Cryopreservation of NK cell products for established immunotherapy

Abstract

Methods are provided herein for inactivating effector cells, such as NK cells, that contain cells for adoptive cell therapy that are pre-made cells. The inactivated cells may be cryopreserved following inactivation. The inactivated cells may be proliferated and / or activated prior to inactivation and may or may not contain a transgene. The transgene may optionally encode a chimeric antigen receptor and / or a T cell receptor. In certain embodiments, methods are disclosed for inactivation of NK cells that include treatment with a kinase inhibitor, such as an mTOR inhibitor and / or a tyrosine kinase inhibitor, such as rapamycin and / or dasatinib. Also provided herein are methods for preparing and / or using inactivated cryopreserved NK cells, as well as treatment of a subject in need thereof, such as treatment of a subject having cancer, with the inactivated cryopreserved NK cells.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 364,516, filed May 11, 2022, which is incorporated herein by reference in its entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted in ST26 format and is incorporated herein by reference in its entirety. The ST26 copy was created on May 3, 2023, is named MDAC_P1326_Sequence_Listing.xml, and is 6,349 bytes in size.

[0003] Technical Field The present disclosure relates generally to at least the fields of cell biology, molecular biology, biochemistry, immunology, and medicine. [Background technology]

[0004] 2. Description of Related Art Cultivation and preservation of cells, e.g., mammalian cells, for in vitro study or ex vivo culture and / or preservation for subsequent administration to humans or animals is an important tool for the study and treatment of human diseases. Cell culture and preservation is widely used for the production of various biologically active products, e.g., viral vaccines, monoclonal antibodies, polypeptide growth factors, hormones, enzymes, and tumor-specific antigens. However, many of the media or methods used for cell culture and / or preservation contain components that may have adverse effects on cell growth and / or maintenance of cells in culture and / or are insufficient to protect cells from the consequences of storage (e.g., cryopreservation).

[0005] Furthermore, there are currently several cell banks that preserve cells, such as human placental or umbilical cord stem cells, for future medical use. There are also cell banks that preserve cells cultured, for example, in bioreactors, for scientific purposes as well as medical therapy. Common to all cell banks is that the cells are preserved by cryopreservation, usually in liquid nitrogen. Cryopreservation of cells using current methods can adversely affect the function and / or viability of the cells.

[0006] Current CAR T cells approved by the FDA are autologous and produced in a highly individualized manner for each patient, an approach that has proven effective but is time-consuming and expensive. The development of readily available, off-the-shelf allogeneic products offers the opportunity to generate cell banks in advance that can be used as needed. Off-the-shelf effector cell products (e.g., NK cells, CAR-NK cells, etc.) must meet two conditions: (i) donor cells must be injectable without regard for HLA matching; and (ii) donor cells must retain function after cryopreservation. The inventors have previously shown that CAR19 / IL-15 cord blood (CB)-derived NK cells that are HLA-mismatched to the recipient can be safely infused into subjects (see, e.g., Liu E, Marin D, Banerjee P, et al. Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med. 2020;382(6):545-553, incorporated herein for purposes described herein), addressing a first need for an off-the-shelf product.However, unlike T cells, whose cytotoxicity is not significantly affected by freeze-thaw cycles, the ability of NK cells to proliferate, persist, home to sites of disease, and / or kill tumor cells in vivo can be significantly affected by cryopreservation (see, e.g., Mark C, Czerwinski T, Roessner S, et al., Cryopreservation impairs 3-D migration and cytotoxicity of natural killer cells. Nat Commun. 2020;11(1):5224; and Miller JS, Rooney CM, Curtsinger J, et al., Expansion and homing of adoptively transferred human natural killer cells in immunodeficient mice varies with product preparation and in vivo cytokine administration: implications for clinical therapy. Biol Blood Marrow Transplant. 2014;20(8):1252-1257, each of which is incorporated herein for the purposes described herein). Due to this limitation, clinical trials testing the safety and efficacy of NK cell therapy often must utilize fresh NK cells after expansion. Summary of the Invention [Problem to be solved by the invention]

[0007] The present disclosure satisfies the need in the art for improved cell preservation methods. [Means for solving the problem]

[0008] overview The present disclosure relates to cell, inactivation, and / or cryopreservation techniques, as well as methods utilizing cells and / or compositions produced as described herein. Generally, the disclosure relates to immune cells, such as NK cells, that can be inactivated using one or more inactivating agents, cryopreserved, and subsequently thawed as described herein. These cells are more robust in viability and / or cytotoxicity against tumor cells compared to cells cryopreserved in the absence of the disclosed methods. In certain embodiments, the cell inactivation methods described herein abolish cytolytic activity, cytokine production, and / or NK cell proliferation, allowing for enhanced cell viability after cryopreservation and, in certain embodiments, the generation of cells for use "off the shelf." Following cell inactivation and cryopreservation, the thawed cells can be used immediately, expanded, or further manipulated, e.g., by subjecting them to recombinant techniques, including transfection. In some cases, the cells may be cryopreserved a second or subsequent time, with or without the use of the disclosed methods, and may or may not be further manipulated, such as by subjecting the cells to recombinant techniques, including but not limited to, transduction, transfection, and / or gene editing, prior to the second or subsequent cryopreservation.

[0009] Disclosed herein, in some embodiments, are methods for inactivating natural killer (NK) cells, comprising treating NK cells with an effective amount of one or more inactivating agents under conditions to produce inactivated NK cells. In some embodiments, the inactivating agent is a kinase inhibitor. In some embodiments, the inactivating agent is a mechanistic target of rapamycin (mTOR) inhibitor. In some embodiments, the mTOR inhibitor is rapamycin, everolimus, and / or temsirolimus. In some embodiments, the mTOR inhibitor is rapamycin. In some embodiments, the inactivating agent is a tyrosine kinase (TK) inhibitor. In some embodiments, the TK inhibitor is selected from the group consisting of dasatinib, nilotinib, lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, pexidartinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdafitinib, nintedanib, gilteritinib, and migratinib. In some embodiments, the TK inhibitor is a BCR-Abl inhibitor. ... In some embodiments, the TK inhibitor is dasatinib and / or nilotinib. In some embodiments, the TK inhibitor is dasatinib. In some embodiments, the NK cells are not treated with bosutinib. In some embodiments, the NK cells are not treated with nilotinib. In some embodiments, the NK cells are not treated with saracatinib. In some embodiments, the NK cells are not treated with an mTOR inhibitor.

[0010] In some embodiments, treatment with an inactivating agent occurs at any time during the culture of NK cells. In some embodiments, treatment is for about 24 hours to about 96 hours, about 36 hours to about 84 hours, or about 48 hours to about 72 hours. In some embodiments, treatment is for about 24 hours, about 48 hours, or about 72 hours. In some embodiments, NK cells are treated with an inactivating agent at a concentration of about 1 to about 1000 nM. In some embodiments, NK cells are treated with an inactivating agent at a concentration of about 5 to about 500 nM. In some embodiments, NK cells are treated with an inactivating agent at a concentration of about 20 to about 200 nM. In some embodiments, NK cells are treated with an inactivating agent at a concentration of about 30 to about 100 nM. In some embodiments, inactivated NK cells have increased expression of one or more of C-kit, CCR-5, CD62L, and / or CXCR4, and / or decreased expression of one or more of NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS, and / or CD95 compared to activated NK cells.

[0011] In some embodiments, the NK cells are derived from human peripheral blood mononuclear cells (PBMCs), unstimulated leukopheresis cells (PBSCs), human embryonic stem cells (hESCs), hematopoietic stem cells, induced pluripotent stem cells (iPSCs), bone marrow, NK cell lines, and / or umbilical cord blood. In some embodiments, the NK cells are isolated from blood. In some embodiments, the NK cells are isolated from one or more umbilical cord blood units. In some embodiments, the NK cells are induced NK cells generated from progenitor cells. In some embodiments, the progenitor cells are hESCs, hematopoietic stem cells, iPSCs, and / or induced hematopoietic stem cells.

[0012] In some embodiments, the NK cells comprise a transgene. In some embodiments, the transgene encodes a chimeric antigen receptor (CAR), a T cell receptor (TCR), a non-naturally occurring variant of FcγRIII (CD16), an interleukin (e.g., interleukin-15 (IL-15), interleukin-15 receptor (IL-15R) or a variant thereof, interleukin-12 (IL-12), interleukin-21 (IL-21), interleukin-18 (IL-18), interleukin-12 receptor (IL-12R) or a variant thereof), a human leukocyte antigen (e.g., human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E)), leukocyte surface antigen cluster of differentiation CD47 (CD47), or any combination of two or more thereof. In some embodiments, the NK cells comprise a transgenic CAR. In some embodiments, the NK cells comprise two or more transgenic CARs.

[0013] In some embodiments, the NK cells comprise a mutation in an endogenous gene. In some embodiments, the endogenous gene is an immunomodulatory gene. In some embodiments, the endogenous gene is NKG2A, SIGLEC-7, LAG3, TIM3, CISH, FOXO1, TGFBR2, TIGIT, CD96, ADORA2, NR3C1, PD1, PDL-1, PDL-2, CD47, SIRPA, SHIP1, ADAM17, RPS6, 4EBP1, CD25, CD40, IL21R, ICAM1, CD95, CD80, CD86, IL10R, TDAG8, CD5, CD7, SLAMF7, CD38, LAG3, TCR, beta2-microglobulin, HLA, CD73, GCR, CREM, ICER, CREB1, and / or CD39.

[0014] In some embodiments, the NK cells are activated and / or expanded prior to inactivation. In some embodiments, the NK cells are activated and / or expanded by culturing with a cell culture solution comprising universal antigen-presenting cells (uAPCs), IL-2, IL-12, IL-15, and / or IL-18.

[0015] In some embodiments, the inactivated NK cells are frozen and cryopreserved for any period of time. In some embodiments, the inactivating agent is included in the cryopreservation medium. In some embodiments, the inactivating agent is washed away from the inactivated NK cells prior to cryopreservation.

[0016] Also provided herein in some embodiments are NK cells produced by any one or any combination of the methods described herein. Provided herein in some embodiments are inactivated, cryopreserved NK cells produced by any one or more of the methods described herein. In some embodiments, the inactivated, cryopreserved NK cells are thawed to produce inactivated, thawed NK cells. In some embodiments, the inactivated, thawed NK cells are washed to remove the inactivating agent. In some embodiments, the inactivated, thawed NK cells are reactivated in the absence of the inactivating agent to produce reactivated NK cells. In some embodiments, the reactivated NK cells have improved viability compared to cryopreserved NK cells that were thawed without inactivation. In some embodiments, the reactivated NK cells comprise a transgene, and the expression level of the transgene is not significantly decreased compared to cryopreserved NK cells that were thawed without inactivation. In some embodiments, the expression level of the transgene is increased compared to cryopreserved NK cells that were thawed without inactivation. In some embodiments, the reactivated NK cells have an increased tumor cell kill rate after cryopreservation compared to cryopreserved NK cells that were not inactivated and thawed.

[0017] Also provided herein, in some embodiments, is a method of treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of reactivated NK cells described herein. In some embodiments, the subject has cancer. In some embodiments, the cancer is a hematologic cancer. In some embodiments, the cancer comprises a solid tumor. In some embodiments, the cancer is a cancer of hematopoietic origin. In some embodiments, the reactivated NK cells are allogeneic or autologous with respect to the subject. In some embodiments, the reactivated NK cells are allogeneic with respect to the subject. In some embodiments, the subject has an improved chance of survival compared to a subject not treated with an effective dose of the reactivated NK cells.

[0018] Embodiments of the present disclosure include methods of maintaining greater than at least 50% viability of a cell population after cryopreservation of the population, comprising treating the population of cells with an effective amount of one or more inactivating agents (e.g., kinase inhibitors) to inactivate the cells prior to cryopreservation, cryopreserving the cells, and thawing the population, wherein upon thawing, the viability of the population is at least greater than 50%. In some cases, after cryopreservation of the population, upon thawing the cells, the viability of the cell population is at least greater than 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%.

[0019] Contemplated herein are methods of extending the shelf life of a population of cells (e.g., effector cells, such as NK cells) upon cryopreservation of the population, for example, comprising treating the population with an effective amount of an inactivating agent (e.g., a kinase inhibitor) prior to cryopreservation. In some embodiments, the shelf life may be extended by on the order of 1 to 4, 1 to 2, 1 to 3, 2 to 4, 2 to 3, or 3 to 4 weeks, 1 to 12, 2 to 12, 3 to 12, 4 to 12, 5 to 12, 6 to 12, 7 to 12, 8 to 12, 9 to 12, 10 to 12, or 11 to 12 months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 years or more, compared to the shelf life of cells cryopreserved in the absence of an inactivating agent (e.g., a kinase inhibitor) prior to cryopreservation. The cells may or may not include one or more transgenes, such as, but not limited to, a chimeric antigen receptor (CAR), an engineered cytokine, and / or a T cell receptor (TCR). In certain embodiments, the cells may be combined in vivo or ex vivo with monospecific, bispecific, and / or multispecific antibodies. After cryopreservation and thawing of the cells, an effective amount of the cells may be delivered to a subject in need thereof. The cells may be allogeneic or autologous with respect to the recipient subject, and the subject may have cancer, an autoimmune disorder, graft-versus-host disease, allograft rejection, and / or an inflammatory condition, including bacterial, viral, or fungal infection. In some embodiments, the subject may have vital organ damage requiring regenerative repair.

[0020] Embodiments of the present disclosure include methods of thawing a population of cells cryopreserved by any of the methods disclosed herein, including, for example, exposing the population of cells to an effective amount of an inactivating agent (e.g., a kinase inhibitor) prior to cryopreservation to produce a population of inactivated cells, cryopreserving the cells, and exposing the cryopreserved population to suitable thawing conditions. The thawing conditions may or may not be standard in the art. For example, in certain embodiments, frozen cells may be thawed rapidly (in less than 1 minute), e.g., in a 37°C water bath, after which the thawed cells may be diluted, e.g., slowly, using growth medium that is optionally pre-warmed. In certain cases, the thawed cells are plated at high density to optimize recovery.

[0021] Certain embodiments of the present disclosure relate to methods of delivering cells to a target site or tissue in an individual, including when the cells have been cryopreserved in a cryopreservation medium composition of the present disclosure, comprising substantially immediately and / or substantially directly after thawing the cells, injecting or administering an effective amount of the cells intravenously, topically, intrathecally, intraperitoneally, or subcutaneously to the target site or tissue. In certain embodiments, the target site or tissue is a cancer, e.g., a solid tumor, although hematological malignancies may also be treated with the methods of the present disclosure.

[0022] Other objects, features, and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

[0023] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present disclosure. The subject matter of the disclosure may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [Brief explanation of the drawings]

[0024] [Figure 1] 1 is a schematic diagram describing a strategy for inactivation of NK cells by treatment with an inactivating agent (e.g., a kinase inhibitor, e.g., a tyrosine kinase (TK) inhibitor, e.g., dasatinib, nilotinib, imatinib, bosutinib) or an mTOR inhibitor for 24, 48, or 72 hours in preparation for activation / expansion and subsequent storage (e.g., cryopreservation). NK cells are isolated and / or derived from a suitable source (e.g., blood, e.g., umbilical cord blood), optionally pre-activated with a cytokine cocktail (e.g., IL-12, IL-15, and / or IL-18), optionally expanded and / or activated (e.g., by inclusion of general antigen-presenting cells (APCs) and / or IL-2), and once expanded and / or activated, the NK cells are temporarily inactivated (e.g., induced to become quiescent) by treatment with the inactivating agent; after a set period of time, the inactivating agent is removed (e.g., by washing), and the cells can then be stored (e.g., by cryopreservation).

[0025] [Figure 2-1] Figures 2A-2B show how the addition of dasatinib prior to cryopreservation shifted NK cell phenotype to a less activated state, as analyzed by mass cytometry. The left side of Figures 2(A) and (B) shows t-distributed stochastic neighbor embedding (t-SNE) plots demonstrating a clear phenotypic distinction between activated NK cells treated with dasatinib and those not treated with dasatinib. (A) shows the relative expression of activation and cytotoxicity markers, such as CD95, NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, and ICOS, which exhibited increased expression in NK cells not treated with dasatinib compared to those treated with dasatinib. (B) shows the relative expression of activation and cytotoxicity markers, such as CCR5, CD62L, CXCR4, and C-kit. These showed decreased expression in NK cells not treated with dasatinib compared to NK cells treated with dasatinib. [Figure 2-2] Same as above.

[0026] [Figure 3-1] Figures 3A-3B show how the addition of dasatinib before cryopreservation improved post-thaw NK cell viability without adversely affecting CAR expression. (A) Pre-cryopreservation analysis of NK cells treated with dasatinib for 24, 48, or 72 hours demonstrates comparable and / or improved viability compared to NK cells not treated with dasatinib prior to cryopreservation. The Y-axis quantifies Annexin V levels (a marker of apoptosis), and the X-axis quantifies cell death markers. The lower left quadrant of each graphical representation highlights and quantifies the percentage of viable cells (60.2% without dasatinib, 61.7% with 24 hours of dasatinib, 68.8% with 48 hours of dasatinib, and 70.9% with 72 hours of dasatinib). (B) Flow cytometry results showing how NK cells treated with dasatinib for 24 or 48 hours prior to cryopreservation exhibit similar and / or improved chimeric antigen receptor (CAR) expression levels compared to NK cells not treated with dasatinib prior to cryopreservation. The Y-axis quantifies CD56 levels, and the X-axis quantifies CAR levels. The percentage of CAR-positive cells and mean fluorescence intensity (MFI) are shown for each test condition (no dasatinib: 57% CAR+, MFI 3724; 24-hour dasatinib: 64.9% CAR+, MFI 7987; 48-hour dasatinib: 55.4% CAR+, MFI 4620). [Figure 3-2] Same as above.

[0027] [Figure 4-1]Figures 4A-4B show how the addition of dasatinib for 48 or 72 hours before cryopreservation improved post-thaw NK cell viability and anti-tumor cytotoxicity. (A) Graph showing NK cell death after cryopreservation and subsequent thawing. NK cell death was measured using Cytotox green dye, and the total integrated intensity of the green dye was used as a surrogate for NK cell death (Y-axis) over time (X-axis). The data showed that the addition of dasatinib to NK cell cultures prior to cryopreservation for 48 or 72 hours enhanced NK cell viability after thawing. (B) Graph showing tumor cell death after cryopreservation and subsequent thawing of NK cells cocultured with tumor cells (e.g., Raji tumor cells) at an effector:target ratio of 1:1. Cytotox green dye was used to measure tumor cell death, and the total integrated intensity of the green dye was used as a surrogate for tumor cell death (Y-axis) over time after the addition of NK cells (X-axis). This indicated that the addition of dasatinib to NK cell cultures for 48 or 72 hours prior to cryopreservation enhanced their antitumor capacity. [Figure 4-2] Same as above.

[0028] [Figure 5-1]Figures 5A-5B show how the addition of dasatinib for 48 or 72 hours before cryopreservation improved the antitumor cytotoxicity of thawed NK cells. (A) Graph showing the death of Karpas cells (e.g., the Karpas-299 cell line, a human non-Hodgkin's Ki-positive large cell lymphoma cell line) after coculture with NK cells inactivated before cryopreservation. Karpas cell death was measured using Cytotox green dye, and the total integrated intensity of green light as a function of near-infrared camera (NIR) object area was used as a surrogate (Y-axis) for Karpas cell death over time (X-axis) after the addition of thawed NK cells at an effector:target ratio (E:T ratio) of 1:1. (B) Graph showing the death of Raji cells (e.g., a human B-lymphoblastoid cell line) after coculture with NK cells inactivated before cryopreservation. Raji cell death was measured using Cytotox green dye, and the total integrated intensity of green light as a function of near-infrared camera (NIR) object area was used as a surrogate (Y-axis) of Raji cell death over time (X-axis) after addition of NK cells at an effector:target ratio (E:T ratio) of 1:1. Together, these results demonstrate that adding dasatinib to NK cell cultures prior to cryopreservation enhances their anticancer cell potential. [Figure 5-2] Same as above.

[0029] [Figure 6-1]Figures 6A-6B show how the addition of dasatinib before cryopreservation improves the antitumor cytotoxicity of NK cells in vivo and improves the in vivo survival of Raji-NSG (e.g., NOD scid gamma genotype) mice. (A) Graph showing the mean tumor brightness (p / s / cm2 / sr, a surrogate for tumor growth) (Y-axis) over time (X-axis, days) in Raji-NSG mice after injection of Raji tumor cells and simultaneous treatment with approximately 1 x 107 thawed NK cells. Results showed that NK cells treated with dasatinib for 24, 48, or 72 hours before cryopreservation improved tumor growth inhibition compared with mice treated with thawed NK cells that had not been treated with dasatinib before cryopreservation or tumor-bearing mice not treated with NK cells. (B) Graph showing survival probability (Y-axis) over time (X-axis) for Raji-NSG mice injected with Raji tumor cells and NK cells (approximately 1 × 10 thawed NK cells) or control media. Results showed that thawed NK cells treated with dasatinib for 24, 48, or 72 hours before cryopreservation improved tumor growth inhibition compared with mice treated with thawed NK cells not treated with dasatinib or tumor-bearing mice not treated with NK cells. [Figure 6-2] Same as above.

[0030] [Figure 7-1]Figures 7A-7D show how the addition of dasatinib before cryopreservation improves NK cell anti-tumor cytotoxicity and NK cell engraftment in vivo. (A) is a schematic of the experimental procedure performed (animals were irradiated on day -4, injected with 0.5 x 10 MM1S cells on day -3, injected with 5 x 10 fresh or 10 x 10 frozen CAR NK cells on day 0, and imaged weekly for life). (B) Bioluminescence imaging over time (days 0, 7, 14, and 21) for mice transplanted with untreated MM1s cells (CD70+ multiple myeloma cells) transduced with firefly luciferase (FFluc) (MM1S alone), fresh day 15 NK cells transduced with a construct containing CD70 CAR and IL-15, thawed NK cells containing the same constructs treated with dasatinib for 24 or 72 hours before cryopreservation and frozen on day 15 or 18, respectively, or NK cells containing the same constructs cryopreserved and thawed on day 18 without dasatinib treatment before cryopreservation. (C) Quantitative graph of the mean bioluminescence intensity shown in (B). (D) Quantitative graph of the percentage of in vivo NK cell engraftment at day 10 after NK cell infusion into mice shown in (B). [Figure 7-2] Same as above. [Figure 7-3] Same as above. [Figure 7-4] Same as above.

[0031] [Figure 8-1]Figures 8A-8B demonstrate that CAR NK cells cultured for 14 days and then treated with dasatinib for 24 or 72 hours prior to freezing were superior in in vivo tumor control compared to CAR NK cells preserved by standard freezing media protocols without inactivation. Furthermore, dasatinib-treated cells demonstrated similar in vivo anti-tumor control compared to that of fresh CAR NK cells (cultured for 14 days). (A) Bioluminescence imaging (BLI) showing MM1S tumor growth over time (days -3, 4, 15, 22, and 29) in mice transplanted with MM1S cells (CD70+ multiple myeloma cells transduced with firefly luciferase (FFluc)) alone, MM1S cells and dasatinib, MM1S cells and fresh (14-day culture) CD70-targeted CAR-NK cells, or MM1S cells and frozen CAR-NK cells treated with or without dasatinib for 24 or 72 hours before cryopreservation. (B) is a quantitative graph of the mean bioluminescence intensity shown in (8A). [Figure 8-2] Same as above.

[0032] [Figure 9-1]Figures 9A-9E demonstrate that CAR NK cells (MDACC) cultured for 13 days and then treated with dasatinib for 24 hours prior to freezing outperform CAR NK cells preserved by standard freezing medium (CS10) protocols without inactivation. Furthermore, dasatinib-treated cells demonstrated in vivo anti-tumor control similar to that of fresh CAR NK cells. (A) Diagram illustrating the experimental procedure (animals were irradiated on day -4, injected with 0.5 x 10 MM1S cells on day -3, and injected with 5 x 10 6 fresh or 10 x 10 6 frozen CAR NK cells on day 0, and imaged weekly). (B) Bioluminescence imaging (BLI) showing tumor growth over time (days -3, 4, 15, 22, and 29) in mice receiving transplants of MM1S cells (CD70+ multiple myeloma cells transduced with firefly luciferase (FFluc)) alone, MM1S cells and dasatinib, MM1S cells and fresh (13-day-old culture) CD70-targeted CAR-NK cells, or MM1S cells and frozen CAR-NK cells treated with dasatinib for 24 hours before cryopreservation or not. (C) Quantitative graph of the mean bioluminescence intensity shown in (9B). (D) Quantitative graph of the absolute number of in vivo NK cell engraftments in the blood of mice 10 or 20 days after transplantation of CAR-NK cells shown in (9B). (E) Survival curves for the four groups of mice shown in (9B). (F) presents the accompanying statistical analysis. [Figure 9-2] Same as above. [Figure 9-3] Same as above. [Figure 9-4] Same as above. [Figure 9-5] Same as above. [Figure 9-6] Same as above.

[0033] [Figure 10-1]Figures 10A-10D demonstrate that CAR NK cells cultured for 13 days and then treated with dasatinib for 24 hours before freezing exhibited comparable in vivo anti-tumor control and engraftment capabilities compared to freshly prepared, day 13 CAR NK cells. Furthermore, the data demonstrated that the activity of CAR NK cells remained unaffected when injected with freezing medium. (A) is a diagram illustrating the experimental procedure (animals were irradiated on day -4, injected with 0.5 x 10 MM1S cells on day -3, injected with 5 x 10 6 fresh or 10 x 10 6 frozen CAR NK cells on day 0, and imaged weekly). (B) Bioluminescence imaging (BLI) showing MM1S tumor growth over time (days -3, 7, 14, 21, 28, and 35) in mice receiving transplants of MM1S cells (CD70+ multiple myeloma cells transduced with firefly luciferase (FFluc)) alone, MM1S cells and fresh (day 13 of culture) CD70-targeted CAR-NK cells, or MM1S cells and frozen CAR-NK cells. Frozen CAR-NK cells were resuspended in saline or freezing medium in preparation for injection, and all CAR-NK cells contained the same construct. (C) Quantitative graph of mean bioluminescence intensity shown in (10B). (D) Quantitative graph of the percentage of in vivo NK cell engraftment in the blood of mice 10 days after receiving transplants of CAR-NK cells shown in (10B). [Figure 10-2] Same as above. [Figure 10-3] Same as above. [Figure 10-4] Same as above.

[0034] [Figure 11-1]Figures 11A-11C are FACS plots showing that CAR NK cells cryopreserved after 13 days of culture and treated with dasatinib for 24 hours prior to freezing exhibited comparable in vivo engraftment levels to those of freshly prepared (culture day 13) CAR NK cells 10 days after infusion. Furthermore, the data demonstrated that CAR NK cell engraftment remained unaffected when injected with freezing medium compared to saline. (A) Negative and positive controls for CD138 (tumor marker) and hCD45 (natural killer cell marker) were used to assess antibody quality and gating strategy. (B) demonstrates the percentage of freshly CD70-targeted CAR-NK cells (top right) and frozen CAR-NK cells injected with saline (middle right) or freezing medium (bottom right) of CD56 / CD16+ and CD27+ (CAR marker) cells previously gated as CD138- and hCD45+ (left, example panel). (C) Demonstrates the percentage of engraftment of hCD45+ / CD138- (CAR NK cells) from three different tumor-bearing mice injected with fresh (culture day 13) CD70-targeted CAR-NK cells or frozen CAR-NK cells treated with dasatinib prior to cryopreservation. Frozen CAR-NK cells were thawed and resuspended in saline or freezing medium. [Figure 11-2] Same as above. [Figure 11-3] Same as above.

[0035] [Figure 12-1]Figures 12A-12F depict validation of the anti-tumor cytotoxicity of frozen CAR NK cells targeting TROP2, cultured for 13 days and treated with dasatinib for 24 hours prior to freezing. CAR NK cells treated with dasatinib before cryopreservation demonstrated comparable anti-tumor cytotoxicity compared to fresh NK cells (cultured on day 13) in an in vivo mouse model of ovarian cancer (SKOV3 cells). (A) is a diagram of the experimental procedure performed. Animals were injected with 0.5 x 10 SKOV3 cells on day -7 and BLI began on day -2. Animals were irradiated on day -1, injected with 10 x 10 fresh or 10 x 10 frozen CAR NK cells on day 0, and imaged weekly throughout their lives. (B) Bioluminescence imaging (BLI) showing tumor growth of SKOV3 (TROP2+ ovarian cancer cells transduced with firefly luciferase (FFluc)) over time (days -2, 5, 12, 19, 26, 33, 40, 47, 54, 61, and 68) in mice that received no treatment, treatment with NT NK cells, treatment with fresh TROP2-targeted CAR NK cells, or treatment with frozen / thawed TROP2-targeted CAR NK cells (CAR NK cells containing the same construct) treated with dasatinib before cryopreservation. (C) Quantitative graph of mean bioluminescence intensity shown in (12B). (D) Quantitative graph of in vivo NK cell engraftment in the blood of mice 10 or 20 days after NK cell transplantation shown in (12B). (E) Survival curves for the four groups of mice in (12B). (F) presents the accompanying statistical analysis. [Figure 12-2] Same as above. [Figure 12-3] Same as above. [Figure 12-4] Same as above. [Figure 12-5] Same as above. [Figure 12-6] Same as above.

[0036] [Figure 13-1]Figures 13A-13B show how CAR NK cells treated with dasatinib prior to freezing demonstrate comparable anti-tumor cytotoxicity to fresh NK cells in vivo in a mouse model of pancreatic ductal adenocarcinoma (PATC148). (A) Presents bioluminescence imaging over time (days 3, 6, 13, 20, 27, 34, and 41) in mice transplanted with firefly luciferase (FFluc)-transduced PATC148 cells and treated with either no treatment (PATC148 alone), fresh NK cells transduced with a construct containing a TROP2-targeting CAR (iC9 / TROP2CAR / IL15), or frozen CAR NK cells containing the same construct and treated with dasatinib prior to freezing. (B) Presents a quantitative graph of the mean brightness of bioluminescence shown in (13A). [Figure 13-2] Same as above.

[0037] [Figure 14-1]Figures 14A-14C show that the addition of dasatinib to NK cells prior to freezing enhances post-thaw antitumor cytotoxicity in an in vitro glioblastoma tumor spheroid assay. (A) Shows representative images of GSC272 spheroids (an mcherry-transduced glioblastoma multiforme (GBM) tumor cell cancer stem cell line) cultured alone (right column, top two panels) or cocultured with NK cells that were not treated with dasatinib prior to freezing (column 1) or with NK cells that were treated with dasatinib prior to freezing (column 2) at E:T ratios of 1:1, 2:1, 3:1, or 5:1. Dasatinib alone was also added to some wells containing tumor cells as a control (right column, bottom two panels). (B) Quantification of total integrated red intensity over time showing a significant decrease in total integrated red intensity (as a measure of tumor growth) when spheroids were co-cultured with NK cells inactivated with dasatinib prior to freezing. (C) Quantification of total integrated red intensity over time showing a significant decrease in total integrated red intensity (as a measure of tumor growth) when GSC20 spheroids (an mcherry-transduced GBM tumor cell cancer stem cell line) were cultured alone, or co-cultured with NK cells that were not treated with dasatinib prior to freezing, or with NK cells that were treated with dasatinib prior to freezing. Together, these results demonstrate that NK cells inactivated with dasatinib prior to freezing have increased cytotoxicity against glioblastoma tumor cells compared to NK cells that were not inactivated prior to freezing. [Figure 14-2] Same as above. [Figure 14-3] Same as above.

