Natural killer (NK) cell engager that binds to NKp46 and BCMA variant with FC engineering

Abstract

The present disclosure relates to a multifunctional binding protein comprising a first and a second antigen-binding domain (ABD) and all or part of an immunoglobulin Fc region or a variant thereof, wherein the first ABD specifically binds to human BCMA, the second ABD specifically binds to human NKp46, and all or part of the immunoglobulin Fc region or a variant thereof binds to human Fc-gamma receptors. The present disclosure also relates to methods for making such binding proteins, compositions thereof, and their use, including the treatment or prevention of proliferative disorders including multiple myeloma (MM).

Description

Technical Field

[0001] B cell maturation antigen (BCMA) is expressed on mature B cells and B cell-derived tumor cells and is involved in the progression of several B cell cancers (e.g., multiple myeloma) and B cell diseases or disorders (e.g., light chain amyloidosis or LCA). Thus, BCMA is an attractive target for the treatment of anti-B cell cancer and B cell-related diseases or disorders. A few existing BCMA-targeted therapies, such as anti-CD3xBCMA T cell engagers, induce strong toxicity problems such as excessive pro-inflammatory cytokine release.

Background Art

[0002] Natural killer (NK) cells are a subpopulation of lymphocytes involved in innate immunity. NK cells provide an efficient immune surveillance mechanism capable of eliminating unwanted cells such as tumor or virus-infected cells. The characteristics and biological properties of NK cells include the expression of surface antigens including CD16, CD56, and / or CD57, the absence of α / β or γ / δ TCR complexes on the cell surface, the ability to bind and kill cells in an MHC-unrestricted manner, particularly the ability to kill "self" cells that do not express MHC / HLA antigens, tumor cells, or other diseased cells that express ligands for NK activating receptors by activating specific cytolytic enzymes, and the ability to release protein molecules called cytokines that stimulate the immune response. Interest is growing around natural killer (NK) cells due to their potential anti-tumor properties.

[0003] There is a need in the art for a potent anti-BCMA therapy with a manageable safety profile. The anti-BCMA×NKp46 binding protein described in the claims herein provides this need.

Summary of the Invention

Means for Solving the Problems

[0004] The present disclosure relates to a multifunctional binding protein comprising a first and a second antigen-binding domain (ABD) and all or part of an immunoglobulin Fc region or a variant thereof, wherein the first ABD specifically binds to human BCMA, the second ABD specifically binds to human NKp46, and all or part of the immunoglobulin Fc region or a variant thereof binds to human Fc-gamma receptors. In particular, the disclosed NKp46-BCMA engager has extensive Fc engineering that enhances ADCC activity and / or serum half-life (via CD16 (FcγRIIIa) binding to the constant region (Fc) of the antibody).

[0005] The disclosed NKp46-BCMA engager exhibits strong potency through dual NK engagement with NKp46 and CD16, has a favorable safety profile (minimal pro-inflammatory cytokine release compared to the T cell engager (TCE) modality), and a long serum half-life.

[0006] The present disclosure also relates to methods for making the binding proteins, compositions thereof, and their use.

[0007] In one aspect, the present disclosure is a binding protein comprising a first antigen-binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein (a) the first ABD comprises (a1) a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence having the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence having the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence having the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and (a2) a LCDR1 sequence having the amino acid sequence of CX 1 SSTGX 2 VTPX 3 X 4 YAN (SEQ ID NO: 4), wherein X 1 is R or A, X 2 is T or A, X 3 is S or G, X 4 is N or Y, and the LCDR1 sequence, DNNX5 X 6 An LCDR2 sequence comprising the amino acid sequence of PP (SEQ ID NO: 5), wherein X 5 is S, I or N, and X 6 is R or K, and an LCDR2 sequence, and ALX 7 X 8 GX 9 An LCDR3 sequence comprising the amino acid sequence of QWV (SEQ ID NO: 6), wherein X 7 is W or Y, and X 8 is F or Y, and X 9 is N or G, and a first immunoglobulin light chain variable domain (VL1) comprising an LCDR3 sequence, (b) A second ABD provides a binding protein that comprises a binding specificity for NKp46.

