Anti-PTEN RNA interference oligonucleotides and their use

Abstract

The present invention provides RNA interference (RNAi) oligonucleotides that inhibit the expression of phosphatase and tensin homolog (PTEN), extracellular vesicles containing the RNAi oligonucleotides, pharmaceutical compositions containing the RNAi oligonucleotides or extracellular vesicles, and their use in the treatment of neurological disorders and CNS disorders, and more specifically their use for the treatment of spinal cord injury.

Description

Technical Field

[0001] The present invention relates to RNA interference oligonucleotides that inhibit the expression of PTEN, extracellular vesicles containing the same, RNAi or pharmaceutical compositions containing the vesicles, and their use in the treatment of neuropathy, and more particularly to their use for the treatment of spinal cord injury.

Background Art

[0002] Spinal cord injury can cause autonomic dysfunction, loss of sensation, or loss of motor function. Such spinal cord injury (SCI) is caused by trauma, tumors, ischemia, developmental disorders, neurodegenerative diseases, demyelinating diseases, transverse myelitis, vascular malformations, or other causes. The consequences of SCI depend on the specific nature of the injury and its location along the spinal cord. Furthermore, since SCI is a dynamic process, in all cases of acute spinal cord syndrome, the full extent of the injury may not be immediately apparent. Incomplete spinal cord lesions can progress to more complete lesions. More generally, the injury ascends one or two spinal cord levels within hours to days after the initial event. A complex cascade of pathophysiological events is responsible for this clinical deterioration.

[0003] In many cases, the psychological and social impact of SCI is devastating. Common disability states associated with SCI include permanent paralysis of the limbs, chronic pain, muscle atrophy, loss of spontaneous control of the bladder and bowel, sexual dysfunction, and infertility.

[0004] Recent advances in neuroscience have directed considerable attention to the study of SCI, and significantly improved treatment and rehabilitation options have become available. For example, functional electrical stimulation (FES) has shown the potential to enhance nerve regeneration and significantly improve the recovery and improvement of functional capacity after SCI. However, not all patients with spinal cord injury are eligible for FES, and there must be no complete injury to the spinal cord. The patient must be in a neurologically stable state, and the peripheral nerves must be intact in order to respond to exogenous electrical stimulation.

[0005] Axonal regeneration after SCI is limited by the intrinsically very limited ability of mature neurons to grow and exogenous factors such as glial scars and inhibitory molecules that mature over time. Attempts have been made to modify exogenous factors, but the success has been limited. For example, removal of extracellular inhibitory molecules, delivery of neurotrophic factors, or transplantation of permissive substrates have not been able to elicit robust regeneration of the damaged corticospinal tract.

[0006] Phosphatase and tensin homolog (PTEN) is a highly conserved dual-specificity protein tyrosine phosphatase. This protein dephosphorylates the lipid second messengers phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3] and phosphatidylinositol 3,4-bisphosphate [PI(3,4)P2] to generate phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] and phosphatidylinositol 4-phosphate [PI(4)P], respectively. Due to this unique activity, PTEN becomes a major homeostasis regulator and tumor suppressor protein, and as a result of somatic cell changes, its function is lacking or defective in various types of tumors. The important role of the PI3K / AKT / mTOR signaling pathway in cell growth, regeneration, and survival provides a theoretical basis for the therapeutic targeting of PTEN. Proposed PTEN inhibition-based therapeutic targets include nerve growth and regeneration after injury or trauma, treatment of cardiac ischemia / reperfusion and related diseases, wound repair, and infertility (see review by Pulido, 2018, Molecules, 23, 285). Interestingly, the main paradigm of PTEN's involvement in cancer is as a tumor suppressor, and PTEN inhibition has been shown to be potentially involved in brain metastasis (Zhang et al., Nature, 2015, 527, 100-104).

[0007] PTEN is preferentially expressed in neurons of the adult brain and plays an important role in controlling the regeneration of corticospinal neurons through downregulation of mammalian mTOR activity. mTOR activity is greatly suppressed in axotomized adult neurons, limiting the new protein synthesis required for sustained axonal regeneration. Some publications have referred to the involvement of PTEN in the suppression of nerve regeneration, and other publications have shown positive effects of PTEN depletion on axonal injury or injury-related conditions. Effective inhibition of PTEN would be a candidate to increase mTOR and thereby promote nerve regeneration.

[0008] WO2009 / 117389 describes the therapeutic use of inhibitors of PTEN for treating neurodegenerative disorders. WO2015 / 066701 describes a method of attenuating nerve regeneration or nerve degeneration by administering a PTEN inhibitory peptide near or to a damaged nerve. WO2011 / 044701 describes certain PTEN inhibitory peptides and their use in the treatment of diseases associated with cytotoxic stress including diseases of the central nervous system and injury.

[0009] In particular, there is a vast number of vehicles that have been proposed to be useful for delivering siRNA molecules such as liposomes, protein particles, micelles, lipid particles. Rungta et al. (Molecular Therapy-Nucleic Acids, 2013, 2, e136) showed that siRNA in lipid nanoparticles (LNP) can efficiently halt neuronal gene expression.

[0010] Extracellular vesicles (EVs) are membrane vesicles secreted from various types of cells. EVs are present in blood circulation under normal physiological conditions and their levels increase in various diseases such as diabetes and related vascular complications, cardiovascular diseases, hematological malignancies as well as solid tumors.

[0011] EVs can be divided into the following three subpopulations: (I) Exosomes: typically having a diameter of 30 - 100 nm within the endosomal compartment and originating from the endosomal compartment; (II) Microvesicles: having a diameter of 100 nm - 1 μm and released from the surface by "vesiculation"; (III) Apoptotic bodies: having a diameter of 1 - 5 μm and released from apoptotic cells. EVs contain some elements of the parental cells, including proteins, DNA fragments, microRNAs, and mRNAs.

[0012] EP2254586 is directed to exosomes isolated from mesenchymal stem cells, and the exosomes contain at least one biological property of mesenchymal stem cells. Further, exosomes have been proposed as carriers for various drugs, including small molecules and non-coding RNAs (e.g., US2017 / 0247708 and Ha et al., Acta Pharmaceutica Sinica B 2016;6(4):287 - 296). Typically, siRNA is introduced into exosomes by electroporation. WO2018 / 033911 to some of the inventors of the present application teaches exosomes derived from mesenchymal stem cells for the treatment of neuropathy.

[0013] WO2019 / 186558 discloses a pharmaceutical composition comprising membrane vesicles containing extracellular vesicles called exosomes carrying an exogenous phosphatase and tensin homolog (PTEN) inhibitor, and a method of treating a neurological disease, disorder, or condition using the extracellular vesicles.

[0014] Nevertheless, there remains an unmet need for the development of further safe, efficient, and convenient methods for treating SCI. SUMMARY OF THE INVENTION

[0015] The present invention discloses novel siRNA sequences that are superior to currently known sequences in targeting and inhibiting PTEN mRNA and in reducing PTEN protein expression. The present invention relates to novel compositions and methods that enable the regeneration and recovery of neurons damaged in the CNS. An example of such CNS injury is spinal cord injury (SCI). By using the siRNA molecules of the present invention, it is possible to reduce PTEN protein expression and thus restore the regenerative capacity of neurons and the entire CNS.

[0016] In one aspect, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23 for inhibiting the expression of phosphatase and tensin homolog (PTEN) protein. According to some embodiments, the RNAi is selected from siRNA and shRNA. Thus, according to some embodiments, the present invention provides an RNA interference (RNAi) oligonucleotide for inhibiting the expression of PTEN, comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23, wherein the RNAi is selected from siRNA and shRNA. According to some embodiments, the RNAi is siRNA and the guide strand consists of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the RNAi oligonucleotide comprises a strand complementary to the guide strand, and the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14-19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the RNAi is siRNA and the guide strand comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 2, 3, and 4. According to some embodiments, the RNAi is siRNA and the sense strand comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 25, 26, and 27. According to some embodiments, the RNAi oligonucleotide is a siRNA comprising a guide strand comprising or consisting of the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and a sense strand comprising or consisting of the nucleic acid sequence GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26).

[0017] According to some embodiments, the present invention provides conjugates of the RNAi oligonucleotides as defined above. According to some embodiments, the RNAi conjugates with a hydrophobic moiety. According to yet another embodiment, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

[0018] According to another aspect, the present invention provides an isolated extracellular vesicle (EV) comprising the RNAi oligonucleotide described herein that is capable of inhibiting the expression of PTEN. According to some embodiments, the isolated EV is selected from exosomes, microvesicles, and combinations thereof.

[0019] According to yet another aspect, the present invention provides a pharmaceutical composition comprising at least one RNAi oligonucleotide as defined above and / or an EV comprising at least one RNAi oligonucleotide, and a pharmaceutically acceptable excipient and / or carrier. According to some embodiments, the pharmaceutical composition of the present invention is formulated for administration via an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes. According to some embodiments, the pharmaceutical composition of the present invention is for use in regenerative therapy. According to some embodiments, the pharmaceutical composition of the present invention is for use in the treatment of a degenerative disease or disorder. According to some embodiments, the degenerative disease or disorder is a neurodegenerative disease, neuronal disorder, neuronal injury, or CNS injury in a subject. According to one embodiment, the neuronal injury or damage is spinal cord injury (SCI). According to one embodiment, the use comprises intranasal administration of the composition. According to one embodiment, the use comprises local administration of the composition.

[0020] According to another aspect, the present invention provides a method for treating a degenerative disease or condition, a neurodegenerative disease or condition, a disease or condition associated with cell degeneration or cell death such as neuronal injury or damage, in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an RNAi oligonucleotide, an EV, and / or a pharmaceutical composition comprising an RNAi oligonucleotide and / or an EV. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Some embodiments of the present invention are described herein by way of example only with reference to the accompanying drawings. In particular, referring now to the drawings in detail, it is emphasized that the details shown are by way of example and for purposes of illustrative discussion of embodiments of the present invention. In this regard, the description taken in conjunction with the drawings will make apparent to those skilled in the art how embodiments of the present invention may be practiced.

Figure 1

Figure 2A

Figure 2B

Figure 2C

Figure 2D

Figure 2E

Figure 2F

Figure 3

Figure 4

Figure 5

Figure 6

Mode for Carrying Out the Invention

[0022] Before detailing at least one embodiment of the present invention, it should be understood that the present invention is not necessarily limited to the details described in the following explanation or exemplified by the examples in its application. The present invention allows for other embodiments and can be practiced or executed in various ways.

[0023] According to one aspect, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to some embodiments, the RNAi inhibits the expression of phosphatase and tensin homolog (PTEN). According to some embodiments, inhibiting the expression includes inhibiting the protein expression. Thus, in some embodiments, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 23, which inhibits the expression of phosphatase and tensin homolog (PTEN) protein. According to some embodiments, the RNAi oligonucleotide is selected from siRNA and shRNA. Thus, according to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 23 for inhibiting the expression of PTEN. According to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 23 for inhibiting the expression of PTEN protein. The nucleic acid sequences of the sense and antisense strands of the RNAi oligonucleotide of the present invention are summarized in Table 1.