[0038] [Figure 15-1]Figures 15A-15E show the effect of pre-cryopreservation treatment with various receptor tyrosine kinase inhibitors (dasatinib, D; bosutinib, B; nilotinib, N; and saracatinib, S, respectively) on the viability and phenotype of NK cells after thawing. (A) shows the recovery (viability) of NK cells after freeze / thaw when cells were treated with various tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib, final concentration 1 micromolar) before cryopreservation. Annexin V assay shows the percentage of viable anti-CD70 CAR NK cells (iCas9 / CD27 CAR / IL-15) (Annexin V negative and live / dead negative) after thawing, assessing the recovery of NK cells treated with various kinase inhibitors before freezing. (B) t-SNE analysis of thawed iC9 / CD27 CAR / IL-15-NK cells (CAR) pretreated with tyrosine kinase inhibitors (dasatinib (D), bosutinib (B), nilotinib (N), or saracatinib (S)) before cryopreservation. Controls included untreated cryopreserved CAR NK cells. Cells were assessed by CyTOF after thawing and combined to create a single t-SNE CUDA map (12,000 from two pooled donors per condition). FlowSOM analysis was then performed for the various conditions, and the various FlowSOM metaclusters overlapped on the t-SNE CUDA map. Each colored area corresponded to a metacluster (1–10). (C) Stacked bar graphs show the relative percentage frequencies of the various FlowSOM metaclusters for each of the CAR NK cell conditions. (D) Contour plot showing t-SNE CUDA cluster configuration (shown in 15B) for the various CAR NK cell conditions tested. (E) Representative heatmap showing expression levels of phenotypic and functional markers for thawed CAR-NK cells. The Z-score of expression level for each marker is represented on a color scale, with light red corresponding to maximum expression and dark blue corresponding to minimum expression. [Figure 15-2] Same as above. [Figure 15-3] Same as above. [Figure 15-4] Same as above. [Figure 15-5] Same as above.

[0039] [Figure 16-1] Figures 16A-16C show how the addition of various tyrosine kinase inhibitors prior to freezing enhances the antitumor cytotoxicity of thawed CAR-NK cells against solid tumors, as determined by the xCELLigence impedance assay. An ovarian cancer cell line (SKOV3) (A) and a renal cell carcinoma cell line (UMRC3) (B) were grown overnight in 96-well RTCA E-plates. The following day, frozen iC9 / CD27 CAR / IL-15-NK cells that were either not pretreated before cryopreservation or pretreated with tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib) were thawed and added at an effector-to-target (E:T) ratio of 2:1. Cancer cell proliferation was measured continuously over time (X-axis) by the xCELLigence device and expressed as a normalized cell index (Y-axis). As shown in (C), compared with frozen / thawed iC9 / CD27 CAR / IL-15-NK cells without pretreatment, frozen / thawed iC9 / CD27 CAR / IL-15-NK cells pretreated with the tyrosine kinase inhibitors dasatinib, nilotinib, or saracatinib exhibited increased cytotoxicity against SKOV3 and / or UMRC3 cells. [Figure 16-2] Same as above. [Figure 16-3] Same as above.

[0040] [Figure 17-1]Figures 17A-17C show how the addition of various tyrosine kinase inhibitors prior to freezing enhances the antitumor cytotoxicity of thawed TCR-NK cells against solid tumors, as determined by the xCELLigence impedance assay. A melanoma cell line (A375) (A) and an osteosarcoma cell line (Saos-2) (B) were grown overnight in 96-well RTCA E-plates. The following day, frozen NYESO-targeted TCR-NK cells, either untreated or pretreated with tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib) prior to cryopreservation, were thawed and added at an effector-to-target (E:T) ratio of 2:1. Cancer cell proliferation was measured continuously over time (X-axis) by the xCELLigence device and expressed as a normalized cell index (Y-axis). As shown in (C), compared with frozen / thawed NYESO-TCR-NK cells without pretreatment, frozen / thawed NYESO-TCR-NK cells pretreated with the tyrosine kinase inhibitors dasatinib, nilotinib, bosutinib, or saracatinib exhibited increased cytotoxicity against A375 and / or Saos-2 cells. [Figure 17-2] Same as above. [Figure 17-3] Same as above.

[0041] [Figure 18-1]Figures 18A-18B show how the addition of dasatinib before cryopreservation enhances the antitumor cytotoxicity of thawed NYESO-targeted TCR-NK cells against multiple myeloma cells, as shown by chromium release assay. (A) Multiple myeloma cells (U266) were labeled with chromium-51 and co-cultured with frozen and thawed NYESO-TCR-NK cells that were either untreated before cryopreservation or treated with various tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib) at various E:T ratios (2:1, 1:1, 0.5:1, or 0.25:1) before cryopreservation. After 4 hours, chromium release, corresponding to cancer cell death, was measured. (B) Compared to NYESO-TCR-NK cells frozen without pretreatment, frozen NYESO-TCR-NK cells pretreated with dasatinib showed increased cytotoxicity against U266 cells. [Figure 18-2] Same as above. DETAILED DESCRIPTION OF THE INVENTION

[0042] Detailed Description One limitation of using certain cryopreserved cells for clinical therapy is their low numbers and low post-thaw viability. In some embodiments, the present disclosure addresses both of these limitations by using a GMP-compliant strategy for ex vivo activation and / or expansion of cells and subsequent temporary inactivation of the cells prior to cryopreservation. Such inactivation prior to cryopreservation is performed by treatment with at least one inactivating agent, resulting in effector cells that can be stored in sufficiently high numbers. After thawing, the cells have improved viability, improved transgene expression, and / or improved cytotoxicity compared to their counterparts that are cryopreserved without inactivation and subsequently thawed. In certain embodiments, any of the methods disclosed herein demonstrate that this strategy can be applied to cells that have not undergone prior expansion and / or activation.

[0043] Accordingly, certain embodiments of the present disclosure provide methods and compositions for storing, e.g., preserving, clinical-grade cells, including clinical-grade cells intended for immunotherapy, including effector cells. Expanding and producing clinically relevant numbers of cells for patient infusion while meeting time constraints is an extremely challenging endeavor under the best of circumstances. The disclosed methods and compositions detail technical processes for cell preservation suitable for improving cell viability, cytotoxicity, and / or transgene expression levels compared to control counterparts not prepared using the methods described herein.

[0044] Further provided herein are methods for inactivating any type of mammalian cell in certain embodiments. In some embodiments, the mammalian cell can be of any type, including NK cells, T cells, B cells, NKT cells, macrophages and monocytes, gamma delta T cells, regulatory T cells, stem cells, induced pluripotent stem cells (iPSCs), or any type of immune cell, including iPSCs, MSCs, any cells derived from hematopoietic stem cells, differentiated or committed cells from any organ, and any fibroblasts. In certain embodiments, provided herein are methods for inactivating immune cells, such as effector cells. In either case, the mammalian cell may be used in adoptive cell therapy. In some embodiments, the cell is an NK cell. In some embodiments, the cell is not a T cell. In some embodiments, the cell is an NK cell comprising one or more transgenes. In some embodiments, the transgene is a chimeric antigen receptor (CAR), an engineered cytokine and / or a member of a cytokine signaling pathway, and / or a T cell receptor (TCR). In some embodiments, NK cells may be manually modified in one or more ways, such as, but not limited to, the introduction of one or more engineered antigen receptors, including, for example, a chimeric antigen receptor or a T cell receptor, or CD16, CD32, and / or CD64 receptors. In some embodiments, NK cells may express heterologous cytokines, such as IL-2, IL-4, IL-7, IL-12, IL-15, IL-18, IL-21, and / or IL-23. In some embodiments, NK cells may express a suicide gene. In certain embodiments, NK cells comprise a chimeric antigen receptor targeting a tumor antigen and a cytokine, such as IL-15, optionally with a suicide gene. In some embodiments, NK cells are gene-edited using any method. In some embodiments, NK cells are combined with monospecific, bispecific, and / or multispecific antibodies ex vivo or in vivo. In some embodiments, NK cells are activated and / or expanded, or used directly ex vivo without prior activation / expansion.

[0045] In certain embodiments, following cell inactivation, the cells are placed in a suitable cryopreservation medium (e.g., freezing medium). In some embodiments, the freezing medium may contain a cryoprotectant such as (but not limited to) dimethyl sulfoxide (DMSO), glycerin, glycerol, hydroxyethyl starch, or a combination thereof, a serum substitute such as (but not limited to) serum or platelet lysate from human, bovine, or other animal sources, one or more cytokines or growth factors including, but not limited to, IL-1, IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-22, interferon, tumor necrosis factor, stem cell factor, FLT3-ligand, APRIL, or a combination thereof. Serum is utilized as a source of growth factors, adhesion factors, hormones, lipids, and / or minerals, and / or in certain cases is used to regulate the permeability of cell membranes, acting as a carrier for lipids, enzymes, micronutrients, and trace elements into cells. In some embodiments, the freezing medium allows for improved success rates in freezing individual doses of cells with improved viability and functionality. In some embodiments, the cells are thawed on demand and infused into patients. That is, the inactivated and frozen cells provided herein are "off-the-shelf" cell therapies that can be thawed and infused into patients without the delay required for production.

[0046] The methods and compositions described herein eliminate the need to recruit donors for cell collection and provide cells to be stored as cell banks for any purpose, including adoptive cell therapy methods and immunotherapy, although this approach may also be used for cryopreservation of patient-directed autologous products.

[0047] It is contemplated that any embodiment discussed herein can be implemented with respect to any method or composition of the invention, and vice versa. Further, compositions of the invention can be used to achieve methods of the invention.

[0048] Following long-standing patent law practice, the words "a" and "an" herein, when used in conjunction with the word "comprising," including within the scope of the claims, refer to "one or more." Some embodiments of the present disclosure may consist of, or consist essentially of, one or more elements, method steps, and / or methods of the present disclosure. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein, and that different embodiments may be combined.

[0049] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method employed to determine the value, or the variation that exists in the study subjects.

[0050] As used herein, the terms "or" and "and / or" are utilized to describe multiple components that are combined or mutually exclusive. For example, "x, y, and / or z" can refer to "x" alone, "y" alone, "z" alone, "x, y, and z," "(x and y) or z," "x or (y and z)," or "x or y or z." It is specifically intended that x, y, or z can be specifically excluded from an embodiment.

[0051] Throughout this specification, unless the context dictates otherwise, the words "comprise," "comprises," and "comprising" are understood to mean the inclusion of the recited step or element or steps or elements, but not the exclusion of other steps or elements or steps or elements. "Consisting of" means including and limited to what follows the phrase "consisting of." Thus, the phrase "consisting of" indicates that the recited elements are required or essential, and that other elements may not be present. "Consisting essentially of" means including the elements recited after the phrase, limited to other elements that do not interfere with or contribute to the activity or function specified in the disclosure for the recited elements. Thus, the phrase "consisting essentially of" indicates that the recited elements are required or essential, but that other elements are optional and may or may not be present depending on whether they affect the activity or function of the recited elements.

[0052] As used herein, "essentially free" with respect to a specified component is used herein to mean that none of the specified components are intentionally formulated in the composition and / or are present only as contaminants or in trace amounts. Thus, the total amount of the specified component resulting from any unintentional inclusion of the composition is much less than 0.05%, preferably much less than 0.01%. Most preferred are compositions in which the specified component is completely undetectable by standard analytical methods.

[0053] Throughout this specification, references to "one embodiment," "an embodiment," "a particular embodiment," "a related embodiment," "an embodiment," "an additional embodiment," or "a further embodiment," or combinations thereof, mean that the particular feature, structure, or characteristic described in connection with the embodiment is included in at least one embodiment of the invention. Thus, the appearances of such phrases in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0054] As used herein, the term "inactivate" or "inactivated" refers to the process of or cells being induced into a less active state by exposure to one or more agents. Inactivated cells may also be considered "quiescent" or "resting" cells. Generally, as described herein, inactivation is a temporary process that can be reversed by removing the agent or agents that induced the inactivated state. Generally, inactivated cells will have reduced or altered levels of cytolytic activity, cytokine production, NK cell proliferation, and / or one or more cytotoxic markers, such as, but not limited to, CD95, NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS, CCR5, CD62L, CXCR4, and / or C-kit, compared to non-inactivated cells.

[0055] As used herein, the term "engineered" refers to an entity created by the hand of man, including cells, nucleic acids, polypeptides, vectors, etc. In at least some cases, the engineered entity is synthetic and comprises elements that do not occur in nature or are not constructed by the methods utilized in this disclosure. In specific embodiments, the vector is engineered by recombinant nucleic acid techniques and the cell is engineered by transfection or transduction of the engineered vector.

[0056] "Immune disorder," "immune-related disorder," or "immune-mediated disorder" refers to a disorder in which the immune response plays a significant role in the development or progression of the disease. Immune-mediated disorders include autoimmune disorders, allograft rejection, graft-versus-host disease, and inflammatory and allergic conditions.

[0057] An "immune response" is a response of a cell of the immune system, such as a B cell or T cell, or an innate immune cell, to a stimulus. In one embodiment, the response is specific for a particular antigen (an "antigen-specific response").

[0058] "Autoimmune disease" refers to a disease in which the immune system produces an immune response (e.g., a B cell or T cell response) against antigens that are part of the normal host (i.e., self-antigens), resulting in tissue damage. Self-antigens can originate from host cells or from commensal organisms, such as microorganisms that normally colonize mucosal surfaces (known as commensals).

[0059] As used herein, the terms "load," "loaded," or "loading" refer to adoptive cell therapy cells that have one or more antibodies bound to the cells on their surface.

[0060] As used herein, the terms "preload," "preloaded," or "preloaded" refer to adoptive cell therapy cells in which one or more antibodies have bound to the cells on their surface prior to using the cells for any reason.

[0061] The phrases "pharmaceutically or pharmacologically acceptable" refer, as appropriate, to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to an animal, such as a human. The preparation of pharmaceutical compositions containing an antibody or additional active ingredient will be known to those of skill in the art in light of the present disclosure. Furthermore, it will be understood that when administered to an animal (e.g., a human), preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by the FDA Office of Biological Standards.

[0062] As used herein, "pharmaceutically acceptable carriers" include any and all aqueous solvents (e.g., parenteral vehicles such as water, alcoholic / aqueous solutions, saline, sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters such as ethyl oleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, antioxidants, chelating agents, and inert gases), isotonicity agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, fluid and nutrient replenishers, and such materials and combinations thereof will be known to those skilled in the art. The pH and exact concentration of the various components in the pharmaceutical composition are adjusted according to well-known parameters.

[0063] As used herein, the terms "preactivation" or "preactivated" refer to exposure of NK cells to IL-12, IL-15 or IL-2, and / or IL-18, resulting in an increase in signaling pathways associated with NK cell effector function, such as IFN-γ response, TNF signaling, IL-2 / STAT5 signaling, IL-6 / JAK / STAT3 signaling, the mTOR pathway, and / or enrichment of genes associated with inflammatory immune responses. In certain cases, there is increased expression of TRAIL, NKp44, and / or CD69.

[0064] As used herein, "prevent" and similar terms such as "prevented," "preventing," and the like refer to an approach for preventing, inhibiting, or reducing the likelihood of occurrence or recurrence of a disease or condition, such as cancer. It also refers to delaying the onset or recurrence of a disease or condition, or delaying the onset or recurrence of symptoms of a disease or condition. As used herein, "prevention" and similar terms also include reducing the intensity, impact, symptoms, and / or burden of a disease or condition prior to the onset or recurrence of the disease or condition.

[0065] The terms "subject," "patient," and "individual" may be used interchangeably and may refer to humans or non-humans, such as primates, mammals, and vertebrates. In certain embodiments, the subject is a human. A subject may be any organism or animal subject that is the object of a method or material, including mammals, such as humans, laboratory animals (e.g., primates, rats, mice, rabbits), livestock (e.g., cows, sheep, goats, pigs, turkeys, and chickens), domestic pets (e.g., dogs, cats, and rodents), horses, and transgenic non-human animals. A subject may be a patient, such as a patient having or suspected of having a disease (which may be referred to as a medical condition), such as one or more infectious diseases, one or more genetic disorders, one or more cancers, or any combination thereof. A "subject" or "individual," as used herein, may or may not be housed in a medical facility and may be treated as an outpatient in a medical facility. An individual may receive one or more medical compositions via the internet. An individual may include a human or non-human animal of any age, and thus includes adults, juveniles (e.g., children), and infants, including individuals in utero. A subject may or may not be in need of medical treatment. An individual may be willingly or involuntarily part of an experiment in support of clinical or basic scientific research.

[0066] "Treatment" or treatment of a disease or condition refers to carrying out a protocol that may include administering one or more drugs or cell therapy products to a patient in an effort to alleviate the signs or symptoms of the disease. Desirable effects of treatment include slowing the rate of disease progression, amelioration or reduction of the disease state, and remission or improved prognosis. Alleviation can occur before signs or symptoms of the disease or condition appear, as well as after they appear. That is, "treating" or "treatment" can include "preventing" or "prevention" of a disease or undesirable condition. Furthermore, "treating" or "treatment" does not require complete alleviation of signs or symptoms, does not require a cure, and specifically includes protocols that have only a marginal effect on the patient.

[0067] The term "therapeutic benefit" or "therapeutically effective" as used throughout this application refers to anything that promotes or enhances the well-being of a subject with respect to the medical treatment of the condition. This includes, but is not limited to, reducing the frequency or severity of signs or symptoms of a disease. For example, treating cancer can include, for example, complete eradication of a tumor, reducing the size of a tumor, reducing the invasiveness of a tumor, reducing the rate of cancer growth, or preventing metastasis. Treating cancer can also refer to extending the survival of a subject with cancer.

[0068] The term "antigen-presenting cell (APC)" refers to a class of cells that can present one or more antigens in the form of peptide-MHC complexes that can be recognized by specific effector cells of the immune system, thereby eliciting an effective cellular immune response against the presented antigens. The term "APC" encompasses intact whole cells, such as macrophages, B cells, endothelial cells, activated T cells, dendritic cells, cell lines (e.g., K562), or naturally occurring or synthetic molecules capable of presenting antigens, such as purified MHC class I molecules complexed with β2-microglobulin.

[0069] II. Cell Inactivation and Cryopreservation Any type of cell can be inactivated and subsequently cryopreserved as described herein. The cell can be mammalian, and in certain embodiments and cases, the cell is a mammalian cell used for research and / or therapy. The cell can be an immune cell, and in certain cases, including an immune cell used for adoptive cell therapy. Such cells may or may not be NK cells, T cells, NKT cells, B cells, macrophages or monocytes, stem cells, induced pluripotent stem cells (iPSCs), or any cells derived from iPSCs, MSCs, hematopoietic stem cells, differentiated or committed cells from any organ, any fibroblasts, etc. In certain embodiments, the cells are NK cells. Cells are obtained from an individual, cryopreserved using media encompassed herein, and then thawed and used in that individual and / or one or more other individuals. Cells are obtained from an individual, engineered to contain one or more features, inactivated and cryopreserved as described herein, and used in that individual and / or one or more other individuals.

[0070] A first plurality of cells from one collection of cells can be inactivated and cryopreserved using one or more specific inactivating agents and one or more specific cryopreservation media described in the art, while optionally, a second plurality of cells from the same collection of cells can be inactivated and cryopreserved using one or more different inactivating agents and a different cryopreservation medium. Such practices may or may not be adopted depending on the use of the cells, the number and / or viability of the cells, etc. Exemplary cryopreservation medium solutions are described in International Publication WO2021041399, "Cell cryopreservation medium," which is incorporated herein by reference for the purposes described herein.

[0071] In certain embodiments, cells are inactivated and cryopreserved as described herein substantially immediately after their collection (e.g., isolation) from one or more individuals or from one or more sources (e.g., cryopreserved blood banks). In some embodiments, cells inactivated and cryopreserved as described herein are inactivated and cryopreserved after culture and / or expansion. In some embodiments, cells are preactivated and / or inactivated as described herein prior to inactivation and cryopreservation. Following expansion and / or activation, the cells (e.g., immune cells) may be immediately manipulated for a later purpose (e.g., infusion) or inactivated and preserved (e.g., by cryopreservation). In certain aspects, cells may be expanded ex vivo as a bulk population for days, weeks, or months within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or more days after cell collection (e.g., cell isolation).

[0072] In certain embodiments, a complete medium change may need to be performed on the cells prior to inactivation and / or cryopreservation. In some embodiments, a complete medium change may need to be performed on the cells prior to inactivation and / or cryopreservation based on the viable cell concentration. In some embodiments, a complete medium change is required when the viable cell concentration is at least about 1 x 10 4 , 1×10 5 , 1×10 6 , 1×10 7 , or 1 × 10 8 If the cells / mL, a complete medium change may need to be performed on the cells prior to inactivation and / or cryopreservation. In some embodiments, a complete medium change is performed to ensure a viable cell concentration of at least about 1 x 10 6cells / mL, may need to be performed on the cells prior to inactivation and / or cryopreservation. In some embodiments, the cell culture medium may be replaced with warm complete medium. In some embodiments, the warm complete medium comprises any one, any combination, or all of RPMI, Clicks, and human AB serum. In some embodiments, the warm complete medium may be warmed to 37°C for at least about 5 minutes, 10 minutes, 15 minutes, 20 minutes, or 25 minutes prior to the medium change. In some embodiments, the warm complete medium may be warmed to 37°C for at least about 15 minutes prior to the medium change.

[0073] In certain embodiments, a complete medium change may not be performed for cells prior to inactivation and / or cryopreservation. In some embodiments, a complete medium change is performed when the viable cell concentration is about 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 , or 1 × 10 8 In some embodiments, a complete medium change may not be performed for cells prior to inactivation and / or cryopreservation if the viable cell concentration is less than about 1 x 10 cells / mL. 6 cells / mL or less, it may not be necessary to perform this procedure on the cells prior to inactivation and / or cryopreservation.

[0074] In certain embodiments, the cells for inactivation and / or cryopreservation are NK cells. In certain embodiments, the surface antigen of the NK cells may be CD16, CSI, CD56, NKG2D, NKG2C, or any c-type lectin, costimulatory molecule, such as DNAM, 2B4, CD2, NCR, or KIR. In some embodiments, the source of NK cells is derived from umbilical cord blood (CB). In some embodiments, the source of umbilical cord blood is umbilical cord blood from a single donor or pooled from cord blood units of two or more individuals. CB may be pooled from cord blood units of 3, 4, 5, 6, 7, or 8 individuals. In some embodiments, the NK cells (which may be CD56+) may be derived from cord blood mononuclear cells, from umbilical cord blood, from hematopoietic stem cells of bone marrow or peripheral blood, from iPSCs, from peripheral blood, or from an NK cell line. In some embodiments, the source of NK cells may be a fresh source or a cryopreserved reservoir. In some cases, when the NK cells are from a cryopreserved source, the NK cells are cryopreserved in a medium comprising at least one cryoprotectant, at least one serum or non-serum substitute for serum.

[0075] In certain embodiments, the inactivating agent may have a pharmacological effect on the activity of the cell. See, e.g., Mestermann K, Giavridis T, Weber J, et al., The tyrosine kinase inhibitor Dasatinib acts as a pharmacologic on / off switch for CAR T cells. Sci Transl Med. 2019;11(499); and / or Weber EW, Lynn RC, Sotillo E, Lattin J, Xu P, Mackall CL. Pharmacologic control of CAR-T cell function using Dasatinib. Blood Adv. 2019;3(5):711-717, each of which is incorporated herein by reference for purposes described herein.

[0076] In certain embodiments, the inactivating agent is washed off the cells one or more times prior to cryopreservation.

[0077] A.NK cells In some embodiments, the cells are immune cells. In certain embodiments, the cells are NK cells. In certain embodiments, the cells are untransduced NK cells (e.g., NK cells not transduced with a construct). In certain embodiments, the cells are transduced NK cells (e.g., NK cells transduced with a construct encoding a functional molecule, e.g., a CAR, a TCR, a cytokine, etc.). NK cells have emerged as an exciting source of cellular immunotherapy for patients with hematological malignancies and solid tumors. However, most studies using adoptively transferred, fresh NK cells have been limited by inadequate persistence, insufficient in vivo expansion, and disappointing anti-tumor activity of the infused cells. Thus, an obstacle to overcome in the field of NK immunotherapy is the need for a biological approach to increase NK cell availability while maintaining and / or improving anti-tumor functionality, e.g., by manipulating the cells before administration as a therapy. Accordingly, in certain embodiments, the present disclosure provides methods for the expansion and / or activation, inactivation, and optional preservation of NK cells with any type of increased efficacy compared to unmanipulated NK cells. Some embodiments of the present disclosure relate to the isolation, activation, expansion, inactivation, cryopreservation, thawing, and use of NK cells, including for the immunotherapy of cancer.

[0078] In certain embodiments, the present disclosure encompasses NK cells that are (optionally) loaded, (optionally) preactivated, (optionally) expanded, then inactivated and (optionally) stored as described herein. In some embodiments, such cells exhibit enhanced anti-tumor functionality against cancer. In some embodiments, such cells exhibit enhanced antibody-dependent cellular cytotoxicity (ADCC). In some embodiments, such cells exhibit enhanced transgene expression. In some embodiments, such cells exhibit enhanced survival. In some embodiments, such cells may have reduced expression of one or more genes.

[0079] In certain embodiments, the NK cells described herein may be derived from any suitable source, such as umbilical cord blood (CB), which contains human CB. Notably, the NK cells are not derived from umbilical cord tissue (the insulating substance surrounding the blood vessels of the umbilical cord (i.e., Wharton's jelly)). In alternative embodiments, the NK cells are derived from human peripheral blood mononuclear cells (PBMCs), unstimulated leukocyte products (PBSCs), human embryonic stem cells (hESCs), induced pluripotent stem cells (iPSCs), and / or bone marrow, or from umbilical cord blood, bone marrow, or peripheral blood hematopoietic stem cells, or from patient-derived NK cell lines such as NK-92, by methods well known in the art. In certain embodiments, the NK cells are isolated from pooled CB. CB may be pooled from 2, 3, 4, 5, 6, 7, 8, 9, 10, or more units. The NK cells may be autologous or allogeneic with respect to the recipient individual. The isolated NK cells may or may not be haplotype-matched to the subject receiving cell therapy. NK cells may or may not be detectable by specific surface markers, such as CD16 and / or CD56 in humans. In some cases, NK cells may or may not be depleted for the presence of one or more surface markers, such as depletion for CD3+, CD14+, and / or CD19+ cells. In certain embodiments, the NK cells are CD3- CD56+.

[0080] In certain embodiments, NK cells are isolated by the previously described ex vivo expansion method of NK cells (Spanholtz et al., 2011; Shah et al., 2013). In this method, CB mononuclear cells are isolated by Ficoll density gradient centrifugation. This cell culture may be depleted of CD3-expressing cells and characterized by determining the ratio of CD56+ / CD3- cells or NK cells. In other methods, umbilical CB is used to isolate CD34+ cells and induce NK cells.

[0081] B. Activator In some embodiments, the cells are expanded and / or activated prior to inactivation. Expanding and / or activating the cells can be by any suitable means known in the art.

[0082] In certain embodiments, NK cells are expanded in a specific manner and optionally preactivated in a specific manner. For example, NK cells are expanded in the presence of specific antigen-presenting cells under specific culture conditions, with the NK cells optionally being exposed to one or more cytokines as a preactivation step. In some embodiments, following cell isolation, the cells are preactivated with a cytokine cocktail. In some embodiments, the cytokine cocktail includes one or more of IL-2, IL-12, IL-15, and / or IL-18, or any combination thereof.

[0083] In some embodiments, NK cells are preactivated before optional expansion and / or further activation, and inactivation and / or storage. The preactivation step may or may not occur before any expansion step. In certain embodiments, NK cells are preactivated with one or more cytokines, and in certain embodiments, NK cells are preactivated with a plurality, including one or two, three, or more of IL-12, IL-15, IL-2, and IL-18. If less than all three of IL-12, IL-15, and IL-18 are utilized, it may be IL-12 and IL-15 but not IL-18, IL-12 and IL-18 but not IL-15, or IL-15 and IL-18 but not IL-12. IL-15 may or may not be replaced with IL-2.

[0084] In some embodiments, the preactivation cytokines are IL-12, IL-15, and IL-18. One or more additional cytokines may be used in the preactivation step. Preactivation may be for a short period of time, such as 5 to 72 hours, e.g., 10 to 50 hours, particularly 10 to 20 hours, e.g., 12, 13, 14, 15, 16, 17, 18, 19, or 20 hours, and may be, in some cases, approximately 16 hours. In some embodiments, the preactivation culture may contain IL-18 and / or IL-15 at a concentration of 10 to 100 ng / mL, e.g., 40 to 60 ng / mL, particularly 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 ng / mL, particularly about 50 ng / mL. In some cases, the pre-activation culture comprises IL-12 at a concentration of 0.1 to 150 ng / mL, including a concentration of 1 to 20 ng / mL, e.g., 10 ng / mL. In alternative embodiments, NK cells may be stimulated with IL-2 or other cytokines that bind to the common gamma chain (e.g., IL-7, IL-21, and others), which may be in addition to or as a replacement for one or more of IL-12, IL-15, and IL-18. In such cases, the pre-activation culture may comprise IL-12 at a concentration of 0.1 to 150 ng / mL, e.g., 0.5 to 50 ng / mL, particularly 1 to 20 ng / mL, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 ng / mL, particularly about 10 ng / mL.

[0085] In certain embodiments, following optional preactivation, NK cells are expanded to increase their quantity prior to inactivation and / or storage. The expanded cells may or may not be derived from preactivated NK cells, such that the preactivation step may occur before the expansion step. The NK cell expansion step may be of any suitable length such that the NK cell population expands, but in certain cases, the expansion step utilizes a specific reagent or reagents to enhance expansion, e.g., during culture. In certain cases, the NK cells do not need to be expanded. IL-2, IL-15, IL-18, or any combination of cytokines may be added to the expansion culture before or during expansion. In some embodiments, NK cells can be expanded ex vivo in flasks. In some embodiments, NK cells can be expanded ex vivo in several different bioreactor configurations with continuous perfusion of media / additives.

[0086] In some embodiments, NK cells (whether preactivated or not) may be washed (e.g., with PBS, Plasma Lyte, human serum albumin, or culture medium, or a combination thereof) prior to and / or after expansion, e.g., 2, 3, 4, or 5 times, particularly 3 times. In certain embodiments, NK cells are expanded in the presence of feeder cells and / or artificial antigen-presenting cells (APCs), e.g., universal artificial antigen-presenting cells (uAPCs) and / or artificial antigen-presenting cells (aAPCs). The aAPCs may be engineered to express CD137 ligand and / or membrane-bound cytokines. The membrane-bound cytokine may be membrane-bound IL-21 (mIL-21) or membrane-bound IL-15 (mIL-15). In certain embodiments, the aAPCs are engineered to express CD137 ligand and mIL-21. The aAPCs are derived from cancer cells, e.g., leukemia cells. aAPCs may not express endogenous HLA class I, II, or CD1d molecules. They may express ICAM-1 (CD54) and LFA-3 (CD58) or CD48. In particular, aAPCs may be K562 cells, for example, K562 cells engineered to express CD137 ligand and mIL-21. Engineering may be by any method known in the art, for example, retroviral transduction, but may utilize any viral or non-viral vector. aAPCs may be irradiated or non-irradiated.

[0087] In some embodiments, antigen-presenting cells may be macrophages, B lymphocytes, and / or dendritic cells, which are distinguished by their expression of specific MHC molecules. APCs internalize antigens and re-express portions of the antigen along with MHC molecules on their outer cell membranes. MHC is a large genetic complex with numerous loci. MHC loci encode two major classes of MHC membrane molecules, termed class I and class II MHC. T helper lymphocytes generally recognize antigens associated with MHC class II molecules, while T cytotoxic lymphocytes recognize antigens associated with MHC class I molecules. MHC is referred to as the HLA complex in humans and the H-2 complex in mice.

[0088] In some cases, aAPCs are useful for preparing the therapeutic compositions and cell therapy products of the present embodiments. For general guidance on the preparation and use of antigen-presenting systems, see, for example, U.S. Patent Nos. 6,225,042, 6,355,479, 6,362,001, and 6,790,662, U.S. Patent Application Publication Nos. 2009 / 0017000 and 2009 / 0004142, and International Publication No. WO2007 / 103009.

