, or progeny, in a plasmid, vector, or construct used to transform a plant cell, or present in detectable amounts in a tissue, progeny, biological sample, or commercial product derived from the plant, plant part, plant tissue, progeny, or plant cell, is considered to be an "isolated" DNA molecule because these sequences do not occur in nature. Recombinant DNA molecules or sequences containing all or a portion of the transgene or junction sequence of the soybean event Gm_CSM63714, or any fragment derived therefrom, are therefore similarly considered to be "isolated." An "isolated" DNA molecule may be extracted or purified from transgenic plant(s), plant part(s), plant cell(s) and / or tissue(s), or may be present in a homogenate, extract or lysate from such transgenic plant(s), plant part(s), plant cell(s) and / or tissue(s), or may be produced as an amplicon or amplification product from plant genomic DNA and / or from DNA extracted or purified from transgenic plant(s), plant part(s), plant cell(s) and / or tissue(s), or a homogenate, extract or lysate from the plant(s), plant part(s), plant cell(s) and / or tissue(s). For the purposes of this disclosure, any transgenic polynucleotide or DNA sequence, i.e., a nucleotide sequence of DNA that is inserted into the genome of a plant or bacterium or that is present in an extrachromosomal vector, is considered to be an "isolated" nucleotide or DNA sequence, whether it is present in a plasmid or similar structure used to transform the cell, present in the genome of the plant or bacterium, or present in detectable amounts in tissues, progeny, biological samples, or commercial products derived from the plant or bacterium.An "isolated" DNA molecule is a chemical or biochemical molecule, regardless of whether the molecule is referred to as a nucleic acid, nucleic acid sequence, polynucleotide sequence, DNA sequence, nucleic acid molecule, polynucleotide molecule, DNA molecule, etc. An "isolated" molecule can provide industrial applicability when present in a plant cell or plant genome, or when present outside a plant cell, thus providing and offering (and is intended to provide and offer) utility regardless of where the molecule is located. As used herein, terms such as "corresponding" or "corresponding," when used in the context of a nucleotide position, mutation, insertion, and / or substitution in any given polynucleotide (e.g., SEQ ID NO: 9) relative to a reference polynucleotide sequence (e.g., SEQ ID NO: 10), refer to the position(s) of the polynucleotide residue(s) in the given sequence that have identity to the residue(s) in the reference polynucleotide sequence when the given polynucleotide is aligned to the reference polynucleotide sequence using a global or local sequence alignment algorithm.

[0111] DNA molecules, fragments, and their corresponding DNA sequences, as well as detection methods, are provided. As used herein, the terms "DNA," "DNA molecule," and "nucleic acid molecule" refer to deoxyribonucleic acid (DNA) molecules. DNA molecules may be of genomic or synthetic origin and / or may comprise recombinant or heterologous DNA molecules or sequences. DNA molecules may, by convention, be written from the 5' (upstream) end to the 3' (downstream) end. As used herein, the term "DNA sequence" refers to the polynucleotide sequence of a DNA molecule, i.e., the sequence of consecutive nucleotides within a DNA molecule. As used herein with respect to the nucleotides of a polynucleotide or DNA sequence or molecule, the terms "consecutive" and "contiguous" are interchangeable and synonymous and refer to nucleotides in 5' to 3' order within a polynucleotide or DNA sequence, strand, or molecule, with no gaps or interruptions between them. The nomenclature used is that required by 37 CFR § 1.822 and set forth in WIPO Standard ST.25 (1998) Annex 2, Tables 1 and 3. By convention, DNA sequences and fragments thereof are disclosed with reference to the 5' to 3' direction of only one of the two complementary DNA sequence strands of a DNA molecule. By implication and intent, complementary sequences (sequences of the complementary strand) of the sequences provided herein, also referred to in the art as reverse complementary or reverse complement sequences, are expressly intended to be within the scope of this disclosure and the claimed subject matter. As used herein, references to SEQ ID NOS: 1-10 and fragments thereof include and refer to the sequences of the complementary strand and fragments thereof.

[0112] Also provided is a nucleic acid molecule comprising a polynucleotide having a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the entire length of any one of SEQ ID NOs: 1-12.

[0113] For example, nucleic acid molecules are provided that include a polynucleotide having a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9.

[0114] DNA molecules, or fragments derived therefrom, can also be extracted from the plant(s), plant part(s), seed(s), progeny or plant cell(s), or homogenates, extracts or lysates from the plant(s), plant part(s), plant cell(s) or seed(s) or progeny, or can be produced as amplicons from DNA extracted, purified or isolated from the plant part(s), plant cell(s) and / or tissue(s), progeny, or from homogenates, extracts or lysates from the plant(s), plant part(s), plant cell(s), progeny and / or seeds, which may further comprise the soybean event Gm_CSM63714.

[0115] As used herein, the term "percent sequence identity" or "% sequence identity" refers to the percentage of identical nucleotides or amino acids in a linear polynucleotide or polypeptide sequence of a reference ("query") sequence (or its complement) compared to a test ("subject") sequence (or its complement) when the two sequences are optimally aligned (with appropriate nucleotide or amino acid insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the comparison window). Optimal alignment of sequences over a comparison window is well known to those skilled in the art and may be performed, for example, using default parameters, by tools such as the Smith and Waterman local homology algorithm, the Needleman and Wunsch homology alignment algorithm, the Pearson and Lipman similarity search method, and by computer implementations of these algorithms, such as GAP, BESTFIT, FASTA, and TFASTA, available as part of the sequence analysis software package GCG® Wisconsin Package® (Accelrys Inc., San Diego, Calif.), MEGAlign (DNAStar Inc., 1228 S. Park St., Madison, Wis. 53715), and MUSCLE (version 3.6) (Edgar, "MUSCLE: multiple sequence alignment with high accuracy and high throughput" Nucleic Acids Research 32(5):1792-7 (2004)). The "identity fraction" for an aligned segment of a test sequence and a reference sequence is the number of identical elements shared by the two aligned sequences in the portion of the segment of the reference sequence that is being aligned, i.e., the entire reference sequence or a smaller, defined portion of the reference sequence, divided by the total number of elements. Percent sequence identity is expressed as the percent identity multiplied by 100. Comparison of one or more sequences can be to the full-length sequence, a portion thereof, or to a longer sequence.Within the scope of the present disclosure are soybean plants, progeny, seeds, cells, plant parts and commercial products comprising a detectable amount of a polynucleotide having a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9.

[0116] As used herein, the term "fragment" refers to a smaller piece or sequence of a larger or entire DNA molecule or sequence. For example, a fragment of any one of SEQ ID NOs: 1-12 and 98-99 may be a fragment of at least about 10 contiguous nucleotides, at least about 11 contiguous nucleotides, at least about 12 contiguous nucleotides, at least about 13 contiguous nucleotides, at least about 14 contiguous nucleotides, at least about 15 contiguous nucleotides, at least about 16 contiguous nucleotides, at least about 17 contiguous nucleotides, at least about 18 contiguous nucleotides, at least about 19 contiguous nucleotides, at least about 20 contiguous nucleotides, at least about 21 contiguous nucleotides, at least about 22 contiguous nucleotides, at least about 23 contiguous nucleotides, at least about 24 contiguous nucleotides of the larger, entire, or complete DNA molecule or sequence. The nucleic acid sequence may comprise a sequence that is at least about 25 contiguous nucleotides, at least about 30 contiguous nucleotides, at least about 35 contiguous nucleotides, at least about 40 contiguous nucleotides, at least about 45 contiguous nucleotides, at least about 50 contiguous nucleotides, at least about 60 contiguous nucleotides, at least about 70 contiguous nucleotides, at least about 80 contiguous nucleotides, at least about 90 contiguous nucleotides, at least about 100 contiguous nucleotides, at least about 150 contiguous nucleotides, at least about 200 contiguous nucleotides, at least about 250 contiguous nucleotides, at least about 300 contiguous nucleotides, at least about 400 contiguous nucleotides, or at least about 500 contiguous nucleotides.

[0117] For example, a "fragment" of the transgenic insert sequence of soybean event Gm_CSM63714 (SEQ ID NO:9) can comprise at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 400, or at least about 500 consecutive nucleotides of SEQ ID NO:9. Additionally, the present disclosure encompasses nucleotide sequences that are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identical to SEQ ID NO:9 or any fragment thereof.

[0118] Similarly, a fragment of the 5' flank (SEQ ID NO:11 or SEQ ID NO:98) or 3' flank (SEQ ID NO:12 or SEQ ID NO:99) of soybean event Gm_CSM63714 may comprise at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, at least about 400, or at least about 500 consecutive nucleotides of SEQ ID NO:11 or SEQ ID NO:98, or SEQ ID NO:12 or SEQ ID NO:99. Additionally, the present disclosure encompasses nucleotide sequences that are at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8% or at least 99.9% identical to SEQ ID NO:11 or SEQ ID NO:12, or SEQ ID NO:98 or SEQ ID NO:99, or any fragment of any of them.

[0119] As used herein, the term "about" is understood as the equivalent of a stated value and indicates a value or range of values ​​that may be greater than or less than the stated value or range of values. Each value or range of values ​​preceded by the term "about" is also intended to encompass the embodiment of the stated absolute value or range of values.

[0120] The term "or" is used herein to mean "and / or" unless expressly indicated to refer to only alternatives or the alternatives are not mutually exclusive. Thus, the term "and / or" as used herein in phrases such as "X and / or Y" is intended to include "X and Y," "X or Y," "X" (alone), and "Y" (alone). Similarly, the term "and / or" as used in phrases such as "X, Y, and / or Z" is intended to encompass each of the following embodiments: X (alone), Y (alone), Z (alone), X and Y, X and Z, Y and Z, X, Y, and Z, X, Y, or Z, X or Z, Y or Z, Y or Z.

[0121] When used in conjunction with the word "comprise" or other open language, the words "a" and "an" mean "one or more" unless expressly noted otherwise. The terms "comprise," "having," and "include" are open-ended linking verbs. Any form or tense of one or more of these verbs, such as "comprises," "comprising," "have," "having," "includes," and "including," are also open-ended. For example, any method that "comprises," "has," or "includes" one or more steps is not limited to having only those one or more steps, but also encompasses other unlisted steps.

[0122] The soybean event Gm_CSM63714 is characterized as a transgenic insertion into a single locus within the soybean genome, resulting in two new junctions (or junctions or connection points). The DNA sequence of the region spanning the phosphodiester bond connection of one end of the transgenic insert to the adjacent soybean genomic DNA is referred to herein as a "junction." In other words, a junction is a connection point or covalent linkage of one end of the transgenic insert and the adjacent genomic DNA as one continuous molecule, formed by the insertion of a heterologous nucleic acid molecule into the soybean genomic DNA. One junction is found at the 5' end of the transgenic insert, and the other is found at the 3' end of the transgenic insert, referred to herein as the 5' and 3' junctions, respectively. A "junction sequence" refers to a DNA sequence of contiguous nucleotides of any length spanning the 5' or 3' junction of a transgenic event within a plant genome. In the case of a "junction sequence" specific to the junction between a transgenic event and an adjacent genomic sequence, the junction sequence generally includes a sufficient number of contiguous nucleotides at one end of the insertion and a sufficient number of contiguous nucleotides of the adjacent genomic sequence.According to some embodiments, a "junction sequence" comprises (i) at least five (5) contiguous nucleotides, at least ten (10) contiguous nucleotides, at least fifteen (15) contiguous nucleotides, at least twenty (20) contiguous nucleotides, at least twenty-five (25) contiguous nucleotides, at least thirty (30) contiguous nucleotides, at least thirty-five (35) contiguous nucleotides, at least forty (40) contiguous nucleotides, at least forty-five (45) contiguous nucleotides, or at least fifty (50) contiguous nucleotides of the flanking genomic DNA sequence; The junction sequence may comprise at least ten (10) contiguous nucleotides, at least fifteen (15) contiguous nucleotides, at least twenty (20) contiguous nucleotides, at least twenty-five (25) contiguous nucleotides, at least thirty (30) contiguous nucleotides, at least thirty-five (35) contiguous nucleotides, at least forty (40) contiguous nucleotides, at least forty-five (45) contiguous nucleotides, or at least fifty (50) contiguous nucleotides, although it is understood that any length of contiguous nucleotides spanning the junction of the transgenic event in the plant genome can be a junction sequence. The junction sequence of soybean event Gm_CSM63714 will be apparent to one of skill in the art, and various junction sequences for soybean event Gm_CSM63714 can be identified by one of skill in the art using SEQ ID NO:10. In SEQ ID NO:10, the 5' junction is at nucleotides 1,000-1,001, and the 3' junction is at nucleotides 11,196-11,197. Exemplary junction sequences for soybean event Gm_CSM63714 are provided as SEQ ID NOs: 1-8. Figure 1 shows the physical layout and location of exemplary junction sequences arranged 5' to 3' (left to right) relative to SEQ ID NO: 10. The DNA sequence of the transgenic insert for soybean event Gm_CSM63714 is provided as SEQ ID NO: 9. The DNA sequences of the transgenic insert and soybean genomic DNA flanking both sides of the transgenic insert are provided as SEQ ID NO: 10. The 5' junction sequences are provided as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 7.The 3' junction sequences are provided as SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, and SEQ ID NO: 8. The junction sequences of soybean event Gm_CSM63714 may be present as part of the genome of a plant, seed, plant part, progeny, or plant cell that contains soybean event Gm_CSM63714, a DNA molecule that contains all or a portion of event Gm_CSM63714. Identification of any one or more of the junction sequences in a DNA molecule or sample from a plant, plant part, seed, progeny, cell, or commercial product indicates that the DNA molecule or plant, plant part, seed, progeny, cell, or commercial product contains or comprises event Gm_CSM63714, or has been obtained from a soybean plant, plant part, seed, progeny, cell, or commercial product containing or comprising event Gm_CSM63714, and is used to diagnose the presence of soybean event Gm_CSM63714.

[0123] The junction sequences described herein are used to diagnose the presence of all or a portion of the soybean event Gm_CSM63714. Thus, direct or indirect identification or detection of one or more of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:10 in a sample or DNA molecule derived from a soybean plant, plant part, seed, progeny, cell, or commercial product is used to diagnose that the soybean plant, plant part, seed, progeny, cell, or commercial product has or contains all or a portion of the soybean event Gm_CSM63714. Direct or indirect identification or detection of 5' junction sequences and / or 3' junction sequences (each provided or described herein) in a sample or DNA molecule derived from a soybean plant, plant part, seed, progeny, cell, or commercial product is used to diagnose that the soybean plant, plant part, seed, progeny, cell, or commercial product has or contains the soybean event Gm_CSM63714. The present disclosure therefore provides DNA molecules comprising at least one of the nucleotide sequences provided as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10. Any segment of DNA derived from transgenic soybean event Gm_CSM63714 that is sufficient to include at least one of the sequences provided as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10 is within the scope of the present disclosure. Additionally, any DNA or polynucleotide molecule or sequence comprising a sequence complementary to any of the sequences described herein is also within the scope of the present disclosure.

[0124] Polynucleotide molecules are provided that can be single-stranded or double-stranded and can be used as either primers or probes to detect the presence of DNA containing all or a portion of the Gm_CSM63714 event in samples derived from soybean plants, plant parts, seeds, progeny, cells, or commercial products. Such primers or probes are specific for a target polynucleotide sequence and are therefore useful for identifying soybean event Gm_CSM63714 nucleic acids using the methods described herein. The primers or probes can hybridize to the target polynucleotide sequence, allowing for the specific detection or amplification of polynucleotide molecules containing or covalently associated with the target polynucleotide sequence. According to this embodiment, the primers and / or probes can be selected to identify and distinguish the presence of a transgene in the plant genome, as well as the detection of a specific transgenic event. The target polynucleotide sequence can include all or a portion of the Gm_CSM63714 event, junction sequences, and / or adjacent genomic DNA. Probes and primers according to the present disclosure may have (i) perfect or 100% sequence complementarity (i.e., 100% complementarity) to a target polynucleotide sequence, or (ii) incomplete sequence complementarity to the target polynucleotide sequence, e.g., at least 60% complementarity, at least 65% complementarity, at least 70% complementarity, at least 75% complementarity, at least 80% complementarity, at least 85% complementarity, at least 90% complementarity, at least 95% complementarity, or at least 99% complementarity to the target polynucleotide sequence, so long as the probe or primer has sufficient complementarity to the target polynucleotide sequence to hybridize to the target polynucleotide sequence under stringent hybridization conditions appropriate and necessary for the probe or primer's use in an amplification or detection assay, reaction, or method associated with the probe or primer. As is understood in the art, if the length of a primer or probe is long, depending on the stringency and use, the percentage complementarity of the primer or probe may be lower.Provided are exemplary polynucleotide molecules that can be used as either primers or probes to detect the presence of soybean event Gm_CSM63714 in a sample. Detecting the presence of soybean event Gm_CSM63714 can be done using methods known in the art, such as thermal or isothermal amplification of nucleic acids or nucleic acid hybridization techniques (e.g., Northern and Southern analysis).

[0125] A "probe" is a nucleic acid molecule that is complementary to a strand of a target nucleic acid and is useful in hybridization detection methods. Probes include not only deoxyribonucleic acid or ribonucleic acid, but also polyamides and other probe materials that specifically bind to a target DNA sequence, and detection of such binding can be useful for detecting the presence or absence of the target DNA sequence. Probes can be conjugated to conventional detectable labels or reporter molecules, such as radioisotopes, ligands, chemiluminescent agents, or enzymes. Such probes are complementary to a strand of a target nucleic acid, in this disclosure, a strand of DNA from event Gm_CSM63714, whether from a plant containing event Gm_CSM63714 or from a sample containing the DNA of event Gm_CSM63714. An exemplary DNA sequence useful as a probe for detecting soybean event Gm_CSM63714 is provided as SEQ ID NO: 16.

[0126] " Primer " is a DNA molecule or oligonucleotide designed for use in a specific annealing or hybridization method involving in vitro amplification reaction. A pair of primers can be used with template DNA (for example, a sample of genomic DNA from soybean event Gm_CSM63714) in a thermal amplification reaction (for example, polymerase chain reaction (PCR)) or any other suitable amplification method known in the art to produce an amplification product or amplicon, and the amplicon produced from such a reaction has a DNA sequence corresponding to the sequence of the template DNA located between the two sites where the primer hybridizes to the template DNA.

[0127] DNA amplification reactions, methods, and techniques are known to those skilled in the art. DNA amplification can be achieved by any of a variety of nucleic acid amplification methods known in the art, such as thermal and isothermal amplification, including the polymerase chain reaction or PCR. Amplification methods are known in the art and are described, inter alia, in U.S. Pat. Nos. 4,683,195 and 4,683,202 and PCR Protocols: A Guide to Methods and Applications, ed. Innis et al., Academic Press, San Diego, 1990. PCR amplification methods have been developed to amplify up to 22 kb (kilobases) of genomic DNA and up to 42 kb of bacteriophage DNA (Cheng et al., 1994). These methods and other methods known in the art of DNA amplification can be used in the practice of the present disclosure. Examples of DNA amplification methods include PCR, recombinase polymerase amplification (RPA) (see, e.g., U.S. Pat. No. 7,485,428), strand displacement amplification (SDA) (see, e.g., U.S. Pat. Nos. 5,455,166 and 5,470,723), transcription-mediated amplification (TMA) (see, e.g., Guatelli et al., 1990), rolling circle amplification (RCA) (see, e.g., Fire and Xu, 1995; Lui, et al., 1996; Lizardi, et al., 1998; U.S. Pat. Nos. 5,714,320 and 6,235,502), helicase dependent amplification (HDA) (see, e.g., Vincent et al., 2004; U.S. Pat. No. 7,282,328), multiple displacement amplification (MDA) (see, e.g., Dean et al., 2004; U.S. Pat. No. 7,282,328), and multiple displacement amplification (MDA) (see, e.g., Dean et al., 2004). al., 2002), and Loop-Mediated Isothermal Amplification (LAMP) (see, e.g., Notomi et al., 2000).The sequence of the heterologous DNA insert and / or flanking genomic DNA sequences from soybean event Gm_CSM63714 can be verified or tested by amplifying such DNA molecules from soybean seeds containing DNA from event Gm_CSM63714 or soybean seeds grown from soybean seeds containing DNA from event Gm_CSM63714 using primers derived from the sequences provided herein, followed by standard DNA sequencing of the PCR amplicons or cloned DNA fragments thereof.

[0128] As used herein, "amplification product" or "amplified DNA" or "amplicon" refers to a nucleic acid or DNA molecule or segment produced by a nucleic acid amplification reaction or method further described herein directed to a target nucleic acid or DNA molecule that is part of a template nucleic acid molecule. Amplification or amplifying refers to the production of multiple copies of a target DNA molecule or segment from a template DNA. For example, to determine whether a soybean plant, plant part, seed, progeny, or plant cell resulting from selfing or outcrossing a parent containing soybean event Gm_CSM63714 contains soybean event Gm_CSM63714, DNA can be extracted from the soybean plant tissue sample and subjected to an amplification reaction or method using a pair of primers specific for a target sequence specifically associated with or part of soybean event Gm_CSM63714, such as a first primer derived from a genomic DNA sequence in a region adjacent to the heterologous inserted DNA of soybean event Gm_CSM63714 that is extended by a polymerase in the 5' to 3' direction of the inserted DNA, and a second primer derived from the heterologous inserted DNA molecule that is extended by a polymerase in the 5' to 3' direction of the adjacent genomic DNA from which the first primer is derived. The length of the amplicon can vary depending on the length of the intervening polynucleotide or DNA sequence between the target sequences of the two primers in the template DNA molecule. Alternatively, primer pairs can be derived from genomic sequences on either side of the inserted heterologous DNA, such that an amplicon containing the entire inserted polynucleotide sequence is produced (e.g., a forward primer targeted to the portion of the genome at the 5' end of SEQ ID NO:10 (i.e., upstream of SEQ ID NO:9) and a reverse primer targeted to the portion of the genome at the 3' end of SEQ ID NO:10 (i.e., downstream of SEQ ID NO:9), which will amplify a DNA molecule containing the inserted DNA sequence (SEQ ID NO:9) identified herein in the genome of the soybean event Gm_CSM63714. The use of the term "amplicon" specifically excludes primer dimers that may be formed during DNA amplification reactions.

[0129] The amplicon described herein can comprise a DNA sequence comprising one or more of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, or a fragment of any of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, or SEQ ID NO:10, the fragment being at least 10 nucleotides in length and comprising nucleotides 1,000-1,001 or 11,196-11,197 of SEQ ID NO:10. According to this embodiment, the sequence of the amplicon comprises at least one junction sequence or two junction sequences, e.g., the 5' junction sequence and / or the 3' junction sequence, for the soybean event Gm_CSM63714. Amplification and detection of such amplicons is used to indicate or diagnose the soybean event Gm_CSM63714.

[0130] In practice, primers should be designed to produce amplicons within a limited size range, e.g., 100-1000 bases. Generally, amplicons of smaller size (shorter polynucleotide length) are more reliably produced in thermal amplification reactions, allow for shorter cycle times, and are easily separated and visualized on agarose gels or adaptable for use in end-point TaqMan®-like assays. Smaller amplicons can be produced and detected by DNA amplicon detection methods known in the art. Furthermore, amplicons produced using such primer pairs can be cloned into vectors, propagated, isolated, and sequenced, or directly sequenced using methods well known in the art. Any primer pair of forward and reverse primers, e.g., SEQ ID NOs: 14 and 15, that may correspond to or be complementary to a portion of SEQ ID NO: 10 and are useful in DNA amplification methods to produce amplicons for use in diagnosing soybean event Gm_CSM63714 or its progeny, is an embodiment of the present disclosure. Any single isolated DNA polynucleotide primer molecule comprising at least 15 contiguous nucleotides of SEQ ID NO: 10, or its complement, useful in DNA amplification methods to produce an amplicon for use in diagnosing soybean event Gm_CSM63714 or its progeny, is an embodiment of the disclosure. Any single isolated DNA polynucleotide primer molecule comprising at least 15 contiguous nucleotides of SEQ ID NO: 11 or SEQ ID NO: 12, or its complement, useful in DNA amplification methods to produce an amplicon for use in diagnosing plants containing soybean event Gm_CSM63714 or its progeny, is an embodiment of the disclosure. Any single isolated DNA polynucleotide primer molecule comprising at least 15 contiguous nucleotides of SEQ ID NO: 9, or its complement, useful in DNA amplification methods to produce an amplicon for use in diagnosing soybean event Gm_CSM63714 or its progeny, is an embodiment of the disclosure.

