Treatment of ulcerative colitis in selected patients

Abstract

The present disclosure relates to a method of treating ulcerative colitis with intestinal alkaline phosphatase for therapeutic use, in particular.

Description

Technical Field

[0001] The present disclosure particularly relates to a method for treating ulcerative colitis with small intestinal alkaline phosphatase for therapeutic purposes.

[0002] Cross - reference to related applications This application claims priority based on U.S. Provisional Patent Application No. 63 / 345,141 filed on May 24, 2022, which is hereby incorporated by reference in its entirety.

[0003] Description of electronically submitted XML file This application includes a sequence listing submitted electronically in XML file format, which is hereby incorporated by reference in its entirety. The XML file was created on May 16, 2023, named "SYN - 059_Sequence_Listing.xml", and has a size of 28,596 bytes.

Background Art

[0004] Ulcerative colitis (UC) is an inflammatory disease that affects the inner lining of the colon and rectum. The main symptom of this disease is persistent diarrhea with blood and mucus. UC can be an intermittent disease with periods of symptom exacerbation (relapse) and periods with relatively few symptoms. The severity of symptoms varies and can generally appear gradually. Symptoms include abdominal pain, abdominal rumbling, fever, tenesmus, blood loss, and weight loss. The symptoms of this disease may resolve spontaneously in some cases, but usually treatment is required to induce remission.

[0005] UC affects over 2 million people in North America, 3.2 million in Europe, and millions more worldwide. Ananthakrishnan, A. N., Kaplan, G.G., & Ng, S.C. (2020) Changing global epidemiology of inflammatory bowel diseases: sustaining health care delivery into the 21st century. Clinical Gastroenterology and Hepatology, 18(6), 1252-1260. Although the cause of UC is unknown, both genetic and environmental factors are thought to be involved in the etiology of this disease.

[0006] Currently, there is no drug treatment that can cure UC. The goal of treatment is to suppress disease relapse, induce and maintain remission, which can be effective for some patients, but may not be effective for certain patients.

[0007] Therefore, there is still a need for alternative treatments for ulcerative colitis. In particular, alternative treatments for moderate to severe ulcerative colitis are needed as an alternative for subjects who do not respond to one or more of the existing ulcerative colitis treatments.

Summary of the Invention

Means for Solving the Problems

[0008] Accordingly, in one aspect, the present disclosure provides a method for treating ulcerative colitis (UC) in a subject in need thereof. In certain embodiments, the method of the present disclosure comprises administering to the subject a therapeutically effective amount of intestinal alkaline phosphatase (IAP), wherein the subject is resistant to one or more UC treatments and the subject is characterized by lower expression and / or activity of IAP compared to a subject not suffering from UC or a subject suffering from non-resistant UC.

[0009] In certain embodiments, the subject has low expression and / or activity of IAP in the mucosa of the subject. In certain embodiments, the subject has low expression and / or activity of IAP in the intestinal mucosa of the subject. In certain embodiments, the subject has low expression and / or activity of IAP in the colonic mucosa of the subject. In certain embodiments, the subject is characterized by having low expression and / or activity of IAP by assaying a biological sample from the subject.

[0010] In certain embodiments, the methods of the present disclosure are effective in avoiding the need for colectomy with ileal pouch - anal anastomosis.

[0011] In certain embodiments, the IAP is bovine IAP (bIAP). In certain embodiments, the bIAP is selected from bIAP I, bIAP II, and bIAP IV. In certain embodiments, the bIAP is bIAP II.

[0012] In certain embodiments, the IAP is administered orally.

[0013] In certain embodiments, the subject further has a hypersensitivity to bacterial toxins.

[0014] In certain embodiments, the subject further has a metabolic disease or disorder. In certain embodiments, the metabolic disease or disorder is type I or type II diabetes. In certain embodiments, the metabolic disease or disorder is cardiovascular disease (CVD) or coronary artery disease (CAD). In certain embodiments, the metabolic disease or disorder is atherosclerotic CVD. In certain embodiments, the metabolic disease or disorder is obesity or overweight. In certain embodiments, the metabolic disease or disorder is hypertriglyceridemia. In certain embodiments, the metabolic disease or disorder is hypercholesterolemia. In certain embodiments, the metabolic disease or disorder is fatty liver, fatty liver disease, non - alcoholic fatty liver disease (NAFLD), non - alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma (HCC), or liver failure.

[0015] In certain embodiments, low IAP expression and / or activity exacerbates UC or a metabolic disease or disorder and / or promotes its progression.

[0016] Details of the invention are set forth in the following description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, exemplary methods and materials are described below. Other features, objects, and advantages of the invention will be apparent from the following description and the claims. In this specification and the appended claims, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

Brief Description of the Drawings

[0017]

Figure 1-1

Figure 1-2

Figure 1-3

Figure 1-4

Figure 1-5

Figure 1-6

Figure 1-7

Figure 2

Figure 3

DETAILED DESCRIPTION OF THE INVENTION

[0018] The present disclosure is based, in particular, on the discovery that alkaline phosphatases, such as intestinal alkaline phosphatase (IAP), are useful in the treatment of ulcerative colitis (UC). Such use of an alkaline phosphatase (e.g., IAP) enables a more effective UC treatment when the subject is resistant to one or more UC treatments and when the subject has a lower expression and / or activity of IAP compared to a subject not suffering from UC or compared to a subject suffering from non-resistant UC. In certain embodiments, the use of an alkaline phosphatase improves the effectiveness of existing UC treatments.

[0019] Ulcerative colitis Ulcerative colitis is a chronic inflammatory bowel disease (IBD) caused by an abnormal immune response that leads to inflammation and ulcers in the inner lining of the large intestine. Ulcerative colitis can occur at any age, but it is more likely to develop in people between the ages of 15 and 30. Studies suggest that approximately 600,000 to 900,000 people in the United States have ulcerative colitis. See Kappelman MD, Moore KR, Allen JK, Cook SF. Recent trends in the prevalence of Crohn's disease and ulcerative colitis in a commercially insured US population. Digestive Diseases and Sciences. 2013;58(2):519-525. In some patients with ulcerative colitis, inflammation can also occur in other parts of the body, such as the joints, skin, eyes, liver, and bile ducts. Patients with ulcerative colitis also have a higher risk of blood clots in the blood vessels. Ulcerative colitis increases the risk of developing colorectal cancer. The risk of developing colorectal cancer is higher if ulcerative colitis affects a large area of the colon, is more severe, develops at a young age, or has been present for a long time. The risk is also higher if the patient has primary sclerosing cholangitis or a family history of colorectal cancer. See Rubin DT, Ananthakrishnan AN, Siegel CA, Sauer BG, Long MD. ACG clinical guideline: ulcerative colitis in adults. American Journal of Gastroenterology. 2019;114(3):384-413.

[0020] Ulcerative colitis can, over time, cause complications such as anemia, bone problems, growth and development problems in children, and colorectal cancer. In some cases, ulcerative colitis can cause severe complications that progress rapidly and threaten life. These complications require treatment in a hospital or emergency surgery. Severe complications include fulminant ulcerative colitis, perforation, severe rectal bleeding, and toxic megacolon. Severe ulcerative colitis or severe complications can cause further problems such as severe anemia and dehydration. These problems may require hospital treatment with blood transfusions or intravenous (IV) fluids and electrolyte solutions.

[0021] The symptoms of ulcerative colitis vary from person to person and may include diarrhea, blood in the stool, and abdominal pain. Due to the symptoms of ulcerative colitis, some people may experience a decrease in appetite, a reduction in food intake, and may not be able to obtain sufficient nutrition. In certain embodiments, the method reduces or eliminates one or more of these symptoms.

[0022] To diagnose ulcerative colitis, a physician confirms the symptoms as well as the medical history and family history and performs a physical examination and tests. Medical tests can include, but are not limited to, blood tests, stool tests, and endoscopic examinations of the large intestine, and may include the tests described herein (e.g., Example 1).

[0023] Physicians typically use medications to reduce inflammation in the large intestine and assist in inducing and maintaining remission to treat ulcerative colitis. In certain embodiments, remission of UC occurs when drug therapy for UC suppresses or eliminates inflammation in the colon, thereby improving symptoms. In certain embodiments, the remission period varies from a few weeks or months to several years. If the drug therapy is effective and relapse is not induced by other factors, the disease can remain in remission for a long time. A physician may recommend surgery to treat ulcerative colitis or its complications.

[0024] Alkaline phosphatase ("AP", EC 3.1.3.1) is a hydrolase enzyme that can remove phosphate groups from various targets including nucleotides and proteins. In particular, mammalian AP exerts its properties mainly by targeting lipopolysaccharide (LPS, a TLR4 agonist), flagellin (a TLR5 agonist), and CpG DNA (a TLR9 agonist). AP also degrades NTPs (such as ATP, GTP, etc.) in the intestinal lumen, thereby promoting the growth of beneficial bacteria and restoring dysbiosis. Therefore, AP may find clinical applications, for example, in the treatment of various GI disorders.

[0025] Intestinal alkaline phosphatase (IAP) is an endogenous protein expressed by intestinal epithelium and can be used to reduce inflammation and maintain intestinal homeostasis. For example, loss of IAP expression or function is associated with dysbiosis, bacterial translocation, and systemic inflammation. In particular, its major functions in maintaining intestinal homeostasis are generally recognized to be bicarbonate secretion and regulation of duodenal surface pH, absorption of long-chain fatty acids, reduction of intestinal inflammation by detoxification of pathogen-associated molecular patterns, and regulation of the intestinal microbiota. Some substrates on which the phosphatase function of IAP acts include lipopolysaccharide (LPS), flagellin, CpG DNA, as well as nucleotide diphosphates and nucleotide triphosphates. Specifically, IAP is a target for therapeutic agents because it has the ability to suppress inflammation, regulate the intestinal microbiota, strengthen the intestinal barrier by enhancing the expression of claudin and occludin, and affect the metabolism of adenosine triphosphate and adenosine diphosphate (ATP and ADP). The present disclosure contemplates compositions containing IAP that do not interfere with the treatment of UC in patients. Indeed, according to the present disclosure, the therapeutic scope of UC treatment is expanded by the methods described herein.

[0026] In one aspect, the present disclosure provides a method for treating ulcerative colitis (UC) in a subject in need thereof. In certain embodiments, the method of the present disclosure comprises administering to the subject a therapeutically effective amount of intestinal alkaline phosphatase (IAP), wherein the subject is resistant to one or more UC treatments and wherein the subject is characterized by having lower expression and / or activity of IAP compared to a subject not suffering from UC or compared to a subject suffering from non-resistant UC.

[0027] In certain embodiments, the subject has lower expression and / or activity of IAP in the mucosa of the subject. In certain embodiments, the subject has lower expression and / or activity of IAP in the intestinal mucosa of the subject.

[0028] In certain embodiments, the subject has lower expression and / or activity of IAP in the colonic mucosa of the subject. In certain embodiments, the subject is characterized by having lower expression and / or activity of IAP by assaying a biological sample from the subject.

[0029] In certain embodiments, the biological sample is selected from feces, mucus, tissue, blood, plasma, serum, pus, urine, sweat, tears, sputum, saliva, and / or other body fluids. In certain embodiments, the biological sample is a biopsy specimen, optionally a biopsy specimen from the colon. In certain embodiments, the biological sample is feces.

[0030] In certain embodiments, a biological sample is assayed for low expression and / or low activity of IAP using an immunoassay. In certain embodiments, the immunoassay is selected from an electrochemiluminescence (ECL) immunoassay, dissociation-enhanced lanthanide fluorescence immunoassay (DELFIA®), enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), sandwich assay, Western blot assay, and immunoprecipitation assay (IPA). In certain embodiments, the biological sample is assayed for low expression and / or low activity of IAP using an electrochemiluminescence (ECL) immunoassay (including, but not limited to, the ECL immunoassay described in Example 1 herein). In certain embodiments, the immunoassay is an ECL immunoassay comprising an anti-HIAP monoclonal capture antibody (optionally AbD54140ad (BioRad)). In certain embodiments, the ECL immunoassay comprises a monoclonal anti-HIAP detection antibody (optionally AbD54130ad (BioRad)). In certain embodiments, the ECL immunoassay comprises a polyclonal anti-bovine IAP detection antibody.

[0031] In certain embodiments, the low expression of IAP is lower than the IAP expression in an untreated patient or a patient without a disease. In certain embodiments, the low expression of IAP is less than about 30 U / L, or less than about 25 U / L, less than about 20 U / L, less than about 10 U / L, less than about 5 U / L, less than about 1 U / L.

[0032] In certain embodiments, the low expression of IAP is less than about 30 U / L, or less than about 25 U / L, less than about 20 U / L, less than about 10 U / L, less than about 5 U / L, less than about 1 U / L in the blood of a patient.

[0033] In certain embodiments, the low expression of IAP is less than about 30 U / L, or less than about 25 U / L, less than about 20 U / L, less than about 10 U / L, less than about 5 U / L, less than about 1 U / L in the stool of a patient.

[0034] In certain embodiments, UC is an acute disease. In certain embodiments, UC is a chronic disease. In certain embodiments, UC is a moderate disease. In certain embodiments, UC is a severe disease. In certain embodiments, UC is a mild to moderate disease. In certain embodiments, UC is a moderate to severe disease. In certain embodiments, UC is a severe and fulminant disease. Fulminant colitis is a rare but severe form of ulcerative colitis. Less than 10% of people with UC develop fulminant colitis, usually at the time of the first symptomatic attack. The risk of fulminant colitis is higher in patients taking corticosteroids or other medications that suppress the immune system. In fulminant colitis, the entire inner lining of the colon becomes inflamed, causing severe symptoms such as bloody diarrhea and abdominal pain. Fulminant colitis is a medical emergency.

[0035] In certain embodiments, the methods of the present disclosure can be used to treat ulcerative colitis affecting any part of the colon. For example, ulcerative colitis may be left-sided colitis or extensive colitis affecting almost the entire or most of the colon. In certain embodiments, the methods of the present disclosure are methods for treating ulcerative proctosigmoiditis. In certain embodiments, the methods of the present disclosure are methods for treating left-sided colitis. In certain embodiments, the methods of the present disclosure are methods for treating extensive colitis (pancolitis). Pancolitis is inflammation of the entire colon, which is the most common cause of ulcerative colitis. In certain embodiments, the methods of the present disclosure are methods for treating ulcerative colitis limited to the rectum (ulcerative proctitis). Ulcerative proctitis is characterized by inflammation, redness, and ulceration of the inner lining of the rectum. In certain embodiments, the methods of the present disclosure are not aimed at treating ulcerative proctitis. As described herein, the treatment can be for mild, moderate, or severe ulcerative colitis. For example, the methods of the present disclosure can be methods for treating acute, moderate, or severe extensive colitis affecting any part of the colon.

[0036] In an embodiment, the UC treatment is an anti-inflammatory agent. In certain embodiments, the subject is insufficiently responsive, non-responsive, or has failed treatment with an anti-inflammatory agent. In certain embodiments, the anti-inflammatory agent is a 5-aminosalicylate or a corticosteroid. In certain embodiments, the 5-aminosalicylate is selected from sulfasalazine (e.g., AZULFIDINE), mesalamine (e.g., ASACOL HD, DELZICOL), balsalazide (e.g., COLAZAL), and olsalazine (e.g., DIPENTUM). In certain embodiments, the aminosalicylate is a compound containing 5-aminosalicylic acid (5-ASA) that reduces inflammation in the intestinal mucosa. Aminosalicylates can be used in Crohn's disease or ulcerative colitis, and are often more effective in ulcerative colitis. Aminosalicylates have been shown to induce and maintain remission alone in mild to moderate ulcerative colitis. In certain embodiments, the corticosteroid is selected from dexamethasone (e.g., OZURDEX, MAXIDEX), hydrocortisone (e.g., HYDROCORT, ALPHOSYL, AQUACORT, CORTEF), methylprednisolone (e.g., MEDROL), and prednisone (e.g., DELTASONE, RAYOS). Corticosteroids reduce the activity of the immune system and limit inflammation in the gastrointestinal tract. Corticosteroids are used as short-term treatment for ulcerative colitis flares because they rapidly reduce inflammation, sometimes within days to months.

[0037] In certain embodiments, the UC treatment is an immunosuppressant. In certain embodiments, the subject is insufficiently responsive, non-responsive, or has failed treatment with an immunosuppressant. In certain embodiments, the immunosuppressant is selected from azathioprine (e.g., AZASAN, IMURAN), mercaptopurine (e.g., PURINETHOL, PURIXAN), cyclosporine (e.g., GENGRAF, NEORAL, SANDIMMUNE), and tofacitinib (XELJANZ).

[0038] In certain embodiments, the UC treatment is a biologic. In certain embodiments, the subject is insufficiently responsive, non-responsive, or has failed treatment with a biologic. In certain embodiments, the biologic is an antibody. In certain embodiments, the biologic is a monoclonal antibody. In certain embodiments, the biologic is a tumor necrosis factor (TNF) inhibitor. In certain embodiments, the TNF inhibitor is a monoclonal antibody against TNF-alpha (e.g., anti-TNFα).

[0039] In certain embodiments, the anti-TNFα is selected from infliximab (REMICADE), adalimumab (HUMIRA), and golimumab (SIMPONI). Generally, clinicians initiate anti-TNF agents to manage acute severe ulcerative colitis when other treatments are unable to induce remission. However, studies have shown that biologic anti-TNF therapy has limited effectiveness in the treatment of ulcerative colitis. Many patients with severe ulcerative colitis do not achieve remission, and some of those who do eventually develop resistance to antibody treatment. Furthermore, the use of such biologics can be associated with undesirable side effects such as an increased incidence of tuberculosis and other infections. Long-term use of antibody therapy can also be associated with undesirable immunological side effects. Thus, in certain embodiments, the method enables an alternative to antibody treatment, or a reduction in dosage, and / or a reduction in side effects.

[0040] In certain embodiments, the biologic is an integrin α4β regulator. In certain embodiments, the integrin α4β regulator is vedolizumab (ENTYVIO). Vedolizumab is a monoclonal antibody pharmaceutical for treating ulcerative colitis. It functions by blocking integrins in the body to provide intestine-selective anti-inflammatory activity. Vedolizumab is approved for use in adults with moderately to severely active ulcerative colitis or Crohn's disease who are insufficiently responsive to tumor necrosis factor (TNF) inhibitors or corticosteroids, or are steroid-dependent.

[0041] In an embodiment, the biological agent is a modulator of interleukin-12 (IL-12) or interleukin-23 (IL-23). Blockade of IL-12 and IL-23 has been successful in psoriasis. In certain embodiments, the modulator of interleukin-12 (IL-12) or interleukin-23 (IL-23) is ustekinumab (STELARA). Ustekinumab has been shown to be effective in inducing and maintaining remission in patients with moderate to severe ulcerative colitis. See Sands, et al. (2019) Ustekinumab as induction and maintenance therapy for ulcerative colitis. New England Journal of Medicine, 381(13), 1201-1214.

