Compositions and Methods for Circular RNA Affinity Purification

Abstract

The present disclosure provides circular RNA (circRNA) compositions and methods for their purification and use. In particular, the present disclosure relates to compositions of circRNAs comprising one or more aptamers that specifically bind to an affinity ligand, and methods for their production and use.

Description

Technical Field

[0001] Related Applications This application is related to the priority application European Patent Application Publication No. 22305884.3 filed on June 17, 2022 and the priority application European Patent Application Publication No. 22306497.3 filed on October 6, 2022, the contents of each of which are incorporated herein by reference.

Background Art

[0002] Exogenous circular RNAs (circRNAs) containing protein-coding regions have emerged as valuable molecular tools and alternatives to messenger RNA (mRNA) therapeutics. CircRNAs are single-stranded and characterized by a covalently closed structure. In contrast to linear RNAs, circRNAs have high stability, a very long half-life, and are resistant to degradation by exonucleases. The use of exogenous circRNAs includes (1) overexpression of natural circRNAs, (2) engineering of in vitro-produced circRNAs as a substitute for existing linear mRNA delivery, and / or (3) those as described herein as part of methods for the production and purification of linear and / or circular RNAs.

[0003] Methods for efficiently purifying exogenous circRNAs remain a major hurdle that must be overcome before the protein-coding potential of circRNAs can be fully realized. This is due in part to the different types and combinations of unwanted contaminants in the samples that need to be separated from a pure sample of circRNA. Such contaminants are typically components and by-products of any upstream process, such as RNA production and circularization conditions. Samples typically contain the desired circRNA along with various contaminants such as linear precursor RNAs, nicked circular RNAs, double-stranded RNAs, triphosphate-RNAs, free nucleotides, endotoxins, and solvents.

Summary of the Invention

Problems to be Solved by the Invention

[0004] For therapeutic use possibilities, there is still a need for a more effective, reliable, and safe method to purify circRNA from large-scale manufacturing processes, which is also economical in terms of the number of steps, complexity of the steps, and resources used in the steps.

Means for Solving the Problems

[0005] In one aspect, the present disclosure provides a circular RNA comprising a protein-coding region and at least one RNA aptamer.

[0006] In certain embodiments, an internal ribosome entry site (IRES) is positioned at the 5' end of the protein-coding region.

[0007] In certain embodiments, the IRES is positioned at the 3' end of the protein-coding region.

[0008] In certain embodiments, the IRES is derived from coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), dicistrovirus, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or a synthetic IRES.

[0009] In certain embodiments, the IRES comprises the polynucleotide sequence of SEQ ID NO: 75.

[0010] In certain embodiments, the protein-coding region encodes at least one polypeptide or peptide.

[0011] In certain embodiments, the polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide.

[0012] In certain embodiments, the circular RNA comprises at least one 5' internal homology arm and at least one 3' internal homology arm.

[0013] In certain embodiments, the 5' internal homology arm is about 5 to about 50 nucleotides in length.

[0014] In certain embodiments, the 5' internal homology arm comprises the nucleotide sequence of SEQ ID NO: 70.

[0015] In certain embodiments, the 3' internal homology arm is about 5 to about 50 nucleotides in length.

[0016] In certain embodiments, the 3' internal homology arm comprises the nucleotide sequence of SEQ ID NO: 71.

[0017] In certain embodiments, the circular RNA comprises at least one 3' exon element.

[0018] In certain embodiments, the 3' exon element comprises the nucleotide sequence of SEQ ID NO: 81.

[0019] In certain embodiments, the circular RNA comprises at least one 5' exon element.

[0020] In certain embodiments, the 5' exon element comprises the nucleotide sequence of SEQ ID NO: 83.

[0021] In certain embodiments, the circular RNA comprises at least one spacer sequence.

[0022] In certain embodiments, the spacer sequence is about 5 to about 75 nucleotides in length.

[0023] In certain embodiments, the spacer sequence comprises the nucleotide sequence of SEQ ID NO: 78 or 79.

[0024] In certain embodiments, the spacer array is positioned at one or both of the 5' and 3' ends of any one of the following elements: a protein coding region, an IRES, a 5' internal homology arm, a 3' internal homology arm, a 5' exon element, and a 3' exon element.

[0025] In certain embodiments, the circular RNA contains, from 5' to 3', the following elements: a) a 3' exon element, b) a 5' internal homology arm, c) a spacer array, d) an IRES, e) a protein coding region, f) a spacer array, g) a 3' internal homology arm, and h) a 5' exon element.

[0026] In certain embodiments, the circular RNA contains, from 5' to 3', the following elements: a) a 3' exon element, b) a 5' internal homology arm, c) a spacer array, d) a protein coding region, e) an IRES, f) a spacer array, g) a 3' internal homology arm, and h) a 5' exon element.

[0027] In certain embodiments, at least one RNA aptamer is positioned at the 5' or 3' end of any one of elements a) - h).

[0028] In certain embodiments, the circular RNA contains at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR), and / or at least one polyadenylation (polyA) sequence.

[0029] In certain embodiments, the 5'UTR, 3'UTR, and / or polyA sequence is a spacer array.

[0030] In certain embodiments, the RNA aptamer is embedded in an RNA scaffold.

[0031] In certain embodiments, the RNA scaffold contains at least one secondary structure motif.

[0032] In certain embodiments, the secondary structure motif is a tetraloop, pseudoknot or stem-loop.

[0033] In certain embodiments, the RNA scaffold comprises at least one tertiary structure.

[0034] In certain embodiments, the secondary structure motif and / or the tertiary structure is nuclease-resistant.

[0035] In certain embodiments, the RNA scaffold comprises transfer RNA (tRNA).

[0036] In certain embodiments, the RNA aptamer is embedded in the tRNA hairpin loop of tRNA.

[0037] In certain embodiments, the RNA aptamer is embedded in the tRNA anticodon loop of tRNA.

[0038] In certain embodiments, the RNA aptamer is embedded in the tRNA D loop of tRNA.

[0039] In certain embodiments, the RNA aptamer is S1m, Sm or a derivative or fragment thereof.

[0040] In certain embodiments, the circular RNA comprises 1 to 4 RNA aptamers.

[0041] In certain embodiments, the RNA aptamers are identical.

[0042] In certain embodiments, at least one of the RNA aptamers is distinct.

[0043] In certain embodiments, the RNA aptamer is synthetically derived.

[0044] In certain embodiments, the RNA aptamer is a split aptamer or X-aptamer.

[0045] In certain embodiments, the RNA aptamer is of natural origin.

[0046] In certain embodiments, the RNA aptamer is derived from hairpin RNA, tRNA, or riboswitch.

[0047] In certain embodiments, the RNA aptamer binds to an affinity ligand.

[0048] In certain embodiments, the affinity ligand includes protein A, protein G, streptavidin, glutathione, dextran, or a fluorescent molecule.

[0049] In certain embodiments, the affinity ligand includes streptavidin.

[0050] In certain embodiments, the affinity ligand is immobilized on a chromatography resin.

[0051] In certain embodiments, at least one RNA aptamer is positioned a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the IRES, e) between the protein coding region and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the IRES, and / or j) between the IRES and the 5' exon element.

[0052] In certain embodiments, at least one RNA aptamer is positioned a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the protein coding region, e) between the IRES and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the protein coding region, and / or j) between the protein coding region and the 5' exon element.

[0053] In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66.

[0054] In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 84. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 85. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 86. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 87. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 88. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 89. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 90. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 91. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 92. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 93.

[0055] In certain embodiments, the RNA aptamer embedded in the tRNA comprises the nucleotide sequence of SEQ ID NO: 67.

[0056] In certain embodiments, the RNA aptamer is about 30 to 200 nucleotides in length.

[0057] In certain embodiments, the RNA aptamer is about 50 to 200 nucleotides in length.

[0058] In certain embodiments, the RNA aptamer is not a histone stem loop.

[0059] In certain embodiments, the circular RNA comprises at least one chemical modification.

[0060] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine or N6-methyladenosine.

[0061] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine or combinations thereof.

[0062] In certain embodiments, the chemical modification is N1-methylpseudouridine.

[0063] In another aspect, the present disclosure provides a linear precursor RNA comprising at least a self-splicing ribozyme and a protein coding region, the linear precursor RNA comprising at least one RNA aptamer.

[0064] In certain embodiments, the self-splicing ribozyme comprises at least two catalytic subunits.

[0065] In certain embodiments, the self-splicing ribozyme catalytic subunit is derived from either a Group I intron or a Group II intron RNA transcript or a fragment thereof.

[0066] In certain embodiments, the self-splicing ribozyme catalytic subunit is derived from the circularized intron-exon (PIE) sequence from the Cyanobacterium Anabaena pre-tRNA-Leu gene, the T4 phage Td gene, or the Tetrahymena pre-rRNA.

[0067] In certain embodiments, the catalytic activity of the two subunits results in circularized RNA.

[0068] In certain embodiments, the linear precursor RNA, from 5' to 3', comprises the following elements: a) 5' external homology arm, b) 3' self-splicing PIE fragment, c) 5' internal homology arm, d) 5' spacer sequence, e) internal ribosome entry site (IRES), f) protein coding region, g) 3' spacer sequence, h) 3' internal homology arm, i) 5' self-splicing PIE fragment, and j) 3' external homology arm, and the RNA aptamer is present at one or both of the 5' end and the 3' end of any one of elements a) - j).

[0069] In certain embodiments, the linear precursor RNA, from 5' to 3', comprises the following elements: a) 5' external homology arm, b) 3' self-splicing PIE fragment, c) 5' internal homology arm, d) 5' spacer sequence, e) protein coding region, f) IRES, g) 3' spacer sequence, h) 3' internal homology arm, i) 5' self-splicing PIE fragment, and j) 3' external homology arm, and the RNA aptamer is present at one or both of the 5' end and the 3' end of any one of elements a) - j).

[0070] In certain embodiments, the 5' external homology arm and the 3' external homology arm comprise the nucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 72.

[0071] In certain embodiments, the 5' external homology arm and the 3' external homology arm are each independently about 5 to about 50 nucleotides in length.

[0072] In certain embodiments, the 5' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO: 74.

[0073] In certain embodiments, the 5' internal homology arm comprises the nucleotide sequence of SEQ ID NO: 70.

[0074] In certain embodiments, the 5' internal homology arm is about 5 to about 50 nucleotides in length.

[0075] In certain embodiments, the 5' spacer and the 3' spacer comprise the nucleotide sequence of SEQ ID NO: 78 or SEQ ID NO: 79.

[0076] In certain embodiments, the 5' spacer and the 3' spacer are each independently about 5 to 75 nucleotides in length.

[0077] In certain embodiments, the 3' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO: 73.

[0078] In certain embodiments, the IRES is derived from coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), dicistrovirus, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or a synthetic IRES.

[0079] In certain embodiments, the IRES comprises the nucleotide sequence of SEQ ID NO: 75.

[0080] In certain embodiments, the linear precursor RNA comprises at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and / or a polyadenylation (polyA) sequence.

[0081] In certain embodiments, the protein coding region encodes at least one polypeptide.

[0082] In certain embodiments, the polypeptide is a biologically active polypeptide, a therapeutic polypeptide or an antigenic polypeptide.

[0083] In certain embodiments, the RNA aptamer is embedded in an RNA scaffold.

[0084] In certain embodiments, the RNA scaffold comprises at least one secondary structure motif.

[0085] In certain embodiments, the secondary structure motif is a tetraloop, a pseudoknot or a stem-loop.

[0086] In certain embodiments, the RNA scaffold comprises at least one tertiary structure.

[0087] In certain embodiments, the secondary structure motif and / or the tertiary structure is nuclease-resistant.

[0088] In certain embodiments, the RNA scaffold comprises a transfer RNA (tRNA).

[0089] In certain embodiments, the RNA aptamer is embedded in the tRNA hairpin loop of the tRNA.

[0090] In certain embodiments, the RNA aptamer is embedded in the tRNA anticodon loop of the tRNA.

[0091] In certain embodiments, the RNA aptamer is embedded in the tRNA D loop of the tRNA.

[0092] In certain embodiments, the RNA aptamer is S1m, Sm, or a derivative or fragment thereof.

[0093] In certain embodiments, the linear precursor RNA comprises 1 to 4 RNA aptamers.

[0094] In certain embodiments, the RNA aptamers are identical.

[0095] In certain embodiments, at least one of the RNA aptamers is distinct.

[0096] In certain embodiments, the RNA aptamer is synthetically derived.

[0097] In certain embodiments, the RNA aptamer is a split aptamer or an X-aptamer.

[0098] In certain embodiments, the RNA aptamer is a split aptamer comprising a 5' portion and a 3' portion.

[0099] In certain embodiments, the 5' portion of the split aptamer is positioned 3' to the 5' exon element, and the 3' portion of the split aptamer is positioned 5' to the 3' exon element.

[0100] In certain embodiments, the 5' portion of the split aptamer is positioned 3' to the 3' internal homology arm, and the 3' portion of the split aptamer is positioned 5' to the 5' internal homology arm.

[0101] In certain embodiments, the split aptamer is reformed into a functional aptamer upon cyclization of the linear precursor RNA.

[0102] In certain embodiments, the RNA aptamer is of natural origin.

[0103] In certain embodiments, the RNA aptamer is derived from a hairpin RNA, tRNA or riboswitch.

[0104] In certain embodiments, the RNA aptamer binds to an affinity ligand.

[0105] In certain embodiments, the affinity ligand includes protein A, protein G, streptavidin, glutathione, dextran or a fluorescent molecule.

[0106] In certain embodiments, the affinity ligand includes streptavidin.

[0107] In certain embodiments, the affinity ligand is immobilized on a chromatography resin.