[0131] Primers are usually designed to specifically hybridize with complementary target DNA strands and form hybrids between the primer and the target DNA strand.The hybridization or binding of a primer to a complementary target DNA strand is the recognition point for polymerase to initiate the extension of the primer (i.e., polymerizing additional nucleotides into an extended nucleotide molecule) using the target DNA strand as a template.A primer pair refers to the use of two primers that bind to opposite strands of a double-stranded nucleotide segment, for the purpose of amplifying the polynucleotide segment between the positions targeted for binding by each of the primer pair, usually in a thermal amplification reaction or other conventional nucleic acid amplification method.Primer pairs are usually designed to hybridize to different adjacent target positions of a template DNA molecule on opposite strands of the template DNA molecule, so that the intervening region or sequence between the two primers can be specifically amplified for use or detection through multiple rounds of amplification.

[0132] To detect the presence or absence of soybean event Gm_CSM63714, the target position and / or intervening region or sequence of the template DNA molecule may include at least one junction sequence and / or at least a portion of the insert of soybean event Gm_CSM63714. To detect the absence of soybean event Gm_CSM63714, the target position and / or intervening region or sequence of the template DNA molecule may include soybean genomic DNA that does not include the junction sequence of the insert of soybean event Gm_CSM63714 or any portion of the insert. Thus, the presence or absence of an amplicon with a primer pair can be used to diagnose the presence or absence of soybean event Gm_CSM63714 in a DNA molecule or sample, respectively, and vice versa. This may also be possible with two or more primer pairs. For example, a first primer pair can produce a first amplicon when soybean event Gm_CSM63714 is present, and a second primer pair can produce a second amplicon when soybean event Gm_CSM63714 is absent or not present. Alternatively, the size of the amplicon produced in the amplification reaction may be used to diagnose the presence or absence of soybean event Gm_CSM63714 in a DNA molecule or sample, for example, a primer pair may produce a first amplicon of a first size when soybean event Gm_CSM63714 is present, or a second amplicon of a second size when soybean event Gm_CSM63714 is absent or not present, or a first primer pair may produce a first amplicon of a first size when soybean event Gm_CSM63714 is present, and a second primer pair may produce a second amplicon of a second size when soybean event Gm_CSM63714 is absent or not present. According to some of these embodiments, at least two primer pairs may be used, in which case at least one primer pair is used as an internal control and is not associated with soybean event Gm_CSM63714.

[0133] According to this embodiment, a primer pair for detecting the presence or absence of all or a portion of the soybean event Gm_CSM63714 in a DNA molecule or sample comprises a first primer and a second primer, wherein the first primer is complementary to a 5' flanking genomic DNA sequence and the second primer is complementary to a sequence within the transgenic insert, or the first primer is complementary to a 5' flanking genomic DNA sequence and the second primer is complementary to a 3' flanking genomic DNA sequence, or the first primer is complementary to a sequence within the transgenic insert and the second primer is complementary to a 3' flanking genomic DNA sequence. In this paragraph, each reference to a primer complementary to the 5' flanking genomic DNA sequence, the 3' flanking genomic DNA sequence, or a sequence within the transgenic insert of soybean event Gm_CSM63714 is also intended to potentially include a primer complementary to the reverse complement or opposite strand of the 5' flanking genomic DNA sequence, the 3' flanking genomic DNA sequence, or a sequence within the transgenic insert of soybean event Gm_CSM63714, respectively.

[0134] Exemplary DNA molecules useful as primers are provided as SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 20. The primer pair of SEQ ID NO: 14 and SEQ ID NO: 15 may be useful as a first primer (corresponding to a sequence within the transgenic insert) and a second primer (corresponding to a 3'-flanking genomic DNA sequence), each primer having contiguous nucleotides of SEQ ID NO: 10, or a sequence complementary to SEQ ID NO: 10, of sufficient length to function as DNA primers that, when used together in an amplification reaction with template DNA from soybean event Gm_CSM63714, hybridize to opposite strands of the template DNA and produce an amplicon that is diagnostic of the DNA of soybean event Gm_CSM63714 in a sample. The primer pair of SEQ ID NO: 20 (corresponding to the 5'-flanking genomic DNA sequence) and SEQ ID NO: 15 (corresponding to the 3'-flanking genomic DNA sequence) is useful as a first primer and a second primer, and each primer has a locus of contiguous nucleotides of sufficient length in the soybean genome to function as a DNA primer when used together in a thermal amplification reaction with template DNA to produce an amplicon that is used to indicate wild-type DNA or to diagnose the DNA zygosity of the Gm_CSM63714 event in a sample. The amplicon used to diagnose the event Gm_CSM63714 contains a sequence that is not naturally found in the soybean genome.

[0135] The primers may further comprise an oligo tail sequence, such as that used in the Kompetitive Allele-Specific PCR (KASP™) method. Each of the allele-specific primers carries a unique tail sequence corresponding to a universal FRET (fluorescence resonance energy transfer) cassette, one labeled with FAM™ dye and the other labeled with HEX™ dye. During thermal cycling, the associated allele-specific primer binds to the template and extends, attaching the tail sequence to the newly synthesized strand. The complement of the allele-specific tail sequence is then generated during subsequent rounds of PCR, allowing the FRET cassette to bind to DNA. The FRET cassette is no longer quenched and fluoresces.

[0136] Methods for designing and using primers and probes are well known in the art. DNA molecules comprising fragments of SEQ ID NOS: 1-10 are useful as primers and probes for detecting the soybean event Gm_CSM63714 and can be readily designed by those skilled in the art using the sequences provided herein. Such probes and primers are selected to have sufficient length and sequence complementarity with the target sequence to specifically hybridize to the target sequence under stringent hybridization conditions. Probes and primers can have complete sequence complementarity or identity with the target sequence, but probes and primers that differ from the target sequence in terms of identity or complementarity but retain the ability to form a stable double-stranded structure and hybridize to the target sequence under specific hybridization or reaction conditions can be designed using conventional methods.

[0137] Any conventional nucleic acid hybridization or amplification method can be used to identify or detect the presence of target DNA from a transgenic plant, e.g., soybean event Gm_CSM63714, in a sample. A polynucleotide molecule or DNA molecule, also referred to as a "polynucleotide segment or fragment of sufficient length" or "contiguous or consecutive nucleotides of sufficient length," can therefore specifically hybridize to a target DNA sequence under certain hybridization or reaction conditions. As used herein, the term "sufficient length" refers to a length sufficient to facilitate optimal detection. Probes and primers are generally at least about 8 nucleotides, at least about 10 nucleotides, at least about 12 nucleotides, at least about 14 nucleotides, at least about 16 nucleotides, at least about 18 nucleotides, at least about 20 nucleotides, at least about 22 nucleotides, at least about 24 nucleotides, at least about 26 nucleotides, at least about 28 nucleotides, or at least about 30 nucleotides or more in length. Such probes and primers specifically hybridize to a target DNA sequence under stringent hybridization conditions.

[0138] As used herein, two nucleic acid molecules can specifically hybridize with each other when the two molecules can form an antiparallel double-stranded nucleic acid structure.A nucleic acid molecule is the "complement" of another nucleic acid molecule when they show complete complementarity.As used herein, two nucleic acid molecules show "complete complementarity" and are "completely complementary" when, when they are aligned, all nucleotides of the first nucleic acid molecule are complementary to all nucleotides of the second nucleic acid molecule.Two molecules are "minimally complementary" when they can hybridize with each other with sufficient stability to remain annealed to each other at least under conventional "low stringency" conditions.Similarly, the molecules are "complementary" when they can hybridize with each other with sufficient stability to remain annealed to each other under conventional "high stringency" conditions. Conventional stringency conditions are described by Haymes et al., In: Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985), and MR Green and J Sambrook, Molecular cloning: a laboratory manual, 4 th Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012). Deviations from perfect complementarity are therefore permissible as long as such deviations do not completely eliminate the ability of the molecule to form a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it is only necessary that the sequences be sufficiently complementary to allow the formation of a stable double-stranded structure under the particular solvent and salt concentrations and other conditions used.

[0139] As used herein, a substantially homologous or complementary sequence relative to a reference nucleic acid sequence is a nucleic acid sequence that specifically hybridizes to the reference nucleic acid sequence or its complement under high stringency conditions. As used herein, "stringent hybridization conditions" refers to conditions under which a polynucleotide will hybridize to its target sequence, usually in a complex mixture of nucleic acids, but will not hybridize to essentially any other sequences. "Stringent conditions" or "stringent hybridization conditions" when referring to a polynucleotide probe refers to conditions under which the probe hybridizes to its target sequence to a detectably higher degree than to other sequences (e.g., at least twice the background). Stringent conditions are sequence-dependent and vary depending on the environment. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are determined by the thermal melting point (T) for a particular sequence at a defined ionic strength pH. m ) is selected to be about 5 to 10°C lower than the T m is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (because the target sequence is present in excess, T m (In this case, 50% of the probes are occupied at equilibrium.) Stringent conditions are those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion (or other salt), pH 7.0 to 8.3, and temperature is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for long probes (e.g., more than 50 nucleotides). Stringent conditions may also be achieved by adding destabilizing agents, such as formamide. By controlling the stringency of the hybridization and / or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in the sequence, resulting in detection of lower degrees of identity (heterologous probing).

[0140] Suitable stringency conditions that promote DNA hybridization, such as 6× sodium chloride / sodium citrate (SSC) at about 45°C, followed by a 2× SSC wash at 50°C, are known to those of skill in the art or can be found in *Current Protocols in Molecular Biology*, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from low stringency conditions of about 2.0× SSC at 50°C to high stringency conditions of about 0.2× SSC at 50°C. Furthermore, the temperature of the wash step can be increased from low stringency conditions at room temperature, i.e., about 22°C, to high stringency conditions at about 65°C. Both temperature and salt can be varied, or either temperature or salt concentration can be held constant while the other variable is varied. With respect to the amplification of a target polynucleotide using a particular amplification primer pair (e.g., by PCR), "stringent conditions" or "stringent hybridization conditions" refer to conditions under which a DNA thermal amplification reaction allows a primer having a corresponding wild-type sequence (or its complement) to hybridize to the target polynucleotide and produce an identifiable amplification product (amplicon) having a region specific to the soybean Gm_CSM63714 event. The term "specific for" a target sequence indicates that a probe or primer will hybridize under stringent hybridization conditions only to the target sequence in a sample containing the target sequence.

[0141] A polynucleotide molecule or DNA molecule, e.g., a primer or probe, of the present disclosure specifically hybridizes under stringent conditions, or under moderately stringent hybridization conditions if the sequence of the polynucleotide molecule is not identical to the sequence of at least one nucleic acid molecule selected from the group consisting of a polynucleotide having a nucleotide sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:10, or a complete complement or fragment of any of the foregoing. Hybridization of a nucleic acid molecule, e.g., a primer or a probe, to the target DNA molecule can be detected by any method known to those skilled in the art, including, but not limited to, fluorescent tags, radioactive tags, antibody-based tags, and chemiluminescent tags.

[0142] An exemplary DNA molecule or polynucleotide useful as a probe for detecting soybean event Gm_CSM63714 is provided as SEQ ID NO: 16. In some embodiments, a DNA molecule that functions as a probe comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, a complement of any of the above, or a fragment of any of the above. In other embodiments, the DNA molecule comprises a polynucleotide segment of sufficient length to function as a DNA probe specific for at least one of the following: a) the 5' junction sequence between the flanking soybean genomic DNA and the transgenic insert of soybean event Gm_CSM63714, b) the 3' junction sequence between the transgenic insert of soybean event Gm_CSM63714 and the flanking soybean genomic DNA, c) SEQ ID NO: 9, or d) a fragment of SEQ ID NO: 9 comprising consecutive nucleotides of SEQ ID NO: 9 of sufficient length to identify the sequence in a sample of DNA as a fragment of the transgenic insert of Gm_CSM63714.

[0143] The diagnostic amplicons produced by the methods described herein can be detected by several techniques known in the art, such as sequencing, restriction enzyme mapping, Southern analysis, or any other suitable polynucleotide or DNA hybridization, blotting, polymerization, and / or amplification-based approach or technique. One method is genetic bit analysis (Nikiforov, et al., 1994), in which DNA oligonucleotides that overlap both the adjacent genomic DNA sequences and the inserted DNA sequence are inserted into the genomic DNA. That is, a junction sequence is designed. The oligonucleotides are immobilized in the wells of a microtiter plate. Following PCR of the region of interest (e.g., using one primer in the inserted sequence and one in the adjacent flanking genomic sequence), the single-stranded PCR product can hybridize to the immobilized oligonucleotide and serve as a template for a single-base extension reaction using DNA polymerase and a labeled dideoxynucleotide triphosphate (ddNTP) specific for the expected next base. Readout can be fluorescent or ELISA-based. A signal indicates the presence of the transgene / genomic junction sequence of interest upon successful amplification, hybridization, and single-base extension.

[0144] Another method is pyrosequencing, described in Winge (2000). In this method, oligonucleotides are designed that overlap the junction of the flanking genomic DNA and the inserted DNA. The oligonucleotides are hybridized to a single-stranded PCR product from the region of interest (one primer in the inserted sequence and one in the flanking genomic sequence) and incubated in the presence of DNA polymerase, ATP, sulfurylase, luciferase, apyrase, adenosine 5' phosphosulfate, and luciferin. DNTPs are added individually, and their incorporation generates a light signal that is measured. The light signal indicates the presence of the transgene / genomic sequence of interest by achieving amplification, hybridization, and single- or multi-base extension.

[0145] Fluorescence polarization, as described by Chen et al. (1999), is a method that can be used to detect the amplicons of the present invention. Using this method, oligonucleotides are designed that overlap the genomic flanking and inserted DNA junctions. The oligonucleotides are hybridized to single-stranded PCR products from the region of interest (one primer in the inserted DNA and one in the adjacent genomic DNA sequence) and incubated in the presence of DNA polymerase and fluorescently labeled ddNTPs. The ddNTPs are incorporated by single-base extension. Incorporation can be measured as a change in polarization using a fluorometer. The change in polarization indicates the presence of the transgene / genomic sequence of interest due to the completion of amplification, hybridization, and single-base extension.

[0146] Real-time polymerase chain reaction (PCR) allows the progress of PCR to be observed as it occurs (i.e., in real time). Data is collected throughout the PCR process, rather than at the end of the PCR. In real-time PCR, the reaction is characterized by the point in the cycle when target amplification is first detected, rather than the amount of target accumulated after a certain number of cycles. In real-time PCR assays, a positive reaction is detected by the accumulation of a fluorescent signal. The higher the starting copy number of the nucleic acid target, the sooner a significant increase in fluorescence is observed. The cycle threshold (Ct value) is defined as the number of cycles required for the fluorescent signal to cross a threshold (i.e., above background levels). The Ct level is inversely proportional to the amount of target nucleic acid in the sample (i.e., the lower the Ct value, the greater the amount of target nucleic acid in the sample).

[0147] Taqman® (PE Applied Biosystems, Foster City, CA) is a method for detecting and quantifying the presence of DNA sequences using real-time PCR, and is well understood in the manufacturer's instructions. Briefly, FRET oligonucleotide probes are designed that overlap the genomic flanking and insert DNA junctions. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in cleavage and release of a fluorescent moiety away from the quenching moiety of the FRET probe. The fluorescent signal indicates the presence of the transgene / genomic sequence of interest upon successful amplification and hybridization.

[0148] Molecular beacons have been described for use in sequence detection and are described in Tyangi, et al. (1996). Briefly, a FRET oligonucleotide probe is designed that overlaps the junction of the flanking genomic and insert DNA. The unique structure of the FRET probe results in a secondary structure that maintains the fluorescent and quenching moieties in close proximity. The FRET probe and PCR primers (one primer in the insert DNA sequence and one in the flanking genomic sequence) are cycled in the presence of a thermostable polymerase and dNTPs. Following PCR amplification, hybridization of the FRET probe to the target sequence results in the removal of the probe's secondary structure and spatial separation of the fluorescent and quenching moieties. A fluorescent signal is generated, indicating the presence of the flanking / transgene insert sequence upon successful amplification and hybridization.

[0149] Other detection methods known in the art may also be used. For example, microfluidic technology (see, e.g., U.S. Patent Publication No. 2006 / 068398 and U.S. Patent No. 6,544,734) provides methods and devices that can be used to separate and amplify DNA samples or molecules. Specific DNA molecules can be detected and measured using optical dyes (see, e.g., WO / 05017181). Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind to specific DNA molecules (see, e.g., WO / 06024023) can then be used to detect events. Nanopore sequencing technologies, such as those described in Wang et al. (2021), Tyler et al. (2018), or Pearson et al. (2019), can also be used to detect events.

[0150] Thus, the DNA molecules and corresponding nucleotide sequences provided herein are useful for, inter alia, identifying the soybean event Gm_CSM63714, detecting the presence of DNA derived from the transgenic soybean event Gm_CSM63714 in a sample, and monitoring samples or plant parts derived from soybean plants containing the event Gm_CSM63714 for the presence and / or absence of the soybean event Gm_CSM63714.

[0151] Provided are proteins that can be used to generate antibodies for detecting the presence of soybean event Gm_CSM63714 in a sample. Such antibodies are specific to one or more of the proteins encoded by soybean event Gm_CSM63714. Methods for preparing polyclonal or monoclonal antibodies are well known to those skilled in the art and can be used to generate antibodies specific to one or more of the proteins encoded by soybean event Gm_CSM63714. For example, U.S. Patent No. 7,838,729 and Wang et al. (2016) describe antibodies against DMO, and U.S. Patent No. 9,371,394 describes antibodies against PAT enzyme. DNA sequences encoding such proteins are provided in SEQ ID NO: 10, and the start and end positions of the coding sequences are shown in Table 1. The DNA sequences encoding each protein, and the proteins encoded by the sequences, are useful for generating antibodies for detecting the presence of soybean event Gm_CSM63714 using the methods described herein. The presence of soybean event Gm_CSM63714 can be detected using any protein detection technique known in the art, such as Western blot analysis, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), antibody binding to a detectable label or reporter molecule (e.g., a radioisotope, a ligand, a chemiluminescent agent, or an enzyme), or enzyme action on a reporter molecule. One method provides for contacting a sample with an antibody that binds to the DMO, PAT, FT_Tv7, or TDO protein encoded by soybean event Gm_CSM63714, and then detecting the presence or absence of antibody binding. Such antibody binding is used to diagnose the presence of one or more proteins encoded by soybean event Gm_CSM63714.

[0152] Nucleic acid or protein detection kits for detecting the presence of soybean event Gm_CSM63714 are provided. Variations of such kits can also be developed using the compositions and methods disclosed herein and methods known in the art for detecting proteins and nucleic acids to identify soybean event Gm_CSM63714. Protein and nucleic acid detection kits can be applied to methods for breeding plants containing soybean event Gm_CSM63714. Such kits include primers and / or probes or antibodies specific to soybean event Gm_CSM63714. Such DNA primers and / or probes can include one or more fragments of SEQ ID NOS: 1-10, or antibodies specific to proteins encoded by soybean event Gm_CSM63714. The kits can also include instructions for using the primers, probes, or antibodies to detect the presence of soybean event Gm_CSM63714. The kits can also optionally include reagents for performing the detection or diagnostic reactions described herein.

[0153] An example of a detection kit contains at least one DNA molecule of consecutive nucleotides of SEQ ID NO: 10 of sufficient length to function as a DNA probe useful for detecting the presence or absence of soybean event Gm_CSM63714 in a sample. DNA derived from a transgenic soybean plant containing event Gm_CSM63714 includes a DNA molecule having at least one sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, a complement of any of the foregoing, or a fragment of any of the foregoing. An exemplary DNA molecule sufficient for use as a probe is one comprising the sequence provided as SEQ ID NO: 16. Other probes can be readily designed by one of skill in the art. The probe may include a junction sequence spanning the 5' or 3' junction between the soybean genomic DNA and the transgenic insert of soybean event Gm_CSM63714.

[0154] Another example of a detection kit includes at least one primer pair that specifically hybridizes to target DNA and amplifies a diagnostic amplicon under appropriate reaction conditions useful for detecting the presence or absence of soybean event Gm_CSM63714 in a sample. A kit containing DNA primers homologous to or complementary to any portion of the soybean event region set forth in SEQ ID NO: 10 and any portion of the inserted transgenic DNA set forth in SEQ ID NO: 9 is within the scope of the present disclosure. The kit may provide an agarose gel-based detection method or various methods for detecting amplicons known in the art. Such methods may also include sequencing of the amplicon or fragments thereof. Exemplary DNA molecules sufficient for use as primer pairs are those comprising the sequences provided as SEQ ID NO: 14 and SEQ ID NO: 15, and SEQ ID NO: 20 and SEQ ID NO: 15, respectively, where the primer pair of SEQ ID NO: 14 and SEQ ID NO: 15 produces an amplicon that is diagnostic of the presence of the event Gm_CSM63714 in a sample, and the primer pair of SEQ ID NO: 20 and SEQ ID NO: 15 produces an amplicon that is indicative of wild-type DNA in a sample and thus is diagnostic of the absence of the event Gm_CSM63714. Other primer pairs can be readily designed by one of skill in the art.

[0155] Another example of a detection kit includes at least one antibody specific to at least one protein encoded by soybean event Gm_CSM63714. For example, such a kit may utilize a lateral flow strip containing a reagent that is activated when the tip of the strip contacts an aqueous solution. An exemplary protein sufficient for use in antibody production is that encoded by the sequence provided as SEQ ID NO: 10, or any fragment thereof. Detecting the binding of at least one antibody to at least one protein encoded by soybean event Gm_CSM63714 in a sample is used to diagnose the presence of soybean event Gm_CSM63714 in the sample.

[0156] The detection kits provided herein are useful for, inter alia, identifying soybean event Gm_CSM63714, selecting plant species or hybrids containing soybean event Gm_CSM63714, detecting the presence of DNA derived from transgenic soybean plants containing event Gm_CSM63714 in a sample, and observing samples or plant parts derived from soybean plants containing event Gm_CSM63714 for the presence and / or absence of soybean plants containing event Gm_CSM63714.

[0157] Provided are soybean plants, progeny, seeds, cells, and plant parts comprising the soybean event Gm_CSM63714, as well as commercial products produced therefrom. As used herein, the term "soybean" or "soy" refers to plant species within the Glycine max genus and all plant species within the genus Glycine, which can be crossed with Glycine max plants, including wild soybean species, e.g., Glycine soja. The term "soybean" is intended to include soybean plants, plant parts, plant cells, plant tissues, seeds, progeny plants, and / or soybean commercial products. These soybean plants, plant parts, plant cells, plant tissues, seeds, progeny plants, and commercial products contain or comprise the soybean event Gm_CSM63714 or are derived from transgenic soybean plants, plant parts, plant cells, plant tissues, seeds, progeny plants, or commercial products containing or comprising the event Gm_CSM63714.These soybean plants, plant parts, plant cells, plant tissues, seeds, progeny plants and commercial products contain a detectable amount of polynucleotides or DNA molecules containing at least one junction sequence and / or heterologous transgenic insertion sequence of soybean event Gm_CSM63714, e.g., polynucleotides or nucleic acids or DNA molecules having or comprising at least one of the sequences provided as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, at least 16 contiguous nucleotides of SEQ ID NO:1, at least 23 contiguous nucleotides of SEQ ID NO:2, at least 33 contiguous nucleotides of SEQ ID NO:3, at least 31 contiguous nucleotides of SEQ ID NO:4, at least 16 contiguous nucleotides of SEQ ID NO:5, at least 23 contiguous nucleotides of SEQ ID NO:6, at least 33 contiguous nucleotides of SEQ ID NO:7, at least 31 contiguous nucleotides of SEQ ID NO:8, at least 16 contiguous nucleotides of SEQ ID NO:9, at least 16 contiguous nucleotides of SEQ ID NO:1, at least 23 contiguous nucleotides of SEQ ID NO:2, at least 33 contiguous nucleotides of SEQ ID NO:3, at least 31 contiguous nucleotides of SEQ ID NO:4 ... polynucleotides comprising at least 51 consecutive nucleotides of SEQ ID NO:5, or at least 51 consecutive nucleotides of SEQ ID NO:6, a polynucleotide comprising a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9, and the complete complement of any of the above. In some embodiments, the soybean plant, plant part, plant cell, plant tissue, or seed is further defined as a progeny plant of any generation of a soybean plant comprising soybean event Gm_CSM63714, or a soybean plant part, plant seed, or plant cell derived therefrom.