[0024] The terms "phosphatase and tensin homolog" and "PTEN" are used interchangeably herein and refer to the human phosphatase and tensin homolog enzyme, which is the product of EntrezGene ID: 5728 and may have an amino acid sequence composition corresponding to UniProt Accession: P60484. Other non-human homologs can be readily identified using known methods, such as BLAST searches, and are considered to be within the scope of the present invention. The PTEN protein functions as a phosphatase that dephosphorylates phosphatidylinositol (3,4,5)-trisphosphate (PtdIns(3,4,5)P3 or PIP3). PTEN specifically catalyzes the dephosphorylation of the 3'-phosphate of the inositol ring of PIP3 to produce the diphosphate product PIP2 (PtdIns(4,5)P2). This dephosphorylation is important because it causes inhibition of the AKT signaling pathway.

[0025] As used herein, the term "polynucleotide" refers to a long nucleic acid containing more than 150 nucleotides. As used herein, the term "oligonucleotide" refers to a short sequence of single-stranded or double-stranded nucleic acid, such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA), or mimetics thereof, which nucleic acid is usually 150 nucleotides or less. According to some embodiments, the oligonucleotide consists of 2 to 150, 10 to 100, or 14 to 50 nucleotides. According to other embodiments, the oligonucleotide consists of 14 to 40, 17 to 35, or 18 to 30 nucleic acids.

[0026] As used herein, the term "RNA silencing" refers to a group of regulatory mechanisms (e.g., RNA interference (RNAi), transcriptional gene silencing (TGS), post-transcriptional gene silencing (PTGS), quelling, co-suppression, and translational repression) mediated by RNA molecules that cause inhibition or "silencing" of the expression of the corresponding protein-coding gene. RNA silencing has been observed in many types of organisms, including plants, animals, and fungi.

[0027] As used herein, the terms "RNA silencing agent", "RNA silencing molecule" and "RNA silencing oligonucleotide" are used interchangeably herein and refer to an RNA capable of inhibiting or "silencing" the expression of a target gene. In certain embodiments, an RNA silencing agent can prevent the complete processing (e.g., complete translation and / or expression) of an mRNA molecule through a post-transcriptional silencing mechanism, e.g., by degradation of the mRNA via RNA interference. RNA silencing agents include non-coding RNA molecules, such as RNA duplexes containing base pairs, and precursor RNAs capable of generating such small non-coding RNAs. Exemplary RNA silencing agents, also referred to as RNA interference oligonucleotides, include dsRNAs such as siRNA, miRNA, and shRNA. In one embodiment, an RNA silencing agent can induce RNA interference. In another embodiment, an RNA silencing agent can mediate translational repression.

[0028] The term "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by RNA interference oligonucleotides such as short interfering RNAs (siRNAs) and shRNAs. The corresponding process in plants is generally referred to as post-transcriptional gene silencing or RNA silencing, and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily conserved cellular defense mechanism used to prevent the expression of foreign genes, and is generally shared by diverse microbial floras and phyla. Such protection from foreign gene expression may have evolved through a cellular response that specifically destroys homologous single-stranded RNA or viral genomic RNA in response to the production of double-stranded RNA (dsRNA) induced in the host genome from viral infection or random integration of transposon elements.

[0029] The presence of long dsRNA within a cell stimulates the activity of ribonuclease III enzymes called Dicer. Dicer is involved in processing dsRNA into short fragments of dsRNA known as small interfering RNAs (siRNAs). Small interfering RNAs derived from Dicer activity are typically about 21 to about 23 nucleotides in length and contain about 19 base pairs of duplex. The RNAi response also generally features an endonuclease complex called the RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having a sequence complementary to the antisense strand of the siRNA duplex. Cleavage of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex.

[0030] The terms "small interfering RNA" and "siRNA" refer to small molecule inhibitory RNA duplexes (generally between 18 and 30 base pairs) that trigger the RNA interference (RNAi) pathway. Typically, siRNAs are chemically synthesized as 21mers with a central 19bp duplex region and symmetric 2-base 3' overhangs at the termini, although it has recently been reported that chemically synthesized RNA duplexes 25 - 30 bases in length can have a 100-fold increase in potency compared to 21mers at the same location. The increased potency observed when using long RNAs to trigger RNAi is theorized to result from providing the substrate (27mer) to Dicer instead of the product (21mer), thereby improving the rate or efficiency of entry of the siRNA duplex into RISC.

[0031] The position of the 3'-overhang affects the potency of the siRNA, and asymmetric duplexes with a 3'-overhang on the antisense strand have generally been found to be more potent than those with a 3'-overhang on the sense strand. When targeting antisense transcripts, the opposite potency pattern is observed, suggesting that this may be due to the asymmetric strand carried by RISC.

[0032] According to some embodiments, the RNAi is siRNA. According to some embodiments, the siRNA that inhibits the expression of PTEN comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1 to 23.

[0033] The terms "guide strand", "guide strand oligonucleotide", and "antisense strand" are used interchangeably herein and refer to the strand of siRNA or shRNA that is complementary to a sequence within the mRNA molecule.

[0034] As used herein, the term "inhibiting the expression of PTEN" means inhibiting the expression of the PTEN gene and inhibiting the production of the PTEN protein.

[0035] According to some embodiments, the RNAi is shRNA. According to some embodiments, the shRNA that inhibits the expression of PTEN comprises a nucleic acid sequence selected from SEQ ID NOs: 1 to 23.

[0036] As used herein, the terms "small hairpin RNA" and "shRNA" refer to RNA agents having a stem-loop structure that includes first and second regions of complementary sequences, where the degree of complementarity and the orientation of the regions are such that base pairing occurs between the regions, the first and second regions are joined by a loop region, and the loop is sufficient due to the lack of base pairing between nucleotides (or nucleotide analogs) within this loop region. The number of nucleotides within the loop is a number between 3 and 23, or 5 and 15, or 7 and 13, or 4 and 9, or 9 and 11, including these. Some of the nucleotides within the loop can participate in base-pair interactions with other nucleotides within the loop. Typically, an shRNA molecule has less than about 400 to 500 nucleotides (nt), or less than 100 to 200 nt, and at least one stretch of at least 14 to 100 nucleotides (e.g., 17 to 50 nt, 19 to 29 nt) base pairs with a complementary sequence located on the same RNA molecule (single-stranded RNA), and the sequence and the complementary sequence are separated by an unpaired region of at least about 4 to 7 nucleotides (or about 9 to about 15 nt, about 15 to about 100 nt, about 100 to about 1000 nt) and form a single-stranded loop on a stem structure created by two regions of base complementarity.

[0037] According to some embodiments, RNAi oligonucleotides such as siRNA or shRNA are not natural, i.e., they do not occur naturally and are artificially designed, modified, and / or manufactured.

[0038] According to some embodiments, the RNAi oligonucleotides of the present invention, for example, siRNA or shRNA, comprise a sense strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the sense strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand consists of 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand consists of and is complementary to 14, 15, 16, 17, 18, or 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 24 to 46.

[0039] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is siRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is siRNA comprising a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is siRNA comprising a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to some embodiments, the siRNA comprises, or consists of, a guide strand comprising the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3). According to some embodiments, the siRNA comprises, or consists of, a guide strand comprising the nucleic acid sequence UUCCGCCACUGAACAUUGGAA (SEQ ID NO: 2). According to some embodiments, the siRNA comprises, or consists of, a guide strand comprising the nucleic acid sequence AAGUUCCGCCACUGAACAUUG (SEQ ID NO: 4). According to some embodiments, the siRNA comprises, or consists of, a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 2 to 4. According to some embodiments, the siRNA comprises, or consists of, a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1 to 5. According to another embodiment, the siRNA that inhibits the expression of PTEN comprises a sense strand complementary to the guide strand and comprising a nucleic acid sequence selected from SEQ ID NOs: 24 to 46. According to another embodiment, the siRNA that inhibits the expression of PTEN comprises a sense strand complementary to the guide strand and consisting of a nucleic acid sequence selected from SEQ ID NOs: 24 to 46. According to another embodiment, the siRNA that inhibits the expression of PTEN comprises a sense strand complementary to the guide strand and comprising, or consisting of, a nucleic acid sequence selected from SEQ ID NOs: 25 to 27.According to some embodiments, the siRNA that inhibits the expression of PTEN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46.

[0040] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 24, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand consisting of the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 24, respectively.

[0041] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. In some examples, the siRNA is designated as siRNA_1455.

[0042] According to some embodiments, the siRNAs of the present invention each comprise a guide strand and a sense strand comprising the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26), respectively. According to some embodiments, the siRNAs of the present invention each comprise a guide strand and a sense strand consisting of the nucleic acid sequences AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and GAACCUGAUCAUUAUAGAU (SEQ ID NO: 26), respectively. In some examples, the siRNA is designated as siRNA_1962.

[0043] According to some embodiments, the siRNAs of the present invention each comprise a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to some embodiments, the siRNAs of the present invention each comprise a guide strand and a sense strand consisting of the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. In some examples, the siRNA is designated as siRNA_1458.

[0044] According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 5 and SEQ ID NO: 28, respectively. According to some embodiments, the siRNA of the present invention comprises a guide strand and a sense strand consisting of the nucleic acid sequences of SEQ ID NO: 5 and SEQ ID NO: 28, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 6 and SEQ ID NO: 29, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 7 and SEQ ID NO: 30, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 8 and SEQ ID NO: 31, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 9 and SEQ ID NO: 32, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 10 and SEQ ID NO: 33, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 11 and SEQ ID NO: 34, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 12 and SEQ ID NO: 35, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 13 and SEQ ID NO: 36, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 14 and SEQ ID NO: 37, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 15 and SEQ ID NO: 38, respectively. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 16 and SEQ ID NO: 39, respectively.According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 17 and 40. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 18 and 41. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 19 and 42. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 20 and 43. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 21 and 44. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 22 and 45. According to some embodiments, the siRNA of the present invention comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 23 and 46.

[0045] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is an shRNA comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is an shRNA comprising a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the shRNA that inhibits the expression of PTEN comprises a sense complementary strand containing a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to another embodiment, the shRNA that inhibits the expression of PTEN comprises a sense strand that is complementary to the guide strand and consists of a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the shRNA that inhibits the expression of PTEN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 24; (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the pair of sense and antisense sequences is as described for siRNA. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand each containing the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 24. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand each consisting of the nucleic acid sequences of SEQ ID NO: 1 and SEQ ID NO: 24.

[0046] According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively.

[0047] According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand consisting of the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively.

[0048] According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to some embodiments, the shRNA of the present invention comprises a guide strand and a sense strand consisting of the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively.