[0089] In some embodiments, the APC system (e.g., uAPC and / or aAPC) may include at least one exogenous assisting molecule. Any suitable number and combination of assisting molecules may be employed. The assisting molecules may be selected from assisting molecules such as costimulatory molecules and adhesion molecules. Exemplary costimulatory molecules include CD86, CD64 (FcγRI), 41BB ligand, and IL-21. Adhesion molecules include carbohydrate-binding glycoproteins such as selectins, transmembrane glycoproteins such as integrins, calcium-dependent proteins such as cadherins, and single-pass transmembrane immunoglobulin (Ig) superfamily proteins such as intercellular adhesion molecules (ICAMs), which promote contact, for example, between cells or between cells and the matrix. Exemplary adhesion molecules include LFA-3 and ICAMs, such as ICAM-1. Techniques, methods, and reagents useful for the selection, cloning, preparation, and expression of exemplary accessory molecules, including costimulatory molecules and adhesion molecules, are exemplified, for example, in U.S. Patent Nos. 6,225,042, 6,355,479, and 6,362,001.

[0090] In some embodiments, expansion may occur over a specific period of time, e.g., about 2 to 30 days, e.g., 3 to 20 days, particularly 12 to 16 days, e.g., 12, 13, 14, 15, 16, 17, 18, or 19 days, specifically about 14 days. In some embodiments, the optionally preactivated NK cells and APCs may be present in a ratio of about 3:1 to 1:3, e.g., 2:1, 1:1, or 1:2, specifically about 1:2. In some embodiments, the expansion culture may further contain one or more cytokines that promote proliferation, e.g., IL-2. IL-2 may be present at a concentration of about 10 to 500 U / mL, e.g., 100 to 300 U / mL, specifically about 200 U / mL. IL-2 may be replenished during the expansion culture at a specific frequency, e.g., every 2 to 3 days. In some embodiments, APCs may be added to the culture at least a second time, e.g., on about day 7 of expansion. Any cytokine used in the preactivation and / or expansion steps may be a recombinant human cytokine.

[0091] In some embodiments, following expansion, the NK cells may be immediately inactivated, e.g., by treatment with one or more inactivating agents described herein. Following inactivation, the NK cells may be preserved, e.g., by cryopreservation. In certain aspects, the cells may be expanded ex vivo for days, weeks, or months as a bulk population within about 1, 2, 3, 4, or 5 days after cell isolation.

[0092] In certain embodiments, activated and / or expanded NK cells can secrete type I cytokines, such as interferon-γ, tumor necrosis factor-α, and granulocyte-macrophage colony-stimulating factor (GM-CSF), which activate innate and adaptive immune cells and other cytokines and chemokines. In some embodiments, measurement of these cytokines can be used to determine the activation status of NK cells. Additionally, other methods known in the art for determining NK cell activation may be used to characterize the NK cells of the present disclosure. In some embodiments, measurement of such markers can be used to determine the effectiveness of one or more inactivating agents and / or the phenotypic state of NK cell activation.

[0093] In some embodiments, with regard to certain preactivation and expansion aspects of the present disclosure, in certain embodiments, NK cells are preactivated with IL-12, IL-15, and IL-18, and then expanded by APCs. In some embodiments, the APCs are aAPCs, such as K562 cells, that express mIL-21 and CD137 ligand, providing highly potent cell products. In some embodiments, provided herein are NK cells suitable for long-term storage, e.g., by cryopreservation, for the treatment of various diseases, such as immunotherapy of patients with cancer. In an exemplary method, isolated NK cells are pre-activated for a short period, e.g., about 16 hours, with a combination of cytokines such as interleukin-12 (IL-12), IL-15, and / or IL-18, followed by expansion with APCs, and / or exogenous IL-2, IL-2 or IL-15 or IL-18, or any combination of cytokines, is added to the expansion culture for at least a second time, and following a suitable period of expansion, the NK cells are inactivated by treatment with an inactivating agent for a suitable period of time, and following inactivation, the NK cells can be preserved, e.g., by cryopreservation, and following cryopreservation, the NK cells can be thawed and utilized for any suitable downstream process, such as, but not limited to, immunotherapy and / or further manipulation (e.g., transformation, transduction, loading, etc.).

[0094] C. NK cell loading In some embodiments, the cells are optionally loaded with an agent, such as an antibody.

[0095] In certain embodiments, NK cells may be loaded in any particular manner, such as during culture, immediately prior to injection, and / or by in vivo addition, to produce, for example, NK cell-antibody complexes. Conditions are sufficiently suitable to allow an effective amount of antibody to bind to the surface of NK cells. When a monospecific antibody is used, the Fc region of the monospecific antibody binds to the NK cell, while the antigen-binding domain of the monospecific antibody is free to bind to its target antigen. When a multispecific antibody is used, one or more antigen-binding domains of the antibody bind to the surface of the NK cell, for example, through an antigen on the surface of the NK cell, while the other antigen-binding domain is free to bind to its target antigen. In the alternative case of using a multispecific antibody, one or more antigen-binding domains of the antibody may bind to one target antigen on the target cell, and one or more alternative antigen-binding domains of the antibody may bind to one or more alternative target antigens on the target cell.

[0096] In some embodiments, the culture conditions under which NK cells are loaded may or may not be of a specific type having one or more specific parameters. In certain embodiments, loading of NK cells occurs during culture at a specific temperature, such as 37°C, while in alternative embodiments, the temperature is 36°C or 38°C, or lower or higher. In some embodiments, the duration of the loading step may be any suitable time, such as from 1 minute to 24 hours or more. For example, the duration may be in the range of 1 minute to 24 hours, 1 minute to 18 hours, 1 minute to 12 hours, 1 minute to 6 hours, 1 minute to 1 hour, 30 minutes to 24 hours, 30 minutes to 18 hours, 30 minutes to 12 hours, 30 minutes to 6 hours, 30 minutes to 1 hour, 1 to 24 hours, 1 to 18 hours, 1 to 12 hours, 1 to 6 hours, 6 to 24 hours, 6 to 18 hours, 6 to 12 hours, 12 to 24 hours, 12 to 18 hours, or 18 to 24 hours. In some embodiments, the duration of the loading step can be about 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, or 48 hours or more, or any range derivable therein. In certain embodiments, the cell culture medium is a basal medium or a complex medium. In some cases, the culture may or may not include one or more reagents utilized during the preactivation and / or expansion steps. In certain embodiments, the culture includes one or more cytokines, including, for example, one or more of IL-12, IL-15, IL-2, and IL-18. In some embodiments, the culture includes any type of APC.

[0097] In some embodiments, an antibody is provided to an effective amount of an NK cell of the present disclosure, thereby producing a complex that is "chimeric antigen receptor-like." In some embodiments, the antigen-binding domain of the antibody binds to the NK cell through an antigen, e.g., a cell surface protein. In some embodiments, multiple antibodies are provided to multiple NK cells, thereby resulting in multiple cell / antibody complexes. In some embodiments, the antibody can be of any type, including monospecific, bispecific, or multispecific, and in certain cases, the antibody engages both the NK cell and the target antigen through the antigen-binding domain of the antibody (e.g., by engagers of the art that are fusion proteins consisting of two single-chain variable fragments (scFv) of different antibodies). In some embodiments, the antibody is monospecific, the antigen-binding domain of the antibody binds to a target antigen, such as a cancer antigen, and another portion of the antibody, e.g., the Fc region of the antibody, binds to the NK cell. In some embodiments, the antibody is multispecific, one or more antigen-binding domains of the antibody bind to the NK cell (e.g., through an NK cell surface antigen), and one or more antigen-binding domains of the antibody bind to one or more target antigens. In some embodiments, multispecific antibodies may be, for example, bispecific, trispecific, or tetraspecific. In some embodiments where the antibody is trispecific or tetraspecific, the additional antigen-binding domain may bind to other cells, such as stem cells.

[0098] In some embodiments, the antibody binds to any NK cell surface antigen on NK cells (which may or may not be a receptor), such as CD16 (including CD16a or CD16b), CD56, c-type lectins, such as NKG2D, NKG2C, costimulatory molecules, such as CS1, DNAM, 2B4, CD2, and NCR or KIR, redirecting the NK cells to targets, thereby increasing response and specificity against various tumors.

[0099] In some embodiments, the antibody may bind to any suitable antigen (e.g., an antigen described herein, such as those described as targets for CAR and / or TCR). In certain embodiments, the antibody targets EGFR. In certain embodiments, the antibody is bispecific and targets EGFR and c-MET.

[0100] In some embodiments, complex formation may be by any suitable means, provided that conditions are sufficient for the appropriate region of the antibody to bind to the appropriate surface region of the NK cell. In some embodiments, any particular culture medium may be utilized. In certain cases, Plasma-Lyte A and / or human serum albumin are utilized, while in other cases, these are not utilized. Once complexes are formed during culture, they may or may not be washed prior to inactivation or storage.

[0101] D. Inactivating Agents In some embodiments, the cells are inactivated by treating the cells with an inactivating agent. In some embodiments, the cells are inactivated by treating the cells with an inactivating agent under conditions suitable for the cells to be inactivated prior to storage, including but not limited to, cryopreservation.

[0102] In some embodiments, the inactivating agent comprises one or more kinase inhibitors. In some embodiments, the inactivating agent is a tyrosine kinase (TK) inhibitor. In some embodiments, the cells are NK cells, which are treated with an inactivating agent under conditions to produce inactivated NK cells. In some embodiments, the NK cells are treated with a TK inhibitor to produce inactivated NK cells. In some embodiments, the NK cells are treated with dasatinib to produce inactivated NK cells. In some embodiments, the NK cells are treated with dasatinib, nilotinib, imatinib, bosutinib, saracatinib, and / or an mTOR inhibitor (e.g., rapamycin, etc.) to produce inactivated NK cells. In some embodiments, the NK cells are not treated with bosutinib. In some embodiments, the NK cells are not treated with nilotinib. In some embodiments, the NK cells are not treated with saracatinib. In some embodiments, the NK cells are not treated with an mTOR inhibitor.

[0103] In some embodiments, the inactivating agent is an agent that can be removed after a suitable treatment period. In some embodiments, the inactivating effect of the inactivating agent is reversible by removing the inactivating agent. In some embodiments, after removing the inactivating agent, the cells (e.g., NK cells) can spontaneously reactivate without the addition of further inactivating agent. In some embodiments, the inactivating agent is removed by washing the inactivating agent; one of skill in the art will understand the steps necessary to perform cell culture, such as expanding cells, splitting cells, washing cells, etc. In some embodiments, the inactivating agent is removed prior to storage (e.g., cryopreservation) of the cells (e.g., NK cells). In some embodiments, the inactivating agent is removed after storage (e.g., cryopreservation) of the cells (e.g., NK cells).

[0104] In some embodiments, the cells (e.g., NK cells) comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57 , 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 hours, or any range denoted therein. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 16 hours. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 24 hours. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 36 hours. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 48 hours. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 60 hours. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 72 hours. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 84 hours. In certain embodiments, the NK cells are treated with the inactivating agent for more than, less than, or exactly about 96 hours. In certain embodiments, the NK cells are treated with the inactivating agent for about 24-96 hours, about 24-72 hours, about 24-48 hours, about 36-84 hours, or about 48-72 hours.

[0105] In some embodiments, the cells (e.g., NK cells) are treated with an inactivating agent after the cells have been cultured for at least about or about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, or 30 days. In some embodiments, the cells (e.g., NK cells) are treated with an inactivating agent after the cells have been cultured for at least about or about 11 days, 12 days, 13 days, 14 days, 15 days, or 16 days. In some embodiments, the cells (e.g., NK cells) are treated with an inactivating agent after the cells have been cultured for about 12 days. In some embodiments, the cells (e.g., NK cells) are treated with an inactivating agent after the cells have been cultured for about 13 days. In some embodiments, the cells (e.g., NK cells) are treated with an inactivating agent after the cells have been cultured for about 14 days. In some embodiments, the cells (e.g., NK cells) are treated with an inactivating agent after the cells have been cultured for about 15 days.

[0106] In certain embodiments, the inactivating agent is a kinase inhibitor. In some embodiments, the kinase inhibitor is a broad-spectrum kinase inhibitor that may have an inhibitory effect on two or more tyrosine kinases and / or serine / threonine kinases. In certain embodiments, the inactivating agent is a mammalian (mechanistic) target of rapamycin (mTOR) inhibitor. In certain embodiments, the mTOR inhibitor is rapamycin (also known as sirolimus), everolimus, and / or temsirolimus. In certain embodiments, the mTOR inhibitor is rapamycin. In certain embodiments, the inactivating agent is an FDA-approved kinase inhibitor (see, e.g., Robert Roskoski, "Properties of FDA-approved small molecule protein kinase inhibitors: A 2021 update," Pharmalogical Research, March 2021, incorporated herein by reference for purposes described herein). In certain embodiments, the inactivating agent is dasatinib. In certain embodiments, the inactivating agent is nilotinib.

[0107] In certain embodiments, the inactivating agent is a tyrosine kinase (TK) inhibitor. In certain embodiments, the TK inhibitor is selected from the group consisting of lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, nilotinib, dasatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, pexidartinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdafitinib, nintedanib, gilteritinib, midostaurin, tucatinib, neratinib, baricitinib, ruxolitinib, fedratinib, tofacitinib, ripretinib, selumetinib, binimetinib, cobimetinib, trametinib, upadacitinib, avapritinib, selpercatinib, cabozantinib, fostamatinib, larotrectinib, entrectinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, vandetanib, and / or sunitinib. In certain embodiments, the TK inhibitor is selected from the group consisting of lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, nilotinib, dasatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, pexidartinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdafitinib, nintedanib, gilteritinib, Not midostaurin, tucatinib, neratinib, baricitinib, ruxolitinib, fedratinib, tofacitinib, ripretinib, selumetinib, binimetinib, cobimetinib, trametinib, upadacitinib, avapritinib, selpercatinib, cabozantinib, fostamatinib, larotrectinib, entrectinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, vandetanib, and / or sunitinib.

[0108] In certain embodiments, the TK inhibitor is an anaplastic lymphoma kinase (ALK) inhibitor. In certain embodiments, the ALK inhibitor is lorlatinib, brigatinib, ceritinib, alectinib, and / or crizotinib. In certain embodiments, the ALK inhibitor is not lorlatinib, brigatinib, ceritinib, alectinib, and / or crizotinib.

[0109] In certain embodiments, the TK inhibitor is a breakpoint cluster tyrosine protein kinase ABL1 fusion (BCR-Abl) inhibitor. In certain embodiments, the BCR-Abl inhibitor is bosutinib, ponatinib, nilotinib, dasatinib, saracatinib, and / or imatinib. In certain embodiments, the TK inhibitor is dasatinib and / or nilotinib. In certain embodiments, the TK inhibitor is dasatinib. In certain embodiments, the BCR-Abl inhibitor is not bosutinib, ponatinib, nilotinib, dasatinib, saracatinib, and / or imatinib.

[0110] In certain embodiments, the TK inhibitor is a Bruton's tyrosine kinase (BTK) inhibitor. In certain embodiments, the BTK inhibitor is zanubrutinib, acalabrutinib, and / or ibrutinib. In certain embodiments, the BTK inhibitor is not zanubrutinib, acalabrutinib, and / or ibrutinib.

[0111] In certain embodiments, the TK inhibitor is a c-MET (a member of the MNNG HOS transforming gene family) inhibitor. In some embodiments, the c-MET inhibitor is capmatinib. In some embodiments, the c-MET inhibitor is not capmatinib.

[0112] In certain embodiments, the TK inhibitor is a colony-stimulating factor 1 receptor (CSFR1) inhibitor. In some embodiments, the CSFR1 inhibitor is pexidartinib. In some embodiments, the CSFR1 inhibitor is not pexidartinib.

[0113] In certain embodiments, the TK inhibitor is an epidermal growth factor receptor (EGFR) inhibitor.In certain embodiments, the EGFR inhibitor is dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, and / or afatinib.In certain embodiments, the EGFR inhibitor is not dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, and / or afatinib.

[0114] In certain embodiments, the TK inhibitor is a fibroblast growth factor receptor (FGFR) inhibitor.In certain embodiments, the FGFR inhibitor is pemigatinib, erdafitinib, and / or nintedanib.In certain embodiments, the FGFR inhibitor is not pemigatinib, erdafitinib, and / or nintedanib.

[0115] In certain embodiments, the TK inhibitor is a vascular endothelial growth factor receptor (VEGFR) inhibitor.In certain embodiments, the VEGFR inhibitor is gilteritinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, cabozantinib, and / or vandetanib.In certain embodiments, the VEGFR inhibitor is not gilteritinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, cabozantinib, and / or vandetanib.

[0116] In certain embodiments, the TK inhibitor is an fms-like tyrosine kinase 3 (FLT3) inhibitor. In certain embodiments, the FLT3 inhibitor is midostaurin. In certain embodiments, the FLT3 inhibitor is not midostaurin.

[0117] In certain embodiments, the TK inhibitor is a receptor tyrosine protein kinase erbB-2 (also known as HER2) inhibitor. In some embodiments, the HER2 inhibitor is tucatinib, lapatinib, afatinib, and / or neratinib. In some embodiments, the HER2 inhibitor is not tucatinib, lapatinib, afatinib, and / or neratinib.

[0118] In certain embodiments, the TK inhibitor is a Janus kinase 1, 2, and / or 3 (JAK) inhibitor. In some embodiments, the JAK inhibitor is baricitinib, ruxolitinib, fedratinib, and / or tofacitinib. In some embodiments, the JAK inhibitor is not baricitinib, ruxolitinib, fedratinib, and / or tofacitinib.

[0119] In certain embodiments, the TK inhibitor is a platelet-derived growth factor receptor (PDGFR) inhibitor. In certain embodiments, the PDGFR inhibitor is ripretinib, upadacitinib, and / or avapritinib. In certain embodiments, the PDGFR inhibitor is not ripretinib, upadacitinib, and / or avapritinib.

[0120] In certain embodiments, the TK inhibitor is a mitogen-activated protein kinase kinase 1 / 2 (MEK1 / 2) inhibitor. In some embodiments, the MEK1 / 2 inhibitor is selumetinib, binimetinib, cobimetinib, and / or trametinib. In some embodiments, the MEK1 / 2 inhibitor is not selumetinib, binimetinib, cobimetinib, and / or trametinib.

[0121] In certain embodiments, the TK inhibitor is a proto-oncogene tyrosine protein kinase receptor (RET) inhibitor.In certain embodiments, the RET inhibitor is alectinib, lenvatinib, selpercatinib, and / or cabozantinib.In certain embodiments, the RET inhibitor is not alectinib, lenvatinib, selpercatinib, and / or cabozantinib.

[0122] In certain embodiments, the TK inhibitor is a tyrosine protein kinase (SYK) inhibitor. In some embodiments, the SYK inhibitor is fostamatinib. In some embodiments, the SYK inhibitor is not fostamatinib.

[0123] In certain embodiments, the TK inhibitor is a Trk potassium uptake protein A, B, and / or C (TRKA / B / C) inhibitor. In some embodiments, the TRKA / B / C inhibitor is larotrectinib and / or entrectinib. In some embodiments, the TRKA / B / C inhibitor is not larotrectinib and / or entrectinib.

[0124] In certain embodiments, the TK inhibitor is a proto-oncogene tyrosine protein kinase ROS (ROS1) inhibitor. In some embodiments, the ROS1 inhibitor is crizotinib and / or entrectinib. In some embodiments, the ROS1 inhibitor is not crizotinib and / or entrectinib.

[0125] In certain embodiments, the TK inhibitor is an obesity / stem cell growth factor receptor Kit (KIT) inhibitor.In certain embodiments, the KIT inhibitor is ripretinib and / or imatinib.In certain embodiments, the KIT inhibitor is not ripretinib and / or imatinib.

[0126] In certain embodiments, the cells are about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 110, 111, 112, In some embodiments, the inactivating agent is treated with an inactivating agent at a concentration of 0, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nM, or any range of concentrations derivable therein. In certain embodiments, the cells comprise at least about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 100 μM, or any range of concentrations derivable therein. In certain embodiments, the cells are treated with an inactivating agent at a concentration of about 0.1-1, 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, or 190-200 nM.In certain embodiments, the cells are treated with an inactivating agent at a concentration of about 0.1-1, 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, or 190-200 μM. In certain embodiments, the cells are at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,050, 1,100, 1,150, 1,200, 1,250, 1,300, 1,350, 1,400, 1,450, 1,500, 1,550, 1,600, 1,650, and / or 1,700, 1,750, 1,800, 1,850, 1,900, 1,950, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, or 10,000 nM, or any range of concentrations derivable therein. In certain embodiments, the cells are at least about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,050, 1,100, 1,150, 1,200, 1,250, 1,300, 1,350, 1,400, 1,450, 1,500, 1,550, 1,600, 1,650, and treated with an inactivating agent at a concentration of 1,700, 1,750, 1,800, 1,850, 1,900, 1,950, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500, or 10,000 μM, or any range of concentrations derivable therein.

[0127] In certain embodiments, cells are inactivated by treating the cells with an inactivating agent. In some embodiments, cells are inactivated by treating the cells with an inactivating agent under conditions suitable for cell inactivation prior to storage, such as, but not limited to, cryopreservation. In some embodiments, the inactivating agent is at a concentration of at least about 2000, 1000, 500, 200, 100, 50, 40, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 mM, or any range therein. In some embodiments, the inactivating agent is at a concentration of at least about or about 11 mM. In some embodiments, the inactivating agent is at a concentration of at least about or about 10 mM. In some embodiments, the inactivating agent is at a concentration of at least about or about 9 mM. In some embodiments, the inactivating agent is in a suitable aqueous or non-aqueous solvent. In some embodiments, the inactivating agent is in a suitable non-aqueous solvent. In some embodiments, the inactivating agent is in DMSO. In some embodiments, the inactivating agent and / or any solvent is stored under refrigeration conditions.

[0128] In certain embodiments, cells are treated with an inactivation agent based on the total volume of cell culture. In some embodiments, at least about 0.001, 0.01, 0.05, 0.1, 0.15, 0.2, or 0.3 μL of inactivation agent is added to the cell culture for every 1 mL of cell culture volume. In some embodiments, at least about or about 0.05 μL of inactivation agent in DMSO at a concentration of at least about or about 10 mM is added to the cell culture for every 1 mL of cell culture volume. In some embodiments, at least about or about 0.1 μL of inactivation agent in DMSO at a concentration of at least about or about 10 mM is added to the cell culture for every 1 mL of cell culture volume. In some embodiments, at least about or about 0.15 μL of inactivation agent in DMSO at a concentration of at least about or about 10 mM is added to the cell culture for every 1 mL of cell culture volume. In some embodiments, cells are treated with an inactivating agent at a final concentration of at least about or about 0.05 μM, 0.1 μM, 0.5 μM, 1 μM, 5 μM, 10 μM, 50 μM, or 100 μM, or any range therein. In some embodiments, cells are treated with an inactivating agent at a final concentration of at least about or about 0.5 μM. In some embodiments, cells are treated with an inactivating agent at a final concentration of at least about or about 1 μM. In some embodiments, cells are treated with an inactivating agent at a final concentration of at least about or about 5 μM.

[0129] In certain embodiments, treatment of cells (e.g., NK cells) with an inactivating agent results in increased expression of one or more of C-kit, CCR-5, CD62L, and / or CXCR4, and / or decreased expression of one or more of NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS, and / or CD95, compared to activated NK cells. E. Cell Recovery for Cryopreservation

[0130] In some embodiments, following inactivation, the cells are harvested before being placed in cryopreservation medium for storage (eg, cryopreservation).

[0131] In certain embodiments, following inactivation, a wash medium may be used to wash cells. In some embodiments, the wash medium comprises an HSA PlasmaLyte-A buffer solution with an HSA concentration of about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, or 1.0%, or any range therein. The HSA PlasmaLyte-A buffer solution may be prepared by adding a desired amount of HSA at a concentration of about 25% to 1 L of PlasmaLyte-A. For example, in some embodiments, a 0.5% HSA PlasmaLyte-A buffer solution may be prepared by adding 20 mL of 25% HSA to 1 L of Plasma-Lyte A.

[0132] In certain embodiments, cells may be washed with wash medium under gentle, non-damaging conditions, such as centrifugation at low centrifugation speeds, with no or low brakes, and / or short centrifugation times. In some embodiments, different combinations of centrifugation parameters may be employed to achieve washing of cells while reducing the potential for damage to the cells, as will be understood by those skilled in the art. In some embodiments, centrifugation and handling of cells may be performed under sterile conditions using sterile containers and / or equipment.

[0133] In certain embodiments, the cells and culture medium may be subjected to one or more quality control tests. The one or more quality control tests may include the following aspects: cell count, cell viability, microorganisms (e.g., mycoplasma measured by PCR), viruses (e.g., adventitious viruses), cytokines (e.g., IL-15 and IL-15 by Elisa), immunophenotyping, endotoxin, vector copy number, replication-competent retrovirus (RCR, e.g., measured by QPCR), and / or remaining beads.

[0134] In certain embodiments, cells may be washed before being placed in cryopreservation medium. In some embodiments, an exemplary method for washing cells includes collecting cells from one or more cell culture flasks and pooling them into one or more appropriately labeled sterile centrifuge tubes, gently resuspending the pooled cell suspension, centrifuging the cells using gentle and / or non-damaging centrifugation settings, aseptically aspirating and discarding the supernatant, and gently resuspending the cell pellet using a suitable buffer (e.g., 0.5% HSA PlasmaLyte buffer), washing the cells, collecting a quality control sample, and calculating the viable total cells per mL and the viable total cell recovery after harvesting from the quality control count.

[0135] In certain embodiments, the cells may be placed in a cryopreservation medium, with or without washing. In some embodiments, the cell pellet may be collected by centrifugation using gentle and / or non-damaging centrifugation settings, and the cell pellet may be gently dispersed in a freezing medium and transferred to a refrigerator (e.g., at about 4°C) for a period of time.

[0136] F. Cryopreservation medium In some embodiments, following inactivation and / or recovery, the cells are placed in cryopreservation medium for storage (eg, cryopreservation).

[0137] In certain embodiments, at least one cytokine and / or at least one growth factor may be added to the cryopreservation medium. In some embodiments, the cryoprotectant may be dimethyl sulfoxide (DMSO), glycerin, glycerol, hydroxyethyl starch, dextran trehalose, or a combination thereof. In some embodiments, the non-serum substitute may include platelet lysate and / or blood product lysate, or human or animal serum albumin. In some cases, the at least one cytokine (which may be interleukin (IL)-1, IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-22, IL-23, interferon, tumor necrosis factor, stem cell factor, FLT3-ligand, APRIL, thrombopoietin, erythropoietin, or a combination thereof) is a natural protein, a recombinant protein, a synthetic protein, or a mixture thereof.

[0138] In certain embodiments, a cryopreservation medium suitable for cryopreserving the inactivated cells of the present disclosure may contain dimethyl sulfoxide (DMSO), serum (including human serum), and any type of one or more cytokines. In certain embodiments, any one or more components of the cryopreservation medium are natural proteins, also referred to as endogenous or recombinant proteins. In certain cases, the endogenous proteins are one or more cytokines. The cryopreservation medium may contain one or more FDA-approved drugs, which may in certain cases be one or more cytokines.

[0139] In certain embodiments, the cryopreservation medium composition comprises, consists of, or consists essentially of at least one cryoprotectant, at least one serum (or non-serum serum substitute), and at least one cytokine and / or at least one growth factor. Examples of cryoprotectants include dimethyl sulfoxide (DMSO), glycerin, glycerol, hydroxyethyl starch, or a combination thereof. For the composition, the non-serum substitute includes platelet lysate and / or blood product lysate and / or human serum albumin and / or animal serum albumin. The human serum may be human AB serum. Any cytokine may be a natural protein, a recombinant protein, a synthetic protein, or a combination thereof, including at least one cytokine that is a Food and Drug Administration (FDA)-approved cytokine. In certain cases, the composition includes two or more cytokines. By way of example only, the at least one cytokine is IL-1, IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-22, interferon, tumor necrosis factor, stem cell factor, FLT3-ligand, APRIL, or a combination thereof.

[0140] In certain cases, the one or more cytokines include IL-2, IL-15, IL-12, IL-18, and / or IL-21. The cells are incubated in a solution of DMSO (e.g., 1-10%, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10%, particularly 5%), 95% The cells may be suspended in GMP cryopreservation medium containing human AB serum (e.g., 90-99%, for example 91, 92, 93, 94, 95, 96, 97, 98, or 99%, particularly 95%), platelet lysate (e.g., 90-99%, for example 91, 92, 93, 94, 95, 96, 97, 98, or 99%, particularly 95%), IL-2 (e.g., 50-500 U / mL, for example 100, 200, 300, 400, 500, 1000, or 5000 U / mL, particularly 400 U / mL), IL-15 (5-500 ng / mL), and / or IL-21 (e.g., 1-500 ng / mL, for example 10, 20, 30, 40, 50, 100, or 500 ng / mL, particularly 20 ng / mL). In certain cases, cells are frozen in liquid nitrogen using a rate-controlled method.

[0141] In certain embodiments, the cryoprotectant comprises a specific amount of the composition. In certain aspects, the cryoprotectant comprises 4-6% of the composition or 5-10% of the composition. In certain cases, the cryoprotectant comprises 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9, or 9-10% of the composition. The serum may comprise a particular amount of the composition, for example, 5-99, 5-90, 5-85, 5-80, 5-75, 5-70, 5-65, 5-60, 5-55, 5-50, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 10-99, 10-90, 10-85, 10-80, 10-75, 10-70, 10-65, 10-60, 10-55, 10-50, 10-45, 10-40, 10-35, 10-30, 10-25, 10-20, 10-15, 25-99, 25-90, 25-85, 25-08, 25-75, 25-70, 25-65, 25-60, 25-55, 25-50, 25-45, 25-40, 25-35, 25-30, 50-99, 50-90, 50-85, 50-80, 50-75, 50-70, 40-65, 50-60, or 50-55%. The platelet lysate may comprise a certain amount of the composition, for example, 5-99, 5-90, 5-85, 5-80, 5-75, 5-70, 5-65, 5-60, 5-55, 5-50, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 10-99, 10-90, 10-85, 10-80, 10-75, 10-70, 10-65, 10-60, 10-55, 10-50, 10- In certain embodiments, the platelet lysate comprises 45%, 10-40, 10-35, 10-30, 10-25, 10-20, 10-15, 25-99, 25-90, 25-85, 25-08, 25-75, 25-70, 25-65, 25-60, 25-55, 25-50, 25-45, 25-40, 25-35, 25-30, 50-99, 50-90, 50-85, 50-80, 50-75, 50-70, 40-65, 50-60, or 50-55% of the composition.

[0142] In embodiments where the composition comprises IL-2, this may be present at a concentration including 1-5000, 1-4000, 1-3000, 1-2000, 10-1000, 100-5000, 100-4000, 100-3000, 100-1000, 100-1000, 100-500, 500-5000, 500-4000, 500-3000, 500-2000, 500-1000, 1000-5000, 1000-4000, 1000-3000, 1000-2000, or 2000-5000 U / mL, particularly 100, 200, 300, 400, or 500 U / mL. In embodiments where the composition comprises IL-21, it may be present at a concentration of 10-3000, 10-2500, 10-2000, 10-1000, 10-500, 100-3000, 100-2000, 100-1000, 500-3000, 500-2000, 500-1000, or 1000-3000 ng / mL, and particularly at a concentration of 10, 15, 20, or 25 ng / mL. In certain cases, IL-15 is present in the composition at a concentration of 10-2000, 10-1000, 10-500, 100-2000, 100-1000, 100-500, 500-2000, 500-1000, or 1000-2000 ng / mL.

[0143] For cryopreservation, in one example, inactivated cells (e.g., NK cells for adoptive therapy, including umbilical cord blood NK cells) may be suspended in GMP cryopreservation medium, e.g., containing 5% DMSO, 95% human AB serum, 400 units / ml IL-2, and 20 ng / ml IL-21. They may be frozen using dry ice, liquid nitrogen, or a non-liquid nitrogen freezer, e.g., by rapid freezing, controlled-rate freezing (e.g., using a controlled-rate freezer), and / or non-controlled-rate freezing. In some embodiments, after freezing, the inactivated cells may be stored in the vapor phase of a liquid nitrogen storage unit.

