Uncapped and untailed therapeutic exogenous mRNA and method for producing same

JP2025517453A5Pending Publication Date: 2026-05-22UNIV OF SOUTH ALABAMA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
UNIV OF SOUTH ALABAMA
Filing Date
2023-05-19
Publication Date
2026-05-22

AI Technical Summary

Technical Problem

Current methods for synthesizing exogenous mRNA for therapeutic and vaccine applications require the addition of 5' caps and 3' poly(A) tails, which are costly and time-consuming, and also vulnerable to exonuclease degradation.

Method used

The use of hairpin structures at the 5' and 3' ends of mRNA transcripts instead of traditional caps and tails, combined with internal translation initiation sites, to enhance stability and facilitate single-step in vitro production.

Benefits of technology

This approach reduces production costs and time, increases yield, and enhances the stability and functionality of the mRNA by protecting it from exonuclease degradation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided is a biologically functional polynucleotide in the form of a therapeutic exogenous mRNA with a hairpin instead of a cap and poly(A) tail, as well as a method for its manufacture. The design of the biologically functional polynucleotide allows for a one-step manufacturing method. The target mRNA vector or chemically synthesized mRNA molecule of the biologically functional polynucleotide comprises an internal translation initiation site and a delivery gene sequence. In addition, the target mRNA vector is designed to form a stable hairpin at both the 5' and 3' ends, and the hairpin comprises at least four paired nucleotides in the stem that are linked to the nearest end with no more than two unpaired nucleotides.
Need to check novelty before this filing date? Find Prior Art

Description

Related Applications

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 63 / 344,299, filed May 20, 2022, the entire contents of which are incorporated by reference herein. [Technical field]

[0002] The subject matter of this disclosure relates generally to synthesizing therapeutic exogenous mRNAs having hairpins in place of caps and poly(A) tails. [Background technology]

[0003] The success of mRNA vaccines in controlling the SARS-CoV-2 pandemic has confirmed the efficacy of mRNA immunization, and since the first approval of an mRNA vaccine against the SARS-CoV-2 pandemic by the FDA in 2021, scientists have become more knowledgeable about the design and synthesis of mRNA for vaccines, as well as developed a better understanding of the manufacturing costs for such vaccines. Currently, mRNAs synthesized for use as therapeutics or vaccines are usually transcribed in vitro using a DNA template, and capped and polyadenylated. The 5' cap and 3' poly(A) tail are important not only for initiating protein translation, but also for protection against 5' and 3' exonucleases that can rapidly degrade mRNA transcripts. Unfortunately, the 5' cap is the most expensive component of exogenously produced mRNA, accounting for approximately 45% of the raw material cost.

[0004] The main advantage of exogenous mRNA-based vaccines is that they are less expensive and can be produced faster than conventional vaccines such as subunit vaccines, live attenuated vaccines, and inactivated vaccines. In addition, exogenous mRNA-based vaccines also avoid the safety issues inherent in handling live viruses, which results in simpler downstream purification processes and faster production when compared to conventional vaccine production methods. In addition to mRNA-based vaccines, other therapeutic exogenous mRNA-based technologies have recently seen a rapid increase in interest in the biotechnology field. This is especially true in situations where short-term protein expression is a necessary attribute in a therapeutic agent, since the function and degradation of therapeutic exogenous mRNA occurs via the same degradation mechanisms that cause endogenous mRNA to function and degrade. In addition to vaccines, biotechnologies in which therapeutic exogenous mRNA may be particularly important include protein supplementation, gene therapy, and cancer immunotherapy. Exogenous mRNA may also be useful as a therapeutic agent for the treatment of clinical diseases.

[0005]

[0005] As mentioned before, the current synthesis methods of exogenous mRNA-based biotechnology also incorporate cap and tail structures. This is mainly because almost all endogenous eukaryotic mRNAs contain a 5' cap structure and a 3' strand of adenosine nucleotides (poly(A) tail) that are added during RNA processing. Although both capping and adding long poly(A) tails to eukaryotic mRNAs are important for the proper function and stability of current exogenous mRNA-based biotechnology, both capping and tailing require additional steps, which slow down the production of exogenous mRNA-based biotechnology and add to the cost of producing the vaccine. Redesigning mRNA transcripts to retain their function and stability without the requirement for caps and lengthy poly(A) tails will reduce the cost, increase the speed, and improve the yield of in vitro mRNA production. The cap is necessary not only to initiate translation but also to protect the 5' end of the mRNA transcript from exonucleases, while the poly(A) tail is essential to protect the 3' end from exonucleases. Either alternative to the cap and tail is required to accomplish these tasks.

[0006]

[0006] One possible solution to replace the role of the cap in initiating translation is to use internal translation initiation sites, which can range from a modified single nucleotide to hundreds of modified or unmodified nucleotides located in the middle of a polyribonucleotide. Known examples of internal translation initiation include, but are not limited to, IRES-stimulated translation initiation, 5'UTR m6A-mediated translation initiation, YTHDF1-mediated translation initiation, ribosome shunting, and repeat-associated non-AUG (RAN) translation. However, using such methods to initiate translation on transcripts that lack a 5' cap and a 3' poly(A) tail still requires a method to protect the 5' and 3' ends from exonucleases.

[0007]

[0007] Therefore, there is a need in the art for in vitro synthesized mRNA transcripts that can be functional and stable without 5' caps and / or 3' poly(A) tails. Furthermore, there is a need in the art for therapeutic exogenous mRNA-based technologies that can be produced in vitro in a single step to increase production efficiency and reduce production costs. Summary of the Invention

[0008]

[0008] Therapeutic exogenous mRNAs having hairpins instead of caps and poly(A) tails and methods for their manufacture are provided. In one aspect, the biologically functional polynucleotides and methods for their manufacture can be used to accelerate the production of vaccines. In another aspect, the biologically functional polynucleotides and methods for their manufacture can be used to reduce the cost of vaccines and treatments for transient diseases / injuries. In yet another aspect, the biologically functional polynucleotides and methods for their manufacture can be used to increase the yield of RNA when the same amount of raw material is used for its manufacture. In general, the biologically functional polynucleotides and methods for their manufacture of the present disclosure are intended to be used as an alternative to the design and manufacture of therapeutic exogenous mRNAs (both linear and circular). In addition, the design of the biologically functional polynucleotides and methods for their manufacture allow for a one-step manufacturing process as opposed to some of the multi-step manufacturing processes required for more conventional capped and tailed therapeutic exogenous mRNA molecules.

[0009] In a preferred embodiment, the biologically functional polynucleotide is an mRNA comprising a target mRNA designed to form hairpins at both the 5' and 3' ends, said hairpin having no unpaired nucleotides in the stem and between the stem and the ends. The biologically functional polynucleotide hairpins are preferably formed by pairing of four or more complementary base pairs resulting in a double-stranded mRNA segment at the 5' and 3' ends. Each hairpin comprises at least one loop, said at least one loop being composed of two or more unpaired nucleotides. Furthermore, the loop is a sequence that does not form a stable double-stranded RNA within a given hairpin, but can form a linkage with other sequences within the molecule without destroying the given hairpin. The target mRNA preferably comprises an mRNA transcript or a chemically synthesized mRNA molecule that includes an internal translation initiation site integrated upstream of a transgene. In a preferred embodiment, the internal translation initiation site is an internal ribosome entry site (IRES) and is incorporated into the mRNA transcript or chemically synthesized mRNA molecule within the 5' untranslated region (5'UTR) of the mRNA transcript or chemically synthesized mRNA molecule. The hairpin is contiguous with the rest of the mRNA at the 5' and 3' ends, including but not limited to single hairpins, double hairpins and triple hairpins, with 0 or 2 or less unpaired nucleotides separating each individual hairpin. The terminal hairpin may also function as another important structured portion in the mRNA molecule (part of a structured IRES, hairpin-based protein binding site, etc.) that plays an additional role in mRNA translation and stability. Thus, biologically functional polynucleotide embodiments can include target mRNAs with multiple different types of hairpins without departing from the inventive subject matter described herein.Furthermore, the 5' hairpin is operably linked to the internal translation initiation site by a linker nucleotide sequence that may vary in sequence and number, while the 3' hairpin is operably linked to the open reading frame (ORF) of the gene delivered by another linker nucleotide sequence that may also vary in sequence and number. In addition, the linker nucleotide sequence to which the hairpin is operably linked may vary in sequence and number.

[0010]

[0010] The DNA sequence used to generate the target mRNA sequence is first inserted into a DNA source (plasmid DNA, genomic DNA, synthetic DNA, PCR product, etc.) to generate a DNA template, which is configured to encode an RNA transcript with an internal translation initiation incorporated upstream of the gene sequence to be delivered and containing the target mRNA continuous with hairpins at both ends. In vitro transcription is then performed using T7 RNA polymerase; however, other RNA polymerases such as SP6, T3, etc. can be used without departing from the subject matter of the invention described herein. This results in a target mRNA vector that possesses an internal translation initiation upstream of the gene sequence to be delivered. Furthermore, since the DNA template is configured to generate an mRNA transcript with an internal translation initiation incorporated therein and continuous hairpins at both the 5' and 3' ends, there is no need to add a cap or poly(A) tail in a subsequent step, which allows for the generation of a stable and functional therapeutic exogenous mRNA in a single step. Alternatively, terminal hairpins can be added to the mRNA only at the 5' end. In this case, a poly(A) tail may be required at the 3' end for mRNA protection and proper functionality. Similarly, a terminal hairpin may be added to the mRNA only at the 3' end. In this case, a cap may be required at the 5' end for mRNA protection and proper functionality. Natural and modified ribonucleotides (or a combination thereof) may be used for the synthesis of the target mRNA. Alternatively, the target mRNA vector may be chemically synthesized without a DNA template to generate the therapeutic exogenous mRNA in a single step.

[0011]

[0011] The foregoing summary has outlined some features of the biologically functional polynucleotides and methods of production so that those skilled in the relevant art may better understand the detailed description that follows. Additional features that form the subject matter of the claims are described hereinafter. Those skilled in the relevant art will appreciate that these features can be readily used to design or modify other structures for carrying out the same purposes of the biologically functional polynucleotides and methods disclosed herein. Those skilled in the relevant art will also appreciate that such equivalent designs or modifications do not depart from the scope of the biologically functional polynucleotides and methods of the present disclosure.

[0012]

[0012] These and other features, aspects, and advantages of the present disclosure will become better understood with regard to the following description, appended claims, and accompanying drawings. [Brief description of the drawings]

[0013] [Figure 1] FIG. 1 is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 2A] FIG. 2A is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 2B] FIG. 2B is a diagram illustrating eGFP fluorescent signal in cells transfected with a biologically functional polynucleotide encoding eGFP. [Figure 3A] FIG. 3A is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 3B] FIG. 3B is a diagram illustrating eGFP fluorescent signal in cells transfected with a biologically functional polynucleotide encoding eGFP. [Figure 4A] FIG. 4A is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 4B] FIG. 4B is a diagram illustrating eGFP fluorescent signal in cells transfected with a biologically functional polynucleotide encoding eGFP. [Figure 5A] FIG. 5A is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 5B] FIG. 5B is a diagram illustrating eGFP fluorescent signal in cells transfected with a biologically functional polynucleotide encoding eGFP. [Figure 5C] FIG. 5C is a diagram illustrating eGFP fluorescent signal in cells transfected with a biologically functional polynucleotide encoding eGFP. [Figure 6A] FIG. 6A is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 6B] FIG. 6B is a diagram illustrating eGFP fluorescent signal in cells transfected with a biologically functional polynucleotide encoding eGFP. [Figure 7A] FIG. 7A is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 7B] FIG. 7B is a diagram illustrating eGFP fluorescent signal in cells transfected with a biologically functional polynucleotide encoding eGFP. [Figure 8A] FIG. 8A is a diagram illustrating a biologically functional polynucleotide embodying features consistent with the principles of the present disclosure. [Figure 8B] FIG. 8B is a diagram illustrating hemagglutinin (HA) expression (ELISA data) in cells transfected with a biologically functional polynucleotide encoding HA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014]

[0013] In the summary above and in this detailed description, as well as in the claims that follow and in the accompanying drawings, reference is made to certain features of the invention, including method steps. It is to be understood that the disclosure of the invention herein includes all possible combinations of such specific features. For example, when a specific feature is disclosed in a particular aspect or embodiment of the invention, or in the context of a particular claim, that feature can also, to the extent possible, be used in combination with / or in the context of other specific aspects of the embodiments of the invention, and in the invention generally.