[0049] According to some embodiments, the RNAi oligonucleotides of the present invention are conjugated to a moiety for improving at least one property such as solubility, permeability, carrying capacity, stability, blood circulation period, etc., or for targeting the RNAi oligonucleotides to a specific site. According to some embodiments, the moiety is heterologous and / or exogenous. The term "exogenous" refers to a molecule or substance (e.g., a compound, nucleic acid, or protein) that is not normally present in a cell, or a molecule or substance for which the combination or conjugation is not present in the cell. Thus, according to some embodiments, the present invention provides conjugates of the RNAi oligonucleotides of the present invention. According to some embodiments, the RNAi oligonucleotides of the present invention are conjugated to a hydrophilic moiety. According to some embodiments, the RNAi oligonucleotides of the present invention are conjugated to a hydrophobic moiety. Thus, according to some embodiments, the siRNA or shRNA oligonucleotides of the present invention are conjugated to a hydrophobic molecule. According to some embodiments, the hydrophobic molecule is bound to the guide strand. According to some embodiments, the hydrophobic molecule is bound to the complementary (sense) strand. According to some embodiments, the moiety is a carrying moiety. The term "carrying moiety" refers to a moiety that enables or enhances the carrying of a molecule to a carrier entity such as an extracellular vesicle (EV) or a liposome.

[0050] According to one embodiment, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the RNA interference oligonucleotide conjugates with a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such an embodiment, the RNA interference oligonucleotide conjugates with cholesterol. According to some embodiments, one strand of the double-stranded RNAi conjugates with a hydrophobic molecule such as cholesterol. According to other embodiments, the two strands of the double-stranded RNAi conjugate with a hydrophobic molecule such as cholesterol. According to other embodiments, the RNA interference oligonucleotide conjugates with a molecule selected from monosialotetrahexosylganglioside (GM1), lipid, vitamin, small molecule, peptide, or combinations thereof. In some embodiments, this moiety is a lipid. For example, in certain embodiments, this moiety is palmitoyl. In some embodiments, this moiety is a sterol, such as cholesterol. Additional hydrophobic moieties include, for example, phospholipids, vitamin D, vitamin E, squalene, and fatty acids. In another exemplary embodiment, the RNAi oligonucleotide conjugates with myristic acid or a derivative thereof (e.g., myristoylated oligonucleotide cargo). In some embodiments, the hydrophobic moiety conjugates at the end of the oligonucleotide cargo (i.e., "end modification"). In other embodiments, the hydrophobic moiety conjugates to other parts of the oligonucleotide molecule.

[0051] According to some embodiments, the RNAi oligonucleotide of the present invention conjugates with a hydrophobic moiety selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

[0052] According to some embodiments, the siRNA conjugates with cholesterol. According to some embodiments, cholesterol conjugates with the guide strand of the siRNA. According to other embodiments, cholesterol conjugates with the complementary strand of the siRNA. According to some embodiments, cholesterol conjugates with shRNA. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, and conjugates with a cholesterol molecule. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, and conjugates with a cholesterol molecule. According to some embodiments, the siRNA comprising or consisting of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27 conjugates with a cholesterol molecule. According to some embodiments, cholesterol conjugates to the 5' of the oligonucleotide. According to some embodiments, cholesterol conjugates to the 3' of the oligonucleotide.

[0053] According to another aspect, the present invention provides a composition comprising an RNAi oligonucleotide of the present invention and a carrier. Any one of the above definitions, terms, and embodiments is incorporated herein and applied equally. As used herein, the term "carrier" refers to any class of compounds or compositions useful for facilitating the storage, stability, administration, cell targeting, and / or delivery of topical compositions, and includes, but is not limited to, suitable vehicles, skin conditioning agents, skin protectants, diluents, emollients, solvents, excipients, pH adjusters, salts, colorants, rheology modifiers, thickeners, lubricants, wetting agents, defoaming agents, erodible polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, mono-, di- and tri-glycerides and their derivatives, waxes, oils and water.

[0054] According to some embodiments, the composition is a pharmaceutical composition and the carrier is a pharmaceutically acceptable carrier. Thus, according to some embodiments, the present invention provides a pharmaceutical composition comprising a plurality of siRNAs and / or shRNAs of the present invention as defined above and a pharmaceutically acceptable carrier. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising nucleic acid sequences SEQ ID NO: 2 and SEQ ID NO: 25, and optionally conjugated to a cholesterol molecule. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising nucleic acid sequences SEQ ID NO: 3 and SEQ ID NO: 26, and optionally conjugated to a cholesterol molecule. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising nucleic acid sequences SEQ ID NO: 4 and SEQ ID NO: 27, and optionally conjugated to a cholesterol molecule.

[0055] In another aspect, the present invention provides an isolated extracellular vesicle (EV) comprising an RNA interference (RNAi) oligonucleotide according to any of the above aspects and embodiments that inhibits the expression of PTEN protein. All terms, embodiments, and definitions disclosed in any one of the above aspects apply equally and are incorporated herein. According to some embodiments, the RNAi oligonucleotide is carried on / in the EV. Thus, according to some embodiments, the present invention provides an isolated extracellular vesicle (EV) carrying an RNA interference (RNAi) oligonucleotide that inhibits the expression of PTEN. According to some embodiments, the present invention provides an EV comprising an RNAi oligonucleotide that inhibits the expression of PTEN.

[0056] According to some embodiments, the RNAi oligonucleotide is exogenous. As used herein, the term "exogenous" refers to a molecule or substance (e.g., a compound, nucleic acid, or protein) that is derived from outside of a given membrane vesicle, such as an EV, and that does not naturally occur within the vesicle. With respect to EVs, the term refers to a molecule or substance that does not naturally occur within the vesicle and that also does not occur within the cell from which the EV is derived. According to some embodiments, the term "exogenous" refers to a synthetic non-natural molecule. According to some embodiments, the substance is artificially carried by the EV or the cell from which the EV is derived. With respect to peptides, proteins, and nucleic acids, the term means that the compound is artificially carried by the EV or the cell from which the vesicle is derived, or is artificially expressed within the cell from which the vesicle is derived, but the compound is not naturally expressed within the parent cell.

[0057] The terms "extracellular vesicles" and "EVs" are used interchangeably herein and refer to vesicles derived from cells that contain a membrane surrounding an internal space. Generally, EVs range in diameter from 30 nm to 1500 nm, more frequently from 40 to 1200 nm, and can contain various cargo molecules that are within the internal space, presented on the outer surface of the extracellular vesicle, and / or span the membrane. The cargo molecules can include nucleic acids, proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. EVs can be classified into three subpopulations: (I) exosomes, which have a diameter of 30 - 150 nm and are derived from the endosomal compartment; (II) microvesicles, which have a diameter of 100 nm - 1 μm and are released from the surface by "blebbing"; (III) apoptotic bodies, which have a diameter of 1 - 5 μm and are released from apoptotic cells. The term EVs includes the terms "exosomes" and "microvesicles". The terms "exosomes" and "nanovesicles" are used interchangeably herein and refer to EVs having a size of 30 - 150 nm. In some references, exosomes refer to EVs having a size of 30 - 100 nm. The term "microvesicles" as used herein refers to EVs having a size of 150 - 1000 nm. Generally, EVs can contain at least a portion of the molecular contents of the cells from which they are derived, such as lipids, fatty acids, polypeptides, polynucleotides, proteins, and / or saccharides.

[0058] The EVs of the present invention are mostly spherical, and the terms "size", "particle size", "average particle size", and "particle diameter size" as used herein interchangeably refer to the diameter of the EV or the longer diameter of the EV. The size of the EVs of the present invention can be determined using any known method for measuring particle size. A non-limiting example is nanoparticle tracking analysis (NTA).

[0059] According to some embodiments, the isolated EVs are exosomes. According to one embodiment, the exosomes have a diameter of 30 - 150 nm, 40 - 120 nm, 50 - 100 nm, 30 - 100 nm, 30 - 80 nm, or 60 - 80 nm.

[0060] According to another embodiment, the EVs are microvesicles. According to one embodiment, the microvesicles have a diameter of 100 to 1000 nm, 120 to 800 nm, 150 to 600 nm, or 200 to 400 nm. According to another embodiment, the microvesicles have a size of 100 to 300 nm or 150 to 250 nm.

[0061] According to some embodiments, the EVs have a diameter of 30 to 250 nm or 50 to 200 nm. According to some embodiments, the EVs have a diameter of 70 to 170 nm or 80 to 150 nm.

[0062] The EVs can have a size range such as 2 nm to 20 nm, 2 nm to 50 nm, 2 nm to 100 nm, 2 nm to 150 nm, or 2 nm to 200 nm. The EVs can have a size of 20 nm to 50 nm, 20 nm to 100 nm, 20 nm to 150 nm, or 20 nm to 200 nm. The EVs can have a size of 50 nm to 100 nm, 50 nm to 150 nm, or 50 nm to 200 nm. The EVs can have a size of 100 nm to 150 nm or 100 nm to 200 nm. The EVs can have a size of 150 nm to 200 nm. The EVs can have a size of 100 to 600 nm, 150 to 500 nm, or 200 to 400 nm.

[0063] The size can be determined by various means. In principle, the size can be determined by size fractionation and filtration through a membrane with an appropriate size cut-off.

[0064] According to a further embodiment, the isolated EVs are a combination of small vesicles and large vesicles, for example, microvesicles and exosomes.

[0065] As described above, EVs are derived from cells. The terms "derived from" and "originating from" are used interchangeably herein and refer to vesicles produced within, within, by, or from a particular cell, cell type, or cell population. As used herein, the terms "parent cell", "producer cell", and "original cell" include any cell from which extracellular vesicles are derived and isolated. This term also includes cells that share protein, lipid, sugar, or nucleic acid components of extracellular vesicles. For example, a "parent cell" or "producer cell" includes a cell that functions as a source of extracellular vesicles. According to some embodiments, the cell is a eukaryotic cell.

[0066] EVs can be obtained from living cells by any of several means, such as secretion, budding, or dispersion from living cells. EVs are isolable from mesenchymal stem cells (MSCs), neural crest cells (NCCs), mesenchymal stem cell culture supernatants (MSC-CM), or neural crest cell culture supernatants. EVs can carry or possess the activity of at least parent cells such as MSCs, NCCs, NCC-CM, or MSC-CM. EVs can carry and execute most or all of the functions of the activity of parent cells such as MSCs, NCCs, NCC-CM, or MSC-CM. For example, EVs can be an alternative (or biological substitute) for MSCs, NCCs, NCC-CM, or MSC-CM. For example, EVs can be generated, exuded, released, or emitted from living cells. When the living cells are in cell culture, the particles can be secreted into the cell culture medium.

[0067] Examples of living cells from which EVs can be derived include adherent cells that express mesenchymal markers such as mesenchymal stem cells, oral mucosal stem cells, or olfactory ensheathing cells, astrocytes, and neural crest cells. Thus, according to some embodiments, the present invention provides a pharmaceutical composition comprising EVs carrying an exogenous PTEN inhibitor, wherein the EVs are derived from adherent cells that express mesenchymal markers. According to one embodiment, the adherent cells that express mesenchymal markers are selected from mesenchymal stem cells (MSCs), oral mucosal stem cells, and olfactory ensheathing cells. According to one embodiment, the cell is a mesenchymal stem cell (MSC).