[0042] In certain embodiments, the methods of the present disclosure are effective to avoid the need for colectomy with ileal pouch - anal anastomosis. In certain embodiments, the methods of the present disclosure are effective to avoid surgical treatment. In certain embodiments, surgical treatment of ulcerative colitis includes colectomy. In certain embodiments, colectomy involves partial or complete removal of the large intestine.

[0043] In certain embodiments, the subject further has a hypersensitivity to bacterial toxins.

[0044] In certain embodiments, the subject further has a metabolic disease or disorder. In certain embodiments, the metabolic disease or disorder is type I or type II diabetes. In certain embodiments, the metabolic disease or disorder is cardiovascular disease (CVD) or coronary artery disease (CAD). In certain embodiments, the metabolic disease or disorder is atherosclerotic CVD. In certain embodiments, the metabolic disease or disorder is obesity or overweight. In certain embodiments, the metabolic disease or disorder is hypertriglyceridemia. In certain embodiments, the metabolic disease or disorder is hypercholesterolemia. In certain embodiments, the metabolic disease or disorder is fatty liver, fatty liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma (HCC), or liver failure.

[0045] In certain embodiments, low expression and / or activity of IAP exacerbates UC or a metabolic disease or disorder and / or promotes its progression.

[0046] Alkaline phosphatase (AP) The present disclosure relates, in part, to pharmaceutical compositions, formulations, and uses of one or more alkaline phosphatases. Alkaline phosphatase is a dimeric metalloenzyme that catalyzes the hydrolysis of phosphate esters at physiological pH and higher pH and dephosphorylates various target substrates. Exemplary APs that can be utilized in the present disclosure include, but are not limited to, intestinal alkaline phosphatase (IAP, e.g., calf IAP or bovine IAP, chicken IAP, goat IAP), placental alkaline phosphatase (PLAP), placental-like alkaline phosphatase, germ cell alkaline phosphatase (GCAP), tissue non-specific alkaline phosphatase (TNAP, which is mainly found in the liver, kidney, and bone), bone alkaline phosphatase, liver alkaline phosphatase, kidney alkaline phosphatase, bacterial alkaline phosphatase, fungal alkaline phosphatase, shrimp-derived alkaline phosphatase, modified IAP, recombinant IAP, or any polypeptide containing alkaline phosphatase activity.

[0047] In certain embodiments, the present disclosure contemplates the use of mammalian alkaline phosphatases, including but not limited to intestinal alkaline phosphatase (IAP), placental alkaline phosphatase (PLAP), germ cell alkaline phosphatase (GCAP), and tissue non-specific alkaline phosphatase (TNAP).

[0048] Intestinal alkaline phosphatase (IAP) In certain embodiments, the alkaline phosphatase is IAP. IAP is produced in the proximal small intestine and is bound to enterocytes by a glycosylphosphatidylinositol (GPI) anchor. Some IAP is released into the intestinal lumen as a soluble protein detached from the cell by phospholipase together with vesicles released from the cell. The enzyme passes through the small and large intestines, and as a result, some active enzyme can be detected in the feces. In certain embodiments, the IAP is human IAP (hIAP). In certain embodiments, the IAP is calf IAP (cIAP), which is also referred to as bovine IAP (bIAP).

[0049] In certain embodiments, the IAP is bovine IAP (bIAP). There are multiple isozymes of bIAP. For example, bIAP II and bIAP IV have a higher specific activity than bIAP I. In certain embodiments, the IAP is any one of the isozymes of cIAP or bIAP (e.g., bIAP I, II, and IV). In certain embodiments, the IAP is bIAP II. In certain embodiments, the IAP is bIAP IV.

[0050] In certain embodiments, the IAP of the present disclosure has a higher specific enzyme activity than commercially available AP, such as calf IAP (cIAP).

[0051] IAP variant The definition of IAP also encompasses IAP variants. An IAP variant has at least one or more amino acid modifications, generally amino acid substitutions, compared to the parental wild-type sequence. In certain embodiments, the IAPs of the present disclosure include amino acid sequences having at least about 60% (e.g., about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%) sequence identity with any of the sequences disclosed herein. Additionally, the IAP variants retain most or all of their biochemical activities as measured as described herein.

[0052] In certain embodiments, the IAPs of the present disclosure include amino acid sequences having at least about 60% (e.g., about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%) sequence identity with any one of SEQ ID NOs: 1-14.

[0053] In certain embodiments, the IAP of the present disclosure comprises an amino acid sequence having at least about 60% (e.g., about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%) sequence identity to any one of SEQ ID NO: 5, 6, or 10-14.

[0054] In certain embodiments, the IAP of the present disclosure comprises an amino acid sequence having at least about 60% (e.g., about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%) sequence identity to SEQ ID NO: 11. In certain embodiments, the IAP of the present disclosure comprises, consists of, and / or consists essentially of SEQ ID NO: 11.

[0055] GPI-anchored protein Mammalian alkaline phosphatases are GPI-anchored proteins. They have a signal peptide and are translated into the secretory pathway. Upon entry into the endoplasmic reticulum (ER), these proteins are glycosylated and folded. There are two disulfide bonds and a single free cysteine that does not appear to be accessible on the surface. In the late ER, the carboxy terminus is removed and a GPI anchor is added. Thus, GPI anchor addition is a process that occurs at the carboxy terminus of alkaline phosphatase. By including a stop codon at the anchor site, secretion of the biologically active protein (presumably a homodimer) is enabled. There is no consensus sequence, but the carboxy terminus contains three amino acids called omega, omega+1, and omega+2, followed by a short sequence of hydrophilic amino acids and then a sequence of hydrophobic amino acids. Although not wishing to be bound by theory, hydrophobicity is thought to be important for embedding the carboxy terminus in the ER membrane. There, the carboxy terminus is replaced by a GPI anchor through an enzymatic reaction.

[0056] In another aspect, the IAPs of the present disclosure are secretory proteins. That is, in certain embodiments, the IAPs are not GPI-anchored and are thus secreted rather than retained within the cell. This can be achieved in several ways. In certain embodiments, the IAP may lack the GPI anchor site, for example, the DAAH site has been removed, resulting in secretion. Alternatively, this can be achieved in embodiments where the IAP contains a stop codon inserted immediately prior to the GPI anchor site. In certain embodiments, the IAP contains a stop codon after the aspartic acid of the DAAH consensus site (e.g., amino acid 503 of hIAP and bIAP IV or amino acid 506 of bIAP II). Figure 1 shows HIAP (SEQ ID NO: 3) having a stop codon and bIAP II (SEQ ID NO: 4) having a stop codon.

[0057] Human IAP In certain embodiments, the IAP is a human IAP (hIAP). In certain embodiments, the IAP is an hIAP that comprises the amino acid sequence of SEQ ID NO:1 shown in FIG. 1, or is a variant as described herein, provided that it retains at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the phosphatase activity as compared to the wild-type enzyme, using the assays described herein and / or assays known in the art.

[0058] The definition of hIAP includes amino acid modifications, and amino acid substitutions are particularly useful in the present disclosure. For example, without wishing to be bound by theory, the cysteine at the carboxy terminus of IAP (e.g., position 500 of SEQ ID NO:1) is thought to interfere with protein folding. Thus, in certain embodiments, the IAP comprises a mutation of cysteine (e.g., at position 500 of SEQ ID NO:1). In certain embodiments, the cysteine is substituted with any amino acid, and in certain embodiments, glycine is particularly useful. Additionally, the C-terminal cysteine can be deleted.

[0059] In certain embodiments, the hIAP is a recombinant glycosylated hIAP. In certain embodiments, the hIAP is glycosylated and has one or more terminal sialic acids. In certain embodiments, the recombinant hIAP is glycosylated on one or more residues located at the N-terminus, C-terminus, and / or within the primary amino acid sequence. In certain embodiments, the recombinant hIAP is terminally sialylated, in which case, for example, sialylation occurs at the terminus of one or more glycosylation structures.

[0060] As will be understood by those skilled in the art, additional amino acid modifications can be made to hIAP as discussed herein. For example, in certain embodiments, a stop codon may be inserted after the aspartic acid of the DAAH consensus site (e.g., amino acid 503 of hIAP). FIG. 1 shows hIAP (SEQ ID NO:3) with a stop codon inserted.

[0061] Fusion protein In certain embodiments, the present disclosure provides a chimeric protein. In certain embodiments, the present disclosure provides a chimeric fusion protein. For example, in certain embodiments, the present disclosure provides an isolated or recombinant alkaline phosphatase comprising a crown domain and a catalytic domain, wherein these crown and catalytic domains are obtained from different alkaline phosphatases (e.g., human-derived and bovine-derived alkaline phosphatases). In another aspect, both alkaline phosphatases are human-derived APs. In certain embodiments, the present disclosure provides a recombinant fusion protein comprising domains of human IAP and human placental alkaline phosphatase. In certain embodiments, the present disclosure provides a chimeric hIAP-placenta fusion protein. In certain embodiments, the IAP is a human-derived recombinant fusion protein such as a human placental AP / intestinal AP fusion protein (e.g., irofotase alfa).

[0062] In certain embodiments, the IAP of the present disclosure is a fusion protein. In certain embodiments, the IAP comprises an alkaline phosphatase fused to a protein domain that replaces the GPI anchor sequence. In certain embodiments, the alkaline phosphatase is fused to a protein domain that promotes protein folding and / or purification and / or dimerization and / or stability. In certain embodiments, the IAP fusion protein has an extended serum half-life.

[0063] In certain embodiments, the alkaline phosphatase is fused to the Fc domain and / or hinge region of an immunoglobulin. In certain embodiments, the Fc domain and / or hinge region of the immunoglobulin is derived from the Fc domain and / or hinge region of an antibody (e.g., IgG, IgA, IgD, and IgE, and subclasses (e.g., IgG1, IgG2, IgG3, and IgG4, and IgA1 and IgA2)). In certain embodiments, the IAP of the present disclosure comprises an alkaline phosphatase fused to the hinge region and / or Fc domain of IgG.

[0064] In certain embodiments, the IAP of the present disclosure is a proenzyme. In certain embodiments, the activity of the proenzyme is suppressed by the carboxy terminus. In certain embodiments, removal of the carboxy terminus by a protease reactivates the enzymatic activity of alkaline phosphatase. In certain embodiments, the proenzyme is secreted more efficiently than the enzyme lacking the carboxy terminus.

[0065] In certain embodiments, to generate the proenzyme, the native carboxy terminus of alkaline phosphatase is replaced with a similar sequence from hPLAP. In certain embodiments, a mutation is added to the hydrophobic carboxy terminus to promote protein secretion without cleaving the carboxy terminus. In certain embodiments, a single point mutation, such as a substitution of leucine with arginine at the hydrophobic carboxy terminus, is added to result in enzyme secretion without removing the carboxy terminus (e.g., allpllagtl is changed to allplragtl, e.g., Leu515 of SEQ ID NO: 1 is changed to Arg515 for example).

[0066] Bovine IAP In certain embodiments, the IAP is bovine IAP (bIAP). In certain embodiments, the bIAP is selected from bIAP I, bIAP II, and bIAP IV.

[0067] In certain embodiments, the IAP comprises an amino acid sequence having at least about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity with any one of SEQ ID NOs: 1-14. In certain embodiments, the IAP comprises an amino acid sequence having at least about 97% sequence identity with SEQ ID NO: 11. In certain embodiments, the IAP comprises an amino acid sequence having at least about 99% sequence identity with SEQ ID NO: 11.

[0068] Wild-type bIAP produced in calf intestine is not naturally sialylated. In certain embodiments, the bIAP is recombinant sialylated bIAP. In certain embodiments, the bIAP is recombinant glycosylated bIAP. In certain embodiments, the bIAP is glycosylated and has one or more terminal sialic acids. In certain embodiments, the recombinant bIAP is glycosylated on one or more residues located at the N-terminus, C-terminus, and / or within the primary amino acid sequence. In certain embodiments, the recombinant bIAP has a sialylated terminus, in which case, for example, the sialylation occurs at the terminus of one or more glycosylated structures.

[0069] In certain embodiments, the recombinant sialylated bIAP comprises an amino acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% or more sequence identity to SEQ ID NO: 11. In certain embodiments, the recombinant sialylated bIAP comprises the amino acid sequence of SEQ ID NO: 11.

[0070] In certain embodiments, the recombinant IAPs of the present disclosure (e.g., sialylated bIAP) have a specific activity that is substantially equivalent to or higher than that of commercially available APs, such as calf IAP (cIAP). In certain embodiments, the recombinant IAPs of the present disclosure (e.g., sialylated bIAP) have a half-life that is substantially equivalent to or higher than that of commercially available IAPs. In certain embodiments, the IAP is bovine IAP II (bIAP II) or is a variant described herein as long as it retains at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the phosphatase activity as determined using the assays described herein. In certain embodiments, bIAP II includes the signal peptide and carboxy terminus of bIAP I. In certain embodiments, bIAP II (similar to bIAP IV) includes aspartic acid at position 248. In certain embodiments, bIAP II includes the amino acid sequence of SEQ ID NO: 2. FIG. 1 shows BIAP II (SEQ ID NO: 2) having 248D. The signal peptide and the sequence after 480 are derived from bIAP I.

[0071] In certain embodiments, bIAP II includes an amino acid variant described herein. For example, in certain embodiments, a stop codon may be inserted after the aspartic acid of the DAAH consensus site (e.g., amino acid 506 of bIAP II). FIG. 1 shows bIAP II (SEQ ID NO: 4) with a stop codon inserted.

[0072] In certain embodiments, bIAP II comprises, consists of, or consists essentially of the amino acid sequence of SEQ ID NO: 11.

[0073] BIAP II (SYN-020) (SEQ ID NO: 11) having a stop codon and no leader sequence

Chemical Formula

[0074] Expression Variant In certain embodiments, the IAP of the present disclosure is efficiently expressed and secreted from host cells. In certain embodiments, the IAP of the present disclosure is efficiently transcribed in host cells. In certain embodiments, the IAP improves the stability and / or transport of RNA in host cells. In certain embodiments, the IAP is efficiently translated in host cells. In certain embodiments, the IAP has improved protein stability.

[0075] In certain embodiments, the IAP is efficiently expressed in host cells. In certain embodiments, the Kozak sequence of the DNA construct encoding the IAP is optimized. The Kozak sequence is a nucleotide sequence adjacent to the ATG start codon that instructs the ribosome to initiate translation. Although there is flexibility in the design of the Kozak sequence, one standard sequence is GCCGCCACCATGGGCCGCCACCATGG (SEQ ID NO: 15). The purine at the -3 position and the G at the +4 position are the most important bases for translation initiation. In the case of hIAP, bIAP II, and bIAP IV, the second amino acid, i.e., the amino acid following the initiating methionine, is glutamine. The codons for glutamine all have C in the first position. Therefore, all of these Kozak sequences contain the ATGC sequence. Thus, in certain embodiments, the ATGC sequence is changed to ATGG. This can be achieved by changing the second amino acid to glycine, alanine, valine, aspartic acid, or glutamic acid (the codons for all of these have G in the first position). These amino acids may be compatible with the signal peptide function. In another embodiment, the entire signal peptide is replaced with a peptide derived from a highly expressed protein such as an immunoglobulin having a standard Kozak sequence.

[0076] In embodiments, the signal peptide of the IAP may be removed and / or replaced. For example, to ensure optimal protein expression, the signal peptide may be removed, mutated, and / or replaced (e.g., replaced with another signal peptide).

[0077] In certain embodiments, the DNA construct encoding the IAP of the present disclosure includes untranslated DNA sequences. Such sequences include introns (which may be heterologous to the IAP protein or may be native to the IAP protein, such as a native first intron and / or a native second intron), and / or a native 3' UTR. Without wishing to be bound by theory, inclusion of these sequences is thought to enhance protein expression by stabilizing the mRNA. Thus, in certain embodiments, the DNA construct encoding the IAP of the present disclosure includes a 5' UTR and / or a 3' UTR. Figure 1 shows an exemplary IAP DNA sequence having a first intron and a 3' UTR. This includes hIAP (SEQ ID NO: 7) having a native first intron (shown in bold and underlined) and hIAP (SEQ ID NO: 8) having a native 3' UTR (shown in bold and underlined).

[0078] In certain embodiments, the IAP of the present disclosure includes a nucleotide sequence having at least about 60% (e.g., about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%) sequence identity to any of the sequences disclosed herein.

[0079] In certain embodiments, the IAP of the present disclosure may include an amino acid sequence having one or more amino acid mutations relative to any of the protein sequences described herein. In certain embodiments, the one or more amino acid mutations may be independently selected from substitutions, insertions, deletions, and truncations.

[0080] In certain embodiments, the substitution may also include non-classical amino acids (e.g., selenocysteine, pyrrolysine, N-formylmethionine, β-alanine, GABA, and δ-aminolevulinic acid, 4-aminobenzoic acid (PABA), D-isomers of common amino acids, 2,4-diaminobutyric acid, α-aminoisobutyric acid, 4-aminobutyric acid, Abu, 2-aminobutyric acid, γ-Abu, ε-Ahx, 6-aminohexanoic acid, Aib, 2-aminoisobutyric acid, 3-aminopropionic acid, ornithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t-butylglycine, t-butylalanine, phenylglycine, cyclohexylalanine, β-alanine, fluoro-amino acids, designer amino acids such as β-methylamino acids, Cα-methylamino acids, Nα-methylamino acids, and amino acid analogs in general).

[0081] By introducing mutations into the IAPs of the present disclosure, agents with desired characteristics can be selected. For example, by introducing mutations, IAPs with improved catalytic activity or protein stability can be generated. In certain embodiments, directed evolution can be utilized to generate the IAPs of the present disclosure. For example, error-prone PCR and DNA shuffling can be used to identify mutations in a bacterium alkaline phosphatase with improved activity.

[0082] Method for preparing the IAPs of the present disclosure The IAPs of the present disclosure are prepared using standard molecular biology techniques. For example, nucleic acid compositions encoding the IAPs of the present disclosure, expression vectors containing these nucleic acids, and host cells transformed with these nucleic acid compositions and / or expression vector compositions are also provided. It will be understood by those skilled in the art that the protein sequences shown herein can be encoded by any number of nucleic acid sequences due to the degeneracy of the genetic code.

[0083] As is known in the art, nucleic acids encoding the components of the present disclosure can be incorporated into expression vectors well-known in the art and used to produce the IAP compositions of the present disclosure, depending on the host cell. Generally, the nucleic acid is operably linked to any number of regulatory elements (promoters, origins of replication, selectable markers, ribosome binding sites, inducers, etc.). The expression vector can be either an extrachromosomal vector or an integrative vector.

[0084] The nucleic acids and / or expression vectors of the present disclosure are transformed into any number of different types of host cells, including mammalian cells, bacterial cells, yeast cells, insect cells, and / or fungal cells, as is well-known in the art. In many embodiments, mammalian cells (e.g., CHO cells) are utilized.