[0008] In certain embodiments, (b) the second ABD is (b1) A second immunoglobulin heavy chain variable domain (VH2), wherein - An HCDR1 sequence containing -DYVIN, an HCDR2 sequence containing EIYPGSGTNYYNEKFKA, and an HCDR3 sequence containing RGRYGLYAMDY; - An HCDR1 sequence containing -GYTFSDYVIN (SEQ ID NO: 19), an HCDR2 sequence containing EIYPGSGTN (SEQ ID NO: 20), and an HCDR3 sequence containing RGRYGLYAMDY (SEQ ID NO: 21); - An HCDR1 sequence containing -SDYAWN (SEQ ID NO: 22), an HCDR2 sequence containing YITYSGSTSYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence containing GGYYGSSWGVFAY (SEQ ID NO: 24); - An HCDR1 sequence containing -EYTMH (SEQ ID NO: 25), an HCDR2 sequence containing GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and an HCDR3 sequence containing RGGSFDY (SEQ ID NO: 27); - An HCDR1 sequence containing -SFTMH (SEQ ID NO: 28), an HCDR2 sequence containing YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and an HCDR3 sequence containing GSSRGFDY (SEQ ID NO: 30); or - A second immunoglobulin heavy chain variable domain comprising an HCDR1 sequence containing -SDYAWN (SEQ ID NO: 31), an HCDR2 sequence containing YITYSGSTNYNPSLKS (SEQ ID NO: 32), and an HCDR3 sequence containing CWDYALYAMDC (SEQ ID NO: 33), and (b2) A second immunoglobulin light chain variable domain (VL2) comprising - An LCDR1 sequence containing -RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence containing YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence containing QQGNTRPWT (SEQ ID NO: 36); - An LCDR1 sequence containing -RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence containing NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence containing QHHYGTPWT (SEQ ID NO: 39); - An LCDR1 sequence containing -RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence containing YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence containing QNGHSFPLT (SEQ ID NO: 42); - An LCDR1 sequence containing -RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence containing AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence containing QHFWGTPRT (SEQ ID NO: 45); or - An LCDR1 sequence containing -RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence containing NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence containing QHHYDTPLT (SEQ ID NO: 48), comprising a second immunoglobulin light chain variable domain.

[0009] In certain embodiments, VL1 comprises an LCDR1 sequence comprising the amino acid sequence of -CASSTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9); - An LCDR1 sequence comprising the amino acid sequence of -CRSSTGTVTPSNYAN (SEQ ID NO: 10), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12); - An LCDR1 sequence comprising the amino acid sequence of -CASSTGAVTPSNYAN (SEQ ID NO: 13), an LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and an LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15); or - An LCDR1 sequence comprising the amino acid sequence of -CASSTGAVTPGYYAN (SEQ ID NO: 16), an LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and an LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0010] In certain embodiments, -VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; -VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50; -VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51; -VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52; -VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53; or -VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 54.

[0011] In certain embodiments, VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 55; -VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 50; -VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 51; -VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 52; -VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 53; or -VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 54.

[0012] In certain embodiments, -VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64; -VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65; -VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66; -VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67; VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68; -VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69; -VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70; or -VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 63, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 71.

[0013] In certain embodiments, -VH2 comprises the amino acid sequence of SEQ ID NO: 56 and VL2 comprises the amino acid sequence of SEQ ID NO: 64; -VH2 comprises the amino acid sequence of SEQ ID NO: 57 and VL2 comprises the amino acid sequence of SEQ ID NO: 65; -VH2 comprises the amino acid sequence of SEQ ID NO: 58 and VL2 comprises the amino acid sequence of SEQ ID NO: 66; -VH2 comprises the amino acid sequence of SEQ ID NO: 59 and VL2 comprises the amino acid sequence of SEQ ID NO: 67; -VH2 comprises the amino acid sequence of SEQ ID NO: 60 and VL2 comprises the amino acid sequence of SEQ ID NO: 68; -VH2 comprises the amino acid sequence of SEQ ID NO: 61 and VL2 comprises the amino acid sequence of SEQ ID NO: 69; -VH2 comprises the amino acid sequence of SEQ ID NO: 62 and VL2 comprises the amino acid sequence of SEQ ID NO: 70; or -VH2 comprises the amino acid sequence of SEQ ID NO: 63 and VL2 comprises the amino acid sequence of SEQ ID NO: 71.

[0014] In certain embodiments, the binding protein further comprises all or part of an immunoglobulin Fc domain or a variant thereof. In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the IgG1 Fc domain is a human IgG1 Fc domain. In certain embodiments, all or part of the immunoglobulin Fc domain or a variant thereof binds to a human Fc-γ receptor. In certain embodiments, all or part of the immunoglobulin Fc domain or a variant thereof binds to the human CD16A (FcγRIII) polypeptide.

[0015] In certain embodiments, the Fc domain contains a native glycan at amino acid position 297 according to EU numbering.

[0016] In certain embodiments, the binding protein is N-glycosylated.

[0017] In certain embodiments, the Fc domain or a variant thereof comprises a first Fc heavy chain and a second Fc heavy chain.

[0018] In certain embodiments, at least one Fc heavy chain comprises engineered intra-chain disulfide bonds mediated by a pair of cysteines (C) that replace: (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334; or (ii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302 (amino acid positions are according to EU numbering).

[0019] In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a pair of cysteines. In certain embodiments, each of the first and second Fc heavy chains comprises a pair of cysteines. In certain embodiments, each of the first and second Fc heavy chains comprises an L242C / K334C substitution. In certain embodiments, each of the first and second Fc heavy chains comprises an R292C / V302C substitution.