[0144] In some embodiments, the cryopreservation medium comprises glucose, a pH indicator, one or more salts, one or more amino acids, and one or more vitamins. Examples of pH indicators include at least phenol red, bromophenol blue, methyl orange, bromocresol purple, Congo red, etc. Examples of salts include at least sodium chloride, sodium bicarbonate, disodium phosphate, potassium chloride, magnesium sulfate, calcium nitrate, or a combination thereof. Examples of amino acids include glutamine, arginine, asparagine, cysteine, leucine, isoleucine, lysine, serine, aspartic acid, glutamic acid, hydroxyproline, proline, threonine, tyrosine, valine, histidine, methionine, phenylalanine, glycine, tryptophan, reduced glutathione, or a combination thereof. In some embodiments, one or more amino acids may be present in greater amounts than one or more other amino acids in the medium, while the other amino acids may be present in equal amounts in the medium. For example, glutamine may or may not be present in the greatest amount in the medium, followed by arginine. Asparagine, cysteine, leucine, isoleucine, or a combination thereof may or may not be present in substantially the same amount in the medium. Aspartic acid, glutamic acid, hydroxyproline, proline, threonine, tyrosine, valine, or a combination thereof may or may not be present in substantially the same amount in the medium. Histidine, methionine, phenylalanine, or a combination thereof may or may not be present in substantially the same amount in the medium. One or more specific vitamins may be present in the medium, such as i-inositol, choline chloride, para-aminobenzoic acid, folic acid, nicotinamide, pyridoxine hydrochloride, thiamine hydrochloride, calcium pantothenate, biotin, riboflavin, cyanocobalamin, or a combination thereof. Vitamins may or may not be present in a specific amount in the medium. For example, i-inositol may be present in the largest amount, followed by choline chloride.In some cases, certain vitamins, including para-aminobenzoic acid, folic acid, nicotinamide, pyridoxine hydrochloride, thiamine hydrochloride, or a combination thereof, may be substantially equal in the medium. Biotin and riboflavin may or may not be present in essentially equal amounts in the medium. Cyanocobalamin may be present in the smallest amount of any vitamin in the medium, or may not be present at all.

[0145] In some embodiments, the cells may be cultured in a medium substantially similar to or identical to RPMI 1640 medium, also known as RPMI medium, which is a growth medium developed by Moore et al. at Roswell Park Memorial Institute (Moore GE, Gerner RE, Franklin HA (1967). "Culture of normal human leukocytes". JAMA. 199(8):519-524).

[0146] In a specific example, one liter of RPMI 1640 contains the following: glucose (2 g), pH indicator (phenol red, 5 mg), salts (sodium chloride 6 g, sodium bicarbonate 2 g, disodium phosphate 1.512 g, potassium chloride 400 mg, magnesium sulfate 100 mg, and calcium nitrate 100 mg), amino acids (glutamine 300 mg, arginine 200 mg, asparagine, cystine, leucine, and isoleucine 50 mg each, lysine hydrochloride 40 mg, serine 30 mg, aspartic acid, glutamic acid, hydroxyproline, proline, threonine, It contains or consists of: 20 mg each of tyrosine and valine, 15 mg each of histidine, methionine, and phenylalanine, 10 mg of glycine, 5 mg of tryptophan, and 1 mg of reduced glutathione, and vitamins (35 mg of i-inositol, 3 mg of choline chloride, 1 mg each of para-aminobenzoic acid, folic acid, nicotinamide, pyridoxine hydrochloride, and thiamine hydrochloride, 0.25 mg of calcium pantothenate, 0.2 mg each of biotin and riboflavin, and 0.005 mg of cyanocobalamin).

[0147] In certain embodiments, the compositions comprise one or more of: (a) platelet lysate, PlasmaLyte, and Roswell Park Memorial Institute (RPMI) medium; (b) one or more of dextran, albumin, and DMSO, which may be formulated in dextrose or saline (for example); and (c) one or more of IL-2, IL-15, and IL-21. In certain embodiments, any composition comprises platelet lysate at 50%-90%, about 50%, or about 90% of the composition. When PlasmaLyte is utilized, it may comprise about 32.5%-70%, or about 32.5%, 35%, 50%, or 70% of the composition. RPMI may comprise 32.5%-50%, or about 32.5%, 35%, or 50% of the composition. When dextran is used, it may comprise about 25-40% of the composition, such as about 25% or about 40% of the composition. When albumin is used, it may comprise about 1-99% of the composition, such as about 20% of the composition. When DMSO is used, it may comprise about 5-7.5% of the composition, such as about 5% or 7.5% of the composition.

[0148] In some embodiments, the cells of the present disclosure may be stored in the following specific formulations at any time for cryopreservation: In some embodiments, the cells of the present disclosure may be stored in the following specific formulations for cryopreservation after treatment with an inactivating agent: Examples of specific formulations at certain concentrations listed below may be utilized. Table 1 - Exemplary cryopreservation media [Table 1] Table 2 - Exemplary cryopreservation media with specific concentrations [Table 2]

[0149] III. Cells for storage The cells to be preserved (e.g., cryopreserved) can be of any type, including prokaryotic or eukaryotic cells, although in certain embodiments, the cells are mammalian cells. In certain embodiments, the cells are inactivated prior to preservation (e.g., treated with one or more inactivating agents prior to cryopreservation). In more specific embodiments, the mammalian cells are immune cells. In even more specific embodiments, the immune cells are NK cells. In some embodiments, the NK cells may be derived from any of the sources described herein. In certain embodiments, the NK cells are derived from human CB.

[0150] In some embodiments, mammalian cells may be utilized for any type of research or therapeutic purpose. In certain embodiments, the cells are any type of immune cell, including NK cells, T cells, NK T cells, PBMCs, antigen-presenting cells (APCs), B cells, monocytes, dendritic cells, macrophages, monocytes, neutrophils, induced pluripotent stem cells (iPSCs), hematopoietic stem cells, or any cells derived from hematopoietic stem cells, iPSCs, and / or MSCs, differentiated or committed cells from any organ, any fibroblasts, etc. In some examples, the cells may or may not be stem cells.

[0151] As described herein, cells are inactivated prior to storage (e.g., cryopreservation). Furthermore, in some embodiments, cells are modified prior to and / or after inactivation and / or storage. For example, cells may be transfected or transduced with a vector or electroporated with a plasmid encoding a specific gene product, such as a gene product that confers therapeutic activity to the cells. In certain embodiments, cells are transfected or transduced with, or electroporated with, one or more antigen receptors, including T cell receptors (TCRs) or chimeric antigen receptors (CARs), cytokines, homing receptors, or any other gene. In certain cases, the cells are CAR-expressing immune cells, such as CAR-expressing NK cells. In certain cases, the cells are gene-edited.

[0152] In certain embodiments, the cells may be stored at various concentrations and / or various volumes in suitable containers. In some embodiments, the cells are at least about or about 3 x 10 cells per mL. 4 , 3×10 5 , 3×10 6 , 5×10 6 , 1×10 7 , 2.5×10 7 , 5×10 7 , or 1×10 8 The cells may be stored at a concentration within any range derivable therein. In some embodiments, the cells may be stored in one or more vials of at least about or about 0.5 mL, 1 mL, 2 mL, 6 mL, 20 mL, 50 mL, 100 mL, 150 mL, or 200 mL, or any range of sizes derivable therein.

[0153] In certain embodiments, NK cells are derived from human peripheral blood mononuclear cells (PBMCs), unstimulated leukopheresis cells (PBSCs), human embryonic stem cells (hESCs), induced pluripotent stem cells (iPSCs), bone marrow, or umbilical cord blood by methods well known in the art. Specifically, NK cells may be isolated from umbilical cord blood (CB), peripheral blood (PB), bone marrow, or stem cells. In certain embodiments, immune cells are isolated from pooled CB. CB may be pooled from 2, 3, 4, 5, 6, 7, 8, 10, or more units. Immune cells may be autologous or allogeneic. The isolated NK cells may be fully matched, fully mismatched, haploidentical (half-matched), or more than fully haploidentical but less than fully matched to the subject receiving cell therapy. NK cells can be detected by specific surface markers, such as CD16 and CD56 in humans.

[0154] In certain embodiments, the starting population of NK cells is obtained by isolating mononuclear cells using Ficoll density gradient centrifugation. The cell culture may be depleted of any cells expressing CD3, CD14, and / or CD19, and characterized to identify CD56 + / CD3 -The percentage of cells or NK cells may be determined, and in certain procedures, these may be subjected to positive selection with CD56 or other specific NK cell antibodies.

[0155] The cells may be expanded in the presence of APCs, e.g., generalized APCs and / or artificial APCs. Expansion may last for about 2 to 30 days or more, e.g., 3 to 20 days, particularly 12 to 16 days, e.g., 12, 13, 14, 15, 16, 17, 18, or 19 days, specifically about 14 days. NK cells and APCs may be present in a ratio of about 3:1 to 1:3, e.g., 2:1, 1:1, or 1:2, specifically about 1:2. The expansion culture may further contain cytokines, such as IL-2, IL-15, IL-21, and / or IL-18, to promote expansion. The cytokines may be present at a concentration of about 10 to 500 U / mL, e.g., 100 to 300 U / mL, particularly about 200 U / mL. The cytokines may be replenished during the expansion culture, e.g., every 2 to 3 days. APCs may be added to the culture at least a second time, for example, after transduction with a transgene (e.g., CAR, TCR, cytokine, etc.). In certain embodiments, cytokines are present in the cryopreservation medium at a level that does not confer a therapeutic effect on the individual upon receiving the cells, for example, when the medium is included with the cells when the cells are administered to a subject. The cells may be included in at least a portion of the cryopreservation medium by residual medium when preparing the cells for administration, or the cells may be included in at least a portion of the cryopreservation medium by intended design. Following thawing of the cells, the cells may or may not be washed before administration to a subject.

[0156] In certain embodiments, the starting population of cells is MNCs isolated from a single CB unit by Ficoll density gradient. The cells are then washed, and CD3, CD14, and CD19 positive cells are depleted, for example, by using CliniMACS immunomagnetic beads (Miltenyi Biotec). The unlabeled enriched CB-NK cells can be collected, washed with CliniMACS buffer, counted, and combined with irradiated (e.g., 100 Gy) APCs, for example, at a ratio of 1:2. The cell mixture (e.g., 1 x 10 6 The cells (e.g., 1 x 10 cells / mL) may be transferred to a cell culture flask containing NK complete medium (e.g., 90% stem cell growth medium, 10% FBS, 2 mM L-glutamine) and e.g., 50-500, e.g., 100-300, e.g., 200 U / mL IL-2. The cells may be incubated at 37°C in 5% CO2. On day 3, collect the cells by centrifugation and resuspend the cells (e.g., 1 x 10 cells / mL) in NK complete medium containing e.g., 50-500, e.g., 100-300, e.g., 200 U / mL IL-2. 6 A medium change may be performed by adding 1000 mg of Retronectin solution (0.1% of cells / mL). Cells may be incubated at 37°C in 5% CO2. On day 5, the number of wells required for Retronectin transduction can be determined by the number of CB-NK cells in culture. Retronectin solution may be seeded into wells of a 24-well culture plate. Plates can be sealed and stored in a refrigerator at 4°C.

[0157] In certain embodiments, on day 6, a second NK selection as described on day 0 can be performed prior to transduction of CB-NK cells. Cells can be washed with CliniMACS buffer, centrifuged, and cultured at 0.5 x 10 in complete NK medium containing, for example, 100-1000, particularly 600 U / mL, of IL-2. 6The RetroNectin plate can then be washed with NK complete medium and incubated at 37°C until use. The NK complete medium in each well can be replaced with the retroviral supernatant, and the plate can then be centrifuged at 32°C. The retroviral supernatant can then be aspirated and replaced with fresh retroviral supernatant. 0.5 x 10 6 A CB-NK cell suspension containing 10 cells and 600 U / mL of IL-2 may be added to each well, and the plate may be centrifuged. The plate may then be incubated at 37°C in 5% CO2. On day 9, the CAR-transduced CB-NK cells may be removed from the transduction plate, collected by centrifugation, and stimulated with irradiated (e.g., 100 Gy) aAPCs in NK complete medium with 200 U / mL of IL-2, for example, at a ratio of 1:2. The cell culture flask is incubated at 37°C in 5% CO2. A medium change may be performed on day 12. On day 14, the cells may be collected by centrifugation, the supernatant may be aspirated, and the cells may be resuspended in fresh NK complete medium containing 200 U / mL of IL-2. The cell culture flask is incubated at 37°C in 5% CO2. 1 x 10 5 More than CD3 + If cells / kg were present, CD3 was detected using CliniMACS CD3 Reagent. + Magnetic immunodepletion of cells can be performed. On the 14th or 15th day, cells are collected, and then inactivated by treatment with an inactivating agent as described herein. After a suitable inactivation time, cells can be prepared for storage (e.g., cryopreservation). After any suitable storage period, cells can be thawed and used for any suitable purpose, such as, but not limited to, immunotherapy and / or further modification.

[0158] Expanded NK cells can secrete type I cytokines, such as interferon-γ, tumor necrosis factor-α, and granulocyte-macrophage colony-stimulating factor (GM-CSF), which can activate both innate and adaptive immune cells, as well as other cytokines and chemokines. Measurement of these cytokines can be used to determine the activation status of NK cells. Additionally, other methods known in the art for determining NK cell activation may be used to characterize the NK cells of the present disclosure.

[0159] In certain embodiments, the cells are engineered to express one or more engineered antigen receptors (including one or more chimeric antigen receptors and / or one or more engineered TCRs), one or more cytokines, one or more suicide genes, CD47, HLA-G, HLA-E, or a combination thereof.

[0160] A. Engineered Antigen Receptors In some embodiments, the cells that are inactivated and cryopreserved are engineered to express one or more engineered antigen receptors prior to inactivation and cryopreservation and / or after inactivation, cryopreservation, and subsequent thawing.

[0161] In some embodiments, cells (e.g., NK cells) may be genetically modified to express one or more engineered antigen receptors, including at least one or more chimeric antigen receptors (CARs) and / or one or more TCRs. In certain embodiments, the engineered antigen receptors are directed to target one or more cancer antigens.

[0162] In some embodiments, engineered antigen receptors include CARs, including activating or stimulatory CARs, costimulatory CARs (see WO2014 / 055668), and / or inhibitory CARs (iCARs, see Fedorov et al., 2013). CARs generally comprise an extracellular antigen (or ligand) binding domain linked, in some aspects, via a linker and / or transmembrane domain, to one or more intracellular signaling components. Such molecules typically mimic or resemble signals through natural antigen receptors, signals through such receptors in combination with costimulatory receptors, and / or signals through costimulatory receptors alone.

[0163] In some embodiments, cells (e.g., NK cells) may be engineered to encode at least one CAR, and the CAR may be, for example, a first-, second-, third-, or later-generation CAR. The CAR may or may not be bispecific for two or more different antigens. The CAR may include one or more costimulatory domains. NK cells may also be engineered to express receptors for enhanced antibody binding, such as CD16, CD32, and / or CD64 receptors. Each costimulatory domain may include, for example, one or more costimulatory domains from any one of the following TNFR superfamily members: CD28, CD137 (4-1BB), CD134 (OX40), DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-I, TNFR-II, Fas, CD30, CD27, NKG2D, 2B4M, CD40, or a combination thereof. In certain embodiments, the CAR comprises CD3 zeta. In certain embodiments, the CAR lacks one or more particular costimulatory domains; for example, the CAR can lack 4-1BB and / or lack CD28.

[0164] In certain embodiments, the intracellular CAR polypeptide comprises an extracellular spacer domain, sometimes referred to as a hinge, that connects the antigen-binding domain and the transmembrane domain. The extracellular spacer domain includes, but is not limited to, an Fc fragment of an antibody or a fragment or derivative thereof, a hinge region of an antibody or a fragment or derivative thereof, a CH2 region of an antibody, a CH3 region of an antibody, an artificial spacer sequence, or a combination thereof. Examples of extracellular spacer domains include, but are not limited to, artificial spacers made from polypeptides such as CD8α hinge, CD28, and Gly3, or the CH1 and CH3 domains of IgG (such as human IgG1 or IgG4). In certain embodiments, the extracellular spacer domain can comprise (i) the hinge, CH2, and CH3 regions of IgG4, (ii) the hinge region of IgG4, (iii) the hinge and CH2 of IgG4, (iv) the hinge region of CD8α or CD4, (v) the hinge, CH2, and CH3 regions of IgG1, (vi) the hinge region of IgG1, or (vii) the hinge and CH2 of IgG1, (viii) the hinge region of CD28, or a combination thereof. In certain embodiments, the hinge is derived from IgG1, and in certain embodiments, the CAR polypeptide comprises a particular IgG1 hinge amino acid sequence or is encoded by a particular IgG1 hinge nucleic acid sequence.

[0165] In some embodiments, the transmembrane domain of the CAR may be naturally derived or synthetic. If naturally derived, in some embodiments, a domain derived from a membrane-bound or transmembrane protein is used. Transmembrane regions include those derived from (i.e., at least the transmembrane region of) the alpha, beta, or zeta chain of the T cell receptor, CD28, CD3 zeta, CD3 epsilon, CD3 gamma, CD3 delta, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD30, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, ICOS / CD278, GITR / CD357, NKG2D, and DAP molecules (such as DAP10 or DAP12). Alternatively, the transmembrane domain in some embodiments is synthetic. In some embodiments, synthetic transmembrane domains primarily contain hydrophobic residues such as leucine and valine. In some embodiments, triplets of phenylalanine, tryptophan, and valine may be found on either side of the synthetic transmembrane domain.

[0166] Certain embodiments of the present disclosure relate to the use of nucleic acids, including nucleic acids encoding antigen-specific CAR polypeptides, including humanized CARs (hCARs) for reduced immunogenicity, which comprise an intracellular signaling domain, a transmembrane domain, and an extracellular domain containing one or more signaling motifs. In certain embodiments, the CAR can recognize an epitope comprising a shared space between one or more antigens. In certain embodiments, the binding region can comprise a complementarity-determining region of a monoclonal antibody, a variable region of a monoclonal antibody, and / or an antigen-binding fragment thereof. In another embodiment, the specificity is derived from a peptide (e.g., a cytokine) that binds to a receptor.

[0167] It is contemplated that the human CAR nucleic acid may be a human gene used to enhance cellular immunotherapy for human patients. In certain embodiments, the present invention comprises a full-length CAR cDNA or coding region. The antigen-binding region or domain may be the V of a single-chain variable fragment (scFv) derived from a particular human monoclonal antibody, such as the antibody described in U.S. Patent No. 7,109,304, which is incorporated herein by reference. H and V L The CAR may comprise fragments of a chain. The fragments may be any number of different antigen-binding domains of a human antigen-specific antibody. In a more specific embodiment, the fragments are antigen-specific scFvs encoded by sequences optimized for human codon usage for expression in human cells. The CAR may be bispecific for two non-identical antigen targets, or trispecific for three non-identical antigen targets, etc.

[0168] The configuration may be multimeric, e.g., a diabody or multimer. Multimers are most likely formed by pairing the variable portions of the light and heavy chains with each other to form a diabody. The hinge portion of the construct may have many options, including complete deletion, retention of the first cysteine, substitution of proline for serine, or truncation to the first cysteine. The Fc portion may be deleted. Any stable and / or dimerizing protein can be used for this purpose. Only one of the Fc domains can be used, e.g., the CH2 or CH3 domain of a human immunoglobulin. The hinge, CH2, and CH3 regions of a human immunoglobulin modified to improve dimerization can also be used. Only the hinge portion of an immunoglobulin can also be used. A portion of CD8 alpha can also be used.

[0169] In certain embodiments, the CAR can be co-expressed with one or more cytokines to improve persistence when the amount of tumor-associated antigen is low. For example, the CAR can be co-expressed with one or more cytokines, such as IL-7, IL-2, IL-15, IL-12, IL-23, IL-18, IL-21, IL-7, GMCSF, or a combination thereof. In some embodiments, the cells expressing the CAR (e.g., NK cells) are engineered to express one or more heterologous cytokines and / or to upregulate the normal expression of one or more heterologous cytokines. The cells may or may not be transduced or transfected with one or more cytokines on the same vector as other genes. In certain embodiments, the engineered antigen receptor is co-expressed with the cytokine IL-15.

[0170] The sequence of the open reading frame encoding the engineered antigen receptor can be obtained from genomic DNA sources, cDNA sources, or synthetically (e.g., by PCR), or a combination thereof. Depending on the size of the genomic DNA and the number of introns, it may be preferable to use cDNA or a combination thereof, since introns have been shown to stabilize mRNA. It may also be advantageous to use endogenous or exogenous non-coding regions to stabilize the mRNA.

[0171] It is contemplated that chimeric constructs can be introduced into all kinds of immune cells as naked DNA or in suitable vectors.Methods for stable transfection of cells by electroporation using naked DNA are known in the art.See, for example, U.S. Patent No. 6,410,319.Naked DNA generally refers to the DNA encoding chimeric receptor contained in a plasmid expression vector in the appropriate orientation for expression.

[0172] Alternatively, viral vectors (e.g., retroviral vectors, adenoviral vectors, adeno-associated viral vectors, or lentiviral vectors) or non-viral methods can be used to introduce the chimeric construct into immune cells.Vectors suitable for use according to the methods of the present disclosure are non-replicative in immune cells.For example, many vectors are known that are based on viruses, such as vectors based on HIV, SV40, EBV, HSV, or BPV, in which the copy number of the virus maintained in cells is low enough to maintain cell viability.Non-viral vectors include plasmids, transposons, nanoparticles, liposomes, lipids, metals, or combinations thereof.

[0173] In some embodiments, the engineered antigen receptor comprises a recombinant TCR and / or a TCR cloned from a naturally occurring T cell. "T cell receptor" or "TCR" refers to a molecule that comprises a variable a chain and a variable β chain (also known as TCRα and TCRβ, respectively) or a variable γ chain and a variable δ chain (also known as TCRγ and TCRδ, respectively), and that can specifically bind to an antigenic peptide bound to an MHC receptor. In some embodiments, the TCR is of the αβ type.

[0174] TCRs, typically present in αβ and γδ subtypes, are generally structurally similar, although the T cells expressing them may differ in anatomical location and function. TCRs may exist on the cell surface or in a soluble form. Generally, TCRs are present on the surface of T cells (or T lymphocytes) and are generally responsible for recognizing antigens bound to major histocompatibility complex (MHC) molecules. In some embodiments, TCRs may also comprise a constant domain, a transmembrane domain, and / or a short cytoplasmic tail (see, e.g., Janeway et al., 1997). For example, in some embodiments, each chain of a TCR may have an N-terminal immunoglobulin variable domain, an immunoglobulin constant domain, a transmembrane region, and a short C-terminal cytoplasmic tail. In some embodiments, TCRs are associated with invariant proteins of the CD3 complex, which are involved in mediating signal transduction. Unless otherwise specified, the term "TCR" should be understood to encompass functional TCR fragments thereof. The term also encompasses intact or full-length TCRs, including αβ or γδ TCRs.

[0175] Thus, as used herein, TCR refers to any TCR or functional fragment thereof, such as an antigen-binding portion, that binds to a specific antigen peptide bound to an MHC molecule, i.e., in an MHC-peptide complex. The terms "antigen-binding portion" or "antigen-binding fragment" of a TCR are sometimes used interchangeably and refer to a molecule that includes part of the structural domain of the TCR but that binds to the antigen (e.g., an MHC-peptide complex) that the complete TCR binds. In some cases, the antigen-binding portion includes the variable domain of the TCR, e.g., the variable a chain and variable β chain of the TCR, sufficient to form a binding site for binding to a specific MHC-peptide complex, such that each chain typically contains three complementarity-determining regions.

[0176] In some embodiments, the variable domains of TCR chains associate to form loops, or complementarity-determining regions (CDRs) similar to immunoglobulins, which form the binding site of the TCR molecule, thereby conferring antigen recognition and determining peptide specificity. Typically, like immunoglobulins, CDRs are separated by framework regions (FRs) (see, e.g., Jores et al., 1990; Chothia et al., 1988; Lefranc et al., 2003). In some embodiments, CDR3 is the primary CDR that recognizes processed antigens, although CDR1 of the α chain has also been shown to interact with the N-terminal portion of antigenic peptides, and CDR1 of the β chain interacts with the C-terminal portion of peptides. CDR2 is thought to recognize MHC molecules. In some embodiments, the variable region of the β chain can contain an additional hypervariable (HV4) region.

[0177] In some embodiments, a TCR chain comprises a constant domain. For example, similar to an immunoglobulin, the extracellular portion of a TCR chain (e.g., a chain, β chain) comprises two immunoglobulin domains: a variable domain (e.g., V a or Vp; typically, amino acids 1-116 according to Kabat numbering in Kabat et al., "Sequences of Proteins of Immunological Interest, U.S. Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5th ed.") at the N-terminus, and one constant domain adjacent to the cell membrane (e.g., the a-chain constant domain or C aThe TCR may comprise a β-chain constant domain or Cp, typically amino acids 117 to 259 according to Kabat, and a β-chain constant domain or Cp, typically amino acids 117 to 295 according to Kabat. For example, in some cases, the extracellular portion of the TCR formed by the two chains includes two membrane-proximal constant domains and two membrane-distal variable domains containing the CDRs. The constant domain of the TCR domains includes a short linking sequence in which cysteine ​​residues form disulfide bonds, creating the link between the two chains. In some embodiments, the TCR can have an additional cysteine ​​residue in each of the α-chain and the β-chain, such that the TCR includes two disulfide bonds in the constant domain.

[0178] In some embodiments, the TCR chain can include a transmembrane domain. In some embodiments, the transmembrane domain is positively charged. In some cases, the TCR chain includes a cytoplasmic tail. In some cases, this structure allows the TCR to associate with other molecules, such as CD3. For example, a TCR that includes a constant domain with a transmembrane region can anchor the protein to the cell membrane and associate with the invariant subunit of the CD3 signaling apparatus or complex.

[0179] Generally, CD3 is a multiprotein complex, and in mammals, it can have three distinct chains (γ, δ, ε) and a ζ chain. For example, in mammals, it can contain a homodimer of CD3γ, CD3δ, two CD3ε, and a CD3ζ chain. The CD3γ, CD3δ, and CD3ε chains are highly related cell surface proteins of the immunoglobulin superfamily, each containing a single immunoglobulin domain. The transmembrane regions of the CD3γ, CD3δ, and CD3ε chains are negatively charged, a feature that allows these chains to associate with positively charged T cell receptor chains. The intracellular tails of the CD3γ, CD3δ, and CD3ε chains each contain one conserved motif known as an immunoreceptor tyrosine-based activation motif (ITAM), while the CD3ζ chain has three. Generally, ITAMs are involved in the signaling capacity of the TCR complex. These accessory molecules have negatively charged transmembrane regions and play a role in transmitting signals from the TCR into the cell. The CD3 and ζ chains together with the TCR form what is called the T cell receptor complex.

[0180] In some embodiments, the TCR may be a heterodimer of two chains, an α chain and a β chain (or optionally a γ chain and a δ chain), or may be a single-chain TCR construct. In some embodiments, the TCR is a heterodimer comprising two separate chains (α and β, or γ and δ chains) linked by a disulfide bond or disulfide bond, etc. In some embodiments, a TCR against a target antigen (e.g., a cancer antigen) is identified and introduced into a cell. In some embodiments, nucleic acids encoding the TCR can be obtained from various sources, such as by polymerase chain reaction (PCR) amplification of publicly available TCR DNA sequences. In some embodiments, the TCR is obtained from a biological source, such as from cells such as T cells (e.g., cytotoxic T cells), T cell hybridomas, or other publicly available sources. In some embodiments, the T cells can be obtained from cells isolated in vivo. In some embodiments, high-affinity T cell clones can be isolated from patients and the TCRs isolated. In some embodiments, the T cells can be cultured T cell hybridomas or clones. In some embodiments, TCR clones against a target antigen are generated in transgenic mice engineered with human immune system genes (e.g., human leukocyte antigen system, or HLA). See, for example, tumor antigens (see, e.g., Parkhurst et al., 2009 and Cohen et al., 2005). In some embodiments, phage display is used to isolate TCRs against a target antigen (see, e.g., Varela-Rohena et al., 2008 and Li, 2005). In some embodiments, the TCR, or antigen-binding portion thereof, can be synthetically generated from knowledge of the sequence of the TCR.

[0181] B. Antigen The CARs and TCRs of the present disclosure target one or more specific antigens. Some of the antigens targeted by the engineered antigen receptors are expressed in the context of the disease, condition, or cell type targeted via adoptive cell therapy. Diseases and conditions include proliferative, neoplastic, and malignant diseases and disorders, including hematologic cancers, lymphomas, leukemias, and / or cancers of the immune system, such as B, T, and myeloid leukemias, lymphomas, and myelomas, such as multiple myeloma. In some embodiments, the antigen is selectively expressed or overexpressed on cells of the disease or condition, e.g., tumor or pathogenic cells, compared to normal or non-target cells or tissues. In other embodiments, the antigen is expressed on normal cells and / or on engineered cells.

[0182] Among the antigens targeted by engineered antigen receptors are those expressed in association with the disease, condition, or cell type targeted by adoptive cell therapy. Among these diseases and conditions are proliferative, neoplastic, and malignant diseases and disorders, including cancers and tumors, including blood cancers, cancers of the immune system, such as lymphomas, leukemias, and / or myelomas, including B, T, and myeloid leukemias, lymphomas, and multiple myelomas. In some embodiments, the antigen is selectively expressed or overexpressed on cells of the disease or condition, such as tumor or pathogenic cells, compared to normal or non-target cells or tissues. In other embodiments, the antigen is expressed on normal cells and / or expressed on engineered cells.

[0183] Any suitable antigen can be targeted in this method. In some cases, the antigen may be associated with a particular cancer cell but not with a non-cancerous cell. Exemplary antigens include, but are not limited to, antigenic molecules derived from infectious agents, self / autoantigens, tumor / cancer-associated antigens, and tumor neoantigens (Linnemann et al., 2015). In certain embodiments, antigens include CD19, EBNA, CD123, HER2, CA-125, TRAIL / DR4, CD20, CD70, CD38, trop2, HLA-G, CD123, CLL1, carcinoembryonic antigen, alpha-fetoprotein, CD56, AKT, Her3, epithelial tumor antigen, CD319 (CS1), ROR1, folate-binding protein, HIV-1 envelope glycoprotein gp120, HIV-1 envelope glycoprotein gp 41, CD5, CD23, CD30, HERV-K, IL-11Rα, κ chain, λ chain, CSPG4, CD33, CD47, CLL-1, U5snRNP200, CD200, BAFF-R, BCMA, CD99, p53, mutant p53, Ras, mutant ras, c-Myc, cytoplasmic serine / threonine kinases (e.g., A-Raf, B-Raf, and C-Raf, cyclin-dependent kinases), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MA GE-A6, MAGE-A10, MAGE-A12, MART-1, melanoma-associated antigen, BAGE, DAM-6, -10, GAGE-1, -2, -8, GAGE-3, -4, -5, -6, -7B, NA88-A, MC1R, mda-7, gp75, Gp100, PSA, PSM, tyrosinase, tyrosinase-related protein, TRP-1, TRP-2, ART-4, CAMEL, CEA, Cyp-B, hTERT, hTRT, iCE, MUC1, MUC2, phospho Inositide 3-kinase (PI3K), TRK receptor, PRAME, P15, RU1, RU2, SART-1, SART-3, Wilms tumor antigen (WT1), AFP, -catenin / m, caspase-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HAGE, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II,CDC27 / m, TPI / mbcr-abl, BCR-ABL, interferon regulatory factor 4 (IRF4), ETV6 / AML, LDLR / FUT, Pml / RAR, tumor-associated calcium signal transducer 1 (TACSTD1) TACSTD2, receptor tyrosine kinases (e.g., epidermal growth factor receptor (EGFR) (especially EGFRvIII), platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR)), VEGFR2, cytoplasmic tyrosine kinases (e.g., src family, syk-ZAP70 family), integrin-linked kinase (ILK), signal transducers and activators of transcription STAT3, STATS, and STATE, hypoxia-inducible factors (e.g., HIF-1 and HIF-2), nuclear factor-κB (NF-B), Notch receptors (e.g., Notch1-4), NY ESO 1, c-Met, mammalian target of rapamycin (mTOR), WNT, extracellular signal-regulated kinase (ERK) and their regulatory subunits, PMSA, PR-3, MDM2, mesothelin, renal cell carcinoma-5T4, SM22α, carbonic anhydrase I (CAI) and IX (CAIX) (also known as G250), STEAD, TEL / AML1, GD2, proteinase 3, hTERT, sarcoma translocation breakpoints, EphA2, ML-IAP, EpCAM, ERG (TMPRSS2) ETS fusion gene), NA17, PAX3, ALK, androgen receptor, cyclin B1, polysialic acid, MYCN, RhoC, GD3, fucosyl-GM1, mesothelial, PSCA, sLe, PLAC1, GM3, BORIS, Tn, GLoboH, NY-BR-1, RGsS, SAGE, SART3, STn, PAX5, OY-TES1, sperm protein 17, LCK, HMWMAA, AKAP-4, SSX2, XAGE1, B7H3, legumain, TIE2, Page4, MAD-CT-1, FAP, MAD-CT-2, fos-related antigen 1, CBX2, CLDN6, SPANX, TPTE, ACTL8, ANKRD30A, CDKN2A, MAD2L1, CTAG1B, SUNC1, and LRRN1. Examples of antigen sequences can be found, for example, in GenBank, 登録商標In the database: CD19 (accession number NG_007275.1), EBNA (accession number NG_002392.2), WT1 (accession number NG_009272.1), CD123 (accession number NC_000023.11:1336785-1382689), NY-ESO (accession number: NC_000023.11), EGFRvIII (accession number: NG_007726.3), MUC1 (accession number: NG_029383.1), HER2 (accession number: NG_007503.1), CA-125 (accession number NG_055257.1), WT1 (accession number NG_009272.1), Mage-A3 (accession number NG_013244.1), Mage-A4 (Accession No. NG_013245.1), Mage-A10 (Accession No. NC_000023.11), TRAIL / DR4 (Accession No. NC_000003.12), and / or CEA (Accession No. NC_000019.10) are known in the art.