[0085] In certain embodiments, the cell is a mammalian cell. In certain embodiments, the mammalian cell is a human cell. In certain embodiments, the cell is an insect cell. In certain embodiments, the cell is immortalized.

[0086] In certain embodiments, the cells are Chinese Hamster Ovary (CHO) cells, Baby Hamster Kidney (BHK) cells, Human Embryonic Kidney (HEK293T) cells, Vero cells, or Spodoptera frugiperda 9 (Sf9) cells. In certain embodiments, the CHO cells are CHO-K1 cells, CHO-DHB11 cells, CHO-DXB1 cells, CHO-S cells, or CHO-DG44 cells. In certain embodiments, the CHO cells include, or are selected from, CHO-K1 (ATCC CCL-61) cells, SURE CHO-M cells (a derivative of CHO-K1), or Baby Hamster Kidney cells (BHK, ATCC CCL-10). In certain embodiments, the Vero cells include, or are selected from, Vero, Vero76, and Vero E6. In certain embodiments, the cells are the Per C6 cell line, for example, a human embryonic retinal cell line transformed with the E1A gene and the E1B gene of adenovirus type 5 (Ad5). In certain embodiments, the cells are an immortalized cell line based on primary human amniotic fluid cells (including, for example, amniotic fluid stem cells, fetal somatic stem cells), and are produced, for example, as in the CAP cell line (CEVEC Pharmaceuticals, an amniotic fluid cell-derived cell line), by transduction using a vector having the functions of E1 and pIX of adenovirus type 5 (Ad5).

[0087] In certain embodiments, the cells are, but are not limited to, human cervical cancer cells (HELA, ATCC CCL-2), 293 (ATCC CRL-1573), 3T3 (ATCC CCL-163), or monkey kidney CV1 strain (ATCC CCL-70), which can be transformed with SV40 (COS-7, ATCC CRL-1587).

[0088] The IAP of the present disclosure is produced by culturing host cells containing an expression vector, as is well known in the art. After production, conventional purification steps are performed. In certain embodiments, the IAP of the present disclosure is produced by: i) introducing a nucleic acid (e.g., an expression vector) encoding one or more APs described herein into a host cell; ii) culturing the host cell under conditions suitable for expression (e.g., under a selective antibiotic); and iii) isolating the IAP (e.g., using various purification techniques such as affinity chromatography, size exclusion, etc.).

[0089] Additional agents The present disclosure provides the described IAP and / or additional agents in various formulations.

[0090] In certain embodiments, the additional agents are selected from anti-inflammatory agents, immunosuppressive agents, and biological agents.

[0091] In certain embodiments, the additional agent is an anti-inflammatory agent. In certain embodiments, the anti-inflammatory agent is 5-aminosalicylate or a corticosteroid. In certain embodiments, the 5-aminosalicylate is selected from sulfasalazine (e.g., AZULFIDINE), mesalamine (e.g., ASACOL HD, DELZICOL), balsalazide (e.g., COLAZAL), and olsalazine (e.g., DIPENTUM). In certain embodiments, the corticosteroid is selected from dexamethasone (e.g., OZURDEX, MAXIDEX), hydrocortisone (e.g., HYDROCORT, ALPHOSYL, AQUACORT, CORTEF), methylprednisolone (e.g., MEDROL), and prednisone (e.g., DELTASONE, RAYOS).

[0092] In certain embodiments, the additional agent is an immunosuppressive agent. In certain embodiments, the immunosuppressive agent is selected from azathioprine (e.g., AZASAN, IMURAN), mercaptopurine (e.g., PURINETHOL, PURIXAN), cyclosporine (e.g., GENGRAF, NEORAL, SANDIMMUNE), and tofacitinib (XELJANZ).

[0093] In certain embodiments, the additional agent is a biological agent. In certain embodiments, the biological agent is an antibody. In certain embodiments, the biological agent is a monoclonal antibody. In certain embodiments, the biological agent is a tumor necrosis factor (TNF) inhibitor. In certain embodiments, the TNF inhibitor is a monoclonal antibody against TNF-alpha (e.g., anti-TNFα). In certain embodiments, the anti-TNFα is selected from infliximab (REMICADE), adalimumab (HUMIRA), and golimumab (SIMPONI). In certain embodiments, the biological agent is an integrin α4β modulator. In certain embodiments, the integrin α4β modulator is vedolizumab (ENTYVIO). In certain embodiments, the biological agent is a regulator of interleukin-12 (IL-12) or interleukin-23 (IL-23). In certain embodiments, the regulator of interleukin-12 (IL-12) or interleukin-23 (IL-23) is ustekinumab (STELARA).

[0094] Formulations The present disclosure provides the described IAP (and / or additional agent) in various formulations. Any IAP (and / or additional agent) described herein can be in the form of tablets, pills, pellets, capsules, capsules containing liquids, capsules containing multiparticulates, powders, solutions, emulsions, drops, suppositories, emulsions, aerosols, sprays, suspensions, delayed-release formulations, sustained-release formulations, controlled-release formulations, or other forms suitable for use. In certain embodiments, the IAP of the present disclosure is formulated as a delayed-release capsule.

[0095] In certain embodiments, the IAP described herein is formulated as a composition suitable for any of the dosing regimens described herein.

[0096] In certain embodiments, the IAP is formulated to be released substantially within the GI tract. In certain embodiments, the IAP is formulated to be released substantially within the small intestine. In certain embodiments, the IAP is formulated to be released substantially within the large intestine. In certain embodiments, the IAP is formulated such that it is not released substantially systemically.

[0097] Formulations containing IAP (and / or additional agents) can be conveniently presented in unit dosage form. For example, these dosage forms can be prepared by a method that includes combining the therapeutic agent with a carrier that constitutes one or more auxiliary components. For example, the formulation combines the therapeutic agent with a liquid carrier, a micronized solid carrier, or both, uniformly and intimately, and, if necessary, shaping the product into the desired dosage form (e.g., wet granulation or dry granulation, powder blend, etc., and subsequent tableting).

[0098] In certain embodiments, the IAP (and / or additional agents) described herein is formulated as a composition suitable for the dosing regimens described herein.

[0099] In certain embodiments, the recombinant IAP comprises an amino acid sequence having at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% or more sequence identity to any one of SEQ ID NOs: 1-14.

[0100] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 15 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsule contains a plurality of AP-derived agent-containing pellets. In certain embodiments, the formulation of the present invention includes at least one release-modulating pellet, where each release-modulating pellet contains about 5-25% by weight of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). For example, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, or about 25% by weight of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof) may be included. In certain embodiments, the pellet (or each individual pellet) contains about 45-65% by weight of sucrose spheres. For example, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, or about 65% by weight of sucrose spheres may be included. In certain embodiments, the pellet (or each individual pellet) contains about 20-40% by weight of hydroxypropylcellulose (HPC). For example, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, or about 40% by weight of hydroxypropylcellulose may be included. In certain embodiments, the pellet (or each individual pellet) contains about 0.2-2% by weight of a buffering salt. The buffering salt may be selected from tris base, magnesium chloride, magnesium sulfate, zinc chloride, and zinc sulfate. For example, about 0.2%, 0.3%, 0.4%, 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1.0%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, 1.6%, about 1.7%, about 1.8%, about 1.9%, or about 2.0% by weight of a buffering salt may be included.In certain embodiments, each release modulating pellet comprises from about 5 to 25 (w / w) or at least about 5 to 25 (w / w) recombinant IAP, from about 45 to 65% (w / w) or at least about 45 to 65% (w / w) sucrose spheres, from about 20 to 40% (w / w) or at least about 20 to 40% (w / w) hydroxypropyl cellulose, and from about 0.2 to 2% (w / w) or at least about 0.2 to 2% (w / w) buffering agent. In certain embodiments, each release modulating pellet comprises from about 10 to 15% (w / w) recombinant IAP, from about 55 to 60% (w / w) sucrose spheres, from about 25 to 30% (w / w) hydroxypropyl cellulose, and from about 0.2 to 1% (w / w) buffering agent. In certain embodiments, each release modulating pellet comprises about 15% (w / w) recombinant IAP, about 55% (w / w) sucrose spheres, about 30% (w / w) hydroxypropyl cellulose, and about 0.5% (w / w) buffering agent. In certain embodiments, each release modulating pellet comprises about 14.5% (w / w) recombinant IAP, about 56.2% (w / w) sucrose spheres, about 28.9% (w / w) hydroxypropyl cellulose, and about 0.4% (w / w) buffering agent.

[0101] In certain embodiments, the pellet (or each individual pellet) comprises from about 10 to 40% by weight EUDRAGIT L30 D-55. For example, from about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, or about 40% by weight EUDRAGIT L30 D-55 may be included. In certain embodiments, the pellet (or each individual pellet) comprises from about 0.5% to 11% by weight HTP-20. For example, from about 0.5%, about 1.0%, about 1.5%, about 2.0%, about 2.5%, about 3.0%, about 3.5%, about 4.0%, about 4.5%, about 5.0%, about 5.5%, about 6.0%, about 6.5%, about 7.0%, about 7.5%, about 8.0%, about 8.5%, about 9.0%, about 9.5%, about 10.0%, about 10.5%, or about 11.0% by weight HTP-20 may be included.

[0102] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 15 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsule contains a plurality of enteric-coated AP-derived agent-containing pellets. In certain embodiments, the capsule contains about 5-15% by weight of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). For example, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 12%, about 13%, about 14%, or about 15% by weight of an AP-derived agent may be included. In certain embodiments, the capsule contains about 35-45% by weight of sucrose spheres. For example, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, or about 45% by weight of sucrose spheres may be included. In certain embodiments, the capsule contains about 15-25% by weight of hydroxypropyl cellulose (HPC). For example, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, or about 25% by weight of HPC may be included. In certain embodiments, the capsule contains about 0.1-1.5% by weight of a buffer salt. In certain embodiments, the capsule contains about 20-30% by weight of an enteric polymer (e.g., EUDRAGIT L30 D-55). For example, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, or about 30% by weight of an enteric polymer may be included. In certain embodiments, the capsule contains about 1-10% by weight of HTP-20 (e.g., PLASACRYL HTP 20). For example, about 1%, about 1.5%, about 2%, about 2.5%, about 3%, about 3.5%, about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, or about 10% by weight of HTP-20 may be included.

[0103] In certain embodiments, the formulations of the present invention are in the form of capsules (e.g., hard gelatin capsules or HPMC capsules) containing about 15 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsules contain a plurality of enteric-coated pellets containing the AP-derived agent. In such embodiments, the formulation comprises about 10 wt% of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof), about 39 wt% of sucrose spheres, about 20 wt% of hydroxypropyl cellulose (HPC), about 0.5 wt% of buffer salts, about 26 wt% of an enteric polymer (e.g., EUDRAGIT L30 D-55), and about 4.5 wt% of HTP-20 (e.g., PLASACRYL HTP 20).

[0104] In certain embodiments, the formulations of the present invention are in the form of capsules (e.g., hard gelatin capsules or HPMC capsules) containing about 15 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsules contain a plurality of enteric-coated pellets containing the AP-derived agent. In such embodiments, the formulation comprises about 10.0 wt% of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof), about 38.9 wt% of sucrose spheres, about 20.0 wt% of hydroxypropyl cellulose (HPC), about 0.3 wt% of buffer salts, about 26.3 wt% of an enteric polymer (e.g., EUDRAGIT L 30 D-55), and about 4.5 wt% of HTP-20 (e.g., PLASACRYL HTP 20).

[0105] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 5 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsule contains a plurality of pellets containing the AP-derived agent. In certain embodiments, the formulation of the present invention includes at least one release-modulating pellet, where each release-modulating pellet contains about 5-25% by weight of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). For example, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, or about 25% by weight of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof) may be included. In certain embodiments, the pellet (or each individual pellet) contains about 45-65% by weight of sucrose spheres. For example, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, or about 65% by weight of sucrose spheres may be included. In certain embodiments, the pellet (or each individual pellet) contains about 20-40% by weight of hydroxypropyl cellulose (HPC). For example, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, or about 40% by weight of hydroxypropyl cellulose may be included. In certain embodiments, the pellet (or each individual pellet) contains about 0.2-2% by weight of a buffering salt. The buffering salt may be selected from tris base, magnesium chloride, magnesium sulfate, zinc chloride, and zinc sulfate. For example, about 0.2%, 0.3%, 0.4%, 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1.0%, about 1.1%, about 1.2%, about 1.3%, about 1.4%, about 1.5%, 1.6%, about 1.7%, about 1.8%, about 1.9%, or about 2.0% by weight of a buffering salt may be included.In certain embodiments, each release-modulating pellet comprises from about 5 to 25 (w / w) or at least about 5 to 25 (w / w) recombinant IAP, from about 45 to 65% (w / w) or at least about 45 to 65% (w / w) sucrose spheres, from about 20 to 40% (w / w) or at least about 20 to 40% (w / w) hydroxypropyl cellulose, and from about 0.2 to 2% (w / w) or at least about 0.2 to 2% (w / w) buffering agent. In certain embodiments, each release-modulating pellet comprises from about 10 to 15% (w / w) recombinant IAP, from about 55 to 60% (w / w) sucrose spheres, from about 25 to 30% (w / w) hydroxypropyl cellulose, and from about 0.2 to 1% (w / w) buffering agent. In certain embodiments, each release-modulating pellet comprises about 15% (w / w) recombinant IAP, about 55% (w / w) sucrose spheres, about 30% (w / w) hydroxypropyl cellulose, and about 0.5% (w / w) buffering agent. In certain embodiments, each release-modulating pellet comprises about 14.5% (w / w) recombinant IAP, about 56.2% (w / w) sucrose spheres, about 28.9% (w / w) hydroxypropyl cellulose, and about 0.4% (w / w) buffering agent.

[0106] In certain embodiments, the pellet (or each individual pellet) comprises from about 10 to 40% by weight EUDRAGIT L30 D-55. For example, from about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, or about 40% by weight EUDRAGIT L30 D-55 may be included. In certain embodiments, the pellet (or each individual pellet) comprises from about 0.5 to 11% by weight HTP-20. For example, from about 0.5%, about 1.0%, about 1.5%, about 2.0%, about 2.5%, about 3.0%, about 3.5%, about 4.0%, about 4.5%, about 5.0%, about 5.5%, about 6.0%, about 6.5%, about 7.0%, about 7.5%, about 8.0%, about 8.5%, about 9.0%, about 9.5%, about 10.0%, about 10.5%, or about 11.0% by weight HTP-20 may be included.

[0107] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 5 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsule contains a plurality of enteric-coated AP-derived agent-containing pellets. In certain embodiments, the capsule contains about 5-15% by weight of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). For example, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 12%, about 13%, about 14%, or about 15% by weight of an AP-derived agent may be included. In certain embodiments, the capsule contains about 35-45% by weight of sucrose spheres. For example, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, or about 45% by weight of sucrose spheres may be included. In certain embodiments, the capsule contains about 15-25% by weight of hydroxypropyl cellulose (HPC). For example, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, or about 25% by weight of HPC may be included. In certain embodiments, the capsule contains about 0.1-1.5% by weight of a buffering salt. In certain embodiments, the capsule contains about 20-30% by weight of an enteric polymer (e.g., EUDRAGIT L30 D-55). For example, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, or about 30% by weight of an enteric polymer may be included. In certain embodiments, the capsule contains about 1-10% by weight of HTP-20 (e.g., PLASACRYL HTP 20). For example, about 1%, about 1.5%, about 2%, about 2.5%, about 3%, about 3.5%, about 4%, about 4.5%, about 5%, about 5.5%, about 6%, about 6.5%, about 7%, about 7.5%, about 8%, about 8.5%, about 9%, about 9.5%, or about 10% by weight of HTP-20 may be included.

[0108] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 5 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsule contains a plurality of enteric-coated pellets containing the AP-derived agent. In such embodiments, the formulation comprises about 10 wt% of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof), about 39 wt% of sucrose spheres, about 20 wt% of hydroxypropylcellulose (HPC), about 0.5 wt% of buffer salts, about 26 wt% of an enteric polymer (e.g., EUDRAGIT L30 D-55), and about 4.5 wt% of HTP-20 (e.g., PLASACRYL HTP 20).

[0109] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 5 mg of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof). The capsule contains a plurality of enteric-coated pellets containing the AP-derived agent. In such embodiments, the formulation comprises about 10.0 wt% of an AP-derived agent (e.g., IAP, or other AP-derived agents described herein, and variants thereof), about 38.9 wt% of sucrose spheres, about 20.0 wt% of hydroxypropylcellulose (HPC), about 0.3 wt% of buffer salts, about 26.3 wt% of an enteric polymer (e.g., EUDRAGIT L 30 D-55), and about 4.5 wt% of HTP-20 (e.g., PLASACRYL HTP 20).

[0110] In certain embodiments, IAP and / or additional agents are co-formulated.

[0111] In certain embodiments, the formulation containing IAP is resistant to compression and is thus suitable for tableting. IAP can be provided, for example, in the form of a powder that is tableted by physical compression of the dry material.

[0112] In certain embodiments, the formulation comprises one or more enzyme cofactors such as zinc and / or magnesium. In certain embodiments, the enzyme cofactor zinc is used. In certain embodiments, zinc is provided as zinc sulfate heptahydrate. In certain embodiments, the enzyme cofactor magnesium is used. In certain embodiments, magnesium is provided as magnesium sulfate heptahydrate.

[0113] In certain embodiments, the formulation comprises a protein stabilizer such as trehalose, sucrose, lactose, mannitol, Tween 80, and / or polyvinyl alcohol. In certain embodiments, the stabilizer is arginine. In certain embodiments, the stabilizer is sucrose. In certain embodiments, the stabilizer is lactose.

[0114] In certain embodiments, the formulation comprises one or more surfactants. The surfactant can be used as a solubilizer or an emulsifier. Exemplary surfactants include, but are not limited to, vitamin E polyethylene glycol succinate, sorbitan monostearate - 60 / 80, polysorbate 20, polysorbate 80, and polyoxyl 40 hydrogenated castor oil.

[0115] In certain embodiments, the IAP of the present disclosure is stable and / or active in the GI tract, for example, in one or more of the mouth, esophagus, stomach, duodenum, small intestine, duodenum, jejunum, ileum, large intestine, transverse colon, descending colon, ascending colon, sigmoid colon, cecum, and rectum. In certain embodiments, the IAP is stable in the large intestine, optionally in the large intestine selected from one or more of the transverse colon, descending colon, ascending colon, sigmoid colon, and cecum. In certain embodiments, the IAP is stable in the small intestine, optionally in the small intestine selected from one or more of the duodenum, jejunum, and ileum. In certain embodiments, the IAP is resistant to proteases in the GI tract, including, for example, the small intestine. In certain embodiments, the IAP is substantially active at a pH of about 5.0 or higher. For example, the IAP can be substantially active at a pH of about 6.0 to about 12, such as about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 8.0, about 8.5, about 9.0, about 9.5, about 10.0, about 10.5, about 11.0, about 11.5, or about 12.0 (e.g., by formulations described herein). In certain embodiments, stable refers to an enzyme having a sufficiently long half-life and maintaining sufficient activity for therapeutic efficacy.