[0158] The soybean plants, plant parts, plant cells, plant tissues, seeds, progeny plants, and commercial products express or contain at least one herbicide-tolerance gene selected from the group consisting of dicamba monooxygenase (DMO), phosphinothricin N-acetyltransferase (PAT), alpha-ketoglutarate-dependent non-heme iron dioxygenase variant (FT_Tv7), triketone dioxygenase (TDO), and any combination thereof, and are tolerant to at least one herbicide selected from the group consisting of dicamba, glufosinate, 2,4-D, β-triketones (HPPD inhibitors), such as mesotrione, and any combination thereof.

[0159] Also provided is a soybean plant, plant seed, plant part, or plant cell that is resistant to herbicides with at least three different herbicide action mechanisms, and the gene that confers herbicide tolerance is present in a single genome location.For example, the soybean plant, plant seed, plant part, or plant cell can be resistant to herbicides with at least four different herbicide action mechanisms, and the gene that confers herbicide tolerance is present in a single genome location.To create such a soybean plant, plant seed, plant part, or plant cell, three or more transgenic cassettes that contain herbicide tolerance genes can be inserted into a single genome location in soybean genome as a continuous polynucleotide or a single molecularly linked transgenic insert.Alternatively, three or more transgenic cassettes that contain herbicide tolerance genes can be inserted into a single genome location by inserting separate cassettes that contain herbicide tolerance genes into the same location. "Single genomic location" means that the gene, along with any regulatory sequences (e.g., promoter, intron, leader sequence, 5'-UTR, and / or 3'UTR, etc.) and / or sequences encoding targeting peptides (e.g., chloroplast transit peptides), is present at a single location on a chromosome and will be inherited as a single locus. Some intervening sequences may be present between each transgene cassette, but the length of the intervening sequences is limited so that the transgene cassettes are adjacent to each other on the chromosome. For example, the intervening sequences between the transgene cassettes may be 500 nucleotides or less, 400 nucleotides or less, 300 nucleotides or less, 250 nucleotides or less, 200 nucleotides or less, or 150 nucleotides or less in length. For example, the soybean plant, plant seed, plant part, or plant cell can comprise any of the DNA constructs described herein and can exhibit tolerance to at least one herbicide selected from the group consisting of a benzoic acid-type auxin, e.g., dicamba, a phenoxy-type auxin, e.g., 2,4-D, a glutamine synthetase inhibitor, e.g., glufosinate, a β-triketone HPPD inhibitor, e.g., mesotrione, and any combination thereof.

[0160] The present disclosure provides soybean plants, progeny, seeds, plant cells, and plant parts, such as microspores, pollen, anthers, ovules, ovaries, flowers, pods, embryos, stems, leaves, roots, and calli, derived from transgenic soybean plants containing the soybean event Gm_CSM63714. A representative sample of seeds containing the soybean event Gm_CSM63714 has been deposited in accordance with the Budapest Treaty for the purposes of making the present disclosure possible. The ATCC repository has assigned accession number PTA-127099 to seeds containing the soybean event Gm_CSM63714.

[0161] A microorganism is provided, which comprises a polynucleotide molecule having a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the nucleotide sequence of SEQ ID NO:9, or the entire length of SEQ ID NO:9. An example of such a microorganism is an Agrobacterium cell. Another example of such a microorganism is an E. coli cell.

[0162] Plant cells comprising the polynucleotide molecules described herein are provided, for example, plant cells having in their genome a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, and nucleic acid molecules comprising a polynucleotide having a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9.

[0163] The plant cells and microorganisms disclosed herein are useful in many industrial applications, including, but not limited to: (i) use as research tools for scientific or industrial research; (ii) use in culture to produce endogenous or recombinant carbohydrate, lipid, nucleic acid, enzyme, or protein products, or small molecules that can then be used for scientific research or as industrial products; and (iii) in the case of the plant cells disclosed herein, use with modern plant tissue culture techniques to produce transgenic plants or plant tissue cultures that can then be used in agricultural research or production. The production and use of such transgenic plant cells utilizes modern microbiological techniques and human intervention to produce artificial, unique plant cells. In this process, recombinant DNA is inserted into the genome of a plant cell, creating a unique transgenic plant cell that is distinct from naturally occurring plant cells. This transgenic plant cell can then be cultured using modern microbiological techniques, much like bacteria and yeast cells, and can exist in an undifferentiated, unicellular state. The genetic makeup and phenotype of this novel plant cell are the technical effect created by incorporating heterologous DNA into the genome of that cell.

[0164] Provided are methods for using plant cells, e.g., transgenic plant cells, including (i) methods for generating transgenic cells by integrating recombinant DNA into the genome of the cells and then using the cells to derive additional cells carrying the same heterologous DNA, (ii) methods for culturing cells containing recombinant DNA using modern microbiological techniques, (iii) methods for producing and purifying endogenous or recombinant carbohydrate, lipid, nucleic acid, enzyme, or protein products from cultured cells, and (iv) methods for using modern plant tissue culture techniques with transgenic plant cells to produce transgenic plants or transgenic plant tissue cultures.

[0165] The plants, progeny, seeds, cells, and plant parts may contain one or more additional desirable trait(s). Such desirable traits may be transgenic traits, natural traits, or traits produced by other methods, such as genome editing, base editing, prime editing, or other conventional mutagenesis methods. Desirable traits may be combined with the soybean event Gm_CSM63714, for example, by crossing a soybean plant containing the soybean event Gm_CSM63714 with another soybean plant containing the additional trait(s) or transgenic event. Such traits or transgenic events include, but are not limited to, improved insect resistance, improved water use efficiency, improved yield, improved drought tolerance, improved disease resistance, improved seed quality, improved nutritional value, hybrid seed production, and / or improved herbicide tolerance, as measured relative to a soybean plant lacking such transgenic trait. For example, the Gm_CSM63714 event may be used in combination with other events known in the art for providing herbicide tolerance and / or for controlling lepidopteran pests, including, but not limited to, A2704-12 (Liberty Link®, for glufosinate herbicide tolerance), A2704-21 (Liberty Link®, for glufosinate herbicide tolerance), A5547-127 (Liberty Link®, for glufosinate herbicide tolerance), A5547-35 (Liberty Link®, for glufosinate herbicide tolerance), CV127 (Cultivance, for sulfonylurea herbicide tolerance), DAS44406-6 (glufosinate, glyphosate and 2,4-D herbicide tolerance), DAS81419 (for glufosinate tolerance and lepidoptera tolerance), DP356043 (Optimum GAT™, for glyphosate and sulfonylurea herbicide tolerance), FG72 (for glyphosate and isoxaflutole herbicide tolerance), FG72 x A5547-127 (Liberty Link® GT27™, for glufosinate, glyphosate, and isoxaflutole herbicide tolerance), GMB151 (for isoxaflutole herbicide tolerance), GTS 40-3-2 (Roundup Ready™, for glyphosate herbicide tolerance), GU262 (Liberty Link™, for glufosinate herbicide tolerance and antibiotic tolerance), MON87708 (Genuity® Roundup Ready™ 2 Xtend™, for glyphosate and dicamba herbicide tolerance), MON89788 (Genuity® Roundup Ready 2 Yield™, for glyphosate herbicide tolerance), SYHT0H2 (Herbicide-Tolerant Soybean Line, for glufosinate and mesotrione herbicide tolerance), W62 (Liberty Link™, for glufosinate herbicide tolerance), and W98 (Liberty Link™, for glufosinate herbicide tolerance), MON87701 (for lepidopteran insect resistance), MON87751 (for lepidopteran insect resistance), DAS81419 x DAS44406 (Conkesta Enlist E3™, for glufosinate, glyphosate, and 2,MON87701 x MON89788 (Intacta™ Roundup Ready™ 2 Pro, for glyphosate herbicide tolerance and lepidopteran resistance), MON87751 x MON87701 x MON87708 x MON89788 (for glyphosate and dicamba herbicide tolerance and lepidopteran resistance), etc., or by site-specific introgression. The Gm_CSM63714 event can also be stacked by breeding or by site-specific introgression with other transgenic soybean events known in the art to provide herbicide tolerance and / or modified oils, improved photosynthesis / yield, or drought tolerance, including, but not limited to, DP305423 (Treus™, Plenish™, for sulfonylurea herbicide tolerance and modified oils / fatty acids), MON87705 (Vistive Gold™, for glyphosate herbicide tolerance and modified oils / fatty acids), MON87712 (for glyphosate herbicide tolerance and improved photosynthesis / yield), MON87769 (for glyphosate herbicide tolerance and modified oils / fatty acids), and HB4 (Verdeca HB4 soybean, for drought stress tolerance). The Gm_CSM63714 event can also be stacked by breeding with genome editing events known in the art, including, but not limited to, high oleic acid soybean traits and high oleic, low linolenic acid (HOLL) soybean traits, or by site-specific introgression.

[0166] The plants described herein can be used to produce progeny or descendants comprising the soybean event Gm_CSM63714. Such progeny can include any plants, seeds, and cells and / or regenerable plant parts comprising the soybean event Gm_CSM63714 inherited from or derived from an ancestral or parent soybean plant(s), at least one of which contains at least one polynucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, at least 16 contiguous nucleotides of SEQ ID NO:1, at least 23 contiguous nucleotides of SEQ ID NO:2, at least 33 contiguous nucleotides of SEQ ID NO:3, at least 31 contiguous nucleotides of SEQ ID NO:4, at least 51 contiguous nucleotides of SEQ ID NO:5. Contiguous nucleotides of SEQ ID NO:6, or at least 51 contiguous nucleotides of SEQ ID NO:6, or a polynucleotide having a nucleotide sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9.

[0167] Soybean plants, progeny, and seeds may be homozygous or heterozygous for the event Gm_CSM63714 and the transgene of the event Gm_CSM63714. Progeny may be grown from seeds produced by soybean plants comprising or containing the event Gm_CSM63714 and / or from seeds produced by plants pollinated with pollen from soybean plants comprising or containing the event Gm_CSM63714 (i.e., pollinated with pollen comprising or containing the event Gm_CSM63714). Plants or progeny may also be obtained by tissue culture and regeneration methods from protoplasts, cells, embryos, or reproductive or somatic tissue derived from soybean plants comprising or containing the soybean event Gm_CSM63714.

[0168] The progeny plants may be self-pollinated (also known as "selfing") to produce pure-breeding plants, i.e., plants homozygous for the DNA of the soybean event Gm_CSM63714. Alternatively, the progeny plants may be outcrossed, i.e., crossed with another plant, to produce a variety or hybrid seed or plant. The other plant may be transgenic or non-transgenic. A variety or hybrid seed or plant of the present disclosure may thus be obtained by crossing a first parent lacking the specific and unique DNA of event Gm_CSM63714 with a second parent containing event Gm_CSM63714, resulting in a hybrid containing the specific and unique DNA of event Gm_CSM63714. Each parent is selected from the group consisting of: a) a parent, b) a parent, c) a parent, and d) a parent, e) a parent, e) a parent, and d ... The plant may be a hybrid or an inbred / variety plant, so long as it produces seeds having a polynucleotide having a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:9.

[0169] The mating of one plant with another, i.e., cross-pollination, may be achieved or facilitated by human intervention, for example, by collecting pollen from one plant by human hand and contacting the pollen with the style or stigma of a second plant; by removing, destroying, or covering the stamens or anthers of a plant by human hand and / or human action (e.g., by manual intervention or by application of a chemical sterilizer) to prevent natural self-pollination and require cross-pollination to occur; by humans positioning pollinating insects for "pollination induction" (e.g., by placing beehives in an orchard or field or caging plants with pollinating insects); by humans releasing or removing flower parts to place or contact foreign pollen on the style or stigma; by selective positioning of plants (e.g., deliberately planting plants in pollinating proximity); and / or by applying chemicals to promote flowering or to promote receptivity (of the stigma to pollen).

[0170] Thus, two different transgenic plants of the same or different genetic backgrounds may be crossed to produce inbred or hybrid progeny plants, plant parts, and / or seeds containing two independently segregating transgenes or events, at least one of which contains or is contained within the soybean event Gm_CSM63714. For example, a transgenic plant containing the soybean event Gm_CSM63714 can be crossed with another transgenic soybean plant to produce a plant having characteristics of both transgenic parents.

[0171] Backcrossing to parental plants and outcrossing with non-transgenic plants are also contemplated, as is vegetative propagation. Descriptions of other breeding methods commonly used for different traits and crops are known in the art and can be found in one of several references, for example, Fehr, in Breeding Methods for Cultivar Development, Wilcox J. ed., American Society of Agronomy, Madison WI (1987).

[0172] Plant parts are provided. As used herein, "plant part" refers to any part of a plant that is composed of material directly from or derived from a plant containing the soybean event Gm_CSM63714. Plant parts include, but are not limited to, all or portions of microspores, pollen, anthers, ovules, ovaries, flowers, pods, embryos, stems, leaves, roots, and calluses. Plant parts can be viable or non-viable, regenerable, and / or non-regenerable.

[0173] A commodity product produced from a plant containing soybean event Gm_CSM63714 is provided, the commodity product comprising a detectable quantity of DNA comprising a polynucleotide having a DNA sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, or a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full length of SEQ ID NO:10 or the full length of SEQ ID NO:9. As used herein, "commercial product" refers to any composition or product comprised of material derived from a plant, seed, cell, or plant part that includes the soybean event Gm_CSM63714. The commercial product may be viable or non-viable plant material that is not living and is derived from a plant, seed, cell, or plant part that includes the soybean event Gm_CSM63714. Non-viable commodity products include, but are not limited to, non-viable seeds, whole or processed seeds, processed plant tissues or plant parts, dried plant tissues or parts, frozen plant tissues or parts, human foods (e.g., soybean oil, soy milk, soy flour and soybean grits, soy protein, soy protein concentrate, vegetable protein hydrolysates, processed soy protein, lecithin, curd, tofu, vegetable soy (edamame), bean sprouts, soybean film (yuba), roasted soybeans, miso, tempeh, soy sauce, natto), plant parts processed for animal feed such as soybean meal, soybean fiber, biodiesel, bio-composite building materials (e.g., particle board, laminated plywood, and lumber products), soybean oil-based solvents and industrial lubricants, soy ink, soy candles and crayons, soy-based hydraulic fluids, and soy-based foams. Viable commercial products include, but are not limited to, viable seeds, viable plant parts (eg, roots and leaves), and viable plant cells.Thus, plants containing event Gm_CSM63714 can be used to produce any commercial product normally obtained from soybean plants. Any such commercial product derived from a plant containing event Gm_CSM63714 may contain at least a detectable amount of specific and unique DNA corresponding to event Gm_CSM63714, and in particular a polynucleotide having a nucleotide sequence of at least 16 contiguous nucleotides of SEQ ID NO:1, at least 23 contiguous nucleotides of SEQ ID NO:2, at least 33 contiguous nucleotides of SEQ ID NO:3, at least 31 contiguous nucleotides of SEQ ID NO:4, at least 51 contiguous nucleotides of SEQ ID NO:5, or at least 51 contiguous nucleotides of SEQ ID NO:6. The polynucleotide molecule may comprise a detectable amount of a polynucleotide having a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the full-length sequence of SEQ ID NO: 10 or the full-length sequence of SEQ ID NO: 9. Any standard detection method for polynucleotide molecules may be used, including the detection methods disclosed herein.

[0174] Plants that are tolerant to herbicides can be produced by mating a plant containing the Gm_CSM63714 event with another plant to produce seeds, which can then be grown into progeny plants. These progeny plants can be analyzed using diagnostic methods to select progeny plants containing the DNA of the Gm_CSM63714 event, or progeny plants that are tolerant to herbicides such as benzoic acid-type auxins, e.g., dicamba, glutamine synthetase inhibitors, e.g., glufosinate, phenoxy-type auxins, e.g., 2,4-D, β-triketones, e.g., mesotrione, and any combination thereof. The other plants used may or may not be transgenic. The progeny plants and / or seeds produced may be variety or hybrid seeds.

[0175] Plants that are tolerant to herbicides include those that contain a polynucleotide having the nucleotide sequence of SEQ ID NOs: 1-10, at least 16 consecutive nucleotides of SEQ ID NO: 1, at least 23 consecutive nucleotides of SEQ ID NO: 2, at least 33 consecutive nucleotides of SEQ ID NO: 3, at least 31 consecutive nucleotides of SEQ ID NO: 4, at least 51 consecutive nucleotides of SEQ ID NO: 5, or at least 51 consecutive nucleotides of SEQ ID NO: 6, and a polynucleotide that is at least 90%, at least 91%, at least 92%, at least 93%, or at least 94% of the full length of SEQ ID NO: 10 or the full length of SEQ ID NO: 9. The polynucleotides may be produced by selfing a plant containing event Gm_CSM63714, which contains a polynucleotide having a sequence that is 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the Gm_CSM63714 event, thereby producing seeds that are then grown into progeny plants. These progeny plants may then be analyzed using diagnostic methods to select progeny plants containing the DNA of event Gm_CSM63714, or progeny plants that are resistant to herbicides such as dicamba, glufosinate, 2,4-D, β-triketone HPPD inhibitors such as mesotrione, and any combination thereof.

[0176] Soybean event Gm_CSM63714 contains four expression cassettes that together provide tolerance to benzoate-type auxins such as dicamba, phenoxy-type auxins such as 2,4-D, inhibitors of glutamine synthetase such as glufosinate, and β-triketone HPPD inhibitors such as mesotrione.

[0177] As used herein, inhibitors of glutamine synthetase include, but are not limited to, phosphinothricin, glufosinate, glufosinate salt, glufosinate ammonium, glufosinate sodium, glufosinate-P,L-glufosinate ammonium, and L-glufosinate sodium.

[0178] As used herein, synthetic auxins include, but are not limited to, benzoic acid-type herbicides, phenoxy acid-type herbicides, arylpicolinic acid-type herbicides, and pyridinyloxy acid-type herbicides. Examples of benzoic acid-type herbicides include, but are not limited to, dicamba (3,6-dichloro-2-methoxybenzoic acid), dicamba salts, dicamba butotyl, dicamba diglycolamine salts, dicamba dimethylammonium, dicamba diethanolammonium, dicambaisopropylammonium, dicamba potassium, dicamba sodium, and dicamba trolamine. Examples of phenoxy acid herbicides include 2,4-D (2,4-dichlorophenoxyacetic acid), 2,4-D-butotyl, 2,4-D-butyl, 2,4-D-choline, 2,4-D-dimethylammonium, 2,4-D diolamine (diolamin), 2,4-D-ethyl, 2,4-D-2-ethylhexyl, 2,4-D-isobutyl, 2,4-D-isooctyl, 2,4-D-isopropyl, 2,4-D-isopropylammonium, 2,4-D-potassium, 2,4-D-sodium, 2,4-D-triisopropanolammonium, Examples of herbicides include, but are not limited to, 2,4-D-trolamine, clomeprop, dichlorprop, fenoprop, MCPA (2-methyl-4-chlorophenoxyacetic acid), MCPA-butotyl, MCPA-dimethylammonium, MCPA-2-ethylhexyl, MCPA-isopropylammonium, MCPA-potassium, MCPA-sodium, MCPA-thioethyl, 2,4-DB, MCPB (4-(4-chloro-2-methylphenoxy)butanoic acid), MCPB-methyl, MCPB-ethyl-sodium, and mecoprop. Examples of arylpicolinic acid type herbicides include, but are not limited to, haloxifen, haloxifen-methyl, and florpyrauxifen-benzyl. Examples of pyridinyloxy acid type herbicides include, but are not limited to, triclopyr, fluroxypyr, aminopyralid, and picloram.

[0179] As used herein, β-triketone HPPD inhibitors include, but are not limited to, benzobicyclone (BBC), tefuryltrione, sulcotrione, mesotrione, and tembotrione.

[0180] FT_Tv7 degrades phenoxy-type auxins, such as 2,4-D, and thus soybeans containing event Gm_CSM63714 are tolerant to 2,4-D. Furthermore, FT_Tv7 can also degrade aryloxyphenoxypropionic acid (AOPP) inhibitors of acetyl-CoA carboxylase (ACCase), including the "fop" family of herbicides. Examples of AOPP herbicide ACCase inhibitors include, but are not limited to, clodinafop, clodinafop-ethyl, clodinafop-propargyl, cyhalofop, cyhalofop-butyl, diclofop, diclofop-methyl, diclofop-P, diclofop-P-methyl, fenoxaprop, fenoxaprop-P, fenoxaprop-P-ethyl, fentiaprop, fluazifop, fluazifop-butyl, fluazifop-P, fluazifop-P-butyl, fluroxypyr, haloxyfop, haloxyfop-ethotyl, haloxyfop-methyl, haloxyfop-P, haloxyfop-P-methyl, isoxapyrifop, metamifop, propaquizafop, quizalofop, quizalafop-ethyl, quizalofop-P, quizalafop-P-ethyl, quizalafop-P-tefuryl, and trifop. Thus, in addition to conferring tolerance to phenoxy-type auxin herbicides, such as 2,4-D, in plants (e.g., corn) that are not naturally tolerant to such herbicides, FT_Tv7 also confers tolerance to AOPP herbicides. Furthermore, in plants that are naturally tolerant to AOPP or fop herbicides, or plants that have been selected or engineered to be tolerant to AOPP or fop herbicides, FT_Tv7 can improve the level of tolerance to these herbicides. The ability of FT_Tv7 and related α-ketoglutarate-dependent non-heme iron dioxygenase variants to degrade both phenoxy-type auxins, such as 2,4-D and AOPP herbicides, is further described in U.S. Pat. No. 10,023,874, the disclosure of which is incorporated herein by reference in its entirety.

[0181] As used herein, "herbicide-tolerant" or "herbicide tolerance" or "tolerance" refers to the ability to be completely or partially unaffected by the presence or application of one or more herbicides, e.g., to resist the toxic effects of herbicides when applied. A cell, seed, or plant is "herbicide-tolerant" or has "improved tolerance" if it can maintain at least some normal growth or phenotype in the presence of one or more herbicides. A trait is a herbicide-tolerant trait if its presence can confer improved tolerance to herbicides in cells, plants, or seeds compared to wild-type or control cells, plants, or seeds. Crops comprising a herbicide-tolerant trait can continue to grow in the presence of the herbicide and can be minimally affected by the presence of the herbicide. A protein confers "herbicide tolerance" if the expression of the protein can confer improved tolerance to herbicides in cells, plants, or seeds compared to wild-type or control cells, plants, or seeds. Examples of herbicide tolerance proteins are dicamba monooxygenase, phosphinothricin N-acetyltransferase, alpha-ketoglutarate-dependent non-heme iron dioxygenase variant FT_Tv7, and triketone dioxygenase. Herbicide tolerance can be complete or partial insensitivity to a particular herbicide and can be expressed as percent tolerance or insensitivity to a particular herbicide.

[0182] As used herein, "herbicide phytotoxicity" or "phytotoxicity" refers to phytotoxicity to a plant due to the application of one or more herbicides. "Phytotoxicity rate" or "percent phytotoxicity" refers to the percentage of plant leaf area, based on a visual assessment, that exhibits damage caused by the application of a herbicide, such as necrosis (brown or dead tissue), chlorosis (yellow tissue or yellow spots), and malformations (abnormal leaf or plant structure, stem epineurosis or twisting, leaf cupping). This is measured on a scale of 0 to 100, with "0" representing no phytotoxicity and "100" representing complete phytotoxicity (death).

[0183] In the case of soybean plants containing or comprising soybean event Gm_CSM63714, the plants experience reduced phytotoxicity following application of one or more of a synthetic auxin (e.g., dicamba or 2,4-D), a β-triketone HPPD inhibitor (e.g., mesotrione), or an inhibitor of glutamine synthetase (e.g., glufosinate). For example, soybean plants containing or comprising soybean event Gm_CSM63714 have less than about 5% phytotoxicity, less than about 10% phytotoxicity, less than about 15% phytotoxicity, or less than about 20% phytotoxicity following application of a synthetic auxin such as dicamba or 2,4-D, a β-triketone HPPD inhibitor such as mesotrione, or an inhibitor of glutamine synthetase such as glufosinate, compared to an otherwise identical soybean plant that does not contain soybean event Gm_CSM63714.

[0184] As used herein, a "weed" is any undesirable plant. Some plants may be generally considered undesirable for agricultural or horticultural purposes (e.g., Amaranthus species), or may be considered undesirable in specific situations (e.g., certain crops in different fields, also known as volunteer plants). Weeds are commonly known in the art and vary depending on the terrain, season, growing environment, and time of year. Lists of herbicide species are available from agricultural and scientific societies and organizations (e.g., Weed Society of America, Weed Society of Canada, Brazilian Weed Society, International Weed Society, and International Survey of Herbicide-Resistant Weeds), government agencies (e.g., the United States Department of Agriculture and the Australian Department of Environment and Energy), and industry and farmer organizations. The main troublesome weeds in soybean production include waterhemp (Amaranthus tuberculatus), ragweed (Ambrosia spp.), lamb's quarter (Chenopodium album), morning glory spp., horseweed / marestail (Erigeron canadensis), palmetto (Amaranthus palmeri), pigweed (Amaranthus spp.), velvet leaf (Abutilon theophrasti Medik.), cocklebur (Xanthium strumarium), foxglove (Setaria spp.), crabgrass (Digitaria spp.), barnyardgrass (Echinochloa crus-galli), Johnsongrass (Sorghum halepense), and thistle (Cirsium spp.) (Heap 2021, Shoup et al, 2016).