[0184] For example, tumor-associated antigens can be derived from prostate cancer, breast cancer, colon cancer, lung cancer, pancreatic cancer, kidney cancer, mesothelioma, ovarian cancer, liver cancer, brain tumor, bone cancer, stomach cancer, spleen cancer, testicular cancer, cervical cancer, anal cancer, gallbladder cancer, thyroid cancer, or melanoma cancer. Exemplary tumor-associated antigens or tumor cell-derived antigens include MAGE1, 3, and MAGE4 (or other MAGE antigens as disclosed in International Patent Publication No. WO99 / 40188); PRAME; BAGE; RAGE, Lage (also known as NY ESO 1); SAGE; and HAGE or GAGE. These non-limiting examples of tumor antigens are expressed in a wide range of tumor types, such as melanoma, lung cancer, sarcoma, and bladder cancer. See, for example, U.S. Patent No. 6,544,518. Prostate cancer tumor-associated antigens include, for example, prostate-specific membrane antigen (PSMA), prostate-specific antigen (PSA), prostatic acid phosphate, NKX3.1, and six-stage membrane epithelial antigen of the prostate (STEAP).

[0185] Other tumor-associated antigens include Plu-1, HASH-1, HasH-2, Cripto, Criptin, etc. Furthermore, tumor antigens can be self-peptide hormones, such as gonadotrophin-releasing hormone (GnRH), a short peptide with a total length of 10 amino acids, which is useful in the treatment of many cancers.

[0186] Antigens can include genes mutated in tumor cells, such as telomerase enzyme, survivin, mesothelin, mutant ras, bcr / abl rearrangements, Her2 / neu, mutant or wild-type p53, cytochrome P450 1B1, and aberrantly expressed intronic sequences such as N-acetylglucosaminyltransferase-V; clonal rearrangements of immunoglobulin genes that generate unique idiotypes in myeloma and B-cell lymphoma; tumor antigens containing epitopic regions or epitopic peptides derived from oncoviral processes, such as human papillomavirus proteins E6 and E7; Epstein-Barr virus protein LMP2; and epitopic regions or epitopic peptides derived from genes transcribed at different levels in tumor cells compared to normal cells, such as unmutated oncofetal proteins with tumor-selective expression, such as carcinoembryonic antigen and alpha-fetoprotein.

[0187] In other embodiments, antigens are obtained or derived from pathogenic or opportunistic pathogenic microorganisms (also referred to herein as infectious disease microorganisms), such as viruses, fungi, parasites, and bacteria. In certain embodiments, antigens derived from such microorganisms comprise full-length proteins.

[0188] Illustrative pathogenic organisms whose antigens are contemplated for use in the methods described herein include human immunodeficiency virus (HIV), herpes simplex virus (HSV), respiratory syncytial virus (RSV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), influenza A, B, and C, vesicular stomatitis virus (VSV), polyomaviruses (e.g., BK virus and JC virus), adenovirus, Staphylococcus species, including methicillin-resistant Staphylococcus aureus (MRSA), and Streptococcus species, including Streptococcus pneumoniae. As will be appreciated by those of skill in the art, proteins derived from these and other pathogenic microorganisms for use as antigens described herein, as well as the nucleotide sequences encoding those proteins, are identified in publications and public databases such as GENBANK®, SWISS-PROT®, and TREMBL®.

[0189] Antigens derived from human immunodeficiency virus (HIV) include HIV virion structural proteins (e.g., gp120, gp41, p17, p24), protease, reverse transcriptase, or any of the HIV proteins encoded by tat, rev, nef, vif, vpr, and vpu.

[0190] Antigens derived from herpes simplex viruses (e.g., HSV1 and HSV2) include, but are not limited to, proteins expressed from the HSV late genes. The late group of genes primarily encodes proteins that form virion particles. Such proteins include five proteins from (UL) that form the viral capsid UL6, UL18, UL35, UL38, and the major capsid proteins UL19, UL45, and UL27, each of which may be used as an antigen as described herein. Other illustrative HSV proteins contemplated for use as antigens herein include ICP27 (H1, H2), glycoprotein B (gB), and glycoprotein D (gD) proteins. The HSV genome contains at least 74 genes, each encoding a protein that may be used as an antigen.

[0191] Antigens derived from cytomegalovirus (CMV) include CMV structural proteins, viral antigens expressed during the immediate early and early phases of viral replication, glycoproteins I and III, capsid protein, coat protein, lower matrix protein pp65 (ppUL83), p52 (ppUL44), IE1 and 1E2 (UL123 and UL122), protein products from the UL128-UL150 derived gene cluster (Rykman et al., 2006), envelope glycoproteins B (gB), gH, gN, and pp150. As will be appreciated by those of skill in the art, CMV proteins for use as antigens described herein are identified in public databases such as GENBANK®, SWISS-PROT®, and TREMBL® (see, e.g., Bennekov et al., 2004; Loewendorf et al., 2010; Marschall et al., 2009).

[0192] Antigens derived from Epstein-Barr virus (EBV) contemplated for use in certain embodiments include EBV proteins produced during latent cycle infection, including EBV lytic proteins gp350 and gp110, Epstein-Barr nuclear antigen (EBNA)-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA leader protein (EBNA-LP), and latent membrane protein (LMP)-1, LMP-2A, and LMP-2B (see, e.g., Lockey et al., 2008).

[0193] Antigens derived from respiratory syncytial virus (RSV) contemplated for use herein include any of 11 proteins encoded by the RSV genome, or antigenic fragments thereof, namely, NS1, NS2, N (nucleocapsid protein), M (matrix protein) SH, G and F (viral coat proteins), M2 (second matrix protein), M2-1 (elongation factor), M2-2 (transcriptional regulator), RNA polymerase, and phosphoprotein P.

[0194] Antigens derived from vesicular stomatitis virus (VSV) contemplated for use include any one of the five major proteins encoded by the VSV genome and their antigenic fragments: large protein (L), glycoprotein (G), nucleoprotein (N), phosphoprotein (P), and matrix protein (M) (see, e.g., Rieder et al., 1999).

[0195] Antigens derived from influenza virus contemplated for use in certain embodiments include hemagglutinin (HA), neuraminidase (NA), nucleoprotein (NP), matrix proteins M1 and M2, NS1, NS2 (NEP), PA, PB1, PB1-F2, and PB2.

[0196] Exemplary viral antigens include, but are not limited to, adenovirus polypeptides, alphavirus polypeptides, calicivirus polypeptides (e.g., calicivirus capsid antigen), coronavirus polypeptides, distemper virus polypeptides, Ebola virus polypeptides, enterovirus polypeptides, flavivirus polypeptides, hepatitis virus (AE) polypeptides (hepatitis B core or surface antigen, hepatitis C virus E1 or E2 glycoprotein, core, or nonstructural protein), herpesvirus polypeptides (including herpes simplex virus or varicella zoster virus glycoproteins), infectious peritonitis virus polypeptides, leukemia virus polypeptides, and the like. Also included are polypeptides, Marburg virus polypeptides, orthomyxovirus polypeptides, papillomavirus polypeptides, parainfluenza virus polypeptides (e.g., hemagglutinin and neuraminidase polypeptides), paramyxovirus polypeptides, parvovirus polypeptides, pestivirus polypeptides, picornavirus polypeptides (e.g., poliovirus capsid polypeptides), poxvirus polypeptides (e.g., vaccinia virus polypeptides), rabies virus polypeptides (e.g., rabies virus glycoprotein G), reovirus polypeptides, retrovirus polypeptides, and rotavirus polypeptides.

[0197] In certain embodiments, the antigen may be a bacterial antigen. In certain embodiments, the bacterial antigen of interest may be a secreted polypeptide. In certain other embodiments, the bacterial antigen comprises an antigen having a portion of a polypeptide exposed on the outer cell surface of the bacterium.

[0198] Antigens derived from Staphylococcus species, including methicillin-resistant Staphylococcus aureus (MRSA), contemplated for use include virulence regulators such as the Agr system, Sar and Sae, the Arl system, Sar homologs (Rot, MgrA, SarS, SarR, SarT, SarU, SarV, SarX, SarZ, and TcaR), the Srr system, and TRAP. Other Staphylococcus proteins that can serve as antigens include Clp proteins, HtrA, MsrR, aconitase, CcpA, SvrA, Msa, CfvA, and CfvB (see, e.g., Staphylococcus: Molecular Genetics, 2008 Caister Academic Press, edited by Jodi Lindsay). The genomes for two species of Staphylococcus aureus (N315 and Mu50) have been sequenced and are publicly available, for example, at PATRIC (PATRIC: The VBI PathoSystems Resource Integration Center, Snyder et al., 2007). As will be appreciated by those of skill in the art, Staphylococcal proteins for use as antigens may also be identified in other public databases, such as GenBank®, Swiss-Prot®, and TrEMBL®.

[0199] Antigens derived from Streptococcus pneumoniae contemplated for use in certain embodiments described herein include pneumolysin, PspA, choline-binding protein A (CbpA), NanA, NanB, SpnHL, PavA, LytA, Pht, and pilin proteins (RrgA, RrgB, RrgC). Antigenic proteins of Streptococcus pneumoniae are known in the art and may be used as antigens in some embodiments (see, e.g., Zysk et al., 2000). The complete genome sequence of pathogenic strains of Streptococcus pneumoniae has been sequenced, and as will be appreciated by those of skill in the art, S. pneumoniae proteins for use herein may also be identified in other public databases, such as GenBank®, Swiss-PROT®, and TREMBL®. Proteins of particular interest for antigens according to the present disclosure include virulence factors and proteins predicted to be exposed on the surface of Pneumococcus (see, for example, Frolet et al., 2010).

[0200] Examples of bacterial antigens that can be used as antigens include, but are not limited to, Actinomyces polypeptides, Bacillus polypeptides, Bacteroides polypeptides, Bordetella polypeptides, Bartonella polypeptides, Borrelia polypeptides (e.g., B. burgdorferi OspA), Brucella polypeptides, Campylobacter polypeptides, Capnocytophaga polypeptides, Chlamydia polypeptides, Corynebacterium polypeptides, Coxiella polypeptides, Dermatophilus polypeptides, Enterococcus polypeptides, Ehrlichia polypeptides, Escherichia polypeptides, Francisella polypeptides, Fusobacterium polypeptides, Haemobartonella polypeptides, Haemophilus polypeptides (e.g., H. influenza type b outer membrane protein), Helicobacter polypeptides, Klebsiella polypeptides, L-form bacteria polypeptides, Leptospira polypeptides, Listeria polypeptides, Mycobacteria polypeptides, Mycoplasma polypeptides, Neisseria polypeptides, Neorickettsia polypeptides, Nocardia polypeptides, Pasteurella polypeptides, Peptococcus polypeptides, Peptostreptococcus polypeptides, Pneumococcus polypeptides (i.e., S. pneumoniae polypeptides) (see description herein), Proteus polypeptides, Pseudomonas polypeptides, Rickettsia polypeptides, Rochalimaea polypeptides, Salmonella polypeptides, Shigella polypeptides, Staphylococcus polypeptides, Group A streptococcus polypeptides (e.g., S. pyogenes M protein), Group B streptococcus (S. agalactiae) polypeptides, Treponema polypeptides, and Yersinia polypeptides (e.g., Y pestis F1 and V antigens).

[0201] Examples of fungal antigens include, but are not limited to, Absidia polypeptides, Acremonium polypeptides, Alternaria polypeptides, Aspergillus polypeptides, Basidiobolus polypeptides, Bipolaris polypeptides, Blastomyces polypeptides, Candida polypeptides, Coccidioides polypeptides, Conidiobolus polypeptides, Cryptococcus polypeptides, Curvalaria polypeptides, Epidermophyton polypeptides, Exophiala polypeptides, Geotrichum polypeptides, Histoplasma polypeptides, Madurella polypeptides, Malassezia polypeptides, Microsporum polypeptides, Mo niliella polypeptides, Mortierella polypeptides, Mucor polypeptides, Paecilomyces polypeptides, Penicillium polypeptides, Phialemonium polypeptides, Phialophora polypeptides, Prototheca polypeptides, Pseudallescheria polypeptides, Pseudomicrodochium polypeptides, Pythium polypeptides, Rhinosporidium polypeptides, Rhizopus polypeptides, Scolecobasidium polypeptides, Sporothrix polypeptides, Stemphylium polypeptides, Trichophyton polypeptides, Trichosporon polypeptides, and Xylohypha polypeptides.

[0202] Examples of protozoan parasitic antigens include, but are not limited to, Babesia polypeptides, Balantidium polypeptides, Besnoitia polypeptides, Cryptosporidium polypeptides, Eimeria polypeptides, Encephalitozoon polypeptides, Entamoeba polypeptides, Giardia polypeptides, Hammondia polypeptides, Hepatozoon polypeptides, Isospora polypeptides, Leishmania polypeptides, Microsporidia polypeptides, Neospora polypeptides, Nosema polypeptides, Pentatrichomonas polypeptides, and Plasmodium polypeptides. Examples of helminth parasitic antigens include, but are not limited to, Acanthocheilonema polypeptides, Aelurostrongylus polypeptides, Ancylostoma polypeptides, Angiostrongylus polypeptides, Ascaris polypeptides, Brugia polypeptides, Bunostomum polypeptides, Capillaria polypeptides, Chabertia polypeptides, Cooperia polypeptides, Crenosoma polypeptides, Dictyocaulus polypeptides, Dioctophyme polypeptides, Dipetalonema polypeptides, Diphyllobothrium polypeptides, Diplydium polypeptides, Dirofilaria polypeptides, Dracunculus polypeptide, Enterobius polypeptide, Filaroides polypeptide, Haemonchus polypeptide, Lagochilascaris polypeptide, Loa polypeptide, Mansonella polypeptide, Muellerius polypeptide, Nanophyetus polypeptide, Necator polypeptide, Nematodirus polypeptide, Oesophagostomum polypeptide, Onchocerca polypeptide, Opisthorchis polypeptide, Ostertagia polypeptide, Parafilaria polypeptide, Paragonimus polypeptide, Parascaris polypeptide, Physaloptera polypeptide,Protostrongylus polypeptides, Setaria polypeptides, Spirocerca polypeptides, Spirometra polypeptides, Stephanofilaria polypeptides, Strongyloides polypeptides, Strongylus polypeptides, Thelazia polypeptides, Toxascaris polypeptides, Toxocara polypeptides, Trichinella polypeptides, Trichostrongylus polypeptides, Trichuris polypeptides, Uncinaria polypeptides, and Wuchereria polypeptides (e.g., P. falciparum peripheral sporozoite (PfCSP)), sporozoite surface protein 2 (PfSSP2), carboxyl-terminus of liver status antigen 1 (PfLSA1 c-term), and export protein 1 (PfExp-1), Pneumocystis polypeptides, Sarcocystis polypeptides, Schistosoma polypeptides, Theileria polypeptides, Toxoplasma polypeptides, and Trypanosoma polypeptides.

[0203] Examples of ectoparasite antigens include, but are not limited to, polypeptides (including antigens and allergens) from fleas, ticks, including hard and soft ticks, midges, mosquitoes, sand flies, black flies, bot flies, horn flies, deer flies, tsetse flies, stable flies, flies such as myiasis flies and black flies, ants, spiders, lice, mites, and hemipterans, such as bed bugs and assassin bugs.

[0204] In certain embodiments, the technology disclosed herein utilizing genetically modified immune cells, e.g., NK cells, includes (i) non-viral gene transfer using an electroporation device (e.g., nucleofector), (ii) CARs that signal through an endodomain (e.g., CD28 / CD3-ζ, CD137 / CD3-ζ, or other combinations), (iii) CARs with variable lengths of extracellular domains connecting the antigen recognition domain to the cell surface, and in some cases (iv) CARs +These include artificial antigen-presenting cells (aAPCs) derived from K562, which allow robust and numerical expansion of immune cells ( Singh et al., 2008 ; Singh et al., 2011 ).

[0205] As demonstrated herein, in some embodiments, cells comprising one or more engineered antigen receptors (e.g., CARs) have increased expression of said engineered antigen receptors after inactivation, cryopreservation, and thawing relative to otherwise identical cells that were not inactivated prior to cryopreservation. In some embodiments, such cells exhibit higher engineered antigen receptor-mediated signaling relative to suitable control cells.

[0206] C. Suicide gene In certain embodiments, the cells described herein contain a suicide gene to control their use and allow for termination of cell therapy at a desired event and / or time. In some embodiments, a suicide gene is employed in transduced cells to induce their death when necessary. Cells of the present disclosure that have been modified to carry vectors encompassed by the present disclosure may contain one or more suicide genes. In some embodiments, the term "suicide gene," as used herein, is defined as a gene that, upon administration of a prodrug or other agent, results in the transfer of the gene product to a compound that will kill the host cell. In other embodiments, the suicide gene encodes a gene product that is optionally targeted by an agent (such as an antibody) that targets the suicide gene product.

[0207] In some cases, cell therapy may be subject to the use of one or more suicide genes of any type when an individual undergoing and / or receiving cell therapy is considered to be at risk of developing or imminently developing one or more symptoms of one or more adverse events, such as cytokine release syndrome, neurotoxicity, anaphylaxis / allergy, and / or on-target / off-tumor toxicity (for example). The use of a suicide gene may be part of a planned protocol for treatment, or may be used only if its use is deemed necessary. In some cases, cell therapy may be terminated using an agent targeting the suicide gene or its gene product because treatment is no longer necessary.

[0208] In some embodiments, the use of suicide genes can be initiated upon the onset of at least one adverse event in an individual, which can be recognized by any means, including periodic monitoring, which may or may not be continuous from the start of cell therapy. Adverse events can be detected by examinations and / or tests. If an individual develops cytokine release syndrome (sometimes referred to as cytokine storm), the individual may experience elevated levels of inflammatory cytokine(s) (by way of example only: interferon-γ, granulocyte-macrophage colony-stimulating factor, IL-10, IL-6, and TNF-α), fever, fatigue, hypotension, hypoxia, tachycardia, nausea, capillary leak, cardiac / renal / liver dysfunction, or a combination thereof. If an individual experiences neurotoxicity, the individual may experience confusion, delirium, aplasia, and / or seizures. In some cases, the individual is tested for markers associated with the onset and / or severity of cytokine release syndrome, such as C-reactive protein, IL-6, TNF-α, and / or ferritin.

[0209] Examples of suicide genes include engineered non-secreted (including membrane-bound) tumor necrosis factor (TNF)-α mutant polypeptides (see PCT / US19 / 62009, incorporated herein by reference in its entirety), which may be affected by delivery of antibodies that bind to TNF-α mutants. Examples of suicide gene / prodrug combinations that may be used include herpes simplex virus thymidine kinase (HSV-tk) and ganciclovir, acyclovir, or FIAU; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase-thymidylate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside. Escherichia coli purine nucleoside phosphorylase, a so-called suicide gene that converts the prodrug 6-methylpurine deoxyriboside to the toxic purine 6-methylpurine, may also be used. Other examples of suicide genes include CD20, CD52, inducible caspase 9, purine nucleoside phosphorylase (PNP), cytochrome p450 enzymes (CYP), carboxypeptidase (CP), carboxylesterase (CE), nitroreductase (NTR), guanine ribosyltransferase (XGRTP), glycosidase enzymes, methionine-α,γ-lyase (MET), and thymidine phosphorylase (TP).

[0210] In certain embodiments, a vector encoding an engineered antigen receptor (e.g., a CAR and / or a TCR), or any vector in a cell (e.g., an NK cell) encompassed herein, comprises one or more suicide genes. The suicide gene may or may not be on the same vector as the engineered antigen receptor. If the suicide gene is on the same vector as the engineered antigen receptor, the suicide gene and the engineered antigen receptor may be separated, for example, by an IRES or 2A (e.g., P2A, T2A, etc.) element.

[0211] D. Cytokines In some embodiments, the cells disclosed herein (e.g., NK cells) are engineered to express one or more heterologous cytokines and / or to upregulate the normal expression of one or more heterologous cytokines. The cells may or may not be transduced or transfected with one or more cytokines on the same vector as other genes.

[0212] One or more cytokines may be coexpressed from vectors containing polypeptides separate from the engineered antigen receptor and / or suicide gene. For example, interleukin-15 (IL-15) is tissue-restricted and is only observed at any serum or systemic levels under pathological conditions. IL-15 possesses several desirable properties for adoptive therapy. IL-15 is a homeostatic cytokine that promotes the eradication of established tumors by inducing the development and proliferation of natural killer cells and relieving the functional suppression of tumor-resident cells, thereby inhibiting activation-induced cell death (AICD). In addition to IL-15, other cytokines are also contemplated. These include, but are not limited to, cytokines, chemokines, and other molecules that contribute to the activation and proliferation of cells used in human applications. IL-15-expressing NK cells enable sustained supportive cytokine signaling, which is beneficial for survival after infusion.

[0213] In specific embodiments, the cells express one or more exogenously supplied cytokines. By way of example, the cytokines are IL-15, IL-12, IL-2, IL-18, IL-21, IL-23, GMCSF, or a combination thereof. Cytokines can be exogenously supplied to cells (e.g., NK cells) by being expressed from an expression vector within the cells. Alternatively, endogenous cytokines within cells are upregulated by manipulation of the expression control of the endogenous cytokine, such as by genetic modification of the cytokine's promoter site. When cytokines are provided to cells on an expression construct, the cytokine can be encoded from the same vector as the suicide gene and / or CAR. In some embodiments, the present disclosure relates to the inactivation and optional preservation of NK cells, wherein the NK cells comprise one or more CARs, IL-15, and optionally a suicide gene.

[0214] E. Endogenous gene knockout or knockdown In some embodiments, the inactivated and cryopreserved cells of the present disclosure are modified to alter the expression of certain genes, such as glucocorticoid receptor, TGFβ receptor (e.g., TGFβ-RII), and / or CISH. In one embodiment, immune cells may be modified to express the major negative TGFβ receptor II (TGFβRIIDN), which can function as a cytokine sink to deplete endogenous TGFβ.

[0215] Cytokine signaling is important for the normal function of hematopoietic cells. The SOCS family of proteins acts as an intrinsic brake and plays a key role in the negative regulation of cytokine signaling. CIS, a member of the SOCS family of proteins encoded by the CISH gene, has been identified as an important checkpoint molecule in mouse NK cells. That is, in some embodiments, the present disclosure provides a method for the regulation of cytokine signaling in NK cells and CD8 cells, for example. +This study relates to knockout of CISH in immune cells to improve T cell cytotoxicity. This approach may be used alone or in combination with other checkpoint inhibitors to improve anti-tumor activity.

[0216] In some embodiments, altered gene expression is achieved by disrupting a gene, for example by knocking out, inserting, missense or biallelic frameshift mutations, deleting all or part of a gene, for example one or more exons or parts thereof, and / or knocking in. For example, altered gene expression can be achieved by sequence-specific or targeted nucleases, including DNA-binding targeted nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), and RNA-guided nucleases such as CRISPR-associated nucleases (Cas), which are specifically designed to target the sequence of a gene or part thereof.

[0217] In some embodiments, the alteration of gene expression, activity, and / or function is achieved by disrupting the gene. In some aspects, the gene is modified such that its expression is reduced by at least or about 20, 30, or 40%, typically at least or about 50, 60, 70, 80, 90, or 95%, compared to the expression in the absence of the genetic modification or the components introduced to effect the modification.

[0218] In some embodiments, the change is transient or reversible, such that expression of the gene is subsequently restored. In other embodiments, the change is not reversible or transient, e.g., permanent.

[0219] In some embodiments, gene alteration is typically carried out by inducing one or more double-strand breaks and / or one or more single-strand breaks in gene in a targeted manner.In some embodiments, double-strand or single-strand breaks are carried out by nuclease, for example, endonuclease, such as gene-targeting nuclease.In some aspects, breaks are induced in the coding region of gene, for example, in exon.For example, in some embodiments, induction occurs near the N-terminal part of coding region, for example, in the first exon, the second exon, or subsequent exon.

[0220] In some aspects, double-strand or single-strand breaks are repaired through cellular repair processes, for example, by non-homologous end joining (NHEJ) or homology-directed repair (HDR). In some aspects, the repair process is prone to errors, resulting in gene disruption, for example, frameshift mutation, for example, biallelic frameshift mutation, which may lead to complete gene knockout. For example, in some aspects, disruption includes the induction of deletion, mutation, and / or insertion. In some embodiments, disruption results in the presence of premature stop codon. In some aspects, insertion, deletion, translocation, frameshift mutation, and / or the presence of premature stop codon leads to disruption of gene expression, activity, and / or function.

[0221] In some embodiments, gene alterations are achieved using antisense techniques, such as RNA interference (RNAi), short interfering RNA (siRNA), short hairpin (shRNA), and / or ribozymes, to selectively suppress or silence gene expression. siRNA technology is RNAi, which uses double-stranded RNA molecules with a sequence homologous to and complementary to the nucleotide sequence of mRNA transcribed from a gene. siRNAs generally may be homologous / complementary to a single region of mRNA transcribed from a gene, or may comprise multiple RNA molecules homologous / complementary to different regions. In some embodiments, siRNAs are contained in polycistronic constructs.

[0222] In some embodiments, the cells of the instant disclosure can also include gene editing of the cells to remove one, two, three, four, five, six, seven, eight, nine, ten, or more endogenous genes in the cells. In some cases, gene editing is performed in NK cells that express one or more xenogeneic antigen receptors, while in other cases, gene editing is performed in at least some cases in NK cells that do not express xenogeneic antigen receptors but will eventually express one or more xenogeneic antigen receptors. In certain embodiments, the NK cells that are gene edited are expanded and / or activated NK cells. In certain embodiments, the NK cells that are gene edited are inactivated or previously inactivated NK cells.

[0223] In certain embodiments, one or more endogenous genes of NK cells are modified, such as disrupted expression, which reduces part or all of the expression.In certain cases, one or more genes are knocked down or knocked out using the process of the present disclosure.In certain cases, multiple genes are knocked down or knocked out in the same process of the present disclosure.The gene that is edited in NK cells can be any, but in a specific embodiment, the gene is a gene whose gene product inhibits the activity and / or proliferation of NK cells.In certain cases, the gene that is edited in NK cells allows NK cells to work more effectively in tumor microenvironment. In specific cases, the gene is one or more of NKG2A, SIGLEC-7, LAG3, TIM3, CISH, FOXO1, TGFBR2, TIGIT, CD96, ADORA2, NR3C1, PD1, PDL-1, PDL-2, CD47, SIRPA, SHIP1, ADAM17, RPS6, 4EBP1, CD25, CD40, IL21R, ICAM1, CD95, CD80, CD86, IL10R, TDAG8, CD5, CD7, SLAMF7, CD38, LAG3, TCR, β2-microglobulin, HLA, CD73, CREB, CREM, ICER, and CD39. In specific embodiments, the TGFBR2 gene is knocked out or knocked down in NK cells.

[0224] 1. ZFPs and ZFNs In some embodiments, the DNA target molecule comprises a DNA-binding protein, such as one or more zinc finger proteins (ZFPs) or transcription activator-like proteins (TALs), fused to an effector protein, such as an endonuclease. Examples include ZFNs, TALEs, and TALENs.

[0225] In some embodiments, the DNA target molecule comprises one or more zinc finger proteins (ZFPs) or domains thereof that bind to DNA in a sequence-specific manner. A ZFP or domain thereof is a protein or domain within a larger protein that binds to DNA in a sequence-specific manner through one or more zinc fingers, i.e., a region of amino acid sequence within the binding domain whose structure is stabilized by the coordination of zinc ions. The term "zinc finger DNA-binding protein" is often abbreviated as zinc finger protein or ZFP. Among ZFPs are artificial ZFP domains that are generated by the assembly of individual fingers and target specific DNA sequences, typically 9-18 nucleotides in length.

[0226] ZFPs comprise proteins with a single finger domain approximately 30 amino acids in length, an alpha helix containing two invariant histidine residues in which two cysteines in a single beta turn coordinate with zinc, and have two, three, four, five, or six fingers. Generally, the sequence specificity of a ZFP can be altered by making amino acid substitutions in the four helical positions (-1, 2, 3, and 6) of the zinc finger recognition helix. Thus, in some embodiments, the ZFP or ZFP-containing molecule is not naturally occurring, but rather is engineered to bind, for example, to a selected target site.

[0227] In some embodiments, the DNA target molecule is or includes a zinc finger DNA binding domain fused to a DNA cleavage domain, forming a zinc finger nuclease (ZFN). In some embodiments, the fusion protein includes a cleavage domain (or cleavage half-domain) derived from at least one type IIS restriction enzyme and one or more zinc finger binding domains, which may be engineered or unengineered. In some embodiments, the cleavage domain is derived from the type IIS restriction endonuclease Fok I. Fok I generally catalyzes double-stranded cleavage of DNA, located 9 nucleotides from its recognition site on one strand and 13 nucleotides from its recognition site on the other strand.

[0228] Many gene-specific engineered zinc fingers are commercially available. For example, Sangamo Biosciences (Richmond, CA, USA) has developed a zinc finger construction platform (CompoZr) in collaboration with Sigma-Aldrich (St. Louis, MO, USA), allowing researchers to completely omit the construction and validation of zinc fingers and providing zinc fingers specifically targeted to thousands of proteins (Gaj et al., Trends in Biotechnology, 2013, 31(7), pp. 397-405). In some embodiments, commercially available zinc fingers are used or specifically designed (see, for example, Sigma-Aldrich catalog numbers CSTZFND, CSTZFN, CTil-lKT, and PZD0020). 2. TAL, TALE, and TALEN

[0229] In some embodiments, the DNA target molecule comprises a naturally occurring or engineered (non-naturally occurring) transcription activator-like protein (TAL) DNA binding domain, e.g., in a transcription activator-like protein effector (TALE) protein. See, e.g., U.S. Patent Publication No. 2011 / 0301073, which is incorporated herein by reference in its entirety.

[0230] A TALE DNA-binding domain, or TALE, is a polypeptide containing one or more TALE repeat domains / units. The repeat domains are responsible for binding of the TALE to its associated target DNA sequence. A single "repeat unit" (also referred to as a "repeat") is typically 33-35 amino acids in length and exhibits at least some sequence homology to other TALE repeat sequences in naturally occurring TALE proteins. Each TALE repeat unit contains one or two DNA-binding residues, typically forming a repeat variable dinucleotide (RVD) at positions 12 and / or 13 of the repeat. The natural (canonical) codes for DNA recognition of these TALEs have been determined, whereby the HD sequence at positions 12 and 13 results in binding to cytosine (C), NG binds to T, NI binds to A, NN binds to G or A, and NO binds to T; non-canonical (non-classical) RVDs are also known. In some embodiments, TALEs can be targeted to any gene by designing TAL arrays with specificity for the target DNA sequence. The target sequence generally begins with a thymidine.