[0108] In certain embodiments, at least one RNA aptamer is positioned a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the IRES, f) after the protein coding region but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0109] In certain embodiments, at least one RNA aptamer is positioned a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the protein coding region, f) after the IRES but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0110] In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66.

[0111] In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 84. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 85. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 86. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 87. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 88. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 89. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 90. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 91. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 92. In certain embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 93.

[0112] In certain embodiments, the RNA aptamer embedded in tRNA comprises the nucleotide sequence of SEQ ID NO: 67.

[0113] In certain embodiments, the RNA aptamer is about 30 to 200 nucleotides in length.

[0114] In certain embodiments, the RNA aptamer is about 50 to 200 nucleotides in length.

[0115] In certain embodiments, the RNA aptamer is not a histone stem-loop.

[0116] In certain embodiments, the linear precursor RNA comprises at least one chemical modification.

[0117] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine or N6-methyladenosine.

[0118] In certain embodiments, the chemical modification is pseudouridine, N1-methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine or a combination thereof.

[0119] In certain embodiments, the chemical modification is N1-methylpseudouridine.

[0120] In certain embodiments, the linear precursor RNA is synthesized using in vitro transcription (IVT).

[0121] In one aspect, the present disclosure provides a circular RNA comprising a protein coding region and at least one RNA aptamer, wherein the circular RNA is formed from the linear precursor RNA described above.

[0122] In one aspect, the present disclosure provides a circular RNA comprising a protein-coding region, the circular RNA being formed from the above linear precursor RNA and the circular RNA lacking an RNA aptamer.

[0123] In one aspect, the present disclosure provides a nucleic acid encoding the above linear precursor RNA.

[0124] In one aspect, the present disclosure provides a vector comprising the above nucleic acid.

[0125] In one aspect, the present disclosure provides a host cell comprising the above vector.

[0126] In one aspect, the present disclosure provides a pharmaceutical composition comprising the above circular RNA or the above linear precursor RNA.

[0127] In one aspect, the present disclosure provides a method for producing circular RNA, the method comprising incubating the above linear precursor RNA under conditions that result in circularization of the linear precursor RNA.

[0128] In certain embodiments, the linear precursor RNA is incubated with GTP and Mg2+.

[0129] In certain embodiments, the linear precursor RNA is incubated with GTP and Mg2+ for a time sufficient to circularize the linear precursor RNA.

[0130] In certain embodiments, GTP is present at a concentration of about 1 mM to about 15 mM.

[0131] In certain embodiments, GTP is present at a concentration of about 2 mM.

[0132] In certain embodiments, Mg2+ is present at a concentration of about 1 mM to about 50 mM.

[0133] In certain embodiments, Mg2+ is present at a concentration of about 10 mM.

[0134] In one aspect, the present disclosure provides a method for producing a plurality of circular RNA molecules, the method comprising incubating a plurality of linear precursor RNA molecules under conditions that result in circularization of at least a portion of the linear precursor RNA molecules, wherein each linear precursor RNA molecule comprises the linear precursor RNA as described above.

[0135] In certain embodiments, at least about 30% (i.e., about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or 100%) of the plurality of linear precursor RNA molecules are circularized.

[0136] In one aspect, the present disclosure provides a method for purifying circular RNA, the method comprising: (a) contacting a sample containing the circular RNA as described above with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the circular RNA from the chromatography resin; and (c) purifying the circular RNA from the sample.

[0137] In one aspect, the present disclosure provides a method for purifying linear precursor RNA, the method comprising: (a) contacting a sample containing the linear precursor RNA as described above with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the linear precursor RNA from the chromatography resin; and (c) purifying the linear precursor RNA from the sample.

[0138] In certain embodiments, the method includes one or more washing steps between the contacting step (a) and the eluting step (b).

[0139] In one aspect, the present disclosure provides a method for purifying circular RNA, comprising: (a) contacting a sample containing circular RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the circular RNA from the chromatography resin; and (c) isolating the circular RNA from the sample, wherein the circular RNA comprises a protein-coding region and at least one RNA aptamer, and the RNA aptamer comprises a binding affinity for the affinity ligand.

[0140] In one aspect, the present disclosure provides a method for purifying linear precursor RNA, comprising: (a) contacting a sample containing linear precursor RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the linear precursor RNA from the chromatography resin; and (c) isolating the linear precursor RNA from the sample, wherein the linear precursor RNA comprises a protein-coding region and at least one RNA aptamer, and the RNA aptamer comprises a binding affinity for the affinity ligand.

[0141] In one aspect, the present disclosure provides a method for purifying circular RNA, comprising: (a) contacting a sample containing a plurality of linear precursor RNA molecules and a plurality of circular RNA molecules with an affinity ligand immobilized on a chromatography resin; and (b) isolating the circular RNA molecules from the sample, wherein the linear precursor RNA molecules comprise a protein-coding region and at least one RNA aptamer, the RNA aptamer comprises a binding affinity for the affinity ligand, and the circular RNA molecules lack the RNA aptamer.

[0142] In certain embodiments, the circular RNA molecules do not bind to the affinity ligand.

[0143] In certain embodiments, the circular RNA or linear precursor RNA has a purity of 90% or more.

[0144] In one aspect, the present disclosure provides a method of treating or preventing a disease or disorder, the method comprising administering the above pharmaceutical composition to a subject in need thereof.

[0145] In one aspect, the present disclosure provides a pharmaceutical composition comprising a plurality of circular RNA molecules, wherein at least about 90% of the circular RNAs comprise a protein-coding region and at least one RNA aptamer.

[0146] The foregoing and other features and advantages of the present disclosure will be more particularly understood from the following detailed description of exemplary embodiments in conjunction with the accompanying drawings.

Brief Description of the Drawings

[0147]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figures 8A - 8B

Figures 8C - 8D

Figure 9A

Figure 9B

Figure 9C

Figure 10

Figure 11A

Figure 11B

Figure 12A

Figure 12B

Figure 13

Figure 14

Mode for Carrying Out the Invention

[0148] The present disclosure is directed, inter alia, to novel circRNA compositions and methods of RNA affinity purification. In particular, the present disclosure relates to circRNA and linear RNA precursor compositions comprising at least one RNA aptamer. The RNA aptamers associated with the disclosed circRNA compositions enable the use of effective affinity purification. Methods for making these circRNA-tagged aptamer compositions are also disclosed herein.

[0149] I. Definitions Unless defined otherwise in this specification, scientific and technical terms used in connection with the present invention shall have the meanings commonly understood by those of ordinary skill in the art. Exemplary methods and materials are described below, but methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. In case of conflict, the present specification, including definitions, shall control. In general, the nomenclature used in connection with, and the laboratory procedures of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry, as well as protein and nucleic acid chemistry and hybridization described herein, are those well known and commonly employed in the art. Enzyme reactions and purification techniques are performed according to manufacturers' specifications, either as commonly practiced in the art or as described herein. Further, unless the context dictates otherwise, singular terms shall include pluralities and plural terms shall include the singular. Throughout this specification and the embodiments, the words "have" and "comprise" or variations thereof, such as "has", "having", "comprises" or "comprising", are to be understood to mean the inclusion of the stated integer or group of integers but not the exclusion of any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although many references are cited herein, such citation does not constitute an admission that any of these references forms part of the common general knowledge in the art.

[0150] It should be noted that the term "a" or "an" entity refers to one or more of that entity; for example, a "nucleotide sequence" is understood to represent one or more nucleotide sequences. Thus, the terms "a" (or "an"), "one or more", and "at least one" may be used interchangeably herein.

[0151] Furthermore, "and / or" as used herein should be regarded as a specific disclosure of each of the two specified features or components, regardless of the presence or absence of the other. Thus, the term "and / or" as used in phrases such as "A and / or B" is intended herein to include "A and B", "A or B", "A" (alone), and "B" (alone). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to include each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0152] It is understood that whenever an aspect is described herein in the language of "comprising", other aspects similar in other respects described in the terms of "consisting of" and / or "consisting essentially of" are also provided.

[0153] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press can provide those of ordinary skill in the art with many general dictionaries of the terms used in this disclosure.

[0154] Units, prefixes, and symbols are shown in their International System of Units (SI) approved forms. Numerical ranges include the numbers defining the range. Unless otherwise indicated, amino acid sequences are written left to right in an amino- to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure. Accordingly, the terms defined immediately below are defined more fully by reference to the entire specification.

[0155] The terms "about" or "approximately" are used herein to mean about, roughly, around or within range. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical value. Generally, the term "about" can modify the numerical value by up to or down by (higher or lower) 10% from the stated value. In some embodiments, the term can indicate a deviation of ±10%, ±5%, ±4%, ±3%, ±2%, ±1%, ±0.9%, ±0.8%, ±0.7%, ±0.6%, ±0.5%, ±0.4%, ±0.3%, ±0.2%, ±0.1%, ±0.05% or ±0.01% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±10% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±5% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±4% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±3% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±2% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±1% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.9% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.8% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.7% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.6% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.5% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.4% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.3% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.1% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.05% from the indicated numerical value. In some embodiments, "about" indicates a deviation of ±0.01% from the indicated numerical value.

[0156] Depending on the context, the terms "polynucleotide" or "nucleotide" may encompass single nucleic acids as well as multiple nucleic acids. In some embodiments, the polynucleotide is an isolated nucleic acid molecule or construct, such as circular RNA (circRNA) or plasmid DNA (pDNA). In some embodiments, the polynucleotide contains conventional phosphodiester bonds. In some embodiments, the polynucleotide contains non-conventional bonds (e.g., amide bonds such as those found in peptide nucleic acids (PNA)). The term "nucleic acid" refers to any one or more nucleic acid segments present in the polynucleotide, such as DNA or RNA fragments. An "isolated" nucleic acid or polynucleotide is intended to mean a nucleic acid molecule, DNA or RNA, that has been removed from its native environment. For example, a recombinant polynucleotide encoding a factor VIII polypeptide contained in a vector is considered isolated for the purposes of this disclosure. Further examples of isolated polynucleotides include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) from other polynucleotides in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the polynucleotides of this disclosure. Isolated polynucleotides or nucleic acids according to this disclosure further include such molecules produced synthetically. Additionally, the polynucleotide or nucleic acid can contain regulatory elements such as promoters, enhancers, ribosome binding sites or transcription termination signals.

[0157] As used herein, the term "polypeptide" is intended to encompass both a single "polypeptide" and plural "polypeptides", and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term "polypeptide" refers to any one or more chains of two or more amino acids, and does not refer to a product of a specific length. Thus, peptides, dipeptides, tripeptides, oligopeptides, "proteins", "amino acid chains" or any other term used for the purpose of referring to any one or more chains of two or more amino acids are included in the definition of "polypeptide", and the term "polypeptide" can be used in place of or synonymously with any of the above terms. The term "polypeptide" is also intended to refer to products of post-expression modification of polypeptides, including but not limited to glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, protein cleavage or modification with non-natural amino acids. A polypeptide can be derived from a natural biological source or produced by recombinant technology, but does not necessarily have to be translated from a specific nucleic acid sequence. It can be produced by any method, including chemical synthesis.

[0158] An "isolated" polypeptide or fragment, variant or derivative thereof refers to a polypeptide that is not in its natural environment. No specific level of purification is required. For example, an isolated polypeptide can be readily removed from its native or natural environment. Recombinant polypeptides and proteins produced in host cells are considered isolated for the purposes of the present disclosure if they are separated, fractionated or partially or substantially purified by any suitable technique, such that the native or recombinant polypeptide is contemplated.

[0159] "Administer" or "administering" as used herein, when referring to a composition described herein, e.g., a chimeric protein, means delivering the composition to a subject. The composition, e.g., the chimeric protein, can be administered to the subject using methods known in the art. In particular, the composition can be administered to the subject intravenously, subcutaneously, intramuscularly, intradermally, or via any mucosal surface, e.g., orally, sublingually, buccally, intranasally, rectally, vaginally, or via the pulmonary route. In some embodiments, the administration is intravenous. In some embodiments, the administration is subcutaneous. In some embodiments, the administration is self-administration. In some embodiments, a parent administers the chimeric protein to a child. In some embodiments, the chimeric protein is administered to the subject by a healthcare provider such as a physician, doctor, or nurse.

[0160] II. Circular RNA and Linear Precursor RNA Disclosed herein are circular RNA (circRNA) compositions comprising a protein-coding region and at least one RNA aptamer. Also disclosed herein are linear precursor RNA compositions comprising a self-splicing ribozyme and a protein-coding region, wherein the linear precursor RNA comprises at least one RNA aptamer.

[0161] As used herein, the term "circular RNA" or "circRNA" refers to an RNA polynucleotide that does not include a 5' end or a 3' end, i.e., a continuous RNA molecule that does not include a 5' end or a 3' end. Exogenous circRNA constructs comprising a protein-coding region have been previously described and have been shown to extend the duration of protein expression from full-length RNA. Wesselhoeft et al., (2018), Nat Commun., 9(1):2629; Wesselhoeft et al., (2019), Mol Cell., 74(3):508-520; International Publication No. WO 2019 / 236673 Pamphlet.

[0162] As used herein, the term "linear RNA precursor" refers to an RNA polynucleotide that is not circular but contains sequence motifs for promoting a cyclization reaction, thereby creating a circular RNA. In certain embodiments, the sequence motif that promotes cyclization is a self-splicing ribozyme. The self-splicing ribozyme method efficiently regulates cyclization in a wide range of RNAs in vitro, including RNAs having protein-coding regions. Designing linear precursor RNAs with additional auxiliary sequences helps create favorable conditions for splicing (i.e., 5' external homology arm, 5' internal homology arm, 5' spacer sequence, 3' spacer sequence, 3' internal homology arm, and 3' external homology arm). Id. Successful translation initiation of a functional protein was achieved by producing an exogenous circRNA construct in eukaryotic cells and incorporating an internal ribosome entry site (IRES) and an internal polyadenosine tract.