[0185] A method for weed control in a soybean-growing area is provided. The method includes applying at least one herbicide selected from the group consisting of (i) a glutamine synthetase inhibitor, e.g., glufosinate; (ii) a benzoic acid-type auxin, e.g., dicamba; (iii) a phenoxy-type auxin, e.g., 2,4-D; (iv) a β-triketone HPPD inhibitor, e.g., mesotrione; and (v) any combination thereof, wherein seeds or plants containing soybean event Gm_CSM63714 are planted in the area before, during, or after application of the herbicide, and application of the herbicide prevents or inhibits weed growth and results in no or less than about 5-20% phytotoxicity to the soybean plants containing event Gm_CSM63714. The plant-growing area may or may not contain weed seeds or plants at the time of herbicide application. The herbicide(s) used in the methods described herein can be applied alone, sequentially with one or more herbicides, or in combination with one or more herbicides during the growing season. The herbicide(s) used in the methods described herein can be applied temporally (e.g., as a tank mix or in sequential applications), spatially (e.g., at different times during the growing season, including before and after planting soybean seeds), or both, and can be combined with one or more herbicides. For example, a method for controlling weeds is provided, which comprises planting seeds containing soybean event Gm_CSM63714 in an area, and applying a herbicidally effective amount of one or more of dicamba, glufosinate, 2,4-D, and mesotrione, alone or in any combination with another herbicide, throughout the growing season to control weeds in the area without or with about 5-20% or less of phytotoxicity to plants containing soybean event Gm_CSM63714. Such application of herbicide(s) may be pre-plant (any time before planting seeds containing soybean event Gm_CSM63714, including for the purpose of controlling them, i.e., application to weeds that have germinated or are present before the plants are sown), pre-emergence (any time after seeds containing soybean event Gm_CSM63714 are planted and before the plants containing soybean event Gm_CSM63714 germinate), or post-emergence (any time after the plants containing soybean event Gm_CSM63714 germinate).Multiple applications of one or more herbicides, or combinations of herbicides applied together or individually, can be used throughout the growing season, for example, two applications (e.g., a pre-plant application and a post-emergence application, or a pre-emergence application and a post-emergence application), or three or more applications (e.g., a pre-plant application and two post-emergence applications).

[0186] The application of herbicides in the practice of the methods described herein may be the recommended commercial application rate or any fraction or multiple thereof, for example, twice the recommended commercial application rate. Herbicide application rates may be expressed as pounds acid equivalent per acre (lb ae / acre), pounds active ingredient per acre (lb ai / acre), or pounds active ingredient per hectare (lb ai / ha), depending on the herbicide and formulation. The use of acres in the herbicide application rates provided herein is for guidance only, and herbicide application rates equivalent to any of the rates provided herein may be used for areas larger or smaller than an acre. The herbicide application includes at least one herbicide selected from the group consisting of (i) a glutamine synthetase inhibitor, e.g., glufosinate; (ii) a benzoic acid-type auxin, e.g., dicamba; (iii) a phenoxy-type auxin, e.g., 2,4-D; and (iv) a β-triketone HPPD inhibitor, e.g., mesotrione. The plant growing area may or may not contain weed plants at the time of herbicide application. The herbicidally effective amount of glutamine synthetase inhibitor used in the area for weed control ranges from about 0.1 lb ae / acre to about 10 lb ae / acre throughout the growing season (e.g., glufosinate may be applied at a rate of from about 0.4 lb ai / acre to about 1.6 lb ai / acre). Herbicidally effective amounts of benzoic acid-type herbicides used in the area for weed control range from about 0.1 lb ae / acre to about 16 lb ae / acre throughout the growing season (e.g., dicamba can be applied at rates of about 0.5 lb ae / acre to about 2.0 lb ae / acre). Herbicidally effective amounts of phenoxy-type auxin herbicides used in the area for weed control range from about 0.1 lb ae / acre to about 16 lb ae / acre throughout the growing season (e.g., 2,4-D can be applied at rates of about 0.5 lb ae / acre to about 4.0 lb ae / acre). Herbicidally effective amounts of β-triketone HPPD inhibitors used in the area for weed control range from about 0.5 lb ae / ac to about 12 lb ae / ac throughout the growing season (e.g., mesotrione can be applied at rates of from about 0.09 lb ae / acre to about 0.36 lb ae / acre).

[0187] A method for controlling volunteer soybean containing soybean event Gm_CSM63714 for crop cultivation in an area is provided, comprising applying to the crop cultivation in the area one or more herbicides that are effective against soybean event Gm_CSM63714 and have a mechanism of action other than a benzoate-type auxin, a phenoxy-type auxin, an inhibitor of glutamine synthetase, and a β-triketone HPPD inhibitor. Specific examples of such herbicides are atrazine, bromoxynil (3,5-di-bromo-4-hydroxybenzonitrile), clopyralid, pyrithiobac, isoxaflutole, topramezone, fluometuron, trifloxysulfuron, monosodium methyl arsenate (MSMA), inhibitors of protoporphyrinogen oxidase (PPO) (e.g., saflufenacil, flumioxazin, and sulfentrazone), and any combination thereof, and application of the herbicides prevents the growth of volunteer soybean containing event Gm_CSM63714. For example, in a corn field, topramezone, atrazine, clopyralid, or isoxaflutole can be applied pre- and / or post-emergence to control volunteer soybean containing event Gm_CSM63714. In cotton fields, flumeturon can be applied pre-emergence and trifloxysulfuron, pyrithiobac, or monosodium methyl arsenate (MSMA) can be applied post-emergence to control volunteer soybean containing event Gm_CSM63714.

[0188] Methods for producing plants and seeds containing the soybean event Gm_CSM63714 are provided. Plants can be bred using any method known in the art. Progeny soybean plants containing the event Gm_CSM63714 can be produced, for example, by selfing a parent plant or line containing the event Gm_CSM63714, where the parent plant or line is homozygous or hemizygous for the event Gm_CSM63714, or by crossing a first parent plant or line containing the event Gm_CSM63714, where the parent plant or line is homozygous or hemizygous for the event Gm_CSM63714, with a second parent plant or line having a different genotype or germplasm from the first parent line, which may or may not contain or comprise the event Gm_CSM63714. As further described herein, soybean event Gm_CSM63714 contains four independent expression cassettes or transgenes encoding dicamba monooxygenase (DMO), phosphinothricin N-acetyltransferase (PAT), alpha-ketoglutarate-dependent non-heme iron dioxygenase variant (FT_Tv7), and triketone dioxygenase (TDO), respectively. According to some embodiments, transgenic soybean plant(s) containing event Gm_CSM63714 are tolerant to benzoate-type auxins such as dicamba, phenoxy-type auxins such as 2,4-D, inhibitors of glutamine synthetase such as glufosinate, β-triketone HPPD inhibitors such as mesotrione, or any combination thereof, compared to non-transgenic control plants. Transgenic soybean plants used in these methods can be homozygous or heterozygous for the transgenes.Progeny plants produced by these methods may be variety or hybrid plants and may be grown from seeds produced by plants containing the soybean event Gm_CSM63714 and / or from seeds produced by plants pollinated with pollen from plants containing the soybean event Gm_CSM63714, and may be homozygous or heterozygous for the transgene and / or event Gm_CSM63714. The progeny plants may then be self-pollinated to produce pure-breeding plants, i.e., plants homozygous for the transgene, or alternatively, may be outcrossed, e.g., with another unrelated plant, to produce variety or hybrid seeds or plants.

[0189] As used herein, the terms "line," "breeding line," "genotype," or "germplasm" are used interchangeably and refer to a group of plants that exhibit little or no genetic variation among individuals for at least one trait. Such "lines," "breeding lines," "genotypes," or "germplasm" may be created from a single parent by several generations, selection, or self-pollination for vegetative propagation using tissue or cell culture techniques. As used herein, the terms "cultivar" and "species" are interchangeable and refer to a line used in a commercial product.

[0190] The production of doubled haploids may be used in breeding programs to produce soybean plants and seeds homozygous for the DNA of the Gm_CSM63714 event. Doubled haploids are produced by doubling a set of chromosomes (1N) from a heterozygous plant to produce fully homozygous individuals. See, for example, Wan, et al., (1989) and U.S. Patent No. 7,135,615. This process can be advantageous because it eliminates the selfing generations required to obtain homozygous plants from a heterozygous source. One method for producing haploid and doubled haploid soybean plants containing the Gm_CSM63714 event is by anther culture of flowers containing the Gm_CSM63714 event (Khan et al., 2010). Other methods, such as natural polyembryony, induction by irradiated pollen, crosses with polyploid plants or wild species, unpollinated ovule and microspore culture, can also be applied to produce haploid and doubled haploid soybean plants containing event Gm_CSM63714.

[0191] Seeds and progeny plants produced by the methods described herein contain the soybean event Gm_CSM63714. Application of one or more herbicides to which the soybean event Gm_CSM63714 confers resistance may be used to select progeny containing the soybean event Gm_CSM63714. Alternatively, the progeny may be analyzed using diagnostic methods to select plants or seeds containing the soybean event Gm_CSM63714.

[0192] Soybean transgenic events are known to those skilled in the art; for example, a list of such traits is provided by the United States Department of Agriculture (USDA) Animal and Plant Health Inspection Service (APHIS) and can be found on the website www.aphis.usda.gov. Thus, two or more transgenic events may be combined in progeny seeds or plants by crossing two parent plants, each containing one or more transgenic event(s), collecting progeny seeds, and selecting progeny seeds or plants containing two or more transgenic events. These steps may then be repeated until a desired combination of transgenic events in the progeny is achieved. Backcrossing to parent plants and outcrossing with non-transgenic plants are also contemplated, as is vegetative propagation.

[0193] Methods for detecting the presence of DNA derived from a soybean plant, plant part, plant cell, or seed containing soybean event Gm_CSM63714 in a sample are provided. One method includes (i) extracting a sample containing DNA from at least one soybean plant, plant part, plant cell, or seed, (ii) contacting the sample with at least one primer capable of producing a DNA sequence specific to the DNA of event Gm_CSM63714 under conditions suitable for DNA sequencing, (iii) performing a DNA sequencing reaction, and then (iv) confirming that the nucleotide sequence contains a nucleotide sequence specific to the transgenic insert event Gm_CSM63714 contained therein, e.g., one selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10.

[0194] Another method includes (i) extracting a sample containing DNA from at least one soybean plant, plant part, plant cell, or seed, (ii) contacting the sample with a primer pair capable of producing an amplicon from the DNA of event Gm_CSM63714 under conditions suitable for DNA amplification, (iii) performing a DNA amplification reaction, and then (iv) detecting the amplicon molecule and / or confirming that the nucleotide sequence of the amplicon comprises a nucleotide sequence specific to event Gm_CSM63714, e.g., selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, and SEQ ID NO:10. The amplicon should be specific for event Gm_CSM63714 and include junctions at nucleotide positions 1000-1001 and / or 11,196-11,197 of SEQ ID NO: 10, for example, an amplicon comprising SEQ ID NO: 1, or SEQ ID NO: 2, or SEQ ID NO: 3, or SEQ ID NO: 4, or SEQ ID NO: 5, or SEQ ID NO: 6, or SEQ ID NO: 7, or SEQ ID NO: 8, or SEQ ID NO: 9, or SEQ ID NO: 10. Detection of the nucleotide sequence specific for event Gm_CSM63714 in the amplicon is used to determine and / or diagnose the presence of soybean event Gm_CSM63714-specific DNA in the sample. Exemplary primer pairs capable of producing an amplicon from DNA of event Gm_CSM63714 under conditions suitable for DNA amplification are provided as SEQ ID NO: 14 and SEQ ID NO: 15. Other primer pairs for producing amplicons for use in diagnosing soybean event Gm_CSM63714 can be readily designed by those skilled in the art. Such primer pairs include at least one primer in a genomic region adjacent to the insert and a second primer within the insert, provided that any primer pair that produces an amplicon containing all or part of the junction sequence and / or the insert or transgene sequence can be designed and used. Detection of the amplicon can be based on any suitable method, such as sequencing, measuring the fragment size or migration of the amplicon in a matrix or gel, or hybridization-based methods.

[0195] Another method for detecting the presence of DNA derived from soybean plants, plant parts, plant cells, or seeds containing soybean event Gm_CSM63714 in a sample comprises: (i) extracting a sample containing DNA from at least one soybean plant, plant part, plant cell, or seed; (ii) contacting the sample with a DNA probe specific to the DNA of event Gm_CSM63714; (iii) hybridizing the probe with the DNA in the sample under stringent hybridization conditions; and then (iv) detecting hybridization between the probe and the target DNA in the sample. An example of the sequence of a DNA probe specific to event Gm_CSM63714 is provided as SEQ ID NO: 16. Other probes can be easily designed by those skilled in the art. The detection of hybridization of the probe to the DNA in the sample is used to diagnose the presence of soybean event Gm_CSM63714-specific DNA in the sample. The absence of hybridization is used as a surrogate diagnostic for the absence of soybean event Gm_CSM63714-specific DNA in the sample.

[0196] Methods are provided for determining the zygosity of the soybean event Gm_CSM63714 and the transgene in a sample using genomic DNA derived from at least one soybean plant, plant part, plant cell, or seed containing the event. One method comprises (i) extracting a sample containing DNA from at least a soybean plant, plant part, plant cell or seed; (ii) contacting the sample with a first primer pair capable of producing a first amplicon used to diagnose the event Gm_CSM63714; (iii) contacting the sample with a second primer pair capable of producing a second amplicon used to diagnose wild-type genomic DNA not containing the event Gm_CSM63714; (iv) performing a DNA amplification reaction; and then (v) detecting the amplicons, wherein the presence of only the first amplicon is diagnostic of DNA of homozygous event Gm_CSM63714 in the sample, the presence of both the first amplicon and the second amplicon is diagnostic of a soybean plant heterozygous for the event Gm_CSM63714, and the presence of only the second amplicon is diagnostic of the absence of DNA of the event Gm_CSM63714 in the sample. Exemplary primer pair sets are shown as SEQ ID NO: 14 and SEQ ID NO: 15, which produce amplicons used to diagnose event Gm_CSM63714, and SEQ ID NO: 20 and SEQ ID NO: 15, which produce amplicons used to diagnose wild-type soybean genomic DNA that does not contain event Gm_CSM63714. Probe sets can also be incorporated into such amplification methods used in real-time PCR formats using the primer pair sets described above. Exemplary probe sets are shown as SEQ ID NO: 16 (used to diagnose amplicons for event Gm_CSM63714) and SEQ ID NO: 21 (used to diagnose amplicons for wild-type soybean genomic DNA that does not contain event Gm_CSM63714).

[0197] Another method for determining zygosity comprises (i) extracting a sample containing DNA from at least one soybean plant, plant part, plant cell, or seed; (ii) contacting the sample with a probe set comprising at least a first probe that specifically hybridizes to the DNA of event Gm_CSM63714 and at least a second probe that specifically hybridizes to soybean genomic DNA disrupted by the insertion of the heterologous DNA of event Gm_CSM63714 but does not hybridize to the DNA of event Gm_CSM63714; and (iii) hybridizing the probe set to the sample under stringent hybridization conditions, wherein the hybridization Detecting hybridization of only the first probe under said hybridization conditions is diagnostic of a soybean plant, plant part, plant cell or seed homozygous for DNA of the event Gm_CSM63714 in the sample; detecting hybridization of both the first probe and the second probe under said hybridization conditions is diagnostic of a soybean plant, plant part, plant cell or seed heterozygous for DNA of the event Gm_CSM63714 in the sample; and detecting hybridization of only the second probe under said hybridization conditions is diagnostic of the absence of DNA of the event Gm_CSM63714 in the sample.

[0198] Yet another method for determining zygosity includes (i) extracting a sample comprising DNA from at least one soybean plant, plant part, plant cell, or seed; (ii) contacting the sample with a first primer pair capable of producing a first amplicon used to diagnose the event Gm_CSM63714; (iii) contacting the sample with a second primer pair capable of producing a second amplicon of an internal control known to be single copy and homozygous in the soybean plant; and (iv) contacting the sample with at least a first primer pair that specifically hybridizes to the first amplicon. (v) performing a DNA amplification reaction using real-time PCR to determine the cycle threshold (Ct) values ​​of the first and second amplicons; (vi) calculating the difference (ΔCt) between the Ct values ​​of the first amplicon and the second amplicon; and (vii) determining zygosity, where a ΔCt of approximately zero (0) indicates homozygosity for the event or inserted T-DNA, and a ΔCt of approximately one (1) indicates heterozygosity for the event or inserted T-DNA. Heterozygous and homozygous events are distinguished by a ΔCt value of approximately one (1) unit. Considering the normal variation observed in real-time PCR due to multiple factors, such as amplification efficiency and ideal annealing temperature, the "about one (1)" range is defined as a ΔCt of 0.75 to 1.25, and the "about zero (0)" range is defined as a ΔCt of -0.25 to 0.25 (or 0.0 to 0.25 if the ΔCt is measured as an absolute value). The primer pairs and probes for the above methods for determining zygosity are capable of amplifying and detecting amplicons from the transgene or event DNA and the internal DNA standard.

[0199] A DNA construct is provided that includes a first expression cassette, a second expression cassette, a third expression cassette, and a fourth expression cassette. The first expression cassette comprises, in operable linkage, i) a ubiquitin (UB3) promoter, leader, and intron sequence from Arabidopsis thaliana, ii) an APG6 (Albino and Pale Green 6) chloroplast transit peptide coding sequence from Arabidopsis thaliana, iii) a codon-optimized dicamba monooxygenase coding sequence (DMO) from Stenotrophomonas maltophilia to confer dicamba resistance, and iv) a 3'UTR sequence of the aluminum-induced Sali3-2 protein from Medicago truncatula, and the second expression cassette comprises, in operable linkage, i) a promoter and intron sequence derived from multiple promoter and intron sequences from Arabidopsis thaliana, ii) a codon-optimized phosphinothricin N-acetyltransferase (PAT) coding sequence from Streptomyces viridochromogene to confer resistance to glutamine synthetase inhibitors, and iii) a 3'UTR sequence of the aluminum-induced Sali3-2 protein from Medicago truncatula. The third expression cassette comprises the 3'UTR of a small heat shock protein (Hsp20) derived from Arabidopsis truncatula, and the third expression cassette comprises, in operable linkage, i) a polyubiquitin (UBQ10) promoter, leader, and intron sequence derived from Arabidopsis thaliana, and ii) a codon-optimized alpha-ketoglutarate-dependent non-heme iron dioxygenase variant coding sequence derived from Sphingobium herbidovorans (FT_Tv7, FT_Tv7) for conferring tolerance to phenoxy-type auxins, such as 2,4-D.The fourth expression cassette comprises, in operable linkage, i) promoter, leader, and intron sequences derived from multiple promoter, leader, and intron sequences from Arabidopsis thaliana, ii) a codon-optimized coding sequence for triketone dioxygenase (TDO) from Oryza sativa to confer tolerance to β-triketone HPPD inhibitors, such as mesotrione, and iii) a 3'UTR sequence derived from multiple 3'UTR sequences from Zea mays. The nucleotide sequences of the four expression cassettes were contained in SEQ ID NOs: 9 and 10 of the soybean event Gm_CSM63714. Expression of the DMO, PAT, FT_Tv7, and TDO in transgenic plants confers tolerance to herbicides through at least four different mechanisms of action. For example, plants, plant parts, plant cells, or seeds containing or comprising soybean event Gm_CSM63714 are tolerant to dicamba (a benzoate-type herbicide), glufosinate (a glutamine synthetase inhibitor), 2,4-D (a phenoxy-type herbicide), and mesotrione (a β-triketone HPPD inhibitor).

[0200] Any of the DNA constructs or transgenic inserts described herein may further comprise at least 50 contiguous nucleotides of SEQ ID NO:11 or SEQ ID NO:98, or at least 50 contiguous nucleotides of SEQ ID NO:12 or SEQ ID NO:99 at its 5' or 3' end. Alternatively, any of the DNA constructs or transgenic inserts described herein may further comprise at its 5' or 3' end at least 100 contiguous nucleotides, at least 150 contiguous nucleotides, at least 200 contiguous nucleotides, at least 250 contiguous nucleotides, at least 300 contiguous nucleotides, at least 350 contiguous nucleotides, at least 400 contiguous nucleotides, at least 450 contiguous nucleotides, or at least 500 nucleotides of SEQ ID NO:11 or SEQ ID NO:98, or at least 100 contiguous nucleotides, at least 150 contiguous nucleotides, at least 200 contiguous nucleotides, at least 250 contiguous nucleotides, at least 300 contiguous nucleotides, at least 350 contiguous nucleotides, at least 400 contiguous nucleotides, at least 450 contiguous nucleotides, or at least 500 nucleotides of SEQ ID NO:12 or SEQ ID NO:99.

[0201] SEQ ID NOs:11 and 12 are 1,000-nucleotide sequences representing soybean genomic DNA flanking the transgenic insert at the 5' and 3' ends, respectively, of the insert in soybean event Gm_CSM63714. SEQ ID NOs:11 and 12 have been confirmed by sequencing, as further described in Example 5 below. SEQ ID NOs:98 and 99 are 5,000-nucleotide sequences representing soybean genomic DNA flanking the transgenic insert at the 5' and 3' ends, respectively. Nucleotides 4,001-5,000 of SEQ ID NO:98 are identical to nucleotides 1-1,000 of SEQ ID NO:11. The remaining nucleotides of SEQ ID NO:98 (nucleotides 1-4,000) are based on the genomic sequence of Williams 82 soybean cultivar (Schmutz et al., 2010). Similarly, nucleotides 1-1,000 of SEQ ID NO:99 are identical to nucleotides 1-1,000 of SEQ ID NO:12. The remaining nucleotides of SEQ ID NO:99 (nucleotides 1,001-5,000) are based on the genomic sequence of the Williams 82 soybean variety.

[0202] The at least 50 contiguous nucleotides of SEQ ID NO:11 or SEQ ID NO:98 at the 5' end of the DNA construct or transgenic insert may be immediately adjacent to and upstream (5' end) of the transgenic insert, or may be within about 5,000, 3,000, or 1,000 nucleotides further upstream (5' end) of, but not immediately adjacent to, the transgenic insert. Similarly, the at least 50 contiguous nucleotides of SEQ ID NO:12 or SEQ ID NO:99 at the 3' end of the DNA construct or transgenic insert may be immediately adjacent to and downstream (3' end) of, the transgenic insert, or may be within about 5,000, 3,000, or 1,000 nucleotides further downstream (3' end) of, but not immediately adjacent to, the transgenic insert. Specific examples of sequences comprising 50 contiguous nucleotides of SEQ ID NO:11 are provided in SEQ ID NOs:58-77. Specific examples of 50 contiguous nucleotides of SEQ ID NO:12 are provided in SEQ ID NOs:78 to 97. Specific examples of 50 contiguous nucleotides of SEQ ID NO:98 are provided in SEQ ID NOs:100 to 139. Specific examples of 50 contiguous nucleotides of SEQ ID NO:99 are provided in SEQ ID NOs:140 to 179. However, any sequence comprising at least 50 contiguous nucleotides of SEQ ID NO:11 or SEQ ID NO:98, or at least 50 contiguous nucleotides of SEQ ID NO:12 or SEQ ID NO:99 is within the scope of the present disclosure.

[0203] Further provided is a DNA construct comprising a first expression cassette, a second expression cassette, a third expression cassette, and a fourth expression cassette, wherein the first expression cassette comprises a dicamba monooxygenase coding sequence, the second expression cassette comprises a phosphinothricin N-acetyltransferase (PAT) coding sequence, the third expression cassette comprises an alpha-ketoglutarate-dependent non-heme iron dioxygenase variant coding sequence (FT_Tv7) capable of degrading 2,4-D, and the fourth expression cassette comprises a triketone dioxygenase (TDO) coding sequence. The DNA construct further comprises (i) at least 50 contiguous nucleotides of SEQ ID NO:11 or SEQ ID NO:98 and / or (ii) at least 50 contiguous nucleotides of SEQ ID NO:12 or SEQ ID NO:99 at the 5' and / or 3' end of the construct.

