Novel Compositions and Methods for Cell-Free DNA Detection

Abstract

Internal standard oligonucleotides, primers, probes, and kits for the detection and quantification of cell-free DNA using multiplex quantitative real-time PCR are provided herein.

Description

[Technical Field]

[0001] The present disclosure relates to compositions and kits for detecting cell-free DNA, and their uses. Specifically, primers and probes for multiplex quantitative real-time PCR, and methods for detecting and quantifying circulating cell-free DNA are provided. [Background technology]

[0002] background Since its discovery in human plasma approximately 70 years ago, circulating cell-free DNA (cfDNA) has become an attractive research target as a noninvasive disease biomarker. Interest in clinical applications has grown exponentially, making it a common and potential target in a wide range of research areas. cfDNA can be found in different body fluids in both healthy and unhealthy subjects. The recent rapid development of new molecular technologies has facilitated the study and identification of cfDNA, unlocking minimally invasive diagnostics and improving disease monitoring, clinical decisions, and patient outcomes. cfDNA has already had a significant impact on prenatal medicine and may become the standard of care in other fields, from oncology to transplant medicine and cardiovascular disease (see, for example, Ranucci et al., Methods Mol Biol. 2019;1909:3-12).

[0003] cfDNA can be detected in various body fluids, such as blood (blood plasma or serum), urine, saliva, cerebrospinal fluid, and synovial fluid. Therefore, the detection and quantification of cfDNA in body fluids can be affected by several factors, such as the type of test sample, nucleic acid extraction method, storage method, and detection and quantification method.

[0004] Different quantification methods can lead to large deviations in test results due to the relatively low content of cfDNA in body fluids. Quantitative analysis using gene amplification techniques is used to solve this problem. Due to the loss of nucleic acids during the extraction process, quantitative results may not reflect the actual amount of cfDNA in body fluids. Furthermore, there are different degrees of DNA degradation (up to 30%) either during or after purification or after long-term storage. These variations significantly affect the accuracy and interpretation of the final results.

[0005] Current methods for quantifying circulating cfDNA involve quantitative fluorescent PCR using an external standard and PicoGreen labeling. The method uses a housekeeping gene as a quantitative standard and generates a standard curve using known concentrations of the external standard. Because the external standard and test samples are quantified in different containers, variability between assays affects the accuracy and stability of the results. Furthermore, because methods using PicoGreen fluorophores directly detect cfDNA without amplification, the sensitivity of the quantification method is low, and variability between different tests is significant.

[0006] Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is an enveloped, positive-strand RNA virus that causes Coronavirus Disease-2019 (COVID-19). Coronaviruses typically cause relatively mild respiratory illness, but as of February 2021, COVID-19 has been ongoing since its emergence in late 2019, killing 2.5 million people. While recent progress in vaccine development has been significant, the emergence of novel coronaviruses in the human population is a continuing threat. From its 5' end to its 3' end, the SARS-CoV-2 genome contains open reading frames (ORFs), such as ORF1ab, which corresponds to nonstructural proteins that form the transcription-replication complex, and ORF-S (S gene), ORF-E (E gene), ORF-M (M gene), and ORF-N (N gene), which correspond to the four major structural proteins: spike surface glycoprotein (S), envelope protein (E), membrane glycoprotein (M), and nucleocapsid protein (N). It also contains several auxiliary proteins, such as ORFs corresponding to proteins of unknown function, interspersed among or overlapping the structural genes.

[0007] The SARS-CoV-2 RNA genome has a 5' methylated cap and a 3' polyadenylated tail, allowing the RNA to attach to host cell ribosomes for translation. ORF1b encodes a protein called RNA-dependent RNA polymerase (RdRp or nsp12), which allows the viral genome to be transcribed into new RNA copies using the host cell's machinery. RdRp is the first protein produced, and once the gene encoding RdRp is translated, translation is halted by a stop codon. RNA-dependent RNA polymerase (RdRp, RDR) is an enzyme that catalyzes the replication of RNA from an RNA template. This is in contrast to typical DNA-dependent RNA polymerases, which catalyze the transcription of RNA from a DNA template. RdRP is an essential protein encoded in the genomes of all RNA-containing viruses that do not have a DNA step. It catalyzes the synthesis of an RNA strand complementary to a given RNA template. The RNA replication process is a two-step mechanism. First, the initiation step of RNA synthesis begins at or near the 3' end of the RNA template by either a primer-independent (de novo) or primer-dependent mechanism utilizing a viral protein genome-binding (VPg) primer. De novo initiation consists of the addition of a nucleoside triphosphate (NTP) to the 3'-OH of the initial initiating NTP. During the following so-called elongation phase, this nucleotidyl transfer reaction is repeated with subsequent NTPs to generate complementary RNA products. The protein nsp9 encoded by ORF1a may be involved in viral replication by acting as a single-stranded RNA-binding protein. The protein nsp6 encoded by ORF1a plays a role in the initial induction of autophagosomes from the host reticulum and subsequently limits the proliferation of these phagosomes, which are no longer able to deliver viral components to lysosomes.

[0008] Several variants of SARS-CoV-2 carrying mutations in the Spike protein, with predicted impact on the epidemiology of Covid-19 disease, have emerged since mid-2020 and are currently spreading worldwide. These variants of concern were first reported in the UK (lineage B.1.1.7, notable mutations N501Y, 69-70del, P681 H) and VOC-202102 / 02 (B.1.1.7 with E484K), South Africa (SA) (lineage B.1.351, notable mutations N501Y, E484K, K417N), Brazil (BR) (lineage P.1, notable mutations N501Y, E484K, K417T), and the UK and Nigeria (lineage B.1.525, notable mutations E484K, F888L, 69-70del) and are now spreading to multiple countries.

[0009] All these new variants of SARS-CoV-2 are characterized by enhanced human-to-human infectivity compared to previous variants of the virus. The UK, SA, and BR variants all share the mutation N501Y in the receptor-binding region (RBD), which is predicted to increase the binding affinity of the spike for the human ACE2 receptor. Variants SA and BR share an additional mutation in this region (K417T / N) that is suspected to contribute to additional binding affinity for hACE2. The UK variant harbors another mutation outside the RBD (del69 / 70), which is predicted to affect infectivity. Furthermore, variants SA and BR share an additional mutation in the RBD (E484K) that has been reported to enhance the ability of SARS-CoV-2 to evade immune responses (both natural and vaccine-induced). Monoclonal and serum-derived antibodies have been reported to be 10-60 times less effective at neutralizing viruses harboring the E484K mutation. A separate mutation, L452R, carried by the Californian variant has previously been shown to enhance SARS-CoV-2's immune evasion capabilities, and some vaccines may be less effective against these variants.

[0010] Consequently, these new variants of SARS-CoV-2 are of concern due to their increased penetrance (UK, BR, SA). Furthermore, the reduced susceptibility of variants carrying the mutation E484K (SA, BR) to neutralizing antibodies may compromise vaccine efficacy.

[0011] As a result, there is a need in the art for approaches that provide accurate and robust testing of cfDNA in bodily fluid samples and methods for predicting the severity of diseases such as SARS-CoV-2 infection. [Prior art documents] [Non-patent literature]

[0012] [Non-Patent Document 1] Ranucci et al., Methods Mol Biol. 2019;1909:3-12 Summary of the Invention

[0013] overview The present disclosure relates to an internal standard oligonucleotide, a primer, a probe, and a kit for detecting cfDNA in a body fluid sample using multiplex quantitative real-time PCR.The present disclosure also relates to a method for detecting cfDNA and assessing the severity of injury or diagnosing disease.

[0014] Thus, the present disclosure provides a double-stranded internal standard oligonucleotide for detecting cell-free DNA in a biological sample that comprises a sequence that is at least 80% identical to the sequence of SEQ ID NO:1.

[0015] In some embodiments, the oligonucleotide comprises a sequence consisting of SEQ ID NO:1.

[0016] In some embodiments, the internal standard oligonucleotide has a length of about 100 bp to about 3000 bp.

[0017] In some embodiments, the internal standard oligonucleotide has a length of about 190 bp to about 200 bp.

[0018] The present disclosure also provides a method for producing the internal standard oligonucleotide described herein, comprising: (a) providing a double-stranded oligonucleotide sequence comprising an approximately 25-200 bp region on a target human gene; (b) inserting the oligonucleotide into a recombinant vector; and (c) digesting the recombinant vector of step (b) with one or more endonucleases, thereby obtaining a linear internal standard oligonucleotide.

[0019] In some embodiments, the recombinant vector is a pMD20 vector.

[0020] In some embodiments, the one or more endonucleases include SmaI.

[0021] The present disclosure also provides an oligonucleotide comprising a sequence that is at least 90% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 2-6.

[0022] In some embodiments, the oligonucleotide is complementary to and / or binds to the human β-actin gene, wherein the oligonucleotide contains a sequence that is at least 90% identical to the entire length of the oligonucleotide sequence of SEQ ID NO: 2 or 3.

[0023] In some embodiments, the oligonucleotide is complementary to and / or binds to the sequence of SEQ ID NO: 1, and the oligonucleotide comprises a sequence that is at least 90% identical to the entire length of the oligonucleotide sequence of SEQ ID NO: 3 or 4.

[0024] In some embodiments, the oligonucleotides described herein comprise a sequence that is at least 90% identical to the entire length of the oligonucleotide sequence of SEQ ID NO: 5 or 6, the oligonucleotide has a 5' end and a 3' end, and the oligonucleotide is detectably labeled.

[0025] In some embodiments, the oligonucleotide comprises a sequence consisting of SEQ ID NO:5.

[0026] In some embodiments, the oligonucleotide is detectably labeled at the 5' end with JOE and / or the oligonucleotide is detectably labeled at the 3' end with BHQ1.

[0027] In some embodiments, the oligonucleotide comprises a sequence consisting of SEQ ID NO:6.

[0028] In some embodiments, the oligonucleotide is detectably labeled at the 5' end with FAM and / or the oligonucleotide is detectably labeled at the 3' end with BHQ1.

[0029] The present disclosure also provides pharmaceutical compositions comprising an effective amount of any of the oligonucleotides described herein and a pharmaceutically acceptable carrier, diluent, or both.

[0030] The present disclosure also provides methods comprising contacting a biological sample with any of the oligonucleotides described herein.

[0031] In some embodiments, the methods described herein further comprise detecting and quantifying the human β-actin gene in the biological sample.

[0032] In some embodiments, the methods described herein further comprise quantifying cell-free DNA in the biological sample based on quantification of the human β-actin gene.

[0033] The present disclosure also provides a method for detecting cell-free DNA in a biological sample, the method comprising: (A) incubating the biological sample with (1) a DNA polymerase and dNTPs; (2) a forward primer for the human β-actin gene having a nucleotide sequence consisting of SEQ ID NO: 2; (3) a reverse primer for the human β-actin gene having a nucleotide sequence consisting of SEQ ID NO: 3; and (4) a detectably labeled probe comprising an oligonucleotide sequence capable of specifically hybridizing to the oligonucleotide sequence of the human β-actin gene, wherein the incubation is under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the human β-actin gene, if the human β-actin gene is present in the clinical sample, thereby generating an amplified human β-actin fragment; and (B) detecting the human β-actin gene, thereby detecting the presence of cell-free DNA in the biological sample.

[0034] In some embodiments, the method further comprises quantifying the human β-actin gene in the biological sample, if said human β-actin gene is present in said clinical sample.

[0035] In some embodiments, the human β-actin probe is detectably labeled at the 5′ end with JOE and / or the oligonucleotide is detectably labeled at the 3′ end with BHQ1.

[0036] In some embodiments, the human β-actin probe comprises the oligonucleotide sequence of SEQ ID NO:5.

[0037] In some embodiments, the human β-actin probe hybridizes to an amplified human β-actin fragment.

[0038] In some embodiments, the methods described herein further include: (C) adding to the biological sample an amount of an internal standard oligonucleotide having the sequence of SEQ ID NO: 1; (D) incubating the biological sample in (C) with (1) a DNA polymerase and dNTPs; (2) a forward primer having a nucleotide sequence consisting of SEQ ID NO: 4; (3) a reverse primer having a nucleotide sequence consisting of SEQ ID NO: 3; and (4) a detectably labeled internal standard probe comprising an oligonucleotide sequence capable of specifically hybridizing to the internal standard oligonucleotide, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the sequence of SEQ ID NO: 1, thereby generating an amplified fragment of the region; and (E) detecting the internal standard oligonucleotide.

[0039] In some embodiments, the internal standard probe is detectably labeled at the 5' end with FAM and / or the oligonucleotide is detectably labeled at the 3' end with BHQ1.

[0040] In some embodiments, the internal standard probe comprises the oligonucleotide sequence of SEQ ID NO:6.

[0041] In some embodiments, the internal standard probe hybridizes to a region of SEQ ID NO:1.

[0042] In some embodiments, 5 x 10 in 5 μL 4 A copy of the internal standard oligonucleotide is added to each 195 μL of biological sample.

[0043] In some embodiments, the DNA polymerase has 5' to 3' exonuclease activity that hydrolyzes the hybridized human β-actin probe or internal standard probe, thereby separating the detectable labels on the probes and making the signal detectable.

[0044] In some embodiments, hybridization of the probe to the amplified fragment separates the detectable labels on the probe, rendering the signal detectable.

[0045] In some embodiments, the signal is a fluorescent signal.

[0046] In some embodiments, the probe is labeled with a fluorophore and a quencher of the fluorescence of the fluorophore.

[0047] In some embodiments, the DNA polymerase is Taq DNA polymerase.

[0048] The present disclosure also provides a method for quantifying cell-free DNA in a biological sample, the method comprising: (A) incubating the biological sample with (1) a DNA polymerase and dNTPs; (2) a forward primer for the human β-actin gene having a nucleotide sequence consisting of SEQ ID NO:2; (3) a reverse primer for the human β-actin gene having a nucleotide sequence consisting of SEQ ID NO:3; and (4) a detectably labeled probe comprising an oligonucleotide sequence capable of specifically hybridizing to an oligonucleotide sequence of the human β-actin gene, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the human β-actin gene, if the human β-actin gene is present in the clinical sample, thereby producing an amplified human β-actin fragment; and (B) producing an amount of an internal standard oligonucleotide having the sequence of SEQ ID NO:1. (C) incubating the biological sample in (B) with (1) DNA polymerase and dNTPs, (2) a forward primer having a nucleotide sequence consisting of SEQ ID NO: 4, (3) a reverse primer having a nucleotide sequence consisting of SEQ ID NO: 3, and (4) a detectably labeled probe, wherein the probe comprises an oligonucleotide sequence capable of specifically hybridizing to the internal standard oligonucleotide, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the sequence of SEQ ID NO: 1, thereby generating an amplified fragment of the region; (D) detecting the internal standard oligonucleotide; and (E) detecting and quantifying the human β-actin gene based on the detection of the internal standard oligonucleotide, thereby quantifying cell-free DNA in the biological sample.

[0049] In some embodiments, the methods described herein further comprise determining the amplification efficiency of the internal standard oligonucleotide and the human β-actin gene.

[0050] In some embodiments, quantification of the human β-actin gene is performed based on one or more of the following parameters: (1) the starting copy number of the internal standard oligonucleotide (S0), (2) Amplification efficiency of the human β-actin gene (E T ), (3) Amplification efficiency of the internal standard oligonucleotide (E S ), (4) the cycle threshold (Ct,T) of the human β-actin gene, and (5) Cycle threshold (Ct,S) of the internal standard oligonucleotide.

[0051] In some embodiments, quantification of the human β-actin gene is performed according to formula (I): TIFF2025516389000002.tif7128

[0052] The present disclosure also provides a kit, the kit comprising: (1) one or more internal standard oligonucleotides, wherein the one or more internal standard oligonucleotides comprise a sequence that is at least 90% identical to the sequence of SEQ ID NO: 1; (2) one or more oligonucleotides, wherein the one or more oligonucleotides comprise a sequence that is at least 90% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 2 to 6; (3) a PCR buffer, a DNA polymerase, dNTPs, and MgCl2; and (4) optionally, instructions for carrying out the method of any one of claims 17 to 38.

[0053] The present disclosure also provides an internal standard oligonucleotide comprising: (a) an oligonucleotide sequence that is at least 80% identical to a corresponding region of a target human gene; and (b) a forward primer binding site and a reverse primer binding site, wherein the length between the forward primer binding site and the reverse primer binding site is about 90 bp to about 200 bp.

[0054] In some embodiments, the reverse primer binding site is within a sequence that is at least 80% identical to the corresponding region of a human gene.

[0055] In some embodiments, the internal standard oligonucleotide has a length of about 100 bp to about 3000 bp.

[0056] In some embodiments, the target human gene is a human housekeeping gene.

[0057] In some embodiments, the housekeeping gene is a single copy housekeeping gene.

[0058] In some embodiments, the housekeeping gene is selected from the group consisting of human 18S rRNA (18S ribosomal RNA), human 28S rRNA (28S ribosomal RNA), human TUBA (α-tubulin), human ACTB (β-actin), human β2M (β2-microglobulin), human ALB (albumin), human RPL32 (ribosomal protein L32), human TBP (TATA sequence-binding protein), human CYCC (cyclophilin C), human EF1A (elongation factor 1 alpha), human GAPDH (glyceraldehyde-3-phosphate dehydrogenase), human HPRT (hypoxanthine phosphoribosyltransferase), and human RPII (RNA polymerase II).

[0059] In some embodiments, the internal standard oligonucleotide is double-stranded.

[0060] The present disclosure also provides a primer set for detecting cell-free DNA in a subject, the primer set comprising: (a) a forward primer and a reverse primer for amplifying a human gene in a biological sample; and (b) a forward primer and a reverse primer for amplifying an internal standard oligonucleotide, wherein the reverse primer for amplifying the internal standard oligonucleotide has a sequence that is at least 80% identical to the sequence of the reverse primer for amplifying the target human gene.

[0061] In some embodiments, the reverse primer for amplifying the internal standard oligonucleotide has a sequence identical to the sequence of the reverse primer for amplifying the target gene.

[0062] The present disclosure also provides a primer set for detecting cell-free DNA in a subject, the primer set including: (a) a forward primer and a reverse primer for amplifying a human gene in a biological sample; and (b) a forward primer and a reverse primer for amplifying an internal standard oligonucleotide, wherein the forward primer for amplifying the internal standard oligonucleotide has a sequence that is at least 80% identical to the sequence of the forward primer for amplifying the human gene.

[0063] In some embodiments, the forward primer for amplifying the internal standard oligonucleotide has a sequence identical to the sequence of the forward primer for amplifying the target gene.

[0064] In some embodiments, the forward and reverse primers for amplifying the human gene bind to regions on the human gene that are about 90 bp to about 200 bp apart.

[0065] In some embodiments, the forward and reverse primers for amplifying the internal standard oligonucleotide bind to regions on the internal standard oligonucleotide that are about 90 bp to about 200 bp apart.

[0066] In some embodiments, the forward primer and / or the reverse primer has a length of about 15 bp to about 30 bp.

[0067] The present disclosure also provides a kit, the kit comprising: (1) one or more internal standard oligonucleotides; (2) one or more primer sets described herein; (3) a PCR buffer, a DNA polymerase, and dNTPs; and (4) optionally, instructions for carrying out any one of the methods described herein.

[0068] The present disclosure also provides a method for producing an internal standard oligonucleotide for detecting cell-free DNA, the method comprising: (a) providing a double-stranded oligonucleotide sequence comprising a region of about 25 to 150 bp on a target human gene; (b) inserting the oligonucleotide into a recombinant vector; and (c) digesting the recombinant vector of step (b) with one or more endonucleases, thereby obtaining a linear internal standard oligonucleotide, wherein the internal standard oligonucleotide is about 100 bp to about 3,000 bp in length.