[0163] Exogenous circRNA purified by high performance liquid chromatography demonstrated excellent protein production quality in terms of both the amount and stability of the protein produced. However, the samples retained unwanted RNA species, including impurities and linear precursor RNA, nicked circular RNA, double-stranded RNA, triphosphate-RNA, free nucleotides, endotoxin, as well as solvents.

[0164] Provided herein are methods and compositions for promoting the use of exogenous circRNAs for robust and stable protein expression in eukaryotic cells by improving the efficiency, quality, and reliability of circRNA purification methods.

[0165] A. IRES Since circRNA lacks a 5' cap and a 3' poly-A tail, the translation of circRNA can only be initiated in a cap-independent manner. IRES-mediated translation of exogenous circRNA is one of the widely accepted mechanisms for circRNA translation initiation. Pamudurti et al.,(2017),66:9-21 e27;Petkovic(2015),Nucleic Acids Res.,43:2454-2465.

[0166] In some embodiments, the circRNA disclosed herein includes an internal ribosome entry site (IRES) positioned at the 5' end of the protein coding region. In some embodiments, the linear precursor RNA disclosed herein includes an IRES. In some embodiments, the IRES is positioned at the 3' end of the protein coding region in the linear precursor RNA but shifts to the 5' end of the protein coding region upon circularization.

[0167] In some embodiments, the IRES is Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Aphid lethal paralysis virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, Homalodisca coagulata virus-1, Drosophila P virus, Hepatitis C virus (HCV), Hepatitis A virus, GB hepatitis virus, Equine rhinopneumonitis virus, Autographa californica nuclear polyhedrosis virus, Encephalomyocarditis virus (EMCV), Drosophila C virus, Crucifer tobamo virus, Cricket paralysis virus, Bovine viral diarrhea virus 1, Black queen cell virus, Aphid lethal paralysis virus, Avian encephalomyelitis virus, Acute paralysis virus, Hibiscus chlorotic ringspot virus, Classical swine fever virus, Human FGF2, Human SFTAPA1, Human AMLURUNX1, Drosophila antennapedia, Human AQP4, Human AT1R, Human BAG-1, Human BCL2, Human BiP, Human c-IAP1, Human c-myc, Human eIF4G, Mouse NDST4L, Human LEF1, Mouse HIF1 alpha, Human n.myc, Mouse Gtx, Human p27kip1, Human PDGF2 / c-sis, Human p53, Human Pim-1, Mouse Rbm3, Drosophila reaper, Drosophila Scamper, Drosophila Ubx, Human UNR, Mouse UtrA, Human VEGF-A, Human XIAP, Drosophila hairless, S. cerevisiae TFIID, S. cerevisiae (S.derived from Saccharomyces cerevisiae YAP1, human c-src, human FGF-1, simian picomavirus, Turnip crinkle virus, an aptamer against eIF4G, Coxsackievirus B3 (CVB3) or Coxsackievirus A (CVB1 / 2), dicistrovirus, poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or a synthetic IRES. In some embodiments, it is derived from the CVB3 IRES. In yet another embodiment, the IRES comprises the polynucleotide sequence of SEQ ID NO: 75. In yet another embodiment, the IRES is encoded by the polynucleotide sequence of SEQ ID NO: 51..

[0168] B. 5' and 3' homologous arms As used herein, a "homologous arm" is any contiguous sequence predicted to form base pairs with at least about 75% (e.g., at least about 80%, at least about 85%, at least about 90%, at least about 95% or 100%) of another homologous arm in an RNA (i.e., circular RNA or linear RNA precursor). The homologous arm sequence is from about 5 to about 50 nucleotides in length. The homologous arm sequence can be located before and adjacent to or within the 3' intron fragment and / or can be located after or within the 5' intron fragment. The homologous arm sequence is predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, less than 25%) base pairs with an unintended sequence (e.g., a non-homologous arm sequence) in the RNA. A "strong homologous arm" refers to a homologous arm having a Tm above 50°C when the bases pair with another homologous arm in the RNA.

[0169] "Internal homologous arms" and "external homologous arms" refer to the orientation of homologous arms with respect to self-splicing PIE fragments and protein-coding regions. In linear precursor RNA, the internal homologous arms are positioned between the self-splicing PIE fragment and the protein-coding region. Under cyclization conditions, the internal homologous arms remain in the circular RNA. In linear precursor RNA, the external homologous arms are adjacent to the sides of the self-splicing PIE fragment. Under cyclization conditions, the external homologous arms are excised and do not exist in the circular RNA.

[0170] In some embodiments, the circRNAs disclosed herein include 5' internal homologous arms. In some embodiments, the linear precursor RNAs disclosed herein include 5' internal homologous arms. In some embodiments, the 5' internal homologous arms include the nucleotide sequence of SEQ ID NO: 70. In some embodiments, the 5' internal homologous arms are about 5 to about 50 nucleotides in length.

[0171] In some embodiments, the circRNAs disclosed herein include 3' internal homologous arms. In some embodiments, the linear precursor RNAs disclosed herein include 3' internal homologous arms. In some embodiments, the 3' internal homologous arms include the nucleotide sequence of SEQ ID NO: 71. In some embodiments, the 3' internal homologous arms are about 5 to about 50 nucleotides in length.

[0172] In some embodiments, the linear precursor RNAs disclosed herein include 5' external homologous arms and 3' external homologous arms. In some embodiments, the 5' external homologous arms and 3' external homologous arms include the nucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 72. In some embodiments, the 5' external homologous arms and 3' external homologous arms are each independently about 5 to about 50 nucleotides in length.

[0173] C. Spacer sequence The spacer array can be used to separate different elements in the circular RNA or linear precursor RNA of the present disclosure. By separating different elements, the RNA secondary structure can be folded better. For example, but not by any means limiting, a spacer can be placed at the 5' end of the IRES to enable the IRES to fold into an appropriate structure. The spacer sequence can be a polyA sequence, a polyAC sequence, a polyC sequence, a polyU sequence, or the spacer sequence can be manipulated according to the spatial constraints of the secondary structure created by other elements (such as aptamers, IRESs, and 5' and 3' self-splicing PIE fragments) contained in the linear precursor RNA. The spacer sequence can promote circularization by introducing regions of spacer complementarity to promote the formation of "splicing bubbles", and the spacer sequence promotes functionality by enabling the highly structured intron portions of the self-splicing PIE fragment and the IRES to fold into their correct secondary structures.

[0174] In some embodiments, the circular RNA or linear precursor RNA disclosed herein comprises at least one spacer sequence. In some embodiments, the circular RNA or linear precursor RNA comprises two or more spacer sequences. The two or more spacer sequences can comprise the same nucleotide sequence. In other embodiments, at least one of the two or more spacer sequences comprises a distinct nucleotide sequence. In some embodiments, the spacer sequence is about 5 to about 500 nucleotides in length. In some embodiments, the spacer sequence is about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450 or about 500 nucleotides in length. In some embodiments, the spacer sequence is longer than about 500 nucleotides in length.

[0175] In some embodiments, the circular RNAs or linear precursor RNAs disclosed herein include 5' and 3' spacer sequences. In some embodiments, the 5' and 3' spacers include the nucleotide sequences of SEQ ID NO: 78 or SEQ ID NO: 79.

[0176] D. Self-splicing ribozyme elements and circularization of linear precursor RNAs The self-splicing ribozyme method of circularization using a circularized group I catalytic intron can circularize long linear precursor RNAs and requires only the addition of GTP and Mg2+ as cofactors (i.e., circularization conditions). Petkovic & Muller, (2015) Nucleic Acids Research, 43(4):2454-2465. The circularized intron-exon (PIE) splicing strategy consists of a fusion partial exon flanked by half-intron sequences (i.e., 3' self-splicing PIE fragment and 5' self-splicing PIE fragment). Puttaraju & Been, (1992) Nucleic Acids Research, 20(20):5357-5364. Upon addition of circularization conditions, linear precursor RNAs containing 3' and 5' self-splicing PIEs undergo a double ester exchange reaction characteristic of group I catalytic introns. During the reaction, exon elements are fused, resulting in the formation of a 5' to 3' linked circle. Petkovic & Muller, (2015) Nucleic Acids Research, 43(4):2454-2465; Wesselhoeft et al., (2018), Nat Commun., 9(1):2629.

[0177] In some embodiments, the linear precursor RNAs disclosed herein include at least two catalytic subunits. In some embodiments, the self-splicing ribozyme catalytic subunits are derived from either group I intron or group II intron RNA transcripts or fragments thereof. In some embodiments, the self-splicing ribozyme catalytic subunits are derived from the circularized intron-exon (PIE) sequences from the Cyanobacterium Anabaena pre-tRNA-Leu gene, the T4 phage Td gene, or the Tetrahymena pre-rRNA. In some embodiments, the RNA catalytic subunits include a 3' self-splicing PIE fragment and a 5' self-splicing PIE fragment. In some embodiments, the 3' self-splicing PIE fragment includes the nucleotide sequence of SEQ ID NO: 73. In some embodiments, the 5' self-splicing PIE fragment includes the nucleotide sequence of SEQ ID NO: 74. In some embodiments, the catalytic activity of the two subunits results in circularized RNA.

[0178] In some embodiments, the circRNAs disclosed herein include a 3' exon element. In some embodiments, the 3' exon element includes the nucleotide sequence of SEQ ID NO: 81. In some embodiments, circRNAs that include a protein-coding region and at least one RNA aptamer include a 5' exon element. In some embodiments, the 5' exon element includes the nucleotide sequence of SEQ ID NO: 83.

[0179] E. 5' and 3' UTR sequences and polyA sequences Previous studies have shown that 5' and 3' UTR sequences do not interfere with efficient circularization of RNA and can potentially improve the expression of circRNAs by acting as additional spacer sequences (see, for example, WO 2019 / 236673). The polyadenylation (polyA) sequence can also function as a spacer.

[0180] In some embodiments, the circRNAs disclosed herein contain at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and / or at least one polyadenylation (polyA) sequence. In some embodiments, the linear precursor RNAs disclosed herein contain at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR) and / or a polyadenylation (polyA) sequence.

[0181] In some embodiments, the 5'UTR includes the nucleotide sequence of SEQ ID NO: 76. In some embodiments, the 3'UTR includes the nucleotide sequence of SEQ ID NO: 77.

[0182] In some embodiments, the 5'UTR can be about 50 to 500 nucleotides in length. In some embodiments, the 3'UTR can be 50 to 500 nucleotides or longer in length. In some embodiments, the circular RNAs and linear precursor RNAs disclosed herein include 5' or 3'UTRs derived from a gene distinct from the gene encoding the polypeptide in the protein coding region. In some embodiments, the circRNAs disclosed herein include 5' or 3'UTRs that are chimeric. In some embodiments, the linear precursor RNAs disclosed herein include 5' or 3'UTRs that are chimeric.

[0183] F.IVT: Generation of Linear Precursors The term "in vitro transcription" or "IVT" relates to the process by which RNA is synthesized in a cell-free system (in vitro). As disclosed herein, linearized plasmid DNA can be used as a template for the generation of linear RNA precursors. A promoter for controlling in vitro transcription can be any promoter for DNA-dependent RNA polymerase. Examples of DNA-dependent RNA polymerases are T7, T3, and SP6 RNA polymerases. A DNA template for in vitro RNA transcription can be obtained by cloning a nucleic acid, particularly cDNA corresponding to the target RNA to be transcribed in vitro, and introducing it into an appropriate DNA for in vitro transcription, such as plasmid DNA. cDNA can be obtained by reverse transcription of mRNA, chemical synthesis, or oligonucleotide cloning.

[0184] The linear precursor RNA disclosed herein can be synthesized according to any of various known methods. In some embodiments, the linear precursor RNA according to the present invention can be synthesized by in vitro transcription (IVT). Methods of in vitro transcription are known in the art. See, for example, Geall et al. (2013) Semin. Immunol. 25(2):152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14. Briefly, IVT is typically performed with a linear or circular DNA template containing a buffer system that may contain a promoter, a pool of ribonucleotide triphosphates, DTT, and magnesium ions, as well as an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNAse I, pyrophosphatase, and / or an RNAse inhibitor. The exact conditions will vary according to the specific application. The presence of these reagents is undesirable in the final RNA product and is considered an impurity or contaminant, and they must be purified to provide a clean and homogeneous linear precursor RNA or the resulting circRNA that is suitable for therapeutic use.