[0116] In certain embodiments, the formulation of the IAP of the present disclosure is stable in gruel, gastric juice, and / or bile salts. To evaluate the stability of the IAP in gruel, a sample of the IAP is incubated in human gruel at 37°C. Next, aliquots withdrawn from the incubated sample at time points of 0 hours, 0.5 hours, 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, and 6 hours are assayed for AP activity using para-nitrophenyl phosphate (pNPP) as an AP substrate to evaluate stability. A variety of gruel specimens, including mixed gruel samples, can be used for the evaluation of stability. The gruel samples are characterized with respect to pH, liquid volume, and protease activity.

[0117] In certain embodiments, the IAPs described herein include modified, i.e., derivatives modified by covalent attachment of any type of molecule to alkaline phosphatase such that the covalent attachment does not interfere with the activity of the enzyme. For example, without limitation, derivatives include, inter alia, those modified by glycosylation, lipidation, acetylation, PEGylation, phosphorylation, amidation, derivatization with known protecting groups / blocking groups, proteolytic cleavage, ligation to cell ligands or other proteins, etc. Without limitation, a number of chemical modifications can be performed, including specific chemical cleavage, acetylation, formylation, metabolic synthesis of nikkomycin. Further, the derivative can contain one or more non-classical amino acids. In certain embodiments, the IAP is glycosylated to ensure proper protein folding.

[0118] In certain embodiments, the formulations and unit dosage forms herein, and the formulations and unit dosage forms used in the methods herein, include co-formulations, co-administrations, and / or formulation components of those described in U.S. Patent No. 10,987,410, and published U.S. Patent Application Publication Nos. 20210030686 and US20220323367 (e.g., alkaline phosphatase formulations and their use), the disclosures of which are hereby incorporated by reference in their entireties.

[0119] Pharmaceutically acceptable salts The IAP described herein may have a sufficiently basic functional group that can react with an inorganic or organic acid or a carboxyl group that can react with an inorganic or organic base to form a pharmaceutically acceptable salt. Pharmaceutically acceptable acid addition salts are formed from pharmaceutically acceptable acids, as is well known in the art. Such salts include, for example, those listed in Journal of Pharmaceutical Science, 66, 2-19 (1977) and The Handbook of Pharmaceutical Salts; Properties, Selection, and Use. P. H. Stahl and C. G. Wermuth (eds.), Verlag, Zurich (Switzerland) 2002, which are hereby incorporated by reference in their entirety.

[0120] The term "pharmaceutically acceptable salt" also refers to salts of alkaline phosphatase having an acidic functional group such as a carboxylic acid functional group with a base. Suitable bases include, but are not limited to, hydroxides of alkali metals such as sodium, potassium, and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals such as aluminum and zinc; ammonia, and organic amines such as unsubstituted or hydroxy-substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; tributylamine; pyridine; N-methylamine, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-OH-lower alkylamines), for example, mono-, bis-, or tris-(2-hydroxyethyl)amine, 2-hydroxy-tert-butylamine, or tris-(hydroxymethyl)methylamine, N,N-di-lower alkyl-N-(hydroxyl-lower alkyl)-amine, for example, N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids such as arginine and lysine.

[0121] In certain embodiments, the compositions described herein are in the form of pharmaceutically acceptable salts. In certain embodiments, the formulations comprise from about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, or about 50% by weight of a pharmaceutically acceptable salt.

[0122] Pharmaceutical excipient Furthermore, any of the IAPs described herein can be administered to a subject as a component of a composition comprising a pharmaceutically acceptable carrier or vehicle. Such compositions may optionally contain an appropriate amount of a pharmaceutically acceptable excipient so as to provide a form for proper administration.

[0123] Pharmaceutical excipients can be liquid substances, such as water and oil, which include oils derived from petroleum, animals, plants, or synthesis, such as castor oil, soybean oil, mineral oil, sesame oil, etc. Pharmaceutical excipients can be, for example, physiological saline, gum arabic, gelatin, starch paste, talc, keratin, colloidal silica, urea, etc. In addition, adjuvants, stabilizers, thickeners, lubricants, and coloring agents can also be used. In certain embodiments, the pharmaceutically acceptable excipients are sterile when administered to the subject. When any of the agents described herein are administered intravenously, water is a useful excipient. Physiological saline as well as aqueous dextrose and glycerol solutions can also be used as liquid excipients, specifically injectable solutions. Suitable pharmaceutical excipients include starch, glucose, cellulose, hypromellose, lactose, sucrose, trehalose, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, nonfat dry milk, glycerol, propylene glycol, povidone, crospovidone, water, ethanol, etc. Any of the agents described herein may also contain small amounts of wetting or emulsifying agents, or pH buffering agents. Other examples of suitable pharmaceutical excipients are described in Remington's Pharmaceutical Sciences 1447-1676 (Alfonso R. Gennaro eds., 19th ed. 1995), which is incorporated herein by reference.

[0124] Suitable pharmaceutical excipients for tablet pressing can include Ludipress (lactose, povidone, crospovidone; CAS numbers 5989-81-1 + 9003-39-8).

[0125] Optionally, the IAP and / or pharmaceutical composition (and / or additional agent) can include solubilizing agents. Also, the agent can be delivered using a suitable medium or delivery device. The combination therapies described herein can be delivered simultaneously using a single delivery medium or delivery device.

[0126] In certain embodiments, the IAPs (and / or additional agents) described herein are formulated as compositions suitable for oral administration. Compositions for oral delivery can be, for example, in the form of tablets, buccal tablets, aqueous or oily suspensions, granules, powders, sprinkles, emulsions, capsules, syrups, or elixirs. Compositions for oral administration can include one or more agents, such as sweeteners like fructose, aspartame, or saccharin, flavoring agents like peppermint, wintergreen, or cherry, coloring agents, and preservatives, to provide a pharmaceutically palatable preparation. Further, in the form of tablets or pills, the composition can be coated to delay disintegration in order to provide a sustained action over a long period of time. Selectively permeable membranes surrounding osmotic active agents that drive any of the IAPs (and / or additional agents) described herein are also suitable for compositions for oral administration. In these latter platforms, fluid in the environment surrounding the capsule is absorbed by the driving compound, thereby swelling and releasing the agent or pharmaceutical composition through the opening. These delivery platforms can provide an essentially zero-order delivery profile, in contrast to the spike-like profile of immediate-release formulations. Time-delay materials such as glyceryl monostearate or glyceryl stearate can also be useful. Oral compositions can include mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, acrylic acid, and its derivative polymers, and magnesium carbonate, among others. In certain embodiments, the excipients are of pharmaceutical grade. Suspensions can contain, in addition to the active compound, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, tragacanth, and mixtures thereof.

[0127] In certain embodiments, the IAP (and / or additional agent) is formulated as a solid dosage form such as tablets, dispersible powders, granules, and capsules. In certain embodiments, the IAP (and / or additional agent) is formulated as a capsule. In certain embodiments, the IAP (and / or additional agent) is formulated as a tablet. In certain embodiments, the IAP (and / or additional agent) is formulated as a soft gel capsule. In certain embodiments, the IAP (and / or additional agent) is formulated as a gelatin capsule.

[0128] In certain embodiments, the formulation of the IAP may further comprise a pharmaceutically acceptable carrier or excipient. As will be understood by those skilled in the art, the formulation can take any suitable form appropriate for the desired use and route of administration.

[0129] In some dosage forms, the agents described herein are combined with at least one inert pharmaceutically acceptable excipient or carrier (e.g., sodium citrate, dicalcium phosphate, etc.), and / or a) fillers or extenders (e.g., starch, lactose, sucrose, glucose, mannitol, silicic acid, microcrystalline cellulose, and Bakers Special Sugar, etc.), b) binders (e.g., carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose, gum arabic, polyvinyl alcohol, polyvinylpyrrolidone, methyl cellulose, hydroxypropyl cellulose (HPC), and hydroxymethyl cellulose, etc.), c) humectants (e.g., glycerol, etc.), d) disintegrants (e.g., agar, calcium carbonate, potato starch or tapioca starch, alginic acid, certain silicates, sodium carbonate, cross-linked polymers, e.g., crospovidone (cross-linked polyvinylpyrrolidone), croscarmellose sodium (cross-linked sodium carboxymethyl cellulose), sodium starch glycolate, etc.), e) dissolution retardants (e.g., paraffin, etc.), f) absorption promoters (e.g., quaternary ammonium compounds, etc.), g) wetting agents (e.g., cetyl alcohol and glyceryl monostearate, etc.), h) absorbents (e.g., kaolin and bentonite clay, etc.), and i) lubricants (e.g., talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, glyceryl behenate, etc.), and mixtures of such excipients. It will be appreciated by those skilled in the art that certain excipients may have more than one function in oral dosage forms. In the case of oral dosage forms, e.g., capsules or tablets, the dosage form may also include buffering agents.

[0130] Surfactant The formulation can further contain a surfactant. Suitable surfactants for use in the present disclosure include, but are not limited to, any pharmaceutically acceptable non-toxic surfactant. Types of surfactants suitable for use in the compositions of the present disclosure include, but are not limited to, polyethoxylated fatty acids, PEG-fatty acid diesters, PEG-fatty acid monoester and diester mixtures, polyethylene glycol glycerol fatty acid esters, alcohol-oil transesterification reaction products, polyglycerolated fatty acids, propylene glycol fatty acid esters, mixtures of propylene glycol esters-glycerol esters, monoglycerides and diglycerides, sterols and sterol derivatives, polyethylene glycol sorbitan fatty acid esters, polyethylene glycol alkyl ethers, sugar esters, polyethylene glycol alkyl phenols, polyoxyethylene-polyoxypropylene block copolymers, sorbitan fatty acid esters, lower alcohol fatty acid esters, ionic surfactants, and mixtures thereof. In certain embodiments, the compositions of the present disclosure may contain one or more surfactants including, but not limited to, sodium lauryl sulfate, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, and triethyl citrate.

[0131] The formulation can also contain a pharmaceutically acceptable plasticizer to obtain desired mechanical properties such as flexibility and hardness. Such plasticizers include, but are not limited to, triacetin, citrate esters, triethyl citrate, phthalate esters, dibutyl sebacate, cetyl alcohol, polyethylene glycol, polysorbate, or other plasticizers.

[0132] The formulation can also contain one or more coating solvents. Common solvents that can be used for coating, such as for a delayed release coating composition, include, for example, isopropyl alcohol, acetone, methylene chloride, and the like.

[0133] The formulation can also contain one or more alkaline materials. Alkaline materials suitable for use in the compositions of the present disclosure include, but are not limited to, sodium salts, potassium salts, calcium salts, magnesium salts, and aluminum salts of acids such as phosphoric acid, carbonic acid, and citric acid, and other aluminum / magnesium compounds. In addition, the alkaline material may be selected from antacid materials such as aluminum hydroxide, calcium hydroxide, magnesium hydroxide, and magnesium oxide.

[0134] In certain embodiments, the formulation can further contain magnesium and / or zinc. Without wishing to be bound by theory, including magnesium and / or zinc in the formulation promotes protein folding (e.g., dimer formation) and biological activity of IAP. In certain embodiments, the formulation can contain magnesium at a concentration of about 1 μM to greater than 5 mM (e.g., about 1 μM to greater than 5 mM, including all ranges and values therebetween). In certain embodiments, 1.0 mM of magnesium is included in the formulation. In certain embodiments, the formulation can contain zinc at a concentration of about 1 μM to greater than 1 mM (e.g., about 1 μM to greater than 1 mM, including all ranges and values therebetween). In certain embodiments, 0.1 mM of zinc is included in the formulation. In certain embodiments, the formulations of the present disclosure are substantially free of metal chelating agents.

[0135] In certain embodiments, the pH of the formulation ensures that the IAP is properly folded (e.g., dimer formation) and is biologically active. In certain embodiments, the formulation is maintained at a pH such that the amino acids coordinating the binding of magnesium and / or zinc within the IAP are not protonated. Protonation of such coordinating amino acids can lead to loss of metal ions and biological activity and dissociation of the dimer. In certain embodiments, the pH of the formulation is greater than about 6, greater than about 6.5, greater than about 7, greater than about 7.5, greater than about 8, greater than about 8.5, greater than about 9, greater than about 9.5, greater than about 10, greater than about 10.5, greater than about 11, greater than about 11.5, or greater than about 12.

[0136] In addition to the inert diluent, the oral composition may also include adjuvants such as sweeteners, flavoring agents, and fragrances.

[0137] Delivery Various methods can be used to formulate the agents described herein and / or deliver them to the target site. For example, for delivery to the GI tract, the IAPs (and / or additional agents) described herein can be formulated. The GI tract includes organs of the digestive system such as the mouth, esophagus, stomach, duodenum, small intestine, large intestine, and rectum, and all of their subdivisions are included (e.g., the small intestine can include the duodenum, jejunum, and ileum, and the large intestine can include the transverse colon, descending colon, ascending colon, sigmoid colon, and cecum). For example, the IAPs (and / or additional agents) described herein can be formulated for delivery to one or more of the stomach, small intestine, large intestine, and rectum, and all of their subdivisions (e.g., the duodenum, jejunum, and ileum, transverse colon, descending colon, ascending colon, sigmoid colon, and cecum). In certain embodiments, the compositions described herein can be formulated for delivery to the intestine. In certain embodiments, the compositions described herein can be formulated for delivery to the upper GI tract or the lower GI tract. In certain embodiments, the IAPs (and / or additional agents) can be administered to a subject, such as by contacting the mucosal tissue of the GI tract directly or indirectly.

[0138] In certain embodiments, administration of the IAPs (and / or additional agents) is, for example, by oral delivery, nasogastric tube, enteral tube (e.g., an enteral tube or feeding tube, such as a jejunal tube or a gastroduodenal tube), direct injection (e.g., duodenal injection), endoscopy, colonoscopy, sigmoidoscopy, or enema, for administration to the GI tract.

[0139] For example, in certain embodiments, the present disclosure provides a controlled-release formulation comprising at least one IAP (and / or additional agent) that releases a substantial amount of the IAP (and / or additional agent) at one or more sites of the GI tract. For example, the formulation can release at least about 60% of the IAP at one or more sites of the GI tract after gastric passage.

[0140] In certain embodiments, IAP is formulated to be substantially released in the GI tract. In certain embodiments, IAP is formulated to be substantially released in the small intestine. In certain embodiments, IAP is formulated to be substantially released in the large intestine. In certain embodiments, IAP is formulated such that it is not substantially released systemically.

[0141] In certain embodiments, the release-modulated formulations of the present disclosure release at least 60% of the IAP (or additional agent) at one or more sites in the intestine after gastric passage. For example, the release-modulated formulation releases at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the IAP (or additional agent) in the intestine.

[0142] In certain embodiments, the release-modulated formulations of the present disclosure release at least 60% of the IAP (or additional agent) in the small intestine. For example, the release-modulated formulation releases at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the IAP (or additional agent) in the small intestine (e.g., in one or more of the duodenum, jejunum, ileum, and ileocecal region).

[0143] In certain embodiments, the release-modulating formulation of the present disclosure releases at least 60% of the IAP (or additional agent) in the large intestine. For example, the release-modulating formulation releases at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% of the IAP (or additional agent) in the large intestine (e.g., in one or more of the cecum, ascending colon, transverse colon, descending colon, or sigmoid colon, and rectum).

[0144] In certain embodiments, the release-modulating formulation does not substantially release the IAP (or additional agent) in the stomach.

[0145] In certain embodiments, the release-modulating formulation releases IAP (and / or additional agents) above a specific pH. For example, in some embodiments, the release-modulating formulation is substantially stable in an acidic environment and substantially unstable (e.g., rapidly dissolves or is physically unstable) in an environment near neutral to alkaline. In some embodiments, stability indicates substantially no release, while instability indicates substantially release. For example, in some embodiments, the release-modulating formulation is substantially stable at a pH of about 7.0 or less, or about 6.5 or less, or about 6.0 or less, or about 5.5 or less, or about 5.0 or less, or about 4.5 or less, or about 4.0 or less, or about 3.5 or less, or about 3.0 or less, or about 2.5 or less, or about 2.0 or less, or about 1.5 or less, or about 1.0 or less. In some embodiments, the formulation is more stable in the low pH range and thus, for example, does not substantially release in the stomach. In some embodiments, the release-modulating formulation is substantially stable at a pH of about 1 to about 5 or less and substantially unstable at higher pH values. In these embodiments, the release-modulating formulation does not substantially release in the stomach. In these embodiments, the release-modulating formulation substantially releases in the small intestine (e.g., one or more of the duodenum, jejunum, and ileum) and / or the large intestine (e.g., one or more of the cecum, ascending colon, transverse colon, descending colon, and sigmoid colon). In some embodiments, the release-modulating formulation is substantially stable at a pH of about 4 to about 7 or less and as a result is substantially unstable at higher pH values, so it does not substantially release in the stomach and / or proximal small intestine (e.g., one or more of the duodenum, jejunum). In these embodiments, the release-modulating formulation substantially releases in the distal small intestine or large intestine (e.g., one or more of the cecum, ascending colon, transverse colon, descending colon, and sigmoid colon). In some embodiments, the pH values described herein may be adjusted as known in the art depending on the condition of the subject (e.g., fasting or postprandial state).

[0146] In certain embodiments, the release-modulating formulation is substantially stable in gastric fluid and substantially unstable in intestinal fluid, and thus is substantially released in the small intestine (e.g., one or more of the duodenum, jejunum, and ileum) and / or the large intestine (e.g., one or more of the cecum, ascending colon, transverse colon, descending colon, and sigmoid colon).

[0147] In certain embodiments, the release-modulating formulation is stable in gastric fluid or stable in an acidic environment. These release-modulating formulations release about 30 wt% or less of the alkaline phosphatase and / or additional agent in the release-modulating formulation in about 15 minutes, or about 30 minutes, or about 45 minutes, or about 60 minutes, or about 90 minutes in gastric fluid having a pH of about 4 to about 5 or less, or in simulated gastric fluid having a pH of about 4 to about 5 or less. The release-modulating formulations of the present disclosure can release from about 0% to about 30%, about 0% to about 25%, about 0% to about 20%, about 0% to about 15%, about 0% to about 10%, about 5% to about 30%, about 5% to about 25%, about 5% to about 20%, about 5% to about 15%, about 5% to about 10% by weight of the alkaline phosphatase and / or additional agent in the release-modulating formulation in about 15 minutes, or about 30 minutes, or about 45 minutes, or about 60 minutes, or about 90 minutes in gastric fluid having a pH of 4 to 5 or less, or in simulated gastric fluid having a pH of 4 to 5 or less. The release-modulating formulations of the present disclosure can release about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% by weight of the total alkaline phosphatase and / or additional agent in the release-modulating formulation in about 15 minutes, or about 30 minutes, about 45 minutes, about 60 minutes, or about 90 minutes in gastric fluid having a pH of 5 or less, or in simulated gastric fluid having a pH of 5 or less.