[0068] The term "mesenchymal stem cell" refers to pluripotent stromal cells that can differentiate into various cell types well known in the art, including osteoblasts (bone cells), chondrocytes (cartilage cells), myocytes (muscle cells), and adipocytes (fat cells).

[0069] In their pluripotent state, mesenchymal stem cells typically express the following markers: CD105, CD166, CD29, CD90, and CD73, and do not express CD34, CD45, and CD133.

[0070] Mesenchymal stem cells can be isolated from a variety of tissues including, but not limited to, bone marrow, adipose tissue, dental pulp, oral mucosa, peripheral blood, and amniotic fluid. According to one embodiment, mesenchymal stem cells are isolated from bone marrow. According to one embodiment, mesenchymal stem cells are derived from a site selected from bone marrow, adipose tissue, umbilical cord, dental pulp, oral mucosa, peripheral blood, and amniotic fluid. According to some embodiments, EVs are derived from MSCs of bone marrow origin. According to other embodiments, EVs are derived from MSCs of adipose tissue origin. According to some such embodiments, EVs are selected from exosomes, microvesicles, and combinations thereof. According to some embodiments, the cells express the CD105, CD166, CD29, CD90, and CD73 markers. According to further embodiments, the cells express CD105, CD166, CD29, CD90, and CD73 and do not express CD34, CD45, and CD133. According to some embodiments, the cells are selected from dental pulp stem cells (DPSCs), stem cells from exfoliated deciduous teeth (SHED), periodontal ligament stem cells (PDLSCs), stem cells from apical papilla (SCAP), and dental follicle progenitor cells (DFPC).

[0071] According to some such embodiments, EVs contain or express at least a portion of the markers expressed by the cells from which the EVs are derived.

[0072] EVs may contain one or more proteins, oligonucleotides, or polynucleotides secreted by specific cell types, such as mesenchymal stem cells or neural crest cells. EVs may contain one or more proteins or polynucleotides present in mesenchymal stem cell conditioned medium (MSC-CM). In certain embodiments, EVs may contain miRNAs derived from MSCs or neural crest cells. For example, EVs may contain 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, or 70% or more of these proteins and / or polynucleotides. EVs may contain substantially about 75% of these proteins and / or polynucleotides. Proteins can be defined by reference to the gene products of a list of proteins or a list of genes.

[0073] EVs may have at least one property of mesenchymal stem cells. The particles may have biological properties such as biological activity. The particles can have any of the biological activities of MSCs. The particles may have, for example, the therapeutic or restorative activity of MSCs.

[0074] Methods for isolating, purifying, and expanding mesenchymal stem cells (MSCs) are known in the art and include, for example, the methods disclosed in U.S. Patent No. 5,486,359 by Caplan and Haynesworth, and Jones E.A. et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.

[0075] Mesenchymal stem cell cultures can be generated by diluting BM aspirate (usually 20 mL) with an equal volume of Hank's balanced salt solution (HBSS; GIBCO Laboratories, Grand Island, NY, USA) and layering the diluted cells onto approximately 10 mL of a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, NJ, USA). After centrifugation at 2,500×g for 30 minutes, the mononuclear cell layer is removed from the interface and suspended in HBSS. The cells are then centrifuged at 1500×g for 15 minutes and resuspended in complete medium (MEM, medium without α-deoxyribonucleotides or ribonucleotides; GIBCO); 20% fetal bovine serum (FCS) from a lot selected for rapid MSC expansion (Atlanta Biologicals, Norcross, GA); 100 units / mL penicillin (GIBCO), 100 μg / mL streptomycin (GIBCO); and 2 mM L-glutamine (GIBCO). The resuspended cells are seeded into approximately 25 mL of medium in a 10 cm culture dish (Corning Glass Works, Corning, NY) and incubated at 37°C in 5% humidified CO2. After 24 hours of culture, non-adherent cells are discarded and adherent cells are washed twice thoroughly with phosphate buffered saline (PBS). The medium is replaced with fresh complete medium every 3 or 4 days for approximately 14 days. Next, adherent cells are harvested with 0.25% trypsin and 1 mM EDTA (trypsin / EDTA, GIBCO) at 37°C for 5 minutes and re-seeded into 6 cm plates and cultured for a further 14 days. The cells are then trypsinized and counted using a cell counting device such as a hemocytometer (Hausser Scientific, Horsham, PA, USA). The cultured cells are recovered by centrifugation and resuspended at a concentration of 1 - 2×10 6 cells / mL in 5% DMSO and 30% FCS. Approximately 1 mL aliquots are slowly frozen and stored in liquid nitrogen.

[0076] To expand the mesenchymal stem cell fraction, frozen cells are thawed at 37°C, diluted with complete medium, recovered by centrifugation to remove DMSO. The cells are resuspended in complete medium and seeded at approximately 5,000 cells / cm 2Seed at the concentration of. After culturing for 24 hours, remove non-adherent cells, collect adherent cells using trypsin / EDTA, dissociate them by passing through a narrow Pasteur pipette, preferably at about 1.5 to about 3.0 cells / cm 2 and reseed at the density of. Under these conditions, MSC cultures can proliferate during about 50 population doublings and can be expanded about 2000-fold (Colter DC.et al.,Proc Natl Acad Sci USA.97,3213-3218,2000).

[0077] MSC cultures utilized by some embodiments of the present invention include three cell populations defined by their morphological characteristics: small non-granular cells (hereinafter referred to as RS-1), small granular cells (hereinafter referred to as RS-2 herein), and large moderately granular cells (hereinafter referred to as mature MSCs herein). The presence and concentration of such cells during culture can be assayed by identifying the presence or absence of various cell surface markers, for example, by using immunofluorescence, in situ hybridization, and activity assays.

[0078] According to certain embodiments, EVs are derived from cells that express markers from neural crest cells. According to certain embodiments, EVs are derived from neural crest cells. According to another embodiment, the neural crest cells are cranial neural crest cells. According to some embodiments, cranial neural crest cells include, but are not limited to, dental pulp stem cells (DPSC), stem cells from exfoliated deciduous teeth (SHED), periodontal ligament stem cells (PDLSC), stem cells from apical papilla (SCAP), and dental follicle progenitor cells (DFPC). According to some embodiments, such cells express mesenchymal markers as defined above.

[0079] EVs can be produced or isolated in several ways. Such methods can include isolating EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).

[0080] Therefore, the EVs of the present invention are isolated EVs.

[0081] As used herein, the terms "purify", "purified", "purifying", "isolate", "isolated", and "isolating" are used interchangeably and refer to the state of a population of EVs (e.g., multiple known or unknown amounts and / or concentrations) that have undergone one or more purification / isolation processes, such as the selection of the desired EVs, or the removal or reduction of remaining biological products, and / or the removal of unwanted EVs, such as EVs of a particular size. According to one embodiment, the ratio of EVs to residual parental cells is at least 2, 3, 4, 5, 6, 8, or 10 times higher, or in certain advantageous embodiments, at least 50, 100, 1000, or 2000 times higher than in the starting material. In some embodiments, the ratio is a weight ratio. In some advantageous embodiments, the term "isolated" may have a substantially cell-free or cell-free meaning and may thereby be substituted.

[0082] In some embodiments, EVs, such as exosomes, are derived from adherent cells that express mesenchymal markers. According to some embodiments, the adherent cells that express mesenchymal markers are selected from mesenchymal stem cells (MSCs) and olfactory ensheathing cells.

[0083] EVs can be produced or isolated in several ways. Such methods can include isolating EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).

[0084] According to some embodiments, the present invention provides an isolated EV carrying an RNA interference (RNAi) oligonucleotide that inhibits the expression of PTEN as described in any one of the above embodiments and aspects. According to some embodiments, the loading can be performed according to any known method. According to some embodiments, the loading is performed ex vivo. According to some embodiments, the RNAi oligonucleotide is as defined in any one of the above embodiments. According to some embodiments, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits the expression of PTEN comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the siRNA comprises a sense (complementary) strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14-19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14-19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to one embodiment, the siRNA or siRNA conjugates with a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the siRNA or shRNA conjugates with a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such embodiments, the siRNA or shRNA conjugates with cholesterol.

[0085] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is siRNA. According to some embodiments, the present invention provides an isolated EV comprising siRNA that inhibits the expression of PTEN and comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the siRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the siRNA that inhibits the expression of PTEN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26. According to some embodiments, the siRNA comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the siRNA conjugates with cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells. According to some embodiments, the EV is an exosome.

[0086] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is shRNA. According to some embodiments, the present invention provides an isolated EV carrying shRNA that inhibits the expression of PTEN and includes a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the shRNA includes a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the shRNA that inhibits the expression of PTEN includes a pair of oligonucleotides comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 1 and 24; (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the shRNA includes a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. According to some embodiments, the shRNA includes a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively. According to some embodiments, the shRNA includes a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to some embodiments, the shRNA conjugates with cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells.

[0087] siRNA and shRNA molecules promote sequence-specific degradation of mRNA to achieve inhibition of the expression of a desired protein gene, such as PTEN, or a reduction in the expression level of the PTEN gene, such as 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%.

[0088] According to some embodiments, the EVs of the present invention contain chondroitinase ABC (chABC enzyme) or a nucleic acid encoding the same.

[0089] Mesenchymal stem cell EVs can be produced by culturing mesenchymal stem cells in a medium. The medium may contain DMEM. The DMEM may be phenol red-free. The medium can be supplemented with insulin, transferrin, or selenoprotein (ITS), or any combination thereof. It may contain FGF2. It may contain PDGF AB. The concentration of FGF2 may be about 5 ng / ml FGF2. The concentration of PDGF AB may be about 5 ng / ml. The medium may contain glutamine - penicillin - streptomycin or - mercaptoethanol, or any combination thereof.

[0090] The cells can be cultured for about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days or more, for example, 3 days. The culture supernatant can be obtained by separating the cells from the medium. The culture supernatant may be centrifuged, for example, at 500 g. It may be concentrated by filtration through a membrane. The membrane may include a membrane > 1000 kDa. The culture supernatant can be concentrated about 50 - fold or more.

[0091] It will be understood that polynucleotides or oligonucleotides such as siRNA or shRNA may be directly carried on EVs. In one embodiment, the direct loading of RNAi oligonucleotides onto EVs is performed by electroporation and / or with the use of transfection agents. In alternative embodiments, the loading is performed in the absence of electroporation and / or in the absence of transfection agents.

[0092] According to one embodiment, EVs are incubated for a time sufficient to carry a nucleic acid-based inhibitor together with an RNAi oligonucleotide inhibitor on the particles. The time sufficient to carry a nucleic acid-based inhibitor cargo on EVs can be optimized for a particular type of cargo and, if modified to include hydrophobic modifications, can be optimized for that type of modification. Generally, an incubation of about 1 hour or less is sufficient to efficiently load nucleic acid cargo onto the particles. In many cases, hydrophobically modified cargo is efficiently loaded onto exosomes in a very short time, for example within 5 minutes. Thus, in some embodiments, efficient loading occurs during an incubation of 5 minutes or less, for example, 1 - 5 minutes. In exemplary embodiments, efficient loading occurs during an incubation of 5 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, etc. In other embodiments, efficient loading can occur within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 7 hours, within 8 hours, within 9 hours, within 10 hours, within 12 hours, within 24 hours, etc.