[0185] Full length and chemical modifications of G.circRNA and linear precursor RNA The methods disclosed herein can be used to purify circRNAs or linear precursor RNAs of various nucleotide lengths. In some embodiments, the disclosed methods can be used to purify circRNAs or linear precursor RNAs that are longer than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb, 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, or 15 kb. The circRNAs or linear precursor RNAs disclosed herein can be modified or unmodified. In some embodiments, the circRNAs or linear precursor RNAs disclosed herein typically contain one or more modifications that enhance RNA stability or regulate circRNA translation. Tang and Lv, (2021), Int J Biol Sci. 17(9); 2262-2277. Exemplary modifications include backbone modifications, sugar modifications, or base modifications.In some embodiments, the disclosed linear precursor RNAs can be synthesized from naturally occurring nucleotides and / or nucleotide analogs (modified nucleotides) that include, but are not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and / or modified nucleotide analogs or derivatives of purines and pyrimidines, such as 1-methyl-adenine, 2-methyl-adenine, 2-methylthio-N6-isopentenyl-adenine, N6-methyl-adenine, N6-isopentenyl-adenine, 2-thio-cytosine, 3-methyl-cytosine, 4-acetyl-cytosine, 5-methyl-cytosine, 2,6-diaminopurine, 1-methyl-guanine, 2-methyl-guanine, 2,2-dimethyl-guanine, 7-methyl-guanine, inosine, 1-methyl-inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2-thio-uracil, 5-methyl-uracil, N-uracil-5-oxyacetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5'-methoxycarbonylmethyl-uracil, 5-methoxy-uracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, β-D-mannosyl-queosine, phosphoramidate, phosphorothioate, peptide nucleotide, methylphosphonate, 7-deazaguanosine, 5-methylcytosine, N6-methyladenosine, and inosine.In some embodiments, the disclosed circRNA or linear precursor RNA contains at least one chemical modification including, but not limited to, pseudouridine, N1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. In some embodiments, the modified nucleotide includes N1-methylpseudouridine. The preparation of such analogs is known to those skilled in the art from, for example, U.S. Patent No. 4,373,071, U.S. Patent No. 4,401,796, U.S. Patent No. 4,415,732, U.S. Patent No. 4,458,066, U.S. Patent No. 4,500,707, U.S. Patent No. 4,668,777, U.S. Patent No. 4,973,679, U.S. Patent No. 5,047,524, U.S. Patent No. 5,132,418, U.S. Patent No. 5,153,319, U.S. Patent No. 5,262,530, and U.S. Patent No. 5,700,642.

[0186] H. Protein coding region The circRNA or linear precursor RNA disclosed herein contains a protein coding region that encodes a protein (e.g., a polypeptide or peptide). In some embodiments, the protein coding region is derived from a single gene or a single synthetic or expression construct. However, in some embodiments, the circRNA or linear precursor RNA compositions disclosed herein contain multiple protein coding regions, each of which can encode one or more proteins or can encode collectively.

[0187] In some embodiments, the circRNA or linear precursor RNA comprising an RNA aptamer as disclosed herein encodes a therapeutic polypeptide. In some embodiments, the therapeutic polypeptide comprises an antibody heavy chain, an antibody light chain, an enzyme, or a cytokine.

[0188] In some embodiments, the circRNA or linear precursor RNA encodes a cytokine. Non-limiting examples of cytokines include IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-α, INF-y, GM-CFS, M-CSF, LT-β, TNF-α, growth factors, and hGH.

[0189] In one embodiment, the circRNA or linear precursor RNA comprising an RNA aptamer encodes a genome editing polypeptide. In some embodiments, the genome editing polypeptide is a CRISPR protein, a restriction nuclease, a meganuclease, a transcription activator-like effector protein (TALE such as TALE nuclease, TALEN), or a zinc finger protein (ZF such as ZF nuclease, ZFN). See, for example, WO 2020 / 139783.

[0190] In some embodiments, the circRNA or linear precursor RNA encodes an enzyme utilized in enzyme replacement therapy. Examples of enzyme replacement therapy include lysosomal diseases such as Gaucher disease, Fabry disease, MPS I, MPS II (Hunter syndrome), MPS VI, and glycogenosis type II.

[0191] In some embodiments, the circRNA or linear precursor RNA comprising the RNA aptamer encodes an antigen of interest. The antigen can be a polypeptide derived from a virus, such as an influenza virus, a coronavirus (e.g., SARS-CoV-1, SARS-CoV-2, or MERS-related virus), an Ebola virus, a dengue virus, a human immunodeficiency virus (HIV), a hepatitis A virus (HAV), a hepatitis B virus (HBV), a hepatitis C virus (HCV), a herpes simplex virus (HSV), a respiratory syncytial virus (RSV), a rhinovirus, a cytomegalovirus (CMV), a Zika virus, a human papillomavirus (HPV), a human metapneumovirus (hMPV), a human parainfluenza virus type 3 (PIV3), an Epstein-Barr virus (EBV), or a chikungunya virus.

[0192] The antigen can be derived from a bacterium, such as Staphylococcus aureus, Moraxella spp. (e.g., Moraxella catarrhalis, which causes otitis media, respiratory infections, and / or sinusitis), Chlamydia trachomatis (which causes chlamydia), Borrelia spp. (e.g., Borrelia burgdorferi, which causes Lyme disease), Bacillus anthracis (which causes anthrax), Salmonella typhi (which causes typhoid fever), Mycobacterium tuberculosis (which causes tuberculosis), Propionibacterium acnes (which causes acne), or nontypeable Haemophilus influenzae.

[0193] Optionally, the circRNA or linear precursor RNA comprising an RNA aptamer may encode two or more antigens. In some embodiments, the circRNA or linear precursor RNA disclosed herein encodes 2, 3, 4, 5, 6, 7, 8, 9, 10 or more antigens. These antigens can be from the same pathogen or different pathogens. For example, a polycistronic protein coding region that can be translated into two or more antigens (e.g., each antigen coding sequence is separated by a nucleotide linker encoding a self-cleaving peptide such as a 2A peptide) and can be further fused to an aptamer.

[0194] In some embodiments, the circRNA or linear precursor RNA compositions disclosed herein can be used in vaccines. RNA vaccines are promising vaccines that replace conventional subunit vaccines containing antigenic proteins derived from pathogens. RNA-based vaccines enable the de novo expression of complex antigens in vaccinated subjects, thereby allowing proper post-translational modification and presentation of the antigens in their native conformation. Furthermore, once established, the manufacturing process for circRNA vaccines can be used for various antigens, enabling the rapid development and deployment of circRNA vaccines. A detailed discussion of RNA vaccines can be found in Pardi, et al. (2018) Nat Rev Drug Discov 17, 261-279.

[0195] III. Aptamer The widespread use of affinity purification of RNA is limited due to the lack of efficient RNA fusion tags. Unless the RNA to be purified naturally contains a sequence with a strong affinity for a target that can be immobilized on a stationary phase (i.e., chromatography resin), the RNA may require tagging with a specific sequence, similar to the polyhistidine tags used in protein science.

[0196] Disclosed herein are circular RNA compositions comprising a protein-coding region and at least one aptamer. Also disclosed herein are linear precursor RNA compositions comprising at least a self-splicing ribozyme and a protein-coding region, wherein the linear precursor RNA comprises at least one RNA aptamer. The aptamers associated with these circular RNA and linear precursor RNA compositions enable the use of affinity purification while minimizing the impact on translation efficiency and immunogenicity. Also disclosed herein are methods for making such circular RNA and linear precursor RNA tagged aptamer compositions.

[0197] As used herein, the term "aptamer" refers to any nucleic acid sequence having a non-covalent binding site for a specific target. Exemplary aptamer targets include nucleic acid sequences, proteins, peptides, antibodies, small molecules, minerals, antibiotics, and the like. The aptamer binding site can result from the secondary, tertiary, or quaternary conformational structure of the aptamer.

[0198] As used herein, the term "RNA aptamer" refers to an aptamer composed of RNA. In some embodiments, the RNA aptamer is included within the nucleotide sequence of a circRNA or a linear precursor RNA. In other embodiments, the RNA aptamer is separated from the nucleotide sequence of the circRNA or linear precursor RNA.

[0199] Aptamers can typically bind to a specific target with high affinity and specificity. Aptamers have several advantages over other binding proteins (e.g., antibodies). For example, aptamers can be fully manipulated in vitro (e.g., via the SELEX aptamer selection method), can be produced by chemical synthesis, have desirable storage properties, and induce little or no immunogenicity in therapeutic applications. See generally, Proske et al., (2005) Appl. Microbiol. Biotechnol 69:367-374.

[0200] Aptamers have historically been used to regulate gene expression by directly binding to ligands. These aptamers act similarly to regulatory proteins, forming very specific binding pockets for targets, subsequently resulting in conformational changes.

[0201] In some embodiments, the RNA aptamer is synthetically derived. In some embodiments, the RNA aptamer is naturally derived from prokaryotes and / or eukaryotes. In some embodiments, the RNA aptamer is derived from hairpin RNA, tRNA or riboswitch.

[0202] In some embodiments, the RNA aptamer is derived from a riboswitch. A riboswitch is a regulatory RNA element that functions as a small molecule sensor for controlling gene transcription and translation. Several riboswitch classes are known in the art. Exemplary riboswitches include the B 12 riboswitch, TPP riboswitch, SAM riboswitch, guanine riboswitch, FMN riboswitch, lysine riboswitch and PreQ1 riboswitch.

[0203] In some embodiments, the RNA aptamer is a split aptamer. Split aptamers are similar to split protein systems (e.g., β-galactosidase) and rely on two or more short nucleic acid strands that assemble into a higher-order structure in the presence of a specific target. Debais et al. (2020) Nucleic Acids Res 48(7):3400-3422. An exemplary split aptamer is the ATP aptamer. Sassanfar & Szostak (1993) Nature 364(6437)-550-553. The ATP aptamer is an RNA aptamer that has been split into two RNA fragments by removing the loop that closes the stem and extending each fragment with additional nucleotides to compensate for the loss of stability. Neither of the two RNA fragments binds to ATP alone, but their binding ability is reactivated in the presence of ATP. Debais et al. (2020) Nucleic Acids Res 48(7):3400-3422.

[0204] In other embodiments, the split aptamer is reformed by circularization of a linear precursor RNA. In this context, the split aptamer comprises a 5' portion and a 3' portion. Each portion can be of any length that is smaller than a complete unsplit aptamer. Together, the 5' and 3' portions form a complete non-split aptamer. In the case of a linear precursor RNA comprising a 3' exon element and a 5' exon element, the 5' portion of the split aptamer is positioned 3' to the 5'' exon element, and the 3' portion of the split aptamer is positioned 5' to the 3'' exon element. In the case of a linear precursor RNA that does not comprise a 5' exon element and a 3' exon element, the 5' portion of the split aptamer is positioned 3' to the 3' internal homology arm, and the 3' portion of the split aptamer is positioned 5' to the 5' internal homology arm.

[0205] In certain embodiments, the split aptamer is reformed into a functional aptamer upon circularization of the linear precursor RNA.

[0206] In some embodiments, the RNA aptamer is an X-aptamer. The X-aptamer is engineered to have a combination of natural and chemically modified nucleotides to improve binding affinity, specificity, and versatility. An exemplary embodiment of the X-aptamer is the PS2 aptamer. The PS2 aptamer is an RNA aptamer that contains a phosphorothioate (i.e., PS2) substitution at a single nucleotide of the RNA aptamer, thereby increasing the binding affinity of the aptamer from the nanomolar to the picomolar range. Abeydeera et al. (2016) Nucleic Acids Res. 44(17):8052-8064.

[0207] In some embodiments, the RNA aptamer binds to a ligand. In some embodiments, the ligand is utilized in an affinity purification system. In some embodiments, the affinity ligand includes protein A, protein G, streptavidin, glutathione (GSH), dextran (sephadex), cellulose (e.g., diethylaminoethyl cellulose), or a fluorescent molecule. In some embodiments, the affinity ligand is immobilized on a chromatography resin.

[0208] In some embodiments, the affinity ligand includes protein A. DNA aptamers have previously been shown to target protein A. See, for example, Stoltenburg et al. (2016) Sci Rep. 6:33812.

[0209] In some embodiments, the disclosed RNA aptamer binds to streptavidin. Streptavidin-binding aptamers are described, for example, in Srisawat & Engelke (2001) RNA 7(4):632-641. An exemplary RNA aptamer that binds to streptavidin is S1. In some embodiments, the RNA aptamer includes the nucleotide sequence of UCAUGCAAGUGCGUAAGAUAGUCGCGGGCCGGGGGCGUAU (SEQ ID NO: 90).

[0210] This specification also discloses RNA aptamers that bind to sephadex. The sephadex-binding aptamers are described, for example, in Srisawat et al. (2001) Nucleic Acid Res 29(2):e4. An exemplary RNA aptamer that binds to sephadex (e.g., sephadex G-100) is sephadex D8. In some embodiments, the RNA aptamer comprises the nucleotide sequence of GUCCGAGUAAUUUACGUUUUGAUACGGUUGCGGAACUUGC (SEQ ID NO: 91).

[0211] This specification also discloses RNA aptamers that bind to glutathione (GSH). The glutathione-binding aptamers are described, for example, in Bala, et al. (2011). RNA Biology 8(1):101-111. In some embodiments, the RNA aptamer is GSHapt 8.17 or GSHapt 5.39.

[0212] This specification also discloses RNA aptamers that bind to 6×His. 6×His corresponds to the amino acid sequence of six consecutive histidine residues. The 6×His sequence can be isolated and optionally immobilized on a chromatographic resin. Alternatively, the 6×His sequence can be present as an N-terminal or C-terminal tag on a polypeptide, and optionally, the 6×His-tagged polypeptide is immobilized on a chromatographic resin. The 6×His-binding aptamer is described, for example, in Tsuji, et al. (2009). Biochem Biophys Res Commun. 386(1):227-231. In some embodiments, the RNA aptamer is shot47 or 47s. In some embodiments, the RNA aptamer comprises the nucleotide sequence of GGGUACGCUCAGGUAUAUUGGCGCCUUCGUGGAAUGUCAGUGCCUGGACGUGCAGU (SEQ ID NO: 84). In some embodiments, the RNA aptamer comprises the nucleotide sequence of GGGACGCUCACGUACGCUCACGUCCGAUCGAUACUGGUAUAUUGGCGCCUUCGUGGAAUGUCAGUGCCUGGACGUGCAGU (SEQ ID NO: 85). In some embodiments, the RNA aptamer comprises the nucleotide sequence of GGGUAUAUUGGCGCCUUCGUGGAAUGUCAGUGCCUGG (SEQ ID NO: 86). This specification also discloses RNA aptamers that bind to the MS2 coat protein (MCP). In some embodiments, the RNA aptamer comprises the nucleotide sequence of GGCCAACAUGAGGAUCACCCAUGUCUGCAGGGCC (SEQ ID NO: 87). In some embodiments, the RNA aptamer comprises the nucleotide sequence of ACAUGAGGAUCACCCAUG (SEQ ID NO: 88). In some embodiments, the RNA aptamer comprises the nucleotide sequence of ACAUGAGGAUCACCCAUGU (SEQ ID NO: 89). In some embodiments, the aptamer-containing circular RNA or linear RNA precursor described herein binds to MCP immobilized on a chromatographic resin.The M2 aptamer is described in more detail in Bertrand et al. (1998). Molecular cell, 2(4), 437-445.