[0148] In certain embodiments, the release-modulating formulation is unstable in intestinal fluid. These release-modulating formulations release at least about 70% by weight of the alkaline phosphatase and / or additional agent in the release-modulating formulation in about 15 minutes, about 30 minutes, about 45 minutes, about 60 minutes, or about 90 minutes in intestinal fluid or simulated intestinal fluid. In certain embodiments, the release-modulating formulation is unstable in an environment from near neutral to alkaline. These release-modulating formulations release at least about 70% by weight of the alkaline phosphatase and / or additional agent in the release-modulating formulation in about 15 minutes, about 30 minutes, about 45 minutes, about 60 minutes, or about 90 minutes in intestinal fluid having a pH of about 4-5 or greater or in simulated intestinal fluid having a pH of about 4-5 or greater. Release-modulating formulations that are unstable in an environment near neutral or alkaline release at least 70% by weight of the alkaline phosphatase and / or additional agent in the release-modulating formulation in about 5 minutes to about 90 minutes, about 10 minutes to about 90 minutes, about 15 minutes to about 90 minutes, about 20 minutes to about 90 minutes, about 25 minutes to about 90 minutes, about 30 minutes to about 90 minutes, about 5 minutes to about 60 minutes, about 10 minutes to about 60 minutes, about 15 minutes to about 60 minutes, about 20 minutes to about 60 minutes, about 25 minutes to about 90 minutes, or about 30 minutes to about 60 minutes in a fluid having a pH higher than about 5 (e.g., a fluid having a pH of about 5 to about 14, about 6 to about 14, about 7 to about 14, about 8 to about 14, about 9 to about 14, about 10 to about 14, or about 11 to about 14).

[0149] Examples of simulated gastric fluid and simulated intestinal fluid include, but are not limited to, those disclosed in "Test Solutions" on page 2858 of the 2005 edition of the United States Pharmacopeia 23NF / 28USP, and / or other simulated gastric fluid and simulated intestinal fluid known to those skilled in the art, such as simulated gastric fluid and / or simulated intestinal fluid prepared without enzymes.

[0150] In certain embodiments, the release-modulating formulations of the present disclosure are substantially stable in gruel. For example, in certain embodiments, less than about 50%, less than about 40%, less than about 30%, less than about 20%, or less than about 10% of the IAP activity is lost at about 10 hours, about 9 hours, about 8 hours, about 7 hours, about 6 hours, about 5 hours, about 4 hours, about 3 hours, about 2 hours, or about 1 hour after administration.

[0151] In certain embodiments, the release-modulating formulations of the present disclosure are designed for immediate release (e.g., upon ingestion). In certain embodiments, the release-modulating formulations may have a sustained-release profile, i.e., they may release the active ingredient over an extended period of time in the body (e.g., the GI tract). In certain embodiments, the release-modulating formulations may have a delayed-release profile. That is, the release-modulating formulations do not immediately release the active ingredient upon ingestion, but rather may delay the release of the active ingredient until, for example, the small intestine (e.g., one or more of the duodenum, jejunum, ileum) or the large intestine (e.g., one or more of the cecum, ascending, transverse, descending, or sigmoid colon) by delaying the release of the active ingredient until the composition reaches the lower GI tract. For example, the composition can be enterically coated to delay the release of the active ingredient until it reaches the small intestine or the large intestine.

[0152] Enteric coating In certain embodiments, the formulations of the present disclosure (e.g., IAP as a powder or tablet) are coated to protect the active agent in the GI tract, including the stomach. For example, in certain embodiments, the formulation can be encapsulated in an enteric capsule. Further, in certain embodiments, the formulation itself (e.g., IAP as a powder or tablet) is coated with one or more coatings, e.g., one or more of the release-modulating coatings described herein (e.g., after the step of granulating the powder). Further, in certain embodiments, the powder formulation (e.g., IAP as a powder) can be compressed into a tablet and then enterically coated.

[0153] In certain embodiments, the release-modulating formulations of the present disclosure can utilize one or more release-modulating coatings, such as a delayed-release coating, such that alkaline phosphatase is effectively and, optionally with additional agents, delivered to the GI tract in a delayed but substantially intact manner.

[0154] In certain embodiments, the release-modulating formulations of the present disclosure can utilize one or more release-modulating coatings, such as a delayed-release coating, such that IAP is effectively and, optionally with other additional agents, delivered to the intestine in a delayed but substantially intact manner.

[0155] In certain embodiments, the delayed release coating includes an enteric agent that is substantially stable in an acidic environment and substantially unstable in an environment from near neutral to alkaline. In certain embodiments, the delayed release coating contains an enteric agent that is substantially stable in gastric fluid. Enteric agents can be selected, for example, from copolymers of methacrylic acid, cellulose acetate phthalate, hydroxypropyl methylcellulose phthalate, polyvinyl acetate phthalate, carboxymethyl ethylcellulose, and solutions or dispersions of EUDRAGIT® type polymers (poly(methacrylic acid, methyl methacrylate), hydroxypropyl methylcellulose acetate succinate, cellulose acetate trimellitate, shellac, or other suitable enteric coating polymers). The polymers are described in international pharmacopoeias such as Ph.Eur., USP / NF, DMF, and JPE. Examples of EUDRAGIT® type polymers include EUDRAGIT® FS 30D, L 30 D-55, L 100-55, L 100, L 12.5, L 12.5 P, RL 30 D, RL PO, RL 100, RL 12.5, RS 30 D, RS PO, RS 100, RS 12.5, NE 30 D, NE 40 D, NM 30 D, S 100, S 12.5, and S 12.5 P. Similar polymers include various KOLLICOATs (e.g., polyvinyl alcohol, PEG, and colloidal anhydrous silica) (e.g., Kollicoat® MAE 30 DP or Kollicoat® MAE 100 P), and polymers and formulations of EUDRAGIT (e.g., polymethacrylate-based copolymers).In certain embodiments, one or more of EUDRAGIT® FS 30D, L 30 D-55, L 100-55, L 100, L 12.5, L 12.5 P RL 30 D, RL PO, RL 100, RL 12.5, RS 30 D, RS PO, RS 100, RS 12.5, NE 30 D, NE 40 D, NM 30 D, S 100, S 12.5 S 12.5 P, Kollicoat® MAE 30 DP, and Kollicoat® MAE 100 P are used. In certain embodiments, the enteric solvent may be a combination of the aforementioned solutions or dispersions. In certain embodiments, the delayed release coating comprises the enteric solvent EUDRAGIT® L 100.

[0156] As non-limiting examples, there are various Eudragit formulations that dissolve when the pH rises, such as formulations that dissolve at pH > 5.5 (Eudragit L30 D-550), formulations that dissolve at pH > 6.0 (Eudragit L12,5), and formulations that dissolve at pH > 7.0 (Eudragit FS 30D). Since the ileum has the highest pH in the small intestine, in the range of 7.3 - 7.8, when Eudragit FS 30D is used as an enteric solvent, dissolution is delayed until the ileum, and as a result, the release of IAP can be localized to the ileum. However, since the jejunum has a pH that can range from 6.6 - 7.4, various Eudragit formulations can be used to direct release to this section of the intestine. To achieve targeted delivery and optimize function, different types of Eudragit can be combined with each other, or multiple different types of Eudragit coatings can be combined to fine-tune the dissolution profile. For example, Eudragit L100, Eudragit S100, and triethyl citrate can be mixed together, for example, in a ratio of about 72.7 / 18.2 / 9.1 to form a coating that substantially releases at a pH above about 6.2. In another example, Eudragit L100, Eudragit S100, and triethyl citrate can be mixed together, for example, in a ratio of about 30 / 60.9 / 9 to form a coating that substantially releases at a pH above about 6.7. In a further example, DUOCOAT™ (Kuecept, Ltd.) can be used, which uses two coatings of an enteric polymer (such as Eudragit), an outer layer, and an inner layer of a partially neutralized enteric polymer, and a buffering agent. The DuoCoat™ technology enables more rapid release of therapeutic agents that are initiated at the target pH compared to a single coating of an enteric polymer (Liu et al., 2010, European J. Pharmaceutics and Biopharmaceuticals 47:311, all of which are hereby incorporated by reference in their entirety).Release was demonstrated in 10 healthy volunteers to be directed to the ileum and / or ileocecal region (Varum et al., 2013, European J. Pharmaceutics and Biopharmaceuticals 84:573, all of which are hereby incorporated by reference in their entirety).

[0157] In certain embodiments, one or more coating system additives are used with an enteric solvent. For example, one or more PLASACRYL (e.g., emulsions containing various ratios of anti-tack monoglycerides and diglycerides (glycerol monostearate (GMS)), plasticizers (triethyl citrate (TEC)), and / or stabilizers (polymethacrylate-based copolymers)) additives can be used as anti-tack coating additives, plasticizing additives, and / or stabilizing additives. Exemplary PlasACRYL™ additives include, but are not limited to, PlasACRYL™ HTP20 and PlasACRYL™ T20.

[0158] In certain embodiments, the delayed-release coating can decompose over time, independent of pH and / or the presence of enzymes in solution when in an aqueous solution. Such coatings can include water-insoluble polymers. Thus, its solubility in an aqueous solution is not pH-dependent. As used herein, the term "pH-independent" means that the water permeability of the polymer and the release ability of the pharmaceutical component are not affected by pH and / or have very little dependence on pH. Such coatings can be used, for example, to prepare sustained-release formulations. Suitable water-insoluble polymers include pharmaceutically acceptable non-toxic polymers that are substantially insoluble in aqueous media, such as water, independent of the pH of the solution. Suitable polymers include, but are not limited to, cellulose ethers, cellulose esters, or cellulose ether-esters, i.e., cellulose derivatives in which some of the hydroxy groups on the cellulose backbone are substituted with alkyl groups and some are modified with alkanoyl groups. For example, ethyl cellulose, acetyl cellulose, nitrocellulose, etc. are included. Other examples of insoluble polymers include, but are not limited to, lacquers, and polymers of acrylic acid esters and / or methacrylic acid esters, polymers or copolymers of acrylates or methacrylates with low quaternary ammonium content, or mixtures thereof. Other examples of insoluble polymers include EUDRAGIT RS®, EUDRAGIT RL®, and EUDRAGIT NE®. Insoluble polymers useful in the present disclosure include polyvinyl esters, polyvinyl acetals, polyacrylic acid esters, butadiene styrene copolymers, etc. In certain embodiments, colonic delivery is achieved by using a wax plug that erodes slowly (e.g., various PEGs (e.g., including PEG6000)) or pectin. In certain embodiments, the present disclosure contemplates the use of a delayed-release coating that decomposes over time and includes a swelling layer comprising croscarmellose sodium and hydroxypropyl cellulose.In certain embodiments, the formulation may further comprise an osmotic burst coating comprising ethyl cellulose, such as an ethyl cellulose dispersion.

[0159] Alternatively, the stability of the release-modulating formulation may be enzyme-dependent. An enzyme-dependent sustained-release coating is substantially stable in a fluid that does not contain the specific enzyme and substantially unstable in a fluid that contains the specific enzyme. The sustained-release coating essentially disintegrates or dissolves in a fluid that contains the appropriate enzyme. Enzyme-dependent control can be achieved, for example, by using a material that releases the active ingredient only upon exposure to enzymes in the intestine, such as galactomannan. Also, the stability of the release-modulating formulation may depend on the enzyme stability in the presence of microbial enzymes present in the gut flora. For example, in certain embodiments, the sustained-release coating may be degraded by microbial enzymes present in the gut flora. In certain embodiments, the sustained-release coating may be degraded by bacteria present in the small intestine. In certain embodiments, the sustained-release coating may be degraded by bacteria present in the large intestine.

[0160] In certain embodiments, the release-modulated formulation is designed to be released in the colon. Various colon-specific delivery approaches can be utilized. For example, the release-modulated formulation can be formulated using a colon-specific drug delivery system (CODES) as described in, for example, Li et al., AAPS PharmSciTech (2002), 3(4):1-9, which is hereby incorporated by reference in its entirety. Drug release in such systems is induced by the colonic microflora in combination with a pH-sensitive polymer coating. For example, the formulation can be designed as a core tablet having three polymer layers. The first coating is an acid-soluble polymer (e.g., EUDRAGIT E), and the outer coating is enteric, along with a hydroxypropylmethylcellulose barrier layer sandwiched therebetween. In certain embodiments, colon delivery can be achieved by formulating an alkaline phosphatase (and / or additional agent) with a specific polymer that degrades in the colon, such as pectin. Pectin may be further gelled or cross-linked with a cation such as a zinc cation. In certain embodiments, the formulation is in the form of ionically cross-linked pectin beads further coated with a polymer (e.g., an EUDRAGIT polymer). Additional colon-specific formulations include, but are not limited to, pressure-controlled drug delivery systems (e.g., prepared using ethylcellulose) and osmotic pressure-controlled drug delivery systems (i.e., ORDS-CT).

[0161] Formulations for colonic-specific delivery of IAP (and / or additional agents) as described herein can be evaluated, for example, using in vitro dissolution tests. For example, parallel dissolution tests in different buffers can be performed to characterize the behavior of the formulation at different pH levels. Alternatively, in vitro enzyme tests may be performed. For example, the formulation can be incubated in a fermenter containing an appropriate medium for bacteria, and the amount of drug released at different time intervals can be measured. The drug release study can also be performed in a buffered medium containing enzymes or cecal contents of rats or guinea pigs or rabbits, and the amount of drug released at a specific time can be determined. In certain embodiments, in vivo evaluations may be performed using animal models such as dogs, guinea pigs, rats, and pigs. Further, the clinical evaluation of colonic-specific drug delivery formulations can be performed by calculating a drug delivery index (DDI) that takes into account the relative ratio of RCE (relative colonic tissue exposure to the drug) to RSC (relative amount of drug in the blood, i.e., relative systemic exposure to the drug). The higher the drug DDI, the better the colonic drug delivery. The absorption of the drug from the colon can be monitored by colonoscopy and intubation.

[0162] In certain embodiments, the formulation allows for substantially uniform dissolution of IAP (and / or additional agents) in the release region within the GI tract. In certain embodiments, the formulation minimizes patchy or non-uniform release of IAP.

[0163] In certain embodiments, the present disclosure provides a release-modulated formulation that releases multiple doses of IAP at different locations, different times, and / or different pHs along the intestine. In certain embodiments, the release-modulated formulation comprises a first dose of IAP and a second dose of IAP, wherein the first dose and the second dose are released at different locations, different times, and / or different pHs along the intestine. For example, the first dose is released in the duodenum and the second dose is released in the ileum. In another example, the first dose is released in the jejunum and the second dose is released in the ileum. In another aspect, the first dose is released at a location along the small intestine (e.g., the duodenum), while the second dose is released along the large intestine (e.g., within the ascending colon). In certain embodiments, the release-modulated formulation can release at least one dose, at least two doses, at least three doses, at least four doses, at least five doses, at least six doses, at least seven doses, or at least eight doses of IAP at different locations, different times, and / or different pHs along the intestine.

[0164] In certain embodiments, the formulations of the present disclosure take the form of the formulations described in one or more of U.S. Patent Nos. 8,535,713 and 8,911,777, and U.S. Patent Application Publication Nos. 2012 / 0141585, 2012 / 0141531, 2006 / 001896, 2007 / 0292523, 2008 / 0020018, 2008 / 0113031, 2010 / 0203120, 2010 / 0255087, 2010 / 0297221, 2011 / 0052645, 2013 / 0243873, 2013 / 0330411, 2014 / 0017313, and 2014 / 0234418, the entireties of which are incorporated herein by reference.

[0165] In certain embodiments, the formulations of the present disclosure take the form of formulations described in U.S. Patent Nos. 4,196,564; 4,196,565; 4,247,006; 4,250,997; 4,268,265; 5,317,849; 6,572,892; 7,712,634; 8,074,835; 8,398,912; 8,440,224; 8,557,294; 8,646,591; 8,739,812; 8,810,259; 8,852,631; 8,911,788; and U.S. Patent Application Publication Nos. 2014 / 0302132; 2014 / 0227357; 20140088202; 20130287842; 2013 / 0295188; 2013 / 0307962; and 20130184290, the entireties of which are incorporated herein by reference.

[0166] In certain embodiments, the process of formulating the IAP is gentle enough so that the tertiary structure (e.g., dimeric structure) of the IAP is substantially retained. In certain embodiments, the process of formulating the IAP includes a step of refolding the IAP. In such embodiments, the step of refolding the IAP can include the addition of magnesium and / or cyclodextrin.

[0167] In certain embodiments, the controlled release formulation is a controlled release powder formulation.

[0168] In certain embodiments, a controlled release formulation comprising an IAP and its variants and / or additional agents described herein is administered orally.

[0169] Dosage forms suitable for oral administration include, for example, solid dosage forms such as tablets, capsules, powders, and granules. In certain embodiments, the release-modulating formulation is in the form of a powder. In certain embodiments, the powder formulation of the present disclosure can be added to foods (e.g., fruit juices, fortified foods and / or pureed foods (e.g., fruits, vegetables), sauces, artificial nutritional milks, milk, etc.). In certain embodiments, the release-modulating formulation is packaged in the form of sachets. In certain embodiments, the release-modulating formulation is in the form of a tablet. In certain embodiments, the release-modulating formulation is in the form of a tablet containing a powder. In certain embodiments, the release-modulating formulation is in the form of a capsule. In certain embodiments, the release-modulating formulation is in the form of a capsule containing a powder.

[0170] In certain embodiments, the release-modulating formulation of the present disclosure is in the form of a powder. In certain embodiments, the powder is produced by spray drying and / or spray drying dispersion (SDD) techniques. In certain embodiments, the powder containing IAP is produced by dissolving IAP and a polymer in a solvent and then spray drying the solution. The powder thus obtained contains IAP dispersed in a solid polymer matrix.

[0171] Various types of polymers can be used in the release-modulating formulations of the present disclosure. In certain embodiments, the polymer is an enteric polymer that is substantially stable in an acidic environment and substantially unstable in an environment ranging from near neutral to alkaline. In certain embodiments, the enteric polymer is substantially stable in gastric juice.

[0172] Exemplary polymers include, but are not limited to, copovidone, polyvinyl caprolactam-polyvinyl acetate-polyethylene glycol copolymer, poly(vinylpyrrolidone) (PVP), hydroxypropyl methylcellulose or hypromellose (HPMC), hypromellose phthalate (HPMCP), hydroxypropyl methylcellulose or hypromellose acetate succinate (HPMCAS), methacrylate / methacrylic acid copolymer, and mixtures thereof. In certain embodiments, the polymer is HPMCAS. In certain embodiments, the polymer is HPMCAS LF, LG, MF, HF, or HG. In certain embodiments, the polymer is HPMCAS-LF.