[0015] Illustrative Definitions Following long-standing patent law convention, the words "a" and "an" mean "one or more" when used in this application, including the claims.

[0016]

[0015] The term "comprising" and its grammatical equivalents are used herein to mean that other components, steps, etc. are optionally present. For example, a biologically functional polynucleotide that "comprises" components A, B, and C can include only components A, B, and C, or can include not only components A, B, and C, but also one or more other components.

[0017]

[0016] The term "consisting of" and its grammatical equivalents are used herein to mean that other components, steps, etc. are optionally absent. For example, a biologically functional polynucleotide "consisting of" components A, B, and C can include only components A, B, and C.

[0018]

[0017] As used herein, the terms "about" and "approximately" are interchangeable and should generally be understood to mean a range of numbers around a given number as well as all numbers within a stated range of numbers (e.g., "about 5 to 15" means "about 5 to about 15" unless otherwise stated). Furthermore, all numerical ranges herein should be understood to include each and every whole integer within the range.

[0019]

[0018] In accordance with the present invention, polynucleotides, nucleic acid segments, nucleic acid sequences, etc. include, but are not limited to, DNA (including, but not limited to, genomic or extragenomic DNA), genes, peptide nucleic acids (PNAs), RNA (including, but not limited to, rRNA, mRNA and tRNA), nucleosides, and suitable nucleic acid segments that are either obtained from natural sources, chemically synthesized, modified, or otherwise prepared or synthesized in whole or in part by the hand of man.

[0020]

[0019] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and compositions similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and compositions are described herein. For purposes of the present invention, the following terms are defined below:

[0020] As used herein, the term "internal translation initiation site" describes an RNA element that allows for translation initiation in a cap-independent manner.

[0021]

[0021] As used herein, the term "subject" describes an organism, including mammals such as primates, to which treatment using the compositions according to the present invention can be provided. Mammalian species that can benefit from the disclosed treatment methods include, but are not limited to, apes; chimpanzees; orangutans; humans; monkeys; pet animals such as dogs and cats; farm animals such as horses, cows, pigs, sheep, goats, and chickens; and other animals such as mice, rats, guinea pigs, and hamsters.

[0022]

[0022] As used herein, the term "treatment" or any grammatical variations thereof (e.g., treat, treating, treatment, etc.) includes, but is not limited to, alleviating the symptoms of a disease or condition; and / or reducing, suppressing, inhibiting, reducing, ameliorating or affecting the progression, severity, and / or extent of a disease or condition. As used herein, the term "effective amount" means an amount capable of treating or ameliorating a disease or condition or otherwise producing the intended therapeutic effect.

[0023]

[0023] As used herein, the term "therapeutic agent" or any grammatical variation thereof includes, but is not limited to, drug therapies used to treat a patient with an existing disease or condition. Types of therapeutic agents that can be used to treat a patient's existing disease or condition include, but are not limited to, mRNA-based therapies targeting cancer, infectious diseases, genetic diseases, autoimmunity, etc.

[0024] As used herein, the term "prophylactic agent" or any grammatical variation thereof includes, but is not limited to, a medication used for the purpose of preventing or ameliorating the effects of a disease or condition that the patient does not already have. A type of prophylactic agent that can be used to prevent or ameliorate the effects of a disease or condition includes, but is not limited to, a vaccine.

[0025]

[0025] As used herein, the term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which a compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, such as mineral oil, vegetable oils, such as peanut oil, soybean oil, and sesame oil, animal oils, or oils of synthetic origin. Saline solutions and aqueous dextrose and glycerol solutions can also be utilized as liquid carriers.

[0026]

[0026] As used herein, the term "carrier" is intended to include any solvent, dispersion medium, coating agent, diluent, buffer, isotonicity agent, solution, suspension, colloid, inert substance, etc., or combinations thereof, that are pharma- ceutically acceptable for administration to the relevant animal. The use of one or more delivery vehicles for biological compounds in general, and chemotherapeutic agents in particular, is well known to those skilled in the art of formulation. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in diagnostic, prophylactic, and therapeutic compositions is contemplated. One or more supplementary active ingredients may also be incorporated into or administered with one or more of the disclosed chemotherapeutic compositions.

[0027]

[0027] As used herein, the term "DNA source" refers to any DNA fragment carrying a suitable polymerase promoter, internal translation initiation site, transgene, untranslated region or any other regulatory elements, including nucleotide sequences for linkers, enhancers, repressors and hairpins, to generate a suitable mRNA transcript. Alternatively, a DNA molecule isolated free of total genomic DNA of a particular species can serve as a "DNA source". Thus, a DNA source obtained from a biological sample using one of the compositions disclosed herein can refer to one or more DNA sources that may or may not be isolated away from or purified free of total genomic DNA of the particular species from which the DNA source is obtained. DNA segments and smaller fragments of such segments, as well as recombinant vectors, including, for example, plasmids, cosmids, phages, viruses, PCR products, synthetic DNA, DNA ligation products, and the like, are included within the scope of the term "DNA source".

[0028]

[0028] As used herein, the term "effective amount" means an amount capable of treating or ameliorating a disease or condition or otherwise producing the intended therapeutic effect.

[0029]

[0029] As used herein, the term "for example" (or "eg") is used merely as an example, without any intended limitation, and should not be construed as referring only to the items explicitly listed in this specification.

[0030]

[0030] The term "identical" or percent "identity" in the context of two or more nucleic acid or polypeptide sequences means two or more sequences or subsequences that have the same or a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence as determined using one of the sequence comparison algorithms described below (or other algorithms available to those of skill in the art) or by visual inspection.

[0031]

[0031] As used herein, the phrase "in need of treatment" refers to a judgment made by a caregiver, such as a physician or veterinarian, that a patient needs (or will benefit in one or more ways from) treatment. Such a judgment may be made based on a variety of factors that are within the caregiver's area of ​​expertise, and can include knowledge that the patient is ill as a result of a disease condition that is treatable by one or more compounds or pharmaceutical compositions such as those described herein.

[0032]

[0032] As used herein, the term "nucleic acid" includes one or more types of polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose) and any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base, or a modified purine or pyrimidine base, including an abasic site. As used herein, the term "nucleic acid" also includes polymers of ribonucleosides or deoxyribonucleosides that are covalently linked, typically by phosphodiester bonds between the subunits, but in some cases by phosphorothioates, methylphosphonates, etc. "Nucleic acid" includes single- and double-stranded DNA, as well as single- and double-stranded RNA. Exemplary nucleic acids include, but are not limited to, gDNA; hnRNA; mRNA; rRNA, tRNA, microRNA (miRNA), small interfering RNA (siRNA), small nucleolar RNA (snORNA), small nuclear RNA (snRNA), and small temporal RNA (stRNA), and the like, and any combination thereof.

[0033]

[0033] As used herein, the term "naturally occurring" refers to the fact that an object can be found in nature when applied to an object. For example, a polypeptide or polynucleotide sequence that exists in an organism (including viruses) that can be isolated from a natural source and has not been intentionally modified by the hand of man in a laboratory is naturally occurring. As used herein, a laboratory strain of rodent that can be selectively bred according to classical genetics is considered to be a naturally occurring animal.

[0034]

[0034] As used herein, the term "operably linked" means that the nucleic acid sequences to be linked are typically contiguous or substantially contiguous, and, where necessary, link two or more structural elements of a vector or two or more protein coding regions. However, because enhancers generally function when several kilobases away from the promoter, and because intronic sequences can be of variable length, some polynucleotide elements can be operably linked but not contiguous.

[0035]

[0035] As used herein, the term "patient" (also interchangeably referred to as "host" or "subject") refers to any host that can be administered one or more of the pharmaceutical compositions disclosed herein. Preferably, the subject is a vertebrate, which is intended to refer to any animal species (and preferably, a mammalian species, such as a human). In certain embodiments, "patient" refers to any animal host, including, but not limited to, any mammalian host. Preferably, the term refers to any mammalian host, including, but not limited to, humans and non-human primates, cows, dogs, goats, cabines, crows, epines, horses, cats, goats, lapines, leporines, wolves, mice, sheep, pigs, frogs, racines, foxes, etc., including livestock, zoological specimens, exotic species, as well as companion animals, pets, and any animals under veterinary care. The patient may be of any age in which the patient is capable of responding to inoculation with a vaccine of the present invention by generating an immune response, hi certain embodiments, the mammalian patient is preferably human.

[0036]

[0036] The phrase "pharmacologically acceptable" refers to molecular entities and compositions that preferably do not produce allergic or similar adverse reactions when administered to mammals, particularly humans. As used herein, "pharmacologically acceptable salts" refer to salts that preferably retain the desired biological activity of the parent compound and do not impart any undesired toxic effects. Examples of such salts include, but are not limited to, acid addition salts formed with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid, and the like); and salts formed with organic acids, including, but not limited to, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, pamoic acid (embonic acid), alginic acid, naphthoic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid, and the like; salts containing polyvalent metal cations, such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, and the like; salts formed with organic cations formed from N,N'-dibenzylethylenediamine or ethylenediamine; and combinations thereof.

[0037] As used herein, the terms "prevent," "preventing," "prevention," "suppress," "suppressing," and "suppression," as used herein, refer to the administration of a compound, either alone or in a pharmaceutical composition, prior to the onset of clinical symptoms of a disease, to prevent any symptom, aspect, or feature of the disease state. Such prevention and suppression need not be absolute to be considered medically useful.

[0038]

[0038] As used herein, the term "polypeptide" is intended to encompass the singular "polypeptide" as well as the plural "polypeptides," and includes any chain or chains of two or more amino acids. Thus, terms including, but not limited to, "peptide," "dipeptide," "tripeptide," "protein," "enzyme," "amino acid chain," and "contiguous amino acid sequence" are all included within the definition of "polypeptide" as used herein, and the term "polypeptide" can be used in place of or interchangeably with any of these terms. The term further includes polypeptides that have undergone one or more post-translational modifications, including, for example, but not limited to, modifications by glycosylation, acetylation, phosphorylation, amidation, derivatization, proteolytic cleavage, post-translational processing, or inclusion of one or more non-naturally occurring amino acids. There is a conventional nomenclature in the art for polynucleotide and polypeptide structures. For example, single-letter and three-letter abbreviations are widely used to describe amino acids: alanine (A; Ala), arginine (R; Arg), asparagine (N; Asn), aspartic acid (D; Asp), cysteine ​​(C; Cys), glutamine (Q; Gln), glutamic acid (E; Glu), glycine (G; Gly), histidine (H; His), isoleucine (I; Ile), leucine (L; Leu), methionine (M; Met), phenylalanine (F; Phe), proline (P; Pro), serine (S; Ser), threonine (T; Thr), tryptophan (W; Trp), tyrosine (Y; Tyr), valine (V; Val), and lysine (K; Lys). The amino acid residues described herein are preferably in the "l" isomer. However, residues in the "d" isomeric form can be substituted for any l-amino acid residue, as long as the desired properties of the polypeptide are retained.

[0039]

[0039] "Protein" is used interchangeably herein with "peptide" and "polypeptide" and includes both synthetically, recombinantly, or in vitro produced peptides and polypeptides, as well as peptides and polypeptides expressed in vivo after administration of a nucleic acid sequence to a host animal or human subject. The term "polypeptide" is preferably intended to refer to any amino acid chain length, including short peptides of about 2 to about 20 amino acid residues in length, oligopeptides of about 10 to about 100 amino acid residues in length, and longer polypeptides, including those of about 100 amino acid residues or more in length. Furthermore, the term is also intended to include enzymes, i.e., functional biomolecules that include at least one amino acid polymer. The polypeptides and proteins of the present invention also include polypeptides and proteins that are or have been post-translationally modified, including any sugars or other derivatives or conjugates added to the backbone amino acid chain.

[0040]

[0040] The term "recombinant" indicates that a material (e.g., a polynucleotide or polypeptide) has been altered artificially or synthetically (non-naturally) through human intervention. The alteration can be made to the material within or removed from its natural environment or condition.