[0069] In some embodiments, the biological sample is essentially free of cellular DNA.

[0070] In some embodiments, the methods described herein further comprise removing cellular DNA from the biological sample.

[0071] In some embodiments, cellular DNA is removed using centrifugation, microfluidic-based separation, columns or magnetic beads, or filtration-based separation.

[0072] The present disclosure further provides a method for predicting the severity of an infection by SARS-CoV-2, the method including: (A) obtaining a biological sample from a subject having a SARS-CoV-2 infection; (B) quantifying cell-free DNA (cfDNA) in the biological sample; and (C) predicting the severity based on the cfDNA quantification, wherein a cfDNA concentration above a cutoff value indicates a worsening of the SARS-CoV-2 infection.

[0073] In some embodiments, quantifying cfDNA comprises quantifying housekeeping genes in the biological sample.

[0074] In some embodiments, the housekeeping gene is the human β-actin gene.

[0075] In some embodiments, cfDNA quantification is achieved by (A) incubating a biological sample with (1) DNA polymerase and dNTPs, (2) a forward primer for the human β-actin gene, (3) a reverse primer for the human β-actin gene, and (4) a detectably labeled probe comprising an oligonucleotide sequence capable of specifically hybridizing to an oligonucleotide sequence of the human β-actin gene, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the human β-actin gene, if the human β-actin gene is present in the clinical sample, thereby generating an amplified human β-actin fragment; adding an amount of an internal standard oligonucleotide to the biological sample; and separating the biological sample. 62. The method of any one of claims 59 to 61, comprising: incubating a sample with (1) a DNA polymerase and dNTPs; (2) a forward primer for the internal standard oligonucleotide; (3) a reverse primer for the internal standard oligonucleotide; and (4) a detectably labeled probe comprising an oligonucleotide sequence that can specifically hybridize to the internal standard oligonucleotide, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the internal standard oligonucleotide, thereby generating an amplified fragment of the amplified region; detecting the internal standard oligonucleotide; and detecting and quantifying the human β-actin gene based on the detection of the internal standard oligonucleotide.

[0076] In some embodiments, the cutoff value is from about 90 ng / ml to about 350 ng / ml.

[0077] In some embodiments, the cutoff value is about 169.3 ng / mL.

[0078] In some embodiments, the prediction of worsening SARS-CoV-2 infection has a sensitivity of at least 80%, 85%, 90%, 95%, 99%, or more.

[0079] In some embodiments, the prediction of worsening SARS-CoV-2 infection has a sensitivity of at least 85%.

[0080] In some embodiments, the prediction of worsening SARS-CoV-2 infection has a specificity of at least 80%, 85%, 90%, 95%, 99%, or more.

[0081] In some embodiments, the prediction of worsening SARS-CoV-2 infection has a specificity of at least 86%.

[0082] In some embodiments, the prediction of the severity of the SARS-CoV-2 infection is based on one or more additional indicators selected from demographic variables, clinical signs and symptoms, imaging results, laboratory findings, and medical history.

[0083] In some embodiments, the clinical signs and symptoms are selected from body temperature, systolic blood pressure, diastolic blood pressure, heart rate, respiratory rate, administration of vasoactive agents, administration of sedative agents, administration of analgesics, and loss of consciousness.

[0084] In some embodiments, the imaging findings are selected from abnormalities in chest radiographs and CT scans.

[0085] In some embodiments, the clinical laboratory findings are selected from partial arterial oxygen tension, oxygen saturation, white blood cell count and differential, neutrophil-to-lymphocyte ratio (NLR), platelet count, hematocrit, serum sodium and potassium, pH, total bilirubin, creatinine, and D-dimer levels.

[0086] In some embodiments, the medical history is selected from previous surgery, chronic obstructive pulmonary disease, cirrhosis of the liver, renal dialysis, immunodeficiency disease, cancer, chemotherapy, radiation, long-term and high-dose steroids.

[0087] In some embodiments, predicting the severity of SARS-CoV-2 infection further comprises calculating an APACHE (Acute Physiology and Chronic Health Evaluation) II and / or SOFA (Sequential Organ Failure Assessment) score at the worst value for one or more physiological variables.

[0088] In some embodiments, the calculation of the APACHE II score and the SIPA score is performed within 24 hours from the time the biological sample is collected.

[0089] In some embodiments, the forward primer for the human β-actin gene has a nucleotide sequence that is at least 80% identical to SEQ ID NO:2, and the reverse primer for the human β-actin gene has a nucleotide sequence that is at least 80% identical to SEQ ID NO:3.

[0090] In some embodiments, the detectably labeled probe to the human β-actin gene has a nucleotide sequence that is at least 80% identical to SEQ ID NO:5.

[0091] In some embodiments, the forward primer for the internal standard oligonucleotide has a nucleotide sequence that is at least 80% identical to SEQ ID NO:4, and the reverse primer for the internal standard oligonucleotide has a nucleotide sequence that is at least 80% identical to SEQ ID NO:3.

[0092] In some embodiments, the detectably labeled probe for the internal standard oligonucleotide has a nucleotide sequence that is at least 80% identical to SEQ ID NO:6.

[0093] In some embodiments, the internal standard oligonucleotide has a nucleotide sequence that is at least 80% identical to SEQ ID NO:1.

[0094] In some embodiments, the internal standard oligonucleotide consists of the sequence of SEQ ID NO:1.

[0095] In some embodiments, a severe state of SARS-CoV-2 infection corresponds to an APACHE II score of greater than 15 (>15).

[0096] In some embodiments, a severe state of SARS-CoV-2 infection corresponds to a SIPA score of 2 or greater (≧2).

[0097] In some embodiments, a cfDNA concentration below the cutoff value indicates a non-severe state of SARS-CoV-2 infection.

[0098] In some embodiments, a non-severe state of SARS-CoV-2 infection corresponds to an APACHE II score of 15 or less (≦15).

[0099] In some embodiments, a non-severe state of SARS-CoV-2 infection corresponds to a SOFA score of less than 2 (<2).

[0100] In some embodiments, the methods described herein further comprise determining a treatment regimen for the SARS-CoV-2 infection.

[0101] In some embodiments, the treatment plan for worsening SARS-CoV-2 infection is selected from ICU admission, endotracheal intubation, hormone therapy, and ECMO treatment.

[0102] In some embodiments, the treatment plan for a non-severe form of SARS-CoV-2 infection is selected from reducing the dosage of a current administration of a therapeutic agent, leaving the ICU, or being discharged from the hospital.

[0103] In some embodiments, the methods described herein further comprise determining a baseline amount of cfDNA in the biological sample.

[0104] In some embodiments, the methods described herein further comprise collecting one or more additional biological samples to determine cfDNA levels at one or more additional time points.

[0105] In some embodiments, the method further comprises monitoring the level of cfDNA from different time points over a specified period of time.

[0106] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Methods and materials for use in the present invention are described herein; other suitable methods and materials known in the art may also be used. The materials, methods, and examples are illustrative only and are not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

[0107] Other features and advantages of the invention will become apparent from the following detailed description and figures, and from the claims. [Brief explanation of the drawings]

[0108] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0109] [Figure 1] Figure 1 shows the sources of cfDNA in human biological samples. [Figure 2]2 is a schematic diagram of the internal standard oligonucleotide described herein, in which a) is the full-length region of the internal standard oligonucleotide, b) is the amplifiable region of the internal standard oligonucleotide, and c) is the reverse primer binding region (e.g., the same sequence as the reverse primer binding region for the human β-actin gene). [Figure 3] 3 shows the amplification efficiency of the human β-actin gene and an internal standard oligonucleotide. a) is a graph showing the amplification curve of the internal standard oligonucleotide using serial dilution, b) is a linear regression representation of the amplification of the internal standard oligonucleotide, c) is a graph showing the amplification curve of the human β-actin gene using serial dilution, and d) is a linear regression representation of the amplification of the human β-actin gene. [Figure 4] Figure 4 shows the linear range of detection of cfDNA using the methods described herein. [Figure 5A] Figures 5A-B show the workflow for detecting and quantifying cfDNA using the methods described herein. [Figure 5B] See legend to Figure 5A. [Figure 6] FIG. 6 shows the distribution of cfDNA concentrations from 213 samples using the methods described herein. [Figure 7] FIG. 7 shows the distribution of cfDNA concentrations grouped by gender using the methods described herein. [Figure 8] FIG. 8 shows the nucleic acid sequence of SEQ ID NO:1. [Figure 9] Figure 9 describes the therapeutic management of adults hospitalized with COVID-19 based on disease severity. Key: ECMO = extracorporeal membrane oxygenation, ED = emergency department, Hgb = hemoglobin, ICU = intensive care unit, IL = interleukin, IV = intravenous, JAK = Janus kinase, LMWH = low molecular weight heparin, mAb = monoclonal antibody, MV = mechanical ventilation, NIV = noninvasive ventilation, Panel = COVID-19 Treatment Guidelines Panel, UFH = unfractionated heparin, ULN = upper limit of normal, VTE = venous thromboembolism. [Figure 10A]Figure 10A-B shows the dynamics of plasma DNA and severity scores in monitoring hospitalized COVID-19 patients. The timeline chart shows the APACHE II scores (solid columns), SOFA scores (open columns), and plasma DNA (purple areas) for all 17 patients. [Figure 10B] See legend to Figure 10A. [Figure 11A] Figures 11A-E show the development and performance of the predictive model. Figure 11A shows a nomogram for predicting COVID-19 exacerbations. Figures 11B-C show the calibration curves of the nomogram in the development subset (B) and validation subset (C), respectively. Figures 11D-E show the ROC curves of the predictive model in the development subset (D) and validation subset (E), respectively. [Figure 11B] See legend to Figure 11A. [Figure 11C] See legend to Figure 11A. [Figure 11D] See legend to Figure 11A. [Figure 11E] See legend to Figure 11A. [Figure 12A] Figures 12A-B show the predictive performance of the parsimonious model using only plasma DNA. Figure 12A shows the ROC curve for the model using only plasma DNA in the generated subset. Figure 12B shows the decision curve analysis for the model using either the 2-index (plasma DNA and neutrophil count) or the parsimonious version (plasma DNA only). [Figure 12B] See legend to Figure 12A. [Figure 13] Figure 13 shows the distribution of D-dimer between raw and imputed data. 15 missing values ​​of D-dimer were imputed (red) using predicted mean agreement (PMM) multiple imputation from the entire data set with three nearest neighbors for this continuous variable. The impact of imputation was assessed through a comparative distribution with the raw data (blue), which did not have a significant difference (P=0.685). [Figure 14A] 14A-B show an example of a study workflow. The flow diagram shows the enrollment and observation period of the study population. [Figure 14B] See legend to Figure 14A. [Figure 15] FIG. 15 shows the receiver operating characteristic (ROC) analysis for the discrimination of severe conditions by plasma DNA score and APACHE II score. [Figure 16A] 16A-B show Spearman correlations between plasma DNA and APACHE II and SOFA scores under severe (A) and non-severe (B) conditions. [Figure 16B] See legend to Figure 16A. [Figure 17] FIG. 17 shows plasma DNA monitoring in a case study (Case #1). [Figure 18] FIG. 18 shows plasma DNA monitoring in a case study (Case #3). [Figure 19] FIG. 19 shows plasma DNA monitoring in a case study (Case #4). DETAILED DESCRIPTION OF THE INVENTION

[0110] Detailed Description The present disclosure relates to compositions and methods for detecting and quantifying cell-free DNA (cfDNA).Specifically, the internal standard oligonucleotide, probe and primer for carrying out multiplex quantitative real-time PCR and kit are provided.The kit provided herein comprises the multiplex quantitative real-time PCR primer and probe for detecting human β-actin gene and internal standard oligonucleotide.

[0111] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0112] The term "about" is used herein to mean within a typical tolerance in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, it is about the mean ±10%. In certain embodiments, it is about the mean ±5%. When "about" is present before a series of numerical values ​​or ranges, it is understood that "about" can modify each of the series of numerical values ​​or ranges.

[0113] cell-free DNA Cell-free DNA (cfDNA) is extracellular DNA present in bodily fluids such as plasma. cfDNA levels in healthy people are usually stable and remain low. The cfDNA level in healthy individuals is below 30 ng / mL. Conditions such as infection, trauma, sepsis, acute respiratory distress syndrome (ARDS), and respiratory failure can cause abnormal amounts of dead cells, releasing cfDNA into the circulation and significantly increasing its level in plasma. Therefore, cfDNA may act as a direct indicator of the extent of tissue or organ damage / failure caused by complications in some COVID-19 patients.

[0114] The presence of cell-free DNA (cfDNA) in plasma was discovered by Mandel and Metais in 1948 (see, e.g., Mandel P, Metais P, Les acids nucleques du plasma sanguin chez l'homme, CR Seances Soc Biol Fil 1948;142:241-3). Seventeen years later, in 1965, Bendich et al. hypothesized that cancer-derived cfDNA could be involved in metastasis (Bendich A, Wilczok T, Borenfreund E. Circulating DNA as a possible factor in oncogenesis. Science 1965;148:374-6). However, it took another year for the first link to disease to be discovered. In 1966, Tan et al. observed high levels of circulating cell-free DNA (cfDNA) in the blood of patients with systemic lupus erythematosus (Tan EM, Schur PH, Carr RI, Kunkel HG. Deoxybonucleic acid (DNA) and antibodies to DNA in the serum of patients with systemic lupus erythematosus. J Clin Invest 1966;45:1732-40). Eleven years later, in 1977, Leon et al. used radioimmunochemistry to demonstrate that at least half of cancer patients had significantly higher levels of cfDNA in their blood than normal control subjects (Leon SA, Shapiro B, Sklaroff DM, Yaros MJ. Free DNA in the serum of cancer patients and the effect of therapy. Cancer Res 1977;37:646-50). The authors noted that patients with metastatic cancer had significantly higher levels of cfDNA in their blood.Due to technical limitations, it took another 12 years for the first experimental evidence supporting that cfDNA in cancer patients indeed contains tumor DNA based on temperature stability measurements (Stroun M, Anker P, Maurice P, Lyautey J, Lederrey C, Beljanski M. Neoplastic characteristics of the DNA found in the plasma of cancer patients. Oncology 1989;46:318-22).

[0115] Recent studies have linked cfDNA levels to the outcome of severe injuries such as blunt trauma and burns (see, e.g., Butt AN, Swaminathan R. Overview of circulating nucleic acids in plasma / serum. Ann NY Acad Sci 2008;1137:236-42). Quantitative analysis of cfDNA and plasma APC / RASSF1A methylation provides real-time indicators for monitoring chemotherapy efficacy and toxicity (see, e.g., Wang et al. Clinical Epigenetics 2015;7:119). The entire contents of this document are incorporated herein by reference. cfDNA levels correlated with length of hospital stay, burn surface area, and number of surgeries required for burns (but not flash / burn). Plasma cfDNA levels also correlated with the need for patient ventilation in the intensive care unit (ICU). Consistent with these findings, cfDNA levels in the blood have been found to be higher and have particular predictive value for sepsis and septic shock, sterile inflammation, myocardial infarction, and stroke, including in patients with negative neuroimaging results, and cfDNA concentrations appear to predict post-stroke morbidity and mortality in patients with negative neuroimaging, as well as in sickle cell disease. Briefly, cfDNA concentrations are elevated under conditions accompanied by increased rates of cell death (apoptosis or necrosis).

[0116] Several characteristics of cfDNA suggest cell death as its primary origin. Importantly, cfDNA is double-stranded and highly fragmented, with most molecules being approximately 200 bp (e.g., with a distribution of approximately 160 bp to approximately 240 bp).

[0117] Timely assessment of disease severity and patient triage is important in providing optimized supportive care and appropriate interventions during hospitalization to improve cure rates and reduce mortality, but there is currently a lack of accurate and objective laboratory indicators available to clinicians.

[0118] Provided herein is an internal standard oligonucleotide for detecting and quantifying cfDNA in biological sample (for example, body fluid).In some embodiments, the amount of cfDNA is measured using the amount of representative gene.In some embodiments, the representative gene is housekeeping gene.In some embodiments, the housekeeping gene is human β-actin gene.

[0119] Internal standard oligonucleotide Provided herein are internal standard oligonucleotides for detecting cfDNA in a biological sample.

[0120] The term "oligonucleotide" is used herein to refer to a relatively short nucleic acid fragment or sequence.It can include DNA, RNA, or a hybrid thereof, or a chemically modified analog or derivative thereof.They can be single-stranded or double-stranded, with two complementary strands that can be separated by denaturation.In some embodiments, the internal standard oligonucleotide is a double-stranded DNA oligonucleotide.

[0121] The present disclosure also relates to an internal standard oligonucleotide comprising: (a) a forward primer binding site and a reverse primer binding site; and (b) an amplifiable sequence between the forward primer binding site and the reverse primer binding site, wherein the amplifiable sequence has a length substantially similar to an amplified sequence of a human gene, e.g., about 95% to about 105% of the length of the amplified sequence, about 90% to about 110% of the length of the amplified sequence, about 80% to about 120% of the length of the amplified sequence, or about 70% to about 130% of the length of the amplified sequence.

[0122] In some embodiments, the GC content in the amplifiable sequence is similar to the amplified sequence of a human gene.

[0123] The present disclosure also relates to an internal standard oligonucleotide comprising (a) an oligonucleotide sequence that is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the corresponding region of a human gene, and (b) a forward primer binding site and a reverse primer binding site.

[0124] In some embodiments, provided herein is an internal standard oligonucleotide sequence comprising a forward primer binding sequence and a reverse primer binding sequence, wherein the length between the forward primer binding sequence and the reverse primer binding sequence is about 90 bp to about 200 bp, and the reverse primer binding sequence is identical to the reverse primer binding sequence on the target gene sequence.

[0125] In some embodiments, provided herein are internal standard oligonucleotide sequences comprising a forward primer binding sequence and a reverse primer binding sequence, wherein the length between the forward primer binding sequence and the reverse primer binding sequence is about 90 bp to about 200 bp, and the forward primer binding sequence is identical to the forward primer binding sequence on the target gene sequence.

[0126] In some embodiments, the target human gene is a human β-actin gene. In some embodiments, the human gene is a human housekeeping gene. In some embodiments, the housekeeping gene is a single-copy housekeeping gene. In some embodiments, the housekeeping gene is selected from the group consisting of human 18S rRNA (18S ribosomal RNA), human 28S rRNA (28S ribosomal RNA), human TUBA (α-tubulin), human ACTB (β-actin), human β2M (β2-microglobulin), human ALB (albumin), human RPL32 (ribosomal protein L32), human TBP (TATA sequence-binding protein), human CYCC (cyclophilin C), human EF1A (elongation factor 1 alpha), human GAPDH (glyceraldehyde-3-phosphate dehydrogenase), human HPRT (hypoxanthine phosphoribosyltransferase), and human RPII (RNA polymerase II).

[0127] In some embodiments, the internal standard oligonucleotide is double-stranded. In some embodiments, the internal standard oligonucleotide is partially double-stranded and partially single-stranded. In some embodiments, the internal standard oligonucleotide is single-stranded.