[0204] Further provided are DNA constructs comprising a polynucleotide having a sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to the entire length of SEQ ID NO: 9. The DNA construct further comprises (i) at least 50 contiguous nucleotides of SEQ ID NO: 11 or 98, and / or (ii) at least 50 contiguous nucleotides of SEQ ID NO: 12 or 99 at the 5' and / or 3' end of the construct.

[0205] For example, any of the DNA constructs may comprise, at the 5' end of the construct, one or more nucleotide sequences selected from SEQ ID NOs: 58 to 77 and 100 to 139. Alternatively or in addition, any of the DNA constructs may comprise, at the 3' end of the construct, one or more nucleotide sequences selected from SEQ ID NOs: 78 to 97 and 140 to 179.

[0206] Also provided are soybean plants, plant cells, plant parts, and plant seeds comprising any of the DNA constructs described herein.

[0207] Also provided are soybean plants, plant cells, plant parts, and plant seeds comprising a recombinant DNA construct integrated into chromosome 13, the recombinant DNA construct conferring tolerance to at least one herbicide selected from the group consisting of a benzoate-type auxin, a phenoxy-type auxin, a glutamine synthetase inhibitor, a β-triketone HPPD inhibitor, and any combination thereof. The recombinant DNA construct is integrated into the chromosome at a location flanked by at least 50 contiguous nucleotides of SEQ ID NO: 11-98 and 50 contiguous nucleotides of SEQ ID NO: 12 or 99. The benzoate-type auxin can include dicamba, the phenoxy-type auxin can include 2,4-D, the glutamine synthetase inhibitor includes glufosinate, and the β-triketone HPPD inhibitor can be selected from the group consisting of mesotrione, benzobicyclon (BBC), tembotrione, sulcotrione, tefuryltrione, and any combination thereof. At least 50 consecutive nucleotides of SEQ ID NO: 11 or 98 may comprise one or more nucleotide sequences selected from SEQ ID NOs: 58 to 77 or 100 to 139, and at least 50 consecutive nucleotides of SEQ ID NO: 12 or 99 may comprise one or more nucleotide sequences selected from SEQ ID NOs: 78 to 97 or 140 to 179.

[0208] A method for improving herbicide tolerance is provided. The method comprises: i) inserting a DNA construct containing a first expression cassette, a second expression cassette, a third expression cassette, and a fourth expression cassette described herein into the genome of a plant cell; ii) generating a plant from the plant cell; and iii) selecting a regenerated transgenic plant containing the DNA construct. The transgenic plant produced by the method contains four transgene expression cassettes in a unique combination, in terms of orientation and relative to each other, each with a unique combination of expression elements for optimal expression of the transgene. Furthermore, the transgenic plant produced by the method described herein acquires tolerance to herbicides with four different herbicide mechanisms of action. The regenerated plants containing the DNA constructs can be selected using the DNA detection methods or protein detection methods described herein. Alternatively, or in addition, selecting may include treating the transgenic plant or plant cell with an effective amount of at least one herbicide selected from the group consisting of a benzoate-type auxin, e.g., dicamba; a phenoxy-type auxin, e.g., 2,4-D; an inhibitor of glutamine synthetase, e.g., glufosinate; a β-triketone HPPD inhibitor, e.g., mesotrione; and any combination thereof.

[0209] A method for controlling, preventing, or reducing the occurrence of herbicide-resistant weeds is provided. The method includes: (a) cultivating, in a crop growing environment, a soybean plant containing a DNA construct or transgene or event Gm_CSM63714 of the present disclosure, which confers tolerance to herbicides having at least three different herbicide mechanisms of action at a single genomic location; and (b) applying, to the crop growing environment, at least one herbicide selected from the group consisting of dicamba, glufosinate, 2,4-D, a β-triketone HPPD inhibitor, such as mesotrione, and any combination thereof, wherein the soybean plant is resistant to the at least one herbicide. The at least three different herbicide mechanisms of action are selected from inhibition of glutamine synthetase, benzoic acid-type auxins, phenoxy-type auxins, and inhibition of HPPD. All four of these different herbicide mechanisms of action can be provided by a DNA construct or transgene. For example, soybean plants grown from seeds containing a DNA construct or transgene of the present disclosure, or event Gm_CSM63714, are tolerant to dicamba, 2,4-D, glufosinate, mesotrione, or any combination thereof.

[0210] The soybean plant, plant seed, plant part, or plant cell may further comprise at least one additional transgene for an additional herbicide mechanism of action (e.g., a 5-enoylpyruvinylshikimate-3-phosphate synthase (EPSPS) gene from the CP4 strain of Agrobacterium or another EPSPS that confers tolerance to glyphosate). An exemplary EPSPS coding sequence from the CP4 strain of Agrobacterium and its corresponding amino acid sequence are provided as SEQ ID NO:56 and SEQ ID NO:57, respectively.

[0211] The herbicide(s) used in the methods described herein can be applied alone, sequentially with one or more herbicide(s) or in combination with it during the growing season.The herbicide(s) used in the methods described herein can be applied temporally (for example, as a tank mix or in sequential application), spatially (for example, at different times during the growing season, including before and after soybean seed planting), or both in combination with one or more herbicide(s). For example, provided is a method for controlling the development of herbicide resistance in weeds, comprising planting seeds containing soybean event Gm_CSM63714 in an area and applying a herbicidally effective amount of one or more of a benzoic acid-type auxin, e.g., dicamba; a phenoxy-type auxin, e.g., 2,4-D; an inhibitor of glutamine synthetase, e.g., glufosinate; and a β-triketone HPPD inhibitor, e.g., mesotrione, alone or in combination with another herbicide throughout the growing season to control the development of the herbicide resistance in weeds in the area. Such application of herbicide(s) can be pre-plant (any time before planting the seeds containing soybean event Gm_CSM63714, including for the purpose of controlling, i.e., application to weeds that have germinated or are present before the plants are sown), pre-emergence (any time after the seeds containing soybean event Gm_CSM63714 are planted and before the plants containing soybean event Gm_CSM63714 germinate), or post-emergence (any time after the plants containing soybean event Gm_CSM63714 germinate). Multiple applications of one or more herbicides, or combinations of herbicides applied together or individually, can be used throughout the growing season, for example, two times (e.g., a pre-plant application and a post-emergence application, or a pre-emergence application and a post-emergence application), or three or more applications (e.g., a pre-plant application and two post-emergence applications).

[0212] Also provided is a method for reducing genetic loci for soybean breeding by inserting multiple transgenes at a single genomic location to provide four different mechanisms of action for herbicide tolerance. The soybean event Gm_CSM63714 contains or comprises a transgenic insert containing four independent transgene cassettes: a first expression cassette encodes a dicamba monooxygenase coding sequence (DMO), a second expression cassette encodes a phosphinothricin N-acetyltransferase (PAT), a third expression cassette encodes an alpha-ketoglutarate-dependent non-heme iron dioxygenase variant (FT_Tv7), and a fourth expression cassette encodes a triketone dioxygenase (TDO). These four transgene cassettes are inserted into a single genomic location as a contiguous polynucleotide or DNA molecule, or as a single molecularly linked transgenic insert, and confer commercial-level resistance to at least one herbicide, e.g., dicamba, glufosinate, 2,4-D, mesotrione, and any combination thereof, for each herbicide's mode of action in the field. The nucleotide sequences of the four expression cassettes are contained in SEQ ID NO:9 and SEQ ID NO:10. As used herein, the term "commercial-level," with respect to a herbicide, refers to the commercial rate (1X) recommended for application of the herbicide for a particular herbicide. For example, a 1X rate of dicamba is 1 lb / acre pre-emergence and 0.5 lb / acre post-emergence, a 1X rate of 2,4-D is 1 lb / acre post-emergence, a 1X rate of glufosinate is 0.8 lb / acre, and a 1X rate of mesotrione is 0.18 lb / acre pre-emergence and 0.09 lb / acre post-emergence. As used herein, "commercial-level tolerance" refers to tolerance to one or more herbicides at or above recommended commercial rates as a result of transgene expression from one or more of the four expression cassettes in plants containing event Gm_CSM63714.

[0213] The combination of unique traits, such as a single insertion site, stable integration and expression of the DMO, PAT, FT_Tv7, and TDO transgenes, and consistent and superior efficacy, including herbicide tolerance and agronomic performance, in and across multiple environmental conditions in different landscapes, can be bred or introgressed as a single locus into elite lines or species by conventional breeding methods and maintained over successive generations according to Mendelian inheritance of a single locus. Thus, the disclosed methods allow for rapid trait integration of multiple transgenes in segregating material, saving time and resources in breeding programs and enabling rapid line development, compared to inserting individual transgenes at two or more loci, which requires tedious and laborious multiple crosses over multiple generations to select for plants containing multiple genes. The newly introgressed or integrated DNA molecule or polynucleotide of event Gm_CSM63714 comprising SEQ ID NO:9 and / or SEQ ID NO:10 maintains the expression characteristics of the transgene, as well as the flanking sequences and chromosomal location of the genome, which confers tolerance to at least one herbicide, e.g., dicamba, glufosinate, 2,4-D, or mesotrione, and any combination thereof, for each herbicide's mode of action in the field.

[0214] Deposit information A deposit of a representative sample of soybean seed containing event Gm_CSM63714 was made on August 10, 2021, pursuant to the Budapest Treaty with the American Type Culture Collection (ATCC), 10801 University Boulevard, Manassas, Virginia, USA, ZIP Code 20110. The ATCC patent deposit designation (accession number) for seeds containing soybean event Gm_CSM63714 is accession number PTA-127099. Access to the deposit will be available during the pendency of the application to the Director of Patents and Trademarks and to any person the Director determines is entitled upon request. Upon issuance of the patent, all restrictions on availability to the public will be irrevocably lifted. The deposit will be maintained at the depository for thirty (30) years, or five (5) years from the last request, or for the life of the patent, whichever is longer, and will be replaced as needed during that time. [Example]

[0215] The following examples further illustrate the invention, summarizing the construction and testing of 72 transformation constructs containing single gene cassettes for tolerance to dicamba, glufosinate, 2,4-D, and mesotrione, the construction and testing of six different transformation constructs containing all four of these gene cassettes, the production and testing of over 25,760 unique transformation events, and the multi-stage analysis of thousands of individual plants through rigorous molecular characterization, efficacy, and agronomic testing in both controlled environments and field trials, leading to the creation, identification, and ultimate selection of the soybean event Gm_CSM63714.

[0216] These examples demonstrate certain specific embodiments of the present disclosure. Those skilled in the art will understand that many changes can be made in the specific examples disclosed and still obtain similar results. Certain agents that are chemically and physiologically related may be substituted for the agents described herein, so long as the same or similar results would be achieved. All such substitutions and modifications apparent to those skilled in the art are deemed to be within the scope of the present invention.

[0217] Example 1: Expression cassette testing, construct design, plant testing and construct selection This example describes the design of six different expression constructs for tolerance to dicamba, glufosinate, 2,4-D, and mesotrione herbicides via vector stacks, the production of 25,760 unique soybean events, and the testing and molecular analysis of the resulting transgenic soybean plants for selection of the lead construct.

[0218] Transgene expression and productivity in transgenic plants can be affected by many factors, including, but not limited to: 1) the expression elements used to drive transgene expression in the expression cassette and their interactions with each other and with the transgene, 2) the relative positions and orientations of different expression cassettes when the transgenic insert contains multiple expression cassettes, each carrying a different transgene that confers a different trait, and 3) the genomic location of the transgenic insert, also known as position effect. Commercially useful multigene transgenic events require that each of the transgenes in the transgenic insert be expressed in various germplasm and under different growing conditions in a manner necessary for the achievement of that trait, i.e., optimal transgene expression and productivity across different tissues and developmental stages.

[0219] For these reasons, it is often necessary to create and screen numerous constructs and transformation events to identify a construct (principal construct) and then an event (principal event) that demonstrates optimal expression and productivity of the transgene without phenotypic and agronomic abnormalities, such as yield drag. Prior to such testing, it is impossible to determine whether a particular beneficial event's phenotype or productivity can be achieved.

[0220] In initial proof-of-concept and early developmental studies spanning several years and multiple growing seasons, a total of 72 different constructs were designed, each containing a single gene cassette of DMO, PAT, FT_Tv7, or TDO with different combinations of expression elements. Genes encoding protein variants of TDO and FT_Tv7 were also tested. In addition, one double-stack construct of DMO and PAT, one triple-stack construct of DMO, PAT, and TDO, 41 triple-stack constructs of DMO, PAT, and FT_Tv7, and four quad-stack constructs of DMO, PAT, FT_Tv7, and TDO were designed. Individual gene cassettes in these constructs contained different combinations of expression elements, and the relative position and orientation of the transgene cassettes varied. These vectors were constructed and transformed into dry-excised explants derived from soybean seeds via Agrobacterium-mediated transformation using methods known in the art. Thousands of transformed plants were regenerated and tested in greenhouse and field experiments for optimal protein expression via ELISA protein level measurement and trait efficacy via herbicide spray treatment. Based on these results, the highest-producing individual expression cassettes were identified, each containing an individual transgene driven by a combination of expression elements. From these individual expression cassettes, six different constructs were designed, each containing four expression cassettes (encoding DMO, PAT, FT_Tv7, and TDO, respectively). These six constructs contained combinations of expression cassettes that differed in the relative position and orientation of the expression elements, the protein coding sequences for TDO and FT, and the transgene cassettes.

[0221] These six four-expression cassette constructs were cloned into plant transformation vectors and introduced into dry-excised soybean seed-derived explants via Agrobacterium-mediated transformation using methods known in the art. These transformation vectors contained two T-DNAs: a first T-DNA molecule bounded by a first right border DNA sequence (RB) and a first left border DNA sequence (LB) linked to a second T-DNA molecule bounded by a second right border DNA sequence and a second left border DNA sequence. These two T-DNA molecules were arranged in a DNA construct with a mutual orientation of LB-second T-DNA-RB-RB-first T-DNA-LB, where the first RB and second RB are linked. The first T-DNA contained four expression cassettes encoding DMO, PAT, FT_Tv7, and TDO, respectively, to confer herbicide tolerance. The second T-DNA contained two expression cassettes: one encoding aadA targeted to the chloroplast for selection of transgenic events resistant to spectinomycin and / or streptomycin, and one encoding sucrose phosphorylase (GenBank accession AE009432) under the control of a seed-specific promoter to serve as a marker for identifying the presence of the selectable marker. A total of 25,760 unique transformation events were produced, each generated by random insertion of the transgenic insert into the soybean genome. R0 plants were then regenerated from these transgenic events. Rooted plants with normal phenotypes were transplanted into soil for growth and further evaluation.

[0222] Of the 25,760 R plants generated, 22,834 were analyzed for desirable molecular traits. These included: 1) single-copy and complete transgenic inserts, 2) absence of transformation vector backbone sequences, and 3) non-linked T-DNAs (thus capable of segregating in subsequent generations). Plants that possessed these desirable molecular traits and were able to seed well were advanced to herbicide resistance efficacy testing.

[0223] As shown in Table 2, a total of 288 unique events containing a single copy of the complete transgenic insert, absent the transformation vector backbone and lacking a second T-DNA sequence, were advanced to R1 breeding for R1 seed production. Events with unacceptable segregation or that failed to produce sufficient seeds were discarded. As a result, a total of 224 homozygous events were evaluated for herbicide tolerance in the greenhouse. These plants were sprayed with 1.5 pounds per acre (lb / acre) of 2,4-D at V3, followed by a tank mix of 1.06 lb / acre of glufosinate and 1 lb / acre of dicamba at V6, and then 0.19 lb / acre of mesotrione at R1. Phytotoxicity was visually assessed 7 days after each treatment, with 0% representing no phytotoxicity and 100% representing complete plant death. Events resulting in more than 35% phytotoxicity were discarded. Some events were also dropped due to capacity limitations. From the results of the greenhouse applications, a total of 68 events were advanced to the first phase of field trials. [Table 2]

[0224] Example 2: Field Test Field trials were conducted over multiple seasons / years at many locations across different terrains to evaluate the performance of constructs / events and select superior constructs / events. The field trials consisted of efficacy tests for herbicide tolerance and agronomic tests for event yield. In each field trial, the performance of many individual plants per event was analyzed as a set. Thus, each event was represented by many individual plants. This allowed the performance of each event to be analyzed for various traits under many different conditions, in different locations, and in different terrains. Field trials were conducted with homozygous plants to evaluate the effectiveness of traits for tolerance to commercial rates of the herbicides dicamba, glufosinate, 2,4-D, and mesotron, as well as agronomic performance.

[0225] First phase of field testing A total of 68 events from the four constructs were tested in the first phase of field trials in North America (see Table 2). In efficacy trials, these events were evaluated for tolerance to dicamba, glufosinate, 2,4-D, and mesotrione. Herbicide treatments are summarized in Table 3. These consisted of dicamba at 2 lb / acre pre-emergence (2X) and 1 lb / acre (2X) in V3 and R1; mesotrione at 0.36 lb / acre pre-emergence (2X) and 0.18 lb / acre (2X) in V3 and R1; 2,4-D at 2 lb / acre (2X) in V3 and R1; and glufosinate at 1.6 lb / acre (2X) in V3 and V6. All applications were single chemistry. Plant height, flowering time, maturity, and yield data were collected. [Table 3]

[0226] In agronomic trials, the same events were evaluated for plant height, flowering time, maturity, and yield (presented as bushels per acre). Fields were kept weed-free by hand weeding or the use of conventional herbicides.

[0227] Agronomic and efficacy trials were conducted using a group unbalanced block design (GUBD2). The efficacy trial included nine locations with three replicates and five treatment blocks. These consisted of an untreated block and a block treated with herbicide at twice the maximum rate specified on the herbicide label. Turbo TeeJet Induction (TTI) nozzles were used for all herbicide treatments. Agronomic trials were conducted at 18 locations with two replicates. Plots were 12-foot long, with two rows, 30 inches apart, and 3-foot arrays. Trial maintenance was designed to optimize grain yield. Plots from herbicide-treated events were compared to plots from untreated events. Visual phytotoxicity data for efficacy trials were collected approximately 7 days after postemergence herbicide application or 14 days after preemergence application.

[0228] All data from both agronomic and efficacy trials were subjected to analysis of variance, and means were separated with an LSD (least significant difference) of alpha 0.05. Statistical analysis was automated using ASReml software for mixed model fitting. Events were prioritized for further testing based on yield potential and phytotoxicity. For efficacy trials, the yield of herbicide-treated events was compared to the yield of untreated events. For agronomic trials, the yield of events was compared to the yield of untransformed (wild-type) control plants. Typically, events were not advanced for further testing if their yield after herbicide treatment was significantly lower than that of untreated controls or compared to that of wild-type controls at a p-value of ≦0.05.

[0229] Efficacy and agronomic test results for individual events of the four constructs are summarized in Table 4. Black boxes indicate significantly lower productivity of the event for that treatment, and gray boxes indicate no significant difference when compared to the wild-type or untreated control. Yield (bu / A or bushels / acre) refers to yield performance measured in bushels per acre compared to the wild-type control in the agronomic test. Yield-dicamba, yield-glufosinate, yield-2,4-D, or yield-mesotrione refers to the yield in bushels per acre after application of dicamba, glufosinate, 2,4-D, or mesotrione, respectively, compared to the untreated control. Dicamba injury, glufosinate injury, 2,4-D injury, or mesotrione injury refers to the % injury after application of the respective herbicide compared to the untreated control. Although none of the events showed high levels of phytotoxicity after individual herbicide treatments, more than half of the events showed a reduction in yield (bushels / acre or lb / A) compared to the control. Based on the results of the first phase of field trials, all events from constructs GmHT4-1 and GmHT4-2 were dropped, and seven events from construct GmHT4-3 and eight events from construct GmHT4-4 were advanced to a second phase of field trials. [Table 4]

[0230] Second phase of field testing In a second field trial conducted in South America, these events were evaluated in efficacy trials for resistance to dicamba, glufosinate, 2,4-D, and mesotrione. Seven events from construct GmHT4-3 and eight events from construct GmHT4-4 were advanced from the first field trial. However, because the second field trial began before the results of the first field trial were available, a total of 33 events from constructs GmHT4-3 and GmHT4-4 were planted and subsequently subjected to the second field trial. Herbicide treatments are summarized in Table 3 above. All applications were single chemistry. Efficacy trials were conducted using a group unbalanced block design (GUBD2) across six locations with three replicates and five treatment blocks. These consisted of an untreated block and a block treated with herbicide at twice the maximum rate specified on the herbicide label. A Turbo TeeJet Induction (TTI) nozzle was used for all herbicide treatments. Plots of herbicide-treated events were compared to plots of untreated events. Agronomic trials were conducted at 12 locations, and events were compared to untransformed controls.

[0231] Plots were 4 rows 4 meters long with 0.525 meter row spacing and 1 meter arrays. Trial maintenance was designed to optimize grain yield. Visual phytotoxicity data for efficacy trials were collected approximately 7 days after postemergence herbicide application or 14 days after preemergence application.

[0232] All data from both the agronomic and efficacy trials were subjected to analysis of variance, and means were separated with an LSD of alpha 0.05. Statistical analysis was automated using ASReml software for mixed model fitting. Events were prioritized for further testing based on yield potential and phytotoxicity. In efficacy trials, yields of herbicide-treated events were compared to those of untreated events. In agronomic trials, yields of events were compared to those of untransformed (wild-type) control plants.

[0233] The results of the second phase of efficacy and agronomic testing for individual events of the two constructs are summarized in Table 5. Dark boxes indicate significantly lower productivity of the event for that treatment, while gray boxes indicate no significant difference when compared to the wild-type or untreated control. White boxes indicate that the event was not evaluated in this test. The results of this efficacy testing were consistent with the results of the first phase of testing; that is, none of the events examined showed significant phytotoxicity after individual herbicide treatments. In the agronomic testing, one event for construct GmHT4-3 and two events for construct GmHT4-4 showed significant yield reductions compared to the wild-type control. Yield (bu / A) refers to yield performance measured in bushels per acre compared to the wild-type control in the agronomic testing. Yield-dicamba, yield-glufosinate, yield-2,4-D, or yield-mesotrione refers to the yield in bushels per acre after application of dicamba, glufosinate, 2,4-D, or mesotrione, respectively, compared to an untreated control. Similarly, dicamba injury, glufosinate injury, 2,4-D injury, or mesotrione injury refers to the % injury after application of the respective herbicide, compared to an untreated control. [Table 5]

[0234] Based on the combined data from the first and second phase field trials and detailed molecular characterization of the events, seven events from each of constructs GmHT4-3 and GmHT4-4 were advanced into a third phase field trial.

[0235] Third and fourth field trials Third and fourth field trials were conducted in North and South America, respectively. The third field trial included seven events for construct GmHT4-3 and seven events for construct GmHT4-4, and followed the same test design, individual herbicide application method, application rate, and developmental stage, and statistical analysis methods as the first field trial. The fourth field trial included five to seven events for construct GmHT4-3 (five events for the efficacy trial and seven events for the agronomic trial) and seven events for construct GmHT4-4, and followed the same test design, individual herbicide application method, application rate, and developmental stage, and statistical analysis methods as the second field trial. In both the third and fourth trials, data were collected for germination, vigor, date to first flowering, plant height, maturity, and yield. Additionally, visual phytotoxicity data for efficacy tests were collected approximately 7 days after postemergence herbicide application or 14 days after preemergence application.

[0236] In the third-stage efficacy test, all events showed tolerance to the individual herbicides, with most experiencing less than 10% phytotoxicity compared to untreated controls, although several events had greater than 10% phytotoxicity, particularly in the V3 stage. One event for construct GmHT4-3 (GmHT4-3-3) was not tested due to a lack of sufficient seeds. The results of the efficacy test are summarized in Table 6. Average yield refers to the yield across the region in bushels per acre for untreated events or events treated with dicamba, glufosinate, 2,4-D, or mesotrione. [Table 6]

[0237] The productivity of seven events from each of the constructs GmHT4-3 and GmHT4-4 in the agronomic trials is summarized in Table 7. Average yield refers to the yield across regions in bushels per acre of the events. These results demonstrate that the presence of the transgenic inserts did not adversely affect these events, which had comparable yields compared to the wild-type control. [Table 7]

[0238] To compare field trial data and obtain more accurate estimates of the productivity of different constructs and transgenic events, a statistical meta-analysis was conducted using aggregate values ​​for all plants in the multi-stage, multi-location field trial data for each of the seven events for GmHT4-3 and each of the seven events for GmHT4-4. Table 8 shows the results of the meta-analysis for yield of 14 events from the two constructs in the agronomic trials. Mean yield refers to the yield in bushels per acre of the event or the untransformed control (wild type). Table 9 summarizes the results of the meta-analysis for yield in the efficacy trials. Mean yield refers to the yield in bushels per acre of the untreated events or the events treated with dicamba, glufosinate, 2,4-D, or mesotrione. Plants containing the soybean event GmHT4-4-2 outperformed the other events in these trials. Based on the results of the meta-analysis and the molecular profiles from the molecular analysis of each event, GmHT4-4-2 was selected as the commercial event and named Gm_CSM63714. [Table 8] [Table 9]

[0239] System Testing In addition to evaluating events for tolerance to individual herbicides at twice the commercial rates described in the previous section of this example, systems trials were designed to evaluate crop tolerance to individual herbicides at one time the commercial rate and to herbicide tank-mix combinations similar to those that might be used by a grower.