[0173] In certain embodiments, the controlled release formulation further comprises a single-layer enteric coating, and the weight gain rate of the enteric polymer is about 20-40%, optionally about 26.3%. In certain embodiments, the capsule comprises gelatin or hydroxypropyl methylcellulose.

[0174] Buffering agent In certain embodiments, various types of solvents or buffering agents are used to prepare the powders of the present disclosure. In certain embodiments, the solvent / buffering agent is an organic solvent or an organic buffering agent. Exemplary solvents or buffering agents that can be used to dissolve IAP and the polymer prior to spray drying include, but are not limited to, ethanol, methanol, acetone, IPA, tetrahydrofuran, dichloromethane, and mixtures thereof. In certain embodiments, the solvent used is water such as distilled water or DI water.

[0175] In certain embodiments, various buffers are used, such as Good's buffers (e.g., MES, ADA, PIPES, ACES, MOPSO, chloramine chloride, MOPS, BES, TES, HEPES, DIPSO, TAPSO, acetamidoglycine, POPSO, HEPPSO, HEPPS, tricine, tris, glycine amide, glycylglycine, bicine, and / or TAPS), and salts of these buffers. In certain embodiments, the buffer includes, as non-limiting examples, amino acid buffers such as histidine, arginine, and / or cysteine. In certain embodiments, the buffer includes phosphate buffered saline (PBS). In certain embodiments, various salts are used, such as, as non-limiting examples, potassium chloride, sodium chloride, calcium chloride, magnesium chloride, sodium sulfate, calcium sulfate, and / or magnesium sulfate. In certain embodiments, the buffer and / or salt includes any one combination of potassium chloride, phosphoric acid, calcium chloride, magnesium sulfate, potassium phosphate (monobasic and / or dibasic), and / or sodium phosphate (monobasic and / or dibasic). In certain embodiments, the buffer used is sodium phosphate monobasic monohydrate. In certain embodiments, the buffer used includes arginine and phosphate.

[0176] In certain embodiments, enzyme cofactors including zinc and magnesium are used. In certain embodiments, the enzyme cofactor zinc is used. In certain embodiments, zinc is provided as zinc sulfate heptahydrate. In certain embodiments, the enzyme cofactor magnesium is used. In certain embodiments, magnesium is provided as magnesium sulfate heptahydrate.

[0177] In certain embodiments, the formulation includes protein stabilizers such as trehalose, sucrose, lactose, mannitol, Tween80, or polyvinyl alcohol. In certain embodiments, the stabilizer is sucrose. In certain embodiments, the stabilizer is lactose.

[0178] In an embodiment, a surfactant may be included to prepare the powder of the present disclosure. The surfactant may be used as a solubilizer or an emulsifier. Exemplary surfactants include, but are not limited to, vitamin E polyethylene glycol succinate, sorbitan monostearate - 60 / 80, polysorbate 20, polysorbate 80, and polyoxyl 40 hydrogenated castor oil.

[0179] In certain embodiments, the powder containing IAP gels. In certain embodiments, the powder containing IAP gels in the intestine. In certain embodiments, IAP is released from the gel to one or more sites in the intestine. In certain embodiments, at a pH value of about 5 or greater (e.g., about 5, about 6, about 7, about 8, or about 9), the gel returns to the solution phase and releases the AP enzyme. In certain embodiments, a gel is used to control the release of IAP in the intestine. In certain embodiments, IAP is released from the gel to one or more of the group consisting of the small intestine, duodenum, jejunum, ileum, large intestine, transverse colon, descending colon, ascending colon, sigmoid colon, cecum, and rectum.

[0180] In certain embodiments, the formulations of the present disclosure are in the form of a powder comprising IAP dispersed within a solid polymer matrix. In certain embodiments, the powder is formed by dissolving the IAP and the polymer in a solvent to form a solution and spray drying the solution. In certain embodiments, the solution for spray drying comprises from about 0.1% to 1% by weight of IAP. For example, from about 0.1%, about 0.15%, about 0.2%, about 0.25%, about 0.3%, about 0.35%, about 0.4%, about 0.45%, about 0.5%, about 0.55%, about 0.6%, about 0.65%, about 0.7%, about 0.75%, about 0.8%, about 0.85%, about 0.9%, about 0.95%, or about 1.0% by weight of IAP may be included. In certain embodiments, the solution comprises from about 1% to 10% by weight of a polymer (e.g., HPMCAS-LF). For example, from about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% by weight of the polymer may be included. In certain embodiments, the solution comprises from about 0.05% to 0.5% by weight of a buffer (e.g., sodium dihydrogen phosphate monohydrate). For example, from about 0.05%, about 0.06%, about 0.07%, about 0.08%, about 0.09%, about 0.10%, about 0.11%, about 0.12%, about 0.13%, about 0.14%, about 0.15%, about 0.16%, about 0.17%, about 0.18%, about 0.19%, about 0.20%, about 0.25%, about 0.30%, about 0.35%, about 0.40%, about 0.45%, or about 0.50% by weight of the buffer may be included. In certain embodiments, the solution comprises from about 0.001% to 0.01% by weight of zinc (e.g., zinc sulfate heptahydrate). For example, from about 0.001%, about 0.002%, about 0.003%, about 0.004%, about 0.005%, about 0.006%, about 0.007%, about 0.008%, about 0.009%, or about 0.01% by weight of zinc may be included. In certain embodiments, the solution comprises from about 0.01% to 0.1% by weight of magnesium (e.g., magnesium sulfate heptahydrate). For example, from about 0.01%, about 0.02%, about 0.03%, about 0.04%, about 0.05%, about 0.06%, about 0.07%, about 0.08%, about 0.09%, or about 0.1% by weight of magnesium may be included. In some embodiments, the solution comprises from about 0.1% to 1% by weight of a protein stabilizer (e.g., trehalose).For example, about 0.1%, about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, or about 1% by weight of a protein stabilizer may be included. In certain embodiments, the solution contains about 90-99.9% by weight of a solvent (e.g., water). For example, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% by weight of a solvent may be included.

[0181] In certain embodiments, IAP is formulated into a release control formulation that includes at least one release control pellet. In certain embodiments, the formulation is a release control formulation that includes at least one release control pellet containing IAP. In certain embodiments, the release control formulation releases a substantial amount of IAP in the GI tract. In certain embodiments, each release control pellet contains about 1-10% by weight of IAP, about 75-95% by weight of sucrose spheres, about 5-15% by weight of hydroxypropyl cellulose, and about 0.5-2% by weight of a buffer salt. In certain embodiments, each release control pellet contains about 5% by weight of IAP, about 85% by weight of sucrose spheres, about 9% by weight of hydroxypropyl cellulose, and about 1% by weight of a buffer salt. In certain embodiments, each release control pellet contains about 4.7% by weight of IAP, about 84.9% by weight of sucrose spheres, about 9.3% by weight of hydroxypropyl cellulose, and about 1.2% by weight of a buffer salt.

[0182] In certain embodiments, the release control formulation of the present disclosure is in the form of a tablet or capsule. In certain embodiments, the release control formulation is in the form of a tablet or capsule containing the powder of the present disclosure. Various approaches can be utilized to incorporate the powder of the present disclosure in the preparation of tablets or capsules. In certain embodiments, the tablets of the present disclosure are made by granulation such as dry granulation. In such embodiments, the powder is pre-compressed and the resulting tablets or slugs are crushed to obtain granules. Alternatively, the powder is pre-compressed with a pressure roll to obtain granules. In yet another embodiment, the powder is encapsulated in a capsule. In certain embodiments, the capsule is a gelatin capsule such as a hard gelatin capsule. In certain embodiments, the capsule is a hydroxypropyl methylcellulose (HPMC) capsule.

[0183] In certain embodiments, tablets or capsules include a delayed-release coating that includes an enteric solvent that is substantially stable in an acidic environment and substantially unstable in a neutral to alkaline environment. In certain embodiments, the delayed-release coating contains an enteric solvent that is substantially stable in gastric fluid. Enteric solvents can be selected, for example, from copolymers of methacrylic acid, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, polyvinyl acetate phthalate, carboxymethylethylcellulose, and solutions or dispersions of EUDRAGIT® type polymers (poly(methacrylic acid, methyl methacrylate), hydroxypropylmethylcellulose acetate succinate, cellulose acetate trimellitate, shellac, or other suitable enteric coating polymers). Polymers are described in international pharmacopoeias such as Ph.Eur., USP / NF, DMF, and JPE. EUDRAGIT® type polymers include, for example, EUDRAGIT® FS 30D, L 30 D-55, L 100-55, L 100, L 12,5, L 12,5 P, RL 30 D, RL PO, RL 100, RL 12,5, RS 30 D, RS PO, RS 100, RS 12,5, NE 30 D, NE 40 D, NM 30 D, S 100, S 12,5, and S 12,5 P. Similar polymers include Kollicoat® MAE 30 DP and Kollicoat® MAE 100 P. In certain embodiments, one or more of EUDRAGIT® FS 30D, L 30 D-55, L 100-55, L 100, L 12,5, L 12,5 P RL 30 D, RL PO, RL 100, RL 12,5, RS 30 D, RS PO, RS 100, RS 12,5, NE 30 D, NE 40 D, NM 30 D, S 100, S 12,5 S 12,5 P, Kollicoat® MAE 30 DP, and Kollicoat® MAE 100 P are used. In certain embodiments, the enteric solvent may be a combination of the aforementioned solutions or dispersions. In certain embodiments, the delayed-release coating includes the enteric solvent EUDRAGIT® L 100.In certain embodiments, the tablets or capsules are coated with an enteric coating at about 1-20% of the coating weight, e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, or about 20% of the coating weight.

[0184] Administration and Dosage It is understood that the actual dosage of IAP (and / or additional agent) administered in accordance with the present disclosure will vary depending on the particular compound, particular dosage form, and mode of administration. One of ordinary skill in the art can consider a number of factors that can affect the action of IAP (e.g., body weight, gender, diet, administration time, route of administration, rate of excretion, condition of the subject, concomitant medications, genetic factors, and responsiveness). Administration can be carried out continuously or in one or more discrete administrations within the maximum tolerated dose. One of ordinary skill in the art can use conventional dosage administration tests to determine the optimal dosing rate for a given set of conditions.

[0185] The individual dosages of IAP (and / or additional agents) can be administered, for example, in unit dosage forms (e.g., tablets or capsules) containing from about 0.01 mg to about 1,000 mg, from about 0.01 mg to about 900 mg, from about 0.01 mg to about 800 mg, from about 0.01 mg to about 700 mg, from about 0.01 mg to about 600 mg, from about 0.01 mg to about 500 mg, from about 0.01 mg to about 400 mg, from about 0.01 mg to about 300 mg, from about 0.01 mg to about 200 mg, from about 0.1 mg to about 100 mg, from about 0.1 mg to about 90 mg, from about 0.1 mg to about 80 mg, from about 0.1 mg to about 70 mg, from about 0.1 mg to about 60 mg, from about 0.1 mg to about 50 mg, from about 0.1 mg to about 40 mg, from about 0.1 mg to about 30 mg, from about 0.1 mg to about 20 mg, from about 0.1 mg to about 10 mg, from about 0.1 mg to about 5 mg, from about 0.1 mg to about 3 mg, or from about 0.1 mg to about 1 mg of the active ingredient per unit dosage.For example, the unit dosage form can be about 0.01 mg, about 0.02 mg, about 0.03 mg, about 0.04 mg, about 0.05 mg, about 0.06 mg, about 0.07 mg, about 0.08 mg, about 0.09 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 26 mg, about 27 mg, about 28 mg, about 29 mg, about 30 mg, about 31 mg, about 32 mg, about 33 mg, about 34 mg, about 35 mg, about 36 mg, about 37 mg, about 38 mg, about 39 mg, about 40 mg, about 41 mg, about 42 mg, about 43 mg, about 44 mg, about 45 mg, about 46 mg, about 47 mg, about 48 mg, about 49 mg, about 50 mg, about 51 mg, about 52 mg, about 53 mg, about 54 mg, about 55 mg, about 56 mg, about 57 mg, about 58 mg, about 59 mg, about 60 mg, about 61 mg, about 62 mg, about 63 mg, about 64 mg, about 65 mg, about 66 mg, about 67 mg, about 68 mg, about 69 mg, about 70 mg, about 71 mg, about 72 mg, about 73 mg, about 74 mg, about 75 mg, about 76 mg, about 77 mg, about 78 mg, about 79 mg, about 80 mg, about 81 mg, about 82 mg, about 83 mg, about 84 mg, about 85 mg, about 86 mg, about 87 mg, about 88 mg, about 89 mg, about 90 mg, about 91 mg, about 92 mg, about 93 mg, about 94 mg, about 95 mg, about 96 mg, about 97 mg, about 98 mg, about 99 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about 1,000 mg of IAP (including all values within these ranges).

[0186] In certain embodiments, the IAP (and / or additional agent) is administered in an amount of about 0.01 mg to about 1,000 mg per day, about 0.01 mg to about 900 mg per day, about 0.01 mg to about 800 mg per day, about 0.01 mg to about 700 mg per day, about 0.01 mg to about 600 mg per day, about 0.01 mg to about 500 mg per day, about 0.01 mg to about 400 mg per day, about 0.01 mg to about 300 mg per day, about 0.01 mg to about 200 mg per day, about 0.01 mg to about 100 mg per day, about 0.1 mg to about 100 mg per day, about 0.1 mg to about 95 mg per day, about 0.1 mg to about 90 mg per day, about 0.1 mg to about 85 mg per day, about 0.1 mg to about 80 mg per day, about 0.1 mg to about 75 mg per day, about 0.1 mg to about 70 mg per day, about 0.1 mg to about 65 mg per day, about 0.1 mg to about 60 mg per day, about 0.1 mg to about 55 mg per day, about 0.1 mg to about 50 mg per day, about 0.1 mg to about 45 mg per day, about 0.1 mg to about 40 mg per day, about 0.1 mg to about 35 mg per day, about 0.1 mg to about 30 mg per day, about 0.1 mg to about 25 mg per day, about 0.1 mg to about 20 mg per day, about 0.1 mg to about 15 mg per day, about 0.1 mg to about 10 mg per day, about 0.1 mg to about 5 mg per day, about 0.1 mg to about 3 mg per day, about 0.1 mg to about 1 mg per day, or about 5 mg to about 80 mg per day.In one embodiment, the IAP is administered in a daily dose of about 0.01 mg, about 0.02 mg, about 0.03 mg, about 0.04 mg, about 0.05 mg, about 0.06 mg, about 0.07 mg, about 0.08 mg, about 0.09 mg, about 0.1 mg, about 0.2 mg, about 0.3 mg, about 0.4 mg, about 0.5 mg, about 0.6 mg, about 0.7 mg, about 0.8 mg, about 0.9 mg, about 1 mg, about 2 mg, about 3 mg, about 4 mg, about 5 mg, about 6 mg, about 7 mg, about 8 mg, about 9 mg, about 10 mg, about 11 mg, about 12 mg, about 13 mg, about 14 mg, about 15 mg, about 16 mg, about 17 mg, about 18 mg, about 19 mg, about 20 mg, about 21 mg, about 22 mg, about 23 mg, about 24 mg, about 25 mg, about 26 mg, about 27 mg, about 28 mg, about 29 mg, about 30 mg, about 31 mg, about 32 mg, about 33 mg, about 34 mg, about 35 mg, about 36 mg, about 37 mg, about 38 mg, about 39 mg, about 40 mg, about 41 mg, about 42 mg, about 43 mg, about 44 mg, about 45 mg, about 46 mg, about 47 mg, about 48 mg, about 49 mg, about 50 mg, about 51 mg, about 52 mg, about 53 mg, about 54 mg, about 55 mg, about 56 mg, about 57 mg, about 58 mg, about 59 mg, about 60 mg, about 61 mg, about 62 mg, about 63 mg, about 64 mg, about 65 mg, about 66 mg, about 67 mg, about 68 mg, about 69 mg, about 70 mg, about 71 mg, about 72 mg, about 73 mg, about 74 mg, about 75 mg, about 76 mg, about 77 mg, about 78 mg, about 79 mg, about 80 mg, about 81 mg, about 82 mg, about 83 mg, about 84 mg, about 85 mg, about 86 mg, about 87 mg, about 88 mg, about 89 mg, about 90 mg, about 91 mg, about 92 mg, about 93 mg, about 94 mg, about 95 mg, about 96 mg, about 97 mg, about 98 mg, about 99 mg, about 100 mg, about 200 mg, about 300 mg, about 400 mg, about 500 mg, about 600 mg, about 700 mg, about 800 mg, about 900 mg, or about 1,000 mg (including all values within these ranges).

[0187] In certain embodiments, the appropriate dosage of IAP (and / or additional agent) is in the range of from about 0.01 mg / kg to about 100 mg / kg per subject body weight, from about 0.01 mg / kg to about 90 mg / kg per subject body weight, from about 0.01 mg / kg to about 80 mg / kg per subject body weight, from about 0.01 mg / kg to about 70 mg / kg per subject body weight, from about 0.01 mg / kg to about 60 mg / kg per subject body weight, from about 0.01 mg / kg to about 50 mg / kg per subject body weight, from about 0.01 mg / kg to about 40 mg / kg per subject body weight, from about 0.01 mg / kg to about 30 mg / kg per subject body weight, from about 0.01 mg / kg to about 20 mg / kg per subject body weight, from about 0.01 mg / kg to about 10 mg / kg per subject body weight, for example, about 0.01 mg / kg, about 0.02 mg / kg, about 0.03 mg / kg, about 0.04 mg / kg, about 0.05 mg / kg, about 0.06 mg / kg, about 0.07 mg / kg, about 0.08 mg / kg, about 0.09 mg / kg, about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, about 1 mg / kg, about 1.1 mg / kg, about 1.2 mg / kg, about 1.3 mg / kg, about 1.4 mg / kg, about 1.5 mg / kg, about 1.6 mg / kg, about 1.7 mg / kg, about 1.8 mg / kg, 1.9 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, about 10 mg / kg body weight, about 20 mg / kg body weight, about 30 mg / kg body weight, about 40 mg / kg body weight, about 50 mg / kg body weight, about 60 mg / kg body weight, about 70 mg / kg body weight, about 80 mg / kg body weight, about 90 mg / kg body weight, or about 100 mg / kg body weight (including all values within these ranges).In another aspect, an appropriate dosage of IAP is within the range of about 0.01 mg / kg to about 10 mg / kg body weight, within the range of about 0.01 mg / kg to about 9 mg / kg body weight, within the range of about 0.01 mg / kg to about 8 mg / kg body weight, within the range of about 0.01 mg / kg to about 7 mg / kg body weight, 0.01 mg / kg to about 6 mg / kg body weight, within the range of about 0.05 mg / kg to about 5 mg / kg body weight, within the range of about 0.05 mg / kg to about 4 mg / kg body weight, within the range of about 0.05 mg / kg to about 3 mg / kg body weight, within the range of about 0.05 mg / kg to about 2 mg / kg body weight, within the range of about 0.05 mg / kg to about 1.5 mg / kg body weight, or within the range of about 0.05 mg / kg to about 1 mg / kg body weight.