[0213] Also disclosed herein are RNA aptamers that bind to fluorescent molecules. Examples of such aptamers are described, for example, in Paige et al. (2011) Science 333(6042):642-646. In some embodiments, the RNA aptamer comprises the nucleotide sequence of GAAGGGACGGUGCGGAGAGGAGA (SEQ ID NO: 92). The listed RNA aptamer is designated RNA Mango and binds to the fluorescent molecule thiazole orange (TO), such as TO1-biotin as described in Dolgosheina et al. (2014) ACS Chemical Biology, 9(10):2412-2420.

[0214] In some embodiments, the RNA aptamer comprises the nucleotide sequence of AGCUUAUCCAUUGCAUCUCGGAUGAGCU (SEQ ID NO: 93). The listed RNA aptamer is designated U1hp and binds to the spliceosomal protein U1A as described in Katsamba et al. (2001) J Biol Chem. 276(24):21476-81.

[0215] In some embodiments, the RNA aptamer comprises the S1m aptamer or a derivative or fragment thereof. In some embodiments, the S1m aptamer used in accordance with the present disclosure is the aptamer described in Bachler et al. (1999) RNA 5(11):1509-1516, Srisawat & Engelke (2001) RNA 7(4):632-641 or Li & Altman. (2002) Nuc. Acids Res. 30(17):3706-3711. In some embodiments, the RNA aptamer comprises the nucleotides of SEQ ID NO: 65 or SEQ ID NO: 66. In some embodiments, the RNA adapter is encoded by the nucleotide sequence of SEQ ID NO: 52 or SEQ ID NO: 53.

[0216] In some embodiments, the RNA aptamer comprises an Sm aptamer.

[0217] In some embodiments, the RNA aptamer is about 30 to 200 nucleotides in length. In some embodiments, the RNA aptamer is about 50 to 200 nucleotides in length. In some embodiments, the RNA aptamer is about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 105, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about 165, about 170, about 175, about 180, about 185, about 190, about 195 or about 200 nucleotides in length.

[0218] In some embodiments, the aptamer (e.g., RNA aptamer) is not a histone stem-loop. As used herein, the term "histone stem-loop" typically refers to a stem-loop RNA structure found in mRNA encoding histones. The histone stem-loop binds to the stem-loop binding protein (SLBP) and is used to regulate histone expression during the cell cycle. The histone stem-loop is described in more detail in Lopez et al. (RNA. 14(1):1-10. 2008) and WO 2013 / 120498.

[0219] In some embodiments, the aptamer (e.g., RNA aptamer) is not an internal ribosome entry site (IRES). In some embodiments, the aptamer (e.g., RNA aptamer) does not bind to ribosomes or proteins that regulate protein translation. In some embodiments, the aptamer (e.g., RNA aptamer) does not bind to the protein eIF4G. In some embodiments, the aptamer (e.g., RNA aptamer) can bind to a specific target (e.g., a protein) immobilized on a surface (e.g., a protein immobilized on a surface such as cross-linked agarose or cross-linked dextran).

[0220] A. Position of the aptamer In this specification, RNA aptamers containing aptamers at various positions are disclosed with respect to other elements present in the linear precursor RNA or subsequent circRNA. The selection of the position of the RNA aptamer on the circRNA or linear precursor RNA can be evaluated with respect to both the magnitude of translational regulation and the basal expression level.

[0221] In some embodiments, the RNA aptamer in the circRNA is positioned a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the IRES, e) between the protein-coding region and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, j) between the 3' exon and the IRES, and / or i) between the IRES and the 5' exon element.

[0222] In some embodiments, the RNA aptamer in the circRNA is positioned a) before the 3' exon element, b) between the 3' exon element and the 5' internal homology arm, c) between the 5' internal homology arm and the 5' spacer sequence, d) between the 5' spacer sequence and the protein-coding region, e) between the IRES and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homology arm, g) between the 3' internal homology arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the protein-coding region, and / or j) between the protein-coding region and the 5' exon element.

[0223] In some embodiments, the RNA aptamer in the linear precursor RNA is positioned a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the IRES, f) after the protein-coding region but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0224] In some embodiments, the RNA aptamer in the linear precursor RNA is positioned a) before the 5' external homology arm, b) between the 5' external homology arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homology arm, d) between the 5' internal homology arm and the 5' spacer sequence, e) between the 5' spacer sequence and the protein-coding region, f) after the IRES but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homology arm, h) between the 3' internal homology arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homology arm, and / or j) after the 3' external homology arm.

[0225] In some embodiments, the RNA aptamer need not bind directly to the circRNA or linear precursor RNA. In some embodiments, the RNA aptamer is bound to a linker. See, for example, Elenko et al. (2009) J Am Chem Soc. 131(29):9866-9867.

[0226] In some embodiments, the RNA aptamer can be removed from the circRNA or linear precursor RNA after affinity purification. This can be achieved, for example, using a DNA oligonucleotide that hybridizes to the RNA aptamer or RNA scaffold. The resulting duplex can then be cleaved with an enzyme such as RNase H. See, for example, Batey RT. (2014). Curr Opin Struct Biol. 26:1-8.

[0227] B. Aptamer copy number An increase in the aptamer copy number can enable the aptamer to create a larger three-dimensional structure (i.e., enhance the number of available affinity ligand binding sites or create unique ligand binding sites). Strategic placement of aptamer copies can allow for an increase in activity by a cognate affinity ligand.

[0228] In some embodiments, the circRNA or linear precursor RNA used in the disclosed methods and compositions contains multiple copies of the aptamer. Previous reports have shown that using a single small molecule binding aptamer in the 5'-UTR enables an 8-fold repression of translation upon ligand addition, while using three aptamers results in a 37-fold repression. Kotter et al., (2009). Nucleic Acids Res. 37(18):e120. In some embodiments, the copy number of the aptamer introduced into the circRNA or linear precursor RNA is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.

[0229] In some embodiments, the RNA aptamer contains multiple copies of the aptamer sequence. In some embodiments, the RNA aptamer contains the nucleotide sequence of SEQ ID NO: 65.

[0230] In some embodiments, the copies of the aptamer are in a tandem repeat configuration. The 4×S1m aptamer disclosed herein is an example of a multi-copy aptamer in a tandem repeat configuration.

[0231] IV. RNA Scaffold In some embodiments, the circular RNA and linear RNA precursor compositions disclosed herein include RNA aptamers embedded in an RNA scaffold. As used herein, the term "RNA scaffold" refers to a non-coding RNA molecule that can be assembled to have a defined structure that creates a spatial architecture for organizing, protecting, or enhancing the properties of a functional module of interest. Exemplary functional modules can be nucleic acids (e.g., aptamers) or proteins. In some embodiments, an RNA scaffold suitable for use according to the present disclosure can be associated with RNA without disrupting the RNA structure. Further, a suitable RNA scaffold enables the embedding of RNA aptamers without disrupting the RNA structure. In some embodiments, the RNA scaffold used according to the present disclosure can be any RNA scaffold that does not significantly adversely affect RNA expression or translation.

[0232] The defined structure of the RNA scaffold contains RNA-specific sequence motifs for self-assembly such as base pairing between hairpin stems (kissing loops) and / or chemical modifications. Myhrvold & Silver (2015) Nat Struct Mol Bio 22(1):8-10. The RNA-specific sequence motifs can form secondary (i.e., two-dimensional) and / or tertiary (i.e., three-dimensional) structures. In some embodiments, the RNA scaffold includes at least one secondary structure motif. In some embodiments, the RNA scaffold includes at least one tertiary structure motif. Common secondary and / or tertiary RNA structure motifs include open and stacked three-way junctions, four-way junctions, four-way junctions similar to Holliday structures, stem-loops (i.e., hairpin loops), internal loops (i.e., internal loops), bulges, tetraloops, multi-branched loops, pseudoknots and knots, 90° kinks, and pseudo-twist angles. Shanna et al. (2021) Molecules 26(5):1422.

[0233] RNA scaffolds can be derived from natural sources (e.g., attenuators, tRNA, riboswitches, terminators) or can be engineered artificially to form secondary or tertiary RNA structures. Delebecque et al. (2012) Nat Protoc 7(10):1797-1807. Typically, to maintain a given structure of an RNA scaffold, the RNA loop (e.g., hairpin loop) of the RNA scaffold is a target region for embedding a functional module of interest. See, e.g., U.S. Patent Application Publication No. 20050282190A1. However, the established structure of an RNA scaffold can be modified to have additional desired specifications. For example, a given RNA scaffold structure can be modified to be resistant to one or both of exonuclease digestion and endonuclease digestion.

[0234] In some embodiments, the circular RNA or linear precursor RNA compositions disclosed herein include an RNA aptamer embedded in a transfer RNA (tRNA). Transfer RNA (tRNA) scaffolds are attractive tagging candidates in affinity purification systems because tRNA is folded into a regular stable cloverleaf structure that is resistant to unfolding and can protect RNA fusions from nuclease degradation. Embedding an aptamer in the anticodon loop of a tRNA scaffold has been demonstrated to facilitate proper folding. See generally Ponchon and Dardel (2007) Nat.Methods 4(7):571-576; Ponchon et al. (2013) Nucleic Acids Res.41:e150. The use of an RNA aptamer embedded in a tRNA scaffold has been demonstrated to successfully pull down transcript-specific RNA-binding proteins from cell lysates. Iioka H et al. (2011) Nuc.Acids Res.39(8):e53.

[0235] In some embodiments, the circRNA or linear precursor RNA compositions disclosed herein include an RNA aptamer embedded in a tRNA comprising the nucleotide sequence of SEQ ID NO: 67.

[0236] In some embodiments, the RNA aptamer is embedded in the tRNA hairpin loop of tRNA. In some embodiments, the RNA aptamer is embedded in the tRNA anticodon loop. In some embodiments, the RNA aptamer is embedded in the tRNA D loop. In some embodiments, the RNA aptamer is embedded in the tRNA T loop.

[0237] Other exemplary RNA scaffolds include ribosomal RNA (rRNA) and ribozymes. In some embodiments, the RNA aptamer is embedded in the ribosomal RNA. In some embodiments, the RNA aptamer is embedded in the ribozyme. In some embodiments, the ribozyme is catalytically inactive.

[0238] V. Affinity purification of RNA In one aspect, disclosed herein is a method for purifying a circular RNA sample.

[0239] In some embodiments, the disclosed method for purifying circular RNA comprises: (a) contacting a sample comprising circular RNA disclosed herein with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the circular RNA from the chromatography resin; and (c) purifying the circular RNA from the sample.

[0240] In some embodiments, the disclosed method for purifying linear precursor RNA comprises: (a) contacting a sample comprising linear precursor RNA disclosed herein with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer comprises a binding affinity for the affinity ligand; (b) eluting the linear precursor RNA from the chromatography resin; and (c) purifying the linear precursor RNA from the sample.

[0241] In some embodiments, the disclosed method includes one or more washing steps between the contacting step (a) and the elution step (b).

[0242] In some embodiments, the disclosed method for purifying circular RNA includes: (a) contacting a sample containing circular RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the circular RNA from the chromatography resin; and (c) isolating the circular RNA from the sample, wherein the circular RNA includes a protein-coding region and at least one RNA aptamer, and the RNA aptamer includes a binding affinity for the affinity ligand.

[0243] In some embodiments, the disclosed method for purifying linear precursor RNA includes: (a) contacting a sample containing linear precursor RNA with an affinity ligand immobilized on a chromatography resin; (b) eluting the linear precursor RNA from the chromatography resin; and (c) isolating the linear precursor RNA from the sample, wherein the linear precursor RNA includes a protein-coding region and at least one RNA aptamer, and the RNA aptamer includes a binding affinity for the affinity ligand.

[0244] In some embodiments, the disclosed method yields circular RNA or linear precursor RNA with a purity of 90% or higher. In some embodiments, the disclosed method yields circular RNA and nicked circular RNA with a purity of 90% or higher.

[0245] Affinity chromatography is one purification method that can be used with the circRNA or linear precursor RNA compositions and methods disclosed herein. The RNA aptamers disclosed herein include binding affinities for selected affinity ligands. The selected affinity ligands are immobilized (e.g., cross-linked) on a chromatography resin. Thus, circRNA or linear precursor RNA containing the RNA aptamer binds to the resin containing the affinity ligand. The chromatography resin material is preferably present in a column, the sample containing the RNA is loaded at the top of the column, and the eluate is collected at the bottom of the column.

[0246] The chromatography resin can be any material known to be used as a stationary phase in a chromatography method. The types of molecules used as affinity ligands that interact with the RNA aptamers disclosed herein can be of various types. Non-exhaustive examples of affinity ligands are antibodies, proteins, oligonucleotides, dyes, boronic acid groups or chelating metal ions. The stationary phase can be composed of organic and / or inorganic materials.