[0240] Four events from GmHT4-3 and three events from GmHT4-4 were examined. The trial was conducted at four North American locations using a group unbalanced block design (GUBD2) with two replicates and 20 treatments. These consisted of an untreated block and 19 blocks for herbicide treatments (Table 10). Herbicide applications were performed at the V3, V6, and R1 growth stages. Turbo TeeJet Induction (TTI) nozzles were used for all herbicide treatments. Plots from herbicide-treated events were compared to plots from untreated events.

[0241] Plots were 12-foot-long, two-row, 3-foot arrays with 30-inch row spacing, and 235 seeds were sown per plot. Trial maintenance was designed to optimize grain yield. Data were collected for germination, vigor, date to first flowering, plant height, maturity, and yield. Additionally, visual phytotoxicity data for efficacy trials were collected approximately 7 days after postemergence herbicide application. Statistical analysis was automated using ASReml software for mixed model fitting.

[0242] Table 10 shows a summary of herbicide treatments and the corresponding plant developmental stages for such treatments. Treatment 1 is the untreated control. Herbicide application rates are shown as pounds per acre (lb / acre) unless otherwise noted. Average yields (bushels / acre) for events with different herbicide treatments in these system trials are summarized in Table 11. Soybean event GmHT4-4-2 (Gm_CSM63714) performed very well with all of these herbicide treatments and showed significantly better yields with the application of dicamba (treatment 4). Event GmHT4-3-6 showed significant yield reductions with the herbicide combination of dicamba + mesotrione + glufosinate. [Table 10-1] [Table 10-2] [Table 11]

[0243] A meta-analysis was also performed on germination, plant height, moisture, maturity, and yield for seven events from each of the GmHT4-3 and GmHT4-4 constructs. Germination was a visual assessment of germinated planted seeds on a scale of 1 to 9, with 1 indicating that 90-100% of the planted seeds germinated and 9 indicating that 0-19% of the planted seeds germinated. Results showed that the mean germination for the transgenic events ranged from 1.1 to 1.5, with p-values ​​ranging from 0.01 to 0.97, which was not significantly different from the mean value of 1.2 for the untransformed controls.

[0244] Plant height was assessed prior to harvest by measuring the average height in inches of the top node of a representative plant. Mean plant heights for the transgenic events ranged from 33.0 to 35.9 inches, with p values ​​ranging from 0 to 0.51, which was not significantly different from the mean value of 35.5 for the untransformed controls.

[0245] Moisture refers to the moisture content of the grain harvested from a given plot, expressed as a percentage. The mean moisture content for the transgenic events ranged from 11.7 to 11.9%, with p values ​​ranging from 0.02 to 0.97, which was not significantly different from the mean value of 11.7 for the untransformed controls.

[0246] Maturity is the number of days before or after March 1 (South America) or August 31 (North America) when the plot reached 95% maturity, i.e., when 95% of the pods in the plot were dry-colored. The mean maturity for the transgenic events ranged from 28.5 to 30.9, with p values ​​ranging from 0 to 0.97, which was not significantly different from the mean value of 28.5 for the untransformed controls.

[0247] Yield is grain yield expressed in units of bushels per acre. Average yields for the transgenic events ranged from 59.7 to 63.4, while the untransformed controls averaged 61.1. These results therefore indicate that the transgenic events behaved similarly to the untransformed controls. Expression of these transgenes did not significantly affect plant growth and development.

[0248] Example 3: Molecular analysis and event selection Molecular analysis was performed on the advanced events simultaneously with the field trials. DNA amplification and sequencing were used to confirm the sequence composition and integrity of the inserts, the insert copy number, the Agrobacterium Ti plasmid backbone sequence, and the absence of the aadA / splA selection cassette carried on the second T-DNA. The insertion site in the soybean genome of each event was mapped to confirm that the transgenic inserts were not inserted within or near any endogenous genes or repetitive regions. Northern analysis was performed to detect and measure mRNA transcripts of the DMO, PAT, FT_Tv7, and TDO genes in transgenic plants for each event. Protein analysis of plants containing each event was performed using techniques known in the art. N-terminal protein sequencing of the DMO, PAT, FT_Tv7, and TDO proteins purified from transgenic plants containing each event was performed to confirm the sequences of the recombinant proteins. Western blot analysis was performed on protein extracts to confirm the production of DMO, PAT, FT_Tv7, and TDO proteins from each transgenic event.

[0249] Soybean event Gm_CSM63714 was selected as a commercial event based on comprehensive and detailed molecular characterization of each event, combined with trait efficacy and agronomic performance under various growing conditions in multiple geographic locations over multiple growing seasons. Table 12 summarizes the results of the extensive and intensive selection process that led to the identification and selection of soybean event Gm_CSM63714 as the best event for commercial development. The number of R0 events refers to the number of events generated per construct (Step 1). The number of events with 1-2 copies of transgenic inserts refers to the number of events per construct that contained 1-2 copies of transgenic inserts based on molecular characterization and thus advanced to further testing and / or molecular characterization (Step 2). The number of events without the aadA cassette refers to the number of events that contained one to two copies of the transgenic insert and did not contain the aadA / splA cassette in the second T-DNA, indicating that the second T-DNA was not linked to the first T-DNA and was segregated, thus indicating that the event did not contain the second T-DNA (Step 3). The number of R0 events with seeds represents the number of R0 events from Step 3 that were allowed to mature and harvested with seeds (Step 4). The number of events advanced to R1 breeding refers to the number of events advanced to R1 breeding for seed production and further testing (Step 5). The number meeting molecular criteria refers to the number of events that met all molecular criteria, such as single-copy insertion, completeness of the insert sequence, absence of Agrobacterium Ti plasmid backbone sequence and second T-DNA, the transgene insertion not being within or near any endogenous gene or repetitive region, detection of DMO, PAT, FT_Tv7, and TDO proteins in transgenic plants per event, and confirmation of the recombinant protein sequence (Step 6). R2 Efficacy and Breeding represents the number of events that demonstrated herbicide tolerance efficacy and were advanced to R2 breeding (Step 7). R3 Field Trial NA Y1 and R4 SA Field Trial represent the number of R3 and R4 events that were subjected to the first-year North American and South American field trials (Steps 8 and 9), respectively. R5 Field NA Y2 represents the number of R5 events that were advanced to the second-year North American field trial (Step 10).The commercial event represents the final event selected as the commercial event, which met all molecular criteria and demonstrated consistent efficacy and agronomic performance in all field trials. [Table 12]

[0250] Example 5: Molecular characterization of soybean event Gm_CSM63714 As described above, soybean event Gm_CSM63714 was identified through a comprehensive molecular characterization and event selection process coupled with field performance testing, including trait efficacy and yield. This example describes extensive molecular characterization of Gm_CSM63714 after its selection as a commercial event, including confirmation of a single copy of the intact T-DNA at a single locus, the absence of a second T-DNA containing the Agrobacterium Ti plasmid backbone DNA and the aadA / splA selection cassette, identification of the chromosomal location of the T-DNA insert, confirmation that the T-DNA did not interrupt any known endogenous genes or insert into any repetitive regions, and identification of the 5' and 3' genomic flanking sequences of the transgene and the wild-type allele sequence. The transgenic insert of soybean event Gm_CSM63714 contains the elements and sequences listed in Table 1.

[0251] DNA sequence analysis of soybean event Gm_CSM63714 was performed. Southern hybridization analysis was performed to confirm that plants of soybean event Gm_CSM63714 contained a single, intact copy of the entire transgenic insert, without the backbone of the transformation vector and the second T-DNA sequence carrying the aadA and splA selection cassettes. The in planta transgenic insert was isolated and sequenced using methods known in the art. These results indicated that the inserted in planta T-DNA sequence was a perfect match with the expected T-DNA sequence from the transformation vector HT4-4.

[0252] DNA flanking the transgenic insertion (5' and 3' flanking sequences) was also isolated and sequenced using sequence capture, enrichment, sequencing, inverse PCR, and genome walking techniques. The respective 5' and 3' junction sequences were then identified. The sequence of the flanking DNA of soybean event Gm_CSM63714 was mapped to the known physical assembly of the soybean genome. The sequence information of the insertion site was used in bioinformatics analysis to identify the chromosomal location of the event. The integrity of the insertion site was determined by PCR on the wild-type allele using primers specific to the flanking regions of soybean event Gm_CSM63714. Using the wild-type insertion site, the unique site of transgenic integration of soybean event Gm_CSM63714 was mapped to the soybean reference genome. Molecular analysis identified a 40-nucleotide deletion at the transgene insertion site and also confirmed that the inserted T-DNA sequence perfectly matched the intended T-DNA sequence from the transformation vector, with no mutations or truncations. Whole genome sequencing (E-Southern) was performed on material from multiple generations to confirm the identity of the progeny. Sequence information for the transgenic insert, 5' and 3' flanking sequences, and 5' and 3' junctions is provided herein as SEQ ID NOS: 1-10.

[0253] RNA sequencing analysis was performed on plants containing the soybean event Gm_CSM63714. Northern hybridization was performed on total RNA and mRNA isolated from immature seeds. These results confirmed the presence of RNA transcripts corresponding in size to the mRNA products of DMO, PAT, FT_Tv7, and TDO in the soybean event Gm_CSM63714.

[0254] Protein analysis of plants containing soybean event Gm_CSM63714 was also performed. The N-terminal amino acid sequences of the expressed DMO, PAT, FT_Tv7, and TDO proteins were identified by Edman degradation and mass spectrometry using immunopurified protein extracts from mature seeds, confirming their authentic N-terminal amino acid sequences. Western blot analysis of protein extracts from mature seeds of soybean event Gm_CSM63714 confirmed the production of single proteins of the expected sizes for DMO, PAT, FT_Tv7, and TDO, respectively. Furthermore, ELISA was used to determine the protein levels of DMO, PAT, FT_Tv7, and TDO in leaves of soybean event Gm_CSM63714 at different developmental stages (V3, R1, and R5) under different growth conditions (greenhouse, growth chamber, and field) and across multiple generations (R1, R3, and R5). These results indicate that, overall, the DMO, PAT, FT_Tv7, and TDO proteins remained stable across the different growth conditions and multiple generations examined.

[0255] Example 6: Detection of soybean event Gm_CSM63714 This example describes methods useful for identifying or detecting the presence of the soybean event Gm_CSM63714. Detection of the event in a sample can be achieved using DNA, RNA, or protein detection techniques. Exemplary detection methods and materials are provided below.

[0256] 1) Soybean Event Gm_CSM63714 Event-Specific Endpoint Taqman™ Assay An event-specific endpoint Applied Biosystems™ TaqMan thermal amplification method (Thermo Fisher Scientific) was developed to identify the soybean event Gm_CSM63714 in the samples. The DNA primers and probes used in the endpoint assay in this example are listed in Table 13, although one skilled in the art will understand that other primers and probes may also be used. [Table 13]

[0257] 6-FAM™ is a fluorescent dye product from Applied Biosystems (Foster City, Calif.) that binds to this DNA probe. In the case of TaqMan MGB (Minor Grove Binder) probes, the 5' exonuclease activity of Taq DNA polymerase cleaves the probe from the 5' end between the fluorophore and quencher. Upon hybridization to the target DNA strand, the quencher and fluorophore separate sufficiently to generate a fluorescent signal, resulting in the emission of fluorescence. The primer pair and probe used in these reaction methods produce a DNA amplicon used to diagnose soybean event Gm_CSM63714. Controls for this analysis should include a positive control containing soybean event Gm_CSM63714, a negative control derived from a non-transgenic plant, and a negative control without template DNA. Additionally, PCR reaction controls should optimally include internal control primers and an internal control probe specific to a single-copy gene within the soybean genome. These assays are optimized for use with the Applied Biosystems GeneAmp® PCR System 9700 (Thermo Fisher Scientific) for maximum speed, although other instruments may be used.

[0258] Examples of PCR reaction components and cycling conditions useful for an event-specific qualitative endpoint TaqMan PCR assay of soybean event Gm_CSM63714 are shown in Tables 14 and 15. The extracted DNA templates were the DNA sample to be analyzed, a negative control (non-transgenic soybean DNA), a no-template (water) control, or a positive control containing DNA from soybean event Gm_CSM63714. [Table 14] [Table 15]

[0259] 2) Detection of soybean event Gm_CSM63714 using antibodies Another example of detecting soybean event Gm_CSM63714 involves the use of one or more antibodies specific to at least one protein encoded by soybean event Gm_CSM63714. For example, a detection kit containing at least such an antibody can be used. Such a kit can utilize a lateral flow strip containing a reagent that is activated when the tip of the strip comes into contact with an aqueous solution. An exemplary protein sufficient for use in antibody production is that encoded by the sequence provided as SEQ ID NO: 10, or any fragment thereof.

[0260] A protein detection method is developed to determine whether a sample is derived from a plant, seed, cell, or plant part containing soybean event Gm_CSM63714. At least one antibody specific to at least one protein encoded by soybean event Gm_CSM63714 is used to detect proteins encoded by soybean event Gm_CSM63714 in a sample. A detection kit containing one or more antibodies specific to one or more proteins encoded by soybean event Gm_CSM63714 may utilize a lateral flow strip containing a reagent that is activated when the tip of the strip contacts an aqueous solution. A sample of soybean tissue may be ground, and proteins for analysis may be extracted using water or an aqueous buffer (e.g., phosphate-buffered saline containing a surfactant and bovine serum albumin). After centrifugation, the aqueous supernatant is analyzed using a sandwich-format ELISA method on a lateral flow strip containing an absorbent pad. Detection is initiated by immersing the tip of the strip in an aqueous solution containing the sample to be examined.

[0261] The aqueous solution moves through the strip by capillary action, dissolving the gold-labeled antibodies on the strip. The gold-labeled antibodies are specific for at least one protein encoded by soybean event Gm_CSM63714 and bind to an epitope on the protein in the sample, forming an antibody-antigen complex. The gold-labeled antibody-antigen complex then migrates down the strip to a nitrocellulose membrane. The membrane contains a test line of immobilized antibody that binds to a second, distinct epitope on the protein encoded by soybean event Gm_CSM63714, causing a visible line to appear across the test strip if the protein encoded by soybean event Gm_CSM63714 is present in the sample.

[0262] 3) Detection of soybean event Gm_CSM63714 by Southern analysis Another method for detecting the presence of soybean event Gm_CSM63714 in a plant sample is Southern analysis, which is commonly understood in the art. Based on this disclosure and the description of soybean event Gm_CSM63714, one skilled in the art would understand how to design Southern hybridization probe(s) specific to this event and a second Southern hybridization probe specific to a null (wild-type) plant for this event. In Southern analysis, a signal detected only from the first Southern hybridization probe indicates a plant positive for soybean event Gm_CSM63714, and a signal detected only from the second Southern hybridization probe indicates that the DNA was extracted from a null (wild-type) plant for this event.

[0263] Example 7: Mating assay of soybean event Gm_CSM63714 This example describes a method useful for determining the zygosity of the soybean event Gm_CSM63714. This zygosity assay determines whether plants containing the soybean event Gm_CSM63714 are heterozygous or homozygous for the event or the wild-type allele. Exemplary detection methods and materials are provided below.

[0264] A zygosity assay is developed to determine whether a plant containing the soybean event Gm_CSM63714 is heterozygous or homozygous for the event or the wild-type allele. Amplification reaction assays can be designed using the sequence information provided herein. For example, such a PCR assay involves designing at least three primers: primer 1, primer 2, and primer 3, where primer 1 is specific to the soybean genomic DNA of the 3'-flanking DNA of the soybean event Gm_CSM63714 (e.g., SEQ ID NO: 15), primer 2 is specific to the soybean event Gm_CSM63714 transgenic insert (e.g., SEQ ID NO: 14), and primer 3 is specific to the wild-type allele (e.g., SEQ ID NO: 20). When used as a primer pair in an amplification reaction, primer 1 and primer 2 produce a PCR amplicon specific to the soybean event Gm_CSM63714. When used as a primer pair in an amplification reaction, primer 1 and primer 3 produce a PCR amplicon specific to the wild-type allele. In PCR reactions performed on soybean event Gm_CSM63714, the PCR amplicons generated from Primer 1 + Primer 2 and Primer 1 + Primer 3 differ in sequence and size, respectively. When these three primers are included in a PCR reaction with DNA extracted from plants homozygous for soybean event Gm_CSM63714, only the Primer 1 + Primer 2 amplicon (specific for soybean event Gm_CSM63714) is generated. When these three primers are included in a PCR reaction with DNA extracted from plants heterozygous for soybean event Gm_CSM63714, both the Primer 1 + Primer 2 amplicon (specific for the soybean event Gm_CSM63714 insert) and the Primer 1 + Primer 3 amplicon (specific for the wild-type allele or the absence of the soybean event Gm_CSM63714 insert) are generated.When these three primers are mixed in a PCR reaction together with DNA extracted from plants null for the soybean event Gm_CSM63714 (wild-type plants), only the Primer 1 + Primer 3 amplicon (specific for the wild-type allele) is generated. The amplicons produced using these PCR reactions can be identified or distinguished using any method known in the art.

[0265] Another conjugation assay for soybean event Gm_CSM63714 is the Taqman™ thermal amplification method. In addition to the primers described in the previous section, two fluorescently labeled probes are included. Probe 1, which contains a fluorescent label (e.g., SEQ ID NO: 16 labeled with 6-FAM™), is specific for soybean event Gm_CSM63714, while probe 2, which contains a different fluorescent label (e.g., SEQ ID NO: 21 labeled with VIC™), is specific for wild-type soybean plants that are null for soybean event Gm_CSM63714.

[0266] When the three primers (SEQ ID NO:14, SEQ ID NO:15, and SEQ ID NO:20) and two probes (SEQ ID NO:16 and SEQ ID NO:21) are mixed in a PCR reaction together with DNA extracted from plants homozygous for the soybean event Gm_CSM63714, a fluorescent signal from the 6FAM™-labeled probe PB10269 (SEQ ID NO:16) is emitted, which is indicative of and diagnostic of plants homozygous for the soybean event Gm_CSM63714. When the three primers and two probes are mixed in a PCR reaction together with DNA extracted from plants heterozygous for the soybean event Gm_CSM63714, two different fluorescent signals are generated, one from the 6FAM™-labeled probe PB10269 (SEQ ID NO:16) and one from the VIC™-labeled probe PB50681 (SEQ ID NO:21). When the three primers and two probes are mixed in a PCR reaction together with DNA extracted from wild-type plants that are null for the soybean event Gm_CSM63714, a fluorescent signal from the VIC™-labeled probe PB50681 (SEQ ID NO: 21) is generated.

[0267] Examples of PCR reaction components and cycling conditions useful for TaqMan™ PCR zygosity assays of soybean event Gm_CSM63714 are shown in Tables 16 and 17. Extracted DNA templates were the DNA sample to be analyzed, a negative control (non-transgenic soybean DNA), a no-template (water) control, or a positive control containing DNA from soybean event Gm_CSM63714. [Table 16] [Table 17]

[0268] Another method for detecting the presence and zygosity of the soybean event Gm_CSM63714 in a plant sample is Southern blot analysis. Those skilled in the art will understand how to design a first Southern hybridization probe(s) specific for the soybean event Gm_CSM63714 and a second Southern hybridization probe specific to a soybean plant that is null (wild-type) for the soybean event Gm_CSM63714. In Southern blot analysis, a signal detected only from the first Southern hybridization probe indicates a plant homozygous for the soybean event Gm_CSM63714, a signal detected from both the first and second hybridization probes indicates a plant heterozygous for the soybean event Gm_CSM63714, and a signal detected only from the second Southern hybridization probe indicates that the DNA was extracted from a plant that is null (wild-type) for the soybean event Gm_CSM63714.

[0269] Example 8: Modification of soybean event Gm_CSM63714 by genome editing techniques using single-stranded guide RNA This example describes how all or part of the transgenic insertion and adjacent genomic DNA segments present in the soybean event Gm_CSM63714 can be altered or excised, for example, by making one or more insertions, deletions, substitutions, or rearrangements using genome editing techniques. For example, such alterations can be made using a clustered regularly interspaced short palindromic repeats (CRISPR) editing system containing a single-stranded guide RNA via genome editing methods. Sequences useful for excising the transgenic insertion of event Gm_CSM63714 or the expression cassette within SEQ ID NO:9 or SEQ ID NO:10 can be introduced by genome editing using various methods. In one embodiment, a CRISPR editing system containing a clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein and cognate guide RNA can be used for targeted excision. The CRISPR-associated protein is an RNA-guided nuclease and may be a type I CRISPR-associated protein, a type II CRISPR-associated protein, a type III CRISPR-associated protein, a type IV CRISPR-associated protein, a type V CRISPR-associated protein, or a type VI CRISPR-associated protein, such as, but not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and and Csx12), Cas10, Cas12a (also known as Cpf1), Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, CasX, CasY, and Mad7. The CRISPR-associated proteins and one or more guide RNAs (gRNAs) can be introduced into plant cells corresponding to soybean event Gm_CSM63714 to target specific sequences within the transgene insertion locus.In one embodiment, the CRISPR nuclease system cuts at two identical guide RNA hybridization sites, thereby allowing the excision of intervening sequences.After DNA is cut, the genome sequence can be repaired at the genome target site through double-strand break repair pathways, which can include, for example, non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), homologous recombination, synthesis-dependent strand annealing (SDSA), single-strand annealing (SSA), or any combination thereof.One or more guide RNA hybridization sequences can be inserted into the event Gm_CSM63714 transgene insertion site locus, so that the transgene insertion from event Gm_CSM63714 or the specific expression cassette in SEQ ID NO:9 or SEQ ID NO:10 can then be excised.

[0270] Sequences corresponding to the 5' and 3' flanking genomic sequences of event Gm_CSM63714 (shown as SEQ ID NOS: 11 and 12), the 5' and 3' junction regions (shown as SEQ ID NOS: 1-6), and the transgenic insert (shown as SEQ ID NOS: 9) were scanned for potential originator guide RNA recognition sites (OgRRS). As used herein, the term "originator guide RNA recognition site" or "OgRRS" refers to an endogenous DNA polynucleotide containing a protospacer adjacent motif (PAM) site operably linked to the hybridization site of a guide RNA (i.e., the protospacer sequence). In some embodiments, the OgRRS can be located in the flanking 5' or 3' genomic sequence (i.e., the non-transgenic DNA of the junction polynucleotide). In some embodiments, the OgRRS can be located in the 5' or 3' junction region (i.e., within both the transgenic and non-transgenic DNA of the junction polynucleotide, or across the transgenic and non-transgenic DNA in the DNA junction polynucleotide). In some embodiments, OgRRS can be located in transgenic insert.OgRRS can be determined based on the specific CRISPR editing system selected.For example, Cas9 recognizes the G-rich protospacer adjacent motif (PAM) that is 3' to its guide RNA hybridization site, while Cas12a system recognizes the T-rich protospacer adjacent motif (PAM) that is 5' to its guide RNA hybridization site.