[0128] The internal standard oligonucleotide may be about 100 nucleotides to about 3000 nucleotides in length. In some embodiments, the internal standard oligonucleotide is about 100 bp to about 3000 bp in length. In some embodiments, the internal standard oligonucleotide is about 100 bp to about 2000 bp in length. In some embodiments, the internal standard oligonucleotide is about 100 bp to about 1000 bp in length. In some embodiments, the internal standard oligonucleotide is about 100 bp to about 500 bp in length. In some embodiments, the internal standard oligonucleotide is about 100 bp to about 200 bp in length. In some embodiments, the internal standard oligonucleotide is about 150 bp to about 200 bp in length. In some embodiments, the internal standard oligonucleotide is about 180 bp to about 210 bp in length. In some embodiments, the internal standard oligonucleotide is about 190 bp to about 200 bp in length. In some embodiments, the internal standard oligonucleotide is about 200 bp in length. The internal standard oligonucleotide may be labeled with a detectable marker or modified using conventional methods for various molecular biology applications.

[0129] The internal standard oligonucleotide may comprise a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to the sequence of a target human gene, or a portion thereof. In some embodiments, the internal standard oligonucleotide comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to the sequence of a target gene, e.g., the human β-actin gene, or a portion thereof. In some embodiments, the internal standard oligonucleotide comprises a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to the sequence of a target gene (e.g., the human β-actin gene), e.g., from about 10 bp to about 300 bp, from about 20 bp to about 300 bp, from about 30 bp to about 300 bp, from about 40 bp to about 300 bp, from about 50 bp to about 300 bp, from about 60 bp to about 300 bp, from about 70 bp to about 300 bp, from about 80 bp to about 300 bp, from about 90 bp to about 300 bp, or from about 100 bp. The internal standard oligonucleotide comprises a sequence identical to a portion of a target gene, such as the human β-actin gene, of about 25 bp to about 200 bp, about 150 bp to about 300 bp, about 200 bp to about 300 bp, about 250 bp to about 300 bp, about 10 bp to about 200 bp, about 25 bp to about 200 bp, about 50 bp to about 200 bp, about 100 bp to about 200 bp, about 150 bp to about 200 bp, about 10 bp to about 100 bp, about 25 bp to about 100 bp, or about 50 bp to about 100 bp. In some embodiments, the internal standard oligonucleotide comprises a sequence of about 25 bp to about 200 bp that is identical to a portion of a target gene, such as the human β-actin gene.

[0130] The internal standard oligonucleotide described herein is designed to be used to generate amplification products (such as PCR products) with similar lengths to the amplification products generated based on cfDNA in biological samples.The similar length of amplification products contributes to improving the amplification efficiency and more accurate quantification of cfDNA.In some embodiments, the length between the forward primer binding sequence and the reverse primer binding sequence on the internal standard oligonucleotide is substantially the same as the length of the amplified target gene sequence (for example, has a difference of 5, 10, 15 or 20bp or less).

[0131] In some embodiments, the overlap region between the internal standard oligonucleotide and the human gene is adjusted based on the selected target human gene, for example, an internal standard oligonucleotide having an overlap region with the human β-actin gene.

[0132] An example of the nucleic acid sequence of the human β-actin gene is NCBI Reference Sequence: NG_007992.1 (SEQ ID NO: 7).

[0133] In some embodiments, the length between the forward primer binding site and the reverse primer binding site is about 25 bp to about 300 bp, about 25 bp to about 250 bp, about 25 bp to about 200 bp, about 25 bp to about 150 bp, about 25 bp to about 100 bp, about 25 bp to about 50 bp, about 50 bp to about 300 bp, about 50 bp to about 250 bp, about 50 bp to about 200 bp, about 50 bp to about 150 bp, about 50 bp to about 100 bp, about 100 bp to about 300 bp, about 100 bp to about 250 bp, about 100 bp to about 200 bp, about 100 bp to about 150 bp, about 150 bp to about 300 bp, about 150 bp to about 250 bp, or about 150 bp to about 200 bp. In some embodiments, the length between the forward primer binding site and the reverse primer binding site is about 90 bp to about 200 bp.

[0134] In some embodiments, the reverse primer binding site is within a sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the corresponding region of the human gene.

[0135] In some embodiments, amplification products (e.g., PCR products) are generated using a forward primer, a reverse primer, and an internal standard oligonucleotide as a template. In some embodiments, the amplification products have a length of about 25 bp to about 300 bp, about 25 bp to about 250 bp, about 25 bp to about 200 bp, about 25 bp to about 150 bp, about 25 bp to about 100 bp, about 25 bp to about 50 bp, about 50 bp to about 300 bp, about 50 bp to about 250 bp, about 50 bp to about 200 bp, about 50 bp to about 150 bp, about 50 bp to about 100 bp, about 100 bp to about 300 bp, about 100 bp to about 250 bp, about 100 bp to about 200 bp, about 100 bp to about 150 bp, about 150 bp to about 300 bp, about 150 bp to about 250 bp, or about 150 bp to about 200 bp. In some embodiments, the length between the forward primer binding site and the reverse primer binding site is about 90 bp to about 200 bp.

[0136] In some embodiments, the internal standard oligonucleotide has a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO:1.

[0137] SEQ ID NO: 1 (5'-3'): 5'ccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacgaattcgagctcggtacccggggatcc tctagagattacgggagcggttggtggtggaaatcgtgcgtgacattaagaatcgtcgacctgcaggcatgcaagcttggcactggccgtcgttttacaac 3'

[0138] The sequence of SEQ ID NO:1 is also shown in FIG.

[0139] The present disclosure also relates to a method for producing the internal standard oligonucleotide described herein, comprising: (a) providing a double-stranded oligonucleotide sequence comprising an approximately 25-200 bp region on a target human gene; (b) inserting the oligonucleotide into a recombinant vector; and (c) digesting the recombinant vector of step (b) using one or more endonucleases, thereby obtaining a linear internal standard oligonucleotide.

[0140] In some embodiments, the double-stranded oligonucleotide sequence in step (a) is obtained by direct chemical synthesis. In some embodiments, the double-stranded oligonucleotide sequence in step (a) is obtained and / or amplified from a human gene, for example, through molecular cloning (e.g., enzyme digestion, insertion into a vector, and ligation). In some embodiments, the full-length internal standard oligonucleotide is obtained by chemical synthesis.

[0141] In some embodiments, the target human gene is a human β-actin gene. In some embodiments, the human gene is a human housekeeping gene. In some embodiments, the housekeeping gene is a single-copy housekeeping gene. In some embodiments, the housekeeping gene is selected from the group consisting of human 18S rRNA (18S ribosomal RNA), human 28S rRNA (28S ribosomal RNA), human TUBA (α-tubulin), human ACTB (β-actin), human β2M (β2-microglobulin), human ALB (albumin), human RPL32 (ribosomal protein L32), human TBP (TATA sequence-binding protein), human CYCC (cyclophilin C), human EF1A (elongation factor 1 alpha), human GAPDH (glyceraldehyde-3-phosphate dehydrogenase), human HPRT (hypoxanthine phosphoribosyltransferase), and human RPII (RNA polymerase II).

[0142] In some embodiments, the internal standard oligonucleotide is double-stranded. In some embodiments, the internal standard oligonucleotide is partially double-stranded and partially single-stranded. In some embodiments, the internal standard oligonucleotide is single-stranded.

[0143] The vector can be any suitable vector known in the art.For example, suitable vectors include but are not limited to pUC12, pUC13, pUC18, pUC19, pUC57, pUC120, pMD2.G, pMD18-T, pMDIAI and pMDISI.In some embodiments, the vector is pMD20 vector.

[0144] Any suitable restriction endonuclease can be used in the methods described herein. Examples of restriction endonucleases include, but are not limited to, HhaI, HindIII, NotI, BbvCI, BglI, EcoRI, FokI, AlwI, SmaI, SphI, Sse8387I, PstI, Hin II, AccI, SalI, EcoRV, XbaI, BamHI, XmaI, KpnI, and SacI. In some embodiments, the restriction endonuclease used in the methods described herein is SmaI.

[0145] Primers and probes Provided herein is the oligonucleotide (such as primer and probe) for detecting cfDNA in biological sample.Specifically, provided herein is the primer and probe for detecting human β-actin in biological sample, and the primer and probe for detecting the internal standard oligonucleotide described herein (such as for generating the standard curve for quantifying human β-actin gene).

[0146] The present disclosure provides a primer set for detecting cell-free DNA in a subject, comprising: (a) a forward primer and a reverse primer for amplifying a human gene in a biological sample; and (b) a forward primer and a reverse primer for amplifying an internal standard oligonucleotide, wherein the forward primer and the reverse primer for amplifying the human gene have a sequence that is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% identical to the sequence of the reverse primer for amplifying the internal standard oligonucleotide.

[0147] In some embodiments, the human gene is a human β-actin gene. In some embodiments, the human gene is a human housekeeping gene. In some embodiments, the housekeeping gene is a single-copy housekeeping gene. In some embodiments, the housekeeping gene is selected from the group consisting of human 18S rRNA (18S ribosomal RNA), human 28S rRNA (28S ribosomal RNA), human TUBA (α-tubulin), human ACTB (β-actin), human β2M (β2-microglobulin), human ALB (albumin), human RPL32 (ribosomal protein L32), human TBP (TATA sequence-binding protein), human CYCC (cyclophilin C), human EF1A (elongation factor 1 alpha), human GAPDH (glyceraldehyde-3-phosphate dehydrogenase), human HPRT (hypoxanthine phosphoribosyltransferase), and human RPII (RNA polymerase II).

[0148] The internal standard oligonucleotide can be any one of the internal standard oligonucleotides described herein.

[0149] In some embodiments, the reverse primer for amplifying the internal standard oligonucleotide has a sequence identical to the sequence of the reverse primer for amplifying the target human gene.

[0150] In some embodiments, the forward and reverse primers for amplifying a human gene bind to regions of the human gene that are about 25 bp to about 300 bp, about 25 bp to about 250 bp, about 25 bp to about 200 bp, about 25 bp to about 150 bp, about 25 bp to about 100 bp, about 25 bp to about 50 bp, about 50 bp to about 300 bp, about 50 bp to about 250 bp, about 50 bp to about 200 bp, about 50 bp to about 150 bp, about 50 bp to about 100 bp, about 100 bp to about 300 bp, about 100 bp to about 250 bp, about 100 bp to about 200 bp, about 100 bp to about 150 bp, about 150 bp to about 300 bp, about 150 bp to about 250 bp, or about 150 bp to about 200 bp apart. In some embodiments, the forward and reverse primers for amplifying the human gene bind to regions on the human gene that are about 90 bp to about 200 bp apart.

[0151] In some embodiments, the forward primer and reverse primer for amplifying the internal standard oligonucleotide bind to regions of a human gene that are about 25 bp to about 300 bp, about 25 bp to about 250 bp, about 25 bp to about 200 bp, about 25 bp to about 150 bp, about 25 bp to about 100 bp, about 25 bp to about 50 bp, about 50 bp to about 300 bp, about 50 bp to about 250 bp, about 50 bp to about 200 bp, about 50 bp to about 150 bp, about 50 bp to about 100 bp, about 100 bp to about 300 bp, about 100 bp to about 250 bp, about 100 bp to about 200 bp, about 100 bp to about 150 bp, about 150 bp to about 300 bp, about 150 bp to about 250 bp, or about 150 bp to about 200 bp apart. In some embodiments, the forward and reverse primers for amplifying the internal standard oligonucleotide bind to regions on the human gene that are about 90 bp to about 200 bp apart.

[0152] The forward primer and / or reverse primer can be of any suitable length. In some embodiments, the forward primer and / or reverse primer have a length of about 10 bp to about 40 bp. In some embodiments, the forward primer and / or reverse primer have a length of about 15 bp to about 30 bp. In some embodiments, the reverse primer for the internal standard oligonucleotide and the target human gene are the same. In some embodiments, the forward primer for the internal standard oligonucleotide and the target human gene are the same.

[0153] The present disclosure also provides a set of probes and primers for detecting and quantifying the human β-actin gene, for example, using multiplex quantitative real-time PCR. In some embodiments, the forward primer for amplifying the human β-actin gene comprises the oligonucleotide sequence of SEQ ID NO: 2, the reverse primer for amplifying the human β-actin gene comprises the oligonucleotide sequence of SEQ ID NO: 3, and the probe for detecting the human β-actin gene comprises the oligonucleotide sequence of SEQ ID NO: 5. In some embodiments, the forward primer for amplifying the internal standard oligonucleotide comprises the oligonucleotide sequence of SEQ ID NO: 4, the reverse primer for amplifying the internal standard oligonucleotide comprises the oligonucleotide sequence of SEQ ID NO: 3, and the probe for detecting the internal standard oligonucleotide comprises the oligonucleotide sequence of SEQ ID NO: 6.

[0154] The oligonucleotide sequences of SEQ ID NOs: 1-6 are shown in Table 1. In some embodiments, the oligonucleotides described herein comprise a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 1. In some embodiments, the oligonucleotides described herein comprise a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 2. In some embodiments, the oligonucleotides described herein comprise a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 3. In some embodiments, the oligonucleotides described herein comprise a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 4. In some embodiments, the oligonucleotides described herein comprise a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 5. In some embodiments, the oligonucleotides described herein comprise a sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 6.

[0155] In some embodiments, the primers and probes described herein are used in multiplex quantitative real-time PCR for detecting corresponding target genes.In some embodiments, the probes and primers for detecting one or more genes, for example, human β-actin gene, are used in combination to detect and quantify cfDNA.

[0156] In some embodiments, the primer and probe oligonucleotides described herein are modified (e.g., detectably labeled). In some embodiments, the probe oligonucleotides for detecting the human β-actin gene and internal standard oligonucleotide are modified (e.g., detectably labeled). In some embodiments, the two ends (5' and 3' ends) of the probe are detectably labeled with a reporter fluorophore and a quencher fluorophore, respectively. The 5' modification of the probe of the present invention is selected from reporter fluorophores commonly used in the art, such as FAM, Texas Red, and JOE, and the 3' modification of the probe of the present invention is selected from quenching fluorescent groups commonly used in the art, such as BHQ1, BHQ2, and ECLIPSE. The reporter fluorophore and quencher fluorophore on a probe for one gene are different from those on a probe for another gene. Any other suitable oligonucleotide modifications can be used in the probes described herein. Any other suitable fluorophores and quencher fluorophores can be used to modify the probes described herein.

[0157] In some embodiments, a probe for detecting the human β-actin gene is detectably labeled at the 5' end with JOE and / or a probe for detecting the human β-actin gene is detectably labeled at the 3' end with BHQ1. In some embodiments, a probe for detecting the internal standard oligonucleotide is detectably labeled at the 5' end with FAM and / or a probe for detecting the internal standard oligonucleotide is detectably labeled at the 3' end with BHQ1.

[0158] Also provided herein are pharmaceutical compositions comprising an effective amount of an oligonucleotide described herein and a pharmaceutically acceptable carrier, diluent, or both.

[0159] Detection Method Provided herein is a method, comprising contacting biological sample with the oligonucleotide described herein.In some embodiments, the method further comprises detecting and quantifying the cfDNA in biological sample (for example, by detecting and quantifying human β-actin gene).

[0160] Accordingly, provided herein is a method for detecting cell-free DNA in a biological sample, the method comprising: (A) incubating the biological sample with (1) a DNA polymerase and dNTPs, (2) a forward primer for a target human gene, (3) a reverse primer for the target human gene, and (4) a detectably labeled probe comprising an oligonucleotide sequence capable of specifically hybridizing to the oligonucleotide sequence of the target human gene, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and reverse primer to mediate polymerase chain reaction amplification of a region of the target human gene, if the target human gene is present in the clinical sample, thereby generating an amplified target human fragment; and (B) detecting the target human gene, thereby detecting the presence of cell-free DNA in the biological sample.

[0161] Any suitable primers, probes, and target human genes described herein can be used in the methods described herein.

[0162] Also provided herein is a method for detecting cell-free DNA in a biological sample, the method comprising: (A) incubating the biological sample with (1) a DNA polymerase and dNTPs; (2) a forward primer for the human β-actin gene having a nucleotide sequence consisting of SEQ ID NO: 2; (3) a reverse primer for the human β-actin gene having a nucleotide sequence consisting of SEQ ID NO: 3; and (4) a detectably labeled probe comprising an oligonucleotide sequence capable of specifically hybridizing to the oligonucleotide sequence of the human β-actin gene, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the human β-actin gene, if the human β-actin gene is present in the clinical sample, thereby producing an amplified human β-actin fragment; and (B) detecting the human β-actin gene, thereby detecting the presence of cell-free DNA in the biological sample.

[0163] In some embodiments, the methods described herein further comprise quantifying the human β-actin gene in the biological sample, if the human β-actin gene is present in the clinical sample.

[0164] Any suitable probe described herein can be used to detect human β-actin gene in biological samples. In some embodiments, the probe for detecting human β-actin gene comprises the oligonucleotide sequence of SEQ ID NO: 5. In some embodiments, the probe for detecting human β-actin gene is detectably labeled with JOE at the 5' end, and / or the probe for detecting human β-actin gene is detectably labeled with BHQ1 at the 3' end.

[0165] As used herein, biological sample includes any relevant biological sample that can be used for detecting and quantifying cfDNA.In some embodiments, biological sample is obtained from human subject.Body fluids include but are not limited to mucous secretions, such as blood and blood fractions or products (for example, serum, buffy coat, plasma, platelets, red blood cells, etc.), oral and respiratory secretions (sputum, saliva, etc.), urine, malignant exudates, and other body fluids (for example, prostatic fluid, gastric juice, intestinal fluid, renal fluid, pulmonary fluid, cerebrospinal fluid, etc.).

[0166] In certain embodiments, the biological sample is a clinical sample from a human individual having or suspected of having a disease or disease-related condition (e.g., a SARS-CoV-2 patient, preferably a bodily fluid sample, more preferably oral or respiratory secretions).

[0167] The diseases or disease-related conditions described herein can be any disease that causes changes in the level of cell-free DNA in a subject. For example, the disease or condition can be blood diseases (e.g., blood diseases, anemia, coagulation (including thrombus and venous embolism) and abnormal development and function of platelets and red blood cells), neoplasms such as cancer and benign, potentially malignant or malignant (cancer) cancer growth, leukemia and mesothelioma, cardiovascular diseases such as coronary heart disease, diseases of the vascular system and circulation, including the lymphatic system, and abnormal development and function of the cardiovascular system, ear conditions such as injury, eye conditions such as injury, infectious diseases such as diseases caused by pathogens, acquired immune deficiency syndrome, and sexually transmitted diseases, inflammatory and immune system diseases such as rheumatoid arthritis, connective tissue diseases, autoimmune diseases, allergies and abnormal development and function of the immune system, accidents such as injury and trauma, fractures, poisoning and burns, diseases of the pineal gland, thyroid gland, parathyroid gland, pituitary gland and adrenal gland. metabolic and endocrine diseases such as metabolic disorders (including diabetes) and disorders related to heart disease and stroke; musculoskeletal diseases such as osteoporosis, osteoarthritis, musculo-skeletal disorders, dementia; oral and gastrointestinal diseases such as transmissible spongiform encephalopathies, Parkinson's disease, neurodegenerative diseases, Alzheimer's disease, epilepsy, and multiple sclerosis; inflammatory bowel disease, Crohn's disease, diseases of the digestive system including the mouth, teeth, esophagus, liver and colon; renal and genitourinary diseases such as kidney disease, pelvic inflammatory disease, kidney and reproductive disorders; reproductive health and childbirth-related diseases such as abortion; respiratory diseases such as asthma, chronic obstructive pulmonary disease, respiratory diseases; skin diseases such as skin diseases; stroke, including both ischemic stroke (caused by blood clots) and hemorrhagic stroke (caused by cerebral / intracranial bleeding).