[0093] The loading of oligonucleotides onto EVs is not highly temperature-dependent. In exemplary embodiments, exosomes are loaded at 37°C or about 37°C. In other embodiments, EVs (e.g., exosomes) can be loaded at room temperature or approximately room temperature. In other embodiments, exosomes can be loaded at 4°C or about 4°C.

[0094] According to some embodiments, EVs can be carried without using ultracentrifugation. According to other embodiments, carrying further includes ultracentrifugation. According to some embodiments, the preparation method further includes a step of purifying or isolating the carried EVs. According to one embodiment, isolation is performed by centrifugation, for example, ultracentrifugation. According to another embodiment, isolation is performed via filtration. According to one embodiment, the ratio of the number of EVs to the number of remaining parental cells after purification is at least 2, 3, 4, 5, 6, 8, or 10 times higher, or in certain advantageous embodiments, at least 50 times, 100 times, or 1000 times higher than the original material. According to some embodiments, the EVs are cell-free EVs.

[0095] According to some embodiments, the present invention provides a method for preparing EVs, such as exosomes, the method including incubating the EVs with a conjugated RNAi oligonucleotide, such as siRNA or shRNA, at a temperature of 25 to 42 °C for 0.5 to 5 hours. According to some embodiments, the conjugate of siRNA or shRNA is conjugated with cholesterol.

[0096] According to one embodiment, the method further includes a step of isolating the carried EVs using centrifugation, for example, ultracentrifugation. According to some embodiments, another hydrophobic moiety can be used instead of cholesterol. According to one embodiment, the RNAi oligonucleotide is siRNA.

[0097] According to other embodiments, the EVs carrying the RNAi interfering oligonucleotides described herein can be obtained from cells artificially carrying the RNAi oligonucleotide or a polynucleotide that can encode, express, or generate the RNAi interfering oligonucleotide intracellularly. In this case, the polynucleotide / oligonucleotide agent is linked to a nucleic acid construct under the control of a cis-acting regulatory element (e.g., a promoter) that can direct the expression of the agent in a constitutive or inducible manner.

[0098] The nucleic acid agent can be delivered using an appropriate gene delivery vehicle / method (such as transfection, transduction, etc.). Optionally, an appropriate expression system is used. Examples of appropriate constructs include, but are not limited to, pcDNA3, pcDNA3.1(+ / -), pGL3, PzeoSV2(+ / -), pDisplay, pEF / myc / cyto, pCMV / myc / cyto, each of which is available from Invitrogen Co.

[0099] The expression construct may be a virus. Examples of viral constructs include, but are not limited to, adenovirus vectors, retrovirus vectors, vaccinia virus vectors, adeno-associated virus vectors, polyomavirus vectors, alphavirus vectors, rhabdovirus vectors, lentivirus vectors, and herpesvirus vectors.

[0100] Viral constructs such as retroviral constructs include at least one transcriptional promoter / enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternative splicing, nuclear RNA export, and post-transcriptional modification of the messenger. Such vector constructs also include a packaging signal, a long terminal repeat (LTR) or a portion thereof, and plus and minus strand primer binding sites appropriate for the virus used, unless already present in the viral construct. Furthermore, such constructs typically include a signal sequence for the secretion of the peptide from the host cell in which it is placed. Preferably, the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of a peptide variant of the present invention. Optionally, the construct may also include a signal indicating polyadenylation, as well as one or more restriction sites and translation termination sequences. By way of example, such constructs typically include a 5' LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3' LTR or a portion thereof.

[0101] Preferably, the viral dose of infection is at least 10 3 、104 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 The above is pfu or virus particles.

[0102] Double-stranded RNA can be synthesized by adding two opposing promoters to the ends of the gene segment, with one promoter located adjacent to the 5' end of the gene and the opposing promoter located adjacent to the 3' end of the gene segment. Next, the dsRNA can be transcribed with an appropriate polymerase.

[0103] In another embodiment, a polynucleotide or oligonucleotide agent can be incubated with cells in culture to effect efficient uptake of the nucleic acid by the cells. In such embodiments, preferably, as further described hereinbelow, the nucleic acid agent is hydrophobically modified.

[0104] Regardless of the method used to load the nucleic acid agents described herein onto particles, the cells are then incubated for a time sufficient for the production of EVs, such as exosomes. Exosomes isolated from the medium contain exosomes carrying nucleic acid molecules taken up, produced, or expressed by the cells. Thus, in one embodiment, provided is a method of loading an oligonucleotide cargo onto EVs, the method comprising incubating cells capable of EV production (e.g., exosome production) with an oligonucleotide for a time sufficient for the oligonucleotide to be internalized by the cells, culturing the cells for a time sufficient for exosome secretion, and isolating exosomes carrying the oligonucleotide from the medium.

[0105] According to some embodiments, the present invention provides an isolated EV prepared by any one of the above embodiments.

[0106] According to yet another aspect, the present invention provides a liposome comprising an RNAi oligonucleotide defined by any one of the above aspects and embodiments. All terms, embodiments, and definitions disclosed in any one of the above aspects are equally applicable and incorporated herein. According to some embodiments, the RNAi oligonucleotide that inhibits the expression of PTEN is shRNA or siRNA. According to some embodiments, the present invention provides a liposome comprising siRNA, shRNA, or both that inhibit the expression of PTEN protein and comprising a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the siRNA and / or shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the siRNA and / or shRNA that inhibits the expression of PTEN comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA and / or shRNA comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequence of SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA and / or shRNA comprises or consists of a guide strand and a sense strand each comprising the nucleic acid sequence of SEQ ID NO: 3 and SEQ ID NO: 26.According to some embodiments, the siRNA and / or shRNA comprise or consist of a guide strand and a sense strand that each comprise the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27. According to some embodiments, the shRNA conjugates with cholesterol.

[0107] As used herein, the term "liposome" is well known in the art and refers to a microscopic closed vesicle having an inner phase encapsulated by a lipid bilayer. Liposomes can be small unilamellar liposomes such as small unilamellar vesicles (SUVs), large unilamellar liposomes such as large unilamellar vesicles (LUVs), even larger unilamellar liposomes such as giant unilamellar vesicles (GUVs), multilamellar liposomes having multiple concentric membranes such as multilamellar vesicles (MLVs), or liposomes having multiple irregular and non-concentric membranes such as multivesicular bodies (MVVs). Liposomes can be prepared by any methodology well known in the pharmaceutical art.

[0108] In another aspect, the present invention provides a pharmaceutical composition comprising a plurality of RNAi oligonucleotides defined in any one of the above aspects and embodiments and / or a plurality of vesicles carrying the RNAi oligonucleotides, and a pharmaceutically acceptable carrier. According to some embodiments, the vesicles are EVs. According to some embodiments, the vesicles are liposomes. Non-limiting examples of vesicles are exosomes, liposomes, lipid nanoparticles, microvesicles, ectosomes, nanoparticles, nanocarriers, microparticles, or apoptotic bodies. Any one of the above definitions, terms, and embodiments is incorporated herein and applies equally.

[0109] According to some embodiments, the present invention provides a pharmaceutical composition comprising a plurality of RNA interference (RNAi) oligonucleotides selected from siRNA and shRNA, which comprise a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23, and a pharmaceutically acceptable carrier. According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs comprising an RNA interference (RNAi) oligonucleotide that inhibits the expression of the protein PTEN, wherein the RNAi oligonucleotide comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the present invention provides a pharmaceutical composition comprising vesicles such as liposomes comprising an RNAi oligonucleotide that inhibits the expression of the protein PTEN, wherein the RNAi oligonucleotide comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the RNAi oligonucleotide is shRNA. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to some embodiments, the siRNA or shRNA comprises a sense (complementary) strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. As used herein, the term "complementary" refers to the ability of a first polynucleotide to hybridize to a second polynucleotide under specific conditions (e.g., stringent conditions). According to some embodiments, the complementary strand is complementary to 14-19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14-19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 24-46.According to some embodiments, the siRNA or shRNA comprises, or consists of, a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA or shRNA comprises, or consists of, a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. According to some embodiments, the siRNA or shRNA comprises, or consists of, a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively. According to some embodiments, the siRNA or shRNA comprises, or consists of, a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to one embodiment, the siRNA or siRNA conjugates with a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, peptides, and combinations thereof. According to one embodiment, the siRNA or shRNA conjugates with a sterol. In an exemplary embodiment, this moiety is the sterol cholesterol molecule, and thus, according to such embodiments, the siRNA or shRNA conjugates with cholesterol.

[0110] According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV containing an siRNA molecule that inhibits the expression of PTEN and includes a guide strand containing or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to another embodiment, the siRNA includes a complementary strand containing a nucleic acid sequence selected from SEQ ID NOs: 24 to 46. According to some embodiments, the siRNA includes a pair of oligonucleotides containing or consisting of the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV containing an siRNA molecule that includes a guide strand and a sense strand containing or consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV containing an siRNA molecule that includes a guide strand and a sense strand containing or consisting of the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV containing an siRNA molecule that includes a guide strand and a sense strand containing or consisting of the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to some embodiments, the siRNA conjugates with cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells.

[0111] According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV containing an shRNA that inhibits the expression of PTEN, the shRNA comprising a guide strand that comprises or consists of a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to another embodiment, the shRNA comprises a complementary strand that comprises a nucleic acid sequence selected from SEQ ID NOs: 24 to 46. According to some embodiments, the shRNA comprises or consists of a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NOs: 1 and 24, (ii) SEQ ID NOs: 2 and 25, (iii) SEQ ID NOs: 3 and 26, (iv) SEQ ID NOs: 4 and 27, (v) SEQ ID NOs: 5 and 28, (v) SEQ ID NOs: 6 and 29, (vii) SEQ ID NOs: 7 and 30, (viii) SEQ ID NOs: 8 and 31, (ix) SEQ ID NOs: 9 and 32, (x) SEQ ID NOs: 10 and 33, (xi) SEQ ID NOs: 11 and 34, (xii) SEQ ID NOs: 12 and 35, (xiii) SEQ ID NOs: 13 and 36, (xiv) SEQ ID NOs: 14 and 37, (xv) SEQ ID NOs: 15 and 38, (xvi) SEQ ID NOs: 16 and 39, (xvii) SEQ ID NOs: 17 and 40, (xviii) SEQ ID NOs: 18 and 41, (xix) SEQ ID NOs: 19 and 42, (xx) SEQ ID NOs: 20 and 43, (xxi) SEQ ID NOs: 21 and 44, (xxii) SEQ ID NOs: 22 and 45, or (xxiii) SEQ ID NOs: 23 and 46. According to some embodiments, the shRNA conjugates with cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, and combinations thereof. According to some embodiments, the EV is derived from mesenchymal stem cells.

[0112] According to any one of the above embodiments, the shRNA or siRNA is carried by vesicles such as EVs.