[0231] In some embodiments, the molecule is a DNA-binding endonuclease, such as a TALE nuclease (TALEN). In some aspects, a TALEN is a fusion protein comprising a TALE-derived DNA-binding domain and a nuclease catalytic domain for cleaving a nucleic acid target sequence.

[0232] In some embodiments, TALENs recognize and cleave target sequences in genes. In some aspects, DNA cleavage results in double-strand breaks. In some aspects, cleavage promotes the rate of homologous recombination or non-homologous end joining (NHEJ). Generally, NHEJ is an incomplete repair process, often resulting in changes in the DNA sequence at the cleavage site. In some aspects, the repair mechanism involves rejoining the remaining portions of the two DNA ends by direct religation or so-called microhomology-mediated end joining. In some embodiments, NHEJ-mediated repair results in small insertions or deletions, which can be used to disrupt and thereby silence genes. In some embodiments, the modification can be a substitution, deletion, or addition of at least one nucleotide. In some aspects, cells in which cleavage-induced mutagenesis events, i.e., mutagenesis events subsequent to NHEJ events, have occurred can be identified and / or selected by methods well known in the art.

[0233] In some embodiments, TALE repeats are assembled to specifically target genes (Gaj et al., 2013). A library of TALENs targeting 18,740 human protein-encoding genes has been constructed (Kim et al., 2013). Specially designed TALE arrays are commercially available from Cellectis Bioresearch (Paris, France), Transposagen Biopharmaceuticals (Lexington, KY, USA), and Life Technologies (Grand Island, NY, USA). Specifically, TALENs targeting CD38 are commercially available (see Gencopoeia, catalog numbers HTN222870-1, HTN222870-2, and HTN222870-3). Exemplary molecules are described, for example, in U.S. Patent Publication Nos. 2014 / 0120622 and 2013 / 0315884.

[0234] In some embodiments, TALENs are introduced as transgenes encoded by one or more plasmid vectors. In some aspects, the plasmid vectors may contain selectable markers that provide for identification and / or selection of cells that have received the vector.

[0235] 3. RGEN (CRISPR / Cas system) In some embodiments, the modification is carried out using one or more DNA-binding nucleic acids, such as modification via RNA-guided endonuclease (RGEN). For example, the modification can be carried out using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated (Cas) proteins. Generally, the term "CRISPR system" refers collectively to the transcripts and other elements involved in directing the expression or activity of CRISPR-associated ("Cas") genes, including the sequence encoding the Cas gene, the tracr (trans-activating CRISPR) sequence (e.g., tracrRNA or active part tracrRNA), the tracr-mate sequence (including "direct repeat" and tracrRNA-processing part direct repeat in the context of endogenous CRISPR systems), the guide sequence (also referred to as "spacer" in the context of endogenous CRISPR systems), and / or other sequences and transcripts from the CRISPR locus. Methods for utilizing CRISPR systems are well known in the art, but will be briefly described herein.

[0236] A CRISPR / Cas nuclease or CRISPR / Cas nuclease system can include a non-coding RNA molecule (guide) RNA that binds to DNA in a sequence-specific manner and a Cas protein (e.g., Cas9) that has nuclease functionality (e.g., two nuclease domains). One or more elements of a CRISPR system can be derived from a Type I, Type II, or Type III CRISPR system derived from a particular organism that contains an endogenous CRISPR system, such as, for example, Streptococcus pyogenes.

[0237] In some embodiments, a Cas nuclease and a gRNA (comprising a fusion of a target sequence-specific crRNA and a fixed tracrRNA) are introduced into cells. Generally, a target site at the 5' end of the gRNA targets the Cas nuclease to the target site, e.g., a gene, using complementary base pairing. The target site may be selected based on the position immediately 5' of the protospacer adjacent motif (PAM) sequence, which is typically NGG or NAG. In this regard, the gRNA is targeted to a desired sequence by modifying the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11, or 10 nucleotides of the guide RNA to correspond to the target DNA sequence. In general, CRISPR systems are characterized by elements that promote the formation of a CRISPR complex at the site of the target sequence. Typically, the term "target sequence" generally refers to a sequence to which the guide sequence is designed to have complementarity, and hybridization between the target sequence and the guide sequence promotes the formation of a CRISPR complex. Absolute complementarity is not necessary, provided there is sufficient complementarity to allow hybridization to occur and promote formation of a CRISPR complex.

[0238] As discussed herein, the CRISPR system can involve a double-strand break (DSB) at the target site followed by disruption or alteration. In other embodiments, a Cas9 variant considered a "nickase" is used to create a single-strand nick at the target site. For example, to improve specificity, a pair of nickases can be used, each directed by a pair of different gRNA target sequences, thereby introducing a 5' overhang when simultaneously introducing a nick. In other embodiments, a catalytically inactive Cas9 is fused to a heterologous effector domain, such as a transcriptional repressor or activator, to affect gene expression.

[0239] The target sequence may comprise any polynucleotide, such as a DNA or RNA polynucleotide. The target sequence may be located in the nucleus or cytoplasm of a cell, for example, in a cellular organelle. Generally, a sequence or template that can be used for recombination into a targeted locus that includes a target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence." In some embodiments, an exogenous template polynucleotide may be referred to as an editing template. In some embodiments, the recombination is homologous recombination.

[0240] Typically, in the context of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands within or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50, or more base pairs from the target sequence). A tracr sequence comprising or consisting of all or a portion of a wild-type tracr sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of the wild-type tracr sequence) can form part of a CRISPR complex, such as by hybridization to all or a portion of a tracr mate sequence operably linked to the guide sequence along at least a portion of the tracr sequence. The tracr sequence has sufficient complementarity to the tracr mate sequence to hybridize and contribute to the formation of a CRISPR complex, e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, or 99% sequence complementarity along the length of the tracr mate sequence when optimally aligned.

[0241] One or more vectors driving the expression of one or more elements of the CRISPR system can be introduced into cells so that the expression of the elements directs the formation of a CRISPR complex at one or more target sites. Components can also be delivered to cells as proteins and / or RNA. For example, a Cas enzyme, a guide sequence linked to a tracr mate sequence, and a tracr sequence are each operably linked to separate control elements on separate vectors. Alternatively, two or more elements expressed from the same or different control elements can be combined into a single vector, such that one or more additional vectors provide any components of the CRISPR system not included in the first vector. A vector can include one or more insertion sites, such as restriction endonuclease recognition sequences (also referred to as "cloning sites"). In some embodiments, the one or more insertion sites are located upstream and / or downstream of one or more sequence elements of one or more vectors. When multiple different guide sequences are used, a single expression construct can be used to target CRISPR activity to multiple different corresponding target sequences in a cell.

[0242] The vector can include control elements operably linked to an enzyme-coding sequence that encodes a CRISPR enzyme, such as a Cas protein. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; for example, the amino acid sequence of the S. pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2.

[0243] The CRISPR enzyme can be Cas9 (e.g., from S. pyogenes or S. pneumonia). The CRISPR enzyme can direct cleavage of one or both strands at the location of a target sequence, for example, within the target sequence and / or within the complement of the target sequence. The vector can encode a CRISPR enzyme mutated relative to the corresponding wild-type enzyme, such that the mutated CRISPR enzyme lacks the ability to cleave one or both strands of a target polynucleotide containing the target sequence. For example, an aspartate-to-alanine substitution (D10A) in the RuvC I catalytic domain of S. pyogenes-derived Cas9 converts Cas9 from a nuclease that cleaves both strands into a nickase (cleaving a single strand). In some embodiments, Cas9 nickase can be used in combination with guide sequences, e.g., two guide sequences that target the sense and antisense strands of a DNA target, respectively. This combination allows for the creation of nicks in both strands and the use of these to induce NHEJ or HDR.

[0244] In some embodiments, the enzyme coding sequence encoding the CRISPR enzyme is codon-optimized for expression in a specific cell, such as a eukaryotic cell. The eukaryotic cell may be a cell of or derived from a specific organism, such as a mammal, including, but not limited to, a human, mouse, rat, rabbit, dog, sheep, or non-human primate. Generally, codon optimization refers to the process of modifying a nucleic acid sequence to enhance expression in a target host cell by maintaining the native amino acid sequence and replacing at least one codon in the native sequence with a codon that is more frequently or most frequently used in the host cell's genes. Different species exhibit specific biases for certain codons for specific amino acids. Codon bias (differences in codon usage between organisms) often correlates with the efficiency of messenger RNA (mRNA) translation, which is thought to depend, inter alia, on the properties of the codon being translated and the availability of specific transfer RNA (tRNA) molecules. The dominance of a selected tRNA in a cell generally reflects the codon most frequently used in peptide synthesis. Thus, genes can be adjusted based on codon optimization to optimize gene expression in a given organism.

[0245] Generally, a guide sequence is any polynucleotide sequence that has sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and direct sequence-specific binding of a CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using a suitable alignment algorithm, is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more.

[0246] Exemplary gRNA sequences for NR3CS (glucocorticoid receptor) include Ex3 NR3C1 sG1 5-TGC TGT TGA GGA GCT GGA-3 (SEQ ID NO: 1) and Ex3 NR3C1 sG2 5-AGC ACA CCA GGC AGA GTT-3 (SEQ ID NO: 2). Exemplary gRNA sequences for TGF-beta receptor 2 include Ex3 TGFBR2 sG1 5-CGG CTG AGG AGC GGA AGA-3 (SEQ ID NO: 3) and Ex3 TGFBR2 sG2 5-TGG-AGG-TGA-GCA-ATC-CCC-3 (SEQ ID NO: 4). The T7 promoter, target sequence, and overlapping sequence may have the sequence TTAATACGACTCACTATAGG (SEQ ID NO: 5) + target sequence + gttttagagctagaaatagc (SEQ ID NO: 6).

[0247] Optimal alignment may be determined using any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).

[0248] CRISPR enzymes can be part of fusion proteins that contain one or more heterologous protein domains.CRISPR enzyme fusion proteins can contain any additional protein sequence and optionally a linker sequence between any two domains.Examples of protein domains that can be fused to CRISPR enzymes include, but are not limited to, epitope tags, reporter gene sequences, and protein domains with one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription deactivation factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity.Non-limiting examples of epitope tags include histidine (His) tag, V5 tag, FLAG tag, influenza hemagglutinin (HA) tag, Myc tag, VSV-G tag, and thioredoxin (Trx) tag. Examples of reporter genes include, but are not limited to, glutathione-5-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), beta-galactosidase, beta-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins, including blue fluorescent protein (BFP). CRISPR enzymes may be fused to gene sequences encoding proteins or protein fragments that bind to DNA molecules or other intracellular molecules, including, but not limited to, maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusions, GAL4A DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. Additional domains that can form part of fusion proteins containing CRISPR enzymes are described in US20110059502, which is incorporated herein by reference.

[0249] D. Method of Delivery The cells encompassed herein may harbor a recombinant vector. In some embodiments, the cells may be transformed, transfected, and / or transduced prior to inactivation and cryopreservation, or following thawing after inactivation and cryopreservation. Those skilled in the art are well-versed in constructing vectors for expression of the antigen receptors of the present disclosure by standard recombinant techniques (see, e.g., Sambrook et al., 2001 and Ausubel et al., 1996, incorporated herein by reference). Vectors include, but are not limited to, plasmids, cosmids, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs), such as retroviral vectors (e.g., derived from Moloney murine leukemia virus vector (MoMLV), MSCV, SFFV, MPSV, SNV, etc.), lentiviral vectors (e.g., derived from HIV-1, HIV-2, SIV, BIV, FIV, etc.), adenoviruses (Ad), including replication-competent, replication-deficient, and disabled forms thereof. vectors, including adeno-associated virus (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papilloma virus vectors, Epstein-Barr virus vectors, herpes simplex virus vectors, vaccinia virus vectors, Harvey murine sarcoma virus vectors, mouse mammary tumor virus vectors, Rous sarcoma virus vectors, parvovirus vectors, poliovirus vectors, vesicular stomatitis virus vectors, Maraba virus vectors, and group B adenovirus endothelial cell carcinoma (ADENO) vectors.

[0250] 1. Viral Vectors A viral vector encoding an antigen receptor is provided in certain embodiments of the present disclosure. In generating a recombinant viral vector, non-essential genes are typically replaced with genes or coding sequences for heterologous (or non-native) proteins. A viral vector is a type of expression construct that utilizes viral sequences to introduce nucleic acids and possibly proteins into cells. The ability of certain viruses to infect or enter cells by receptor-mediated endocytosis, integrate into the host cell genome, and stably and efficiently express viral genes makes them attractive candidates for transferring foreign nucleic acids into cells (e.g., mammalian cells). Non-limiting examples of viral vectors used to deliver nucleic acids in certain embodiments of the present invention are described below.

[0251] Lentiviruses are complex retroviruses that contain, in addition to the common retroviral genes gag, pol, and env, other genes with regulatory or structural functions. Lentiviral vectors are well known in the art (see, e.g., U.S. Patent Nos. 6,013,516 and 5,994,136).

[0252] Recombinant lentiviral vectors can infect non-dividing cells and can be used for in vivo and ex vivo gene transfer and expression of nucleic acid sequences. For example, recombinant lentiviruses capable of infecting non-dividing cells (suitable host cells are transfected with two or more vectors carrying packaging functions, i.e., gag, pol, and env, and rev and tat) are described in U.S. Patent No. 5,994,136, which is incorporated herein by reference.

[0253] 2. Control Elements The expression cassette contained in the vector useful in the present disclosure specifically includes (in the 5' to 3' direction) a eukaryotic transcriptional promoter operably linked to the protein-coding sequence, a splice signal including intervening sequences, and a transcription termination / polyadenylation sequence. The promoters and enhancers that control the transcription of protein-coding genes in eukaryotic cells are composed of multiple genetic elements. The cellular machinery can collect and integrate the regulatory information delivered by each element, allowing different genes to evolve unique, often complex, patterns of transcriptional regulation. Promoters used in connection with the present disclosure include constitutive promoters, inducible promoters, and tissue-specific promoters.

[0254] 3. Promoter / Enhancer The expression constructs provided herein include a promoter that drives expression of an antigen receptor. Promoters generally contain sequences that function to position the start site for RNA synthesis. The most well-known example is the TATA box, but in some promoters that lack a TATA box, such as the mammalian terminal deoxynucleotidyl transferase gene promoter and the SV40 late gene promoter, individual elements above the start site themselves serve to fix the location of initiation. Additional promoter elements control the frequency of transcription initiation. Typically, these are located in the region 30-110 bp upstream of the start site, although some promoters have been shown to contain functional elements downstream of the start site. To place a coding sequence "under the control" of a promoter, the 5' end of the transcription start site of the transcriptional reading frame is positioned "downstream" (i.e., 3' end) of the selected promoter. The "upstream" promoter stimulates DNA transcription and promotes expression of the encoded RNA.

[0255] The spacing of promoter elements is often variable, so promoter function is maintained when elements are inverted or moved relative to one another. In the tk promoter, the spacing of promoter elements can be increased to 50 bp apart before activity begins to decline. Depending on the promoter, individual elements appear to be able to function cooperatively or independently to activate transcription. Promoters may or may not be used in conjunction with "enhancers." An "enhancer" refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

[0256] A promoter may be a promoter naturally associated with a nucleic acid sequence, such as a promoter obtained by isolating 5' non-coding sequences located upstream of a coding segment and / or exon. Such a promoter may be referred to as "endogenous." Similarly, an enhancer may be an enhancer naturally associated with a nucleic acid sequence, located downstream or upstream of that sequence. Alternatively, certain advantages may be obtained by placing a coding nucleic acid segment under the control of a recombinant or heterologous promoter. This promoter refers to a promoter not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer also refers to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other virus or prokaryotic or eukaryotic cell, as well as promoters or enhancers that are not "naturally occurring," i.e., promoters or enhancers containing different elements of different transcriptional control regions and / or expression-altering mutations. For example, promoters most commonly used in recombinant DNA constructs include the β-lactamase (penicillinase), lactose, and tryptophan (trp-) promoter systems. In addition to synthetic production of promoter and enhancer nucleic acid sequences, sequences may be produced using recombinant cloning and / or nucleic acid amplification techniques, including PCR™, in connection with the compositions disclosed herein. It is further contemplated that control sequences that direct transcription and / or expression of sequences in mitochondria, chloroplasts, and other non-nuclear organelles may also be employed.

[0257] Of course, it will be important to employ a promoter and / or enhancer that effectively directs expression of the DNA segment in the organelle, cell type, tissue, organ, or organism chosen for expression. Molecular biologists are generally familiar with the use of promoter, enhancer, and cell type combinations for protein expression (see, e.g., Sambrook et al. 1989, incorporated herein by reference). The promoter employed may be constitutive, tissue-specific, inducible, and / or useful under appropriate conditions to direct high levels of expression of the introduced DNA segment, which is advantageous, for example, in large-scale production of recombinant proteins and / or peptides. The promoter may be heterologous or endogenous.

[0258] Additionally, any promoter / enhancer combination (e.g., from the Eukaryotic Promoter Data Base EPDB, available on the World Wide Web at epd.isb-sib.ch / ) can be used to drive expression. The use of T3, T7, or SP6 cytoplasmic expression systems is another possible embodiment. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if an appropriate bacterial polymerase is provided as part of the delivery complex or as an additional gene expression construct.

[0259] Non-limiting examples of promoters include immediate early or late viral promoters, such as the SV40 early or late promoter, the cytomegalovirus (CMV) immediate early promoter, the Rous sarcoma virus (RSV) early promoter, eukaryotic promoters (e.g., beta-actin promoter, GAPDH promoter, metallothionein promoter, and linked response element promoters, such as the cyclic AMP response element promoter (cre), serum response element promoter (sre), phorbol ester promoter (TPA), and minimal TATA box nearby response element promoter (tre). It is also possible to use a human growth hormone promoter sequence (e.g., the human growth hormone minimal promoter set forth in Genbank Accession No. X05244, nucleotides 283-341) or a mouse mammary tumor promoter (available from the ATCC, catalog number ATCC 45007). In certain embodiments, the promoter is selected from the group consisting of CMV IE, dectin-1, dectin-2, human CD11c, F4 / 80, SM22, RSV, SV40, Ad MLP, beta-actin, MHC class I or MHC class II promoters, but any other promoter useful for driving expression of therapeutic genes is also applicable to the practice of the present disclosure.

[0260] In certain aspects, the methods of the present disclosure also relate to enhancer sequences, i.e., nucleic acid sequences that have the potential to increase promoter activity and act in cis over relatively long distances (up to several kilobases away from the target promoter), regardless of its orientation. However, enhancer function is not necessarily limited to such long distances and can also function in close proximity to a given promoter.

[0261] 4. Initiation Signal and Linked Expression Specific initiation signals may be used in the expression constructs provided herein for efficient translation of the coding sequence. These signals include the ATG start codon or nearby sequences. Exogenous translational control signals, including the ATG start codon, must be provided. One of ordinary skill in the art can readily determine this and provide the necessary signals. It is well known that to ensure translation of the entire insert, the start codon must be "in-frame" with the reading frame of the desired coding sequence. Exogenous translational control signals and initiation codons may be natural or synthetic. The efficiency of expression can be enhanced by including appropriate transcriptional enhancer elements.

[0262] In certain embodiments, internal ribosome entry site (IRES) elements are used to create multigene or polycistronic messages. IRES elements can bypass the ribosome scanning model of 5'-methylated Cap-dependent translation and initiate translation at internal sites. IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) and IRESs from mammalian messages have been described. IRES elements can link heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. IRES elements allow each open reading frame to be accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed by transcribing a single message using a single promoter / enhancer.

[0263] Additionally, certain 2A sequence elements can be used to create linked or co-expression of genes in the constructs provided herein. For example, truncation sequences can be used to co-express genes by linking open reading frames to form a single cistron. Exemplary truncation sequences include F2A (foot-and-mouth disease virus 2A) or "2A-like" sequences (e.g., Thosea asigna virus 2A, T2A).

[0264] 5. Origin of replication To propagate a vector in a host cell, the vector may contain one or more origins of replication (often referred to as "ori"), such as a nucleic acid sequence corresponding to the EBV oriP described above or a genetically engineered oriP with a similar or enhanced function in programming. This is the specific nucleic acid sequence from which replication begins. Alternatively, the origins of replication or autonomously replicating sequences (ARS) of other extrachromosomally replicating viruses described above can be employed.

[0265] 6. Selectable and Screenable Markers In some embodiments, cells containing the constructs of the present disclosure may be identified in vitro or in vivo by including a marker in the expression vector. Such a marker confers an identifiable change to the cell, allowing for easy identification of cells containing the expression vector. Generally, a selectable marker is a marker that confers a selectable property. A positive selectable marker is a marker whose presence allows its selection, while a negative selectable marker is a marker whose presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.

[0266] Typically, the inclusion of a drug selection marker aids in the cloning and identification of transformants. For example, genes conferring resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin, and histidinol are useful selection markers. In addition to markers that confer a phenotype that allows for the identification of transformants based on the realization of a condition, other types of markers are contemplated, including screenable markers such as GFP, whose basis is colorimetric analysis. Alternatively, screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized as negative selection markers. Those skilled in the art will know how to employ immunomarkers, perhaps in conjunction with FACS analysis. The marker used is not believed to be critical, so long as it can be expressed simultaneously with the nucleic acid encoding the gene product. Further examples of selectable and screenable markers are well known to those skilled in the art.

[0267] 7. Other methods of nucleic acid delivery In addition to the viral delivery of nucleic acids encoding transgenes described herein, additional methods of delivery of recombinant genes into a given host cell are described below and are contemplated within the present disclosure.

[0268] Nucleic acids, such as DNA or RNA, can be introduced into immune cells of the present disclosure using any suitable method for delivering nucleic acids for cell transformation, as described herein or known to those skilled in the art. Such methods include, but are not limited to, ex vivo transfection, injection, including microinjection, electroporation, calcium phosphate precipitation, the use of DEAE-dextran followed by polyethylene glycol, direct acoustic loading, liposome-mediated transfection and receptor-mediated transfection, microprojectile bombardment, agitation with silicon carbide fibers, Agrobacterium-mediated transformation, desiccation / inhibition-mediated DNA uptake, and any combination of these methods to direct DNA delivery. By applying these techniques, organelles, cells, tissues, or organisms can be stably or transiently transformed.

[0269] IV. Treatment Methods In some embodiments, the present disclosure provides methods for immunotherapy comprising administering an effective amount of the inactivated and cryopreserved cells of the present disclosure following thawing and reactivation. In some embodiments, a medical disease or disorder is treated by transferring a population of previously inactivated and cryopreserved cells, such as a population of NK cells, that elicit an immune response.

[0270] In some embodiments, methods involving the technology of the present disclosure include administering to a subject a therapeutically effective amount of cells (e.g., NK cells) that are optionally loaded, optionally pre-activated, optionally manipulated, optionally expanded, inactivated, optionally cryopreserved, and reactivated (e.g., spontaneous reactivation following removal of an inactivating agent), thereby treating or preventing disease in the subject, including reducing the risk of disease, reducing the severity of disease, and / or delaying the onset of disease. In certain embodiments of the present disclosure, cancer or infection is treated by transferring a composition comprising the cells described herein. In at least some cases where the cells are NK cells, due to their release of proinflammatory cytokines, the NK cells may reverse an anti-inflammatory tumor microenvironment and augment the adaptive immune response by promoting the differentiation, activation, and / or recruitment of accessory immune cells to the malignant site.

[0271] Cells may be thawed using thawing methods and conditions appropriate for clinical products. After thawing, cells may or may not be washed to remove substantially all of the cryopreservation medium and / or inactivating agent prior to administration of the cells to an individual. After thawing, cells may be diluted and injected without washing. Cells may be delivered to an individual substantially immediately upon thawing, or there may be a delay on the order of 1 to 24 hours or one or more days before delivery, including, for example, if the cells are washed prior to injection. Delivery may be by any route and may depend on the medical condition being treated. Delivery may be local or systemic. Regarding the injection volume of the dose of cells to be delivered, the injection volume may or may not depend on whether the subject has previously received a dose of cells. For example, the initial dose of cells may or may not be larger in volume than subsequent doses. Multiple injection volumes may be the same volume. In some embodiments, the injection volume of cells is 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 75, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, or 300 mL or more. The liquid in which cells are suspended for injection can be of any type. In certain embodiments, the liquid is PLASMA-LYTE A or a similar solution. The liquid in which cells are suspended for injection may or may not contain, for example, human serum albumin. Albumin is a cryoprotectant that can also be used as a non-serum substitute, thus having a dual effect. Prior to delivery to an individual in need thereof, the thawed cells may be tested for one or more characteristics, such as the presence of microorganisms, for example, by contamination, viability, cell count, etc. In certain embodiments, the cells for injection are contained in a solution containing one or more therapeutic agents in addition to the cells themselves.

[0272] In certain embodiments of the present disclosure, cancer or infection is treated by transferring a population that has been inactivated and cryopreserved, and subsequently thawed and reactivated, such as a population of NK cells that induces an immune response. Provided herein is a method for treating or delaying the progression of cancer in an individual, comprising administering to the individual an effective amount of antigen-specific cell therapy. This method may be applied to the treatment of immune disorders, solid cancers, blood cancers, viral infections, and regenerative medicine.

[0273] Tumors for which the therapeutic methods of the present invention are useful include any malignant cell type, such as those found in solid tumors or blood tumors. Exemplary solid tumors include, but are not limited to, tumors of organs selected from the group consisting of pancreas, colon, cecum, stomach, brain, head, neck, ovary, kidney, larynx, sarcoma, lung, bladder, melanoma, prostate, and breast. Exemplary blood tumors include bone marrow tumors, T-cell or B-cell malignancies, leukemia, lymphoma, blastoma, myeloma, etc. Further examples of cancers that may be treated using the methods provided herein include, but are not limited to, lung cancer (including small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma), cancer of the peritoneum, stomach or gastric cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney or renal cancer, prostate cancer, vulvar cancer, thyroid cancer, various types of head and neck cancer, and melanoma.

[0274] Cancer may be of the following histological types, among others, but not limited to: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant cell carcinoma and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilonidal carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; cavernous adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma of adenomatous polyps; adenocarcinoma, familial polyposis coli; solid tumor; malignant carcinoid tumor; lobular-alveolar adenocarcinoma; papillary adenocarcinoma; chromatophore carcinoma ;Eosinophilic carcinoma;Eosinophilic adenocarcinoma;Basophilic carcinoma;Clear cell adenocarcinoma;Granular cell carcinoma;Follicular adenocarcinoma;Papillary and follicular adenocarcinoma;Non-encapsulated sclerosing carcinoma;Adrenal cortical carcinoma;Endometrial carcinoma;Cutaneous adenocarcinoma;Apocrine adenocarcinoma;Sebaceous gland carcinoma;Keratin adenocarcinoma;Mucous epidermoid carcinoma;Cystadenocarcinoma;Papillary cystadenocarcinoma;Papillary serous cystadenocarcinoma;Mucinous cystadenocarcinoma;Mucinous adenocarcinoma;Signet ring cell carcinoma;Invasive ductal carcinoma;Medullary carcinoma;Lobular carcinoma;Inflammatory carcinoma;Paget's disease of the breast;Acinic cell carcinoma;Adenosquamous carcinoma;Adenocarcinoma with squamous metaplasia;Thymoma, malignant;Ovarian stromal tumor, malignant;Sarcoma, malignant;Granulosa cell carcinoma Alveolar tumor, malignant;Androblastoma, malignant;Sertoli cell carcinoma;Leydig cell tumor, malignant;Lipocytoma, malignant;Paraganglioma, malignant;Extramammary paraganglioma, malignant;Pheochromocytoma;Angiosarcoma;Malignant melanoma;Amelanotic melanoma;Superficial spreading melanoma;Lentigo maligna melanoma;Lentigo acuminata melanoma;Nodular melanoma;Malignant melanoma of giant pigmented nevus;Epithelioid cell melanoma;Blue nevus, malignant;Sarcoma;Fibrosarcoma;Malignant fibrous histiocytoma;Myxosarcoma;Liposarcoma;Renal cell carcinoma;Leiomyosarcoma;Rhabdomyosarcoma;Embryonic rhabdomyosarcoma;Alveolar rhabdomyosarcoma;Stromatous sarcoma;Mixed tumor, malignant;Müllerian mixed tumor; Nephroblastoma; Hepatoblastoma; Carcinosarcoma; Mesenchymoma, malignant; Brenner tumor, malignant; Philodes tumor, malignant; Synovial sarcoma; Mesothelioma, malignant; Dysembryopathies; Embryonic carcinoma; Teratoma, malignant; Ovarian goiter, malignant; Choriocarcinoma; Mesostosis, malignant; Angiosarcoma; Hemangioendothelioma, malignant; Kaposi's sarcoma; Hemangiopericytoma, malignant; Lymphangiosarcoma; Osteosarcoma; Soft cortical osteosarcoma; Chondrosarcoma; Chondroblastoma, malignant; Mesenchymal chondrosarcoma; Giant cell tumor of bone; Ewing's sarcoma; Odontogenic tumor, malignant; Ameloblastoma, malignant; Ameloblastic odontoma; Ameloblastic fibrosarcoma; Pinealoma, malignant; Chordoma; Glioma, malignant; Ependymoma; Astrocytoma;Protoplasmic astrocytoma; Fibrous astrocytoma; Astroblastoma; Glioblastoma; Oligodendroglioma; Oligodendroglioma; Primitive neuroectodermal tumor; Cerebellar sarcoma; Ganglioneuroblastoma; Neuroblastoma; Retinoblastoma; Olfactory neurogenic tumor; Meningioma, malignant; Neurofibrosarcoma; Schwannoma, malignant; Granular cell tumor, malignant; Malignant lymphoma; Hodgkin's disease; Hodgkin's; Paragranuloma; Malignant lymphoma, small lymphocytic; Malignant lymphoma, large cell, diffuse; Malignant lymphoma, follicular; Mycosis fungoides; Other specified non-Hodgkin's lymphoma; B-cell lymphoma; Low-grade / follicular non-Hodgkin's lymphoma (NHL); Small lymphocytic (SL) NHL; Intermediate-grade / follicular NHL; Intermediate-grade diffuse NHL; High-grade immunosuppressant Lymphoblastic NHL; high-grade lymphoblastic NHL; high-grade small non-necrotic cell NHL; bulky disease NHL; mantle cell lymphoma; AIDS-related lymphoma; Waldenstrom's macroglobulinemia; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphocytic leukemia; plasma cell leukemia; erythroid leukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryocytic leukemia; myeloid sarcoma; hairy cell leukemia; chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); acute myeloid leukemia (AML); and chronic myeloblastic leukemia.

[0275] Certain embodiments relate to methods for treating leukemia. Leukemia is a cancer of the blood or bone marrow characterized by the abnormal proliferation (production by proliferation) of blood cells, usually leukocytes (white blood cells), but may also involve red blood cells (erythroleukemia). It is part of a broad group of diseases called hematologic neoplasms. Leukemia is a broad term that covers a spectrum of diseases. Leukemia is divided clinically and pathologically into acute and chronic forms.

[0276] Acute leukemia is characterized by the rapid proliferation of immature blood cells. This overcrowding prevents the bone marrow from producing healthy blood cells. Acute leukemia can occur in children and young adults. In fact, it is the leading cause of childhood death in the United States, more than any other type of malignancy. Acute leukemia requires immediate treatment due to the rapid progression and accumulation of malignant cells, which then leak into the bloodstream and spread to other organs in the body. Central nervous system (CNS) involvement is rare, but cranial nerve paralysis can occasionally occur. Chronic leukemia is distinguished by the excessive accumulation of relatively mature but still abnormal blood cells. It usually progresses over months to years, and these cells are produced at a much higher rate than normal cells, resulting in a large number of abnormal white blood cells in the blood. Chronic leukemia primarily affects older adults, but theoretically can occur at any age. While acute leukemia requires immediate treatment, chronic leukemia may require observation for a period of time before treatment to maximize its effectiveness.

[0277] The disease is further classified as lymphocytic or lymphoblastic, indicating that cancerous changes occur in the type of bone marrow cells that normally form lymphocytes, and myeloid or myeloid, indicating that cancerous changes occur in the type of bone marrow cells that normally form red blood cells, certain white blood cells, and platelets (see Lymphoid vs. Myeloid Cells).