[0271] The OgRRS sequence is then used to define a cognate guide RNA recognition site (CgRRS), which is inserted into the transgenic insert locus of event Gm_CSM63714 using a CRISPR editing system. As used herein, the term "cognate guide RNA recognition site" or "CgRRS" refers to a DNA polynucleotide comprising a PAM site operably linked to a hybridization site (i.e., protospacer sequence) of a guide RNA, where the CgRRS is not contained in event Gm_CSM63714, which contains the unmodified original transgenic locus, and where the CgRRS and its corresponding OgRRS are capable of hybridizing to a single-stranded gRNA. The CgRRS can be located in the adjacent 5' or 3' genomic sequence (i.e., in the non-transgenic DNA of the junction polynucleotide), in the 5' or 3' junction region (i.e., in both the transgenic and non-transgenic DNA of the junction polynucleotide, or across the transgenic and non-transgenic DNA in the DNA junction polynucleotide), or within the transgenic insert. The CgRRS contains the same gRNA target sequence as the corresponding OgRRS. The CgRRS is inserted into a region within the transgenic insert locus of event Gm_CSM63714 opposite the transgenic insert relative to the OgRRS in a manner that allows for cleavage of a fragment of DNA, e.g., an expression cassette or genetic element within the transgene cassette, corresponding to either the entire transgenic insert of event Gm_CSM63714 or a fragment within the transgene insert of event Gm_CSM63714, using a single-stranded gRNA. For example, if the OgRRS is located within the 3'-flanking genomic sequence or 3'-junction region, the CgRRS can be inserted within the 5'-flanking genomic sequence or 5'-junction region, or within the transgene insert, for example, between expression cassettes or between genetic elements within an expression cassette. Insertion of the CgRRS opposite the OgRRS to the transgenic insert or within the region between expression cassettes allows for cleavage of the transgenic insert or specific expression cassette(s) to be cleaved using a single-stranded gRNA.The OgRRS located between the expression cassettes of event Gm_CSM63714 can be used to design a CgRRS that can be inserted into either the 5' or 3' flanking genomic sequence, allowing for excision of one or more expression cassettes using single-stranded gRNAs.

[0272] Table 18 shows OgRRS sequences located within the 5' and 3' flanking genomic sequences of event Gm_CSM63714, as well as the transgenic insertion, that can be used in CRISPR editing systems employing Cas12a, a type V CRISPR-associated protein. Four Cas12a endonucleases were analyzed. Fn (SEQ ID NO: 48) refers to Cas12a from Francisella novicida U112 (also known as FnCas12a or FnCpf1), which requires a 5'-TTN PAM sequence, where N is A, C, G, or T (Zetsche et al., 2015). Lb (SEQ ID NO: 45) refers to Cas12a from Lachnospiraceae bacterium ND2006 (also known as LbCas12a or LbCpf1) and requires a 5'-TTTV PAM sequence, where V is A, C, or G. Lb_V1 and Lb_V2 refer to engineered variants of Cas12a from Lachnospiraceae bacterium ND2006 (Gao et al., 2017). The Lb_V1 variant (SEQ ID NO: 46) contains G532R / K595R mutations and recognizes a 5'-TYCV PAM, while the Lb_V2 variant (SEQ ID NO: 47) contains G532R / K538V / Y542R mutations and recognizes a 5'-TATV PAM, where Y is C or T and V is A, C, or G. The PAM sequence, the coordinates of the gRNA hybridization site (also known as OgRRS) relative to SEQ ID NO: 10, and the corresponding Cas12a endonuclease are shown under the headings "PAM," "Cas12a nuclease," and "Start...End of gRNA hybridization site in SEQ ID NO: 10," respectively. The "Strand of SEQ ID NO: 10" indicates whether the identified gRNA hybridization site, along with its PAM sequence, is on the forward strand (+) or the complementary strand (-). [Table 18-1] [Table 18-2]

Table 18-3

Table 18-4

Table 18-5

Table 18-6

Table 18-7

Table 18-8

Table 18-9

Table 18-10

Table 18-11

Table 18-12

Table 18-13

Table 18-14

Table 18-15

Table 18-16

Table 18-17

Table 18-18

Table 18-19

Table 18-20

Table 18-21

Table 18-22

Table 18-23

Table 18-24

Table 18-25

Table 18-26

Table 18-27

Table 18-28

Table 18-29

Table 18-30

Table 18-31

Table 18-32

Table 18-33

Table 18-34

Table 18-35

Table 18-36

Table 18-37

Table 18-38

Table 18-39

Table 18-40

Table 18-41

Table 18-42

Table 18-43

Table 18-44

Table 18-45

Table 18-46

Table 18-47

Table 18-48

Table 18-49

Table 18-50

Table 18-51

Table 18-52

Table 18-53

Table 18-54

Table 18-55

Table 18-56

Table 18-57

Table 18-58

Table 18-59

Table 18-60

Table 18-61

Table 18-62

Table 18-63

Table 18-64

Table 18-65

Table 18-66

Table 18-67

Table 18-68

Table 18-69

Table 18-70

Table 18-71

Table 18-72

Table 18-73

Table 18-74

Table 18-75

Table 18-76

Table 18-77

Table 18-78

Table 18-79

Table 18-80

Table 18-81

Table 18-82

Table 18-83

Table 18-84

Table 18-85

Table 18-86

Table 18-87

Table 18-88

Table 18-89

Table 18-90

Table 18-91

Table 18-92

Table 18-93

Table 18-94

Table 18-95

Table 18-96

Table 18-97

Table 18-98

Table 18-99

Table 18-100

Table 18-101

Table 18-102

Table 18-103

Table 18-104

Table 18-105

Table 18-106

Table 18-107

Table 18-108

Table 18-109

Table 18-110

Table 18-111

Table 18-112

Table 18-113

Table 18-114

Table 18-115

Table 18-116

Table 18-117

Table 18-118

Table 18-119

Table 18-120

Table 18-121

Table 18-122

Table 18-123

Table 18-124

Table 18-125

Table 18-126

Table 18-127

Table 18-128

Table 18-129

Table 18-130

Table 18-131

Table 18-132

Table 18-133

Table 18-134

Table 18-135

[0273] A gRNA containing a gRNA repeat of GAATTTCTACTAAGTGTAGAT (SEQ ID NO: 49) for LbCas12a or GTAATTTCTACTGTTGTAGAT (SEQ ID NO: 50) for FnCas12a plus the OgRRS sequence (fourth column of Table 18) plus TTTTTTT (poly-T transcription termination region) can be used to target the Cas12a nuclease for cleavage within both the OgRRS and CgRRS sequences. Specific examples of such gRNAs for FnCas12a are shown in Table 19. The gRNA repeat of GTAATTTCTACTGTTGTAGAT is underlined in the table, and the poly-T transcription termination sequence of TTTTTTT is italicized. [Table 19]

[0274] Any of the OgRRS sequences shown in Table 18 can be used as an alternative site for inserting a CgRRS designed using a different OgRRS.For example, to enable the entire transgenic insertion of event Gm_CSM63714, CgRRS can be inserted into adjacent sequences.To illustrate this approach, 3F-41 of OgRRS is selected as the OgRRS that can be used to design the corresponding DNA fragment containing 3F-41 of CgRRS, and 5F-65 of OgRRS is selected as the target site for inserting the DNA fragment containing 3F-41 of CgRRS.Using, for example, Cas12a editing system with FnCas12a endonuclease, the 5F-65 site of OgRRS is targeted using gRNA, i.e., gRNA_5F-65 shown in Table 19, and cleaved within the 5F-65 site of OgRRS. Next, a CgRRS 3F-41-containing DNA fragment containing the OgRRS 3F-41 target site is inserted into the cleavage site introduced into the OgRRS 5F-65 sequence. After selection of transgenic events containing the introduced CgRRS 3F-41 site, the events can be bred to additional germplasm. If desired, the transgenic insert of Gm_CSM63714 can be excised from the plant using the Cas12a editing system and gRNA, i.e., gRNA_3F-41, shown in Table 19.

[0275] Any of the OgRRS sequences shown in Table 18 within the 5' or 3' flanking genomic sequence of event Gm_CSM63714 can be used as a site for inserting a CgRRS-containing DNA fragment, including the OgRRS sequence present between the first (DMO) and second (PAT) expression cassettes or between the third (FT_Tv7) and fourth (TDO) expression cassettes of the transgenic insert, allowing for excision or removal of the first (DMO) or fourth (TDO) expression cassette adjacent to the 5' or 3' flanking genomic sequence, respectively, using a single-stranded gRNA. Similar methods can also be used to remove expression cassettes between the first and fourth expression cassettes (i.e., the second or third expression cassette, or the PAT or FT_Tv7 cassette). To illustrate this approach, TI-946 of OgRRS is selected as the OgRRS used to design the corresponding TI-946-containing DNA fragment of CgRRS, and 3F-41 of OgRRS is selected as the target site of the DNA fragment of TI-946 of CgRRS to be inserted.Using Cas12a editing system, for example, FnCas12a endonuclease, the 3F-41 site of OgRRS is targeted using gRNA, that is, gRNA_3F-41 shown in Table 19, and cleaved within the 3F-41 site of OgRRS.The DNA fragment of TI-946 of CgRRS containing the target site of TI-946 of OgRRS is then inserted into the cleavage site guided by the 3F-41 sequence of OgRRS.After selecting the transgenic event that contains the TI-946 site of CgRRS introduced, this event can be bred into another germplasm. If desired, the TDO expression cassette expressing the triketone dioxygenase protein can be excised from the plant using the Cas12a editing system and gRNA, i.e., gRNA_TI-946, shown in Table 19.

[0276] The CgRRS can be introduced into the transgenic insertion site locus using the CRISPR system via several methods. For example, the CRISPR system can be used to target the 5' insertion of a blunt-ended double-stranded DNA fragment to a desired genomic target site, for example, an OgRRS other than the OgRRS selected for the design of the CgRRS. CRISPR-mediated endonuclease activity can introduce a double-strand break (DSB) at the selected genomic target site, and the blunt-ended double-stranded DNA fragment is inserted into the DSB by DNA repair, for example, microhomology-driven non-homologous end joining DNA repair. The blunt-ended double-stranded DNA fragment can be designed with 1 to 10 bp of microhomology at both the 5' and 3' ends of the DNA fragment corresponding to the 5' and 3' flanking sequences at the cleavage site of the protospacer at the genomic target site.

[0277] The CRISPR system can be introduced into event Gm_CSM63714 by several methods. One or more expression cassettes encoding gRNA and / or CRISPR-associated protein components of a Type I, Type II, Type III, Type IV, Type V, or Type VI CRISPR-Cas system are transiently introduced into cells. The introduced DNA fragment containing the CgRRS along with the one or more expression cassettes encoding the gRNA and / or CRISPR-associated proteins is provided in an amount sufficient to modify the cell, but does not persist after a desired period of time or one or more cell divisions. In such embodiments, no additional steps are required to remove or separate the one or more expression cassettes encoding the gRNA and / or CRISPR-associated proteins from the modified cell. Double-stranded DNA fragments can also be transiently introduced into cells along with the one or more expression cassettes encoding the gRNA and / or CRISPR-associated proteins. The introduced double-stranded DNA fragment is provided in an amount sufficient to modify the cell, but does not persist after a desired period of time or one or more cell divisions.

[0278] Alternatively, an expression construct comprising one or more expression cassettes for expression of one or more gRNAs and encoding a Type I, Type II, Type III, Type IV, Type V, or Type VI CRISPR-associated protein is stably transformed into event Gm_CSM63714 to modify the plant cells at the targeted region of the transgene insertion locus and introduce the CgRRS into the desired target locus.

[0279] Example 9. Modification of soybean event Gm_CSM63714 by genome editing techniques using two guide RNAs This example describes how a CRISPR editing system containing two guide RNAs can be used by genome editing to excise the transgenic insertion present in soybean event Gm_CSM63714. Excision of the transgenic insertion or expression cassette within SEQ ID NO:9 or SEQ ID NO:10 of event Gm_CSM63714 can be achieved by genome editing using a variety of methods. In one embodiment, a CRISPR editing system containing a clustered regularly interspaced short palindromic repeats (CRISPR)-associated protein and two cognate guide RNAs can be used for targeted excision. The CRISPR-associated protein is an RNA-guided nuclease and may be a type I CRISPR-associated protein, a type II CRISPR-associated protein, a type III CRISPR-associated protein, a type IV CRISPR-associated protein, a type V CRISPR-associated protein, or a type VI CRISPR-associated protein, such as, but not limited to, Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and and Csx12), Cas10, Cas12a (also known as Cpf1), Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, CasX, CasY, and Mad7. The CRISPR-associated proteins and two guide RNAs (gRNAs) can be introduced into plant cells containing the soybean event Gm_CSM63714 to target specific sequences within the transgene insertion locus. In one embodiment, the CRISPR nuclease system cleaves at two different guide RNA hybridization sites, thereby allowing excision of the intervening sequence.After DNA cleavage, the genomic sequence can be repaired at the genomic target site via double-strand break repair pathways, which may include, for example, non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), homologous recombination, synthesis-dependent strand annealing (SDSA), single-strand annealing (SSA), or a combination thereof.

[0280] The 5' and 3' flanking genomic sequences of event Gm_CSM63714, as well as the sequences corresponding to the transgenic insert (shown as SEQ ID NOS: 11, 12, and 9, respectively), and the sequences corresponding to the 5' and 3' junction regions (shown as SEQ ID NOS: 1-6) were scanned for potential guide RNA recognition sites, including protospacer adjacent motif (PAM) sites recognized by the Cas12a endonuclease operably linked to the guide RNA hybridization site. The results are shown in Table 18. The identified gRNA recognition sites are located within the 5' or 3' flanking genomic sequences, within the 5' or 3' junction regions, or within the transgenic insert.

[0281] Two functional guide RNAs (gRNAs) for the RNA-guided nuclease system are created to target the transgenic insert locus of the Gm_CSM63714 event in a manner that allows for excision of a fragment of DNA, such as an expression cassette or genetic element within the transgene cassette, corresponding to either the entire Gm_CSM63714 transgenic insert or a fragment within the Gm_CSM63714 transgenic insert. A specific example is described below using the FnCas12a editing system (see Table 19). The gRNA contains a gRNA repeat of GTAATTTCTACTGTTGTAGAT (SEQ ID NO: 50, underlined) + OgRRS sequence (as shown in the fourth column of Table 18) + TTTTTTT (poly-T transcription termination region, italicized) to target the FnCas12a nuclease to the gRNA's recognition site. Similar methods can be used to excise either the entire transgene insert or a fragment within the transgene insert, such as an expression cassette, by selecting a gRNA targeted to a specific region. Alternatively, the LbCas12a editing system can be used, in which the gRNA contains a gRNA repeat of GAATTTCTACTAAGTGTAGAT (SEQ ID NO: 49) + OgRRS sequence (as shown in the third column of Table 18) + TTTTTTT (a poly-T transcription termination region).

[0282] To excise the entire transgene insert of event Gm_CSM63714, a first gRNA targets a region of the 5' flanking genomic sequence, e.g., 5F-65 (Table 18), and a second gRNA targets a region of the 3' flanking genomic sequence, e.g., 3F-41 (Table 18). A transfer DNA (T-DNA) construct suitable for use in Agrobacterium-mediated transformation is used. The T-DNA construct contains several expression cassettes between the left border (LB) and right border (RB) sequences. The first expression cassette contains a promoter operable in plant cells operably linked to a polynucleotide encoding the Cas12a RNA-guided nuclease. The second expression cassette contains a promoter operable in plant cells operably linked to a selectable marker gene, such as aadA, to confer resistance to spectinomycin and / or streptomycin. The construct also contains an expression cassette comprising a polymerase III promoter operable in plant cells operably linked to polynucleotides encoding two gRNAs, gRNA_5F-65 and gRNA_3F-41 (Table 19).

[0283] To facilitate excision of a fragment within the transgenic insert of event Gm_CSM63714, e.g., an expression cassette (TDO cassette) near the 3'-flanking genomic sequence, the first gRNA targets a region within the 3'-flanking genomic sequence, e.g., 3F-41 (Table 18), and the second gRNA targets a region between the FT_Tv7 expression cassette and the TDO expression cassette, e.g., TI-946 (Table 18). A transfer DNA (T-DNA) construct suitable for use in Agrobacterium-mediated transformation is used. The T-DNA construct contains several expression cassettes between left border (LB) and right border (RB) sequences. The first expression cassette contains a promoter operable in plant cells operably linked to a polynucleotide encoding the Cas12a RNA-guided nuclease. The second expression cassette contains a promoter operable in plant cells operably linked to a selectable marker gene, such as aadA, to confer resistance to spectinomycin and / or streptomycin. The construct also contains an expression cassette containing a polymerase III promoter operable in plant cells operably linked to polynucleotides encoding two gRNAs, gRNA_3F-41 and gRNA_TI-946 (Table 19).

[0284] To facilitate excision of a fragment within the transgenic insert of event Gm_CSM63714, such as the FT_Tv7 expression cassette (TDO cassette), the first gRNA targets the region between the PAT expression cassette and the FT_Tv7 expression cassette of the transgenic insert, e.g., TI-605 (Table 18), and the second gRNA targets the region between the FT_Tv7 expression cassette and the TDO expression cassette, e.g., TI-934 (Table 18). A transfer DNA (T-DNA) construct suitable for use in Agrobacterium-mediated transformation is used. The T-DNA construct contains several expression cassettes between left border (LB) and right border (RB) sequences. The first expression cassette contains a promoter operable in plant cells operably linked to a polynucleotide encoding the Cas12a RNA-guided nuclease. The second expression cassette contains a promoter operable in plant cells operably linked to a selectable marker gene, such as aadA, for conferring resistance to spectinomycin and / or streptomycin. The construct also contains an expression cassette containing a polymerase III promoter operable in plant cells operably linked to polynucleotides encoding two gRNAs, gRNA_TI-605 and gRNA_TI-934 (Table 19).

[0285] Following Agrobacterium-mediated transformation of soybean containing event Gm_CSM63714 and expression of the integrated polynucleotide, the gRNA guides a nuclease to each of these two sites at the transgenic insertion locus, where the nuclease creates a double-stranded break at each target site, excising the region between the target sites, and non-homologous end joining repair joins the flanking regions. Plants containing the complete deletion are identified using appropriate methods known in the art (e.g., PCR, DNA hybridization (Southern) blot, sequencing). References X.Chen,L.Levine and P.-Y.Kwok(1999).Fluorescence polarization in homogeneous nucleic acid analysis.Genome Res.9:492-498. S.Cheng,C.Fockler,W.M.Barnes and R.Higuchi(1994).Effective amplification of long targets from cloned int Proc.Natl.Acad.Sci.USA 91:5695-5699. F.B.Dean,S.Hosono,L.Fang,X.Wu,A.F.Faruqi,P.Bray-Ward,Z.Sun,Q.Zong,Y.Du,,J.Du,M.Driscoll,W.Song,S.F.Kingsmore,M.Egholm and R.S.Lasken(2002).Proc.Natl.Acad Sci.USA 99:5261-5266. A.Fire and S.Q.Xu(1995).Rolling replication of short DNA circles.Proc.Natl.Acad Sci.USA 92:4641-4645. L.Gao,D.B.T.Cox,W.X.Yan,J.C.Manteiga,M.W.Schneider,T.Yamano,H.Nishimasu,O.Nureki,N.Crosetto and F.Zhang(2017).Engineered Cpf1 variants with altered PAM specificities.Nature Biotechnology 35(8):789-792. J.C.Guatelli,K.M.Whitefield,D.Y.Kwon,K.J.Barringer,D.D.Richman and T.R.Gingeras(1990).Isothermal,in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication.Proc.Natl.Acad.Sci.USA 87:1874-1878. I.M.Heap(2021).International Survey of Herbicide Resistant Weeds.http: / / www.weedscience.org / Home.aspx. S.Khan,A.Latif,S.Q,Ahmad,F.Ahmad and M.Ghaffar(2010).Double haploid technique:in soybean and other species.International Journal of Applied Agricultural Research 5:649-655. D.Liu,S.L.Daubendiek,M.Zillman,K.Ryan and E.T.Kool(1996).Rolling circle DNA synthesis:small circular oligonucleotides as efficient templates for DNA polymerases.J.Am.Chem.Soc.118:1587-1594. P.M.Lizardi,X.Huang,Z.Zhu,P.Bray-Ward,D.C.Thomas and D.C.Ward(1998).Mutation detection and single-molecule counting using isothermal rolling-circle amplification.Nature Genetics 19:225-232. T.T.Nikiforov,R.B.Rendie,P.Goelet,Y.-H.Rogers,M.L.Kotewicz,S.Anderson,G.L.Trainor andM.R.Knapp(1994).Genetic bit analysis:a solid phase method for typing single nucleotide polymorphisms.Nucleic Acids Res.22:4167-4175. T.Notomi,H.Okayama,H.Masubuchi,T.Yonekawa,K.Watanabe,N.Amino,T.Hase (2000).Loop-mediated isothermal amplification of DNA”.Nucleic Acids Res.28(12):63e-63. M.D.Pearson,L.Nguyen,Y.Zhao,W.L.McKenna,T.J.Morin and W.B.Dunbar(2019).Past and accurate quantification of insertion-site specific transgene levels from raw seed samples using solid-state nanopore technology.PloS One 14(12):e0226719. D.Shoup,S.Duncan and IA.Ciampitti(2016).Soybean Production Handbook.Kansas State University Agricultural Experiment Station and Cooperative Extension Service. J.Schmutz,S.B.Cannon,J.Schlueter,J.Ma,T.Mitros,W.Nelson,D.L.Hyten,Q.Song,J.J.Thelen,J.Cheng,D.Xu,U.Hellsten,G.D.May,Y.Yu,T.Sakurai,T.Umezawa,M.K.Bhattacharyya,D.Sandhu,B.Valliyodan,E.Lindquist,M.Peto,D.Grant,S.Shu,D.Goodstein,K.Barry,M.Futrell-Griggs,B.Abernathy,J.Du,Z.Tian,L.Zhu,N.Gill,T.Joshi,M.Libault,A.Sethuraman,X.-C.Zhang,K.Shinozaki,H.T.Nguyen,R.A.Wing,P.Cregan,J.Specht,J.Grimwood,D.Rokhsar,G.Stacey,R.D.Shoemaker and S.A.Jackson(2010).Genome sequence of the palaeopolyploid soybean.Nature 463:178-183. A.D.Taylor,L.Mataseje,C.J.Urfano,L.Schmidt,K.S.Antonation,M.R.Mulvey and C.R.Corbett(2018).Ecaluation of Oxford Nanopore’s MinION Sequencing Device for Microbial Whole Genome Sequencing Applications.Scientific Reports 8:10931. S.Tyagi and F.R.Kramer(1996).Molecular beacons:probes that fluoresce upon hybridization.Nature Biotechnology 14:303-308. A.Verkest,S.Bourout,J.Debaveye,K.Reynaert,B.Saey,I.Van den Brande and K.D’Halluin(2019).Impact of differential DNA methylation on transgene expression in cotton(Gossypium hirsutum L.) events generated by targeted sequence insertion.Plant Biotechnology J.17:1236-1247. M.Vincent,Y.Xu and H.Kong(2004).Helicase-dependent isothermal DNA amplification.EMBO Reports 5(8):795-800. Y.Wan,J.F.Petolino and J.M.Widholm(1989).Efficient Production of Doubled Haploid Plants Through Colchicine Treatment of Anther-Derived Maize Callus.Theor.Appl.Genet.77:889-892. C.Wang,K.C.Glenn,C.Kessenich,E.Bell,L.A.Burzio,M.S.Koch,B.Li and A.Silvanovich(2016).Safety assessment of dicamba mono-oxygenases that confer dicamba tolerance to various crops.Regulatory Toxicology and Pharmacology 81:171-182. Y.Wang,Y.Zhao,A.Bollas,Y.Wang and K.F.Au(2021).Nanopore sequencing technology,bioinformatics and applications.Nature Biotechnology 39:1348-1365. M.Winge(2000).Pyrosequencing-a new approach to DNA analysis.Innovation in Pharma.Tech.00:18-24. B.Zetsche,J.S.Gootenberg,O.O.Abudayyeh,I.M.Slaymaker,K.S.Makarova,P.Essletzbichler,S.E.Volz,J.Joung,J.v.d.Oost,A.Regev,E.V.Koonin and F.Zhang(2015).Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.Cell.163(3):759-771.

Claims

1. Sequence ID 10, Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4, Sequence ID 5, Sequence ID 6, Sequence ID 7, Sequence ID 8, Sequence ID 9, A polynucleotide having a nucleotide sequence that is identical to the entire length of Sequence ID No. 10 or Sequence ID No. 9 by at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%. and any of the above complete complements A recombinant DNA molecule containing a nucleotide sequence selected from the group consisting of the following.

2. A recombinant DNA molecule according to claim 1, a) The recombinant DNA molecule originates from a soybean plant, seed, plant part, plant cell, progeny, or commercial product containing the soybean event Gm_CSM63714, and a representative sample of the seed containing the event is deposited as ATCC accession number PTA-127099. b) Recombinant DNA molecules are present in soybean plants, seeds, plant parts, plant cells, or progeny plants containing soybean event Gm_CSM63714, or in commercial products produced therefrom, and a representative sample of seeds containing the event is deposited as ATCC accession number PTA-127099. c) Recombinant DNA molecules are formed by inserting heterologous nucleic acid molecules into the genomic DNA of soybean plants or soybean cells, or d) Recombinant DNA molecules containing amplicons used to diagnose the presence of soy event Gm_CSM63714, Recombinant DNA molecule.