[0113] The siRNA and shRNA molecules facilitate sequence-specific degradation of the mRNA to achieve inhibition of the expression of the desired protein gene or a reduction in the expression level of the PTEN gene, for example, by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, or 5%.

[0114] As used herein, the term "pharmaceutical composition" refers to a composition comprising an active ingredient, i.e., an RNAi oligonucleotide described herein, formulated together with one or more pharmaceutically acceptable carriers, either as such or carried on extracellular vesicles (EVs) such as exosomes.

[0115] The formulation of the pharmaceutical composition may be adjusted according to the intended use. In particular, the pharmaceutical composition may be formulated using methods well known in the art to provide rapid, continuous, or delayed release of the active ingredient after administration to a mammal. For example, the formulation may be any formulation selected from plasters, granules, lotions, liniments, limonades, aromatic waters, powders, syrups, ophthalmic ointments, liquids and solutions, aerosols, sprays, extracts, elixirs, ointments, fluid extracts, emulsions, suspensions, decoctions, infusions, eye drops, tablets, suppositories, injections, spirits, capsules, creams, troches, tinctures, pastes, pills, soft or hard gelatin capsules.

[0116] As used herein, "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to any solvent, dispersion medium, preservative, antioxidant, coating agent, isotonic agent and absorption delaying agent, surfactant, filler, disintegrant, binder, diluent, lubricant, lubricant, pH adjuster, buffer, enhancer, wetting agent, solubilizing agent, surfactant, antioxidant, etc. that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds that provide supplementary, additional, or enhanced therapeutic functions, together with a solid carrier or excipient such as lactose, starch, or talc, or a liquid carrier such as water, fatty oil, or liquid paraffin. Other examples of carriers include culture media such as DMEM or RPMI, hypothermic preservation media containing components that remove free radicals, provide pH buffering, colloidal osmotic / osmotic pressure support, energy substrates, and maintain the balance of intracellular states at low temperatures, and mixtures of organic solvents and water.

[0117] According to any one of the above embodiments, the pharmaceutical composition is formulated for administration via an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes. According to one embodiment, the pharmaceutical composition is formulated for intranasal administration. According to some embodiments, such a pharmaceutical composition is in the form of a liquid solution, nasal drops, a spray, a measured stray. According to other embodiments, the pharmaceutical composition is formulated for injection, for example, for intralesional, intrathecal, or intravenous injection. According to such embodiments, the pharmaceutical composition is in the form of a sterile injection solution.

[0118] According to some embodiments, the pharmaceutical composition is formulated for administration via an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes.

[0119] According to one embodiment, the pharmaceutical composition is formulated for intranasal administration.

[0120] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an siRNA or shRNA molecule that inhibits the expression of PTEN protein and comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1 to 23. According to another embodiment, the siRNA or shRNA that inhibits the expression of PTEN protein comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24 to 46. According to some embodiments, the siRNA or shRNA that inhibits the expression of PTEN comprises a pair of oligonucleotides comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively.

[0121] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV carrying an siRNA or shRNA molecule that inhibits the expression of PTEN protein and comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the siRNA or shRNA that inhibits the expression of PTEN protein comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the siRNA or shRNA that inhibits the expression of PTEN comprises a pair of oligonucleotides comprising or consisting of the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively. According to some embodiments, the siRNA or shRNA comprises a guide strand and a sense strand comprising or consisting of the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to some embodiments, the siRNA or shRNA conjugates with cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, and a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells.

[0122] According to some embodiments, the pharmaceutical composition is formulated for topical administration. Non-limiting examples of such formulations are ophthalmic formulations and injectable formulations.

[0123] According to some embodiments, the pharmaceutical composition of the present invention further comprises chondroitinase ABC (chABC enzyme).

[0124] According to any one of the above embodiments, the pharmaceutical composition of the present invention is useful for treating neurological diseases, disorders, injuries, or conditions. Thus, according to some embodiments, the pharmaceutical composition of the present invention is for use in regenerative therapy. According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is for use in treating nerve regeneration. According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is for use in treating a disease or condition selected from neurodegenerative diseases, neuron disorders, neuron injuries, or CNS injuries. According to some embodiments, the pharmaceutical composition is for use in treating neuronal injury or damage in a subject. According to some embodiments, the neuronal injury or damage is spinal cord injury (SCI). According to some embodiments, the injury or damage is a traumatic injury or damage. According to some embodiments, a pharmaceutical composition comprising an siRNA or shRNA comprising a guide strand and a sense strand that each comprise or consist of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25, respectively, is for use in treating a disease, disorder, or condition that requires regeneration of cells as described above, for example, for use in treating neuronal injury or damage in a subject. According to some embodiments, a pharmaceutical composition comprising an siRNA or shRNA comprising a guide strand and a sense strand that each comprise or consist of the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26, respectively, is for use in treating a disease, disorder, or condition that requires regeneration of cells as described above, for example, for use in treating neuronal injury or damage in a subject. According to some embodiments, a pharmaceutical composition comprising an siRNA or shRNA comprising a guide strand and a sense strand that each comprise or consist of the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively, is for use in treating a disease, disorder, or condition that requires regeneration of cells as described above, for example, for use in treating neuronal injury or damage in a subject.

[0125] The term "neurological disease, disorder or condition" refers to a disease, disorder or condition of the brain, spinal cord and / or the nerves connecting them.

[0126] According to certain embodiments, the condition is due to an injury. According to one embodiment, the injury is to the spinal cord, i.e., a spinal cord injury (SCI). According to other embodiments, the neurological disease, disorder, or condition is a neuronal injury or neuronal damage. According to some embodiments, the disease or injury is to the central nervous system (CNS).

[0127] The terms "spinal cord injury" and "SCI" are used interchangeably herein and refer to an injury to the spinal cord. According to one embodiment, the injury is the result of trauma. According to another embodiment, the injury or damage is the result of degeneration or disease. Depending on where the spinal cord and nerve roots are damaged, the symptoms can vary widely, for example, from pain to paralysis and incontinence. Spinal cord injuries are described at various levels of "incomplete", which can vary from those that do not affect the patient to "complete" injuries that mean a complete loss of function. There are many causes of spinal cord injury, but it is usually associated with major trauma due to motor vehicle accidents, falls, sports injuries, violence. Thus, according to one embodiment, SCI is selected from complete and incomplete SCI. According to some embodiments, the spinal cord injury is selected from acute or chronic SCI. Spinal cord injuries are susceptible to the effects of secondary tissue damage including, but not limited to, glial scarring, myelin inhibition, demyelination, cell death, lack of neurotrophic support, ischemia, free radical formation, and excitotoxicity.

[0128] Diseases of the spinal cord include, but are not limited to, autoimmune diseases (e.g., multiple sclerosis), inflammatory diseases (e.g., meningitis), neurodegenerative diseases, polio, split spine, and spinal cord tumors.

[0129] Subjects that can be treated according to the teachings of the present invention include mammalian subjects such as humans, mice, rats, monkeys, dogs and cats. In one embodiment, the subject is a human subject.

[0130] The term "neurodegenerative disease or disorder" refers to any disease or disorder characterized by neuronal dysfunction and / or death that results in the loss of nerve function in the brain, spinal cord, central nervous system, and / or peripheral nervous system. Neurodegenerative diseases can be chronic or acute. Examples of neurodegenerative diseases include, but are not limited to, Alzheimer's disease, Parkinson's disease, frontotemporal dementia, frontotemporal dementia with Parkinsonism, frontotemporal lobar dementia, pallidopontonigral degeneration, progressive supranuclear palsy, multisystem tauopathy, multisystem tauopathy with early-onset dementia, Wilhelmsen-Lynch disease, Pick's disease, Pick's disease-like dementia, mild cognitive impairment, diffuse Lewy body disease, Lewy body variant dementia, demyelinating diseases such as multiple sclerosis and acute transverse myelitis, Baló concentric sclerosis, acute disseminated encephalomyelitis, neuromyelitis optica, transverse myelitis or leukodystrophy, amyotrophic lateral sclerosis, Huntington's chorea, Creutzfeldt-Jakob disease, AIDS-related dementia, extrapyramidal disorders and cerebellar disorders such as corticospinal tract lesions, basal ganglia disorders, basal ganglia degeneration, progressive supranuclear palsy, structural lesions of the cerebellum, spinocerebellar degeneration such as spinocerebellar ataxia, Friedreich's ataxia, cerebellar cortical degeneration, multisystem degeneration (Mencel, Dejerine-Thomas, Shi-Drager, and Machado-Joseph), multiple system atrophy, systemic disorders (Refsum disease, abetalipoproteinemia, ataxia-telangiectasia, and mitochondrial multisystem disorder), motor unit disorders such as neurogenic muscular atrophy (spinal anterior horn cell degeneration, infantile spinal muscular atrophy, and juvenile spinal muscular atrophy), progressive bulbar palsy, middle-aged Down syndrome, subacute sclerosing panencephalitis, Hallervorden-Spatz disease, pantidancer, primary lateral sclerosis, progressive pseudobulbar palsy or post-polio syndrome. Peripheral neuropathy includes hereditary (HNPP, CMT1A, CMT1B, DSS, CMT1X, CMT4B1), infectious (Lyme disease, HIV), immune (GBS), diabetic (type I, type II), injury (transient nerve contusion, chronic constriction injury, partial nerve ligation, spinal nerve ligation, preganglionic nerve injury), and chemotherapy (e.g., cisplatin)-induced neuropathy, etc.

[0131] The term "treating" a condition or patient refers to taking measures to obtain a beneficial or desired result, including clinical outcomes. Beneficial or desired clinical outcomes include improving, inhibiting, substantially suppressing, delaying, or reversing the progression of a disease, condition, or disorder; substantially improving or alleviating the clinical or aesthetic symptoms of a condition; substantially preventing the onset of the clinical or aesthetic symptoms of a disease, condition, or disorder; and protecting from adverse or bothersome symptoms, but are not limited to these. Treating further refers to achieving one or more of the following: (a) reducing the severity of a disorder; (b) limiting the onset of symptoms characteristic of the disorder(s) being treated; (c) limiting the worsening of symptoms characteristic of the disorder(s) being treated; (d) limiting the recurrence of the disorder(s) in a patient who has previously had the disorder(s); and / or (e) limiting the recurrence of symptoms in a patient who was previously asymptomatic with respect to the disorder(s). According to some embodiments, the term "treating" includes nerve regeneration, axonal growth, and a decrease in astrogliosis and microgliosis at the site of injury. According to other embodiments, the term encompasses improvement of symptoms associated with a disease or condition. According to one embodiment, the term "treating" includes improvement of motor parameters. According to one embodiment, improvement of motor parameters includes a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% improvement in motor parameters as compared to an untreated subject. According to some embodiments, treatment includes reducing astrogliosis and / or microgliosis at the site of injury. According to one embodiment, reduction of astrogliosis and / or microgliosis includes a 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% reduction in astrogliosis and / or microgliosis as compared to an untreated subject.