[0278] Acute lymphocytic leukemia (also known as acute lymphoblastic leukemia, ALL) is the most common type of leukemia in young children. The disease also occurs in adults, especially those over 65 years of age. Chronic lymphocytic leukemia (CLL) most commonly occurs in adults over 55 years of age. It can occur in younger adults, but is rare in children. Acute myeloid leukemia (also known as acute myeloid leukemia or AML) occurs more often in adults than children. This type of leukemia was previously called "acute nonlymphocytic leukemia." Chronic myeloid leukemia (CML) primarily affects adults, although a small number of children also develop the disease.

[0279] Lymphoma is a type of cancer that begins in lymphocytes (a type of white blood cell that is part of the immune system of vertebrates). There are many types of lymphoma. According to the National Institutes of Health, lymphoma accounts for approximately 5% of all cancer cases in the United States, with Hodgkin's lymphoma accounting for less than 1% of all cancer cases in the United States. Because the lymphatic system is part of the body's immune system, patients with weakened immune systems, such as those affected by HIV infection or certain drugs or medications, also have a higher incidence of lymphoma.

[0280] In certain embodiments of the present disclosure, compositions comprising inactivated, cryopreserved, thawed, and reactivated cells (e.g., NK cells) are delivered to an individual in need thereof, such as an individual suffering from cancer or an infectious disease. In at least some cases, the cells can enhance the individual's immune system to attack the respective cancer or pathogenic cells. In some cases, the individual is provided with one or more doses of a composition comprising the cells and antibodies of the present disclosure. When an individual receives more than one dose of the cells of the present disclosure, the period between doses should be sufficient to allow time for proliferation in the individual; in specific embodiments, the period between doses is 1, 2, 3, 4, 5, 6, 7, or more days.

[0281] In some embodiments, the source of the (optionally) pre-activated, (optionally) expanded, inactivated and cryopreserved, and subsequently thawed and reactivated NK cells can be any source, but in specific embodiments, the cells are obtained from, for example, umbilical cord blood, peripheral blood, human embryonic stem cells, or induced pluripotent stem cell banks. A suitable dosage for therapeutic effect is, for example, at least 10 5 , or about 10 5 ~about 10 12 The cells are preferably administered in a series of cycles. An exemplary administration regimen includes at least about 10 5 Starting with cells, for example, approximately 10 cells were obtained within a few weeks of initiating an intrapatient dose escalation scheme. 12The treatment consists of four weekly escalating dose cycles to reach a target dose of cells. Suitable modes of administration include intravenous, subcutaneous, intracavitary (e.g., via a reservoir access device), intraperitoneal, or direct injection into the tumor mass.

[0282] In some embodiments, compositions containing cells produced according to the present methods have many potential uses, including experimental and therapeutic applications. In particular, it is anticipated that such cell populations will be useful for suppressing unwanted or inappropriate immune responses. In such methods, a small number of cells (e.g., NK cells) are removed from a patient, manipulated and expanded ex vivo, inactivated, and stored for a period of time, after which the cells are thawed, reactivated, and reinoculated into the patient. Examples of diseases that may be treated in this manner include autoimmune diseases and conditions in which suppression of immune activity is desirable, such as allograft tolerance. Treatment methods may include obtaining NK cells from a mammal; expanding the NK cells ex vivo according to the present methods as described herein; inactivating and cryopreserving the cells according to the methods described herein; thawing and reactivating the cells according to the methods described herein; and administering a composition containing the NK cells to the mammal to be treated.

[0283] The pharmaceutical compositions of the present disclosure, including the cells of the present disclosure, can be used alone or in combination with other well-established drugs useful in the treatment of cancer. Whether delivered alone or in combination with other drugs, the pharmaceutical compositions of the present disclosure can be delivered to various sites within the mammalian, particularly human, body via various routes to achieve a specific effect. Those skilled in the art will recognize that, while multiple routes of administration can be used, certain routes may provide a more immediate and effective response than others. For example, intradermal administration may be advantageously used over inhalation for the treatment of melanoma. Local or systemic delivery can be achieved by application or injection of the formulation into a body cavity, inhalation or insufflation of an aerosol, or parenteral introduction, including intramuscular, intravenous, intraportal, intrahepatic, intraperitoneal, subcutaneous, or intradermal administration.

[0284] Certain embodiments of the present disclosure provide methods for treating or preventing immune-mediated disorders. In one embodiment, the subject has an autoimmune disease. Non-limiting examples of autoimmune diseases include: alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune diseases of the adrenal gland, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis and orchitis, autoimmune thrombocytopenia, Behçet's disease, bullous pemphigoid, cardiomyopathy, celiac hidrotic dermatitis, chronic fatigue and immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA neuropathy, juvenile arthritis, lichen planus, Systemic lupus erythematosus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, type 1 or immune-mediated diabetes, myasthenia gravis, nephrotic syndrome (including minimal change disease, focal glomerulosclerosis, and membranous nephropathy), pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, and primary cholesteatoma. Autoimmune diseases include, but are not limited to, cirrhosis of the liver, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, stiff-man syndrome, systemic lupus erythematosus, lupus erythematosus, ulcerative colitis, uveitis, vasculitis (such as polyarteritis nodosa, Takayasu's arteritis, temporal arteritis / giant cell arteritis, or dermatitis herpetiformis vasculitis), vitiligo, and Wegener's granulomatosis.Therefore, some examples of autoimmune diseases that can be treated using the methods disclosed herein include, but are not limited to, multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, type I diabetes, Crohn's disease; ulcerative colitis, myasthenia gravis, glomerulonephritis, ankylosing spondylitis, vasculitis, or psoriasis.The subject may also have an allergic disease, such as asthma.

[0285] In yet another embodiment, the subject is a recipient of a transplanted organ or stem cells, and the immune cells are used to prevent and / or treat rejection. In certain embodiments, the subject has or is at risk of developing graft-versus-host disease. GVHD can be a complication of transplants that use or involve stem cells from either related or unrelated donors. There are two types of GVHD: acute and chronic. Acute GVHD appears within three months of transplant. Signs of acute GVHD include a reddish skin rash that initially involves a small area of ​​the body (chest, back, arms, legs), which can spread to involve 80% or more of the body, resulting in peeling, blistering, and severe disease. Acute GVHD can also affect the gastrointestinal (GI) tract, causing nausea and vomiting (upper GI GVHD) and abdominal cramps and diarrhea (lower GI GVHD). Yellowing of the skin and eyes (jaundice) indicates that acute GVHD is affecting the liver. Chronic GVHD is graded by severity: Stage / Grade 1 is mild, Stage / Grade 4 is severe. Chronic GVHD develops three months or more after transplantation. Symptoms of chronic GVHD are similar to those of acute GVHD, but chronic GVHD can also affect the mucosal glands of the eyes, salivary glands in the mouth, the mucous membranes of the stomach, and glands that lubricate the intestines. Any of the populations of immune cells disclosed herein can be utilized. Examples of transplanted organs include solid organ transplants such as kidney, liver, skin, pancreas, lung, and / or heart, or cell transplants such as pancreatic islets, hepatocytes, myoblasts, bone marrow, or hematopoietic or other stem cells. Transplants can also be composite transplants, such as facial tissue. Immune cells can be administered before, simultaneously with, or after transplantation. In some embodiments, the immune cells are administered prior to transplantation, e.g., at least 1 hour, at least 12 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 1 month prior to transplantation. In certain non-limiting examples, administration of a therapeutically effective amount of immune cells occurs 3-5 days prior to transplantation.

[0286] In some embodiments, the cells described herein administered to a patient receiving a transplant can be sensitized with an antigen specific to the transplant material prior to administration. This embodiment results in the transplant recipient experiencing a reduced immune / inflammatory response to the transplanted material, thereby minimizing the likelihood of rejection of the transplanted tissue. Similarly, for the treatment of graft-versus-host disease, cells (e.g., NK cells) can be sensitized with an antigen specific to the host. This embodiment results in the recipient experiencing a reduced immune / inflammatory response to self-antigens.

[0287] Administration of compositions comprising the cells described herein can be used whenever immunosuppression or anti-inflammatory effects are desired, e.g., at the first signs or symptoms of disease or inflammation. These may be general, such as pain, edema, or elevated temperature, or specific signs or symptoms associated with dysfunction of the affected organ, such as elevated serum creatinine levels in kidney transplant rejection, rash in GVHD, or shortness of breath or wheezing in asthma.

[0288] In further embodiments, administering a therapeutically effective amount of a composition comprising the cells described herein to a subject treats or suppresses inflammation in the subject. Thus, the method includes administering a therapeutically effective amount of a composition comprising the cells described herein (e.g., NK cells) to a subject to inhibit the inflammatory process. Examples of inflammatory diseases include, but are not limited to, asthma, encephalitis, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), allergic diseases, septic shock, pulmonary fibrosis, undifferentiated spondyloarthropathy, undifferentiated arthropathy, arthritis, inflammatory osteolysis, and chronic inflammation resulting from chronic viral or bacterial infection. The methods disclosed herein can also be used to treat allergic diseases.

[0289] In some embodiments, the subject may be administered non-myeloablative lymphodepleting chemotherapy prior to the immune cell therapy comprising the cells described herein. The non-myeloablative lymphodepleting chemotherapy may be any suitable therapy and may be administered by any suitable route. The non-myeloablative lymphodepleting chemotherapy may include the administration of cyclophosphamide and fludarabine, for example, particularly when the cancer is melanoma, which may be metastatic. An exemplary route for administering cyclophosphamide and fludarabine is intravenous. Similarly, any suitable dose of cyclophosphamide and fludarabine may be administered, which is the most common regimen for lymphodepleting chemotherapy prior to the administration of CAR-T cells or CAR-NK cells. In certain embodiments, about 60 mg / kg of cyclophosphamide is administered over two days, followed by about 25 mg / m 2 of fludarabine is given over 5 days.

[0290] In certain embodiments, a growth factor that promotes the proliferation and activation of immune cells is administered to a subject concomitantly with or subsequent to the administration of immune cells. The immune cell growth factor may be any suitable growth factor that promotes the proliferation and activation of immune cells. Examples of suitable immune cell growth factors include interleukin (IL)-2, IL-7, IL-15, and IL-12, which may be used alone or in various combinations, such as IL-2 and IL-7, IL-2 and IL-15, IL-7 and IL-15, IL-2, IL-7 and IL-15, IL-12 and IL-7, IL-12 and IL-15, or IL-12 and IL-2.

[0291] Therapeutically effective doses of immune cells can be administered by several routes, including parenteral administration, for example, intravenous, intraperitoneal, intramuscular, intrasternal, or intraarticular injection or infusion.

[0292] A therapeutically effective dose of immune cells for use in adoptive cell therapy is an amount that achieves the desired effect in the treated subject.For example, this may be the dose of immune cells required to inhibit the progression or cause regression of an autoimmune disease or alloimmune disease, or to alleviate symptoms caused by an autoimmune disease, such as pain and inflammation.This may be the amount required to alleviate symptoms associated with inflammation, such as pain, edema, or elevated body temperature.This may also be the amount required to reduce or prevent rejection of a transplanted organ.

[0293] The immune cell population can be administered in a treatment regimen appropriate for the disease, for example, a single or multiple doses over one to several days to improve the disease state, or regular doses over a long period to inhibit the progression of the disease and prevent the recurrence of the disease. The exact dose to be employed in the formulation will depend on the route of administration and the severity of the disease or disorder, and should be determined according to the judgment of the clinician and the circumstances of each patient. The therapeutically effective dose of immune cells will depend on the subject being treated, the severity and type of the affliction, and the mode of administration. In some embodiments, the dose used in the treatment of a human subject is at least 3.8 x 10 4 , at least 3.8 × 10 5 , at least 3.8 × 10 6 , at least 3.8 × 10 7 , at least 3.8 × 10 8 , at least 3.8 × 10 9 , or at least 3.8 × 10 10 immune cells / m 2 In certain embodiments, the dose used in treating a human subject is in the range of 3.8 x 10 9 ~Approx. 3.8×10 10 immune cells / m 2 In a further embodiment, the therapeutically effective amount of immune cells is in the range of about 5×10 6 cells / kg body weight~approx. 7.5×10 8 cells / kg body weight, e.g., approximately 2 x 10 7 Cells ~ approx. 5 x 10 8 cells / kg body weight, or approximately 5 x 10 7 cells ~ approx. 2 x 108 In some embodiments, the dose used in treating human subjects is at least about or about 4 x 10 cells / kg body weight per patient dose. 6 , 8×10 6 , 4×10 7 , 8×10 7 , 4×10 8 , 8×10 8 , 4×10 9 , 8×10 9 , 4×10 10 , or 8 × 10 10 In some embodiments, the dose used in treating human subjects is at least about or about 4 x 10 cells per patient dose. 6 In some embodiments, the dose used in treating a human subject is at least about or about 8 x 10 cells per patient dose. 6 The immune cells are cells. In some embodiments, patients may be treated with multiple doses. In some embodiments, patients may be treated with different doses at different times. In some embodiments, patients may be treated with the same dose at different times. In some embodiments, patients may be treated with different doses at certain times and the same dose at other times. The exact amount of immune cells can be easily determined by a skilled artisan based on the age, weight, sex, and physiological condition of the subject. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

[0294] The immune cells may be administered in combination with one or more other therapeutic agents for the treatment of an immune-mediated disorder. Combination therapy may include, but is not limited to, one or more antimicrobial agents (e.g., antibiotics, antivirals, and antifungals), antitumor agents (e.g., fluorouracil, methotrexate, paclitaxel, fludarabine, etoposide, doxorubicin, or vincristine), immunodepleting agents (e.g., fludarabine, etoposide, doxorubicin, or vincristine), immunosuppressants (e.g., azathioprine, or glucocorticoids such as dexamethasone or prednisone), anti-inflammatory agents (e.g., glucocorticoids such as hydrocortisone, dexamethasone, or prednisone, or nonsteroidal anti-inflammatory agents such as acetylsalicylic acid, ibuprofen, or naproxen sodium), cytokines (e.g., interleukin-10 or transforming growth factor-beta), hormones (e.g., estrogen), or vaccines. Additionally, immunosuppressive or tolerogenic agents, including but not limited to calcineurin inhibitors (e.g., cyclosporine and tacrolimus), mTOR inhibitors (e.g., rapamycin), mycophenolate mofetil, antibodies (e.g., recognizing CD3, CD4, CD40, CD154, CD45, IVIG, or B cells), chemotherapeutic agents (e.g., methotrexate, treosulfan, busulfan), radiation, or chemokines, interferons, or their inhibitors (e.g., BAFF, IL-2, and anti-IL-2R, IL-4, JAK kinase inhibitors), can be administered. Such additional pharmaceutical agents can be administered before, during, or after the administration of immune cells, depending on the desired effect. This administration of cells and agents can be by the same route or different routes, and at the same or different sites.

[0295] In certain embodiments, the compositions comprising the cells described herein are administered in combination with a second therapeutic agent. For example, the second therapeutic agent may include T cells, immunomodulatory agents, monoclonal antibodies, chemotherapeutic agents, hormone(s), drugs of any kind, surgery, radiation, etc. In a non-limiting example, the immunomodulatory agent is lenalidomide, the monoclonal antibody is rituximab, ofatumumab, or lumiliximab, and the chemotherapeutic agent is fludarabine or cyclophosphamide.

[0296] The compositions of the present disclosure can be provided in unit dosage forms, with each dosage unit, such as an injection, containing a predetermined amount of the composition, alone or in appropriate combination with other active agents.The term unit dosage form as used herein refers to a physically discrete unit suitable as a unitary dose for human and animal subjects, each unit containing a predetermined amount of the composition of the present disclosure, alone or in combination with other active agents, calculated in an amount sufficient to produce the desired effect, in association with a pharmaceutically acceptable diluent, carrier, or vehicle as appropriate.The specifications of the unit dosage forms of the present disclosure depend on the specific pharmacodynamics associated with the pharmaceutical composition in a specific subject.

[0297] Desirably, an effective amount or sufficient number of cells of the present disclosure are present in a composition and introduced into a subject to establish a specific anti-tumor response that lasts longer than would be the case in the absence of such treatment to reduce tumor size or eliminate tumor growth or regrowth. Desirably, the amount of cells of the present disclosure (e.g., inactivated, cryopreserved, thawed, reactivated NK cells) reintroduced into the subject causes a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 100% reduction in tumor size compared to otherwise identical conditions in which the NK cells are not inactivated prior to cryopreservation.

[0298] V. Pharmaceutical Compositions Also provided herein are pharmaceutical compositions and formulations comprising inactivated and cryopreserved cells (e.g., NK cells) and a pharmaceutically acceptable carrier.

[0299] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents, isotonicity agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, such materials, and combinations thereof, which would be known to one of ordinary skill in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the pharmaceutical compositions is contemplated.

[0300] Pharmaceutical compositions can contain different types of carriers depending on whether they are administered in solid, liquid, or aerosol form and whether they need to be sterile for routes of administration such as injection. The presently disclosed compositions can be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, nasally, intravaginally, rectally, topically, intramuscularly, subcutaneously, mucosally, orally, topically, by inhalation (e.g., aerosol inhalation), by injection, infusion, continuous infusion, local perfusion, direct immersion in target cells, via catheter, via lavage, in a cream, in a lipid composition (e.g., liposomes), or by any other method or any combination thereof known to those skilled in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed., Mack Printing Company, 1990, incorporated herein by reference).

[0301] The compositions containing the cells of the present disclosure can be formulated into compositions in free base, neutral, or salt form. Where appropriate, pharmaceutically acceptable salts include acid addition salts, such as those formed with the free amino groups of the proteinaceous composition, or those formed with inorganic acids such as hydrochloric acid or phosphoric acid, or organic acids such as acetic acid, oxalic acid, tartaric acid, or mandelic acid. Salts formed with free carboxyl groups can also be derived from inorganic bases such as sodium, potassium, ammonium, calcium, or ferric hydroxide; or organic bases such as isopropylamine, trimethylamine, histidine, or procaine. The formulated solution is administered in a manner compatible with the dosage form and in a therapeutically effective amount. The formulations are easily administered in a variety of dosage forms, including those formulated for parenteral administration as injection solutions, aerosols for pulmonary delivery, or oral administration as drug-release capsules.

[0302] Further in accordance with the present disclosure, compositions of the present disclosure suitable for administration are provided in a pharmaceutically acceptable carrier, with or without an inert diluent. The carrier should be absorbable and include liquid, semi-solid (i.e., paste), or solid carriers. Except insofar as any conventional vehicle, agent, diluent, or carrier is deleterious to the recipient or to the therapeutic effect of the composition contained therein, its use in administrable compositions for use in practicing the methods of the present invention is suitable. Examples of carriers or diluents include fats, oils, water, saline, lipids, liposomes, resins, binders, fillers, and the like, or combinations thereof. The compositions may also contain various antioxidants to retard oxidation of one or more components. Prevention of microbial action can also be achieved by preservatives, such as various antibacterial and antifungal agents, including, but not limited to, parabens (e.g., methylparaben, propylparaben), chlorobutanol, phenol, sorbic acid, thimerosal, or combinations thereof.

[0303] In accordance with the present disclosure, compositions are combined with the carrier by any convenient and practical method, i.e., solution, suspension, emulsion, incorporation, encapsulation, absorption, etc. Such procedures are routine to those skilled in the art.

[0304] In a specific embodiment of the present disclosure, the composition is combined with a semi-solid or solid carrier or thoroughly mixed.Mixing can be carried out by any convenient method, such as grinding.Stabilizers can also be added during the mixing process to protect the composition from loss of therapeutic activity, i.e., denaturation in the stomach.Examples of stabilizers for use in the composition include buffers, amino acids such as glycine and lysine, carbohydrates such as dextrose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.

[0305] In further embodiments, the present disclosure may relate to the use of pharmaceutical lipid vehicle compositions comprising the cells of the present disclosure and, optionally, a composition comprising an aqueous solvent. As used herein, the term "lipid" is defined to include any of a wide variety of substances that are characteristically insoluble in water and extractable with an organic solvent. This broad class of compounds is well known to those skilled in the art, and the term "lipid," as used herein, is not limited to a particular structure. Examples include compounds containing long-chain aliphatic hydrocarbons and their derivatives. Lipids can be naturally occurring or synthetic (i.e., artificially designed or produced). However, lipids are typically biological substances. Biological lipids are well known in the art and include, for example, neutral lipids, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glycolipids, sulfatides, lipids with ether- and ester-linked fatty acids, polymeric lipids, and combinations thereof. Of course, compounds other than those specifically described herein that would be understood by those skilled in the art to be lipids are also encompassed by the compositions and methods of the present invention.

[0306] Those skilled in the art will be familiar with the various techniques that can be employed to disperse compositions in nanoparticles or lipid vehicles. For example, compositions containing NK cells and antibodies can be dispersed in a solution containing lipids, dissolved in lipids, emulsified in lipids, mixed with lipids, coupled to lipids, covalently bound to lipids, contained as a suspension in lipids, contained in or complexed with micelles or liposomes, or otherwise associated with lipids or lipid structures by any means known to those skilled in the art. The dispersion may or may not form liposomes.

[0307] The actual dosage of the composition of the present disclosure administered to animal patients can be determined by physical and physiological factors such as body weight, severity of condition, type of disease to be treated, previous or concurrent therapeutic intervention, characteristics of the patient, and route of administration. Depending on the dosage and route of administration, the preferred dosage and / or the number of administrations of an effective amount can vary depending on the response of the subject. The doctor in charge of administration will in any case determine the concentration of the active ingredient in the composition and the appropriate dosage for each individual subject.

[0308] In certain embodiments, pharmaceutical compositions may contain, for example, at least about 0.1% of the active compound. In other embodiments, the active compound may comprise, for example, from about 2% to about 75%, or from about 25% to about 60% of the weight of the unit, and any range derivable therein. Of course, the amount of active compound in each therapeutically useful composition may be adjusted to obtain an appropriate dosage in any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations will be taken into account by those skilled in the art when preparing such pharmaceutical formulations, and as such, various dosages and treatment regimens may be desirable.

[0309] In other non-limiting examples, dosages can also include about 1 microgram / kg / body weight, about 5 micrograms / kg / body weight, about 10 micrograms / kg / body weight, about 50 micrograms / kg / body weight, about 100 micrograms / kg / body weight, about 200 micrograms / kg / body weight, about 350 micrograms / kg / body weight, about 500 micrograms / kg / body weight, about 1 milligram / kg / body weight, about 5 milligrams / kg / body weight, about 10 milligrams / kg / body weight, about 50 milligrams / kg / body weight, about 100 milligrams / kg / body weight, about 200 milligrams / kg / body weight, about 350 milligrams / kg / body weight, about 500 milligrams / kg / body weight, up to about 1000 mg / kg / body weight or more per administration, and any range derivable therein. Non-limiting examples of ranges that can be derived from the numerical values ​​described herein include ranges such as about 5 mg / kg / body weight to about 100 mg / kg / body weight, about 5 micrograms / kg / body weight to about 500 milligrams / kg / body weight, based on the above numerical values.

[0310] Therapeutic compositions comprising the cells of the present disclosure may be administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intracerebroventricularly, or intranasally. In some embodiments, antibiotics are administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intracerebroventricularly, or intranasally. The appropriate dosage can be determined based on the type of disease being treated, the severity and course of the disease, the individual's clinical condition, the individual's clinical history and response to treatment, and the discretion of the attending physician.

[0311] Therapeutic agents may include various "unit doses." A unit dose is defined as containing a predetermined amount of a therapeutic composition. The amount to be administered, as well as the specific route and formulation, are within the discretion of those skilled in the art. A unit dose need not be administered as a single injection, but may include continuous infusion over a period of time. In some embodiments, a unit dose includes a single administrable dose.

[0312] The dosage depends on the desired therapeutic effect, both in the number of treatments and the unit dose.It is understood that an effective amount refers to the amount required to achieve a specific effect.In practice, it is contemplated that in certain embodiments, a dosage in the range of 10 mg / kg to 200 mg / kg can affect the protective capacity of these agents. Thus, dosages include about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 μg / kg, mg / kg, μg / day, or mg / day, or any range derivable therein. Furthermore, such dosages can be administered multiple times during the day and / or on multiple days, weeks, or months.

[0313] In certain embodiments, an effective amount of the pharmaceutical composition is one that can provide a blood level of about 1 μM to 150 μM. In other embodiments, an effective amount provides a blood level of about 4 μM to 100 μM; or about 1 μM to 100 μM; or about 1 μM to 50 μM; or about 1 μM to 40 μM; or about 1 μM to 30 μM; or about 1 μM to 20 μM; or about 1 μM to 10 μM; or about 10 μM to 150 μM; or about 10 μM to 100 μM; or about 10 μM to 50 μM; or about 25 μM to 150 μM; or about 25 μM to 100 μM; or about 25 μM to 50 μM; or about 50 μM to 150 μM; or about 50 μM to 100 μM (or any range derivable therein). In other embodiments, the dose is about, at least, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 12 The blood concentration may be 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 μM, or any range derivable therein. In certain embodiments, a therapeutic agent administered to a subject is metabolized in the body to become a metabolic therapeutic agent, in which case blood concentration can refer to the amount of that therapeutic agent. Alternatively, to the extent that a therapeutic agent is not metabolized by the subject, blood concentrations discussed herein can refer to the unmetabolized therapeutic agent.

[0314] A. Nutritional Compositions and Formulations In certain embodiments of the present disclosure, the composition comprising the cells of the present disclosure is formulated to be administered via the gastrointestinal route. The gastrointestinal route includes all possible administration routes in which the composition directly contacts the gastrointestinal tract. Specifically, the pharmaceutical compositions disclosed herein can be administered orally, bucally, rectally, or sublingually. As such, these compositions can be formulated with an inert diluent or with an absorbable edible carrier, or can be enclosed in hard or soft shell gelatin capsules, or can be compressed into tablets, or can be directly incorporated into diet.

[0315] In certain embodiments, the active compound may be incorporated with excipients and used in the form of ingestible tablets, buccal tablets, troches, capsules, elixirs, suspensions, syrups, wafers, and the like (Mathiowitz et al., 1997; Hwang et al., 1998; U.S. Patent Nos. 5,641,515; 5,580,579 and 5,792,451, each of which is specifically incorporated herein by reference in its entirety). Tablets, troches, pills, capsules, and the like may also contain: binders such as tragacanth, acacia, corn starch, gelatin, or combinations thereof; excipients such as dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, or combinations thereof; disintegrating agents such as corn starch, potato starch, alginic acid, or combinations thereof; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose, saccharin, or combinations thereof; and flavoring agents such as peppermint, oil of wintergreen, cherry flavor, orange flavor, and the like. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to modify the physical form of the dosage unit. For example, tablets, pills, or capsules may be coated with shellac, sugar, or both. When the dosage form is a capsule, it may contain, in addition to materials of the above type, a carrier such as a liquid carrier. Gelatin capsules, tablets, or pills may be enterically coated. The enteric coating prevents the composition from denaturing in the stomach or upper intestine, where the pH is acidic. See, for example, U.S. Patent No. 5,629,001. Upon reaching the small intestine, the basic pH there dissolves the coating, releasing the composition and allowing it to be absorbed by specialized cells, such as epithelial enterocytes and Peyer's patch M cells. Elixir syrup may contain the active compound sucrose as a sweetener, methyl and propylparabens as preservatives, dyes, and flavorings, such as cherry or orange flavor.Of course, any material used in preparing any dosage form should be pharmaceutically pure and substantially non-toxic in the amounts used. Additionally, the active compound may be incorporated into sustained-release preparations and formulations.

[0316] For oral administration, the compositions of the present disclosure may alternatively be incorporated with one or more excipients in the form of mouthwash, dentifrice, buccal tablets, oral sprays, or sublingual oral preparations. For example, mouthwashes can be prepared by incorporating the required amount of active ingredient into a suitable solvent, such as sodium borate solution (Dobell's solution). Alternatively, the active ingredient can be incorporated into oral fluids, such as a solution containing sodium borate, glycerin, and potassium bicarbonate, dispersed in dentifrice, or added in a therapeutically effective amount to a composition containing water, binders, abrasives, flavoring agents, foaming agents, and humectants. Alternatively, the compositions can be in the form of tablets or solutions that can be placed under the tongue or dissolved in the mouth.

[0317] Other suitable formulations for gastrointestinal administration include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum. After insertion, the suppository softens, melts, or dissolves in the cavity fluid. In general, for suppositories, conventional carriers include, for example, polyalkylene glycols, triglycerides, or combinations thereof. In certain embodiments, suppositories can be formed from mixtures containing, for example, about 0.5% to about 10%, preferably about 1% to about 2%, of the active ingredient.

[0318] B. Parenteral Compositions and Formulations In further embodiments, compositions can be administered via parenteral route.As used herein, term " parenteral " includes the route of bypassing the digestive tract.Specifically, pharmaceutical compositions disclosed herein can be administered for example, intravenously, intradermally, intramuscularly, intraarterially, intravenously, intrathecally, intraventricularly, intratumorally, subcutaneously or intraperitoneally, including but not limited to United States Patent No. 6,613,308; No. 5,466,468; No. 5,543,158; No. 5,641,515; and No. 5,399,363 (each of which is specifically incorporated herein in its entirety by reference).

[0319] In certain embodiments, solutions containing the cells and active compounds of the present disclosure may be provided as free bases or pharmacologically acceptable salts, which may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, and in oils. Under ordinary conditions of storage and use, these formulations contain a preservative to prevent the growth of microorganisms. Pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent No. 5,466,468, specifically incorporated herein by reference in its entirety). In all cases, the form must be sterile and fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it is preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of injectable compositions can be achieved by the use in the compositions of agents delaying absorption, for example, aluminum monostearate or gelatin.

[0320] For example, for parenteral administration in an aqueous solution, the solution should be suitably buffered, if necessary, and the liquid diluent should first be rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, sterile aqueous vehicles that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage can be dissolved in isotonic NaCl solution and added to a subcutaneous injection or injected at the intended site of infusion (see, e.g., "Remington's Pharmaceutical Sciences," 15th Edition, pages 1035-1038 and 1570-1580). Dosages will necessarily vary somewhat depending on the condition of the subject being treated. In any event, the person responsible for administration will determine the appropriate dose for the individual subject. Furthermore, for human administration, formulations must meet sterility, pyrogenicity, general safety, and purity standards as required by FDA Office of Biologics standards.

[0321] The cells of the present disclosure and any active compounds are prepared by incorporating the required amount of the cells and any active compounds into a suitable solvent, optionally with various other ingredients listed above, followed by an appropriate filtration and / or sterilization method (e.g., filter sterilization). Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and the other required ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation method is vacuum drying and freeze-drying, which allows the powder of the active ingredient to be added to a previously sterile-filtered solution to obtain any additional desired ingredients. The powder composition is combined with a liquid carrier, such as water or saline, with or without stabilizers.

[0322] C. Other Pharmaceutical Compositions and Formulations In other specific embodiments of the present disclosure, the active compound compositions comprising the cells of the present disclosure may be formulated for administration via a variety of miscellaneous routes, for example, topical (i.e., transdermal) administration, mucosal administration (intranasal, intravaginal, etc.) and / or inhalation.

[0323] Pharmaceutical compositions for topical administration can include active compounds formulated as ointments, pastes, creams, or powders. Ointments include all oleaginous, absorbent, emulsion-, and water-soluble-based compositions for topical application, while creams and lotions are compositions containing only emulsion bases. Topical ointments can contain penetration enhancers to promote absorption of the active ingredient through the skin. Suitable penetration enhancers include glycerin, alcohol, alkyl methyl sulfoxides, pyrrolidone, and laurocapram. Bases that can be used for topical application include polyethylene glycol, lanolin, cold cream, petrolatum, and other suitable absorbent, emulsion, and water-soluble ointment bases. Topical formulations can also contain emulsifiers, gelling agents, and antimicrobial preservatives as needed to preserve the active ingredient and provide a homogeneous mixture. Transdermal administration of the present invention can involve the use of a "patch." For example, a patch can continuously deliver one or more active agents at a predetermined rate over a period of time.