[0041]

[0041] As used herein, the term "subject" describes an organism, including mammals such as primates, to which treatment using the compositions according to the present invention can be provided. Mammalian species that can benefit from the disclosed treatment methods include, but are not limited to, humans, apes; non-human primates, such as chimpanzees; monkeys, and orangutans; pet animals, including dogs and cats, and livestock, such as horses, cows, pigs, sheep, and goats; or other mammalian species, including, but not limited to, mice, rats, guinea pigs, rabbits, hamsters, etc.

[0042] The term "substantially complementary" when used to define a nucleic acid sequence means that a particular subject sequence, e.g., an oligonucleotide sequence, is substantially complementary to all or a portion of the selected sequence and will therefore specifically self-anneal to a portion of DNA or RNA having the selected sequence. Thus, the number of unpaired nucleotides tolerated in a given sequence depends on the total number of nucleotides in the given sequence and the point at which unpaired nucleotides cause stability problems in the sequence. For example, the hairpin of the present invention includes a "stem" and a "loop". The "stem" of the sequence contains 4 or more paired nucleotides, but can be much larger. The number of unpaired nucleotides that can be tolerated is the number of unpaired nucleotides to destabilize the stem, which in a preferred embodiment should be 20% or less unpaired nucleotides. For example, a stem with 10 paired nucleotides can tolerate 2 unpaired nucleotides. On the other hand, the "loop" of the sequence contains 2 or more unpaired nucleotides. Although these non-pairing nucleotides may be complementary to each other, due to steric folding problems, they cannot self-anneal to each other within a given hairpin, and therefore are "non-pairing".However, the nucleotides in the loop can pair with other distant sequences within the molecule without destroying the given hairpin.In many cases, it may be desirable for the sequence to be an exact match, i.e., to be completely complementary to the sequence that the oligonucleotide specifically self-anneals to, and therefore have zero mismatches along the complementary stretch.

[0043]

[0043] As used herein, the terms "treat", "treating" and "treatment" refer to the administration of one or more compounds (either alone or contained in one or more pharmaceutical compositions) after the onset of clinical symptoms of a disease state to reduce or eliminate any symptom, aspect or characteristic of the disease state. Such treatment need not be absolute to be considered medically useful. Thus, the terms "treatment", "treat", "treated" or "treating" can refer to therapy, or to an improvement or reduction in the extent or severity of a disease, of one or more symptoms thereof, whether before or after its development has afflicted the patient.

[0044]

[0044] As used herein, the term "vector" refers to any molecule / particle that artificially carries an exogenous nucleic acid sequence, usually DNA or RNA, into a target cell and is used as a vehicle by which the nucleic acid sequence can be replicated or expressed in the target cell. Plasmids, PCR products, mRNA, viruses, and / or cosmids are exemplary vectors.

[0045]

[0045] As used herein, an "effective amount" will be understood by one of skill in the art to provide a therapeutic, prophylactic or otherwise beneficial effect to a recipient patient.

[0046]

[0046] The phrases "isolated" or "biologically pure" refer to material that is substantially or essentially free from components which normally accompany the material when found in the native state. Thus, isolated polynucleotides according to the present invention preferably are free of materials which normally accompany the polynucleotides in their natural or in situ environment.

[0047]

[0047] "Connect" or "link" means any method known in the art for operatively linking one or more proteins, peptides, nucleic acids, or polynucleotides, including, but not limited to, recombinant fusion, covalent bonding, disulfide bonding, ionic bonding, hydrogen bonding, electrostatic bonding, and the like.

[0048]

[0048] As used herein, the term "plasmid" refers to a genetic construct composed of genetic material (i.e., nucleic acid). Typically, a plasmid contains an origin of replication that is functional in a bacterial host cell, e.g., Escherichia coli, and a selection marker for detecting a bacterial host cell containing the plasmid. A plasmid of the present invention can contain one or more genetic elements as described herein, arranged such that an inserted coding sequence can be transcribed and translated in a suitable expression cell. In addition, a plasmid can contain one or more nucleic acid segments, genes, promoters, enhancers, activators, multicloning regions, or any combination thereof, including segments obtained or derived from one or more natural and / or artificial sources.

[0049] Of course, the present invention also encompasses nucleic acid segments that are complementary, essentially complementary, and / or substantially complementary to at least one or more of the specific nucleotide sequences specifically set forth herein. In a preferred embodiment, a nucleic acid sequence that is "complementary" is one that is capable of base pairing according to standard Watson-Crick complementarity rules. However, RNAs that can be folded and stabilized by non-canonical base pairing, including but not limited to Hoogsteen base pairing and wobble base pairing, are also encompassed by the present disclosure. As used herein, the term "complementary sequence" refers to a nucleic acid sequence that is substantially complementary, as can be assessed by the same nucleotide comparisons set forth above, or as defined as being capable of hybridizing to one or more of the specific nucleic acid segments disclosed herein under relatively stringent conditions, such as those immediately described above.

[0050] In certain embodiments, it is advantageous to utilize one or more nucleic acid segments of the present invention in combination with a suitable detectable marker (i.e., "label"), such as in the case of utilizing a labeled polynucleotide probe in determining the presence of a given target sequence in a hybridization assay. A wide variety of suitable indicator compounds and compositions are known in the art for labeling oligonucleotide probes, including, but not limited to, fluorescent, radioactive, enzymatic or other ligands such as avidin / biotin, etc., that can be detected in a suitable assay. In certain embodiments, one or more fluorescent labels or enzyme tags, such as urease, alkaline phosphatase or peroxidase, can also be utilized in place of radioactive or other environmentally less desirable reagents. In the case of enzyme tags, colorimetric, chromogenic or fluorogenic indicator substrates are known that can be utilized to provide a method for detecting a sample that is visible to the human eye or by analytical methods such as scintigraphy, fluorometry, spectrometry, etc., to identify specific hybridization with a sample containing one or more complementary or substantially complementary nucleic acid sequences. In the case of so-called "multiplexed" assays, in which two or more labeled probes are detected either simultaneously or sequentially, it may be desirable to label a first oligonucleotide probe with a first label having a first detection property or parameter (e.g., emission and / or excitation spectral maximum) and to also label a second oligonucleotide probe with a second label having a different (i.e., unobtrusive or distinguishable from the first label) second detection property or parameter. The use of multiplexed assays, particularly in the context of gene amplification / detection protocols, is well known to those skilled in the art of molecular genetics.

[0051] Biologically Functional Polynucleotides

[0051] Figures 1-8B illustrate preferred embodiments of biologically functional polynucleotides 105 that are the subject of therapeutic exogenous mRNA-based technology and the manufacturing method thereof. The biologically functional polynucleotides 105 are designed overall to be stable and functional without the need for a cap or poly(A) tail. Figure 1 shows several biologically functional polynucleotide 105 designs that can be used as therapeutic mRNA, including biologically functional polynucleotides 105 that lack a cap and poly(A) tail. Figures 2A and 2B show biologically functional polynucleotides 105 with corresponding eGFP fluorescent signals in transfected HEK293 cells 24 hours after electroporation. All four biologically functional polynucleotides 105 had identical sequences, except for their terminal sequences, which either formed or did not form stable hairpins 105B. 3A and 3B show biologically functional polynucleotides 105 with corresponding eGFP fluorescent signals in transfected HEK293 cells 24 hours after electroporation. All biologically functional polynucleotides 105 had identical sequences, except for their terminal sequences, which either did or did not form stable hairpins 105B and either contained or did not contain short internal poly(A) sequences adjacent to the 5' and 3' terminal hairpins 105B. FIG. 4A and 4B show biologically functional polynucleotides 105 with corresponding eGFP fluorescent signals in transfected HEK293 cells 24 hours after electroporation. All vectors had identical sequences, except for the terminal hairpins 105B or the portions where short poly(A) sequences are shown. FIG. 5A-5C show biologically functional polynucleotides 105 with corresponding eGFP fluorescent signals in transfected HEK293 cells 24, 48, 72, and 96 hours after electroporation.6A and 6B show biologically functional polynucleotides 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24 and 48 hours after electroporation. FIGs. 7A and 7B show biologically functional polynucleotides 105 with corresponding eGFP fluorescence signals in transfected HEK293 cells 24 and 48 hours after electroporation. FIGs. 8A and 8B show biologically functional polynucleotides 105 with corresponding hemagglutinin (HA) expression (ELISA data) in transfected MDCK cells 12 hours after electroporation. When a method including two or more specified steps is referred to herein, the specified steps can be performed in any order or simultaneously (unless the context excludes that possibility), and the method can include one or more other steps that are performed before any of the specified steps, between two of the specified steps, or after all of the specified steps (unless the context excludes that possibility).

[0052] In a preferred embodiment, the biologically functional polynucleotide 105 is an mRNA consisting of a target mRNA designed to form a hairpin 105B at both the 5' and 3' ends, said hairpin 105B comprising a stem and a loop structure. The stem is continuous with the remainder of the mRNA transcript or chemically synthesized mRNA molecule 105A and preferably comprises at least 80% paired nucleotides and can tolerate up to two unpaired nucleotides at the mRNA end. The loop is connected to the stem and preferably comprises at least two unpaired nucleotides in a given hairpin. The hairpin 105B of said biologically functional polynucleotide 105 is preferably formed by pairing of four or more complementary base pairs resulting in a double-stranded mRNA segment at the 5' and 3' ends. Each hairpin 105B includes at least one loop; however, other preferred embodiments of the biologically functional polynucleotide 105 can include a cap, a tail, or both a cap and a tail without departing from the inventive subject matter described herein.

[0053] In a preferred embodiment, the following (hairpin) sequences at the 5' and 3' ends are preferred: Double hairpin structure 5' end GGGCCGUCCGGGCAAUUGCCCGGACGGCCCCCCGGCAGCCCGCAAUUGCGGGCUGCCGGG>>>>> 3' end >>>>>GCGCGCCAGGGCGCCAAUUGGCGCCCUGGCGCGCCCGCGGGUGGGCGCCAAUUGGCGCCCACCCGCGG Triple hairpin structure 5' end GGGAGACCCGAGCUCGGAUCCGAGCUCGGAUCCGAGCUCGGGUCUCCCGCUGCCUGUCCGGGCAUAUGCCCGGACAGGCAGCGACGCUGGCUGGACGCUUAAGGCGUCCAGCCAGCGUC>>>>> 3' end >>>>>CGGACGACGUCGCUCAGGUAUACCUGAGCGACGUCGUCCGACCGGUGUCACGUGCGGCUGCAGCCGCACGUGAGCACCGGUGGGUCGAGGCUGAUCGGCGAGCUCGGUUAACCGAGCUCGCCGAUCAGCCUCGACCC

[0054] However, the effect of these terminal hairpin structures on mRNA functionality is largely sequence-independent and depends primarily on the stability of the hairpin formed. In another preferred embodiment, the stable hairpin contains a range of 20-40 nucleotides and possesses a higher percentage of GC in the stem. However, one skilled in the art will appreciate that stable hairpins with different numbers of nucleotides and / or different combinations of nucleotides can also be used to generate biologically functional polynucleotides and do not depart from the subject matter of the invention described herein.

[0054]

[0055] The target mRNA preferably comprises an mRNA transcript or chemically synthesized mRNA molecule 105 that includes an internal translation start site 105C, an internal ribosome entry site (IRES), integrated upstream of the gene sequence to be delivered. In a preferred embodiment, the internal translation start site 105C is an internal ribosome entry site (IRES) and is integrated into the mRNA transcript 105 (or the chemically synthesized mRNA molecule) within the 5' untranslated region (5'UTR) of the mRNA transcript 105 (or the chemically synthesized mRNA molecule). The hairpin 105B of the target mRNA 105 is contiguous with the internal translation start site 105C, the delivered gene sequence, and the untranslated region of the mRNA transcript or chemically synthesized mRNA molecule 105A at one or both of the 5' and 3' ends. The hairpins 105B of the biologically functional polynucleotide 105 include, but are not limited to, single hairpins, double hairpins, and triple hairpins, where the double hairpins and triple hairpins have zero or a minimal number of unpaired nucleotides separating each individual hairpin. Thus, an embodiment of the biologically functional polynucleotide 105 can include a target mRNA having multiple different types of hairpins 105B without departing from the subject matter of the invention described herein. For example, the biologically functional polynucleotide 105 can include an mRNA having a double hairpin operably linked to the target mRNA at the 5' untranslated region and a double hairpin operably linked to the target mRNA at the 3' untranslated region. For example, the target mRNA 105 can have a single hairpin at the 5' end and a triple hairpin at the 3' end. Furthermore, the 5' end hairpin 105B is operably linked to the internal translation initiation site 105C by a linker nucleotide sequence that may vary in sequence and number, while the 3' untranslated region hairpin 105B is operably linked to the open reading frame (ORF) of the gene delivered by another linker nucleotide sequence that may also vary in sequence and number. In addition, the linker nucleotide sequence to which hairpin 105B is operably linked may vary in sequence and number.