[0188] According to certain embodiments of the present disclosure, IAP (and / or additional agents) can be administered, for example, more than 2 times a day (e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10 times a day), about 1 time a day, approximately once every 2 days, approximately once every 3 days, approximately once a week, approximately once every 2 weeks, approximately once a month, approximately once every 2 months, approximately once every 3 months, approximately once every 6 months, or approximately once a year.

[0189] In certain embodiments, IAP is administered multiple times. In certain embodiments, IAP is administered by multiple oral administrations. In certain embodiments, the dosage of IAP is set based on the amount of IAP recovered in a biological sample (e.g., as present in feces, blood, etc.) of the subject to be treated. In certain embodiments, the dosage of IAP is adjusted based on the severity and / or presence of one or more symptoms.

[0190] Method of treatment There are two main goals in the medical treatment of ulcerative colitis. Namely, to achieve remission and then to maintain remission. In certain embodiments, achieving remission includes controlling or resolving the inflammation that leads to the resolution of symptoms.

[0191] In certain embodiments, the IAPs (and / or additional agents) of the present disclosure are co-administered. Co-administration may be performed simultaneously or sequentially.

[0192] In certain embodiments, the methods and uses of the present disclosure include the use (including co-administration or sequential administration) of IAPs (and / or additional agents) as adjuvants to either of these initial and / or adjuvant therapies. In certain embodiments, the methods and uses of the present disclosure include administration of the IAPs (and / or additional agents) described herein to a subject undergoing initial and / or adjuvant therapy.

[0193] In certain embodiments, the IAP is referred to as "SYN-20". In certain embodiments, "SYN-20" herein refers to a recombinant bIAP II having a stop codon and no leader sequence, as annotated in SEQ ID NO: 11. In certain embodiments, SYN-20 is produced in mammalian cell lines, such as non-bovine cell lines such as CHO cells. In certain embodiments, SYN-20 is glycosylated on one or more residues. In certain embodiments, SYN-20 is sialylated at the terminus on one or more glycosylation structures. In certain embodiments, SYN-20 has structural / functional features that allow for effective administration at lower doses than would be required for other APs.

[0194] In certain embodiments, the IAPs of the present disclosure are co-administered with, for example, one or more additional therapeutic agents as described herein. Co-administration may be performed simultaneously or sequentially. In certain embodiments, the IAPs of the present disclosure can be administered with or without additional agents. In certain embodiments, the methods and uses of the present disclosure include the use (including co-administration or sequential administration) of IAPs as adjuvants to either of these initial and / or adjuvant therapies. In certain embodiments, the methods and uses of the present disclosure include administration of the IAPs described herein to a subject undergoing initial and / or adjuvant therapy.

[0195] In certain embodiments, the method includes administering IAP formulated to be substantially released in the GI tract. In certain embodiments, the method includes administering IAP formulated to be substantially released in the small intestine. In certain embodiments, the method includes administering IAP formulated to be substantially released in the large intestine. In certain embodiments, the method includes administering IAP formulated such that it is not substantially released systemically. In certain embodiments, IAP formulated such that it is not substantially released systemically means that no detectable IAP is found in biological samples such as blood, serum, etc., excluding feces and intestinal lumen samples.

[0196] In certain embodiments, the method includes administering a recombinant IAP having an amino acid sequence with at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% or more sequence identity to any one of SEQ ID NOs: 1-14.

[0197] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 15 mg of an AP-based agent (e.g., IAP, or other AP-based agents described herein, and variants thereof). The capsule contains enteric-coated multiple AP-based agent-containing pellets. In such embodiments, the formulation contains about 10.0 wt% of an AP-based agent (e.g., IAP, or other AP-based agents described herein, and variants thereof), about 38.9 wt% of sucrose spheres, about 20.0 wt% of hydroxypropylcellulose (HPC), about 0.3 wt% of a buffer salt, about 26.3 wt% of an enteric polymer (e.g., EUDRAGIT L 30 D-55), and about 4.5 wt% of HTP-20 (e.g., PLASACRYL HTP 20).

[0198] In certain embodiments, the formulation of the present invention is in the form of a capsule (e.g., a hard gelatin capsule or an HPMC capsule) containing about 5 mg of an AP-based drug (e.g., IAP, or other AP-based drugs described herein, and variants thereof). The capsule contains a plurality of enteric-coated AP-based drug-containing pellets. In such embodiments, the formulation comprises about 10.0 wt% of an AP-based drug (e.g., IAP, or other AP-based drugs described herein, and variants thereof), about 38.9 wt% of sucrose spheres, about 20.0 wt% of hydroxypropylcellulose (HPC), about 0.3 wt% of a buffer salt, about 26.3 wt% of an enteric polymer (e.g., EUDRAGIT L 30 D-55), and about 4.5 wt% of HTP-20 (e.g., PLASACRYL HTP 20).

[0199] In certain embodiments, one or more pharmaceutically acceptable excipients comprise about 1-10% or at least about 1-10% of glycerol monostearate (GMS), triethyl citrate (TEC), and / or a polymethacrylate copolymer. In certain embodiments, the capsule comprises gelatin or hydroxypropylmethylcellulose.

[0200] In certain embodiments, IAP and / or an additional drug is co-formulated with, for example, one or more additional drugs intended to address the symptoms of IAP or the disease or disorder treated by IAP described herein.

[0201] In some embodiments, the terms "patient" and "subject" are used interchangeably. In certain embodiments, the subject and / or animal is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, panda, horse, cow, pig, rabbit, sheep, or a non-human primate such as a monkey, chimpanzee, or baboon. In another aspect, the subject and / or animal is a non-mammal, e.g., a zebrafish, goldfish, turtle, or iguana.

[0202] In certain embodiments, the methods of the present disclosure are useful for treating human patients. In certain embodiments, the human is a pediatric patient. In certain embodiments, the human is an adult. In another aspect, the human is an elderly patient. In certain embodiments, the human is female. In certain embodiments, the human is male.

[0203] In certain embodiments, the human patient is less than about 1 year old to about 1 year old, including neonates, 1 year old to about 18 months old, about 18 to about 36 months old, about 1 to about 5 years old, about 5 to about 10 years old, about 10 to about 15 years old, about 15 to about 20 years old, about 20 to about 25 years old, about 25 to about 30 years old, about 30 to about 35 years old, about 35 to about 40 years old, about 40 to about 45 years old, about 45 to about 50 years old, about 50 to about 55 years old, about 55 to about 60 years old, about 60 to about 65 years old, about 65 to about 70 years old, about 70 to about 75 years old, about 75 to about 80 years old, about 80 to about 85 years old, about 85 to about 90 years old, about 90 to about 95 years old, or about 95 to about 100 years old, about 100 years old to about 105 years old, about 105 years old to about 110 years old, about 110 years old to about 115 years old, about 115 years old to about 120 years old, about 120 years old to about 125 years old, about 125 years old to about 130 years old, about 130 years old to about 135 years old, about 135 years old to about 140 years old, about 140 years old to about 145 years old, about 145 years old to about 150 years old.

[0204] Additional Agents and Combination Therapies Administration of the compositions and formulations of the present disclosure comprising IAP (and / or additional agents) may be combined with additional agents. In certain embodiments, the agent(s) helps prevent and / or reduce side effects in the patient, such as, but not limited to, side effects mediated by UC treatment. Co - administration of the additional agent(s) with the composition / formulation may be carried out simultaneously or sequentially. Further, the composition / formulation may include the additional agent(s) (e.g., by co - formulation). For example, an additional agent and IAP may be combined as a single formulation. Alternatively, the additional agent and IAP may be formulated separately.

[0205] In certain embodiments, the additional agent and IAP are administered to the subject simultaneously. As used herein, the term "simultaneously" means that the additional agent and IAP are administered within about 60 minutes, for example, within about 30 minutes, within about 20 minutes, within about 10 minutes, within about 5 minutes, or within about 1 minute of each other. Administration of the additional agent and IAP can be by co-administration of a single formulation (e.g., a formulation comprising the additional agent and IAP) or separate formulations (e.g., a first formulation comprising the additional agent and a second formulation comprising IAP).

[0206] In certain embodiments, the additional agent and IAP are administered to the subject simultaneously, but release from their respective dosage forms (or a single unit dosage form if co-formulated) can occur sequentially.

[0207] The additional agent and IAP do not need to be administered simultaneously so long as their administration is timed such that the pharmacological activities of the additional agent and IAP overlap in time. For example, the additional agent and IAP (and / or the additional agent) can be administered sequentially. As used herein, the term "sequentially" means that the additional agent and IAP are administered at intervals greater than about 60 minutes. For example, the time between sequential administrations of the additional agent and IAP can be separated by more than about 60 minutes, more than about 2 hours, more than about 5 hours, more than about 10 hours, more than about 1 day, more than about 2 days, more than about 3 days, or more than about 1 week. The optimal administration times depend on the metabolic and excretion rates and / or pharmacodynamic activities of the additional agent and IAP being administered. Either the additional agent or IAP can be administered first.

[0208] Co-administration does not require that the additional agent and IAP be administered to the subject by the same route of administration. Rather, each therapeutic agent can be administered by any suitable route, e.g., parenterally or by a route other than parenteral administration.

[0209] In certain embodiments, the additional agent is an anti-inflammatory agent. In certain embodiments, the anti-inflammatory agent is 5-aminosalicylate or a corticosteroid. In certain embodiments, the 5-aminosalicylate is selected from sulfasalazine (e.g., AZULFIDINE), mesalamine (e.g., ASACOL HD, DELZICOL), balsalazide (e.g., COLAZAL), and olsalazine (e.g., DIPENTUM). In certain embodiments, the corticosteroid is selected from dexamethasone (e.g., OZURDEX, MAXIDEX), hydrocortisone (e.g., HYDROCORT, ALPHOSYL, AQUACORT, CORTEF), methylprednisolone (e.g., MEDROL), and prednisone (e.g., DELTASONE, RAYOS).

[0210] In certain embodiments, the additional agent is an immunosuppressive agent. In certain embodiments, the immunosuppressive agent is selected from azathioprine (e.g., AZASAN, IMURAN), mercaptopurine (e.g., PURINETHOL, PURIXAN), cyclosporine (e.g., GENGRAF, NEORAL, SANDIMMUNE), and tofacitinib (XELJANZ).

[0211] In certain embodiments, the additional agent is a biological agent. In certain embodiments, the biological agent is an antibody. In certain embodiments, the biological agent is a monoclonal antibody. In certain embodiments, the biological agent is a tumor necrosis factor (TNF) inhibitor. In certain embodiments, the TNF inhibitor is a monoclonal antibody against TNF-alpha (e.g., anti-TNFα). In certain embodiments, the anti-TNFα is selected from infliximab (REMICADE), adalimumab (HUMIRA), and golimumab (SIMPONI). In certain embodiments, the biological agent is an integrin α4β modulator. In certain embodiments, the integrin α4β modulator is vedolizumab (ENTYVIO). In certain embodiments, the biological agent is a modulator of interleukin-12 (IL-12) or interleukin-23 (IL-23). In certain embodiments, the modulator of interleukin-12 (IL-12) or interleukin-23 (IL-23) is ustekinumab (STELARA).

[0212] Non-limiting examples of additional therapeutic agents include analgesics such as non-steroidal anti-inflammatory agents, corticosteroid anti-inflammatory agents, antipruritics / local anesthetics, opioid agonists, and salicylates; anti-infective agents such as anthelmintics, anti-anaerobic agents, antibiotics, aminoglycoside antibiotics, antifungal antibiotics, cephalosporin antibiotics, macrolide antibiotics, various B-lactam antibiotics, penicillin antibiotics, quinolone antibiotics, sulfonamide antibiotics, tetracycline antibiotics, antimycobacterial agents, antituberculosis antimycobacterial agents, antiprotozoal agents, antimalarial antiprotozoal agents, antiviral agents, antiretroviral agents, scabicides; electrolyte agents and renal agents such as acidifying agents, alkalinizing agents, diuretics, carbonic anhydrase inhibitor diuretics, loop diuretics, osmotic diuretics, potassium-sparing diuretics, thiazide diuretics, electrolyte replenishers, and uric acid excretion promoters; enzymes such as pancreatic enzymes, thrombolytic enzymes; gastrointestinal agents such as antidiarrheals, antiemetics, gastrointestinal anti-inflammatory agents, salicylic acid gastrointestinal anti-inflammatory agents, antacid antiulcer agents, gastric acid pump inhibitor antiulcer agents, gastric mucosal antiulcer agents, H2 blocker antiulcer agents, gallstone dissolving agents, digestive agents, emetics, laxatives and stool softeners, and gastrointestinal motility improvers; gastrointestinal hormones and gastrointestinal hormone regulators such as GLP-1, GLP-2, abortifacients, adrenal agents, corticosteroid adrenal agents, androgens, antiandrogens; nutritional supplements such as minerals and / or vitamins such as water-soluble vitamins or fat-soluble vitamins, vitamin A, vitamin B, vitamin C, vitamin D, vitamin E, and / or vitamin K, and metabolizable carbohydrates, amino acids, and / or fats.

[0213] In certain embodiments, the one or more additional therapeutic agents include fecal flora from, for example, fecal transplants for reconstructing the gut microbiota for therapeutic purposes. In certain embodiments, the one or more additional therapeutic agents include any therapeutic agent approved for the one or more diseases and / or disorders described herein.

[0214] Diagnostic methods In one aspect, the present disclosure provides a method for determining the concentration of human intestinal alkaline phosphatase (HIAP) in a biological sample.

[0215] In certain embodiments, the biological sample is selected from feces, mucus, tissue, blood, plasma, serum, pus, urine, sweat, tears, sputum, saliva, and / or other body fluids. In certain embodiments, the biological sample is a biopsy specimen, optionally a biopsy specimen from the colon. In certain embodiments, the biological sample is feces.

[0216] In certain embodiments, the method comprises assaying a biological sample for the expression and / or activity of IAP using an immunoassay. In certain embodiments, the immunoassay is selected from an electrochemiluminescence (ECL) immunoassay, a dissociation-enhanced lanthanide fluorescence immunoassay (DELFIA®), an enzyme-linked immunosorbent assay (ELISA), a radioimmunoassay (RIA), a sandwich assay, a Western blot assay, and an immunoprecipitation assay (IPA). In certain embodiments, the method comprises assaying a biological sample for the expression and / or activity of IAP using an electrochemiluminescence (ECL) immunoassay (including, but not limited to, the ECL immunoassay described in Example 1 herein). In certain embodiments, the immunoassay is an ECL immunoassay comprising an anti-HIAP monoclonal capture antibody, optionally AbD54140ad (BioRad). In certain embodiments, the ECL immunoassay comprises a monoclonal anti-HIAP detection antibody, optionally AbD54130ad (BioRad). In certain embodiments, the ECL immunoassay comprises a polyclonal anti-bovine IAP detection antibody.

[0217] In certain embodiments, the method is used to determine whether a biological sample has low expression and / or low activity of IAP. In certain embodiments, the low expression of IAP is lower than the IAP expression in untreated patients or patients without a disease. In certain embodiments, the low expression of IAP is less than about 30 U / L, or less than about 25 U / L, less than about 20 U / L, less than about 10 U / L, less than about 5 U / L, less than about 1 U / L. In certain embodiments, the low expression of IAP is less than about 30 U / L, or less than about 25 U / L, less than about 20 U / L, less than about 10 U / L, less than about 5 U / L, less than about 1 U / L in the blood of a patient. In certain embodiments, the low expression of IAP is less than about 30 U / L, or less than about 25 U / L, less than about 20 U / L, less than about 10 U / L, less than about 5 U / L, less than about 1 U / L in the feces of a patient.

[0218] Definitions As used herein, "a", "an", or "the" can mean one or more.

[0219] Further, when used in connection with a reference numerical indication, the term "about" means within, up to 10% of, the reference numerical indication. For example, the phrase "about 50%" covers the range of 45% to 55%.

[0220] When used in connection with medical uses, "effective amount" means an amount effective to produce a measurable therapeutic, prophylactic, or reduction in the incidence of the disorder of interest.

[0221] Percentages by composition, where referred to in this specification, are by weight of the total composition, unless otherwise explicitly indicated. As used herein, the word "include" and its variations are intended to be non-limiting, and the listing of items in a list does not exclude other similar items that may be equally useful in the compositions and methods of the present technology. Similarly, the terms "can" and "may" and their variations are also intended to be non-limiting, and the recitation that a particular embodiment may include or may include a particular element or feature does not exclude other embodiments of the present technology that do not include those elements or features.

[0222] As used herein, a readout of activity and / or effect is "decreased" if it is decreased by a significant amount, e.g., at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, or more, up to at least about 100% (including 100%), in the presence of a particular agent or stimulus as compared to the case where such modulation is absent. As will be understood by those skilled in the art, in some embodiments, the activity may decrease such that some downstream readouts decrease while others increase.

[0223] Conversely, if the readout of activity and / or effect is increased in the presence of a certain agent or stimulus by a significant amount, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, or more, up to at least about 100% (including 100%), or more, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 50-fold, at least about 100-fold, compared to the case where such agent or stimulus is absent, then the activity is "increased".

[0224] As used herein, if the readout of activity and / or effect is lower than a certain reference point in the presence of a certain agent or stimulus, such as at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, or more, up to at least 100% (including 100%) lower, or at most about one-half, at most about one-third, at most about one-fourth, at most about one-fifth, at most about one-sixth, at most about one-seventh, at most about one-eighth, at most about one-ninth, at most about one-tenth, at most about one-fiftieth, at most about one-hundredth, compared to the case where such regulation is absent, then it is "low expression and / or low activity".

[0225] Percentages by composition are, unless otherwise explicitly indicated, based on the weight of the total composition whenever mentioned in this specification. As used herein, the word "include" and its variations are intended to be non-limiting, and the items in the listed lists do not exclude other similar items that may be equally useful in the compositions and methods of the present technology. Similarly, the terms "can" and "may" and their variations are also intended to be non-limiting, and the description that a certain embodiment can or may include a particular element or feature does not exclude other embodiments of the present technology that do not include those elements or features.

[0226] For the purposes of describing and claiming the present disclosure, the open-ended term "comprising" is used herein as a synonym for terms such as "including", "containing", or "having", although the present disclosure or embodiments thereof could alternatively be described using alternative terms such as "consisting of" or "consisting essentially of".

[0227] As used herein, the terms "preferred" and "preferably" refer to embodiments of the present technology that provide certain benefits under certain circumstances. However, different embodiments may also be preferred under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, nor is it intended to exclude these other embodiments from the scope of the present technology.