[0168] The disease or condition may be one or more of cancer, normal pregnancy, a complication of pregnancy (e.g., neutrophilic pregnancy), myocardial infarction, inflammatory bowel disease, systemic autoimmune disease, localized autoimmune disease, allograft with rejection, allograft without rejection, stroke, and localized tissue damage.

[0169] In some embodiments, the disease or disease-related condition can be one or more of cancer or tumor, infection (bacterial or viral infection), transplant (e.g., organ transplant resulting in graft rejection), tissue injury, or inflammation, such as systemic lupus, kidney injury, and hemodialysis. Details of such diseases or disease-related conditions can be found, for example, in Celec, P. et al., (2018). Cell-free DNA: Role in Pathophysiology and as a Biomarker in Kidney Disease. Expert Reviews in Molecular Medicine, 20, E1. doi:10.1017 / erm.2017.12. In some embodiments, the disease is hepatitis. In some embodiments, the disease is hepatitis B-related liver disease. In some embodiments, the disease is sepsis. In some embodiments, the biological sample is a clinical sample from a human individual undergoing chemotherapy for cancer treatment.

[0170] In some embodiments, the cancer or tumor is acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendiceal cancer, astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, bladder cancer, brain stem glioma, brain tumor, brain stem glioma, atypical teratoid / rhabdoid tumor of the central nervous system, central nervous system embryonal tumor, astrocytoma, craniopharyngioma, ependymoblastoma, ependymoma, ependymoma, medulloblastoma, medulloepithelioma, pineal parenchymal tumor of intermediate differentiation, supratentorial primitive neuroectodermal tumor and pineoblastoma, breast cancer, bronchial tumor, Burkitt's lymphoma, primary site unknown Cancer of the cervix (CUP), carcinoid tumor, cancer of unknown primary site, central nervous system atypical teratoid / rhabdoid tumor, central nervous system embryonal tumor, cervical cancer, childhood cancer, chordoma, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloproliferative disorder, colon cancer, colorectal cancer, craniopharyngioma, cutaneous T-cell lymphoma, endocrine pancreatic islet cell tumor, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, nasal neuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal cell tumor, gastrointestinal stromal tumor (GIST), pregnancy Trophoblastic tumor, glioma, hairy cell leukemia, head and neck cancer, cardiac cancer, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, pancreatic islet cell tumor, Kaposi's sarcoma, kidney cancer, Langerhans cell histiocytosis, pharyngeal cancer, lip cancer, liver cancer, malignant fibrous histiocytoma / bone cancer, medulloblastoma, medulloepithelioma, melanoma, Merkel cell carcinoma, Merkel cell skin cancer, mesothelioma, metastatic squamous cell carcinoma of unknown primary, oral cancer, multiple endocrine neoplasia syndrome, multiple myeloma, multiple myeloma / plasma cell neoplasm, mycosis fungoides, myelodysplastic syndrome, myeloproliferative neoplasm, nasal cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, non-melanoma skin cancer, non-small cell Lung cancer, oral cavity cancer, oral cancer, oropharyngeal cancer, osteosarcoma, other brain and spinal cord tumors, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, sinonasal cancer, parathyroid cancer, pelvic cancer, penile cancer, pharyngeal cancer, intermediately differentiated pineal parenchymal tumor, pineoblastoma, pituitary tumor, plasma cell neoplasm / multiple myeloma, pleuropulmonary blastoma, primary central nervous system (CNS) lymphoma, primary hepatocellular carcinoma, prostate cancer, rectal cancer, renal cancer, renal cell (kidney) cancer, renal cell carcinoma, airway cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sezary syndrome, small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, head and neck squamous cell carcinoma,These include gastric (stomach) cancer, supratentorial primitive neuroectodermal tumor, T-cell lymphoma, testicular cancer, throat cancer, thymic carcinoma, thymoma, thyroid cancer, transitional cell carcinoma, transitional cell carcinoma of the renal pelvis and ureter, trophoblastic tumor, ureteral cancer, uterine cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, or Wilms' tumor.

[0171] In some embodiments, the biological sample is a clinical fluid sample from a human individual suffering from physical trauma, which may be caused by an accident, a fall, a blow, a weapon, and other causes. For example, the physical trauma may be a wound, an injury in which the skin is torn, cut, or perforated (open wound), or blunt force trauma causing a contusion (closed wound), head injury, penetrating head injury, closed head injury, eye injury and chemical eye injury, eye injury during general anesthesia, brain injury, acquired brain injury, direct recoil injury, diffuse axonal injury, frontal lobe injury and nerve injury, spinal cord injury, brachial plexus injury, sciatic nerve injury, axillary nerve injury, soft tissue injury, tracheobronchial injury, acute kidney injury, anterior cruciate ligament injury, musculoskeletal injury, articular cartilage injury, acute lung injury, pancreatic injury, thoracic aortic injury, biliary tract injury, Lisfranc joint injury, knee injury, medial knee joint injury, back injury, hand injury, and / or chest injury. In some embodiments, the methods described herein further comprise assessing the severity of the disease or injury in the subject based on the detection and quantification of cfDNA.

[0172] The biological sample may be subjected to well-known isolation and purification protocols or may be used directly. For example, the sample may be subjected to treatment to release / extract nucleic acids from the sample and / or remove proteins and other non-nucleic acid components from the sample using conventional techniques.

[0173] In some embodiments, the biological sample used for detecting and quantifying cfDNA does not essentially contain cellular DNA (i.e., the DNA contained in cells or cell compartments).For example, the biological sample used in the methods described herein can be subjected to one or more processes to remove cellular DNA (i.e., the DNA in intact cells or cell compartments).

[0174] Any suitable method can be used to remove cellular DNA from biological sample.In some embodiments, cellular DNA is removed by using centrifugation, microfluidic separation, column or magnetic bead, phenol-chloroform separation or filtration separation (see, for example, Wan, JC et al. Liquid biopsies come of age: towards implementation of circulating tumor DNA. Nat. Rev. Cancer 17, 223 (2017) and Hoyoon Lee et al., npj Precision Oncology volume 4, Article number: 3 (2020)).

[0175] In some embodiments, removal of cellular DNA is performed prior to detection and / or quantification of cfDNA.

[0176] A biological sample that is essentially free of cellular DNA contains about 30%, about 25%, about 20%, about 15%, about 10%, about 5%, about 4%, about 3%, about 2%, about 1%, or less cellular DNA.

[0177] In some embodiments, the probes used in the methods (eg, a probe for the human β-actin gene or a probe for an internal standard oligonucleotide) hybridize to an amplified fragment of the corresponding target.

[0178] In some embodiments, the DNA polymerase used in this method has 5' to 3' exonuclease activity, which hydrolyzes the hybridized probe (e.g., a probe for the human β-actin gene or a probe for an internal standard oligonucleotide), thereby separating the detectable label on the probe and making the signal detectable. In some embodiments, the DNA polymerase is Taq DNA polymerase. In some embodiments, the DNA polymerase is a hot-start Taq DNA polymerase.

[0179] In some embodiments, the signal is a fluorescent signal. In some embodiments, hybridization of the probe to the amplified fragment of the target gene separates the detectable label on the probe, making the signal detectable. In some embodiments, the signal is a fluorescent signal. Other suitable methods for detectably labeling probes and detecting signals are known in the art.

[0180] In some embodiments, the ratio of the final concentration of each primer to the final concentration of probe used in the reaction is about 5:1, 4:1, 3:1, 2:1, 1:1, 1:2, 1:3, 1:4, or about 1:5. In some embodiments, the ratio of the final concentration of each primer to the final concentration of probe used in the reaction is about 2:1.

[0181] In some embodiments, a certain amount of internal standard oligonucleotide is added to biological sample as quantification standard.Detection and quantification of internal standard oligonucleotide can be used to generate the standard curve for quantifying human β-actin gene, which can then be used to quantify the cfDNA in biological sample.In some embodiments, standard curve is not used to detect and / or quantify cfDNA.

[0182] Thus, in some embodiments, the methods described herein further include: (C) adding an amount of an internal standard oligonucleotide to the biological sample; (D) incubating the biological sample in (C) with (1) a DNA polymerase and dNTPs; (2) a forward primer having a nucleotide sequence consisting of SEQ ID NO: 4; (3) a reverse primer having a nucleotide sequence consisting of SEQ ID NO: 3; and (4) a detectably labeled internal standard probe comprising an oligonucleotide sequence capable of specifically hybridizing to the internal standard oligonucleotide, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the internal standard oligonucleotide, thereby generating an amplified fragment of the amplified region; and (E) detecting the internal standard oligonucleotide.

[0183] In some embodiments, the subject is a human subject.

[0184] Any of the internal standard oligonucleotides described herein can be used in this method. In some embodiments, the internal standard oligonucleotide has the sequence of SEQ ID NO: 1.

[0185] In some embodiments, the internal standard probe comprises the oligonucleotide sequence of SEQ ID NO: 6. In some embodiments, the internal standard probe is detectably labeled at the 5' end with FAM and / or the internal standard probe is detectably labeled at the 3' end with BHQ1. In some embodiments, the internal standard probe hybridizes to an amplified fragment of the internal standard oligonucleotide.

[0186] The amount of internal standard added to the biological sample is important for the accuracy and amplification efficiency of cfDNA (e.g., human β-actin gene). In some embodiments, about 5×10 2 , 1×10 3 , 5×10 3 , 1×104 , 2 × 10 4 , 3×10 4 , 4×10 4 , 5×10 4 , 6×10 4 , 7×10 4 , 8×10 4 , 9×10 4 , 1×10 5 , 5×10 5 , 1×10 6 In some embodiments, about 5×10 or more copies of the internal standard oligonucleotide are added to each 195 μL of biological sample. 4 One copy of the internal standard oligonucleotide is added to each 195 mL biological sample.

[0187] In some embodiments, an internal standard oligonucleotide (e.g., about 5×10 4 In some embodiments, the internal standard oligonucleotide (e.g., about 5×10 copies) is present in a volume of about 1 μL, 2 μL, 3 μL, 4 μL, 5 μL, 6 μL, 7 μL, 8 μL, 9 μL, 10 μL, or more for each 195 μL of biological sample. 4 In some embodiments, the internal standard oligonucleotide (about 5×10 copies) is added to the biological sample in a volume of about 5 μL for each 195 μL of biological sample. 4 The internal standard oligonucleotide (one copy of the internal standard oligonucleotide) is added to the biological sample at a final concentration (v / v) of about 1:20, 1:25, 1:30, 1:35, 1:40, 1:45, or 1:50. In a preferred embodiment, the internal standard oligonucleotide is added to the biological sample at a final concentration (v / v) of about 1:40.

[0188] In some embodiments, cfDNA (for example, human β-actin gene) is detected at a DNA concentration of about 1 ng / mL, about 5 ng / mL, about 10 ng / mL, about 50 ng / mL, about 100 ng / mL, about 200 ng / mL, about 300 ng / mL, about 400 ng / mL, about 500 ng / mL, about 600 ng / mL, about 700 ng / mL, about 800 ng / mL, about 900 ng / mL, about 1000 ng / mL, about 2000 ng / mL, about 3000 ng / mL, about 4000 ng / mL, about 5000 ng / mL, about 10000 ng / mL or more. In some embodiments, cfDNA (for example, human β-actin gene) is detected at a concentration of at least 1 ng / mL (for example, with at least 95% sensitivity). Due to probe optimization, the detection limit of the method described herein is about 1 ng / mL.

[0189] In some embodiments, internal standard oligonucleotide is detected at about 1ng / mL, about 5ng / mL, about 10ng / mL, about 50ng / mL, about 100ng / mL, about 200ng / mL, about 300ng / mL, about 400ng / mL, about 500ng / mL, about 600ng / mL, about 700ng / mL, about 800ng / mL, about 900ng / mL, about 1000ng / mL, about 2000ng / mL, about 3000ng / mL, about 4000ng / mL, about 5000ng / mL, about 10000ng / mL or more DNA concentration.In some embodiments, internal standard oligonucleotide is detected at a concentration of at least 1ng / mL (for example, with at least 95% sensitivity).Due to the optimization of probe, the detection limit of the method described herein is about 1ng / mL.

[0190] Other suitable positive or negative reference markers can also be used in the methods described herein, for example, a virus stock solution can be used as a negative reference for detecting SARS-CoV-2 infection.

[0191] Also provided herein is a method for quantifying cell-free DNA in a biological sample, the method comprising: (A) A biological sample, (1) DNA polymerase and dNTPs, (2) a forward primer for the human β-actin gene having the nucleotide sequence of SEQ ID NO: 2; (3) a reverse primer for the human β-actin gene having the nucleotide sequence of SEQ ID NO: 3; (4) a detectably labeled probe, wherein the probe comprises an oligonucleotide sequence capable of specifically hybridizing to an oligonucleotide sequence of the human β-actin gene; incubating with a human β-actin gene fragment, wherein the incubation is in a reaction under conditions sufficient to allow the forward and reverse primers to mediate polymerase chain reaction amplification of a region of the human β-actin gene, if the human β-actin gene is present in the clinical sample, thereby producing an amplified human β-actin fragment; (B) adding an amount of an internal standard oligonucleotide having the sequence of SEQ ID NO: 1 to the biological sample; (C) The biological sample in (B), (1) DNA polymerase and dNTPs, (2) a forward primer having a nucleotide sequence consisting of SEQ ID NO: 4; (3) a reverse primer having a nucleotide sequence consisting of SEQ ID NO: 3; (4) a detectably labeled probe, wherein the probe comprises an oligonucleotide sequence capable of specifically hybridizing to an internal standard oligonucleotide; incubating in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the sequence of SEQ ID NO: 1, thereby generating an amplified fragment of the region; (D) detecting an internal standard oligonucleotide; (E) Detecting and quantifying the human β-actin gene based on the detection of an internal standard oligonucleotide; Including, This quantifies cell-free DNA in the biological sample.

[0192] Predicting disease severity and progression The present disclosure features a method for determining the severity of one or more diseases in a subject, such as SARS-CoV-2 infection (used interchangeably with coronavirus disease 2019 or COVID-19). The method includes obtaining a sample from the subject, determining the level of cell-free DNA (cfDNA) in the sample, and comparing the cfDNA level in the sample to a cutoff value. The cfDNA level in the sample compared to the cutoff value indicates whether the subject has one or more diseases that are severe, e.g., life-threatening.

[0193] In a further aspect, the present disclosure includes a method for monitoring a subject's condition, for example, for determining whether the subject has improved, for example, whether the subject has improved enough to be discharged from the hospital. The method includes: determining a first cfDNA level in the subject, for example, a baseline level; and determining at least one subsequent cfDNA level in the subject, for example, a therapeutic level. The first level and the subsequent levels are then compared. If the cfDNA biomarker level from the first level to the subsequent level is sufficiently reduced, for example, statistically significantly, or by at least 5%, 10%, 15%, 20%, or more, the subject's condition is likely to improve; and if one or both levels are sufficiently low, for example, below a selected threshold, the subject can be discharged, for example, for outpatient treatment.

[0194] The methods described herein can be used to predict the progression of a disease or disorder. In some embodiments, the methods described herein can be used to predict the severity of a disease or disorder. Methods for determining and monitoring disease progression can be found, for example, in PCT Publication WO 2007 / 127749A3, the entire contents of which are incorporated herein. In some embodiments, the disease or disorder is SARS-CoV-2 infection.

[0195] Autologous circulating cell-free DNA (cfDNA), a biomarker of cell death, typically remains at low levels in the plasma of healthy individuals. In conditions such as sepsis, trauma, malignant tumors, and endotheliopathy, abnormal cell death and even organ failure result in tissue damage, releasing intracellular genomic DNA, which is absorbed into the circulation and significantly increasing plasma cfDNA levels. The novel double-stranded real-time PCR assay using the internal standard oligonucleotide described herein enhances the accuracy and precision of autologous cfDNA quantification in plasma while eliminating preanalytical error. Therefore, quantifying plasma DNA using the novel assay described herein has particular advantages for assessing disease severity and progression in patients infected with SARS-CoV-2 (COVID-19 patients).

[0196] Accordingly, in one aspect, provided herein is a method for predicting the severity of an infection with SARS-CoV-2, the method comprising: (A) obtaining a biological sample from a subject having a SARS-CoV-2 infection; (B) quantifying cell-free DNA (cfDNA) in the biological sample; and (C) predicting the severity based on the cfDNA quantification, wherein a cfDNA concentration above a cutoff value indicates worsening of the SARS-CoV-2 infection.

[0197] Any of the methods described herein for detecting and quantifying cfDNA can be used in methods for predicting the severity of SARS-CoV-2 infection. In some embodiments, quantifying cfDNA comprises quantifying a housekeeping gene in a biological sample. In some embodiments, the housekeeping gene is the human β-actin gene.

[0198] In some embodiments, quantifying cfDNA involves incubating a biological sample with (1) DNA polymerase and dNTPs, (2) a forward primer for the human β-actin gene, (3) a reverse primer for the human β-actin gene, and (4) a detectably labeled probe comprising an oligonucleotide sequence capable of specifically hybridizing to an oligonucleotide sequence of the human β-actin gene, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and reverse primer to mediate polymerase chain reaction amplification of a region of the human β-actin gene, if the human β-actin gene is present in the clinical sample, thereby generating an amplified human β-actin fragment.

[0199] Any suitable primers and probes described herein can be used to quantify the human β-actin gene. In some embodiments, the forward primer for the human β-actin gene has a nucleotide sequence at least 80%, 85%, 90%, 95, 99%, or 100% identical to SEQ ID NO: 2. In some embodiments, the reverse primer for the human β-actin gene has a nucleotide sequence at least 80%, 85%, 90%, 95, 99%, or 100% identical to SEQ ID NO: 3.

[0200] In some embodiments, the detectably labeled probe of the human β-actin gene has a sequence that is at least 80%, 85%, 90%, 95, 99%, or 100% identical to SEQ ID NO:5.

[0201] In some embodiments, quantifying cfDNA includes adding an amount of an internal standard oligonucleotide to a biological sample; and (A) incubating the biological sample with (1) a DNA polymerase and dNTPs, (2) a forward primer for the internal standard oligonucleotide, (3) a reverse primer for the internal standard oligonucleotide, and (4) a detectably labeled probe comprising an oligonucleotide sequence that can specifically hybridize to the internal standard oligonucleotide, wherein the incubation is in a reaction under conditions sufficient to allow the forward primer and the reverse primer to mediate polymerase chain reaction amplification of a region of the internal standard oligonucleotide, thereby generating an amplified fragment of the amplified region.

[0202] Any suitable primer and probe described herein can be used to detect the internal standard oligonucleotide. In some embodiments, the forward primer for the internal standard oligonucleotide has a nucleotide sequence that is at least 80%, 85%, 90%, 95, 99%, or 100% identical to SEQ ID NO: 4. In some embodiments, the reverse primer for the internal standard oligonucleotide has a nucleotide sequence that is at least 80%, 85%, 90%, 95, 99%, or 100% identical to SEQ ID NO: 3.

[0203] In some embodiments, the detectably labeled probe for the internal standard oligonucleotide has a nucleotide sequence that is at least 80%, 85%, 90%, 95, 99%, or 100% identical to SEQ ID NO:6.

[0204] In some embodiments, the internal standard oligonucleotide has a sequence that is at least 80%, 85%, 90%, 95, 99%, or 100% identical to SEQ ID NO:1.

[0205] In some embodiments, the methods described herein further comprise detecting and quantifying the human β-actin gene based on detection of an internal standard oligonucleotide.