[0055]

[0056] The DNA sequence used to generate the target mRNA is first inserted into a DNA source (plasmid DNA, genomic DNA, synthetic DNA, PCR product, etc.) to generate a DNA template, which is configured to encode an RNA transcript containing a target mRNA 105 with an internal translation initiation site 105C incorporated upstream of the transgene and continuous with hairpins 105B at both ends. In vitro transcription is then performed using T7 RNA polymerase; however, other RNA polymerases such as SP6, T3, etc. can be used without departing from the subject matter of the invention described herein. This results in a target mRNA vector 105 carrying an internal translation initiation site 105C upstream of the transgene. Furthermore, since the DNA template is configured to generate an mRNA transcript with an internal translation initiation site 105C incorporated therein and continuous with hairpins 105B at both the 5' and 3' ends, there is no need to add a cap or poly(A) tail in a subsequent step, which allows for the generation of a stable and functional therapeutic exogenous mRNA in a single step. Natural and modified ribonucleotides (or a combination thereof) can be used for the synthesis of the target mRNA 105. Alternatively, the terminal hairpin 105B can be added to the mRNA only at the 5' end. In this case, a poly(A) tail may be required at the 3' end for mRNA protection and proper functionality. Similarly, the terminal hairpin 105B can be added to the target mRNA 105 only at the 3' end. In this case, a cap may be required at the 5' end for mRNA protection and proper functionality.

[0056]

[0057] Alternatively, the target mRNA 105 can be chemically synthesized without a DNA template to generate therapeutic exogenous mRNA in a single step. Currently, chemically generated RNA (i.e., RNA generated in vitro without the use of a DNA template) is almost always synthesized using automated solid-phase methods. Other methods include solid-phase synthesis of combined RNA using chemical ligation to link multiple chemically synthesized strands of RNA to generate mRNA. Therapeutic and prophylactic uses

[0058] Another aspect of the present invention relates to the use of target mRNA 105 to facilitate efficient transfection of cells, tissues and / or organs of interest and / or for use in therapeutic and prophylactic agents such as gene-based therapies and vaccines, respectively.

[0057]

[0059] In one embodiment, the present invention provides a method for generating therapeutic or experimental mRNA for delivery to a cell, tissue and / or organ of interest, comprising introducing into the cell a composition comprising an effective amount of a single-stranded polynucleotide comprising a target mRNA 105 of the present invention, which may include at least one regulatory element. In certain embodiments, the mRNA regulatory elements of the present invention can be used to affect control of protein expression from one or more mRNAs encoding one or more gene products, therapeutic agents, proteins, etc. in a suitable host cell.

[0058]

[0060] In addition, the present invention provides methods for the treatment of disease comprising administering to a subject in need of such treatment and / or vaccination an effective amount of a composition comprising one or more polynucleotide sequences encoding a selected protein of interest operably arranged with one or more of the mRNA regulatory elements disclosed herein, whereby the regulatory elements can affect, alter, reduce, increase or otherwise control the translation of the encoded protein from the mRNA whose translation the regulatory elements are affecting.

[0059]

[0061] The present invention also provides the use of the compositions disclosed herein in the manufacture of a medicament for treating, preventing or ameliorating symptoms of a disease, disorder, dysfunction, injury or trauma, including, but not limited to, treating, preventing and / or preventing a disease, disorder or dysfunction, and / or ameliorating one or more symptoms of such disease, disorder or dysfunction.Exemplary conditions in which the biologically functional polynucleotide 105 may find particular utility include, but are not limited to, viral, bacterial or other pathogen infection, cancer, diabetes, allergy, autoimmune disease / disorder, kidney disease, cardiovascular disease, pancreatic disease, intestinal disease, liver disease, neurological disease, neuromuscular disorder, neuromotor deficiency, neuroskeletal disorder, neuropathy, sensory nerve dysfunction, stroke, alpha 1-antitrypsin (AAT) deficiency, Batten disease, ischemia, eating disorder, Alzheimer's disease, Huntington's disease, Parkinson's disease, bone disease and lung disease.

[0060]

[0062] The present invention also provides methods for treating or ameliorating symptoms of such disease, injury, disorder or dysfunction in a mammal. Such methods generally include at least the step of administering to a mammal in need of such treatment or amelioration one or more biologically functional polynucleotides 105 of the present invention in an amount and for a period of time sufficient to treat or ameliorate symptoms of such disease, injury, disorder or dysfunction in the mammal.

[0061]

[0063] Such therapeutic regimens are particularly contemplated for human therapy, via administration of one or more compositions either intramuscularly, intravenously, subcutaneously, intrathecally, intraperitoneally, or by direct injection into the organ or tissue of the subject being treated.

[0062]

[0064] The present invention also provides a method for providing a therapeutically effective amount of a biologically functional polynucleotide 105 of the present invention to a mammal in need of such a therapeutic agent, in an amount and for a period of time effective to provide the patient with a therapeutically effective amount of a desired therapeutic agent encoded by one or more nucleic acid segments contained within the biologically functional polynucleotide 105. Preferably, the therapeutic agent is an mRNA, although other embodiments of the biologically functional polynucleotide 105 may be selected from the group consisting of a ribozyme, a peptide nucleic acid, an siRNA, an RNAi antisense oligonucleotide, and an antisense polynucleotide.

[0063] Pharmaceutical Compositions

[0065] The present invention also provides therapeutic or pharmaceutical compositions comprising the active ingredient in a form that can be combined with a therapeutically or pharma- ceutically acceptable carrier.The genetic constructs of the present invention can be prepared in a variety of compositions and can also be formulated in a suitable pharmaceutical vehicle for administration to human or animal subjects.

[0064]

[0066] The biologically functional polynucleotides 105 of the present invention provide novel and useful methods for the regulation of protein translation in suitable mammalian cells, and provide new opportunities for the expression of one or more selected genes of interest in said mammalian cells. The biologically functional polynucleotides 105 of the present invention also provide compositions comprising one or more of the disclosed biologically functional polynucleotides 105.

[0065]

[0067] As described herein, the compositions of the present invention may further comprise pharmaceutical excipients, buffers, transfection reagents, nanoparticles, nanolipoprotein particles, lipid nanoparticles (NLPs), or diluents, and may be formulated for administration to animals, particularly humans. Such compositions may optionally further comprise liposomes, lipids, lipid complexes, microspheres, microparticles, nanospheres, or nanoparticles, or may be otherwise formulated for administration to cells, tissues, organs, or bodies of subjects in need of such compositions. Such compositions may be used to treat, for example, viral, bacterial or other pathogen infections, cancer, tumors, or other malignant growths, neurological deficits and dysfunctions, allergies, autoimmune diseases / disorders, joint diseases, heart or lung diseases, ischemia, stroke, cerebrovascular accidents, transient ischemic attacks (TIA); diabetes and / or other diseases of the pancreas; cardiovascular diseases or dysfunctions (including, for example, hypotension, hypertension, atherosclerosis, hypercholesterolemia, vascular damage or disease); neurological diseases (including, for example, Alzheimer's disease, Huntington's disease, Tay-Sachs disease, Parkinson's disease, memory loss, trauma, etc.) , movement disorders, neuropathy, and related disorders); bile duct, kidney or liver disease or dysfunction; musculoskeletal or neuromuscular diseases (including, for example, arthritis, spasticity, cystic fibrosis (CF), amyotrophic lateral sclerosis (ALS), multiple sclerosis (MS), muscular dystrophy (MD), etc.).

[0066]

[0068] In some preferred embodiments, the target mRNA 105 having at least one hairpin 105B can be formulated with one or more pharma- ceutically acceptable solutions for administration to cells or animals, either alone or in combination with one or more other modalities of therapy, particularly for therapy of human cells, tissues, and diseases affecting humans. This includes embodiments of biologically functional compounds that also contain at least one of a cap and a poly(A) tail. If desired, additional nucleic acid segments can be operably linked to the target mRNA vector 105, and the product can then be administered to an animal (either alone or in combination with one or more other agents, such as, for example, proteins or polypeptides or various pharma- ceutical active agents, therapeutic polypeptides, biologically active fragments, or variants thereof). In fact, there are few limitations on other components that can be included as well, so long as the additional agents do not cause significant adverse effects upon contact with target cells or host tissues and / or do not prevent the target mRNA 105 from being expressed in the animal to which the biologically functional polynucleotide 105 is administered. Thus, compositions containing the biologically functional polynucleotide 105 can be delivered with a variety of other agents as required for a particular instance. Such compositions can be purified from host cells or other biological sources, or alternatively, can be chemically synthesized as described herein.

[0067]

[0069] The formulation of pharma- ceutically acceptable excipients and carrier solutions, as well as the development of suitable dosing and treatment regimens for using the particular compositions described herein in various treatment regimens, including, for example, oral, parenteral, intravenous, intranasal, intraarticular, intramuscular administration and formulation, are well known to those skilled in the art. Typically, these formulations will contain at least about 0.1% or more of the active compound, although the percentage of the active ingredient can, of course, vary and can conveniently be from about 1 or 2% to about 70% or 80% or more of the total formulation weight or volume. Of course, the amount of active compound in each therapeutically useful composition can be prepared in such a manner that a suitable dosage can be obtained for any given unit dose of the compound. Factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations will be considered by those skilled in the art of preparation of such pharmaceutical formulations, and therefore, various dosages and treatment regimens may be desirable.

[0068]

[0070] In certain circumstances, it may be desirable to deliver the disclosed biologically functional polynucleotide 105 in a suitably formulated pharmaceutical composition as disclosed herein subcutaneously, intraocularly, intravitreally, parenterally, subcutaneously, intravenously, intracerebroventricularly, intramuscularly, intrathecally, orally, intraperitoneally, by oral or intranasal inhalation, or by direct injection into one or more cells, tissues, or organs. Methods of administration may also include modalities as described in U.S. Pat. Nos. 5,543,158, 5,641,515, and / or 5,399,363, each of which is specifically incorporated herein in its entirety by express reference thereto. Solutions of the active compounds as free bases or pharma-ceutically acceptable salts may be prepared in sterile water, suitably mixed with one or more surfactants, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof, as well as in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

[0069]

[0071] Pharmaceutical dosage forms of the disclosed biologically functional polynucleotide 105-containing compositions suitable for injection applications include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Patent No. 5,466,468, specifically incorporated herein by express reference in its entirety). In all cases, the dosage form must be sterile and fluid to the extent that easy syringability exists. The dosage form must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), suitable mixtures thereof, and / or vegetable oils. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0070]

[0072] The compositions of the invention can be administered to the subject being treated by standard routes, including, but not limited to, intrapulmonary, intranasal, oral, inhalation, parenteral such as intravenous, topical, transdermal, intradermal, transmucosal, intraperitoneal, intramuscular, intracapsular, intraorbital, intracardiac, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural and intrasternal injection. In preferred embodiments, the compositions are administered via intranasal, intrapulmonary or oral routes.

[0071]

[0073] For administration of an injectable aqueous solution, for example, the solution can be suitably buffered if necessary, and the liquid diluent is first made isotonic with sufficient saline or glucose. These particular aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, the sterile aqueous media that can be utilized will be known to those skilled in the art in view of the present disclosure. For example, one dose can be dissolved in 1 mL of isotonic NaCl solution and added to 1000 mL of subcutaneous infusion or injected at the proposed site of infusion (see, for example, "Remington's Pharmaceutical Sciences", 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person administering will determine the appropriate dose for the individual subject in any event. Furthermore, for human administration, the preparation should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologics standards.

[0072]

[0074] Sterile injectable solutions are prepared by incorporating the biologically functional polynucleotide 105 in the required amount in a suitable solvent containing some of the other ingredients listed above, if necessary, followed by filtration sterilization. In general, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and the other required ingredients listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred preparation method is vacuum drying and freeze-drying technology, which obtains a powder of the active ingredient plus any additional desired ingredients from a previously sterile-filtered solution of sterile injectable solutions.