[0228] The amount of the composition described herein required to achieve a certain therapeutic effect can be determined empirically according to the conventional procedures for that purpose. Generally, when administering a therapeutic agent (e.g., the intestinal microbiota regulator and / or additional agent described herein) for a therapeutic purpose, the therapeutic agent is given at a pharmacologically effective dose. "Pharmacologically effective amount", "pharmacologically effective dose", "therapeutically effective amount" or "effective amount" refers to an amount sufficient to produce the desired physiological effect or an amount capable of achieving the desired result, particularly for treating a disorder or disease. The effective amount as used herein will include, for example, an amount sufficient to delay the onset of symptoms of a disorder or disease, change the course of symptoms of a disorder or disease (e.g., delay the progression of symptoms of a disease), reduce or eliminate one or more symptoms or manifestations of a disorder or disease, or reverse the symptoms of a disorder or disease. Therapeutic benefits also include arresting or delaying the progression of the underlying disease or disorder, whether or not improvement is realized.

[0229] The effective amount, toxicity, and therapeutic efficacy can be determined in cell cultures, tissue samples, tissue homogenates or experimental animals by standard pharmacological procedures, for example, to determine the LD50 (the dose lethal to approximately 50% of the population) and the ED50 (the dose therapeutically effective in approximately 50% of the population). The dosage can vary depending on the dosage form used and the route of administration utilized. The dosage ratio between the toxic effect and the therapeutic effect is the therapeutic index, which can be expressed as the ratio of LD50 / ED50. In some embodiments, compositions and methods showing a large therapeutic index are preferred. The therapeutically effective dose can first be estimated by in vitro assays, including, for example, cell culture. Also, the dosage can be formulated in an animal model such that a circulating plasma concentration range including the IC50 determined in cell culture or in a suitable animal model is achieved. The level of the composition described in the plasma can be measured, for example, by high performance liquid chromatography. The effect of any particular dosage can be monitored by appropriate bioassays. The dosage can be determined by a physician and adjusted as needed to conform to the observed therapeutic effect.

[0230] In certain embodiments, the effect results in a quantitative change of at least about 10%, at least about 20%, at least about 30%, at least about 50%, at least about 70%, or at least about 90%. In some embodiments, the effect results in a quantitative change of about 10%, about 20%, about 30%, about 50%, about 70%, or even about 90% or more. Therapeutic benefits also include halting or delaying the progression of the underlying disease or disorder, whether or not an improvement is realized.

[0231] As used herein, "method of treatment" is equally applicable to the use of a composition for treating a disease or disorder described herein, and / or a composition for use, and / or the use in the manufacture of a medicament for treating a disease or disorder described herein.

[0232] The present disclosure is further described below with respect to examples. These examples are for illustrative purposes only and should not be construed as limiting the scope of the invention. Also, various changes and variations can be made without departing from the technical scope of the invention. [Examples]

[0233] Example 1: Human Fecal IAP Assay An electrochemiluminescence (ECL) immunoassay technique was developed to determine the concentration of human intestinal alkaline phosphatase (HIAP) in human fecal homogenates. Fecal homogenate samples were prepared at a concentration of 100 mg of feces per 1 mL of Tris-buffered saline (TBS), 1 mM MgCl2, and 0.1 mM ZnCl2 on ice and frozen at -70 °C. Standards and QCs were prepared using human alkaline phosphatase / ALPI protein (His-tag) (Sino Biological catalog number 13225-H08H) as a reference standard. On the day of the assay, Meso Scale Discovery (MSD) streptavidin-coated plates were blocked with 3% bovine serum albumin (BSA) in 1× phosphate-buffered saline (PBS) pH 7.4, and then 25 μL / well of 1 μg / mL biotinylated anti-HIAP monoclonal antibody AbD54140ad (manufactured by BioRad) was added. After washing with PBS / 0.05% Tween-20, standards, quality controls (QCs), and blanks were prepared in 1% BSA-PBS and loaded onto the plate without further dilution (50 μL / well). Homogenized fecal samples were diluted in assay diluent (1% BSA-PBS) at a minimum required dilution (MRD) of 1000-fold. Homogenized fecal samples that required dilution beyond the MRD were diluted in 1% BSA-PBS after performing the MRD. After another wash step, HIAP bound to the plate was quantified by adding 25 μL / well of 1 μg / mL anti-HIAP monoclonal antibody AbD54130ad (manufactured by BioRad) with a sulfo-tag. A polyclonal anti-bovine intestinal alkaline phosphatase antibody with a sulfo-tag (manufactured by Rockland Antibodies) was also used for detection and similar results were obtained. Electrochemiluminescence (ECL) was measured using an MSD Sector® S 600 or SQ 120 reader. Data for the standards were regressed according to a four-parameter (4PL marker) curve fitting model with a weighting factor of 1 / y2. Blanks were not included in the curve fitting. Regression was performed using Watson LIMS® software. Concentrations were reported to four significant figures. The calibration curves are shown in Figures 2 and 3.

[0234] The quantification range of this procedure was determined to be within-well concentrations of 0.5000 ng / mL to 256.0 ng / mL (Table 1), which, for MRD, corresponds to 500 ng / mL to 256,000 ng / mL, or 5000 ng / g feces to 2,560,000 ng / g feces in fecal homogenates. This assay was shown to be specific for HIAP, and bovine IAP and human tissue non-specific alkaline phosphatase (TNAP) were not detected up to the highest concentrations tested (200,000 ng / mL for BIAP and 2000 ng / mL (within-well concentration) for TNAP). Parallelism of the samples was demonstrated from 1000-fold dilution to 8000-fold dilution, or 8-fold of MRD.

[0235] Of the 10 individual fecal homogenate samples tested, 8 were quantifiable within the assay range, while 2 were below the limit of quantification (BLQ) (Table 2). Homogenates that underwent one freeze-thaw cycle did not show a significant loss of response compared to samples that were not stressed.

[0236]

Table 1

[0237]

Table 2

[0238] Example 2: Treatment of Ulcerative Colitis (UC) Animal studies for UC treatment are carried out using animal models of UC, such as rat or mouse models of UC. Examples of animal models include, for example, chemical stimulation models, immune stimulation models, and composite models. Chemical substances used in chemical stimulation methods include, for example, dextran sulfate sodium (DSS), oxazolone (OXZ), 2,4-dinitrochlorobenzene (DNCB), and trinitrobenzenesulfonic acid (TNBS). Immune stimulation modeling methods can be broadly classified into colonic mucosal tissue sensitization methods, rat colonic bacterial strain methods, fetal rat colon transplantation methods, and spontaneous animal models. The main combinations of chemical substances currently used in composite methods are as follows: (1) TNBS + ethanol, (2) DNCB + acetic acid, (3) DNCB + ethanol, (4) DSS + acetic acid, (5) DNCB + acetic acid + ethanol, and (6) 1,2-dimethylhydrazine (DMH) + DSS.

[0239] Animals are divided into a control group and a test group. The control group is administered a placebo, and the test group is administered an IAP, for example, a therapeutically effective amount of IAP having the amino acid sequence of SEQ ID NO: 11.

[0240] Animals are monitored for UC pathogenic markers, for example, the following. · Increase in nitric oxide (NO) levels, increased intestinal vascular permeability, secretion of intestinal epithelial cells, inflammation, edema, congestion of the intestinal mucosa, diarrhea, bloody stools, and / or cytotoxic effects; · Stimulation of cyclooxygenase 2 (COX-2), increased release of prostaglandin-like substances from arachidonic acid (AA), increased levels of prostaglandin E2 (PGE2), induction of granulocyte infiltration in the intestinal mucosa, activation of the oxidative stress process, acceleration of cell proliferation, inhibition of the immune action of immune T cells, immune damage, and / or tumor formation; · Increase in the inflammatory levels of IL-1β, IL-6, and / or TNF-α in serum; · Decrease in the biodiversity of the body's bacterial flora accompanied by a decrease in beneficial bacterial genera and an increase in harmful bacterial genera, reduction in the thickness of the mucus layer, worsening of damage to the intestinal mucosal barrier, and / or intestinal inflammation; and / or · Imbalance between pro-inflammatory factors (TNF-α, IL-1β, IL-6, IL-12, and IL-23) and anti-inflammatory factors (IL-2, IL-4, and IL-10), regulatory T cell dysregulation, platelet activation, increased expression of human leukocyte antigen (HLA), increased perinuclear neutrophils, and / or iron deposition.

[0241] The test group is expected to show improvement compared to the control group, for example, stabilization and / or reduction and / or elimination of one or more symptoms or manifestations of UC (e.g., one or more of any of the above UC pathogenic markers).

[0242] Example 3: Treatment of ulcerative colitis (UC) A clinical study of UC treatment is conducted. In this study, subjects are selected who are resistant to one or more UC treatments and are characterized by low expression and / or activity of IAP compared to subjects not suffering from UC or compared to subjects suffering from non-resistant UC. The expression and / or activity of IAP in the subjects is evaluated by assaying biological samples of feces, mucus, tissue, blood, plasma, serum, pus, urine, sweat, tears, sputum, saliva, and / or other body fluids from the subjects, and / or colon biopsy specimens. The assay used to evaluate the expression and / or activity of IAP in the subjects can be those described in Example 1 above.

[0243] UC in any of the subjects may be an acute disease, a chronic disease, a moderate disease, a severe disease, a mild to moderate disease, a moderate to severe disease, or a severe and fulminant disease.

[0244] Any subject may be a subject who is resistant to, has an insufficient response to, does not respond to, or has treatment failure with anti-inflammatory agents such as 5-aminosalicylic acid (e.g., sulfasalazine (e.g., AZULFIDINE), mesalamine (e.g., ASACOL HD, DELZICOL), balsalazide (e.g., COLAZAL), and olsalazine (e.g., DIPENTUM)), or corticosteroids (e.g., dexamethasone (e.g., OZURDEX, MAXIDEX), hydrocortisone (e.g., HYDROCORT, ALPHOSYL, AQUACORT, CORTEF), methylprednisolone (e.g., MEDROL), and prednisone (e.g., DELTASONE, RAYOS)).

[0245] Any subject may be a subject who is resistant to, has an insufficient response to, does not respond to, or has treatment failure with immunosuppressive agents such as azathioprine (e.g., AZASAN, IMURAN), mercaptopurine (e.g., PURINETHOL, PURIXAN), cyclosporine (e.g., GENGRAF, NEORAL, SANDIMMUNE), or tofacitinib (XELJANZ).

[0246] Any subject may be a subject who is resistant to, has an insufficient response to, does not respond to, or has treatment failure with biological agents (e.g., tumor necrosis factor (TNF) inhibitors, e.g., monoclonal antibodies against TNF-alpha (e.g., anti-TNFα), e.g., infliximab (REMICADE), adalimumab (HUMIRA), and golimumab (SIMPONI); integrin α4β modulators, e.g., vedolizumab (ENTYVIO); regulators of interleukin-12 (IL-12) or interleukin-23 (IL-23), e.g., ustekinumab (STELARA).

[0247] Any subject may further have an allergy to bacterial toxins and / or a metabolic disease or disorder, such as type I or type II diabetes, cardiovascular disease (CVD) or coronary artery disease (CAD), atherosclerotic CVD, obesity or overweight, hypertriglyceridemia, hypercholesterolemia, fatty liver, fatty liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma (HCC), or liver failure.

[0248] Subjects are divided into a test group and a control group. The control group is administered the current standard treatment for UC (e.g., surgery, anti-inflammatory drug treatment, immunosuppressive agents, biologic agents, or other standard therapeutic agent treatment), and the test group is orally administered a therapeutically effective amount of IAP having the amino acid sequence of SEQ ID NO: 11.

[0249] The test group is expected to show improvement compared to the control group, such as avoidance of the need for colectomy with ileal pouch - anal anastomosis and / or reduction and / or elimination of one or more symptoms or manifestations of UC (e.g., diarrhea, blood in the stool, abdominal pain, and / or reduced and / or eliminated anorexia).

[0250] Equivalents Although the present disclosure has been described in connection with its particular embodiments, it will be understood that further modifications can be made, and that this application is intended to cover any variations, uses, or adaptations of the disclosure following, in general, the principles of the disclosure and including such departures from the present disclosure as come within known or customary practice within the art to which the disclosure pertains, within the scope of the above - described and appended claims.

[0251] One of ordinary skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments specifically described herein. Such equivalents are intended to be encompassed by the following claims.

[0252] Incorporation by reference All patents and publications referred to in this specification are hereby incorporated by reference in their entirety.

[0253] The publications described in this specification are provided solely for the reason that they were disclosed prior to the filing date of this application. Any statement recognizing that the present disclosure is not entitled to antedate such publications on the ground that such publication was made prior thereto is to be construed as not being present in this specification.

[0254] The headings used in this specification are for structural purposes only and are not intended to limit the disclosure in any way. The contents of each individual section may be equally applicable to all sections.

Claims

1. A pharmaceutical composition used to treat ulcerative colitis (UC) in patients requiring treatment for ulcerative colitis (UC), The aforementioned pharmaceutical composition contains intestinal alkaline phosphatase (IAP), The aforementioned subjects are resistant to one or more UC treatments, The aforementioned subjects are characterized by lower IAP expression and / or activity compared to subjects who do not have UC or subjects who have resistant UC. Optionally, the subject has low IAP expression and / or activity in the mucosa of the subject. Optionally, the subject has low IAP expression and / or activity in the intestinal mucosa of the subject. Optionally, the subject has low IAP expression and / or activity in the colonic mucosa of the subject. The aforementioned pharmaceutical composition.

2. The subject is characterized by low IAP expression and / or activity by assaying a biological sample from the subject. Optionally, the biological sample may be selected from feces, mucus, tissue, blood, plasma, serum, pus, urine, sweat, tears, sputum, saliva, and / or other bodily fluids. Optionally, the biological sample is a biopsy specimen, and optionally, a biopsy specimen from the colon. Optionally, if the biological sample is feces, The pharmaceutical composition according to claim 1.

3. The aforementioned biological sample is assayed for IAP expression and / or activity using an immunoassay method. Optionally, the immunoassay method may be selected from electrochemiluminescence (ECL) immunoassay, dissociation-enhanced lantanide fluorescence immunoassay (DELFIA®), enzyme-linked immunoassay (ELISA), radioimmunoassay (RIA), sandwich assay, Western blot assay, and immunoprecipitation assay (IPA). Optionally, the immunoassay is an ECL immunoassay that includes an anti-HIAP monoclonal capture antibody. Optionally, the ECL immunoassay includes a monoclonal anti-HIAP detection antibody, or the ECL immunoassay includes a polyclonal anti-bovine IAP detection antibody. The pharmaceutical composition according to claim 2.

4. The pharmaceutical composition according to claim 1 or claim 2, wherein the UC is an acute disease, a chronic disease, a moderate disease, a severe disease, a mild to moderate disease, a moderate to severe disease, or a severe and fulminant disease.

5. The aforementioned UC treatment is an anti-inflammatory agent. Optionally, the subject has an insufficient response to, no response to, or failure to receive anti-inflammatory treatment. Optionally, the anti-inflammatory agent is 5-aminosalicylate or corticosteroid. Optionally, the 5-aminosalicylate may be selected from sulfasalazine (e.g., AZULFIDINE), mesalamine (e.g., ASACOL HD, DELZICOL), valsalazide (e.g., COLAZAL), and orsalazine (e.g., DIPENTUM), or the corticosteroid may be selected from dexamethasone (e.g., OZURDEX, MAXIDEX), hydrocortisone (e.g., HYDROCORT, ALPHOSYL, AQUACORT, CORTEF), methylprednisolone (e.g., MEDROL), and prednisone (e.g., DELTASONE, RAYOS). The pharmaceutical composition according to claim 1 or claim 2.

6. The aforementioned UC treatment is an immunosuppressant. Optionally, the subject has an insufficient response to immunosuppressant therapy, no response, or has failed immunosuppressant therapy. Optionally, the immunosuppressant is selected from azathioprine (e.g., AZASAN, IMURAN), mercaptopurine (e.g., PURINETHOL, PURIXAN), cyclosporine (e.g., GENGRAF, NEORAL, SANDIMMUNE), and tofacitinib (XELJANZ). The pharmaceutical composition according to claim 1 or claim 2.

7. The aforementioned UC treatment is a biological agent. Optionally, the subject has an insufficient response to treatment with a biological agent, no response, or has failed treatment with a biological agent. Optionally, (i) The biological agent is an antibody, and optionally, the biological agent is a monoclonal antibody. (ii) The biological agent is a tumor necrosis factor (TNF) inhibitor, optionally the TNF inhibitor is a monoclonal antibody against TNF-alpha (e.g., anti-TNFα), optionally the anti-TNFα is selected from infliximab (REMICADE), adalimumab (HUMIRA), and golimumab (SIMPONI). (iii) The biological agent is an integrin α4β modulator, and optionally the integrin α4β modulator is vedolizumab (ENTYVIO), or (iv) The biological agent is an interleukin-12 (IL-12) or interleukin-23 (IL-23) modulator, and optionally the interleukin-12 (IL-12) or interleukin-23 (IL-23) modulator is ustekinumab (STELARA). The pharmaceutical composition according to claim 1 or claim 2.

8. The pharmaceutical composition according to claim 1 or claim 2, which is effective in avoiding the need for colectomy with ileal pouch-anal anastomosis.

9. The aforementioned IAP is a bovine IAP (bIAP). Optionally, the bIAP is selected from bIAP I, bIAP II, and bIAP IV. The pharmaceutical composition according to claim 1 or claim 2.

10. The pharmaceutical composition according to claim 1 or claim 2, wherein the IAP comprises an amino acid sequence having at least about 90%, about 95%, about 97%, about 98%, or about 99% sequence identity with any one of sequence numbers 1 to 14.

11. The IAP includes an amino acid sequence having at least about 97% sequence identity with SEQ ID NO:

11. Optionally, the IAP includes an amino acid sequence having at least about 99% sequence identity with SEQ ID NO:

11. The pharmaceutical composition according to claim 1 or claim 2.

12. The pharmaceutical composition according to claim 1 or 2, wherein the IAP is administered orally.

13. The pharmaceutical composition according to claim 1 or claim 2, wherein the subject further has hypersensitivity to bacterial toxins.

14. The subject further has a metabolic disease or metabolic disorder, Optionally, the metabolic disease or metabolic disorder is type I or type II diabetes mellitus, cardiovascular disease (CVD) or coronary artery disease (CAD), atherosclerotic CVD, obesity or overweight, hypertriglyceridemia, hypercholesterolemia, fatty liver, fatty liver disease, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), cirrhosis, hepatocellular carcinoma (HCC), or liver failure. The pharmaceutical composition according to claim 1 or claim 2.

15. The pharmaceutical composition according to claim 1 or claim 2, wherein low expression and / or activity of the IAP exacerbates and / or accelerates the progression of ulcerative colitis (UC) or metabolic disease or metabolic disorder.

Images