[0206] The cutoff value described herein is a cfDNA level or level range used to determine the severity of a disease, for example, SARS-CoV-2 infection. In some embodiments, if the cfDNA level in a biological sample is above the cutoff value, the disease (for example, SARS-CoV-2 infection) is predicted to worsen. In some embodiments, if the cfDNA level in a biological sample is above the cutoff value, the disease (for example, SARS-CoV-2 infection) is determined to be in a severe state.

[0207] In some embodiments, if the cfDNA level in the biological sample is below the cutoff value, it is predicted that the disease (e.g., SARS-CoV-2 infection) will not worsen. In some embodiments, if the cfDNA level in the biological sample is below the cutoff value, the disease (e.g., SARS-CoV-2 infection) is determined to be in a non-severe state.

[0208] The cutoff values ​​used in the methods described herein are novel and specific for predicting the progression of a disease or disorder (e.g., SARS-CoV-2 infection). In some embodiments, the cutoff values ​​used in the methods described herein are about 10 ng / ml to about 1000 ng / ml, about 10 ng / ml to about 900 ng / ml, about 10 ng / ml to about 800 ng / ml, about 10 ng / ml to about 700 ng / ml, about 10 ng / ml to about 600 ng / ml, about 10 ng / ml to about 500 ng / ml, about 10 ng / ml to about 400 ng / ml, about 10 ng / ml to about 300 ng / ml, and about 10 ng / ml to about 500 ng / ml. g / ml, about 10 ng / ml to about 200 ng / ml, about 90 ng / ml to about 1000 ng / ml, about 90 ng / ml to about 900 ng / ml, about 90 ng / ml to about 800 ng / ml, about 90 ng / ml to about 700 ng / ml, about 90 ng / ml to about 600 ng / ml, about 90 ng / ml to about 500 ng / ml, about 90 ng / ml to about 400 ng / ml, or about 90 ng / ml to about 300 ng / ml.

[0209] In some embodiments, the cutoff value is 90 ng / ml to about 350 ng / ml. In some embodiments, the cutoff value is about 90 ng / ml to about 300 ng / ml. In some embodiments, the cutoff value is about 90 ng / ml to about 250 ng / ml. In some embodiments, the cutoff value is about 90 ng / ml to about 200 ng / ml. In some embodiments, the cutoff value is about 150 ng / ml to about 200 ng / ml. In some embodiments, the cutoff value used in the methods described herein is about or at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, or 350 ng / ml. In some embodiments, the cutoff value used in the methods described herein is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, or 350 ng / ml or less. In some embodiments, the cutoff value is about 165 to about 175 ng / ml. In some embodiments, the cutoff value is 169.3 ng / ml.

[0210] Prediction of the severity of the diseases (e.g., SARS-CoV-2) described herein may be based on additional predictive factors used in clinical diagnosis and treatment. For example, prediction of the severity of SARS-CoV-2 infection may be based on one or more of demographic variables, clinical signs and symptoms, imaging results, laboratory findings, and medical history.

[0211] In some embodiments, the severity of the SARS-CoV-2 infection is determined as severe. In some embodiments, the severity of the SARS-CoV-2 infection is determined as non-severe. In some embodiments, a severe state of SARS-CoV-2 infection corresponds to a worsening of the subject's condition. In some embodiments, the methods described herein predict a worsening of the subject's condition. In some embodiments, the worsening is one or more of an abnormally high or low body temperature, increased or required use of vasoactive agents, sedatives, and analgesics, respiratory support, increased visible or occult bleeding, and the occurrence of additional complications. In some embodiments, the worsening of the subject's condition is indicated by a cfDNA level above a cutoff value described herein. In some embodiments, the worsening of the subject's condition corresponds to one or more symptoms of a severe state of SARS-CoV-2 infection. In some embodiments, the methods described herein predict a worsening of the condition of a subject who has other clinical symptoms of a severe condition. In some embodiments, the methods described herein predict a worsening of the condition of a subject who does not have other clinical symptoms of a severe condition.

[0212] Any suitable clinical signs and symptoms can be used herein, hi some embodiments, the clinical signs and symptoms are selected from body temperature, systolic blood pressure, diastolic blood pressure, heart rate, respiratory rate, administration of vasoactive agents, administration of sedatives, administration of analgesics, and loss of consciousness.

[0213] Methods for obtaining and interpreting imaging results are known in the art. In some embodiments, the imaging results are abnormalities in chest radiographs and / or computed tomography (CT) images.

[0214] Laboratory tests can be used in combination with the methods described herein to predict the severity of SARS-CoV-2 infection. Suitable laboratory tests are known in the art. In some embodiments, the laboratory findings are selected from partial arterial oxygen tension, oxygen saturation, white blood cell count and differential, neutrophil-to-lymphocyte ratio (NLR), platelet count, hematocrit, serum sodium and potassium, pH, total bilirubin, creatinine, and D-dimer levels (a breakdown product of cross-linked fibrin whose levels increase after clot formation).

[0215] The subject's medical history is also important in determining and predicting the severity of SARS-CoV-2 infection. In some embodiments, the medical history is selected from previous surgery, chronic obstructive pulmonary disease, cirrhosis, renal dialysis, immunodeficiency disease, cancer, chemotherapy, radiation, and long-term and high-dose steroids.

[0216] Other standards used for diagnosing and determining severity of SARS-CoV-2 can also be used in conjunction with the methods described herein. For example, determining the level of severity may be based on the COVID-19 treatment guidelines published by the National Institutes of Health (NIH) (see, e.g., NIH website: covid19treatmentguidelines.nih.gov / management / clinical-management / hospitalized-adults--therapeutic-management / hospitalized-adults-figure / ; and World Health Organization, Clinical Management of COVID-19: Interim Guidance, May 27, 2020).

[0217] Specifically, according to NIH guidelines, patients with SARS-CoV-2 infection can experience a range of clinical manifestations, from no symptoms to severe disease. In general, adults with SARS-CoV-2 infection can be grouped into the following disease severity categories, although the criteria for each category may overlap or vary across clinical guidelines and clinical trials, and a patient's clinical condition may change over time (see, for example, the NIH website: covid19treatmentguidelines.nih.gov / overview / clinical-spectrum / ). Non-symptomatic or pre-symptomatic infection: An individual who tests positive for SARS-CoV-2 using a virological test (i.e., nucleic acid amplification test [NAAT] or antigen test) but does not have symptoms consistent with COVID-19. Mild illness: Individuals who have any of the various signs and symptoms of COVID-19 (e.g., fever, cough, sore throat, fatigue, headache, muscle pain, nausea, vomiting, diarrhea, loss of taste and smell) but do not have shortness of breath, difficulty breathing, or an abnormal chest image. Moderate disease: Individuals who demonstrate evidence of lower airway disease during clinical evaluation or imaging and have an oxygen saturation (SpO2) of ≥ 94% on room air at sea level. · Severe disease: Individuals with SpO2 < 94% on room air at sea level, ratio of arterial partial pressure of oxygen to fraction of stimulated oxygen (PaO2 / FiO2) < 300 mmHg, respiratory rate > 30 breaths / min, or pulmonary infiltrates > 50%. · Critically ill: Individuals with respiratory failure, septic shock, and / or multiple organ dysfunction.

[0218] Patients with certain underlying comorbidities are at higher risk of progressing to severe COVID-19. These comorbidities include age ≥65 years, having cardiovascular disease, chronic lung disease, sickle cell disease, diabetes, cancer, obesity, or chronic kidney disease, pregnancy, cigarette smoking, transplant recipient status, and receiving immunosuppressive therapy. Healthcare professionals should closely monitor these patients until clinical recovery is achieved.

[0219] According to WHO guidelines (World Health Organization, Clinical Management of COVID-19: Interim Guidance, 27 May 2020), the severity of SARS-CoV-2 is determined using the following categories: mild disease, moderate disease (pneumonia), severe disease (severe pneumonia), critical disease (acute respiratory distress syndrome (ARDS)), and severe disease (sepsis or septic shock).

[0220] In some embodiments, the severe conditions described herein correspond to severe or critical illnesses as described in the NIH guidelines. In some embodiments, the severe conditions described herein correspond to severe illnesses (severe pneumonia), severe illnesses (acute respiratory distress syndrome (ARDS)), or severe illnesses (sepsis or septic shock) as described in the WHO guidelines.

[0221] In some embodiments, the non-severe conditions described herein correspond to asymptomatic or pre-symptomatic infection, mild disease, or moderate disease as described in the NIH guidelines. In some embodiments, the severe conditions described herein correspond to mild disease or moderate disease (pneumonia) as described in the WHO guidelines.

[0222] Optimal lung imaging techniques have yet to be defined for people with symptomatic SARS-CoV-2 infection. Initial evaluation of these patients may include chest x-ray, screening ultrasound, or, if indicated, computed tomography scan. Electrocardiography should be performed if indicated. Laboratory testing includes a complete blood count with differential and a metabolic profile including liver and renal function tests. Inflammatory markers such as C-reactive protein (CRP), D-dimer, and ferritin are not routinely measured as part of standard care, but the results of such measurements may have prognostic value.

[0223] In some embodiments, predicting the severity of SARS-CoV-2 infection further comprises calculating an APACHE (Acute Physiology and Chronic Health Evaluation) II and / or SOFA (Sequential Organ Failure Assessment) score at the worst value for one or more physiological variables.

[0224] In some embodiments, the calculation of the APACHE II score and the SIPA score is performed within 24 hours from the time the biological sample is collected.

[0225] The Acute Physiological and Chronic Health Evaluation II (APACHE II) is a severity score and mortality estimation tool developed from a large sample of ICU patients in the United States (see, e.g., Knaus WA et al., APACHE II: a severity of disease classification system. Crit Care Med. 1985;13(10):818-29). The APACHE II score consists of 12 physiological variables and two disease-related variables. During the study period, all 12 physiological measurements were available for 87% of all ICU patients. The worst physiological variables were collected within the first 24 hours of ICU admission. The "worst" measurement was defined as the measurement correlated with the highest score. The APACHE II score ranges from 0 to 71 points, with higher scores correlating with higher predicted mortality.

[0226] In some embodiments, worsening SARS-CoV-2 infection corresponds to an APACHE II score of 0 to 30. In some embodiments, worsening SARS-CoV-2 infection corresponds to an APACHE II score of 10 to 20.

[0227] In some embodiments, a non-severe state of SARS-CoV-2 infection corresponds to an APACHE II score of 0 to 15. In some embodiments, a non-severe state of SARS-CoV-2 infection corresponds to an APACHE II score of 4 to 10.5.

[0228] The Sequential Organ Failure Assessment (SOFA) score is a scoring system that evaluates the performance of several organ systems in the body (neurology, hematology, liver, kidneys, and blood pressure / hemodynamics) and assigns a score based on data obtained in each category. The higher the SOFA score, the higher the likelihood of mortality (see, for example, the online document files.asprtracie.hhs.gov / documents / aspr-tracie-sofa-score-fact-sheet.pdf).

[0229] In some embodiments, a worsening SARS-CoV-2 infection corresponds to a SOFA score of 0 to 15. In some embodiments, a worsening SARS-CoV-2 infection corresponds to a SOFA score of 4 to 9.

[0230] In some embodiments, a non-severe state of SARS-CoV-2 infection corresponds to a SOFA score of 0 to 5. In some embodiments, a non-severe state of SARS-CoV-2 infection corresponds to a SOFA score of 0 to 2.

[0231] In some embodiments, the sensitivity of the methods described herein is the rate at which the methods described herein predict a severe condition in a subject.

[0232] In some embodiments, the prediction of worsening SARS-CoV-2 infection has a sensitivity of at least 80%, 85%, 90%, 95%, 99%, or more, hi some embodiments, the prediction of worsening SARS-CoV-2 infection has a sensitivity of at least 85.0%.

[0233] In some embodiments, the prediction of worsening SARS-CoV-2 infection has a specificity of at least 80%, 85%, 90%, 95%, 99%, or more.

[0234] In some embodiments, the prediction of worsening SARS-CoV-2 infection has a specificity of at least 86%.

[0235] The disease severity predictions described herein are particularly useful for determining a treatment plan for a patient with a SARS-CoV-2 infection. In some embodiments, the methods described herein further include determining a treatment plan for a SARS-CoV-2 infection.

[0236] In some embodiments, the treatment plan for worsening SARS-CoV-2 infection is selected from ICU admission, endotracheal intubation, hormone therapy, and extracorporeal membrane oxygenation (ECMO) therapy.

[0237] Appropriate treatments for different levels of severity of SARS-CoV-2 infection are known in the art. For example, the NIH COVID-19 Treatment Guidelines (Figure 9 and NIH website: covid19treatmentguidelines.nih.gov / management / clinical-management / hospitalized-adults--therapeutic-management / hospitalized-adults-figure / ) provide treatment plans for severity of disease that include hospitalization but requiring supplemental oxygen, hospitalization and supplemental oxygen, hospitalization and oxygen via high-flow device or NIV, and hospitalization and MV or ECMO.

[0238] In some embodiments, the treatment plan for a non-severe form of SARS-CoV-2 infection is selected from reducing the dosage of a current administration of a therapeutic agent, leaving the ICU, or being discharged from the hospital.

[0239] The method described herein can also be used to monitor the progression of disease.In some embodiments, the method described herein further comprises determining the baseline level of cfDNA in biological sample.In some embodiments, the baseline level of cfDNA is used as the reference level for comparing and determining the severity of disease.

[0240] In some embodiments, the methods described herein further comprise collecting one or more additional biological samples to determine cfDNA levels at one or more additional time points. For example, to monitor disease progression, samples can be collected every 1, 2, 3, 4, 5, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 hours, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days. In some embodiments, samples are collected every 4, 6, 8, 10, or 12 hours. In some embodiments, samples are collected every 4 to 6 hours.

[0241] In some embodiments, the methods described herein further comprise monitoring the level of cfDNA from different time points over a certain period.For example, disease progression can be monitored over a period of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days or more.

[0242] The prediction of SARS-CoV-2 disease severity can be a prediction of the disease state over the next 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days. In some embodiments, the prediction of SARS-CoV-2 disease severity is a prediction of the disease state over the next 3-5 days. In some embodiments, the methods described herein predict that the subject's condition will worsen over the next 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days. In some embodiments, the methods described herein predict that the subject's condition will worsen over the next 3-5 days. In some embodiments, the methods described herein detect a worsening of the subject's condition and predict one or more symptoms of a severe condition over the next 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days. In some embodiments, the methods described herein detect a worsening of the subject's condition and predict one or more symptoms of a severe condition over the next 3-5 days. In some embodiments, the methods described herein detect a worsening of the subject's condition and predict one or more symptoms of a severe condition over the next 3-5 days.

[0243] Any of the biological samples described herein can be used to predict and monitor the severity of a disease, hi some embodiments, the biological sample is a plasma sample.

[0244] cfDNA quantification By optimizing the primer and probe set for detecting and quantifying cfDNA, the method described herein further improves the amplification efficiency of cfDNA (for example, human β-actin gene) and internal standard oligonucleotide.Therefore, in some embodiments, the method described herein further comprises determining the amplification efficiency of internal standard oligonucleotide and cfDNA (for example, human β-actin gene).

[0245] Any suitable methods and algorithms used to determine the amplification efficiency of nucleic acids can be used in the methods described herein to determine the amplification efficiency of cfDNA and internal standard oligonucleotides.

[0246] In some embodiments, quantification of cfDNA (e.g., human β-actin gene) is performed based on one or more of the following parameters: (1) the starting copy number of the internal standard oligonucleotide (S0), (2) Amplification efficiency (E) of cfDNA (e.g., human β-actin gene) T ), (3) Amplification efficiency of the internal standard oligonucleotide (E S ), (4) Cycle threshold (Ct.T) of cfDNA (e.g., human β-actin gene), (5) Cycle threshold (Ct,S) of the internal standard oligonucleotide.

[0247] In some embodiments, cfDNA quantification is expressed as copy number per volume (e.g., copies / mL). In some embodiments, the concentration of cfDNA (T0) is determined by adjusting the concentration of the internal standard oligonucleotide using the amplification efficiency of the internal standard oligonucleotide and the target gene.

[0248] In some embodiments, the concentration of cfDNA (e.g., human β-actin gene) can be determined by formula (I): TIFF2025516389000003.tif7128In formula, T0 is the concentration of cfDNA by copy number (copies / mL). In some embodiments, the cfDNA is a human housekeeping gene. In some embodiments, the cfDNA is a human β-actin gene. S0 is the concentration of the internal standard oligonucleotide in copies (copies / mL), E T is the PCR amplification efficiency of cfDNA (e.g., human β-actin gene), E S is the PCR amplification efficiency of the internal standard oligonucleotide, Ct.T is the Ct (cycle threshold) value of cfDNA (e.g., human β-actin gene), Ct.S is the Ct (cycle threshold) value of the internal standard oligonucleotide.

[0249] The embodiment described herein uses the above formula to determine the concentration of cfDNA.In this embodiment, the PCR amplification efficiency of cfDNA (for example, human β-actin gene) is 99.71% (for example, by LinRegPCR software or serial dilution), and the PCR amplification efficiency of internal standard oligonucleotide is 99.88% (for example, by LinRegPCR software or serial dilution), and 195 μ L of plasma sample is 1 × 10 in a volume of 5 μ L. 4 copies / µL of an internal standard oligonucleotide. Thus, each 1 mL mixture contains: TIFF2025516389000004.tif9128 copies of the internal standard oligonucleotide per mL of plasma sample. TIFF2025516389000005.tif9128 copies of S0. The human haploid genome is approximately 3.3 × 10 -3 Based on studies and references that every human haploid genome contains one copy of cfDNA (e.g., the human β-actin gene), the concentration of single copy cfDNA (ng / mL) can be determined by formula (II): cfDNA concentration (ng / mL)=846.15×2 (Ct,S-Ct,T) (II) where Ct,S and Ct,T are the Ct values ​​of the internal standard oligonucleotide and cfDNA (e.g., human β-actin gene) under the same threshold, respectively.

[0250] One advantage of the methods provided herein is their high sensitivity for detecting cfDNA, e.g., the ability to detect cfDNA (e.g., human β-actin gene) and internal standard oligonucleotides with high Ct levels.

[0251] In real-time PCR assays, a positive reaction is detected by the accumulation of a fluorescent signal. The Ct (cycle threshold) is defined as the number of cycles required for the fluorescent signal to exceed a threshold (i.e., above background level). The Ct level is inversely proportional to the amount of target nucleic acid in the sample (i.e., the lower the Ct level, the greater the amount of target nucleic acid in the sample).

[0252] kit Also provided herein is a cfDNA detection kit comprising the internal standard oligonucleotides, as well as primers and probes for multiplex quantitative real-time PCR described herein.

[0253] Thus, there is provided herein a kit, comprising: (1) one or more internal standard oligonucleotides described herein; (2) a primer set described herein; (3) a PCR buffer, a DNA polymerase, MgCl2, and dNTPs; and (4) optionally, instructions for carrying out any of the methods described herein.

[0254] In some embodiments, a kit is provided, the kit comprising: (1) a first composition comprising one or more internal standard oligonucleotides, wherein the one or more internal standard oligonucleotides comprise a sequence at least 90% identical to the sequence of SEQ ID NO: 1; (2) a second composition comprising one or more oligonucleotides, wherein the one or more oligonucleotides comprise a sequence at least 90% identical to the entire length of an oligonucleotide sequence selected from any one of SEQ ID NOs: 2 to 6; (3) a third composition comprising a real-time PCR buffer, dNTPs, MgCl2, and a DNA polymerase; and (3) instructions for performing any one of the methods described herein. Any suitable real-time PCR buffer can be used in the kits described herein.