[0324] In certain embodiments, pharmaceutical compositions can be delivered by eye drops, intranasal spray, inhalation, and / or other aerosol delivery vehicles.Methods for directly delivering compositions to the lungs via nasal aerosol spray are described, for example, in U.S. Patent No. 5,756,353 and U.S. Patent No. 5,804,212 (each of which is specifically incorporated herein by reference in its entirety).Similarly, nasal microparticle resins (Takenaga et al., 1998) and lysophosphatidylglycerol compounds (U.S. Patent No. 5,725,871, specifically incorporated herein by reference in its entirety) are also well known in pharmaceutical technology.Similarly, transmucosal drug delivery in the form of a polytetrafluoroethylene support matrix is ​​described in U.S. Patent No. 5,780,045 (which is specifically incorporated herein by reference in its entirety). The term aerosol refers to a colloidal system of finely divided solid or liquid particles dispersed in a liquefied or pressurized gas propellant. A typical aerosol of the present invention for inhalation may consist of a suspension of the active ingredient in a liquid propellant or a mixture of a liquid propellant and a suitable solvent. Suitable propellants include hydrocarbons and hydrocarbon ethers. Suitable containers may vary depending on the pressure requirements of the propellant. Aerosol administration may vary depending on the age, weight, and severity and response of the subject.

[0325] V. Combination Therapy In certain embodiments, the compositions and methods of the present embodiments utilize the presently disclosed cells (e.g., previously inactivated and cryopreserved NK cells that have subsequently been thawed and reactivated) in combination with at least one additional therapy. The additional therapy may be radiation therapy, surgery (e.g., lumpectomy and mastectomy), chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, immunotherapy, bone marrow transplant, nanotherapy, monoclonal antibody therapy, hormone therapy, or a combination thereof. The additional therapy may take the form of adjuvant or neoadjuvant therapy.

[0326] In some embodiments, the additional therapy is administration of a small molecule enzyme inhibitor(s) or an anti-metastatic agent(s). In some embodiments, the additional therapy is administration of a side effect limiting agent (e.g., an agent intended to reduce the occurrence and / or severity of side effects of treatment, such as an anti-nausea agent). In some embodiments, the additional therapy is chemotherapy. In some embodiments, the additional therapy is radiation therapy. In some embodiments, the additional therapy is surgery. In some embodiments, the additional therapy is a combination of radiation therapy and surgery. In some embodiments, the additional therapy is gamma irradiation. In some embodiments, the additional therapy is a therapy targeting the PBK / ACT / mTOR pathway, an HSP90 inhibitor, a tubulin inhibitor, an apoptosis inhibitor, and / or a chemopreventive agent. The additional therapy may be one or more chemotherapeutic agents known in the art.

[0327] In some embodiments, patients may be treated with compositions and methods of the present disclosure (e.g., pre-expanded, inactivated, cryopreserved, and subsequently thawed NK cells) followed by chemotherapy. In some embodiments, patients may be treated with compositions and methods according to the present disclosure simultaneously with chemotherapy. In some embodiments, patients may be treated with chemotherapy followed by compositions and methods of the present disclosure. In some embodiments, patients may be treated with cyclophosphamide and / or fludarabine followed by compositions and methods of the present disclosure. In some embodiments, patients receive about 300 mg / m 2 and cyclophosphamide at dose levels of approximately 30 mg / m 2 In some embodiments, patients may be treated with fludarabine at a dose level of about 300 mg / m daily for the first three days, followed by treatment with the compositions and methods of the present disclosure. 2 daily dose levels of cyclophosphamide and approximately 30 mg / m 2 and 48 hours after the last dose of cyclophosphamide and fludarabine, the patient is treated with the compositions and methods of the present disclosure. In some embodiments, the patient treated according to aspects of the present disclosure is treated for renal cell carcinoma, glioblastoma, mesothelioma, and / or osteosarcoma.

[0328] Immune cell therapy (in addition to the disclosed compositions) can be administered before, during, or after additional cancer therapy, such as immune checkpoint therapy, or in various combinations. Administration can occur simultaneously, within minutes, or even days or weeks apart. In embodiments in which immune cell therapy is provided to a patient separately from the disclosed composition(s), it is generally ensured that no significant time period elapses between administrations, so that the two compounds can still exert their beneficial combined effect on the patient. In such cases, it is contemplated that the immunotherapy and the disclosed compositions may be provided to the patient within about 12-24 hours or 72 hours of each other, more particularly, within about 6-12 hours of each other. In some circumstances, it may be desirable to significantly extend the duration of treatment, such that days (2, 3, 4, 5, 6, or 7) to weeks (1, 2, 3, 4, 5, 6, 7, or 8) elapse between administrations.

[0329] Various combinations can be used. In the following examples, immune cell therapy is "A" and anti-cancer drug therapy is "B": A / B / AB / A / BB / B / AA / A / BA / B / BB / A / A A / B / B / BB / A / B / B B / B / B / AB / B / A / BA / A / B / BA / B / A / B A / B / B / AB / B / A / A B / A / B / AB / A / A / BA / A / A / BB / A / A / A A / B / A / AA / A / B / A

[0330] Administration of any compound or treatment of the present embodiments to a patient may follow general protocols for the administration of such compounds, taking into account the toxicity, if any, of the agent. Thus, in some embodiments, there is a step of monitoring for toxicity resulting from the combination therapy.

[0331] A. Chemotherapy A wide variety of chemotherapeutic agents can be used in accordance with this embodiment. The term "chemotherapy" refers to the use of drugs to treat cancer. "Chemotherapeutic agent" is used to refer to a compound or composition administered in the treatment of cancer. These agents or drugs are classified by their mode of action within cells, for example, whether and at what stage they affect the cell cycle. Alternatively, agents can be characterized based on their ability to directly crosslink DNA, intercalate into DNA, or induce chromosomal or mitotic abnormalities by affecting nucleic acid synthesis.

[0332] Examples of chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide; alkylsulfonates such as busulfan, improsulfan, and piposulfan; aziridines such as benzodopa, carboquone, metuledopa, and uredopa; ethylenimines and methylamines such as altretamine, triethylenemelamine, triethylenephosphoramide, triethyleneethioniphosphoramide, and trimethylolmelamine; acetogenins (particularly bullatacin and bullatacinone); camptothecin (including the synthetic analog topotecan); bryostatin; kallistatin; CC-1065 (including its synthetic analogs adozelesin, carzelesin, and bizelesin); cryptophycins (particularly cryptophycin 1 and cryptophycin 8); dolastatins; and duocarmycins (synthetic analogs , including KW-2189 and CB1-TM1); eleutherobin; pancratistatin; sarcodictine; spongistatin; nitrogen mustards such as chlorambucil, chlornaphazine, colofosfamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, nobembitine, phenesterine, prednimustine, trofosfamide, and uracil mustard; nitrosoureas such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine, and ranimnustine; antibiotics such as enediyne antibiotics (e.g., calicheamicin, especially calicheamicin gamma II and calicheamicin omega II); dynemicins such as dynemicin A; bisphosphonates such as clodronate; esperamicin;and neocarzinostatin chromophore and related chromoprotein enediine antibiotic chromophores, aclacinomycin, actinomycin, ausularnisin, azaserine, bleomycin, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycin, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, and deoxydoxorubicin) ), mitomycins such as epirubicin, esorubicin, idarubicin, marcelomycin, and mitomycin C, mycophenolic acid, nogalarnisin, olivomycin, peplomycin, potfilomycin, puromycin, keramicin, rhodrubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; metabolic inhibitors such as methotrexate and 5-fluorouracil (5-FU); folic acid analogs such as denopterin, pteropterin, and trimetrexate; fludarabine, 6-mercapto Purine analogs such as toprine, thiamiprine, and thioguanine; pyrimidine analogs such as ancitabine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, and floxuridine; androgens such as calucelone, dromostanolone propionate, epithiostanol, mepitiostane, and testolactone; antiadrenergic drugs such as mitotane and trilostane; folic acid supplements such as floric acid; aceglatone; aldophosphamide glycosides; aminolevulinic acid; eniluracil; and amsacrine ; Bestravsil; Bisantrene; Edatraxate; Defofamine; Demecolcine; Diazicon; Elformitin; Elliptinium acetate; Epothilone; Etoglucide; Gallium nitrate; Hydroxyurea; Lentinan; Lonidynin; Maytansinoids such as maytansine and ansamitocin; Mitoguazone; Mitoxantrone; Mopidanmol; Nitraerin; Pentostatin; Fenamet; Pirarubicin; Rosoxantrone; Podophyllic acid; 2-ethylhydrazide; Procarbazine; PSK polysaccharide complex; Razoxane; Rhizoxin; Sizofiran;Spirogermanium; tenuazonic acid; triazicon; 2,2',2''-trichlorotriethylamine; trichothecenes (especially T-2 toxin, veraculin A, roridin A, and anguidine); urethane; vindesine; dacarbazine; mannomustine; mitobronitol; mitolactol; pipobroman; gacytosine; arabinoside ("Ara-C"); cyclophosphamide; taxoids such as paclitaxel and docetaxel; gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes such as cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP -16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunomycin; aminopterin; xeloda; ibandronate; irinotecan (e.g., CPT-11); topoisomerase inhibitors RFS2000; difluoromethylornithine (DMFO); retinoids such as retinoic acid; capecitabine; carboplatin, procarbazine, plicomycin, gemcitabine, navelbine, farnesyl-protein transferase inhibitors, transplatin, and pharmaceutically acceptable salts, acids, or derivatives of any of the above.

[0333] B. Radiation therapy Other agents that cause DNA damage and have been widely used include what are commonly known as gamma rays, X-rays, and / or the directed delivery of radioisotopes to tumor cells. Other potential DNA-damaging agents include microwaves, proton beam irradiation (U.S. Patent Nos. 5,760,395 and 4,870,287), and ultraviolet radiation. All of these agents likely cause widespread damage to DNA, DNA precursors, DNA replication and repair, and chromosome assembly and maintenance. X-ray doses range from daily doses of 50–200 roentgens over prolonged periods (3–4 weeks) to single doses of 2000–6000 roentgens. Dose ranges for radioisotopes vary and depend on the half-life of the isotope, the strength and type of radiation, and uptake by tumor cells.

[0334] C. Immunotherapy Those skilled in the art will understand that additional immunotherapies (other than the disclosed cell therapies) can be used in combination or in conjunction with the methods of the embodiments. In the context of cancer treatment, immunotherapeutics generally rely on the use of immune effector cells or molecules to target and destroy cancer cells. Rituximab (RITUXAN®) is an example. Immune effectors are, for example, antibodies specific for tumor cell surface markers. Antibodies can function alone as therapeutic effectors or can recruit other cells to actually affect cell killing. Antibodies can also be conjugated to drugs or toxins (e.g., chemotherapeutic agents, radionuclides, ricin A chain, cholera toxin, pertussis toxin, etc.) and function as targeting agents. Alternatively, effectors can be lymphocytes bearing surface molecules that interact directly or indirectly with tumor cell targets. Various effector cells include cytotoxic T cells and NK cells.

[0335] Antibody-drug conjugates (ADCs) have emerged as a groundbreaking approach in the development of cancer therapeutics. Cancer is one of the leading causes of death worldwide. Antibody-drug conjugates (ADCs) are created by covalently linking a monoclonal antibody (MAb) to a cytotoxic drug. This approach combines the high specificity of the MAb for its antigen target with a potent cytotoxic agent, resulting in an "armed" MAb that delivers its payload (drug) to tumor cells where the antigen is concentrated. Targeted drug delivery also minimizes drug exposure in normal tissues, reducing toxicity and improving the therapeutic index. The FDA approval of two ADC drugs, ADCETRIS® (brentuximab vedotin) in 2011 and KADCYLA® (trastuzumab emtansine or T-DM1) in 2013, demonstrated the effectiveness of this approach. Currently, there are more than 30 ADC drug candidates in various stages of clinical trials for cancer treatment (Leal et al., 2014). As antibody engineering and linker-payload optimization become increasingly mature, the discovery and development of new ADCs increasingly relies on the identification and validation of novel targets amenable to this approach and the generation of targeted MAbs. Two criteria for ADC targets are increased / high levels of expression in tumor cells and robust internalization.

[0336] In one aspect of immunotherapy, tumor cells must have some marker that is suitable for targeting, i.e., that is not present on the majority of other cells. Many tumor markers exist, any of which are suitable for targeting in the context of this embodiment. Common tumor markers include CD19, CD20, CA-125, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, sialyl Lewis antigen, MucA, MucB, PLAP, laminin receptor, erb B, p155, and the like. Another aspect of immunotherapy is the combination of anti-cancer and immunostimulatory effects. There are also immunostimulatory molecules, including cytokines such as IL-2, IL-4, IL-12, GM-CSF, and γ-IFN; chemokines such as MIP-1, MCP-1, and IL-8; and growth factors such as FLT3 ligand.

[0337] Examples of immunotherapies currently under investigation or in use include immune adjuvants, e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Patent Nos. 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998); cytokine therapy, e.g., interferon α, β, and γ, IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998); gene therapy, e.g., TNF, IL-1, IL-2, and p53 (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S. Patent Nos. 5,830,880 and 5,846,945); and monoclonal antibodies, such as anti-CD20, anti-ganglioside GM2, and anti-p185 (Hollander, 2012; Hanibuchi et al., 1998; U.S. Patent No. 5,824,311). It is contemplated that one or more anti-cancer drug treatments may be employed in conjunction with the antibody therapies described herein.

[0338] In some embodiments, the immunotherapy is an immune checkpoint inhibitor. Immune checkpoints either upregulate signals (e.g., costimulatory molecules) or downregulate signals. Inhibitory immune checkpoints that can be targeted by immune checkpoint inhibitors include adenosine A2A receptor (A2AR), B7-H3 (also known as CD276), B- and T-lymphocyte attenuating factor (BTLA), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4, also known as CD152), indoleamine 2,3-dioxygenase (IDO), killer cell immunoglobulin (KIR), lymphocyte activation gene-3 (LAG3), programmed death 1 (PD-1), T-cell immunoglobulin domain and mucin domain 3 (TIM-3), and V-domain Ig suppressor of T-cell activation (VISTA). In particular, immune checkpoint inhibitors target the PD-1 axis and / or CTLA-4.

[0339] Immune checkpoint inhibitors can be drugs such as small molecules, recombinant forms of ligands or receptors, or antibodies, particularly human antibodies (e.g., International Patent Publication WO2015016718; Pardoll, Nat Rev Cancer, 12(4):252-64, 2012, both of which are incorporated herein by reference). Known inhibitors of immune checkpoint proteins or analogs thereof can be used, particularly chimeric, humanized, or human antibodies. As known to those skilled in the art, alternative and / or equivalent names can be used for certain antibodies described in this disclosure. Such alternative and / or equivalent names are interchangeable within the context of this disclosure. For example, lambrolizumab is known to be also known by the alternative and equivalent names MK-3475 and pembrolizumab.

[0340] In some embodiments, the PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its ligand binding partner. In certain aspects, the PD-1 ligand binding partner is PDL1 and / or PDL2. In another embodiment, the PDL1 binding antagonist is a molecule that inhibits the binding of PDL1 to its binding partner. In certain aspects, the PDL1 binding partner is PD-1 and / or B7-1. In another embodiment, the PDL2 binding antagonist is a molecule that inhibits the binding of PDL2 to its binding partner. In certain aspects, the PDL2 binding partner is PD-1. The antagonist may be an antibody, antigen-binding fragment thereof, immunoadhesin, fusion protein, or oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. 8,735,553, 8,354,509, and 8,008,449, all of which are incorporated herein by reference. Other PD-1 axis antagonists for use in the methods provided herein are known in the art and are described in U.S. Patent Application Nos. 20140294898, 2014022021, and 20110008369, all of which are incorporated herein by reference.

[0341] In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and CT-011. In some embodiments, the PD-1 binding antagonist is an immunoadhesin (e.g., an immunoadhesin comprising the extracellular portion or PD-1-binding portion of PDL1 or PDL2 fused to a constant region (e.g., the Fc region of an immunoglobulin sequence)). In some embodiments, the PD-1 binding antagonist is AMP-224. Nivolumab, also known as MDX-1106-04, MDX-1106, ONO-4538, BMS-936558, and OPDIVO® are anti-PD-1 antibodies described in WO 2006 / 121168. Pembrolizumab, also known as MK-3475, Merck 3475, lambrolizumab, KEYTRUDA®, and SCH-900475, are anti-PD-1 antibodies described in WO2009 / 114335. CT-011, also known as hBAT or hBAT-1, is an anti-PD-1 antibody described in WO2009 / 101611. AMP-224, also known as B7-DCIg, is a PDL2-Fc fusion soluble receptor described in WO2010 / 027827 and WO2011 / 066342.

[0342] Another immune checkpoint that can be targeted in the methods provided herein is cytotoxic T lymphocyte-associated protein 4 (CTLA-4), also known as CD152. The complete cDNA sequence of human CTLA-4 has Genbank accession number L15006. CTLA-4 is found on the surface of T cells and acts as an "off" switch upon binding to CD80 or CD86 on the surface of antigen-presenting cells. CTLA4 is a member of the immunoglobulin superfamily expressed on the surface of helper T cells and transmits inhibitory signals to T cells. CTLA4 is similar to the T cell costimulatory protein CD28; both molecules bind to CD80 and CD86, also known as B7-1 and B7-2, respectively, on antigen-presenting cells. CTLA4 transmits inhibitory signals to T cells, while CD28 transmits stimulatory signals. Intracellular CTLA4 is also found in regulatory T cells and may be important for their function. Activation of T cells through the T cell receptor and CD28 leads to increased expression of CTLA-4, an inhibitory receptor for B7 molecules.

[0343] In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or an oligopeptide.

[0344] Anti-human CTLA-4 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the present methods can be generated using methods well known in the art. Alternatively, art-recognized anti-CTLA-4 antibodies can be used. For example, the anti-CTLA-4 antibodies disclosed in US8,119,129, WO01 / 14424, WO98 / 42752, WO00 / 37504 (CP675,206, formerly known as tremelimumab, also known as ticilimumab), U.S. Patent No. 6,207,156, Hurwitz et al. (1998) Proc Natl Acad Sci USA 95(17):10067-10071, Camacho et al. (2004) J Clin Oncology 22(145):Abstract No. 2505 (antibody CP-675206), and Mokyr et al. (1998) Cancer Res 58:5301-5304 can be used in the methods disclosed herein. The teachings of each of the above publications are incorporated herein by reference. Antibodies that compete with any of these art-recognized antibodies for binding to CTLA-4 can also be used. For example, humanized CTLA-4 antibodies are described in International Patent Applications WO2001014424, WO2000037504, and U.S. Patent No. 8,017,114, all of which are incorporated herein by reference.

[0345] An exemplary anti-CTLA-4 antibody is ipilimumab (also known as 10D1, MDX-010, MDX-101, and Yervoy®), or antigen-binding fragments and variants thereof (see, e.g., WO 01 / 14424). In other embodiments, the antibody comprises the heavy and light chain CDRs or VRs of ipilimumab. Thus, in one embodiment, the antibody comprises the CDR1, CDR2, and CDR3 domains of the VH region of ipilimumab and the CDR1, CDR2, and CDR3 domains of the VL region of ipilimumab. In another embodiment, the antibody competes for binding to and / or binds to the same epitope on CTLA-4 as the above-described antibodies. In another embodiment, the antibody has at least about 90% variable region amino acid sequence identity with the above-described antibodies (e.g., at least about 90%, 95%, or 99% variable region identity with ipilimumab).

[0346] Other molecules for modulating CTLA-4 include CTLA-4 ligands and receptors such as those described in U.S. Pat. Nos. 5,844,905, 5,885,796, and International Patent Applications WO1995001994 and WO1998042752, all of which are incorporated herein by reference, and immunoadhesins such as those described in U.S. Pat. No. 8,329,867, which is incorporated herein by reference.

[0347] D.Surgery Approximately 60% of cancer patients undergo some type of surgery, including preventive, diagnostic or staging, curative, and palliative surgery. Therapeutic surgery includes resection, which physically removes, excises, and / or destroys all or part of cancerous tissue, and may be used in conjunction with other therapies, such as the present treatment, chemotherapy, radiation therapy, hormone therapy, gene therapy, immunotherapy, and / or alternative therapies. Tumor resection refers to the physical removal of at least part of a tumor. In addition to tumor resection, surgical treatments include laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery).

[0348] Removal of part or all of the cancer cells, tissue, or tumor may result in the formation of a cavity within the body. Treatment can be achieved by perfusion, direct injection, or local application of anticancer therapy to the site. Such treatments can be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days; every 1, 2, 3, 4, or 5 weeks; or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments are available in a variety of dosages.

[0349] E. Other drugs It is contemplated that other agents can be used in combination with certain aspects of the present embodiments to improve the efficacy of the treatment. These additional agents include agents that affect the upregulation of cell surface receptors and GAP junctions, cell activators and differentiation promoters, cell adhesion inhibitors, agents that increase the sensitivity of hyperproliferative cells to apoptosis-inducing agents, or other biological agents. Increasing intercellular signaling by increasing the number of GAP junctions will increase the anti-hyperproliferative effect on adjacent hyperproliferative cell populations. In other embodiments, cell activators or differentiation promoters can be used in combination with certain aspects of the present embodiments to improve the anti-hyperproliferative effect of the treatment. Cell adhesion inhibitors are contemplated to improve the efficacy of the present embodiments. Examples of cell adhesion inhibitors are focal adhesion kinase (FAK) inhibitors and lovastatin. It is further contemplated that other agents that increase the sensitivity of hyperproliferative cells to apoptosis, such as the antibody c225, can be used in combination with certain aspects of the present embodiments to improve the therapeutic effect.

[0350] VII. Manufactured Articles or Kits Articles of manufacture or kits are provided that include cryopreservation media or components thereof and, optionally, immune cells. The articles of manufacture or kits may further include a package insert containing instructions for using the cryopreservation media and / or immune cells to treat or delay the progression of cancer in an individual or to enhance the immune function of an individual with cancer. Any of the components of the cryopreservation media and, optionally, the antigen-specific immune cells described herein may be included in the articles of manufacture or kits. Suitable containers include, for example, bottles, vials, bags, and syringes. The containers may be formed from a variety of materials, such as glass, plastic (such as polyvinyl chloride or polyolefin), or metal alloys (such as stainless steel or Hastelloy). In some embodiments, the container holds the formulation, and a label on or associated with the container may indicate instructions for use. The articles of manufacture or kits may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts containing instructions for use. In some embodiments, the articles of manufacture further include one or more additional agents (e.g., chemotherapeutic agents and anti-neoplastic agents). Suitable containers for the one or more agents include, for example, bottles, vials, bags, and syringes.

[0351] In some embodiments, kits are provided that can include, for example, cells of the present disclosure (e.g., NK cells), optionally one or more media and components for production of the cells, one or more inactivating agents, etc. In some embodiments, the formulation may include a cocktail of factors, including in a form suitable for combination with NK cells. The reagent system or any kit components may be packaged, where appropriate, either in aqueous medium or in lyophilized form. The container means of the kits will generally include at least one vial, test tube, flask, bottle, syringe, or other container means into which the ...

Claims

1. A method for inactivating natural killer (NK) cells, comprising the step of treating NK cells with an effective amount of one or more inactivating agents under conditions that produce inactivated NK cells.

2. The method according to claim 1, wherein the inactivating agent is a kinase inhibitor.

3. The method according to claim 1 or 2, wherein the inactivating agent is a mammalian target of rapamycin (mTOR) inhibitor.

4. The method according to claim 2 or 3, wherein the mTOR inhibitor is rapamycin, everolimus, and / or temsirolimus.

5. The method according to any one of claims 2 to 4, wherein the mTOR inhibitor is rapamycin.

6. The method according to claim 1 or 2, wherein the inactivating agent is a tyrosine kinase (TK) inhibitor.

7. The method according to claim 6, wherein the TK inhibitor is dasatinib, nilotinib, lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, peqidartinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdafitinib, nintedanib, gilteritinib, midostaurin, tucatinib, neratinib, baricitinib, luxitinib, fedratinib, tofacitinib, repotrectinib, selumetinib, binimetinib, cobimetinib, trametinib, upadacitinib, abemaciclib, serpelitinib, cabozantinib, fostamatinib, larotrectinib, entrectinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, vandetanib, and / or sunitinib.

8. The method according to claim 6 or 7, wherein the TK inhibitor is a BCR-Abl inhibitor.

9. The method according to any one of claims 6 to 8, wherein the TK inhibitor is dasatinib, nilotinib, bosutinib, ponatinib, and / or imatinib.

10. The method according to any one of claims 6 to 9, wherein the TK inhibitor is dasatinib and / or nilotinib.

11. The method according to any one of claims 6 to 10, wherein the TK inhibitor is nilotinib.

12. The method according to any one of claims 6 to 10, wherein the TK inhibitor is dasatinib.

13. The method according to any one of claims 1 to 12, wherein the treatment is at any point during the culture of the NK cells.

14. The method according to any one of claims 1 to 13, wherein the treatment lasts for about 24 to about 96 hours, about 36 to about 84 hours, or about 48 to about 72 hours.

15. The method according to any one of claims 1 to 14, wherein the treatment lasts for about 24 hours, about 48 hours, or about 72 hours.

16. The method according to any one of claims 1 to 15, wherein the treatment lasts for about 24 hours.

17. The method according to any one of claims 1 to 16, wherein the NK cells are treated with the inactivating agent at a concentration of about 1 to about 2000 nM.

18. The method according to any one of claims 1 to 17, wherein the NK cells are treated with the inactivating agent at a concentration of about 5 to about 100 nM.

19. The method according to any one of claims 1 to 18, wherein the NK cells are treated with the inactivating agent at a concentration of about 20 to about 500 nM.

20. The method according to any one of claims 1 to 19, wherein the NK cells are treated with the inactivating agent at a concentration of about 30 to about 200 nM.

21. The method according to any one of claims 1 to 16, wherein the NK cells are treated with the inactivating agent at a final concentration of about 0.01 μM to about 10 μM.

22. The method according to any one of claims 1 to 16 or 21, wherein the NK cells are treated with the inactivating agent at a final concentration of about 0.02 μM to about 5 μM.

23. The method according to any one of claims 1 to 16 or 21 to 22, wherein the NK cells are treated with the inactivating agent at a final concentration of about 0.05 μM to about 3 μM.

24. The method according to any one of claims 1 to 16 or 21 to 23, wherein the NK cells are treated with the inactivating agent at a final concentration of about 1 μM.

25. The method according to any one of claims 1 to 24, wherein the cells are washed following inactivation.

26. The method according to any one of claims 1 to 25, wherein the inactivated NK cells have an increase in the expression of one or more of C-kit, CCR-5, CD62L, and / or CXCR4, and / or a decrease in the expression of one or more of NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS, and / or CD95, compared to activated NK cells.

27. The method according to any one of claims 1 to 26, wherein the NK cells are derived from human peripheral blood mononuclear cells (PBMC), unstimulated leukapheresis products (PBSC), human embryonic stem cells (hESC), hematopoietic stem cells, induced pluripotent stem cells (iPSC), bone marrow, NK cell lines, and / or umbilical cord blood.

28. The method according to any one of claims 1 to 27, wherein the NK cells are isolated from blood.

29. The method according to claim 28, wherein the NK cells are isolated from one or more umbilical cord blood units.

30. The method according to claim 27, wherein the NK cells are induced NK cells created from progenitor cells.

31. The method according to claim 30, wherein the progenitor cells are hESC, hematopoietic stem cells, iPSC, and / or induced hematopoietic stem cells.

32. The method according to any one of claims 1 to 31, wherein the NK cells contain a transgene.

33. The method according to claim 32, wherein the transgene encodes a chimeric antigen receptor (CAR), a T cell receptor (TCR), a non-naturally occurring or naturally occurring variant of FcγRIII (CD16), an interleukin (such as interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or its variant, interleukin 12 (IL-12), interleukin 21 (IL-21), interleukin 18 (IL-18), interleukin 12 receptor (IL-12R) or its variant), a human leukocyte antigen (such as human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E)), leukocyte surface antigen differentiation cluster CD47 (CD47), or any combination of two or more thereof.

34. The method according to claim 33, wherein the NK cells contain a transgenic CAR.

35. The method according to claim 34, wherein the NK cells contain two or more transgenic CARs.

36. The method according to claim 34, wherein the transgenic CAR is a CAR targeting CD70.

37. The method according to claim 34, wherein the transgenic CAR is a CAR targeting TROP2.

38. The method according to claim 33, wherein the NK cells contain a transgenic TCR.

39. The method according to claim 38, wherein the transgenic TCR is a TCR targeting NY-ESO.

40. The method according to any one of claims 1 to 39, wherein the NK cells contain mutations in endogenous genes.

41. The method according to claim 40, wherein the endogenous gene is an immune regulatory gene.

42. The method according to claim 40 or 41, wherein the endogenous gene is NKG2A, SIGLEC-7, LAG3, TIM3, CISH, FOXOl, TGFBR2, TIGIT, CD96, ADORA2, NR3C1, PD1, PDL-1, PDL-2, CD47, SIRPA, SHIP1, ADAM17, RPS6, 4EBP1, CD25, CD40, IL21R, ICAM1, CD95, CD80, CD86, IL10R, TDAG8, CD5, CD7, SLAMF7, CD38, LAG3, TCR, beta2-microglobulin, HLA, CD73, GCR, CREM, ICER, CREB1, and / or CD39.

43. The method according to any one of claims 1 to 42, wherein the NK cells are activated and / or proliferated prior to inactivation.

44. The method according to claim 43, wherein the NK cells are activated and / or proliferated by culturing with a cell culture solution containing universal antigen-presenting cells (uAPC), IL-2, IL-12, IL-15, and / or IL-18.

45. The method according to claim 43 or 44, wherein the NK cells are activated and / or proliferated for about 5 to about 20 days, about 8 to about 17 days, about 10 to about 15 days, about 12 days, about 13 days, or about 14 days prior to inactivation.

46. The method according to any one of claims 1 to 45, wherein the inactivated NK cells are frozen and cryopreserved for any period.

47. The method according to claim 46, wherein the inactivating agent is contained in the cryopreservation medium.

48. The method according to claim 46, wherein the inactivating agent is washed and removed from the inactivated NK cells prior to cryopreservation.

49. The method according to claim 48, wherein the inactivating agent is washed and removed using 0.5% HSA Plasma-Lyte A buffer.

50. Inactivated and cryopreserved NK cells produced by the method according to any one of claims 46 to 49.

51. Inactivated and thawed cells produced by thawing the inactivated and cryopreserved NK cells according to claim 50.

52. The inactivated and thawed NK cells according to claim 51, which have been washed and from which the inactivating agent has been removed.

53. The inactivated and thawed NK cells according to claim 51 or 52, which are reactivated in the absence of an inactivating agent to produce reactivated NK cells.

54. The reactivated NK cells according to claim 53, which have an improved survival rate compared to cryopreserved NK cells thawed without inactivation.

55. The reactivated NK cells according to claim 53 or 54, wherein when the reactivated NK cells contain a transgene, the expression level of the transgene is not significantly decreased compared to cryopreserved NK cells thawed without inactivation.

56. The reactivated NK cells according to claim 55, wherein the expression level of the transgene is increased compared to cryopreserved NK cells thawed without inactivation.

57. The reactivated NK cells according to any one of claims 53 to 56, which have an increased tumor cell killing rate after cryopreservation compared to cryopreserved NK cells thawed without inactivation.

58. A method of treating a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of the reactivated NK cells according to any one of claims 53 to 57.

59. The method according to claim 58, wherein the subject has cancer.

60. The method according to claim 59, wherein the cancer is a hematological cancer.

61. The method according to claim 60, wherein the hematological cancer is multiple myeloma.

62. The method according to claim 59, wherein the cancer includes solid tumors.

63. The method according to claim 62, wherein the cancer includes ovarian cancer, pancreatic cancer, and / or brain cancer.

64. The method according to claim 59, wherein the cancer is of hematopoietic origin.

65. The method according to any one of claims 58 to 64, wherein the reactivated NK cells are allogeneic or autologous with respect to the subject.

66. The method according to any one of claims 58 to 65, wherein the reactivated NK cells are allogeneic with respect to the subject.

67. The method according to any one of claims 58 to 66, wherein the subject has an improved survival probability compared to a subject not treated with an effective dose of reactivated NK cells.

Images