[0073]

[0075] The compositions containing the disclosed biologically functional polynucleotide 105 can also be formulated in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed with the free amino groups of the protein) and salts formed with inorganic acids, such as, for example, hydrochloric or phosphoric acid, or organic acids, such as, for example, acetic acid, oxalic acid, tartaric acid, mandelic acid, and the like. Salts formed with free carboxyl groups can also be derived from inorganic bases, such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxide, and organic bases, such as isopropylamine, trimethylamine, histidine, procaine, and the like. Upon formulation, solutions are administered in a manner compatible with the dosage formulation and in an amount that is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as injectable solutions, drug release capsules, and the like.

[0074]

[0076] The amount of the composition containing the disclosed biologically functional polynucleotide 105 and the time required to administer said composition are within the purview of the skilled artisan having the benefit of the present teachings. However, administration of a therapeutically effective amount of the disclosed composition may be achieved by a single administration, such as a single injection of a sufficient number of infectious particles to provide a therapeutic benefit to the patient receiving such treatment. Alternatively, in some situations, it may be desirable to provide multiple or continuous administrations of the composition containing the disclosed biologically functional polynucleotide 105 over either a relatively short or relatively long period of time, as can be determined by the physician supervising the administration of such compositions. EXAMPLES

[0075]

[0077] The following examples are included to demonstrate exemplary embodiments of the invention. It will be understood by those skilled in the art that the techniques disclosed in these examples represent techniques found to function well in the practice of the invention and therefore may be considered to constitute preferred modes for its practice. However, those skilled in the art will understand in light of this disclosure that numerous changes can be made in the specific embodiments disclosed and still obtain similar or similar results without departing from the spirit and scope of the invention. EXAMPLES

[0076]

[0078] Example 1 - The ability of an uncapped and unadenylated RNA vector containing an unstructured UTR to express a fluorescent reporter (eGFP) from an EMCV IRES to that of a target mRNA 105 of the same length but containing a stable terminal hairpin 105B at one or more termini is presented herein in the form of a biologically functional polynucleotide having a transcript or chemically synthesized mRNA molecule operably linked to a hairpin 105B at one or more termini. The use of an internal translation initiation sequence allowed the generation of a target mRNA 105 without a 5' cap and poly(A) tail. The lack of a 5' cap and 3' poly(A) tail leaves these RNAs highly susceptible to degradation from exonucleases, which significantly reduces their expression efficiency. The inclusion of a stable terminal hairpin 105B at each end of a transcript or chemically synthesized mRNA molecule lacking a cap and poly(A) tail can increase protein translation by reducing their susceptibility to exonuclease activity and / or by affecting regulatory mechanisms of protein translation. The effect of incorporating stable secondary RNA hairpin structures at either or both ends of the mRNA on the efficiency of eGFP expression 24 hours after vector delivery into HEK293 cells by electroporation (Figure 2) was studied.

[0077]

[0079] The results were compared with eGFP expression from a control vector (-R-) containing an IRES and with 5' and 3' UTRs of the same length but lacking a stable terminal hairpin structure. As illustrated in FIG. 2, transfection with the control vector without the hairpin 105B resulted in very low eGFP expression. Although eGFP expression was slightly increased when the transcript or chemically synthesized mRNA molecule 105 contained a 5' hairpin (hR-), the presence of the hairpin 105B at the 3' end (-Rh) had a significantly more positive effect on eGFP expression. Delivery of the transcript or chemically synthesized mRNA molecule 105 with both 5' and 3' hairpins (hRh) resulted in maximum eGFP expression. These findings indicated that the addition of terminal secondary structures improved translation initiated by the EMCV IRES in the target mRNA 105 lacking a cap and poly(A) sequence. EXAMPLES

[0078]

[0080] Example 2 - Internal polyadenosine sequences can act as additional entry points for poly(A) binding proteins (PABPs) and play an important role in regulating gene expression, especially in MSCV IRES-driven vectors that show relatively little dependency on the 3' poly(A) terminal compartment for translation initiation. To determine whether such internal poly(A) sequences improve translation efficiency in target mRNAs 105 with one or more terminal hairpins, relatively short (40 bp) poly(A) stretches were inserted immediately downstream of the 5' terminal hairpin or upstream of the 3' terminal hairpin, after which eGFP expression was evaluated. All vectors had identical IRES-eGFP internal transcription cassettes and differed only in the presence or absence of terminal hairpins and poly(A) segments. HEK293 cells were electroporated with these target mRNAs and eGFP signals were measured after 24 hours.

[0079]

[0081] As illustrated in FIG. 3, the presence of a poly(A) sequence downstream of the 5′ hairpin had little to no effect on eGFP expression when the 3′ end was unstructured (i.e., lacked the hairpin; haR- and hR-). As in Example 1, target mRNA 105 with hairpin 105B at the 3′ end expressed more eGFP than target mRNA 105 with hairpin 105B only at the 5′ end, but the addition of a poly(A) stretch immediately upstream of the 3′ hairpin had minimal effect on expression. Compared to target mRNA 105 with a single hairpin, eGFP expression was relatively greater in all vectors with both 5′ and 3′ hairpins. The addition of a poly(A) sequence to target mRNA 105 containing a terminal hairpin had minimal effect on eGFP expression. EXAMPLES

[0080]

[0082] Example 3 - The effect of replacing the terminal hairpin with a short poly(A) stretch was then examined to determine whether this would increase eGFP expression. The addition of a relatively long poly(A) tail at the 3' end of the mRNA increases protein expression of the capped messenger by stabilizing the RNA and activating translational regulatory mechanisms. Whether this is also true for short poly(A) stretches when the transcript or chemically synthesized mRNA molecule 105 initiates translation from an internal IRES has not been fully investigated.

[0081]

[0083] The 5' and 3' terminal hairpins were replaced by short poly(A) stretches to determine the translation efficiency of these target mRNAs 105 in HEK293 cells. Cells were electroporated with the appropriate vectors, and eGFP expression was measured 24 hours after vector delivery. As illustrated in Figure 4, the addition of a short terminal 3' poly(A) sequence modestly increased eGFP expression in target mRNAs 105 lacking a 3' terminal hairpin (-R- vs. -Ra, aR vs. aRa, and hR- vs. hRa), while the addition of a short terminal 5' poly(A) sequence in target mRNAs 105 lacking a 5' terminal hairpin had no significant effect on eGFP expression (aR- vs. -R-, aRa vs. -Ra, aRh vs. -Rh). The positive effect of hairpin 105B on eGFP expression was much greater than that of the short poly(A) sequence. Target mRNA 105 with hairpins 105B at both ends of the transcript or chemically synthesized mRNA molecule 105 had the highest eGFP expression compared to vectors with other end configurations. EXAMPLES

[0082]

[0084] Example 4 - Transcription products or chemically synthesized mRNA molecules operably linked to terminal hairpins were able to support higher levels of eGFP expression. We investigated whether capping and post-translational polyadenylation with a relatively long poly(A) tail affected translation efficiency in target mRNA 105 with both 5' and 3' hairpins. As illustrated in Figure 4, the biologically functional polynucleotide 105 with transcription products or chemically synthesized mRNA molecules operably linked to bilateral terminal hairpins linked to internal poly(A) sequences downstream of the 5' terminal hairpin (haRh) vector had the best expression efficiency. Therefore, it was selected as the preferred biologically functional polynucleotide 105 for these experiments. A vector without an IRES sequence but containing the same eGFP ORF was used for comparison (-R-). The length of the 5' and 3' UTRs of this vector was comparable to that of the vector haRh, but was purposely designed not to form stable secondary structures (i.e., not to form terminal hairpins). These two (control) vectors (-R- and haRh) were then transformed with 3'-O-Me- 7 Two additional vectors, ChaRhA and CRA, were generated by capping with a G(5')ppp(5')G RNA cap analog (also known as anti-reverse cap analog (ARCA)) and polyadenylation with E. coli poly(A) polymerase to generate tail lengths of more than 200 bases.

[0083]

[0085] To assess the stability of protein expression, eGFP levels in targeted cells were measured 24–96 h after vector delivery (Figure 5B and Figure 5C). Cell transfection was achieved by electroporation. The control vector -R-, lacking a 5' cap and a long terminal poly(A), expressed barely detectable eGFP. Vectors CRA (initiated translation with a 5' cap and polyadenylated) and haRh (initiated translation via an IRES and lacked a cap and poly(A) tail) had comparable eGFP expression when used at equimolar concentrations (Figure 5C). A vector combining a bilateral hairpin, a 5' cap, a long poly(A) tail, and the MSCV IRES (ChaRhA) produced the highest eGFP levels at all time points. The fluorescent signal decayed at a consistent rate in all cells 24–96 h after electroporation.

[0084]

[0086] To determine which modification was primarily responsible for the increased eGFP expression from the ChaRhA vector (capped and long poly(A) tail), two more biologically functional polynucleotides 105 were generated: ChaRh, which was capped but lacked the long poly(A) tail, and haRhA, which was not capped but had a long poly(A) tail (Figure 6A). As illustrated in Figure 6B, both modifications increased eGFP expression, but adding a cap (ChaRh) had a greater effect than adding a poly(A) tail (haRhA). The effects of adding both a cap and a poly(A) tail were additive. Similar to the findings in Figure 5, there was no difference between the vectors in the rate of eGFP signal decay over time. EXAMPLES

[0085]

[0087] Example 5 - It is possible that the presence of even more complex secondary structures near either end of an RNA may protect this end from exonucleases by physically restricting the access of the exonuclease to this end.

[0086]

[0088] To test the possibility that the presence of even more complex secondary structures near either end of the RNA could protect this end from exonucleases by physically restricting the access of the exonuclease to the end, we investigated whether a triple-end hairpin structure in the delivered RNA would improve protein expression over that of a single hairpin. Since the inclusion of poly(A) extensions in previous experiments had minimal effect on eGFP expression, three novel biologically functional polynucleotides 105 with no internal poly(A) sequence were constructed and compared to a target mRNA 105 (hRh) carrying a single hairpin at each end (Figure 7A). In one vector, we replaced the single 5' hairpin by a triple-hairpin structure (hhhRh). The individual hairpins 105B were linked together without a non-pairing linker. A second vector was constructed by replacing the single 3' hairpin in the hRh vector by a 3' triple-hairpin structure using the same strategy (hRhhh). The final vector had a triple hairpin structure at both ends (hhhRhhh).

[0087]

[0089] To assess the stability of protein expression, eGFP levels were measured in HEK293 cells transfected with each vector 24 and 48 hours after vector delivery by electroporation (Figure 7B). All vectors containing triple hairpin structures demonstrated enhanced eGFP expression compared to the single hairpin vector (hRh). The vector combining triple hairpin structures at both the 5' and 3' ends (hhhRhhh) produced the highest eGFP levels at both time points. Of particular note, the fluorescence signal at 48 hours after electroporation was approximately 42-43% of the value seen at 24 hours for all vectors, except for one containing triple hairpins at both ends (hhhRhhh), where the fluorescence was 48%. The slower fluorescence decay rate may be explained by improved vector stability in the cells. EXAMPLES

[0088]

[0090] Example 6: To evaluate what exclusive effects the use of a 5' double hairpin and an IRES may have on the expression of membrane proteins, an mRNA vector encoding influenza hemagglutinin (HA) instead of eGFP was tested. Thus, as illustrated in Figure 8A, four additional biologically functional polynucleotides 105 were generated that differ only at the 5' mRNA end: 1) an mRNA vector without a cap and without an IRES, 2) an mRNA vector with a cap ((C), ARCA) and without an IRES, 3) an mRNA vector without a cap, with a 5' double hairpin and an IRES, and 4) an mRNA vector with a cap ((C), ARCA), a 5' double hairpin and an IRES (n=2, * P<0.05). All four vectors had a 3' double hairpin and a poly(A) tail. Figure 8B illustrates HA expression (ELISA data) with equal amounts of mRNA in MDCK cells 12 hours after transfection with TransIT®-mRNA reagent. As can be seen in Figure 8B, the use of a 5' double hairpin and an IRES increased HA expression by approximately 5-fold compared to the vector containing a 5' cap and no IRES. Furthermore, the addition of a 5' cap to an mRNA vector containing a 5' double hairpin and an IRES had little effect on total HA expression.