[0255] In some embodiments, the kit further comprises a high-level control, a low-level control, and a negative quality control. In some embodiments, the kit comprises dNTPs and other necessary components for carrying out multiplex quantitative real-time PCR reactions. The necessary components are known in the art. [Example]

[0256] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

[0257] Example 1. Primers, probes, and kits for detecting cfDNA This example describes a cell-free DNA detection kit, a multiplex fluorescent PCR assay intended for the quantitative detection of extracellular DNA (cfDNA) in human plasma from patients confirmed with SARS-CoV-2, as an aid in assessing disease severity resulting from organ or tissue damage that can occur from SARS-CoV-2 infection.

[0258] The cell-free DNA kit is used in conjunction with the QIAamp DNA Blood Mini Kit (QIAGEN, catalog number 51104 or 51106) and the following multiplex quantitative real-time PCR instruments and software: Applied Biosystems™ 7500 Real-Time PCR Instrument System, software V1.4.1 or later Applied Biosystems™ 7500 Fast Real-Time PCR Instrument System, software V1.4.1 or later Roche Cobas z 480 software version 1.5.0 or higher.

[0259] Table 1 Primer and probe sequences and modifications TIFF2025516389000006.tif138167

[0260] Device description and test principle 1) Product overview / test principle: An exemplary cell-free DNA kit is a duplex fluorescent PCR assay incorporating a novel technology with an internal standard for quantitative detection of circulating cell-free DNA in plasma. Fluctuations in cell-free DNA levels can provide a sensitive signal indicating tissue or organ damage and its severity. The unique design of primers and probes combined with internal parameters overcomes the issues of low accuracy and stability in conventional quantitative cell-free DNA detection. Through real-time dynamic monitoring of abnormal cell death, quantitative measurement of cell-free DNA may play an important role in assessing the condition, treatment efficacy, and disease progression of COVID-19 patients. The cell-free DNA kit can help physicians determine which patients should be treated more aggressively, allowing for more efficient management of limited medical resources.

[0261] The cell-free DNA kit is designed to target a specific DNA sequence of the housekeeping gene, human β-actin (NCBI accession number: NG_007992.1), for accurate cfDNA quantification (DNA primer / probe sequence (China Patent Publication CN 106399536 A, the entire contents of which are incorporated herein by reference)). By providing a measurable indication of tissue damage caused by COVID-19 complications, the cell-free DNA kit can provide medical professionals with important information about when patients are likely to experience severe disease, which may aid in treatment and supportive care decisions. Therefore, cell-free DNA detection kits may help improve COVID-19 cure rates and reduce mortality.

[0262] The cell-free DNA quantitative detection kit is run on a standard laboratory PCR instrument and the concentration of cell-free DNA is calculated from the instrument output. cfDNA concentration (ng / mL)=846.15×2 (Ct,S-Ct,T) (II) where Ct,S is the Ct of the internal standard, and Ct,T is the Ct of the target gene (β-actin).

[0263] The gist of the cell-free DNA concentration equation is as follows: TIFF2025516389000007.tif7128 formula, T0 is the concentration of cfDNA (e.g., human β-actin gene) in copies (copies / mL), S0 is the concentration of the internal standard oligonucleotide in copies (copies / mL), E T is the PCR amplification efficiency of cfDNA (e.g., human β-actin gene), E S is the PCR amplification efficiency of the internal standard oligonucleotide, Ct.T is the Ct (cycle threshold) value of cfDNA (e.g., human β-actin gene), Ct.S is the Ct (cycle threshold) value of the internal standard oligonucleotide.

[0264] Concentrations (ng / mL) are calculated using 3.3 pg of single-copy human genomic DNA as a conversion factor (see, e.g., Chen D, Pan S, Xie E, et al. Development and Evaluation of a Duplex Real-Time PCR Assay with a Novel Internal Standard for Precise Quantification of Plasma DNA. Ann Lab Med. 2017, 37: 18-27).

[0265] 2) Test step description: A. Sample Preparation Sample Collection: Draw 2 mL of peripheral blood into an EDTA-K2 anticoagulated evacuated blood collection tube (purple). Plasma isolation Step 1: Equilibrate all samples to room temperature. Centrifuge a 2 mL blood sample at 1,600 g for 10 minutes. Carefully pipette 400 μL of the upper plasma into a 1.5 mL DNase-free microcentrifuge tube. Step 2: Centrifuge the resulting 400 μL of plasma from step 1 at 16,000 g for 10 minutes at 4°C, then pipette 195 μL of the upper plasma layer into a new 1.5 mL DNase-free microcentrifuge tube. This 195 μL is the isolated sample plasma. Adding an Internal Standard (IS) Step 1: Thaw Reagent C from the kit at room temperature. Step 2: Vortex for 10 seconds, then perform a quick spin. Add 5 μL of Reagent C to each of three separate tubes containing 195 μL of plasma sample (from the sample preparation step), 195 μL of high-level control (HC, Reagent D), and 195 μL of low-level control (LC, Reagent E). Mark them separately and mix well for further processing. No template control (NTC, Reagent F) Reagent F is a negative control (no template control) containing DNase-free water. Pipette 200 μL of NTC into a new 1.5 mL DNase-free microcentrifuge tube. Nucleic acid extraction (manual) The QIAamp DNA Blood Mini Kit (QIAGEN, Cat. No. 51104 / 51106) has been validated and is recommended for use in nucleic acid extraction. 8 μL from each extracted sample and control is used to perform the test.

[0266] B. PCR Reagent Preparation (Master Mix) Thaw Reagent A and Reagent B to room temperature. Then mix by pulse vortexing for 10 seconds, followed by a quick spin. Take out the required number of PCR reaction tubes, N*. Divide 17 μL of PCR mixture equally into each of the PCR reaction tubes (or wells) according to Table 2. The total volume of PCR-Mix is N x 17 μL is. After preparation, Reagents A and B should be immediately tightly covered and stored in the dark at -20±5°C. *Note: N = number of samples tested + 1 (high control) + 1 (low control) + 1 (negative control) + 1 (sampling error).

[0267] Table 2: PCR Master Mix Volume Calculation TIFF2025516389000008.tif53155

[0268] C. Sample addition Add 8 μL of the sample yield from the extraction step to the PCR reaction tube / well described above. Cap the tube / well. The total volume in each tube / well is 25 μL. 17 μL (PCR mix) + 8 μL (sample extraction) = 25 μL

[0269] D. Device Channel Settings Software Settings Applied Biosystems™ 7500 Real-Time PCR System (Software v 1.5 or higher)

[0270] A manufacturer's manual for general instructions can be found on the manufacturer's website: thermofisher.com / order / catalog / product / 4351106?SID=srch-srp-4351106# / 4351106?SID=srch-srp-4351106.

[0271] In short: 1. New Experiment: → Enter a name for this experiment. Select 7500 (96 wells) → Quantification Standard Curve → TaqMan Reagents → Standards. 2. Plate Setup → Define Targets and Samples → Define Targets → Add New Target → Set Target Information (Table 3) → Sample Name 3. Assign targets and samples → Click on wells in the plate layout → Launch all targets and tasks → Select None for passive reference → Assign samples to selected wells 4. Channel Settings (Table 4) 5. Save → Start execution.

[0272] (Table 3) Target information TIFF2025516389000009.tif53144 * IS: Internal standard (reagent C)

[0273] (Table 4) PCR conditions TIFF2025516389000010.tif56138

[0274] 4) Analysis 1) Click Analyze → Amplification Plot (in the Plot Settings tab) → ΔRn vs. Cycle (default) → Log (default) → Target. 2) Click Analysis Settings, and in the Ct Settings dialog box, click Edit Default Settings, deselect "Auto Threshold" and "Auto Baseline," and manually set the threshold and baseline. Enter 3 in the Baseline Start Cycle field. The End Cycle value should be set to one or two cycles less than the Ct value at the start of exponential amplification. 3) In the Options tab, select the target (reporter) to adjust and manually adjust the threshold. The thresholds for the FAM and JOE channels of the same sample must be the same. The threshold line intersects the amplification curves of different channels of the same sample during the exponential amplification period. 4) The Ct value is calculated after adjusting the threshold. Click on the well to check the Ct value of the sample. In the target dropdown, select the target to review.

[0275] Roche Cobas® z 480 Real-Time PCR Instrument System (Software V1.5.0) The manufacturer's manual for general instructions can be found on the manufacturer's website: lifescience.roche.com / en_us / products / lightcycler14301-480-instrument-ii.html#documents.

[0276] In short: 1) Click New Experiment to set up your experiment. 2) In the drop-down menu next to Detection Format, select Dual Color Hydrolysis Probe / UPL Probe for target information settings.

[0277] Click Customize to open the Detection Format dialog box, set up a filter combination, and select FAM and JOE.

[0278] In the reaction volume field, enter 25 μL.

[0279] Filter selection for Cobas z 480: select 465–510 for FAM and 540–580 for JOE (Table 5).

[0280] Table 5. Roche Cobas setup TIFF2025516389000011.tif43166 * The filter combination selection can be configured by clicking Detection Format on the Tools menu.

[0281] 3) Specify individual programs by program name and set the temperature and time parameters for each program in the Program Temperature Targets panel below by referencing the steps, number of cycles, temperature, and duration (Table 6). Use the (+) and (-) buttons to add or delete steps in the interface.

[0282] (Table 6) PCR conditions TIFF2025516389000012.tif62151

[0283] Click Save as Template to save the program. Click Apply Template to use the template for future experiments.

[0284] After editing the subset and defining all sample names for this experiment, select Start Run to run the test.

[0285] 4) Analysis 1) Click Analyze, and in the Create New Analysis dialog box, select Abs Quant / Points. In the Create New Analysis dialog box, select the name of this experiment from the Subset list and click to confirm. 2) In the Cycle Range tab, set the first cycle to 5 and the last cycle to 40. 3) In the Noise Band tab, click Filter Comb 540-580 or Filter Comb 465-510. In the filter combination interface, select FAM (456-510) and JOE (540-580), respectively, to adjust the noise band (the noise band position should be as low as possible when it intersects with the sample amplification curve in the smooth region). Observe and compare the noise band values ​​of the FAM channel and JOE channel, and select the larger number as the threshold. Important: Threshold setting principle: The thresholds of the FAM channel and the JOE channel of the same sample must be the same. 4) In the Analysis tab, change Threshold (Auto) to Threshold (Manual). Enter the above acquisition threshold in the Threshold field, click Calculate at the bottom of the window to obtain the Cp value of the corresponding channel (FAM or JOE) in the test, and right-click to export the data. 5) Click Filter Comb 540-580 or Filter Comb 465-510 to change the channel.

[0286] 3) Management materials used: The cell-free DNA kit contains three vials of controls: Reagents D, E, and F.

[0287] Reagents D and E contain two levels of concentration of a reference standard (β-actin gene NCBI:NG_007992.1). * is lot specific and is indicated on the outside label of each vial. The lot concentration is derived during the manufacturing process as follows: Reagent D (HC): The samples are derived from the reference standard at a concentration of 300 x LoD. An internal standard is added, followed by an extraction process. The process is repeated 10 times for each sample. The results of the 10 samples are used to calculate the mean and SD. 300×LoD+ / -3×SD Reagent E (LC): Samples are derived from the reference standard at a concentration of 20x the LoD. An internal standard is added and the extraction process continues. The process is repeated 10 times for each sample. The results of the 10 samples are used to calculate the mean and SD. 20×LoD+ / -3×SD

[0288] Reagent F is a no-template control containing DNase-free HO as well as a negative control to control for contamination that may affect the accuracy of the results.

[0289] Interpretation of results All study controls should be tested before interpreting patient results. If the controls are not valid, patient results cannot be interpreted.

[0290] The concentration of cell-free DNA is calculated as follows: cfDNA concentration (ng / mL)=846.15×2 (Ct,S-Ct,T) NOTE: Ct,S is the Ct value of the internal standard, and Ct,T is the Ct value of the human β-actin gene in the same PCR reaction tube under the same threshold conditions. All clinical samples must demonstrate a fluorescence growth curve; otherwise, the sample is considered invalid. If a residual sample is available, repeat the extraction process. If not, resample, pretreat, and test. The Ct of the internal standard must be ≥ 20 and ≤ 38. If not, rerun the sample from the internal standard (IS) addition step. The Ct of NTC (Reagent F) must be either no value or ≥ 38. If not, contamination is suggested. Reagent D (HC) and Reagent E (LC) must demonstrate a fluorescence growth curve, and the concentrations calculated from the derived FAM and JOE Ct values ​​must fall within the range of corresponding values ​​provided for each lot per vial labeling. If the control value is not within the range provided for labeling, readjust the threshold. Note: The thresholds for both FAM and JOE must be the same. The thresholds for both the JOE and FAM channels must be the same before proceeding to the next step. Once all controls have been confirmed as above, proceed to the analysis of cell-free DNA.

[0291] Each of the LC and HC channels must be qualified according to the concentration range on the label. Manually adjust the threshold until the value is within the range. NOTE: The thresholds for both the JOE and FAM channels must be the same before proceeding to the next step. Once all controls have been confirmed as above, proceed to the analysis of cell-free DNA. Interpret the results according to Table 7.

[0292] Table 7. Interpretation of cell-free DNA kit results TIFF2025516389000013.tif66160

[0293] The severity of COVID-19 is classified as severe (severe to critical) and non-severe (mild to moderate) according to the WHO "COVID-19 Clinical Management: Interim Guidance." Patients are grouped as severe if their respiratory rate is >30 breaths / min or PaO2 / FiO2 <300 mmHg, and vice versa for non-severe. This method was also later adopted by the NIH for the same type of classification.

[0294] Components included in the test

[0295] Table 8: Components included in the test kit TIFF2025516389000014.tif112168

[0296] Components required for testing but not included Components required for testing but not included: Refer to the manufacturer's instructions for: Applied Biosystems 7500 and 7500 Fast Roche Cobas z 480 Extraction Kit QIAamp DNA Blood Mini Kit (QIAGEN, catalog number 51104 or 51106). Other Equipment and Supplies Vortex Centrifugation Pipette 10μL, 200μL, 1000μL 96-well microplate DNase-free tips Disposable gloves 1.5 mL DNase-free microcentrifuge tube PCR reaction tubes (compatible with Applied Biosystems 7500 or Roche Cobas z 480)

[0297] Testing Capabilities Depends on device parameters.

[0298] Reagent stability: The stability of the cell-free DNA kit has been demonstrated through real-time, in-use, and shipping stability tests. Each test is described in the following sections. Pass criteria for the stability tests are as follows: Linear range: 10ng / mL~2400ng / mL, regression coefficient r≧0.980. Accuracy: Absolute deviation does not exceed ±0.5 logarithmic digits. · Intra-batch precision: The coefficient of variation (CV, %) of the logarithm of the detected concentration is ≦5% when the reference standard is >30 ng / mL and ≦10% when the reference standard is ≦30 ng / mL. Batch-to-batch precision: The log CV% of the detected concentrations is ≦15%. · Limit of quantification (LoQ): 10 ng / mL, log CV% of detected concentration is ≦10%. · Limit of detection (LoD): 1ng / mL, of which a. ≥95% detection rate for β-actin gene, b. 100% detection rate for internal standard.

[0299] Real-time stability planning: A real-time stability study to determine the shelf life of a cell-free DNA quantitative detection kit was designed and conducted in accordance with "In Vitro Diagnostic Medical Devices - Evaluation of the Stability of In Vitro Diagnostic Reagents [EN ISO 23640:2015]" and "CLSI EP25-A." Samples for testing were considered at concentrations of 2400 ng / mL, 800 ng / mL, 300 ng / mL, 266.67 ng / mL, 88.89 ng / mL, 29.63 ng / mL, 20 ng / mL, 10 ng / mL, 9.88 ng / mL, and 1 ng / mL using reference standards. For each test time point, ten (10) sample replicates were tested, along with positive and negative quality control samples. The kits were stored at -20 ± 5°C before testing. Testing was performed according to the following schedule: days 0, 122, 245, 366, and 427. The day 0 test point is the first day of manufacture. Cell-free DNA quantitative detection kit testing is performed according to the instructions on a Roche Cobas z 480 PCR detection system (software v1.5.0) or an Applied Biosystems 7500 real-time PCR system (v2.0.6).

[0300] Based on current data through day 427, the validity of the claims is 12 months.

[0301] Performance Evaluation Limit of Bank (LoB) a. Clinical trial protocol The LoB test was designed based on CLSI EP17. Samples with concentrations of 300 ng / mL and 20 ng / mL were obtained by mixing the obtained plasma samples with a reference solution, respectively. All samples were treated with DNase before use. The cell-free DNA quantitative detection kit was measured for 3 days with 10 replicates per day. To evaluate the LoB, the experiment was repeated with three lots of kits.

[0302] b. Conclusion The results did not have any Ct values, so the LoB of the cell-free DNA kit is not applicable.

[0303] Limit of detection (LoD) Clinical trial protocol

[0304] Step 1: Tentative LoD determination A sample concentration of 1000 ng / mL was derived by mixing the obtained plasma sample with a standard solution. The initial LoD was determined by testing a gradient dilution series, including five replicates at each concentration of 0.1 ng / mL, 1.0 ng / mL, 10 ng / mL, 100 ng / mL, and 1000 ng / mL. Data Summary: 1000ng / mL:5 / 5 was detected. 100ng / mL:5 / 5 was detected. 10ng / mL:5 / 5 was detected. 1ng / mL:5 / 5 was detected. 0.1ng / mL:1 / 5 was detected.

[0305] Step 2: LoD confirmation The LoD was confirmed by testing 20 replicates at three different concentrations: 1 ng / mL, 0.5 ng / mL, and 0.25 ng / mL, respectively. Data Summary: 1ng / mL:20 / 20 was detected. 0.5ng / mL:10 / 20 was detected. 0.25ng / mL:5 / 20 was detected.

[0306] Clinical trial conclusion The LoD of the cell-free DNA quantitative detection kit was confirmed to be 1 ng / mL.

[0307] Limit of quantification (LoQ) Clinical trial protocol

[0308] Step 1: Determine the tentative LoQ A sample concentration of 1000 ng / mL was derived by mixing plasma samples with a reference solution. The LoQ was determined by testing a gradient dilution series, containing five replicates at each concentration of 0.1 ng / mL, 1.0 ng / mL, 10 ng / mL, 100 ng / mL, and 1000 ng / mL. a. Clinical trial overview At 1000 ng / mL, 5 / 5 replicates were detected. The coefficient of variation of the logarithm of the measured concentrations was 1.22% (≤10%). At 100 ng / mL, 5 / 5 replicates were detected. The coefficient of variation of the logarithm of the measured concentrations was 1.36% (≤10%). At 10 ng / mL, 5 / 5 replicates were detected. The coefficient of variation of the logarithm of the measured concentrations was 9.92% (≤10%). Five replicates were detected at 1 ng / mL. The coefficient of variation of the logarithm of the measured concentrations was 153.59% (>10%). · 1 / 5 replication was detected at 0.1ng / mL.

[0309] Step 2: LoQ verification The LoQ was confirmed by testing 20 replicates at three different concentrations: 10 ng / mL, 5 ng / mL, and 2.5 ng / mL, respectively.

[0310] b. Clinical trial overview At 10 ng / mL, 20 / 20 replicates were detected. The coefficient of variation of the logarithm of the measured concentrations was 9.93% (≤10%). At 5 ng / mL, 20 / 20 replicates were detected. The coefficient of variation of the logarithm of the measured concentrations was 26.79%. 20 / 20 replicates were detected at 2.5 ng / mL. The coefficient of variation of the logarithm of the measured concentrations was 42.74%.