[0247] The most widely used stationary phase materials are hydrophilic carbohydrates such as cross-linked agarose and synthetic copolymer materials. These materials can include derivatives of cellulose, polystyrene, synthetic polyamino acids, synthetic polyacrylamide gels or glass surfaces. Further examples of materials that can be used as chromatography resins are polystyrene divinylbenzene, silica gel, silica gel modified with non-polar residues or other materials suitable for gel chromatography or other chromatography methods, such as dextran, sephadex, agarose, dextran / agarose mixtures and other materials known in the art.

[0248] The chromatography resin can be functionalized with an affinity ligand to which the RNA aptamer has binding affinity. In some embodiments, the resin is an agarose medium or membrane functionalized with a phenyl group (e.g., Phenyl Sepharose™ from GE Healthcare or Phenyl Membran from Sartorius), Tosoh Hexyl, CaptoPhenyl, Phenyl Sepharose™ 6 Fast Flow with low or high substitution, Phenyl Sepharose™ High Performance, Octyl Sepharose™ High Performance (GE Healthcare); Fractogel™ EMD Propyl or Fractogel™ EMD Phenyl (E. Merck, Germany); Macro-Prep™ Methyl or Macro-Prep™ t-Butyl column (Bio-Rad, California); WP HI-Propyl (C3)™ (J.T. Baker, New Jersey) or Toyopearl™ Ether, Phenyl or Butyl (TosoHaas, PA). ToyoScreen PPG, ToyoScreen Phenyl, ToyoScreen Butyl and ToyoScreen Hexyl are based on hard methacrylic polymer beads. GE HiScreen Butyl FF and HiScreen Octyl FF are based on high flow agarose-based beads. Preferred are Toyopearl Ether-650M, Toyopearl Phenyl-650M, Toyopearl Butyl-650M, Toyopearl Hexyl-650C (TosoHaas, PA), POROS-OH (ThermoFisher) or methacrylic acid-based monolithic columns, e.g., CIM-OH, CIM-SO3, CIM-C4 A and CIM C4 HDL (BIA Separations) containing OH, sulfate or butyl ligand, respectively.

[0249] In some embodiments, the chromatography resin contains Protein A as an affinity ligand. Exemplary Protein A resins include Byzen Pro Protein A resin (MilliporeSigma; 18887), Dynabeads Protein A magnetic beads (ThermoFisher; 10001D), Pierce Protein A agarose (ThermoFisher; 20334), Pierce Protein A / G Plus agarose (ThermoFisher; 20423), Pierce Protein A Plus UltraLink (ThermoFisher; 53142), Pierce Recombinant Protein A agarose (ThermoFisher), POROS MabCapture A Select (ThermoFisher).

[0250] In some embodiments, the chromatography resin contains streptavidin as an affinity ligand. Exemplary streptavidin resins include streptavidin-agarose derived from Streptomyces avidinii (MilliporeSigma; S1638), Pierce streptavidin Plus UltaLink resin (ThermoFisher; 53117), Pierce High Capacity streptavidin agarose (ThermoFisher; 20357), streptavidin 6HC agarose resin (ABT; STV6HC-5), streptavidin resin - Amintra (Abcam; ab270530).

[0251] In some embodiments, the chromatography resin contains glutathione (GSH) as an affinity ligand. Exemplary GSH resins include glutathione resin (GenScript; L00206), Pierce glutathione agarose (ThermoFisher; 16102BID), glutathione Sepharose 4B GST-tagged protein resin (Cytiva; 17075605); glutathione affinity resin - Amintra (Abcam; ab270237).

[0252] VI. Vector In one aspect, disclosed herein is a vector comprising the linear precursor RNA disclosed herein. Nucleic acid sequences encoding a protein of interest (e.g., a protein coding region encoding a therapeutic polypeptide) can be cloned into a number of types of vectors. For example, the nucleic acid can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Specific vectors of interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors, and vectors optimized for in vitro transcription.

[0253] In one embodiment, the vector is used to express the linear precursor RNA in a host cell. In another embodiment, the vector is used as a template for IVT. The construction of optimally translated IVT RNA suitable for therapeutic use is disclosed in detail in Sahin, et al. (2014). Nat. Rev. Drug Discov. 13, 759-780; Weissman (2015). Expert Rev. Vaccines 14, 265-281.

[0254] In some embodiments, the vectors disclosed herein comprise, from 5' to 3', a) a 5' external homology arm, b) a 5' self-splicing PIE fragment, c) a 5' internal homology arm, d) a 5' spacer sequence, e) an internal ribosome entry site (IRES), f) a protein coding region, g) a 3' spacer sequence, h) a 3' internal homology arm, i) a 3' self-splicing PIE fragment, and j) a 3' external homology arm, and the RNA aptamer is present at one or both of the 5' end and the 3' end of any one of elements a)-j).

[0255] In some embodiments, the vectors disclosed herein also comprise a polynucleotide sequence 5'UTR, a polynucleotide sequence 3'UTR, a polynucleotide sequence encoding polyA, and / or a polyadenylation signal.

[0256] A variety of RNA polymerase promoters are known in the art. In one embodiment, the promoter is a T7 RNA polymerase promoter. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for the T7 promoter, T3 promoter, and SP6 promoter are known in the art.

[0257] Also disclosed herein are host cells (e.g., mammalian cells, e.g., human cells) containing the vectors or RNA compositions disclosed herein.

[0258] The polynucleotide can be introduced by any of a number of different methods, such as, but not limited to, electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg, Germany), cationic lipid-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, biolistic particle delivery systems, such as a "gene gun" (see, e.g., Nishikawa, et al. (2001). Hum Gene Ther. 12(8):861-70, or TransIT-RNA transfection kit (Mirus, Madison WI).

[0259] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. Exemplary colloidal systems for use as in vitro and in vivo delivery vehicles are liposomes (e.g., artificial membrane vesicles).

[0260] Regardless of the method used to introduce exogenous nucleic acids into host cells or otherwise expose the cells to the inhibitors of the present invention, various assays can be performed to confirm the presence of circRNA or linear precursor RNA sequences in the host cells. Such assays are well known to those skilled in the art.

[0261] VII. Pharmaceutical Compositions The RNA purified according to the present invention can be useful, for example, as a component in pharmaceutical compositions for use as vaccines. These compositions typically contain RNA and a pharmaceutically acceptable carrier. The pharmaceutical compositions of the present invention can also contain one or more additional components, such as small molecule immune activators (e.g., TLR agonists). The pharmaceutical compositions of the present invention can also contain a delivery system for the RNA, such as liposomes, oil-in-water emulsions, or microparticles. In some embodiments, the pharmaceutical composition contains lipid nanoparticles (LNPs). In one embodiment, the composition contains an antigen-encoding nucleic acid molecule encapsulated within the LNP. In some embodiments, the LNP contains at least one cationic lipid. In some embodiments, the LNP contains a cationic lipid, a polyethylene glycol (PEG) conjugate (PEGylated) lipid, a cholesterol-based lipid, and a helper lipid.

[0262] To better understand the present invention, the following examples are described. These examples are for illustrative purposes only and should in no way be construed as limiting the scope of the present invention.

Examples

[0263] The foregoing description of specific embodiments is to disclose the general nature of the present disclosure so that others can, within the scope of the technology in the art, apply their knowledge and, without departing from the general concepts of the present disclosure and without undue experimentation, easily modify and / or adapt such specific embodiments for various uses. Therefore, such adapted and modified forms are intended to be within the meaning and scope of equivalents of the disclosed embodiments based on the teachings and guidance presented herein. It should be understood that the expressions or terms herein are for the purpose of description rather than limitation, as they will be interpreted by those skilled in the art in light of the teachings and guidance.

[0264] Example 1: Design of Circular RNA with Aptamer Tags Previous studies have demonstrated that mRNA with aptamer tags can be useful for the purification of linear RNA species. See WO 2023031856A1 pamphlet, which is incorporated herein by reference in its entirety.

[0265] As described herein, the following examples disclose the design of circular RNA (circRNA) with aptamer tags or linear precursor RNA with aptamer tags used to generate circRNA.

[0266] The studies described below utilize the S1m aptamer or the tRNA-S1m aptamer, which can each bind to streptavidin. The DNA nucleotide sequences encoding the S1m aptamer and the tRNA-S1m aptamer are shown below.

[0267] [Table 1]

[0268] The S1m aptamer and tRNA-S1m aptamer sequences present in circular RNA and / or linear precursor RNA are shown below.

[0269]

Table 2

[0270] Figure 1 shows a schematic of the experiment of a linear precursor with an aptamer tag or a circRNA with an aptamer tag tested by streptavidin sepharose bead affinity purification. The left panel shows the orientation of the linear precursor RNA with an aptamer tag relative to the adjacent Anabaena PIE sequence. The Anabaena PIE sequence reacted under group I intron splicing conditions to result in the synthesis of a circRNA with an aptamer tag. The right panel shows that the presence of an intact aptamer in either the linear precursor RNA or the circRNA species enabled binding to the affinity matrix during purification.

[0271] A DNA plasmid was designed to obtain first the linear precursor RNA and then the circRNA.

[0272] Figure 2A shows a plasmid map encoding the 4×S1m aptamer, the linear precursor RNA, and the Anabaena PIE sequence used for RNA circularization. The plasmid elements are arranged in the following 5’ to 3’ order: T7 promoter, 5’ external homology arm, 3’ Anabaena intron / exon fragment, 5’ internal homology arm, 5’ polyAC spacer, CVB3 IRES, protein coding region, 3’ polyAC spacer, 4×S1m aptamer, 3’ internal homology arm, 5’ Anabaena intron / exon fragment, and 3’ external homology arm.

[0273] Figure 2B shows a plasmid map encoding the tRNA-S1m aptamer, linear precursor RNA, and Anabaena PIE sequence used for RNA circularization. Plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' polyAC spacer, CVB3 IRES, protein coding region, 3' polyAC spacer, 3' internal homology arm, 5' Anabaena intron / exon fragment, 3' external homology arm, and tRNA-S1m aptamer.

[0274] Figure 2C shows a control plasmid map encoding the linear precursor RNA and PIE sequence used for RNA circularization but not encoding the aptamer. Plasmid elements are arranged in the following 5' to 3' order: T7 promoter, 5' external homology arm, 3' Anabaena intron / exon fragment, 5' internal homology arm, 5' polyAC spacer, CVB3 IRES, protein coding region, 3' polyAC spacer, 3' internal homology arm, 5' Anabaena intron / exon fragment, and 3' internal homology arm.

[0275] Each construct described in Figures 2A - 2C was driven by the T7 promoter, and each plasmid contained a HindIII restriction site.

[0276] Subsequent examples test the generation and functionality of aptamer-tagged circRNA constructs in streptavidin sepharose bead affinity purification.

[0277] Example 2: Generation of Aptamer-Tagged circRNA from Aptamer-Tagged Linear Precursor RNA The linear precursor RNA was synthesized by obtaining a cDNA template for the IVT template through linearization of the plasmid described in Example 1 using the restriction enzyme HindIII. The linear template DNA was filled into the IVT reactions of the experimental groups, and the linear precursor RNAs with 4×S1m aptamer tags and tRNA×S1m aptamer tags as well as the control group were carried out according to the manufacturer's instructions using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs).

[0278] After the IVT reaction, the samples were treated with DNase I (NEB) for 15 minutes. After DNase treatment, 2 mM of GTP was added to the IVT products and incubated at 55 °C for 15 minutes (i.e., cyclization conditions) to generate circRNAs from the linear precursor RNAs. Subsequently, the RNA samples were purified using LiCl precipitation and resuspended in 100 μl of DEPC H2O.

[0279] After the cyclization conditions, three RNA species were expected to emerge from each sample: (1) circRNAs with aptamer tags, (2) linear precursor RNAs with residual aptamer tags that did not successfully undergo cyclization, and (3) circRNAs with nick-forming aptamer tags. As previously reported, circRNAs with nick-forming aptamer tags are likely mediated by magnesium-catalyzed self-hydrolysis, which is a defect that reduces the yield of circRNAs and requires further optimization and improvement. Wesselhoeft et al., (2018), Nat Commun., 9(1):2629; Wesselhoeft et al., (2019), Mol Cell., 74(3):508-520; Li and Breaker, (1999), J.Am.Chem.Soc 121(23):5364-5372.

[0280] Example 3: Streptavidin Sepharose Bead Affinity Purification and Quantification of circRNAs Samples subjected to cyclization conditions in Example 2 were tested with a Sepharose bead affinity purification strategy, followed by quantification of the yield of RNA recovery.

[0281] A method for preparing related samples and binding conditions is disclosed in the following steps: (1) Preparation of streptavidin Sepharose beads. To remove the bead storage solution, 20 μL of streptavidin Sepharose beads (per sample) were spun at 0.8×g for 1 minute at 4°C. The beads were then resuspended in 20 μL of binding buffer and incubated on ice for 15 minutes. (2) Preparation and incubation conditions of the circRNA-containing sample tagged with the RNA aptamer. 2.5 μg of each sample was resuspended in 10 μL of binding buffer. To allow the aptamer to adopt its predicted secondary structure, refolding was performed by heating at 56°C for 5 minutes, 37°C for 10 minutes, and incubating at room temperature for 5 minutes. 2 μL of the sample was taken before binding to the Sepharose beads and used as a control for the input concentration. 10 μL of the refolded aptamer (2.5 μg) was added to the Sepharose beads, incubated, and rotated at 4°C for 2 hours. The beads were washed twice with 100 μL of binding buffer. (3) Elution of the RNA aptamer from the beads. Elution was performed using 250 μL of a phenolic reagent in the following steps: 50 μL of cold chloroform was added to the sample and vortexed vigorously for 10 seconds. Subsequently, the sample was spun at 12,000×g at 4°C for 15 minutes. The upper aqueous phase containing RNA (approximately 125 μL) was transferred directly to a Monarch clean-up column and finally eluted from the Monarch column with 40 μL of DEPC H2O according to the manufacturer's instructions. (4) Quantification of the yield of RNA recovery. The RNA concentration after streptavidin affinity purification was quantified using a nanodrop. The elution fraction, unbound fraction, and wash fraction were run on a 2% EX agarose gel of an E-Gel Power Snap electrophoresis system to visualize the RNA species present in each fraction (circRNA tagged with the aptamer, linear precursor RNA tagged with the aptamer, and nicked-forming RNA). The putative circRNA migrates with a higher molecular weight than the heavier linear precursor RNA, as shown in Figure 3.