[0132] The pharmaceutical composition of the present invention can be administered using any known method. The terms "administer" or "administration" of a substance, compound, or agent to a subject can be carried out using one of various methods known to those skilled in the art. For example, the compound or agent can be administered intranasally (e.g., by inhalation), intrathecal (within the spinal canal or subarachnoid space), intraarterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, intravitreally, sublingually, orally (by ingestion), intracerebrally, and transdermally (by absorption, e.g., through a skin conduit). The compound or agent can also be appropriately introduced by a rechargeable polymer device or a biodegradable polymer device or other devices, such as patches and pumps, or formulations, resulting in sustained release, controlled release, or extended release of the compound or agent. Administration can also be carried out, for example, once, multiple times, and / or over one or more extended periods. According to some embodiments, the composition is administered once, twice, three times, four times, five times, or six times a day. According to other embodiments, the composition is administered once, twice, three times, four times, five times, or six times a month. In some embodiments, administration includes both direct administration, including self-administration, and indirect administration, including the act of prescribing a drug. For example, as used herein, a physician who instructs a patient to self-administer a drug or to administer the drug to another person and / or provides a prescription for the drug to the patient administers the drug to the patient. According to one embodiment, the pharmaceutical composition of the present invention is administered intranasally. According to another embodiment, the pharmaceutical composition of the present invention is administered intralesionally. According to another embodiment, the pharmaceutical composition of the present invention is administered in proximity to an injury or damage. According to one embodiment, the pharmaceutical composition is administered orally. According to one embodiment, the pharmaceutical composition is administered intranasally. According to some embodiments, the pharmaceutical composition is administered topically. According to some embodiments, the pharmaceutical composition is administered systemically.

[0133] Exemplary dosages of membrane vesicles (exosomes) that can be administered (e.g., intranasally) for each treatment are 1×10 for a 70 kg human 6 ~1×10 20 and / or 1×10 9 ~1×10 15may be between...

[0134] According to another aspect, the present invention provides a method for treating a disease or condition associated with cell degeneration or cell death, the method comprising administering to a subject a therapeutically effective amount of an RNAi oligonucleotide, an extracellular vesicle containing the same, or a pharmaceutical composition containing the same, as described in any one of the above embodiments. According to some embodiments, the method comprises treating neuronal damage or injury in a subject in need thereof. According to some embodiments, the method comprises administering to a subject a therapeutically effective amount of an isolated EV of the present invention containing an RNA interference oligonucleotide of the present invention. According to some embodiments, the administration is intranasal. According to other embodiments, the method further comprises administering chondroitinase ABC (chABC enzyme). The term "therapeutically effective amount" of EV when administered to a subject is one that has the intended therapeutic effect, for example, treatment of neuronal damage or injury such as SCI. The complete therapeutic effect does not necessarily occur upon administration of a single dose and may occur only after a series of dose administrations. Thus, a therapeutically effective amount can be administered in one or more administrations. The exact effective amount required for a subject depends, for example, on the size, health and age of the subject, the nature and extent of the cognitive impairment, and the treatment or combination of treatments selected for administration, as well as the mode of administration. A person skilled in the art can readily determine the effective amount for a given situation by routine experimental methods.

[0135] The term "therapeutically effective amount" of membrane vesicles when administered to a subject is one that has the intended therapeutic effect, for example, treatment of neuronal damage such as SCI. The complete therapeutic effect does not necessarily occur upon administration of a single dose and may occur only after a series of dose administrations. Thus, a therapeutically effective amount can be administered in one or more administrations. The exact effective amount required for a subject depends, for example, on the size, health and age of the subject, the nature and extent of the cognitive impairment, and the treatment or combination of treatments selected for administration, as well as the mode of administration. A person skilled in the art can readily determine the effective amount for a given situation by routine experimental methods.

[0136] According to some embodiments, the vesicles, such as EVs, are administered intranasally, intralesionally, parenterally, topically, systemically, or orally.

[0137] According to another aspect, the present invention provides the use of the RNAi oligonucleotide according to any one of the above aspects and embodiments for preparing a medicament for treating a disease or condition associated with cell degeneration or cell death.

[0138] In another aspect, the present disclosure provides a method for inhibiting or reducing the expression level of PTEN gene and / or PTEN protein in cells in vivo or in vitro, which comprises introducing into the cells the siRNA or shRNA molecule, the EV or the pharmaceutical composition of the present invention as described above herein, such that the expression level of the PTEN gene is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10%, or at least 5%. According to some embodiments, the siRNA or shRNA that inhibits the expression of the PTEN molecule comprises, or consists of, a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-23. According to another embodiment, the siRNA or shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 24-46. According to some embodiments, the siRNA or shRNA that inhibits the expression of PTEN comprises, or consists of, a pair of oligonucleotides comprising the nucleic acid sequences (i) SEQ ID NO: 1 and 24, (ii) SEQ ID NO: 2 and 25, (iii) SEQ ID NO: 3 and 26, (iv) SEQ ID NO: 4 and 27, (v) SEQ ID NO: 5 and 28, (v) SEQ ID NO: 6 and 29, (vii) SEQ ID NO: 7 and 30, (viii) SEQ ID NO: 8 and 31, (ix) SEQ ID NO: 9 and 32, (x) SEQ ID NO: 10 and 33, (xi) SEQ ID NO: 11 and 34, (xii) SEQ ID NO: 12 and 35, (xiii) SEQ ID NO: 13 and 36, (xiv) SEQ ID NO: 14 and 37, (xv) SEQ ID NO: 15 and 38, (xvi) SEQ ID NO: 16 and 39, (xvii) SEQ ID NO: 17 and 40, (xviii) SEQ ID NO: 18 and 41, (xix) SEQ ID NO: 19 and 42, (xx) SEQ ID NO: 20 and 43, (xxi) SEQ ID NO: 21 and 44, (xxii) SEQ ID NO: 22 and 45, or (xxiii) SEQ ID NO: 23 and 46. According to some embodiments, the siRNA or shRNA comprises, or consists of, a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 25. According to some embodiments, the siRNA or shRNA comprises, or consists of, a guide strand and a sense strand each comprising the nucleic acid sequences of SEQ ID NO: 3 and SEQ ID NO: 26.According to some embodiments, the siRNA or shRNA comprises or consists of a guide strand and a sense strand comprising the nucleic acid sequences of SEQ ID NO: 4 and SEQ ID NO: 27, respectively. According to some embodiments, the siRNA or shRNA is conjugated to cholesterol. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from mesenchymal stem cells.

[0139] The terms "comprising," "comprise," "include," "having," "has," and "contain" are used interchangeably herein and have the meaning of "being at least partially constituted by." When interpreting each description herein that includes the term "comprising," there may also be other features or features starting with this term. Related terms such as "comprise" and "comprises" are interpreted similarly. The terms "have," "has," "having," and "comprising" may also encompass the meanings of "consisting of" and "consisting essentially of" and may be replaced by these terms. The term "consisting of" excludes components, steps, or procedures not specifically described or listed. The term "consisting essentially of" means that a composition or component may include additional components, but only if the additional components do not substantially change the basic and novel features of the composition or method according to the claims.

[0140] As used herein, the term "about," when referring to a measurable value such as an amount, a time duration, etc., is intended to encompass a variation of + / - 10%, or + / - 5%, + / - 1%, or + / - 0.1% from the specified value.

[0141] As used herein, the singular forms "a", "an", and "the" include plural references unless the context clearly dictates otherwise. For example, the term "compound" or "at least one compound" can include multiple compounds including mixtures thereof.

[0142] Throughout this application, various embodiments of the invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges and individual numerical values within that range. For example, a description of a range such as 1 - 6 should be considered to have specifically disclosed sub-ranges such as 1 - 3, 1 - 4, 1 - 5, 2 - 4, 2 - 6, 3 - 6, etc., as well as individual numbers within that range such as 1, 2, 3, 4, 5, and 6. This applies regardless of the width of the range.

[0143] When a numerical range is indicated herein, it is always intended to include any cited number (fraction or integer) within the indicated range. The phrases "ranging / ranges from" a first recited number "to" a second recited number and "ranging / ranges between" a first recited number "and" a second recited number are used interchangeably herein and are intended to include the first and second recited numbers, and all fractional and integer numbers therebetween.

[0144] As used herein, the term "method" refers to a way, means, technique, and procedure for achieving a given objective, including, but not limited to, known ways, means, techniques, and procedures by practitioners of the arts of chemistry, pharmacology, biology, biochemistry, medicine, or methods, means, techniques, and procedures readily developed from known ways, means, techniques, and procedures.

[0145] It is understood that certain features of the invention that are described in connection with separate embodiments for clarity may also be provided in combination in a single embodiment. Conversely, the various features of the invention that are described in connection with a single embodiment for brevity may be provided separately, or in any suitable sub-combination, or in any other described embodiment of the invention, as appropriate.

[0146] The various embodiments and aspects of the invention as depicted above and claimed in the following claims are experimentally verified in the following examples.

Examples

[0147] Reference is now made to the following examples, which, together with the above description, illustrate some embodiments of the invention in a non-limiting manner.

[0148] Generally, the nomenclature used herein and the experimental procedures utilized in the present invention include molecular, biochemical, microbiological, and recombinant DNA techniques. Such techniques are well described in the literature.

[0149] Materials and Methods Exosome Purification Protocol Human MSCs were purchased from Lonza (Basel, Switzerland). The cells were cultured and expanded. The cells were cultured in platelet lysate without exosomes (Rabin Medical Center, Israel), and the medium was collected after 2 - 3 days. Exosomes were purified using a standard differential centrifugation protocol that included isolating the culture fluid and centrifuging at 300 g for 10 minutes. The supernatant was collected and centrifuged at 2000 g for 10 minutes, and then recentrifuged at 10,000 g for 30 minutes. Then, the supernatant was passed through a 0.22 μm filter and centrifuged at 100,000 g for 180 minutes. The pellet containing exosomes and proteins was washed three times using a 30 kDa Amicon filter. Exosomes were characterized using NanoSight technology, electron microscopy, and Western blotting for the negative marker calnexin, and the positive markers CD9, CD81, CD63, and TSG101.

[0150] Example 1 Hundreds of RNA sequences targeting the binding to the mRNA encoding PTEN protein, which are considered useful for siRNA preparation, were ranked according to a predetermined criterion. Twenty-three of these sequences with the highest scores were prepared and tested. Interestingly, the siRNA used in WO2019 / 186558 (antisense UUCUGUUUGUGGAAGAACUC (SEQ ID NO: 47) and sense GAGUUCUUCCACAAACAGAA (SEQ ID NO: 48), hereinafter also referred to as the proof-of-concept (POC) sequence) was ranked 489th. The sequences of the antisense (guide) and sense oligonucleotides of the siRNA are provided in Table 1. In some cases, the sequences complementary to the guide polynucleotide contain 14 - 19 nucleotides.

[0151] [Table 1] In the sequence listing file, the letter "t" represents uracil (U).