[0311] Conclusion: The LoQ of the cell-free DNA quantitative detection kit was found to be 10 ng / mL.

[0312] accuracy a. Clinical trial protocol Sample concentrations of 300 ng / mL and 20 ng / mL were derived by spiking plasma with a reference solution. Precision was assessed by the coefficient of variation (CV, %) of the logarithm of the measured concentrations.

[0313] Within-batch precision: The 300 ng / mL and 20 ng / mL samples were each detected in 10 replicates using the same reagent lot. The log coefficient of variation (CV,%) for the 300 ng / mL sample was ≦5%, and the log coefficient of variation (CV,%) for the 20 ng / mL sample was ≦10%.

[0314] Batch-to-batch precision: Samples of 300 ng / mL and 20 ng / mL were detected in 10 replicates with three reagent lots each, and the coefficient of variation (CV, %) of the logarithm of both measured concentrations was ≤15%.

[0315] Passing criteria: · Intra-batch precision: The coefficient of variation (CV, %) of the logarithm of the detected concentration is ≦5% when the reference standard is >30 ng / mL and ≦10% when the reference standard is ≦30 ng / mL. Batch-to-batch precision: The log CV% of the detected concentrations is ≦15%.

[0316] Summary of clinical trials Conclusion: The accuracy of the cell-free DNA kit met the intra- and inter-batch acceptance criteria.

[0317] linearity Clinical trial protocol A sample concentration of 2400 ng / mL was derived by mixing plasma samples with reference synthetic β-actin DNA material. Linearity was assessed by testing a gradient dilution series, containing triplicates at eight different concentrations: 2400 ng / mL, 800 ng / mL, 266.67 ng / mL, 88.89 ng / mL, 29.63 ng / mL, 9.88 ng / mL, 3.29 ng / mL, and 1.1 ng / mL.

[0318] Clinical trial conclusion The linear range is 10 ng / mL to 2400 ng / mL.

[0319] accuracy Clinical trial protocol Samples with concentrations of 300 ng / mL and 20 ng / mL were derived by mixing plasma samples with a reference solution. Precision was assessed by the absolute deviation between the logarithm of the measured concentration and the logarithm of the theoretical concentration. The 300 ng / mL and 20 ng / mL samples were each tested in triplicate from the same lot. The absolute deviation between the logarithm of the measured concentration and the logarithm of the theoretical concentration for both 300 ng / mL and 20 ng / mL must not exceed ±0.5 logarithm in magnitude.

[0320] Clinical trial conclusion Concentrations tested with the cell-free DNA kit did not exceed ±0.5 log orders of magnitude, passing the acceptance criteria for assay precision.

[0321] Normal range To determine the range of cell-free DNA measured in a normal (disease-free) population, peripheral venous blood samples were obtained from 213 apparently healthy individuals and analyzed with a cell-free DNA kit. Normal reference intervals up to 30.65 ng / mL (95th percentile) were determined. The data are summarized in Table 9.

[0322] Table 9. Summary of normal reference range tests TIFF2025516389000015.tif35167 NOTE: Each laboratory should establish its own reference ranges to ensure adequate representation of specific populations.

[0323] Cross-reactivity (analytical specificity): The analytical specificity of the cell-free DNA kit was assessed using both in silico analysis and wet testing against pathogenic microorganisms primarily found in the human respiratory tract (Table 10).

[0324] In silico analysis: BLASTn analysis queries of the cell-free DNA kit primers and probes (human β-actin primer / probe set and internal standard primer / probe set) were performed against public domain nucleotide sequences using the following database search parameters: Mask low complexity regions = Yes Expected value = 10 ·Match / Mismatch = Match 2 Mismatch -3 Gap Cost = Existence 5 Extension 2 Maximum number of hit sequences = 250 Mask bottom case = No Mask low complexity regions = Yes Number of threads = 16 ·Exclude redundant results = number

[0325] Table 10. In silico cross-reactivity analysis TIFF2025516389000016.tif224167TIFF2025516389000017.tif248168TIFF2025516389000018.tif254167TIFF2025516389000019.tif180168

[0326] Conclusion: The above in silico cross-reactivity analysis showed that there was less than 80% homology between any one of the tested primers / probes and any sequences present from the microorganisms analyzed above. Therefore, no cross-reactivity or microbial interference is expected with the microorganisms analyzed.

[0327] Cross-reactivity: Wet test To further assess the potential cross-reactivity of the cell-free DNA quantitative detection kit target sequences, a wet test was performed.

[0328] A total of three replicates were tested for each potential cross-reactant. No unexpected cross-reactivity was observed for the organisms and viruses listed. The results are shown in the table below (Table 11).

[0329] Table 11. Wet test of cross-reactivity of cell-free DNA kits TIFF2025516389000020.tif189168

[0330] Conclusion: None of the pathogens tested in Table 11 produced a Ct result with the cell-free DNA kit described herein. In conclusion, no cross-reactivity was observed with the cell-free DNA kit described herein and the pathogens tested.

[0331] Example 2: Modification of cfDNA detection method Modification of PCR reaction system A comparison of the previous and modified PCR reaction systems is shown in Table 12.

[0332] Table 12: Comparison of PCR reaction systems TIFF2025516389000021.tif120167

[0333] A comparison of the previous and modified PCR reaction conditions is shown in Table 13.

[0334] Table 13: Comparison of PCR reaction conditions TIFF2025516389000022.tif41167

[0335] Detection limit The detection limits using the modified method are shown in Table 14.

[0336] Table 14. Detection limits using the modified method TIFF2025516389000023.tif241170TIFF2025516389000024.tif235167

[0337] The detection rate for 10 ng / mL β-actin is 100% (20 / 20), and the detection rate for the internal standard oligonucleotide is 100% (20 / 20). The detection rate for 1 ng / mL β-actin is 100% (20 / 20), and the detection rate for the internal standard oligonucleotide is 100% (20 / 20). The detection rate for 0.1 ng / mL β-actin is 65% (13 / 20), and the detection rate for the internal standard oligonucleotide is 100% (20 / 20). Therefore, the detection limit of the modified method is 1 ng / mL.

[0338] Quantitation limit

[0339] Table 15. Quantitation limits using the modified method TIFF2025516389000025.tif239167TIFF2025516389000026.tif94167

[0340] The coefficient of variation (CV,%) of the logarithmic concentration of the 10 ng / mL group is 8.98%, and the coefficient of variation (CV,%) of the logarithmic concentration of the 10 ng / mL group is 179.20%. Therefore, the quantitation limit of the modified method is 10 ng / mL.

[0341] Sample Linearity Sample linearity is determined by linear regression of the mean log concentration Yi and the theoretical logarithm Xi, where the linearity coefficient is r. For a detection kit, an acceptable r is |r| ≥ 0.980.

[0342] As shown in Figure 4, r2 is 0.9966 for samples ranging from 1.1 to 2400 ng / mL. |r| = 0.9983 > 0.9800. Furthermore, coupled with the results of the LoQ experiment, the cfDNA detection method has a sample linearity range of 10 to 2400 ng / mL.

[0343] accuracy As shown in Table 16, the logarithmic coefficient of variation (CV, %) at 300 ng / mL was 2.83%, and the logarithmic coefficient of variation (CV, %) at 20 ng / mL was 2.76%.

[0344] Therefore, the accuracy of the modified method of cfDNA quantitative detection technology is satisfactory and is superior to previous methods of cfDNA quantitative detection technology (e.g., the method described in Chinese Patent Publication No. CN 106399536 A) in terms of accuracy at low concentrations.

[0345] Table 16: Accuracy of modified detection methods TIFF2025516389000027.tif174168

[0346] accuracy The accuracy of the modified detection method is shown in Table 17.

[0347] For the 300 ng / mL sample, the absolute deviation range is approximately -0.08 to -0.01, not exceeding ±0.5 logarithmic magnitude.

[0348] For the 20 ng / mL sample, the absolute deviation range is approximately 0.09 to 0.14, not exceeding ±0.5 logarithmic magnitude.

[0349] Therefore, the accuracy of the modified method of cfDNA quantitative detection is qualified, and the detection accuracy of high-value and low-value corporate reference materials is higher than that of previous methods of cfDNA quantitative detection technology (e.g., the method described in Chinese Patent Publication No. CN 106399536 A).

[0350] Table 17. Accuracy of the modified detection method TIFF2025516389000028.tif67167

[0351] Reference range The reference range of the modified detection method is shown in Figures 6 and 7. By optimizing the internal standard sequence and the primers and probes, the amplification of the internal standard is more stable and accurate. Therefore, the reference range of the healthy sample group is narrower than that of the previous method.

[0352] Example 3: Accurate plasma DNA quantification reveals timely disease progression in hospitalized COVID-19 patients The coronavirus disease 2019 (COVID-19) outbreak has overwhelmed the world as one of its greatest threats (see, for example, Woolf SH, Chapman DA, Lee JH. COVID-19 as the Leading Cause of Death in the United States. JAMA 2021;325:123-4). The rapid increase in infected cases has challenged health systems worldwide. Effective triage and management of patients is essential to optimize healthcare resource allocation for those at higher risk. Observations in large populations have reported that approximately 20% of patients develop severe and critical illness with complications such as acute respiratory distress syndrome (ARDS), sepsis, thromboembolism, and multiple organ failure (see, e.g., Wu Z, McGoogan JM. Characteristics of and Important Lessons from the Coronavirus Disease 2019 (COVID-19) Outbreak in China: Summary of a Report of 72,314 Cases From the Chinese Center for Disease Control and Prevention. JAMA 2020;323:1239-42). Early and timely assessment of disease severity is crucial for providing optimized treatment and appropriate interventions, thus improving cure rates and reducing mortality.

[0353] The WHO "Clinical management of COVID-19: interim guidance" (e.g., World Health Organization. Clinical management of COVID-19: interim guidance. See website: who.int / publications / i / item / clinical-management-of-covid-19) employs a set of definitions based on lung status and associated comorbidities to guide early triage and severity determination, but makes limited reference to disease monitoring. The Acute Physiology and Chronic Health Evaluation (APACHE) II score and the Sequential Organ Failure Assessment (SOFA) score are widely used to assess disease severity in general critical illnesses, and they have shown considerable prognostic efficacy in COVID-19 patients, despite issues of sensitivity or practicality (e.g., Zou X et al. Acute Physiology and Chronic Health Evaluation II Score as a Predictor of Hospital Mortality in Patients of Coronavirus Disease 2019. Crit Care Med 2020;48:e657-65, Assaf D, et al. Utilization of machine-learning models to accurately predict the risk for critical COVID-19. Intern Emerg Med 2020;15:1435-43, and Qu R, et al. C-reactive protein concentration as a risk predictor of mortality in intensive care units: a multicenter, prospective, observational study. BMC Anesthesiol 2020;20:292).Chest computed tomography (CT) imaging is considered effective for early detection of pulmonary involvement in COVID-19 (see, e.g., Zu ZY, et al. Coronavirus Disease 2019 (COVID-19): A Perspective from China. Radiology 2020;296:E15-25). However, its resolution is only applicable at the millimeter level for human visual imaging reading, which causes insufficient sensitivity in surveillance (see, e.g., Kwee TC, Kwee RM. Chest CT in COVID-19: What the Radiologist Needs to Know. Radiographics 2020;40:1848-65). Recently, plasma SARS-CoV-2 viral antigen concentrations have been shown to be associated with disease progression, including ICU admission and infusion rates; however, these viral antigens were consistently undetectable in all COVID-19-positive patients (see, e.g., Ogata AF et al. Ultra-Sensitive Serial Profiling of SARS-CoV-2 Antigens and Antibodies in Plasma to Understand Disease Progression in COVID-19 Patients with Severe Disease. Clin Chem 2020;66:1562-72). Therefore, clinically applicable biomarkers that are objective, rapid, cost-effective, and quantitative to communicate reliable, real-time patient status are urgently needed, not only for triage but also for monitoring.

[0354] Novel duplex real-time PCR assays using internal standards eliminate preanalytical errors while increasing the accuracy and precision of autologous cfDNA quantification in plasma and have been described in a range of scenarios (e.g., Liu JP, Zhang SC, Pan SY. Value of dynamic plasma cell-free DNA monitoring in septic shock syndrome: A case report. World J Clin Cases 2020;8: 200-7; Chen D et al. 2011. The Clinical Significance of Plasma DNA Quantification for Quake Trauma Patients. In: Gahan PB, editor. Proceedings of the 6th international conference on circulating nucleic acids in plasma and serum. Hong Kong: Springer, Dordrecht. p. 171-82; Pan S et al. Can plasma DNA monitoring be employed in personalized chemotherapy for patients with advanced lung cancer? Biomed Pharmacother 2012;66: 131-7; Naumann DN, et al. Endotheliopathy is associated with higher levels of cell-free DNA following major trauma: A prospective observational study. PLoS One 2017;12: e0189870, Chen D et al. Development and Evaluation of a Duplex Real-Time PCR Assay With a Novel Internal Standard for Precise Quantification of Plasma DNA.Ann Lab Med 2017;37:18-27; Xia WY, et al. Liquid biopsy for non-invasive assessment of liver injury in hepatitis B patients. World J Gastroenterol 2019;25:3985-95; and Wang H et al. Real-time monitoring efficiency and toxicity of chemotherapy in patients with advanced lung cancer. Clin Epigenetics 2015;7:119). Therefore, quantifying plasma DNA using the assay described herein is advantageous for patient monitoring to assess COVID-19.

[0355] method Study design and participants All patients with confirmed COVID-19, excluding pregnant women and children, were enrolled and followed until discharge or 170 days of hospitalization. COVID-19 diagnosis was confirmed by a positive RT-PCR assay of nasal and throat swab specimens. Because patients were receiving medical care, there was no available method for predetermining sample size.

[0356] Outcome The severity of COVID-19 was classified as severe (severe to critical) and non-severe (mild to moderate) (see, for example, Table 2 from the World Health Organization, Clinical Management of COVID-19: Interim Guidance, May 27, 2020). During monitoring, the progression of disease over a series of non-overlapping 72-hour periods was assessed from medical records in a 6-hour period compared with the 72-hour period. We defined worsening progression as one or more of the following: a) abnormally high or low body temperature; b) increased or increased use of vasoactive agents, sedatives, and analgesics; c) upgraded respiratory support; d) increased visible or occult bleeding; or e) the development of additional complications. Outcome results were independently provided by three clinical experts, with consensus reached by at least two of them.

[0357] Plasma DNA quantification Two-mL blood samples anticoagulated with EDTA-K2 were used for plasma DNA quantification using the kit described herein, a multiplex fluorescent PCR assay using the human β-actin gene as the amplification target and synthetic DNA as an internal standard.

[0358] Data collection and processing Patient medical records collected were not individually identifiable. Patient characteristics from medical records included demographic variables, clinical signs and symptoms, imaging results, laboratory findings, and medical history. Clinical signs and symptoms included temperature, systolic / diastolic blood pressure, heart rate, respiratory rate, administration of vasoactive / sedative / analgesic medications, and loss of consciousness. Imaging results included abnormalities on chest radiographs or CT imaging. Laboratory findings included regional arterial oxygen tension, oxygen saturation, white blood cell count and differential, neutrophil-to-lymphocyte ratio (NLR), platelet count, hematocrit, serum sodium and potassium, pH, total bilirubin, creatinine, and D-dimer levels. Medical history included previous surgery, chronic obstructive pulmonary disease, liver cirrhosis, renal dialysis, immunodeficiency disorders, cancer, chemotherapy, radiation, and long-term or high-dose steroids.

[0359] APACHE II and SOFA scores were calculated based on the worst value of each physiological variable within the previous 24 hours at the time of the visit and averaged by two clinicians blinded to the plasma DNA results.

[0360] statistical analysis The distribution of quantitative data was examined using the Shapiro-Wilk normalization test. Data with skewed distributions were presented as medians with interquartile ranges (IQRs). Correlations between variables were calculated using Spearman's rank coefficient. For complete-case analysis, the 15 missing values ​​of D-dimer were handled using predicted mean concordance (PMM) multiple imputation from the entire dataset with three nearest neighbors. The impact introduced from imputation was assessed through distribution comparisons, which showed no significant difference (P = 0.685, Figure 13). The entire dataset was then randomly divided into creation and validation subsets with a 3:1 ratio of worsening and non-worsening, respectively. Eight variables, including disease severity, APACHE II score, SOFA score, plasma DNA, neutrophil count, lymphocyte count, NLR, and D-dimer, were subjected to multivariate logistic regression with backward stepwise selection, removing terms with P ≥ 0.1 and adding terms with P < 0.05. Given the multiple sampling of disease progression in the same patient, the regression data were considered clustered by patient ID. Model performance estimates were determined using bootstrap resampling based on odds ratios to identify correlates of predictive model development, and goodness of fit was assessed using the Pearson χ2 test. Finally, a validation subset was used to confirm the discriminatory performance of the nomogram and its calibration curve. Decision curve analysis (DCA) was performed by calculating the net benefit of the nomogram for a range of threshold probabilities. All statistical analyses were performed using Stata / IC 15.0 (StataCorp LLC, USA) and R statistical software (version 4.0.3). Unless otherwise stated, a two-sided P < 0.05 was considered to indicate a statistically significant difference.

[0361] result Cohort characteristics One patient was excluded due to hospitalization less than 72 hours. A total of 17 patients were included, including six women and 11 men. Their ages ranged from 27 to 83 years, with a median age of 57 years (IQR: 50-72 years). Ten patients were admitted to the intensive care unit (ICU) on the day of study enrollment, of which seven received endotracheal tubes and two were treated with extracorporeal membrane oxygenation (ECMO). By the end of the study, 15 patients had recovered and been discharged (median follow-up: 46 days, IQR: 20-59 days), and two patients remained hospitalized. No deaths were reported. At enrollment, patients with severe disease had higher APACHE II scores (P = 0.002) and SOFA scores (P = 0.001) compared with patients with non-severe disease. There were no significant differences in age (P = 0.29) or gender ratio (P > 0.99) between them (Table 18).

[0362] Table 18. Baseline characteristics of COVID-19 patients TIFF2025516389000029.tif121133 * CRRT: Continuous renal replacement therapy

[0363] A total of 174 observation visits were performed to determine 72-hour disease progression. Of these, 114 outcomes were determined from the eight patients classified as severe at study enrollment, with an interval of 3–5 days (median: 3 days), and 60 outcomes from the nine non-severe patients with an interval of 3–9 days (median: 4 days). The full outcome dataset was then randomly split into a creation subset and a validation subset with a 3:1 ratio of exacerbation to non-exacerbation. The creation subset contained 40 exacerbation outcomes and 92 non-exacerbation outcomes, while the validation subset contained 13 exacerbation outcomes and 29 non-exacerbation outcomes. The clinical trial workflow includes amino acid sequences shown in Figure 14A-B. There were no significant differences in candidate predictors between the two subsets (see Table 19).