3. A DNA molecule containing a polynucleotide segment of sufficient length to function as a DNA probe, a) Under stringent hybridization conditions, the DNA of soy event Gm_CSM63714 in the sample specifically hybridizes with the DNA of the soy event Gm_CSM63714, and the detection of the hybridization of the DNA molecule under the stringent hybridization conditions is used to diagnose the presence of soy event Gm_CSM63714 in the sample, or b) In the sample, The 5' junction sequence between the adjacent soybean genome DNA and the transgenic insert of the soybean event Gm_CSM63714, The 3' junction sequence between the transgenic insert of the soybean event Gm_CSM63714 and the adjacent soybean genomic DNA, Sequence ID 9, and A fragment of SEQ ID NO: 9 containing a sequence of nucleotides of SEQ ID NO: 9 of sufficient length to identify the sequence as a fragment of the transgenic insertion of Gm_CSM63714. A DNA molecule that is specific to the detection of at least one of the following.

4. a) The DNA probe includes SEQ ID NO: 16, b) The DNA molecular arrangement includes a nucleotide sequence selected from the group consisting of sequence number 1, sequence number 2, sequence number 3, sequence number 4, sequence number 5, sequence number 6, sequence number 7, sequence number 8, sequence number 9, sequence number 10, and any of the above complements, or c) The sample is derived from soybean plants, seeds, plant parts, plant cells, progeny, or commercial products. The DNA molecule according to claim 3.

5. A pair of DNA molecules comprising a first DNA molecule and a second DNA molecule, wherein the first and second DNA molecules each contain a fragment of SEQ ID NO: 10 or its complement, and function as a DNA primer when used in an amplification reaction with DNA containing soy event Gm_CSM63714 to produce an amplicon used for diagnosing soy event Gm_CSM63714 in a sample.

6. a) The first and second DNA molecules include SEQ ID NO: 14 and SEQ ID NO: 15, or b) The amplicon is Sequence ID 1, Sequence ID 2, Sequence ID 3, Sequence ID 4, Sequence ID 5, Sequence ID 6, Sequence ID 7, Sequence ID 8, Sequence ID 9, Sequence ID 10, and A pair of DNA molecules according to claim 5, comprising a fragment of any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, having a length of at least 10 nucleotides, and comprising a nucleotide sequence selected from the group consisting of the fragments, which include nucleotides 1,000 to 1,001 or 11,196 to 11,197 of SEQ ID NO:

10.

7. A method for detecting the presence of soybean event Gm_CSM63714 in a sample derived from soybean seeds, plants, plant parts, plant cells, progeny, or commercial products, wherein the method is: I) a) Contacting the sample with a DNA molecule that functions as a DNA probe according to claim 3 or 4, b) Subjecting the sample and the DNA molecule functioning as the probe to stringent hybridization conditions, and c) Including detecting the hybridization of the DNA molecules that function as probes for the DNA molecules in the sample, Hybridization of the DNA molecule, which functions as a probe for the DNA molecule in the sample, is used to diagnose the presence of soy event Gm_CSM63714 in the sample, or II) d) Contacting the sample with the DNA molecule pair described in claim 5 or 6, e) Performing a sufficient amplification reaction to produce DNA amplicons, and f) including detecting the presence of the DNA amplicon, The aforementioned DNA amplicon, The 5' junction sequence between the adjacent soybean genome DNA and the transgenic insert of the soybean event Gm_CSM63714, The 3' junction sequence between the adjacent soybean genome DNA and the transgenic insert of the soybean event Gm_CSM63714, Sequence ID 9, and A fragment of SEQ ID NO: 9 containing a sequence of nucleotides of SEQ ID NO: 9 of sufficient length to identify the sequence as a fragment of the transgenic insertion of Gm_CSM63714. Includes at least one of the following: The presence of the DNA amplicon indicates the presence of the soybean event Gm_CSM63714 in the sample, III) g) Contacting the sample with the DNA molecule described in claim 6 or 8, and h) comprising performing a sequencing reaction to produce a target sequence, The target sequence includes a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, a complete complement of any of them, and a fragment of any of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 10, which is at least 10 nucleotides long and contains nucleotides 1,000 to 1,001 or 11,196 to 11,197 of SEQ ID NO: 10, IV) i) Contacting the sample with at least one antibody specific to at least one protein encoded by soybean event Gm_CSM63714, and j) The process includes detecting the binding of the antibody to the protein in the sample, The binding of the antibody indicates the presence of the soybean event Gm_CSM63714 in the sample. The aforementioned method.

8. A kit for detecting the presence of soybean event Gm_CSM63714 in a sample, a) A pair of DNA primers according to claim 5 or 6, and / or b) A DNA molecule that functions as a probe according to claim 3 or 4, or c) The kit comprising at least one antibody specific to at least one protein encoded by soy event Gm_CSM63714, wherein detection of the binding of the at least one antibody to at least one protein encoded by soy event Gm_CSM63714 in a sample is used to diagnose the presence of soy event Gm_CSM63714 in the sample.

9. a) A recombinant DNA molecule containing a sequence selected from the group consisting of a polynucleotide having a sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% identical to SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, the full length of SEQ ID NO: 10 or the full length of SEQ ID NO: 9, and a complete complement of any of the above, or b) Soybean event Gm_CSM63714, provided that a representative sample of seeds containing soybean event Gm_CSM63714 is deposited as ATCC accession number PTA-127099. Soybean plants, plant seeds, plant parts, or plant cells, including those included.

10. A soybean plant, plant seed, plant part, or plant cell according to claim 9, wherein a) the soybean plant, plant seed, plant part, or plant cell expresses at least one herbicide resistance gene selected from the group consisting of dicamba monooxygenase (DMO), phosphinothricin N-acetyltransferase (PAT), alpha-ketoglutarate-dependent non-heme iron dioxygenase variant FT_Tv7, triketone dioxygenase (TDO), and any combination thereof. b) The soybean plant, plant seeds, plant parts, or plant cells are resistant to at least one herbicide selected from the group consisting of benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitors, β-tricetone HPPD inhibitors, and any combination thereof. c) The soybean plant, plant seed, plant part, or plant cell contains a further transgene for resistance to at least one further herbicide. d) The soybean plant, plant seed, plant part, or plant cell contains soybean event Gm_CSM63714, provided that a representative sample of a seed containing soybean event Gm_CSM63714 is deposited as ATCC accession number PTA-127099, or e) The soybean plant, plant seed, plant part, or plant cell is further defined as a progeny plant of any generation of a soybean plant containing soybean event Gm_CSM63714, or a soybean plant part, plant seed, or plant cell derived therefrom. Soybean plant, plant seed, plant part, or plant cell.

11. A soybean plant, plant seed, plant part, or plant cell according to claim 10, wherein a) the benzoic acid type auxin comprises dicamba, the phenoxy type auxin comprises 2,4-D, the glutamine synthetase inhibitor comprises glufosinate, and the β-tricetone HPPD inhibitor is selected from the group consisting of mesotrione, benzobicyclon (BBC), tenbotrione, sulcotrione, tefuryltrione, and any combination thereof, or b) The at least one further herbicide is glyphosate, Soybean plant, plant seed, plant part, or plant cell.

12. A soybean plant, plant seed, plant part, or plant cell according to claim 11, a) The soybean plant, plant seeds, plant parts, or plant cells are resistant to mesotriones, b) The soybean plant, plant seed, plant part, or plant cell contains a polynucleotide sequence encoding a protein having the amino acid sequence of Sequence ID No. 57, or c) Soybean plants, plant seeds, plant parts, or plant cells, wherein the plant part includes microspores, pollen, anthers, ovules, ovaries, flowers, sheaths, embryos, stems, leaves, roots, or callus.

13. A method for controlling or preventing the growth of weeds in a certain area, comprising planting soybeans containing the event Gm_CSM63714 in the area, and applying an effective amount of at least one herbicide selected from the group consisting of dicamba, glufosinate, 2,4-D, β-triketone HPPD inhibitors, and any combination thereof, wherein the weeds in the area are controlled with no phytotoxicity to the soybeans or phytotoxicity to the soybeans of less than about 10%.

14. The method according to claim 13, a) Applying an effective amount of the at least one herbicide includes applying at least two herbicides selected from the group consisting of dicamba, glufosinate, 2,4-D, β-triketone HPPD inhibitors, and any combination thereof, throughout the growing season. b) The β-tricetone-based HPPD inhibitor is selected from the group consisting of mesotrione, benzobicyclon (BBC), tenbotrione, sulcotrione, tefuryltrione, and any combination thereof, or c) A method wherein the effective dose of dicamba is about 0.5 lb / acre to about 2 lb / acre throughout the growing season, the effective dose of glufosinate is about 0.4 lb / acre to about 1.6 lb / acre throughout the growing season, the effective dose of 2,4-D is about 0.5 lb / acre to about 4 lb / acre throughout the growing season, and / or the β-tricetone HPPD inhibitor comprises mesotrione, and the effective dose of mesotrione is about 0.09 lb / acre to about 0.36 lb / acre throughout the growing season.

15. A method for controlling wild soybeans containing soybean event Gm_CSM63714 in a certain area, comprising applying an effective amount of at least one herbicide other than dicamba, glufosinate, 2,4-D, or a β-tricetone HPPD inhibitor, wherein the application of the herbicide prevents the growth of soybeans containing soybean event Gm_CSM63714.

16. The method according to claim 15, wherein the herbicide other than dicamba, glufosinate, 2,4-D, or β-tricetone HPPD inhibitors is selected from the group consisting of atrazine, bromoxynil (3,5-dibromo-4-hydroxybenzonitrile), clopyralide, pyrithiobac, isoxaflutol, topramesone, fluomethurone, trifloxysulfuron, monosodium methylarsenate (MSMA), protoporphyrinogen oxidase (PPO) inhibitors, and any combination thereof.

17. The method according to claim 16, wherein the protoporphyrinogen oxidase (PPO) inhibitor comprises saflufenacil, flumioxazine, sulfenthrazone, or any combination thereof.

18. A method for obtaining soybean seeds or soybean plants resistant to benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitors, β-tricetone HPPD inhibitors, or any combination thereof, a) obtaining a population of plants grown therefrom, in which at least one of them contains soybean event Gm_CSM63714, and b) The method comprising identifying at least the first progeny seed containing soybean event Gm_CSM63714 or a plant grown therefrom.

19. The method according to claim 18, a) Identifying progeny seeds containing the soybean event Gm_CSM63714 or plants grown therefrom, i) Growing the aforementioned progeny seeds or plants to produce progeny plants, ii) Treating the progeny plants with an effective amount of at least one herbicide selected from the group consisting of benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitors, β-tricetone HPPD inhibitors, and any combination thereof, and iii) Selecting progeny plants that are resistant to at least one herbicide selected from the group consisting of benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitors, β-tricetone HPPD inhibitors, and any combination thereof, b) The benzoic acid type auxin comprises dicamba, the phenoxy type auxin comprises 2,4-D, the glutamine synthetase inhibitor comprises glufosinate, and the β-tricetone HPPD inhibitor is selected from the group consisting of mesotrione, benzobicyclon (BBC), tenbotrione, sulcotrione, tefuryltrione, and any combination thereof. c) Identifying progeny seeds or plants grown therefrom that contain the soybean event Gm_CSM63714 includes detecting the presence of the soybean event Gm_CSM63714 in a sample derived from the progeny seeds or plants grown therefrom, or d) Identifying a progeny seed containing the soybean event Gm_CSM63714 or a plant grown therefrom includes detecting the presence of at least one protein encoded by the soybean event Gm_CSM63714 in a sample derived from the progeny seed or a plant grown therefrom. method.

20. A method for determining the conjugation of soybean plants, plant parts, plant seeds, or plant cells containing the soybean event Gm_CSM63714, I) a) Contacting a sample containing DNA derived from the soybean plant, plant part, plant seed, or plant cell with a primer set capable of producing a first amplicon used for diagnosing the presence of soybean event Gm_CSM63714, and a second amplicon used for diagnosing wild-type soybean genomic DNA that does not contain soybean event Gm_CSM63714. b) Performing nucleic acid amplification reactions, c) Including detecting the first amplicon and the second amplicon, The presence of both amplicons indicates that the plant, plant part, seed, or cell is heterozygous for soybean event Gm_CSM63714, and the presence of only the first amplicon indicates that the plant, plant part, seed, or cell is homozygous for soybean event Gm_CSM63714, or II) d) Contacting a sample containing DNA derived from the soybean plant, plant part, plant seed, or plant cell with a probe set comprising at least a first probe that specifically hybridizes to soybean event Gm_CSM63714, and at least a second probe that specifically hybridizes to soybean genomic DNA disrupted by heterologous DNA insertion of soybean event Gm_CSM63714, but does not hybridize to soybean event Gm_CSM63714, and e) The method comprising hybridizing the probe set with the sample under stringent hybridization conditions, Detecting hybridization of only the first probe under the aforementioned hybridization conditions is used to diagnose homozygous soybean plants, plant parts, seeds, or plant cells for soybean event Gm_CSM63714, and detecting hybridization of both the first probe and the second probe under the aforementioned hybridization conditions is used to diagnose heterozygous soybean plants, plant parts, seeds, or plant cells for soybean event Gm_CSM63714. method.

21. a) The primer set includes SEQ ID NO: 14, SEQ ID NO: 15, and SEQ ID NO: 20, or b) The method according to claim 20, wherein the probe set includes sequence number 16 and sequence number 21.

22. A DNA construct comprising a first expression cassette, a second expression cassette, a third expression cassette, and a fourth expression cassette, I) a) The first expression cassette comprises, in an operable linkage, i) a ubiquitin (UB3) promoter, leader, and intron sequence derived from Arabidopsis thaliana, ii) a chloroplast transport peptide coding sequence of APG6 (Albino and Pale Green 6) derived from Arabidopsis thaliana, iii) a codon-optimized dicamba monooxygenase coding sequence (DMO) derived from Stenotrophonas maltophilia, and iv) a 3'UTR sequence of the aluminum-induced Sali3-2 protein derived from Medicago truncatula. b) The second expression cassette comprises, in an operable linkage, i) promoter and intron sequences derived from multiple promoter and intron sequences of Arabidopsis thaliana, ii) a codon-optimized phosphinotricin N-acetyltransferase (PAT) coding sequence derived from Streptomyces viridochromogene, and iii) the 3'UTR of a small heat shock protein (Hsp20) derived from Medicago truncatula. c) The third expression cassette comprises, in an operable linkage, i) a polyubiquitin (UBQ10) promoter, leader, and intron sequence derived from Arabidopsis thaliana, ii) an alpha-ketoglutarate-dependent non-heme iron dioxygenase variant coding sequence (FT_Tv7) derived from Sphingobium herbidovorans, and iii) a 3'UTR sequence of a putative protein derived from Medicago truncatula. d) The fourth expression cassette comprises, in an operable linkage, i) promoter, leader, and intron sequences derived from multiple promoter, leader, and intron sequences of Arabidopsis thaliana, ii) codon-optimized coding sequences of triketone dioxygenase (TDO) derived from Oryza sativa, and iii) 3'UTR sequences derived from multiple 3'UTR sequences of Zea mays, or II) e) The first expression cassette comprises a dicamba monooxygenase coding sequence, (f) The second expression cassette comprises a phosphinotricin N-acetyltransferase (PAT) coding sequence; (g) The third expression cassette comprises an alpha-ketoglutarate-dependent non-heme iron dioxygenase variant coding sequence (FT_Tv7) capable of degrading 2,4-D; and (h) The fourth expression set is the DNA construct comprising a triketone dioxygenase (TDO) coding sequence. Furthermore, the 5' or 3' end of the construct includes (i) at least 50 consecutive nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98, or (ii) at least 50 consecutive nucleotides of SEQ ID NO: 12 or SEQ ID NO: 99, The aforementioned DNA construct.

23. The DNA construct according to claim 22, wherein the DNA construct includes sequence number 9.

24. A method for improving resistance in soybean plants to at least one herbicide selected from the group consisting of benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitors, β-tricetone HPPD inhibitors, and any combination thereof, a) Inserting the DNA construct according to claim 22 or 23 into the genome of soybean cells, b) Producing soybean plants from the soybean cells, and c) The method comprising selecting a soybean plant containing the DNA construct.

25. The method according to claim 24, a) The selection includes treating the soybean cells or plants with an effective amount of at least one herbicide selected from the group consisting of benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitors, β-tricetone HPPD inhibitors, and any combination thereof, or b) The benzoic acid type auxin comprises dicamba, the phenoxy type auxin comprises 2,4-D, the glutamine synthetase inhibitor comprises glufosinate, and the β-tricetone HPPD inhibitor is selected from the group consisting of mesotrione, benzobicyclon (BBC), tenbotrione, sulcotrione, tefuryltrione, and any combination thereof. method.

26. Soybean plants, plant seeds, plant parts, or plant cells that are resistant to herbicides having at least three different mechanisms of action at a single genomic location.

27. The soybean plant, plant seed, plant part, or plant cell according to claim 26, comprising the DNA construct according to claim 22 or 23.

28. A soybean plant, plant seed, plant part, or plant cell that is resistant to at least one herbicide selected from the group consisting of benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitor, β-tricetone HPPD inhibitor, and any combination thereof, comprising the DNA construct described in claim 22 or 23.

29. The soybean plant, plant seed, plant part, or plant cell according to claim 28, wherein the benzoic acid type auxin comprises dicamba, the phenoxy type auxin comprises 2,4-D, the glutamine synthetase inhibitor comprises glufosinate, and the β-tricetone HPPD inhibitor is selected from the group consisting of mesotrione, benzobicyclon (BBC), tenbotrione, sulcotrione, tefuryltrione, and any combination thereof.

30. A soybean plant, plant seed, plant part, or plant cell according to any one of claims 26 to 29, a) Soybean plants, plant seeds, plant parts, or plant cells are obtained by the method described in claim 24 or 25, or b) The soybean plant, plant seeds, plant parts, or plant cells are resistant to at least further herbicides. Soybean plant, plant seed, plant part, or plant cell.

31. The soybean plant, plant seed, plant part, or plant cell according to claim 30, wherein the at least further herbicide comprises glyphosate.

32. A method for producing progeny soybean plants containing the soybean event Gm_CSM63714, a) Cross-pollinating a first soybean plant containing soybean event Gm_CSM63714, either by itself or with a second soybean plant. b) Collecting one or more seeds produced from the aforementioned hybrid species. c) To grow one or more seeds and produce one or more progeny plants, d) The method comprising selecting at least the first progeny plant or seed containing soybean event Gm_CSM63714.

33. Inbred or hybrid soybean plants or seeds containing soybean event Gm_CSM63714, produced by the method described in claim 32.

34. Non-living soybean plant material or non-renewable soybean plant material comprising (a) a recombinant DNA molecule according to claim 1 or 2 or a DNA construct according to claim 22 or 23, b) A representative sample of seeds containing soybean event Gm_CSM63714 has been deposited as ATCC accession number PTA-127099. plant material.

35. A commercial product comprising a recombinant DNA molecule according to claim 1 or 2, or a DNA construct according to claim 22 or 23.

36. A product according to claim 35, a) The commercial product is produced from a transgenic soybean plant, plant part, plant seed, or plant cell containing the soybean event Gm_CSM63714, or b) The commodity products include whole seeds or processed seeds, viable or inviolable seeds, viable plant parts (e.g., roots and leaves), viable plant cells, processed plant parts, processed plant tissues, dried plant tissues, dried plant parts, frozen plant tissues, frozen plant parts, food for human consumption, such as soybean oil, soy milk, soybean flour, ground soybeans, soybean protein, soybean protein concentrate, hydrolyzed plant protein, processed soybean protein, lecithin, curd, tofu, vegetable soybeans (edamame), bean sprouts, soybean film (yuba), roasted soybeans, miso, tempeh, soy sauce, or natto, plant parts processed for animal feed, such as soybean meal, soybean fiber, biodiesel, bio-composite building materials, such as particleboard, plywood, or lumber products, soybean oil-based solvents, soybean oil-based industrial lubricants, soybean ink, soy candles, soy crayons, soybean-based hydraulic fluid, or soybean-based foam. Commercial products.

37. A method for producing commodity products, a) Obtaining transgenic soybean plants, plant parts, or plant seeds containing soybean event Gm_CSM63714, and b) The method comprising producing a commercial product from the transgenic soybean plant, plant part, or plant seed.

38. A method for controlling, preventing, or reducing the occurrence of herbicide-resistant weeds, a) Cultivating soybean plants in a crop growing environment that include a transgene that confers resistance to herbicides having at least three different mechanisms of action for herbicides at a single genomic location, or b) Cultivating soybean plants containing the DNA construct according to claim 22 or 23 for conferring resistance to herbicides having at least three different mechanisms of action at a single genomic location in the crop's growing environment, and c) Applying at least one herbicide selected from the group consisting of dicamba, glufosinate, 2,4-D, β-triketone HPPD inhibitors, and any combination thereof, to the growing environment of the crop, wherein the soybean plant is resistant to the at least one herbicide. The aforementioned method.

39. The method according to claim 38, a) The mechanism of action of the at least three different herbicides is selected from the group consisting of glutamine synthetase inhibition, 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibition, phenoxy auxin, and benzoic acid auxin, or b) The soybean plant further comprises at least one further transgene for a further herbicide mechanism of action, method.

40. The method according to claim 39, wherein the at least one further transgene is EPSPS for conferring resistance to glyphosate.

41. The method according to claim 40, wherein the EPSPS transgene comprises a polynucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO:

57.

42. A method for reducing the number of breeding loci in soybeans by inserting a transgene at a single genomic location for resistance to at least three different classes of herbicides.

43. The method according to claim 42, wherein the introduced gene is inserted as a single molecularly bound transgenic insert.

44. The method according to claim 43, wherein the single molecularly bound transgenic insert provides a commercial level of resistance to at least one herbicide for each mechanism of action of the herbicide.

45. Furthermore, at the 5' or 3' end of the structure, a) At least 50 consecutive nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98, or b) comprising at least 50 consecutive nucleotides of sequence number 12 or sequence number 99, The DNA construct according to claim 22 or 23.

46. A DNA construct comprising a polynucleotide having a sequence that is identical to the entire length of Sequence ID No. 9 by at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9%, The DNA construct comprising, at its 5' or 3' end, (i) at least 50 consecutive nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98, or (ii) at least 50 consecutive nucleotides of SEQ ID NO: 12 or SEQ ID NO:

99.

47. A DNA construct according to claim 45 or 46, a) The 5' end of the construct contains at least 50 consecutive nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98, and the 3' end of the construct contains at least 50 consecutive nucleotides of SEQ ID NO: 12 or SEQ ID NO: 99, b) The 5' end of the construct contains one or more nucleotide sequences selected from SEQ ID NOs. 58-77 and SEQ ID NOs. 100-139, or c) The 3' end of the construct includes one or more nucleotide sequences selected from SEQ ID NOs: 78-97 and SEQ ID NOs: 140-179, DNA construct.

48. A soybean plant, plant cell, plant part, or plant seed comprising the DNA construct according to any one of claims 45 to 47.

49. A soybean plant, plant cell, plant part, or plant seed comprising a recombinant DNA construct integrated into chromosome 13, wherein the recombinant DNA construct confers resistance to at least one herbicide selected from the group consisting of benzoic acid auxin, phenoxy auxin, glutamine synthetase inhibitor, β-tricetone HPPD inhibitor, and any combination thereof, and the recombinant DNA construct is integrated into the chromosome at a position where at least 50 consecutive nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98 and 50 consecutive nucleotides of SEQ ID NO: 12 or SEQ ID NO: 99 are located laterally.

50. A soybean plant, plant cell, plant part, or plant seed according to claim 49, a) The benzoic acid type auxin comprises dicamba, the phenoxy type auxin comprises 2,4-D, the glutamine synthetase inhibitor comprises glufosinate, and the β-tricetone HPPD inhibitor is selected from the group consisting of mesotrione, benzobicyclon (BBC), tenbotrione, sulcotrione, tefuryltrione, and any combination thereof. b) At least 50 consecutive nucleotides of SEQ ID NO: 11 or SEQ ID NO: 98 contain one or more nucleotide sequences selected from SEQ ID NOs: 58-77 and SEQ ID NOs: 100-139, or c) At least 50 consecutive nucleotides of SEQ ID NO: 12 or SEQ ID NO: 99 include one or more nucleotide sequences selected from SEQ ID NOs: 78-97 and SEQ ID NOs: 140-179. Soybean plant, plant cell, plant part, or plant seed.