[0152] Example 2 SH-SY5Y cells were cultured in 24-well TC plates to 70 - 80% confluence. Lipofectamine™ RNAiMAX Transfection Reagent (Thermo Fisher) was used according to the manufacturer's protocol to transfect the cells with each of the siRNA duplexes (50 pmol / well). After 36 hours, the cells were harvested and RNA was extracted using the RNeasy Mini Kit (QIAGEN) according to the manufacturer's protocol. cDNA was prepared from the above cell lysates using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). Real-time quantitative PCR was performed on a QuantStudio 12K Flex real-time PCR system. Primers were added with PTEN (Thermo Fisher, assay ID: Hs02621230_s1) or GAPDH (Thermo Fisher, assay ID: Hs02786624_g1). The amplification reaction conditions were 20 seconds at 95°C, 40 cycles of 3 seconds at 95°C and 30 seconds at 60°C, repeated 3 times in a 10 μl reaction. The ΔΔCt method was used to determine the relative expression levels, and the target gene was normalized against GAPDH expression.

[0153] Commercially available sequences considered for reference (designated siRNA reference herein and used as a positive control by the inventors) contained a cholesterol moiety aimed at enhancing the effectiveness of their transfection. Therefore, all siRNA molecules were tested with and without conjugated cholesterol to determine whether its role was important for the transfection of the inventors' molecules.

[0154] The sequence named siRNA_pten5 is defined in Table 2.

[0155]

Table 2

[0156] The results are presented in Figure 1. The relative quantification (RQ) represented on the Y-axis corresponds to a value of 2. -ΔΔCt The RQ is the fold change compared to a calibrator (in this case, in untreated cells). The calibrator has an RQ value of 1. All samples are compared to the calibrator. An RQ of 10 means that this gene is expressed 10 times more in sample x than in the calibrator sample. Pten5 (control), 1455, 1962, and 1458 are the code names of four different PTEN siRNA molecules tested with and without cholesterol.

[0157] From the examples, it can be seen that the siRNA molecules tested have a high inhibitory capacity compared to the siRNA reference.

[0158] Example 3. Effect of siRNA_1962 on PTEN protein expression in human embryonic kidney cells The effect of siRNA_1962 on PTEN protein expression was in human embryonic kidney cells (HEK293: non-cancerous cell line).

[0159] Lipofectamine 3000 (ThermoFisher) was used according to the manufacturer's protocol to transfect HEK293 cells with siRNA / NTC molecules. Then, 96 hours after transfection, the cells were harvested in ice-cold PBS.

[0160] RNA was extracted using the RNeasy Mini Kit (QIAGEN), and cDNA was synthesized using the High Capacity cDNA Kit (Thermo). qPCR was performed using TaqMan probes (Thermo) for determination of PTEN and GAPDH expression levels.

[0161] The protein was extracted with a non-ionic detergent (NP-40 lysis buffer). The protein extract was separated by SDS-PAGE gel electrophoresis under denaturing conditions and then transferred to a nitrocellulose membrane using a Trans-Blot Turbo Transfer System (BIO-RAD). The membrane was blocked with EveryBlot blocking buffer (BIO-RAD) and exposed to an anti-PTEN mouse monoclonal antibody (Santa Cruz) overnight at 4°C. To visualize the signal, the membrane was exposed to an anti-mouse IgG HRP antibody for 1 hour and then provided with a substrate for enhanced chemiluminescence (ECL kit). Signal detection was performed with a LAS4000. The membrane was then washed and exposed to an anti-GAPDH rabbit polyclonal antibody to determine the internal control at RT for 1 hour and then exposed to anti-rabbit IgG HRP. The signal was detected with a LAS4000.

[0162] The results are shown in Figures 2A and 2B. It can be seen that siRNA_1962 significantly decreased the RNA and protein levels. The level of PTEN RNA was reduced by approximately 80%, and the PTEN protein level was reduced by approximately 90%. Interestingly, a commercially available anti-PTEN siRNA, designated as POC siRNA herein, showed a much weaker effect (Figures 2C and 2D). As seen in the figure, siRNA_1962 significantly decreased the PTEN RNA and protein levels compared to the POC siRNA. As shown in Figure 2D, siRNA_1962 reduced the expression of PTEN RNA approximately 3-fold more efficiently than the POC siRNA. The experiment was repeated at least 4 times. Figures 2E and 2F show the effect of siRNA_1962 on PTEN protein expression.

[0163] Example 3 Furthermore, the effect of siRNA_1962 carried by extracellular vesicles (EVs) (conjugated with cholesterol) was tested for its effectiveness in inhibiting PTEN. Experiments were performed on HEK293 cells by incubating the EVs with the cells.

[0164] Exosome loading involves incubating an siRNA sequence (0.1 nmol) with 40 μl of exosomes derived from BM-MSCs (1 * × 10E7 particles / μl) at 30 °C for 4 hours, and washing the unloaded siRNA for 2 hours by a 30 kDa Amicon filter or 100,000 G ultracentrifugation.

[0165] Example 4. Efficacy of siRNA_1962 in vivo Rats were surgically treated at T10 for complete spinal cord transection and divided into four treatment groups. 1. Exo-siRNA PTEN_cholesterol - Exosomes carrying siRNA_1962 conjugated with cholesterol (n = 4) 2. siRNA_1962 conjugated with cholesterol (n = 3) 3. Exosomes only (n = 4) 4. Physiological saline (n = 6)

[0166] Rats were treated for 5 days starting from the day of surgery, had a 2-day break, and then were treated for another 5 days.

[0167] One week after surgery, rats were exercised on a treadmill 5 days a week, tested for Dorsal Von Frey, body weight was measured, and walking was recorded for the weekly BBB score. At the 10th week, the spinal cords of the rats were scanned by MRI.

[0168] Results Sensory recovery was tested using a Von Frey filament with the gradient of bending force applied to the dorsal hindlimb to determine the paw withdrawal threshold as an indicator of sensory recovery. As shown in Figure 3, one week after surgery, the sensory response reached 75% in the treatment group using Exo-PTEN_chol and reached 33% or less in the control group. From the second week, the percentage of rats with sensory recovery in the hindlimb remained the same as that one week after the end of the experiment. None of the rats in the physiological saline group achieved sensory recovery.

[0169] Two weeks after surgery, the tail and feet were pinched to test for reflex recovery, and the results are shown. After complete transection SCI surgery, all rats lose the foot pinch reflex. The inventors examined whether treatment affected their reflex recovery immediately after the rats completed two weeks of treatment. The inventors' results show that the percentage of rats that recovered the foot pinch reflex two weeks after surgery was much higher in rats treated with Exo PTEN_chol (75%) compared to rats treated with Exo only (25%), PTEN_chol (33%), and control (0%) (see Figure 4). After the second week, the recovered reflexes did not change in all animals until the end of the experiment.

[0170] The health of the rats was evaluated by the self - feeding tendency of the treated rats after injury. Rats surgically treated for SCI tend to self - feed. The inventors tracked the self - feeding behavior in their rats and found that the percentage of rats without self - feeding behavior in the Exo - PTEN_chol treatment group was significantly higher than that in the control group (p - value = 0.0033) and the PTEN_chol group (p - value = 0.01), but not significantly higher than that in the Exo only group (p - value = 0.1) (Figure 5).

[0171] Sagittal MRI images, axial slices, and cross - sectional area images 4 mm caudal and rostral to the center of T10 in healthy rats or to the center of injury in untreated, exosome - treated, or ExoPTEN - treated rats were analyzed to calculate the ratio of caudal area to rostral area, representing the regeneration of tissue downstream of the injury. ExoPTEN - treated rats (n = 3) and healthy rats (n = 3). The results are summarized in Figure 6. In vivo MRI imaging clearly shows nerve tissue regeneration.

[0172] Although the present invention has been described above in its preferred embodiments herein, it can be modified without departing from the spirit and nature of the invention as defined in the appended claims.

Claims

1. RNA interference (RNAi) oligonucleotides selected from siRNA and shRNA, comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NOs: 1 to 23, wherein the RNAi oligonucleotide inhibits the expression of phosphatase and tensin homolog (PTEN) proteins.

2. The RNAi oligonucleotide is siRNA, The guide chain consists of nucleic acid sequences selected from SEQ ID NOs: 1 to 23. RNAi-oligonucleotide according to claim 1.

3. An RNAi oligonucleotide according to claim 1, comprising a sense strand complementary to the guide strand, (i) The complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand; (ii) The sense strand consists of 14 to 21 nucleotides; or It is both (i) and (ii), RNAi oligonucleotides.

4. The RNAi oligonucleotide according to claim 3, wherein the complementary strand comprises a nucleic acid sequence selected from sequence numbers 24 to 46.

5. The RNAi oligonucleotide according to claim 1, comprising a guide strand containing the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and a sense strand containing the nucleic acid sequence GAACCUGAUCAAUUAUAGAU (SEQ ID NO: 26).

6. The RNAi oligonucleotide according to claim 5, comprising a guide strand consisting of the nucleic acid sequence AUCUAUAAUGAUCAGGUUCAU (SEQ ID NO: 3) and a sense strand consisting of the nucleic acid sequence GAACCUGAUCAAUUAUAGAU (SEQ ID NO: 26).

7. RNAi oligonucleotide according to any one of claims 1 to 6, conjugated with a supported portion.

8. The RNAi oligonucleotide according to claim 7, wherein the supported portion is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

9. An isolated extracellular vesicle comprising an RNAi oligonucleotide that inhibits the expression of the PTEN protein described in claim 1.

10. The isolated extracellular vesicle according to claim 9, wherein the extracellular vesicle is supported ex vivo with the RNAi oligonucleotide.

11. The isolated extracellular vesicle according to claim 9, wherein the extracellular vesicle is selected from exosomes, microvesicles, and combinations thereof.

12. The isolated extracellular vesicle according to any one of claims 9 to 11, wherein the extracellular vesicle is derived from adherent cells expressing a mesenchymal marker.

13. The isolated extracellular vesicle according to claim 12, wherein the adherent cells expressing the mesenchymal marker are selected from mesenchymal stem cells and olfactory nerve sheath cells.

14. A pharmaceutical composition comprising an RNAi oligonucleotide according to claim 1 or an extracellular vesicle according to claim 9, and a pharmaceutically acceptable carrier and / or excipient.

15. The pharmaceutical composition according to claim 14, formulated for administration via a route of administration selected from the following routes: intranasal cavity, intralesional, subarachnoid, intravenous, intramuscular, subcutaneous, sublingual, oral, transdermal, local, topical, and intracerebral.

16. The pharmaceutical composition according to claim 14 for use in regenerative therapy.

17. The pharmaceutical composition according to claim 16, wherein the use includes treating nerve regeneration.

18. The pharmaceutical composition according to claim 16, wherein the use comprises treating a disease or condition selected from neurodegenerative diseases, neuronal disorders, neuronal injuries, or CNS injuries in the subject.

19. The pharmaceutical composition according to claim 18, wherein the neuronal injury or injury is spinal cord injury (SCI).

20. The pharmaceutical composition according to claim 16, wherein the use includes intranasal administration or topical administration of the composition.

Images