[0282] As shown in Figure 3, the 4×S1m and tRNA-S1m aptamer-tagged circRNAs were successfully subjected to streptavidin sepharose bead affinity purification against the aptamer-free control samples (see lanes 3-5 containing the elution samples) and the unbound fraction (compare lanes 6-11 with lanes 3-5). As predicted in Example 2, Figure 3 also shows that the cyclization conditions resulted in three different RNA species (labeled as "circular", "precursor", and "nick formation" on the agarose gel), indicating that the aptamer did not prevent the cyclization of the linear precursor RNA.

[0283] The RNA recovery in each sample after streptavidin sepharose bead affinity purification was also quantified. The results are shown in the bar graph of Figure 4, which also shows an additional linear precursor RNA control with an aptamer tag. The affinity-purified 4×S1m aptamer-tagged circRNA resulted in an RNA recovery rate of approximately 50%, and the tRNA×S1m-tagged circRNA resulted in an RNA recovery rate of approximately 60% compared to the input control sample. In contrast, the affinity-purified control resulted in an RNA recovery rate of less than about 5%. This result indicates that introducing an aptamer tag into circRNA (e.g., the 4×S1m or tRNA×S1m aptamer tag) may be used to improve the affinity purification efficiency of circRNA.

[0284] Example 4: Negative selection scheme for the recovery of circRNA In Examples 1-3, the aptamer-containing constructs were designed to be present in both the linear precursor RNA and the aptamer-tagged circRNA (see Figure 1). However, to optimally purify the aptamer-tagged circRNA, removal of the linear precursor RNA is necessary. Therefore, the linear precursor RNA was designed to create a negative selection strategy for affinity purification, as illustrated in Figure 6.

[0285] Under the negative selection method, as shown in Figure 6, the aptamer is located at a position that is removed upon cyclization in the linear precursor RNA (i.e., the circRNA will not have the aptamer). In this configuration, the linear precursor RNA binds to the affinity matrix, while the circRNA does not bind to the affinity matrix.

[0286] Several linear precursor RNAs were designed with the aptamer positioned in the 3' intron region. After IVT and cyclization, the cyclization reaction mixture was incubated with streptavidin sepharose beads as described above. All of the unbound fraction, wash fraction, and elution fraction were collected. Purification of linear precursor RNA with 4×S1m aptamer tag (pML49), linear precursor RNA with tRNA-S1m (tS1m) aptamer tag (pML50 and pML51), aptamer-free control (pML47), circRNA with 4×S1m aptamer tag (pML26), and circRNA with tRNA-S1m aptamer tag (pML38) was performed. The amount of recovered RNA measured is expressed as a percentage of the input (i.e., the input is the total RNA in the sample). As shown in Figure 7, the negative selection constructs (pML49, pML50, pML51) showed binding intermediate between the aptamer-free control (pML47) and the circRNAs with aptamer design (pML26&pML38), suggesting that a portion of the RNA in the unbound and wash fractions of the negative selection constructs was the desired circRNA.

[0287] These results were further analyzed by taking images of agarose gels of different samples. As shown in Figures 8A - 8D, circRNAs and nicked - forming RNA species were mainly found in the unbound and wash fractions, while linear precursor RNA was found in the elution fraction of the negative selection constructs. As shown in Figures 9A - 9C, capillary electrophoresis was also performed to determine the various RNA species.

[0288] The arrangement of aptamers in the linear precursor was tested. The tS1m aptamer was placed at the 3’ end of the linear precursor RNA (pML123), the 5’ end of the linear precursor RNA (pML128), and both the 5’ and 3’ ends of the linear precursor RNA (pML125). Each linear precursor RNA contained an ORF encoding human erythropoietin (EPO), a gene of more than 500 nucleotides. As shown in FIGS. 12A - 12B, the arrangement or number of tS1m aptamers on the linear precursor did not adversely affect the purification of circRNA. A summary of the purification for the pML125 construct is provided in Table 1 below. The introns in FIG. 12A arise from the homologous regions of the catalytic introns that co - purify when one of them contains an aptamer.

[0289]

Table 3

[0290] Example 5: Positive selection scheme for the recovery of circRNA In Examples 1 - 3, the aptamer - containing constructs were designed to be present in both the linear precursor RNA and the aptamer - tagged circRNA (see FIG. 1). However, to optimally purify the aptamer - tagged circRNA, removal of the linear precursor RNA is necessary. Therefore, the linear precursor RNA was designed to create a positive selection strategy for affinity purification, as illustrated in FIG. 5.

[0291] As shown in FIG. 5, under the positive selection method, the linear precursor RNA is constructed to contain a split aptamer such that the 3’ and 5’ halves of the aptamer are positioned at the 5’ and 3’ adjacent ends of the linear precursor RNA, respectively. The linear precursor RNA does not undergo affinity purification because an intact aptamer is required for binding to the affinity matrix. Upon circularization of the linear precursor RNA, an intact aptamer is formed, enabling binding to the affinity matrix.

[0292] A cDNA template is generated and an in vitro transcription (IVT) is used to produce a linear precursor RNA construct. The construct will vary the type of aptamer and its spatial configuration within the linear precursor RNA (see Figure 5 for an exemplary configuration). Table 2 shows a list of potential aptamer orientations of the tRNA-S1m and 4×S1m aptamers in the linear precursor RNA. Once the cyclization conditions are complete, the construct is purified using streptavidin sepharose beads and quantified as described in Example 3. Each construct is evaluated based on RNA recovery relative to an input control sample.

[0293] Example 6: Scale-up of circRNA purification The total input amount of the linear precursor was scaled up to determine whether the aptamer purification strategy could reliably purify circRNA. As a first step, the template pML50 was modified to replace the T7 RNA polymerase promoter with an SP6 promoter. An IVT reaction was performed to produce the linear precursor, and a cyclization reaction was performed with an initial 1 mg amount of RNA. As shown in Figure 10, streptavidin purification following cyclization on a 1 mg scale resulted in highly pure circRNA in the unbound and wash fractions. After purification on a 1 mg scale, an attempt was made to purify on a larger 12 mg scale. In this assay, three purification schemes were performed to increase purity. As shown in Figure 11A, even with a higher starting amount of RNA, circRNA was effectively purified after one, two, or three purifications. As shown in Figure 11B, multiple purifications yielded circRNA of higher purity.

[0294] Example 7: Purification of large circRNAs The above circRNA purification strategy was attempted with circRNAs encoding relatively small proteins (GFP and EPO). To test the effectiveness of the aptamer purification strategy for larger circRNAs, six different circRNAs were generated with ORF sizes of 1032, 1035, 1725, 1728, 2172, and 2175 nucleotides. The full sizes of the six circRNAs were 1952, 2645, and 3092 nucleotides. As shown in Figure 13, the six different constructs were purified through a negative selection purification scheme in which one or more aptamers were included in the linear precursor but were lost during the cyclization reaction. The data indicate that large circRNAs were efficiently purified.

[0295] Example 8: Activity of Aptamer-Containing circRNAs Next, the circRNAs were tested to ensure that expression of the encoded protein occurred. The pML50 circRNA encoding GFP was used, which was purified via a negative selection scheme where the linear precursor RNA contained the aptamer, but the circRNA did not contain the aptamer. The GFP-encoding circRNA was transfected into Hela cells at various μg of RNA / million cells. As shown in Figure 14, both purified and unpurified circRNAs showed GFP expression compared to the negative control, but the purified circRNA showed greater expression compared to the unpurified circRNA.

[0296] Other embodiments of the present disclosure will be apparent to those skilled in the art from consideration of the specification and practice of the disclosure disclosed herein. The specification and examples are intended to be considered only as exemplary, and the true scope and spirit of the present disclosure are indicated by the following claims.

[0297] All patents and publications cited herein are hereby incorporated by reference in their entirety.

[0298] Sequence

[0299]

Table 4

[0300]

Table 5

[0301]

Table 6

[0302]

Table 7

[0303]

Table 8

[0304]

Table 9

[0305]

Table 10

[0306]

Table 11

[0307]

Table 12

[0308]

Table 13

[0309]

Table 14

[0310]

Table 15

[0311]

Table 16

[0312]

Table 17

[0313]

Table 18

[0314]

Table 19

[0315]

Table 20

[0316]

Table 21

[0317]

Table 22

[0318]

Table 23

[0319]

Table 24

[0320]

Table 25

[0321]

Table 26

[0322]

Table 27

[0323]

Table 28

[0324]

Table 29

[0325]

Table 30

[0326]

Table 31

[0327]

Table 32

[0328]

Table 33

[0329]

Table 34

[0330]

Table 35

[0331]

Table 36

[0332]

Table 37

[0333]

Table 38

[0334]

Table 39

[0335]

Table 40

[0336]

Table 41

[0337]

Table 42

[0338]

Table 43

[0339]

Table 44

Claims

1. A circular RNA comprising a protein-coding region and at least one RNA aptamer.

2. The circular RNA according to claim 1, wherein the at least one RNA aptamer binds to an affinity ligand.

3. The affinity ligand includes protein A, protein G, streptavidin, glutathione, dextran, a fluorescent molecule, or 6×His; The affinity ligand includes streptavidin; and / or The affinity ligand is the circular RNA according to claim 2, which is immobilized on a chromatographic resin.

4. The RNA aptamer is S1m, Sm, or a derivative or fragment thereof; The circular RNA aptamer comprises one to four RNA aptamers; The aforementioned RNA aptamers are identical; At least one of the RNA aptamers is distinct; The aforementioned RNA aptamer is synthetically induced; The RNA aptamer is a split aptamer or an X-aptamer; The aforementioned RNA aptamer is of natural origin; The RNA aptamer is derived from hairpin RNA, tRNA, or a riboswitch; The RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66; The RNA aptamer is approximately 30 to 200 nucleotides long; The RNA aptamer is approximately 50 to 200 nucleotides long; The aforementioned RNA aptamer is not a histone stem loop; The RNA aptamer does not bind to eIF4G; The RNA scaffold comprises at least one secondary structure motif; The aforementioned secondary structural motif is a tetraloop, pseudoknot, or stemloop; The RNA scaffold comprises at least one tertiary structure; The aforementioned secondary structural motif and / or tertiary structure is nuclease-resistant; The RNA scaffold includes transfer RNA (tRNA); The RNA aptamer is embedded in the tRNA hairpin loop of the tRNA; The RNA aptamer is embedded in the tRNA anticodon loop of the tRNA; The RNA aptamer is embedded in the tRNA D-loop of the tRNA; The RNA aptamer embedded in the tRNA contains the nucleotide sequence of SEQ ID NO: 67; The internal ribosome entry site (IRES) is located at the 5' end of the protein coding region; The IRES is located at the 3' end of the protein coding region; The aforementioned IRES is derived from coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), discistrovirus, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or synthetic IRES; The IRES includes the polynucleotide sequence of SEQ ID NO: 75; and / or The cyclic RNA according to claim 1, wherein the protein coding region encodes at least one polypeptide or peptide, and optionally the polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide.

5. The RNA aptamer is a circular RNA according to claim 1, which is embedded in an RNA scaffold.

6. The circular RNA comprises at least one 5' internal homologous arm and at least one 3' internal homologous arm; The aforementioned 5' internal homologous arm is approximately 5 to 50 nucleotides long; The 5' internal homologous arm contains the nucleotide sequence of Sequence ID No. 70; The aforementioned 3' internal homologous arm is approximately 5 to 50 nucleotides long; The 3' internal homologous arm contains the nucleotide sequence of Sequence ID No. 71; The circular RNA comprises at least one 3' exon element; The 3' exon element comprises the nucleotide sequence of SEQ ID NO: 81; The circular RNA comprises at least one 5' exon element; The 5' exon element includes the nucleotide sequence of Sequence ID No. 83; The circular RNA includes at least one spacer sequence; The aforementioned spacer sequence is approximately 5 to 75 nucleotides long; The spacer sequence includes the nucleotide sequence of sequence number 78 or 79; The spacer array is positioned at one or both of the 5' and 3' ends of any one of the following elements: the protein coding region, the IRES, the 5' internal homology arm, the 3' internal homology arm, the 5' exon element, and the 3' exon element; The circular RNA comprises, from 5' to 3', the following elements: a) the 3' exon element, b) the 5' internal homologous arm, c) the spacer sequence, d) the IRES, e) the protein coding region, f) the spacer sequence, g) the 3' internal homologous arm, and h) the 5' exon element; and / or The circular RNA according to claim 1, wherein the circular RNA comprises the following elements from 5' to 3': a) the 3' exon element, b) the 5' internal homologous arm, c) the spacer sequence, d) the protein coding region, e) the IRES, f) the spacer sequence, g) the 3' internal homologous arm, and h) the 5' exon element, and optionally, at least one RNA aptamer is located at the 5' or 3' end of any one of elements a) to h).