[0089] Consideration

[0091] Here, we show that mRNAs designed to form hairpin secondary structures at both the 5' and 3' ends maintain high levels of reporter expression in eukaryotic cells, even in the absence of a 5' cap and 3' polyadenylation tail, so long as the EMCV IRES is included in its 5'UTR. Equimolar levels of EMCV IRES-containing mRNAs showed the same levels of protein expression as conventionally constructed (non-IRES-containing) mRNAs containing a 5' cap and 3' poly(A) tail. The presence of internal, but not terminal, poly(A) stretches did not significantly affect protein expression. Combining post-transcriptional capping and polyadenylation with terminal hairpins resulted in higher translation efficiency than either strategy alone. Using a triple hairpin structure instead of a single hairpin further increased protein expression, exceeding that of an IRES-free capped and polyadenylated vector.

[0090]

[0092] In general, therapeutic mRNA is generated in three steps: 1) in vitro mRNA synthesis from a DNA template, 2) addition of a modified guanosine cap to the 5' end of the mRNA, and 3) addition of a poly(A) tail to the 3' end of the mRNA. The mRNA can be capped during transcription by including a cap analog in the nucleotide mix during synthesis, or the cap can be added after the mRNA is fully transcribed. Regardless of the method used, a fraction of uncapped mRNA will always result, rendering the mRNA translationally inactive. With regard to poly(A) tails, relatively short poly(A) tails can be added directly to the ends of the mRNA during transcription by including a sequence in the DNA template. Alternatively, relatively long poly(A) tails, which result in more stable mRNAs, can be added after in vitro transcription using recombinant poly(A) polymerase.

[0091]

[0093] The question is whether mRNA can be synthesized without a cap and poly(A) tail and still function when introduced into cells. For in vitro mRNA transcripts, functioning without a 5' cap requires an alternative way to initiate protein synthesis. One way to do this is to include an internal ribosome entry site (IRES) in the 5' region to initiate translation. Cells use IRES to increase the translation of certain proteins during mitosis and programmed cell death. IRES are often used by viruses to ensure that viral translation is active when host translation is inhibited. Positive-stranded RNA viral genomes that utilize internal ribosome entry sites (IRES) to promote cap-independent translation are affected by poly(A) binding proteins (PABPs) and poly(A) status, while transcription from other IRESs shows a much lower dependency on polyadenylation status. The EMCV IRES used in the vectors described herein relies on the traditional set of eukaryotic initiation factors (except for eIF4E and intact eIF4G), but does not require 5'-3' communication with PABP or a poly(A) tail in vitro, at least during the first round of initiation. Thus, using an IRES rather than a 5' cap to initiate protein synthesis allows removal of the poly(A) tail without significantly compromising protein synthesis.

[0092]

[0094] It should therefore be possible to generate uncapped and non-adenylated mRNAs containing an open reading frame downstream of an IRES that would efficiently translate proteins. This approach has not been used in either molecular biology applications or vaccine or therapeutic drug production, however, because the uncapped 5' and non-adenylated 3' ends are highly susceptible to exonuclease degradation, which reduces mRNA stability.

[0093]

[0095] One way to protect exogenously produced uncapped and non-adenylated mRNA from exonuclease degradation is to construct circular RNA. EMCV IRES-driven reporter RNA vectors can be engineered to form circular RNAs that lack both caps and poly(A). Such circular RNAs do not have free ends that are vulnerable to exonucleases and therefore exhibit increased stability, leading to extended duration of protein expression. However, circular RNAs lack flexibility due to their rigid secondary structure, and transfection of cells with exogenous circular RNAs leads to activation of antiviral gene products such as OAS, PKR, and RIG-I, which can initiate cellular responses to circular RNA.

[0094]

[0096] An alternative method to protect the ends of mRNAs that lack caps and poly(A) tails is to include nucleotide hairpins at the 5' and 3' ends. Nucleotide hairpins are complementary base pairings that are essential secondary structures of RNA. Hairpins may guide RNA folding, determine interaction with ribozymes, protect mRNAs from degradation, serve as recognition motifs for RNA-binding proteins, or act as substrates for enzymatic reactions. It has been shown that a 5'-terminal stem-loop structure can stabilize mRNAs in various bacteria, presumably by preventing RNase E from interacting with the 5' end of the message. Of note, the localization of this stem-loop at or very close to the 5' and 3' ends appears to be crucial for its stabilizing effect, whereas the sequence of this hairpin and its position relative to the ribosome-binding site appear to have little effect. Up to two unpaired nucleotides upstream of the 5' hairpin can be tolerated without any reduction in mRNA stability, but the addition of 10-15 random unpaired nucleotides is as destabilizing as the deletion of the 5' hairpin. A strong Shine-Dalgarno sequence near the 5' end of the message in E. coli can stabilize the message by recruiting ribosomes and blocking nuclease access to the degradation signals present in naked mRNA.

[0095]

[0097] The role for terminal hairpin structures in eukaryotes has not been widely studied because such structures appear to be rare in metazoans. At the 5' end, terminal hairpins can interfere with cap-induced processes, and at the 3' end, the majority of mRNAs are flanked by a polyadenylation signal followed by 10-30 downstream nucleotides and a poly(A) tail that makes terminal hairpin formation unlikely. Non-polyadenylated mRNAs are rare in eukaryotes.

[0096]

[0098] We hypothesized that by adding a stable hairpin 105B during in vitro synthesis, both ends of the exogenous mRNA vector could be protected; this could stabilize the molecule and protect the mRNA from exonuclease degradation upon delivery to target cells. However, this could only be possible with mRNAs that do not rely on their ends to function. The inclusion of the EMCV IRES at the 5' end to initiate translation allows for the generation of in vitro mRNA transcripts in a single step, avoiding the costly and time-consuming 5' cap addition and 3' poly(A) addition.

[0097]

[0099] Using this strategy, we generated effective mRNA transcripts that were comparable to conventionally constructed mRNAs containing a 5' cap and a 3' poly(A) tail. The use of triple hairpins at each end resulted in the highest increase in reporter expression of any vector tested (i.e., conventional construct, hairpin 105B containing an IRES, or hairpin 105B containing an IRES with a cap and poly(A) tail). Although such mRNA structures are rare in eukaryotic cells, they can be easily synthesized in vitro in a single step and subsequently delivered as a drug or vaccine. In these experiments, we used the EMCV IRES, but other IRESs could be used as well. However, each IRES may function differently depending on the vector, so the results need to be experimentally verified.

[0098] [000100] These results demonstrate that 5' cap and 3' poly(A) tail are not always required for successful expression of exogenously generated mRNA in eukaryotic cells. Inclusion of 5' IRES is sufficient to initiate translation of the encoded protein. Inclusion of hairpin 105B (single or triple) at each end protects the mRNA from exonuclease degradation. This provides a potential method for rapid generation of exogenous mRNA using a single step, thus saving time and reducing costs.