[0364] Table 19. Candidate predictors between development and validation subsets TIFF2025516389000030.tif53145 * NLR: Neutrophil to lymphocyte ratio

[0365] Severe vs. non-severe conditions Comparison of severity scores and laboratory tests between severe and non-severe conditions during monitoring is shown in Table 20. Patients with severe conditions were significantly higher in APACHE II score (P<0.001) and SOFA score (P<0.001), and were more likely to have coagulopathy with higher D-dimer levels (P<0.001). Immunodeficiency was more commonly demonstrated in severe conditions, with lower lymphocyte counts and higher neutrophil levels achieving a significantly higher NLR compared to non-severe conditions. Receiver operating characteristic (ROC) analysis showed that the AUC for plasma DNA was 0.849 (95% CI: 0.793-0.904), with a sensitivity of 86.0% and specificity of 66.7% at a cutoff value of 95.02 ng / mL, and the APACHE II score (AUC: 0.810, 95% CI: 0.749-0.871, plasma DNA vs. APACHE II: P = 0.323, Figure 15). Plasma DNA levels had similar patterns to the severity scores in different severity states, but from the perspective of long-term monitoring, they were not dynamically parallel to the severity scores (Figure 10A-B). Spearman's correlation test showed that plasma DNA had a rather weak coefficient (ρ) of 0.215 (P = 0.022) for the APACHE II score and did not correlate with the SOFA score (P = 0.833) in the severe condition, whereas in the non-severe condition, the coefficients were 0.405 (P = 0.001) for the APACHE II score and 0.458 (P < 0.001) for the SOFA score (Figure 16A-B), respectively, suggesting an additional role in disease severity assessment.

[0366] Table 20. Severity scores and clinical examinations between severe and non-severe conditions TIFF2025516389000031.tif53141 * NLR: Neutrophil to lymphocyte ratio

[0367] Creating and validating predictive models Baseline variables and laboratory tests deemed clinically relevant were selected as candidate predictors, including WHO disease severity, APACHE II score, SOFA score, plasma DNA, D-dimer, neutrophil count, lymphocyte count, and NLR. All indicators showed significant correlation with disease worsening in univariate analysis. Given the number of available events and the high correlation between predictors (ρ > 0.7) (Table 21), backward stepwise multivariate logistic regression was applied using P ≥ 0.1 to remove variables and cluster them by patient ID. After internal validation using 300 bootstraps, plasma DNA and neutrophil count were retained as independent predictors of worsening in the development dataset (Table 22). A nomogram incorporating these two predictors was then constructed (Figure 11A). The nomogram calibration curve (Figure 11B) and the non-significant Pearson's statistic (P = 0.987) indicated good calibration of the developed model. The preferred calibration of the nomogram was achieved by a non-significant Pearson χ2 This was confirmed by the test statistic (P = 0.670) (Figure 11C). The C-indices of the nomograms in subset development and validation were 0.915 (95% CI: 0.866-0.964, Figure 11D) and 0.931 (95% CI: 0.853-1.000, Figure 11E), respectively, revealing good discrimination. For convenience, we attempted a simplified version of the model containing only the single predictor, plasma DNA, which carries the majority of the weight in predicting deterioration presented in the nomogram. This achieved an AUC of 0.897 (95% CI: 0.836-0.958, Figure 12A), which was not statistically different from the constructed model (P = 0.431). By setting the cutoff value at 169.3 ng / mL, plasma DNA could identify deterioration with 85.0% sensitivity and 85.9% specificity. Decision curve analysis (DCA) of the resulting subsets showed that when the physician or patient threshold probability was within the range of 0.04–0.92, the predictive model, using either the two-index model or its concise one-index version, added more net benefit than the “treat all” or “do not treat” strategies (Figure 12B).

[0368] Table 21. All pairwise correlations between candidate predictors in subset development (n=132) TIFF2025516389000032.tif74167 * NLR: Neutrophil to lymphocyte ratio † NS, not significant (P ≥ 0.05).

[0369] Table 22. Logistic regression analysis of candidate predictors during model development (n=132) TIFF2025516389000033.tif112166 * backward-staged, clustered on patient ID; † 300 internal validations with boot capture; ‡ NLR: Neutrophil to lymphocyte ratio.

[0370] Case studies of three critically ill patients Case #1, a 61-year-old man in the ICU, showed elevated plasma DNA levels, except for correlation with APACHE II scores (before day 59), consistent with irregular fever and intolerance of ventilation parameters (days 69-90), while the severity score and D-dimer levels decreased (see Figure 17), and PCT was within 0.1 ng / mL. The results indicate that plasma DNA provides a warning sign of unrecognized lung damage that other indicators, such as D-dimer, may not provide. A reasonable explanation may be the relatively low coefficient of plasma DNA on severity scores.

[0371] In Case #3, a 68-year-old male patient in the ICU had a rapid increase in plasma DNA levels accompanied by uncontrollable fever, suggesting non-remission under current treatment (Figure 18). The patient presented with recurrent fever and gastrointestinal bleeding on Day 76, with a peak plasma DNA level of 1426.72 ng / mL, yet still showed stable severity scores and D-dimer levels. This suggests the need for plasma DNA in monitoring critical illness.

[0372] Case #4 was a 66-year-old male patient in the ICU who developed an uncontrolled or maladaptive state starting on Day 59. This was accompanied by a consistent increase in plasma DNA, but a decrease in the severity score and D-dimer levels. Granulocyte colony-stimulating factor was then administered on Day 66, and a slight proliferative lesion in the right lung was confirmed by CT scan 10 days later (Day 76, Figure 19). The versatility of plasma DNA differs from that of D-dimer, which primarily reflects fibrinolysis, and the severity score, which synthesizes a high level of systemic condition.

[0373] Consideration Previous studies have found that older age, male gender, and a greater number of comorbidities are risk factors associated with the progression of COVID-19. However, these individual characteristics cannot reflect a patient's real-time condition. While most patients experience mild respiratory symptoms, certain individuals may progress to severe or critical illness, requiring specific management, especially in the intensive care unit (see, e.g., Wang D et al. Clinical Characteristics of 138 Hospitalized Patients With 2019 Novel Coronavirus-Infected Pneumonia in Wuhan, China. JAMA 2020;323:1061-9 and Wu C et al. Risk Factors Associated With Acute Respiratory Distress Syndrome and Death in Patients With Coronavirus Disease 2019 Pneumonia in Wuhan, China. JAMA Intern Med 2020;180:934-43). However, there is no single algorithm for determining the need for invasive intervention, and clinicians must consider various factors. Growing interest in anti-IL-6 therapy raises the question of whether elevated IL-6, due to its dual pro- and anti-inflammatory properties, represents a therapeutic target, and whether IL-6, when elevated, represents a therapeutic target (Hedrick TL et al., COVID-19: Clean up on IL-6. Am J Respir Cell Mol Biol 2020;63:541-3). Dynamic markers of COVID-19 severity with therapeutic relevance remain scarce. This study investigated the utility of plasma DNA levels in predicting COVID-19 progression in hospitalized patients. To our knowledge, this is the first prospective study in a multipoint series to demonstrate that plasma DNA quantification, a liquid biopsy assay, could be a tool for predicting disease progression 72 hours prior to disease onset.

[0374] Decades ago, plasma DNA levels were first found to increase after burn injury and significantly correlated with hospital stay (see, e.g., Chiu TW, et al., Plasma cell-free DNA as an indicator of the severity of injury in burn patients. Clin Chem Lab Med 2006;44:13-7). This suggested the potential of cfDNA for injury assessment. cfDNA quantitative assays can be classified into target-specific amplification and non-amplification assays, which have relatively low specificity and sensitivity. Currently, it is generally believed that circulating genomic DNA is primarily derived from apoptosis and necrosis of nucleated cells (see, e.g., Stroun M, et al., About the possible origin and mechanism of circulating DNA apoptosis and active DNA release. Clin Chim Acta 2001;313:139-42, and Tsang JCH, Lo YMD. Circulating nucleic acids in plasma / serum. Pathology 2007;39:197-207) and is primarily eliminated by the liver (see, e.g., Celec P, Vlkova B, Laukova L, Babickova J, Boor P. Cell-free DNA: the role in pathophysiology and as a biomarker in kidney diseases. Expert Rev Mol Med 2018;20:e1). Therefore, plasma DNA levels are balanced between the cfDNA release and clearance processes. Our previous report suggests that plasma DNA can be used to monitor disease progression in patients with septic shock.However, this inference may not be unanimously supported by other studies because the large amount of analytical variability from sample processing to measurement remains challenging for standardization (e.g., Streleckiene G et al., Effects of Quantification Methods, Isolation Kits, Plasma Biobanking, and Hemolysis on Cell-Free DNA Analysis in Plasma. Biopreserv Biobank 2019;17:553-61). The inevitable loss of cfDNA during sample preparation leads to unclear variance in the analysis, weakening the clinical applicability of cfDNA due to the comparability between various assays. Due to its meticulous design, including an internal standard spiked into plasma and processed synchronously, and consistent amplification efficiency of standard DNA and plasma DNA, this accurate assay, as well as frequently used clinical tests for infection control, including routine blood testing and D-dimer assays, were evaluated in this study to assess COVID-19. Results from 17 patients demonstrated that plasma DNA levels not only indicate disease severity in patient triage, as shown in Figure 15, but also have predictive value for short-term (72-hour) deterioration, overwhelming clinical criteria filtered out by stepwise regression, while implementing similar current criteria, including the WHO severity scale, APACHE II, and SOFA scores, to efficiently allocate limited resources. We thoroughly examined medical records for each case, using a total of 174 observation visits, which revealed that the majority of underlying injuries not evidenced by routine practice were accompanied by rapid elevations in plasma DNA. As exemplified by three representative cases (Figures 17-19), plasma DNA quantified by an accurate assay for molecular levels directly linked to tissue / organ damage clearly demonstrates its ability to indicate short-term disease progression, which is more sensitive than clinical scores based primarily on symptoms or high-level descriptions of physiology.Furthermore, plasma DNA, with its short half-life of approximately 20 minutes (see, for example, Yu SCY, et al. High-resolution profiling of fetal DNA clearance from maternal plasma by massively parallel sequencing. Clin Chem 2013;59:1228-37), allows repeated measurements throughout clinical monitoring and can provide dynamic feedback on disease progression. Clinical scores calculated based on past data cannot reflect the ongoing situation. This may be a reasonable explanation for the relatively low coefficient of plasma DNA on the APACHE II and SOFA scores, suggesting plasma DNA assays as a supplement to clinical scores for severity assessment, especially in emergency situations. Furthermore, this is a powerful indicator for assessing disease progression and for improving physiological parameters related to patient status, which should be considered in further studies.

[0375] Autopsy studies have demonstrated SARS-CoV-2 virus broad organ tropism beyond the lung (see, for example, Fox SE, et al., Pulmonary and cardiac pathology in African American patients with COVID-19: an autopsy series from New Orleans. Lancet Respir Med 2020;8:681-6). Tissue-specific cfDNA methylation may help elucidate COVID-19 pathogenesis. However, limitations remain in methylation patterning across all known cell and tissue types, and the high complexity of whole-genome bisulfite sequencing hinders the clinical applicability of methylation measurements. Total plasma DNA abundance can be measured within 2 hours at low cost, and using a cutoff value of 95.02 ng / mL for severity differentiation is more feasible in clinical scenarios. It also provides physicians with a broader picture of the patient's overall condition 72 hours prior. Warnings of deterioration provide a valuable window for determining whether more frequent monitoring or intervention is warranted. Rapid plasma DNA response allows healthcare providers to manage patients more efficiently, especially during public health emergencies when resources are limited. Notably, aerosolized DNases are currently being evaluated in COVID-19 trials (see, e.g., Weber AG, et al., Nebulized in-line endotracheal dornase alfa and albuterol administered to mechanically ventilated COVID-19 patients: a case series. Mol Med 2020;26:91). Plasma DNA can be monitored as a therapeutic target in companion diagnostics.

[0376] Summary and Conclusion Early recognition of COVID-19 exacerbation promotes efficient triage and optimal allocation of medical resources. However, dynamic markers of COVID-19 severity remain lacking. Here, we conducted a prospective study in hospitalized patients with confirmed COVID-19 to explore effective predictors of disease exacerbation.

[0377] Consecutive hospitalized patients with confirmed COVID-19 infection were included and followed until discharge or 170 days of hospitalization. A non-overlapping series of 72-hour disease progression was assessed using medical records from 6-hour periods compared with 72 hours later. Multivariate logistic regression was used to quantify the association between predictors and 72-hour disease worsening. Predictive performance was assessed by nomogram and decision curve analysis.

[0378] A total of 174 non-overlapping visits from 17 COVID-19 patients were assessed for 72-hour disease progression, which was independently correlated with plasma DNA and neutrophil counts. A concise version of the developed model, using only plasma DNA weighted largely to predict nomogram deterioration, achieved an area under the curve (AUC) of 0.897 (95% CI: 0.836-0.958), providing a net benefit over a "treat all" or "no treat" strategy within a threshold probability range of 0.04-0.92. Extensive testing in three critical cases further supported the utility of plasma DNA in revealing deterioration.

[0379] Using a novel, accurate quantitative assay, plasma DNA can effectively predict COVID-19 worsening up to 72 hours in advance, overpowering the prevailing APACHE II and SOFA scores and providing significant utility to intensive care patients.

[0380] Plasma DNA quantification is an essential aid in assessing disease progression and timely decision-making for patients who may require more aggressive interventions, such as endotracheal tube placement or ECMO.

[0381] Other embodiments While the present invention has been described in conjunction with the detailed description thereof, it should be understood that the foregoing description is intended to illustrate, and not to limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the appended claims.

Claims

1. A double-stranded internal standard oligonucleotide for detecting cell-free DNA in biological samples, containing a sequence that is at least 80% identical to the sequence of Sequence ID No.

1.

2. (a) To provide a double-stranded oligonucleotide sequence containing a region of approximately 25 to 200 bp on a target human gene, (b) Inserting the oligonucleotide into the recombinant vector, (c) Digesting the recombinant vector of step (b) using one or more endonucleases to obtain a linear internal standard oligonucleotide, This generates the internal standard oligonucleotide described in claim 1, A method for generating an internal standard oligonucleotide containing [a specific substance].

3. (a) an oligonucleotide sequence that is at least 80% identical to the corresponding region of the target human gene, (b) A forward primer binding site and a reverse primer binding site, wherein the length between the forward primer binding site and the reverse primer binding site is approximately 90 bp to approximately 200 bp, Internal standard oligonucleotides, including those mentioned above.

4. A pharmaceutical composition comprising an effective amount of the internal standard oligonucleotide described in claim 3, and a pharmaceutically acceptable carrier, diluent, or both.

5. A method for quantifying cell-free DNA in a biological sample, comprising contacting the biological sample with the internal standard oligonucleotide described in claim 3.

6. The method according to claim 5, further comprising detecting and quantifying the human β-actin gene in the biological sample.

7. The method according to claim 6, further comprising quantifying cell-free DNA in the biological sample based on the quantification of the human β-actin gene.

8. A method for detecting or quantifying cell-free DNA in a biological sample, the following: (A) Biological samples, (1) DNA polymerase and dNTPs, (2) Forward primer for the human β-actin gene having the nucleotide sequence of Sequence ID No. 2, (3) A reverse primer for the human β-actin gene having the nucleotide sequence of SEQ ID NO: 3, and (4) A detectable labeled human β-actin probe comprising an oligonucleotide sequence that can specifically hybridize to the oligonucleotide sequence of the human β-actin gene. And incubation, and the incubation is When the human β-actin gene is present in the biological sample, the forward primer and reverse primer mediate polymerase chain reaction amplification in a region of the human β-actin gene, thereby enabling the production of amplified human β-actin fragments during the reaction under conditions sufficient to achieve this. Incubation is, (B) To detect the human β-actin gene, Includes, A method for detecting or quantifying the presence of cell-free DNA in a biological sample.

9. The method according to claim 8, further comprising quantifying the human β-actin gene in the biological sample if the human β-actin gene is present in the biological sample.

10. The method according to claim 8, wherein the human β-actin probe hybridizes to the amplified human β-actin fragment.

11. (C) Adding a certain amount of an internal standard oligonucleotide having the sequence of Sequence ID No. 1 to the biological sample, The biological sample in (D) and (C) (1) DNA polymerase and dNTPs, (2) A forward primer having the nucleotide sequence consisting of SEQ ID NO: 4, (3) A reverse primer having a nucleotide sequence consisting of Sequence ID No. 3, and (4) A detectable labeled internal standard probe comprising an oligonucleotide sequence that can specifically hybridize to the internal standard oligonucleotide. And incubation, and the incubation is The forward and reverse primers mediate polymerase chain reaction amplification of a region of the sequence of Sequence ID No. 1, thereby enabling the production of an amplified fragment of the region during the reaction under conditions sufficient to do so. Incubation is, (E) To detect an internal standard oligonucleotide, The method according to claim 8, further comprising:

12. The method according to claim 11, wherein the internal standard probe hybridizes to a fragment of the region of sequence number 1.

13. In (A) above, the DNA polymerase has 5'→3' exonuclease activity which hydrolyzes the hybridized human β-actin probe, thereby separating the detectable label on the probe and making the signal detectable. In (D) above, the DNA polymerase has 5'→3' exonuclease activity which hydrolyzes the hybridized internal standard probe, thereby separating the detectable label on the probe and making the signal detectable. The method according to claim 12.

14. The following parameters can be quantified from the aforementioned human β-actin gene: (1) Starting copy number of internal standard oligonucleotide (S ０ ), (2) Amplification efficiency of the human β-actin gene (E Ｔ ), (3) Amplification efficiency of internal standard oligonucleotides (E Ｓ ), (4) The cycle threshold (Ct, T) of the human β-actin gene, and (5) Cycle threshold (Ct, S) of internal standard oligonucleotides, The method according to claim 9, which is carried out based on one or more of the following: The quantification of the aforementioned human β-actin gene is given by formula (I): A method implemented in accordance with the following.

15. (1) One or more internal standard oligonucleotides containing a sequence that is at least 90% identical to the sequence of Sequence ID No. 1, (2) One or more oligonucleotides comprising a sequence that is at least 90% identical to the entire length of an oligonucleotide sequence selected from any one of sequence numbers 2 to 6, (3) PCR buffer, DNA polymerase, dNTPs, and MgCl ２ and, (4) Optionally, instructions for carrying out the method described in claim 5, A kit that includes this.

16. The internal standard oligonucleotide according to claim 3, wherein the reverse primer binding site is located within a sequence that is at least 80% identical to the corresponding region of the target human gene.

17. An internal standard oligonucleotide according to claim 3, having a length of approximately 100 bp to approximately 3000 bp.

18. The internal standard oligonucleotide according to claim 3, wherein the target human gene is a human housekeeping gene.

19. The internal standard oligonucleotide according to claim 18, wherein the housekeeping gene is selected from the group consisting of human 18S rRNA (18S ribosomal RNA), human 28S rRNA (28S ribosomal RNA), human TUBA (α-tubulin), human ACTB (β-actin), human β2M (β2-microglobulin), human ALB (albumin), human RPL32 (ribosomal protein L32), human TBP (TATA sequence-binding protein), human CYCC (cyclophyllin C), human EF1A (elongation factor 1α), human GAPDH (glyceraldehyde-3-phosphate dehydrogenase), human HPRT (hypoxanthine phosphoribosyltransferase), and human RPII (RNA polymerase II).

20. A method for quantifying cell-free DNA (cfDNA) in a biological sample in order to predict the severity of infection caused by SARS-CoV-2, (A) To provide biological samples obtained from subjects with SARS-CoV-2 infection, (B) Quantifying cell-free DNA (cfDNA) in the biological sample using the method of claim 5, A method comprising predicting the severity of SARS-CoV-2 infection based on the quantification of cfDNA, wherein a cfDNA concentration exceeding a cutoff value indicates worsening of SARS-CoV-2 infection.

21. A composition for detecting cell-free DNA in a biological sample, comprising a double-stranded internal standard oligonucleotide having a sequence that is at least 80% identical to the sequence of Sequence ID No. 1.

Images