7. The circular RNA comprises at least one 5' untranslated region (5'UTR), and at least one It contains a 3' untranslated region (3'UTR) and / or at least one polyadenylated (polyA) sequence; The 5'UTR, the 3'UTR, and / or the poly-A array are spacer arrays; The at least one RNA aptamer is positioned a) before the 3' exon element, b) between the 3' exon element and the 5' internal homologous arm, c) between the 5' internal homologous arm and the 5' spacer sequence, d) between the 5' spacer sequence and the IRES, e) between the protein coding region and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homologous arm, g) between the 3' internal homologous arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the IRES, and / or j) between the IRES and the 5' exon element; and / or The circular RNA according to claim 1, wherein the at least one RNA aptamer is positioned a) before the 3' exon element, b) between the 3' exon element and the 5' internal homologous arm, c) between the 5' internal homologous arm and the 5' spacer sequence, d) between the 5' spacer sequence and the protein coding region, e) between the IRES and the 3' spacer sequence, f) between the 3' spacer sequence and the 3' internal homologous arm, g) between the 3' internal homologous arm and the 5' exon element, h) after the 5' exon element, i) between the 3' exon and the protein coding region, and / or j) between the protein coding region and the 5' exon element.

8. The circular RNA comprises at least one chemical modification; The aforementioned chemical modifications are pseudouridine, N1-methylpseudridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deazapseudridine, 2-thio-l-methylpseudridine, 2-thio-5-azauridine, 2-thio-dihydropseudridine, 2-thio-dihydrouridine, 2-thiopseudridine, 4-methoxy-2-thiopseudridine, 4-methoxypseudridine, 4-thio-l-methylpseudridine, 4-thiopseudridine, 5-azauridine, dihydropseudridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, or N6-methyladenosine; The aforementioned chemical modifications are pseudouridine, N1-methylpseudridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine, or a combination thereof; and / or The cyclic RNA according to claim 1, wherein the chemical modification is N1-methylpseuduridine.

9. A linear precursor RNA comprising at least a self-splicing ribozyme and a protein-coding region, wherein the linear precursor RNA comprises at least one RNA aptamer. Optionally, The at least one RNA aptamer binds to an affinity ligand; The affinity ligand includes protein A, protein G, streptavidin, glutathione, dextran, a fluorescent molecule, or 6×His; The affinity ligand includes streptavidin; The affinity ligand is immobilized on a chromatographic resin; The RNA aptamer is S1m, Sm, or a derivative or fragment thereof; The circular RNA contains 1 to 4 RNA aptamers; The aforementioned RNA aptamers are identical; At least one of the RNA aptamers is distinct; The aforementioned RNA aptamer is synthetically induced; The RNA aptamer is a split aptamer or an X-aptamer; The aforementioned RNA aptamer is of natural origin; The RNA aptamer is derived from hairpin RNA, tRNA, or a riboswitch; The RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 65 or 66; The RNA aptamer is approximately 30 to 200 nucleotides long; The RNA aptamer is approximately 50 to 200 nucleotides long; The aforementioned RNA aptamer is not a histone stem loop; The RNA aptamer does not bind to eIF4G; The RNA aptamer is embedded in the RNA scaffold; The RNA scaffold comprises at least one secondary structure motif; The aforementioned secondary structural motif is a tetraloop, pseudoknot, or stemloop; The RNA scaffold comprises at least one tertiary structure; The aforementioned secondary structural motif and / or tertiary structure is nuclease-resistant; The RNA scaffold includes transfer RNA (tRNA); The RNA aptamer is embedded in the tRNA hairpin loop of the tRNA; The RNA aptamer is embedded in the tRNA anticodon loop of the tRNA; The RNA aptamer is embedded in the tRNA D-loop of the tRNA; and / or The RNA aptamer embedded in the tRNA is a linear precursor RNA containing the nucleotide sequence of SEQ ID NO:

67.

10. The self-splicing ribozyme comprises at least two catalytic subunits; The self-splicing ribozyme catalyst subunit is derived from either a group I intron or a group II intron RNA transcript or a fragment thereof; The self-splicing ribozyme catalytic subunit is derived from a circulating intron-exon (PIE) sequence from the cyanobacterium anabaena pre-tRNA-Leu gene, the T4 phage Td gene, or Tetrahymena pre-rRNA; and / or The catalytic activity of the two subunits yields a cyclic RNA, as described in claim 9, for the linear precursor RNA.

11. The linear precursor RNA comprises, from 5' to 3', the following elements: a) a 5' external homologous arm, b) a 3' self-splicing PIE fragment, c) a 5' internal homologous arm, d) a 5' spacer sequence, e) an internal ribosome entry site (IRES), f) a protein coding region, g) a 3' spacer sequence, h) a 3' internal homologous arm, i) a 5' self-splicing PIE fragment, and j) a 3' external homologous arm, wherein the RNA aptamer is present at one or both of the 5' or 3' ends of any one of elements a) to j); or The linear precursor RNA comprises, from 5' to 3', the following elements: a) a 5' external homologous arm, b) a 3' self-splicing PIE fragment, c) a 5' internal homologous arm, d) a 5' spacer sequence, e) a protein coding region, f) an IRES, g) a 3' spacer sequence, h) a 3' internal homologous arm, i) a 5' self-splicing PIE fragment, and j) a 3' external homologous arm, wherein the RNA aptamer is present at one or both of the 5' or 3' ends of any one of elements a) to j); Optionally, The 5' external homologous arm and the 3' external homologous arm are each independently about 5 to 50 nucleotides long; The 5' external homologous arm and the 3' external homologous arm include the nucleotide sequence of SEQ ID NO: 69 or SEQ ID NO: 72; The 5' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO: 74; The aforementioned 5' internal homologous arm is approximately 5 to 50 nucleotides long; The 5' internal homologous arm contains the nucleotide sequence of Sequence ID No. 70; The 5' spacer and the 3' spacer are each independently about 5 to 75 nucleotides in length; The 5' spacer and the 3' spacer include the nucleotide sequence of SEQ ID NO: 78 or SEQ ID NO: 79; The 3' self-splicing PIE fragment comprises the nucleotide sequence of SEQ ID NO: 73; The IRES is derived from coxsackievirus B3 (CVB3), encephalomyocarditis virus (EMCV), discistrovirus, hepatitis C virus (HCV), poliovirus (PV), enterovirus 71 (EV71), human rhinovirus (HRV), foot-and-mouth disease virus (FMDV), or synthetic IRES; and / or The linear precursor RNA according to claim 9, wherein the IRES comprises the nucleotide sequence of SEQ ID NO:

75.

12. It comprises at least one 5' untranslated region (5'UTR), at least one 3' untranslated region (3'UTR), and / or a polyadenylated (PolyA) sequence; The protein coding region encodes at least one polypeptide; The polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide; The RNA aptamer is a split aptamer containing a 5' portion and a 3' portion; The 5' portion of the split aptamer is positioned at the 3' of the 5' exon element, and the 3' portion of the split aptamer is positioned at the 5' of the 3' exon element; The 5' portion of the split aptamer is positioned at 3' of the 3' internal homologous arm, and the 3' portion of the split aptamer is positioned at 5' of the 5' internal homologous arm; and / or The linear precursor RNA according to claim 9, wherein the split aptamer is reformed into a functional aptamer when the linear precursor RNA is cyclized.

13. The at least one RNA aptamer is positioned a) before the 5' external homologous arm, b) between the 5' external homologous arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homologous arm, d) between the 5' internal homologous arm and the 5' spacer sequence, e) between the 5' space sequence and the IRES, f) after the protein coding region but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homologous arm, h) between the 3' internal homologous arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homologous arm, and / or j) after the 3' external homologous arm; or The linear precursor RNA according to claim 11, wherein the at least one RNA aptamer is positioned a) before the 5' external homologous arm, b) between the 5' external homologous arm and the 3' self-splicing PIE fragment, c) between the 3' self-splicing PIE fragment and the 5' internal homologous arm, d) between the 5' internal homologous arm and the 5' spacer sequence, e) between the 5' space sequence and the protein coding region, f) after the IRES but before the 3' spacer sequence, g) between the 3' spacer sequence and the 3' internal homologous arm, h) between the 3' internal homologous arm and the 5' self-splicing PIE fragment, i) between the 5' self-splicing PIE fragment and the 3' external homologous arm, and / or j) after the 3' external homologous arm.

14. The linear precursor RNA comprises at least one chemical modification; The aforementioned chemical modifications are pseudouridine, N1-methylpseudridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-l-methyl-1-deazapseudridine, 2-thio-l-methylpseudridine, 2-thio-5-azauridine, 2-thio-dihydropseudridine, 2-thio-dihydrouridine, 2-thiopseudridine, 4-methoxy-2-thiopseudridine, 4-methoxypseudridine, 4-thio-l-methylpseudridine, 4-thiopseudridine, 5-azauridine, dihydropseudridine, 5-methyluridine, 5-methyluridine, 5-methoxyuridine, 2'-O-methyluridine, or N6-methyladenosine; The aforementioned chemical modifications are pseudouridine, N1-methylpseudridine, 5-methylcytosine, 5-methoxyuridine, N6-methyladenosine, or a combination thereof; The aforementioned chemical modification is N1-methylpseudolidine; and / or The linear precursor RNA according to claim 11, wherein the linear precursor RNA is synthesized using in vitro transcription (IVT).

15. A circular RNA comprising a protein coding region and at least one RNA aptamer, formed from a linear precursor RNA according to any one of claims 1 to 8, or A circular RNA comprising a protein coding region, formed from a linear precursor RNA according to any one of claims 9 to 14, and lacking an RNA aptamer.

16. A nucleic acid encoding a linear precursor RNA according to any one of claims 9 to 14, or a vector comprising the nucleic acid according to any one of claims 9 to 14.

17. A circular RNA according to any one of claims 1 to 8 or a linear precursor RNA according to any one of claims 9 to 14, and / or Multiple circular RNA molecules, wherein at least about 90% of the circular RNA comprises a protein-coding region and at least one RNA aptamer. A pharmaceutical composition containing the following:

18. A method for producing circular RNA, comprising incubating a linear precursor RNA according to any one of claims 9 to 14 under conditions that result in the circularization of the linear precursor RNA, optionally, The linear precursor RNA is incubated with GTP and Mg2+; The linear precursor RNA is incubated with GTP and Mg2+ for a sufficient amount of time to circulate the linear precursor RNA; The aforementioned GTP is present at a concentration of approximately 1 mM to approximately 15 mM; The aforementioned GTP is present at a concentration of approximately 2 mM; The aforementioned Mg2+ is present at a concentration of approximately 1 mM to approximately 50 mM; and / or The method involves the presence of Mg2+ at a concentration of approximately 10 mM.

19. RNA molecules for use in the following methods, A method for producing multiple circular RNA molecules, comprising incubating multiple linear precursor RNA molecules under conditions that result in the cyclization of at least a portion of the linear precursor RNA molecules, wherein each linear precursor RNA molecule comprises a linear precursor RNA as described in any one of claims 9 to 14, and optionally, at least about 30% of the multiple linear precursor RNA molecules are cyclized; A method for purifying circular RNA, comprising the steps of (a) contacting a sample containing circular RNA according to any one of claims 1 to 8 with an affinity ligand immobilized on a chromatography resin, wherein the RNA aptamer has binding affinity to the affinity ligand. A method comprising: (a) a step of eluting the circular RNA from the chromatography resin; and (c) a step of purifying the circular RNA from the sample, wherein optionally one or more washing steps are included between the contact step (a) and the elution step (b), and the circular RNA or linear precursor RNA has a purity of 90% or higher; A method for purifying linear precursor RNA, comprising: (a) contacting a sample containing linear precursor RNA according to any one of claims 59 to 116 with an affinity ligand immobilized on a chromatographic resin, wherein the RNA aptamer has binding affinity to the affinity ligand; (b) eluting the linear precursor RNA from the chromatographic resin; and (c) purifying the linear precursor RNA from the sample, wherein the method optionally includes one or more washing steps between the contact step (a) and the elution step (b), and further optionally the cyclic RNA or linear precursor RNA has a purity of 90% or more; A method for purifying circular RNA, comprising the steps of (a) contacting a sample containing the circular RNA with an affinity ligand immobilized on a chromatographic resin; (b) eluting the circular RNA from the chromatographic resin; and (c) isolating the circular RNA from the sample, wherein the circular RNA comprises a protein coding region and at least one RNA aptamer, the RNA aptamer comprises a binding affinity for the affinity ligand, and optionally, the circular RNA or linear precursor RNA has a purity of 90% or more; A method for purifying linear precursor RNA, comprising the steps of (a) contacting a sample containing the linear precursor RNA with an affinity ligand immobilized on a chromatographic resin; (b) eluting the linear precursor RNA from the chromatographic resin; and (c) isolating the linear precursor RNA from the sample, wherein the linear precursor RNA comprises a protein coding region and at least one RNA aptamer, the RNA aptamer comprises a binding affinity for the affinity ligand, and optionally, the circular RNA or linear precursor RNA has a purity of 90% or more; A method for purifying circular RNA, comprising the steps of (a) contacting a sample containing a plurality of linear precursor RNA molecules and a plurality of circular RNA molecules with an affinity ligand immobilized on a chromatographic resin, and (b) isolating the circular RNA molecules from the sample, wherein the linear precursor RNA molecules contain a protein coding region and at least one RNA aptamer, the RNA aptamer contains binding affinity to the affinity ligand, the circular RNA molecules lack an RNA aptamer, optionally the circular RNA molecules do not bind to the affinity ligand, and optionally the circular RNA or linear precursor RNA has a purity of 90% or more. RNA molecules for use in [the relevant field].

20. A pharmaceutical composition according to claim 17 for use in a method of treating or preventing a disease or disorder, comprising administering the pharmaceutical composition according to claim 17 to a subject in need thereof.

Images