[0099] References [000101] The following references, to the extent that they provide exemplary procedural or other details supplementary to those set forth herein, are specifically incorporated herein in their entireties by express reference thereto: 1. Teijaro, JR, and Farber, DL (2021). COVID-19 vaccines: modes of immune activation and future challenges. Nat Rev Immunol 21, 195-197. 10.1038 / s41577-021-00526-x. 2. Wadhwa, A., Aljabbari, A., Lokras, A., Foged, C., and Thakur, A. (2020). Opportunities and Challenges in the Delivery of mRNA-based Vaccines. Pharmaceutics 12. 10.3390 / pharmaceutics12020102. 3. Ramanathan, A., Robb, GB, and Chan, SH (2016). mRNA capping: biological functions and applications. Nucleic Acids Res 44, 7511-7526. 10.1093 / nar / gkw551. 4. Ghosh, A., and Lima, CD (2010). Enzymology of RNA cap synthesis. Wiley Interdiscip Rev RNA 1, 152-172. 10.1002 / wrna.19. 5. Shuman, S. (2001). Structure, mechanism, and evolution of the mRNA capping apparatus. Prog Nucleic Acid Res Mol Biol 66, 1-40. 10.1016 / s0079-6603(00)66025-7. 6. Shatkin, A.J. (1976). Capping of eucaryotic mRNAs. Cell 9, 645-653. 10.1016 / 0092-8674(76)90128-8. 7. Decroly, E., Ferron, F., Lescar, J., and Canard, B. (2011). Conventional and unconventional mechanisms for capping viral mRNA. Nat Rev Microbiol 10, 51-65. 10.1038 / nrmicro2675. 8. Galloway, A., and Cowling, V.H. (2019). mRNA cap regulation in mammalian cell function and fate. Biochim Biophys Acta Gene Regul Mech 1862, 270-279. 10.1016 / j.bbagrm.2018.09.011. 9. Osborne, M.J., and Borden, K.L. (2015). The eukaryotic translation initiation factor eIF4E in the nucleus: taking the road less traveled. Immunol Rev 263, 210-223. 10.1111 / imr.12240. 10. Culjkovic, B., Topisirovic, I., and Borden, K.L. (2007). Controlling gene expression through RNA regulons: the role of the eukaryotic translation initiation factor eIF4E. Cell Cycle 6, 65-69. 10.4161 / cc.6.1.3688. 11. Trepotec, Z., Geiger, J., Plank, C., Aneja, M.K., and Rudolph, C. (2019). Segmented poly(A) tails significantly reduce recombination of plasmid DNA without affecting mRNA translation efficiency or half-life. RNA 25, 507-518. 10.1261 / rna.069286.118. 12. Nicholson, A.L., and Pasquinelli, A.E. (2019). Tales of Detailed Poly(A) Tails. Trends Cell Biol 29, 191-200. 10.1016 / j.tcb.2018.11.002. 13. Beverly, M., Hagen, C., and Slack, O. (2018). Poly A tail length analysis of in vitro transcribed mRNA by LC-MS. Anal Bioanal Chem 410, 1667-1677. 10.1007 / s00216-017-0840-6. 14. Mangus, D.A., Evans, M.C., and Jacobson, A. (2003). Poly(A)-binding proteins: multifunctional scaffolds for the post-transcriptional control of gene expression. Genome Biol 4, 223. 10.1186 / gb-2003-4-7-223. 15. Goldstrohm, A.C., and Wickens, M. (2008). Multifunctional deadenylase complexes diversify mRNA control. Nat Rev Mol Cell Biol 9, 337-344. 10.1038 / nrm2370. 16. Nelson, J., Sorensen, E.W., Mintri, S., Rabideau, A.E., Zheng, W., Besin, G., Khatwani, N., Su, S.V., Miracco, E.J., Issa, W.J., Hoge, S., et al. (2020). Impact of mRNA chemistry and manufacturing process on innate immune activation. Sci Adv 6, eaaz6893. 10.1126 / sciadv.aaz6893. 17. Rosa, S.S., Prazeres, D.M.F., Azevedo, A.M., and Marques, M.P.C. (2021). mRNA vaccines manufacturing: Challenges and bottlenecks. Vaccine 39, 2190-2200. 10.1016 / j.vaccine.2021.03.038. 18. Copur, M. (2021). Messenger RNA Vaccines: Beckoning of a New Era in Cancer Immunotherapy. Oncology (Williston Park) 35, 190-198. 10.46883 / ONC.2021.3504.0198. 19. Van Hoecke, L., and Roose, K. (2019). How mRNA therapeutics are entering the monoclonal antibody field. J Transl Med 17, 54. 10.1186 / s12967-019-1804-8. 20. Contreras, R., Cheroutre, H., Degrave, W., and Fiers, W. (1982). Simple, efficient in vitro synthesis of capped RNA useful for direct expression of cloned eukaryotic genes. Nucleic Acids Res 10, 6353-6362. 10.1093 / nar / 10.20.6353. 21. Konarska, M.M., Padgett, R.A., and Sharp, P.A. (1984). Recognition of cap structure in splicing in vitro of mRNA precursors. Cell 38, 731-736. 10.1016 / 0092-8674(84)90268-x. 22. Pelletier, J., and Sonenberg, N. (1985). Insertion mutagenesis to increase secondary structure within the 5' noncoding region of a eukaryotic mRNA reduces translational efficiency. Cell 40, 515-526. 10.1016 / 0092-8674(85)90200-4. 23. Nielsen, D.A., and Shapiro, D.J. (1986). Preparation of capped RNA transcripts using T7 RNA polymerase. Nucleic Acids Res 14, 5936. 10.1093 / nar / 14.14.5936. 24. Pasquinelli, A.E., Dahlberg, J.E., and Lund, E. (1995). Reverse 5' caps in RNAs made in vitro by phage RNA polymerases. RNA 1, 957-967. 25. Paterson, B.M., and Rosenberg, M. (1979). Efficient translation of prokaryotic mRNAs in a eukaryotic cell-free system requires addition of a cap structure. Nature 279, 692-696. 10.1038 / 279692a0. 26. Green, M.R., Maniatis, T., and Melton, D.A. (1983). Human beta-globin pre-mRNA synthesized in vitro is accurately spliced in Xenopus oocyte nuclei. Cell 32, 681-694. 10.1016 / 0092-8674(83)90054-5. 27. Fuchs, A.L., Neu, A., and Sprangers, R. (2016). A general method for rapid and cost-efficient large-scale production of 5' capped RNA. RNA 22, 1454-1466. 10.1261 / rna.056614.116. 28. Ray, D., Shah, A., Tilgner, M., Guo, Y., Zhao, Y., Dong, H., Deas, T.S., Zhou, Y., Li, H., and Shi, P.Y. (2006). West Nile virus 5'-cap structure is formed by sequential guanine N-7 and ribose 2'-O methylations by nonstructural protein 5. J Virol 80, 8362-8370. 10.1128 / JVI.00814-06. 29. Preiss, T., Muckenthaler, M., and Hentze, M.W. (1998). Poly(A)-tail-promoted translation in yeast: implications for translational control. RNA 4, 1321-1331. 10.1017 / s1355838298980669. 30. Grier, A.E., Burleigh, S., Sahni, J., Clough, C.A., Cardot, V., Choe, D.C., Krutein, M.C., Rawlings, D.J., Jensen, M.C., Scharenberg, A.M., and Jacoby, K. (2016). pEVL: A Linear Plasmid for Generating mRNA IVT Templates With Extended Encoded Poly(A) Sequences. Mol Ther Nucleic Acids 5, e306. 10.1038 / mtna.2016.21. 31. Cao, G.J., and Sarkar, N. (1992). Identification of the gene for an Escherichia coli poly(A) polymerase. Proc Natl Acad Sci U S A 89, 10380-10384. 10.1073 / pnas.89.21.10380. 32. Martin, G., and Keller, W. (1998). Tailing and 3'-end labeling of RNA with yeast poly(A) polymerase and various nucleotides. RNA 4, 226-230. 33. Weissman, D. (2015). mRNA transcript therapy. Expert Rev Vaccines 14, 265-281. 10.1586 / 14760584.2015.973859. 34. Jang, S.K., Krausslich, H.G., Nicklin, M.J., Duke, G.M., Palmenberg, A.C., and Wimmer, E. (1988). A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. J Virol 62, 2636-2643. 10.1128 / JVI.62.8.2636-2643.1988. 35. Baird, S.D., Turcotte, M., Korneluk, R.G., and Holcik, M. (2006). Searching for IRES. RNA 12, 1755-1785. 10.1261 / rna.157806. 36. Renaud-Gabardos, E., Hantelys, F., Morfoisse, F., Chaufour, X., Garmy-Susini, B., and Prats, A.C. (2015). Internal ribosome entry site-based vectors for combined gene therapy. World J Exp Med 5, 11-20. 10.5493 / wjem.v5.i1.11. 37. van den Akker, G.G.H., Zacchini, F., Housmans, B.A.C., van der Vloet, L., Caron, M.M.J., Montanaro, L., and Welting, T.J.M. (2021). Current Practice in Bicistronic IRES Reporter Use: A Systematic Review. Int J Mol Sci 22. 10.3390 / ijms22105193. 38. Pestova, T.V., Hellen, C.U., and Shatsky, I.N. (1996). Canonical eukaryotic initiation factors determine initiation of translation by internal ribosomal entry. Mol Cell Biol 16, 6859-6869. 10.1128 / MCB.16.12.6859. 39. Emory, S.A., Bouvet, P., and Belasco, J.G. (1992). A 5'-terminal stem-loop structure can stabilize mRNA in Escherichia coli. Genes Dev 6, 135-148. 10.1101 / gad.6.1.135. 40. Deutscher, M.P. (2006). Degradation of RNA in bacteria: comparison of mRNA and stable RNA. Nucleic Acids Res 34, 659-666. 10.1093 / nar / gkj472. 41. Houseley, J., and Tollervey, D. (2009). The many pathways of RNA degradation. Cell 136, 763-776. 10.1016 / j.cell.2009.01.019. 42. Shirokikh, N.E., and Spirin, A.S. (2008). Poly(A) leader of eukaryotic mRNA bypasses the dependence of translation on initiation factors. Proc Natl Acad Sci U S A 105, 10738-10743. 10.1073 / pnas.0804940105. 43. Wigington, C.P., Williams, K.R., Meers, M.P., Bassell, G.J., and Corbett, A.H. (2014). Poly(A) RNA-binding proteins and polyadenosine RNA: new members and novel functions. Wiley Interdiscip Rev RNA 5, 601-622. 10.1002 / wrna.1233. 44. Tusup, M., French, L.E., De Matos, M., Gatfield, D., Kundig, T., and Pascolo, S. (2019). Design of in vitro Transcribed mRNA Vectors for Research and Therapy. Chimia (Aarau) 73, 391-394. 10.2533 / chimia.2019.391. 45. Akiyama, B.M., Eiler, D., and Kieft, J.S. (2016). Structured RNAs that evade or confound exonucleases: function follows form. Curr Opin Struct Biol 36, 40-47. 10.1016 / j.sbi.2015.12.006. 46. Maruggi, G., Zhang, C., Li, J., Ulmer, J.B., and Yu, D. (2019). mRNA as a Transformative Technology for Vaccine Development to Control Infectious Diseases. Mol Ther 27, 757-772. 10.1016 / j.ymthe.2019.01.020. 47. Spriggs, K.A., Bushell, M., Mitchell, S.A., and Willis, A.E. (2005). Internal ribosome entry segment-mediated translation during apoptosis: the role of IRES-trans-acting factors. Cell Death Differ 12, 585-591. 10.1038 / sj.cdd.4401642. 48. Komar, A.A., and Hatzoglou, M. (2011). Cellular IRES-mediated translation: the war of ITAFs in pathophysiological states. Cell Cycle 10, 229-240. 10.4161 / cc.10.2.14472. 49. Lee, K.M., Chen, C.J., and Shih, S.R. (2017). Regulation Mechanisms of Viral IRES-Driven Translation. Trends Microbiol 25, 546-561. 10.1016 / j.tim.2017.01.010. 50. Bradrick, S.S., Dobrikova, E.Y., Kaiser, C., Shveygert, M., and Gromeier, M. (2007). Poly(A)-binding protein is differentially required for translation mediated by viral internal ribosome entry sites. RNA 13, 1582-1593. 10.1261 / rna.556107. 51. Wesselhoeft, R.A., Kowalski, P.S., and Anderson, D.G. (2018). Engineering circular RNA for potent and stable translation in eukaryotic cells. Nat Commun 9, 2629. 10.1038 / s41467-018-05096-6. 52. Chen, Y.G., Kim, M.V., Chen, X., Batista, P.J., Aoyama, S., Wilusz, J.E., Iwasaki, A., and Chang, H.Y. (2017). Sensing Self and Foreign Circular RNAs by Intron Identity. Mol Cell 67, 228-238 e225. 10.1016 / j.molcel.2017.05.022. 53. Svoboda, P., and Di Cara, A. (2006). Hairpin RNA: a secondary structure of primary importance. Cell Mol Life Sci 63, 901-908. 10.1007 / s00018-005-5558-5. 54. Unniraman, S., Chatterji, M., and Nagaraja, V. (2002). A hairpin near the 5' end stabilises the DNA gyrase mRNA in Mycobacterium smegmatis. Nucleic Acids Res 30, 5376-5381. 10.1093 / nar / gkf697. 55. Regnier, P., and Arraiano, C.M. (2000). Degradation of mRNA in bacteria: emergence of ubiquitous features. Bioessays 22, 235-244. 10.1002 / (SICI)1521-1878(200003)22:3<235::AID-BIES5>3.0.CO;2-2. 56. Belasco, J.G., Nilsson, G., von Gabain, A., and Cohen, S.N. (1986). The stability of E. coli gene transcripts is dependent on determinants localized to specific mRNA segments. Cell 46, 245-251. 10.1016 / 0092-8674(86)90741-5. 57. Hansen, M.J., Chen, L.H., Fejzo, M.L., and Belasco, J.G. (1994). The ompA 5' untranslated region impedes a major pathway for mRNA degradation in Escherichia coli. Mol Microbiol 12, 707-716. 10.1111 / j.1365-2958.1994.tb01058.x. 58. Agaisse, H., and Lereclus, D. (1996). STAB-SD: a Shine-Dalgarno sequence in the 5' untranslated region is a determinant of mRNA stability. Mol Microbiol 20, 633-643. 10.1046 / j.1365-2958.1996.5401046.x. 59. Marzluff, WF, Wagner, EJ, and Duronio, RJ (2008). Metabolism and regulation of canonical histone mRNAs: life without a poly(A) tail. Nat Rev Genet 9, 843-854. 10.1038 / nrg2438. 60. Martinez-Salas, E., Francisco-Velilla, R., Fernandez-Chamorro, J., and Embarek, AM (2017). Insights into Structural and Mechanistic Features of Viral IRES Elements. Front Microbiol 8, 2629. 10.3389 / fmicb.2017.02629. [000102] The implementations described in the above description are not representative of all implementations consistent with the subject matter described herein. Instead, they are merely some examples consistent with aspects related to the subject matter described. Although several variations have been described in detail above, other modifications or additions are possible. In particular, additional features and / or variations can be provided in addition to those shown herein. For example, the above implementations may be directed to various combinations and subcombinations of the disclosed features and / or combinations and subcombinations of several additional features disclosed above. In addition, the logic flow depicted in the accompanying drawings and / or described herein does not necessarily require the particular order or sequence shown to achieve the desired results. Those skilled in the art will readily appreciate that various other changes in the details, materials and arrangements of the parts and method steps that have been described and illustrated for the purpose of explaining the nature of the subject matter of the present invention can be made without departing from the principles and scope of the subject matter of the present invention.

[0100] 1. A biologically functional polynucleotide, comprising an mRNA transcript having a first end and a second end, a first terminal hairpin located at the first end of the mRNA transcript; a second terminal hairpin located at the second end of the mRNA transcript; the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold upon themselves via nucleotide pairing; the first terminal hairpin and the second terminal hairpin are linked to the first and second ends via no more than two unpaired nucleotides; Biologically functional polynucleotides.

[0101] 1. A biologically functional polynucleotide comprising a chemically synthesized mRNA molecule having a first end and a second end, a first terminal hairpin is located at the first end of the chemically synthesized mRNA molecule; a second terminal hairpin is located at the second end of the chemically synthesized mRNA molecule; the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold upon themselves via nucleotide pairing; the first terminal hairpin and the second terminal hairpin are linked to the first and second ends via no more than two unpaired nucleotides; Biologically functional polynucleotides.

[0102] an mRNA transcript having a 5' end and a 3' end, a first terminal hairpin located at the 3' end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; the first terminal hairpin is linked to the 3' end via no more than two unpaired nucleotides; mRNA transcripts, and a cap operably linked to the 5' end of the mRNA transcript; A biologically functional polynucleotide comprising:

[0103] a chemically synthesized mRNA molecule having a 5' end and a 3' end, a first terminal hairpin is located at the 3' end of the chemically synthesized mRNA molecule; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; the first terminal hairpin is linked to the 3' end via no more than two unpaired nucleotides; Chemically synthesized mRNA molecules, as well as a cap operably linked to the 5' end of the chemically synthesized mRNA molecule; A biologically functional polynucleotide comprising:

[0104] 1. A biologically functional polynucleotide consisting of an mRNA transcript having a 5' end and a 3' end, a first terminal hairpin located at the 5' end of the mRNA transcript; a poly(A) tail sequence is located at the 3' end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; the first terminal hairpin is linked to the 5' end via no more than two unpaired nucleotides; Biologically functional polynucleotides.

[0105] A biologically functional polynucleotide consisting of a chemically synthesized mRNA molecule having a 5' end and a 3' end, a first terminal hairpin is located at the 5' end of the chemically synthesized mRNA molecule; a poly(A) tail sequence is located at the 3' end of the chemically synthesized mRNA molecule; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; the first terminal hairpin is linked to the 5' end via no more than two unpaired nucleotides; Biologically functional polynucleotides.

[0106] A DNA template configured to encode a target RNA transcript, comprising a DNA source configured to generate a target mRNA transcript, the target mRNA transcript comprises a first end and a second end; a first terminal hairpin located at the first end of the mRNA transcript; a second terminal hairpin located at the second end of the mRNA transcript; the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold upon themselves via nucleotide pairing; the first terminal hairpin and the second terminal hairpin are linked to the first and second ends via no more than two unpaired nucleotides; DNA template.

[0107] A DNA template configured to encode a target RNA transcript, comprising a DNA source configured to generate a target mRNA transcript, the target mRNA transcript comprises a first end and a second end; a first terminal hairpin located at the first end of the mRNA transcript; a poly(A) tail is located at the second end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; the first terminal hairpin is linked to the first terminal via no more than two unpaired nucleotides; DNA template.

[0108] A DNA template configured to encode a target RNA transcript, comprising a DNA source configured to generate a target mRNA transcript, the target mRNA transcript comprises a 5' end and a 3' end; a first terminal hairpin located at the 3' end of the mRNA transcript; a cap is positioned at the 5' end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; the first terminal hairpin is linked to the first terminal via no more than two unpaired nucleotides; DNA template.

[0109] generating a target mRNA vector having an mRNA transcript having a first end and a second end; a first terminal hairpin located at the first end of the mRNA transcript; a second terminal hairpin located at the second end of the mRNA transcript; the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold upon themselves via nucleotide pairing; the first terminal hairpin and the second terminal hairpin are linked to the first terminus and the second terminus via no more than two unpaired nucleotides; the target mRNA vector comprises one of an mRNA transcript and a chemically synthesized mRNA molecule; inserting the target mRNA vector into a DNA source to generate a DNA template; performing in vitro transcription of the DNA template using a DNA-dependent RNA polymerase to obtain a target mRNA vector product; Purifying the target mRNA vector product to produce therapeutic exogenous mRNA. 1. A method for making a biologically functional polynucleotide comprising:

[0110] generating a target mRNA vector having a chemically synthesized mRNA molecule having a first end and a second end; a first terminal hairpin is located at the first end of the chemically synthesized mRNA molecule; a second terminal hairpin is located at the second end of the chemically synthesized mRNA molecule; the first terminal hairpin and the second terminal hairpin are nucleotide sequences configured to stably fold upon themselves via nucleotide pairing; said first terminal hairpin and said second terminal hairpin are linked to said first terminus and said second terminus via no more than two unpaired nucleotides; Purifying the target mRNA vector product to produce therapeutic exogenous mRNA. 1. A method for making a biologically functional polynucleotide comprising:

[0111] generating a target mRNA vector having an mRNA transcript having a 5' end and a 3' end; a first terminal hairpin located at the 3' end of the mRNA transcript; a cap is positioned at the 5' end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; said first terminal hairpin being linked to said 3' terminus via no more than two unpaired nucleotides; inserting the target mRNA vector into a DNA source to generate a DNA template; performing in vitro transcription of the DNA template using a DNA-dependent RNA polymerase to obtain a target mRNA vector product; Purifying the target mRNA vector product to produce therapeutic exogenous mRNA. 1. A method for making a biologically functional polynucleotide comprising:

[0112] generating a target mRNA vector having an mRNA transcript having a 5' end and a 3' end; a first terminal hairpin located at the 5' end of the mRNA transcript; a poly(A) tail is located at the 3' end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; said first terminal hairpin being linked to said 3' terminus via no more than two unpaired nucleotides; inserting the target mRNA vector into a DNA source to generate a DNA template; performing in vitro transcription of the DNA template using a DNA-dependent RNA polymerase to obtain a target mRNA vector product; Purifying the target mRNA vector product to produce therapeutic exogenous mRNA. 1. A method for making a biologically functional polynucleotide comprising:

[0113] preparing a target mRNA vector having a chemically synthesized mRNA molecule having a 5' end and a 3' end; a first terminal hairpin located at the 3' end of the mRNA transcript; a cap is positioned at the 5' end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; said first terminal hairpin being linked to said 3' terminus via no more than two unpaired nucleotides; obtaining a target mRNA vector product using the target mRNA vector; and Purifying the target mRNA vector product to produce therapeutic exogenous mRNA. 1. A method for making a biologically functional polynucleotide comprising:

[0114] preparing a target mRNA vector having a chemically synthesized mRNA molecule having a 5' end and a 3' end; a first terminal hairpin located at the 5' end of the mRNA transcript; a poly(A) tail is located at the 3' end of the mRNA transcript; said first terminal hairpin being a nucleotide sequence configured to stably fold upon itself via nucleotide pairing; said first terminal hairpin being linked to said 3' terminus via no more than two unpaired nucleotides; obtaining a target mRNA vector product using the target mRNA vector; and Purifying the target mRNA vector product to produce therapeutic exogenous mRNA. 1. A method for making a biologically functional polynucleotide comprising:

[0115] 1. A product for use as a therapeutic agent, comprising: inserting a target mRNA vector sequence into a DNA source to generate a DNA template; the target mRNA vector sequence encodes a first terminal hairpin located at a first end of the target mRNA vector and a second terminal hairpin located at a second end of the target mRNA vector; an internal translation initiation site is incorporated into the target mRNA vector; performing in vitro transcription of the DNA template using a DNA-dependent RNA polymerase to obtain a target mRNA vector product; purifying the target mRNA vector product to produce a therapeutic agent; the therapeutic agent is the product; The product prepared by

[0116] 1. A product for use as a therapeutic agent, comprising: inserting a target mRNA vector sequence into a DNA source to generate a DNA template; the target mRNA vector sequence encodes a first terminal hairpin at the 5' end of the target mRNA vector and a poly(A) tail at the 3' end of the target mRNA vector; an internal translation initiation site is incorporated into the target mRNA vector; purifying the target mRNA vector product to produce a therapeutic agent; the therapeutic agent is the product; The product prepared by

[0117] 1. A product for use as a therapeutic agent, comprising: inserting a target mRNA vector sequence into a DNA source to generate a DNA template; the target mRNA vector sequence encodes a first terminal hairpin at the 3' end of the target mRNA vector and a cap at the 5' end of the target mRNA vector; an internal translation initiation site is incorporated into the target mRNA vector; performing in vitro transcription of the DNA template using a DNA-dependent RNA polymerase to obtain a target mRNA vector product; performing in vitro transcription of the DNA template using a DNA-dependent RNA polymerase to obtain a target mRNA vector product; purifying the target mRNA vector product to produce a therapeutic agent; the therapeutic agent is the product; The product prepared by

[0118] 1. A product for use as a therapeutic agent, comprising: performing chemical synthesis on an mRNA vector having a target mRNA vector sequence to produce a chemically synthesized mRNA molecule; the mRNA vector has a first end and a second end; the target mRNA vector sequence encodes a first terminal hairpin located at a first end of the target mRNA vector and a second terminal hairpin located at a second end of the target mRNA vector; an internal translation initiation site is incorporated into said chemically synthesized mRNA molecule; performing transcription on the chemically synthesized mRNA molecule to obtain a target mRNA vector product; purifying the target mRNA vector product to produce a therapeutic agent; the therapeutic agent is the product; The product prepared by

[0119] 1. A product for use as a therapeutic agent, comprising: performing chemical synthesis on an mRNA vector having a target mRNA vector sequence to produce a chemically synthesized mRNA molecule; the target mRNA vector sequence encodes a first terminal hairpin at the 5' end of the target mRNA vector and a poly(A) tail at the 3' end of the target mRNA vector; an internal translation initiation site is incorporated into said chemically synthesized mRNA molecule; performing transcription on the chemically synthesized mRNA molecule to obtain a target mRNA vector product; purifying the target mRNA vector product to produce a therapeutic agent; the therapeutic agent is the product; The product prepared by

[0120] 1. A product for use as a therapeutic agent, comprising: performing chemical synthesis on an mRNA vector having a target mRNA vector sequence to produce a chemically synthesized mRNA molecule; the target mRNA vector sequence encodes a first terminal hairpin at the 3' end of the target mRNA vector and a cap at the 5' end of the target mRNA vector; an internal translation initiation site is incorporated into said chemically synthesized mRNA molecule; performing transcription on the chemically synthesized mRNA molecule to obtain a target mRNA vector product; purifying the target mRNA vector product to produce a therapeutic agent; the therapeutic agent is the product; The product prepared by

Claims

1. A biologically functional polynucleotide consisting of mRNA transcripts having 5' and 3' ends, The first terminal hairpin is located at the 5' end of the mRNA transcript, The poly(A) tail sequence is located at the 3' end of the mRNA transcript, The first terminal hairpin is a nucleotide sequence configured to stably fold itself through nucleotide pairing, The first terminal hairpin is linked to the 5' end via two or fewer non-pairing nucleotides. Biologically functional polynucleotides.

2. The biologically functional polynucleotide according to claim 1, wherein the poly(A) tail is added to the 3' end of the mRNA transcript using poly(A) polymerase.

3. The first end hairpin is one of a triple hairpin, a double hairpin, and a single hairpin. The double hairpin and the triple hairpin each contain nucleotides that do not form pairs of two or fewer between individual hairpins. The biologically functional polynucleotide according to claim 1.

4. Furthermore, the biologically functional polynucleotide according to claim 1 comprises an internal translation initiation site incorporated into the mRNA transcript.

5. The biologically functional polynucleotide according to claim 4, wherein the internal translation initiation site is an internal ribosome entry site (IRES).

6. Furthermore, the biologically functional polynucleotide according to claim 5 comprises a delivery gene sequence incorporated into the mRNA transcript.

7. The biologically functional polynucleotide according to claim 6, wherein the internal translation initiation site is incorporated into the mRNA transcript at a position upstream of the delivery gene sequence of the mRNA transcript.

8. The biologically functional polynucleotide according to claim 7, wherein the internal translation initiation site is incorporated into the mRNA transcript in the 5' untranslated region (5'UTR) of the mRNA transcript.

9. Furthermore, it consists of a DNA source, In order to prepare a DNA template, a nucleotide sequence containing instructions for the mRNA transcript is inserted into the DNA source. The DNA template is configured to encode an RNA transcript containing the mRNA transcript. The biologically functional polynucleotide according to claim 1.

10. The biologically functional polynucleotide according to claim 9, wherein the DNA source is one of plasmid DNA, genomic DNA, synthetic DNA, and PCR product.

11. A biologically functional polynucleotide consisting of a chemically synthesized mRNA molecule having a 5' end and a 3' end, The first terminal hairpin is located at the 5' end of the chemically synthesized mRNA molecule. The poly(A) tail sequence is located at the 3' end of the chemically synthesized mRNA molecule. The first terminal hairpin is a nucleotide sequence configured to stably fold itself through nucleotide pairing, The first terminal hairpin is linked to the 5' end via two or fewer non-pairing nucleotides. Biologically functional polynucleotides.

12. The biologically functional polynucleotide according to claim 11, wherein the poly(A) tail is attached to the 3' end of the chemically synthesized mRNA molecule using poly(A) polymerase.

13. The first end hairpin is one of a triple hairpin, a double hairpin, and a single hairpin. The double hairpin and the triple hairpin each contain nucleotides that do not form pairs of two or fewer between individual hairpins. The biologically functional polynucleotide according to claim 11.

14. Furthermore, the biologically functional polynucleotide according to claim 11 comprises an internal translation initiation site incorporated into the chemically synthesized mRNA molecule.

15. The biologically functional polynucleotide according to claim 14, wherein the internal translation initiation site is an internal ribosome entry site (IRES).

16. Furthermore, the biologically functional polynucleotide according to claim 15 comprises a delivery gene sequence incorporated into the chemically synthesized mRNA molecule.

17. The biologically functional polynucleotide according to claim 16, wherein the internal translation initiation site is incorporated into the chemically synthesized mRNA molecule at a position upstream of the delivery gene sequence of the chemically synthesized mRNA molecule.

18. The biologically functional polynucleotide according to claim 17, wherein the internal translation initiation site is incorporated into the chemically synthesized mRNA molecule in the 5' untranslated region (5'UTR) of the chemically synthesized mRNA molecule.