[0020] In certain embodiments, at least one Fc heavy chain comprises a substitution at amino acid position 332 according to EU numbering. In certain embodiments, the substitution at amino acid position 332 is glutamic acid (E).

[0021] In certain embodiments, at least one Fc heavy chain further comprises one or more substitutions at amino acid positions 236, 239 or 330 according to EU numbering. In certain embodiments, the substitution at amino acid position 236 is alanine (A). In certain embodiments, the substitution at amino acid position 239 is aspartic acid (D). In certain embodiments, the substitution at amino acid position 330 is leucine (L).

[0022] In certain embodiments, at least one Fc heavy chain further comprises aspartic acid (D) at amino acid position 239 and glutamic acid (E) at amino acid position 332 according to the EU numbering. In certain embodiments, at least one Fc heavy chain further comprises alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, and glutamic acid (E) at amino acid position 332 according to the EU numbering. In certain embodiments, at least one Fc heavy chain further comprises alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332 according to the EU numbering.

[0023] In certain embodiments, the binding protein comprises at least two polypeptide chains that form at least two antigen-binding sites, and at least one polypeptide chain has the formula: VL1-L1-VL2-L2-CL[I] and comprises a structure represented by: At least one polypeptide chain has the formula: VH2-L3-VH1-L4-CH1[II] and comprises a structure represented by: wherein CL is an immunoglobulin light chain constant domain, CH1 is an immunoglobulin CH1 heavy chain constant domain, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 may optionally be absent, and the polypeptide of formula I and the polypeptide of formula II form an interchanged light chain-heavy chain pair.

[0024] In certain embodiments, the binding protein comprises three polypeptide chains that form two antigen-binding sites, and one polypeptide chain has the following formula: VL1-L1-VL2-L2-CL[I] and comprises a structure represented by: One polypeptide chain has the formula: VH2-L3-VH1-L4-CH1-Hinge-CH2-CH3[III] comprising the structure represented by one polypeptide chain has the formula: Hinge-CH2-CH3[IV] comprising the structure represented by wherein CL is an immunoglobulin light chain constant domain, CH1 is an immunoglobulin CH1 heavy chain constant domain, CH2 is an immunoglobulin CH2 heavy chain constant domain, CH3 is an immunoglobulin CH3 heavy chain constant domain, Hinge is an immunoglobulin hinge region connecting the CH1 domain and the CH2 domain, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 may optionally be absent, the polypeptide of formula I and the polypeptide of formula II form an intercrossed light chain - heavy chain pair.

[0025] In certain embodiments, (a) L1, L2, L3, and L4 are each independently of length 0 amino acids or contain a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS (SEQ ID NO: 82), S, RT, TKGPS (SEQ ID NO: 83), GQPKAAP (SEQ ID NO: 84), and GGSGSSGSGG (SEQ ID NO: 85), or (b) L1, L2, L3, and L4 are each independently selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP, and GGSGSSGSGG.

[0026] In certain embodiments, L1 and L2 each contain the amino acid sequence GGGGSGGGGS. In certain embodiments, L3 and L4 are each absent.

[0027] In certain embodiments, the binding protein comprises: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0028] In another aspect, the present disclosure provides a binding protein comprising a first antigen-binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein: (a) the first ABD comprises a first immunoglobulin heavy chain variable domain (VH1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and a first immunoglobulin light chain variable domain (VL1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55; and (b) the second ABD comprises a second immunoglobulin heavy chain variable domain (VH2) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and a second immunoglobulin light chain variable domain (VL2) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64.

[0029] In certain embodiments, VH1 comprises the amino acid sequence of SEQ ID NO: 49, VL1 comprises the amino acid sequence of SEQ ID NO: 55, VH2 comprises the amino acid sequence of SEQ ID NO: 56, and VL2 comprises the amino acid sequence of SEQ ID NO: 64.

[0030] In certain embodiments, the binding protein comprises: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0031] In another aspect, the present disclosure provides a binding protein comprising a first antigen-binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, the binding protein comprising: (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0032] In certain embodiments, the binding protein described above is for use as a pharmaceutical.

[0033] In certain embodiments, the binding protein described above is for use in a method for treating a disease or disorder.

[0034] In certain embodiments, the binding protein described above is for use in a method for treating or preventing cancer.

[0035] In certain embodiments, the binding protein described above is for use in a method for treating or preventing multiple myeloma.

[0036] In certain embodiments, the binding protein described above is for use in a method for treating or preventing light chain amyloidosis (LCA).

[0037] In another aspect, the present disclosure provides a pharmaceutical composition comprising the binding protein described above and a pharmaceutically acceptable carrier.

[0038] In another aspect, the present disclosure provides a method for treating or preventing cancer, the method comprising administering the pharmaceutical composition described above to a subject in need of such treatment or prevention.

[0039] In another aspect, the present disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding the binding protein described above.

[0040] In another aspect, the present disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72.

[0041] In another aspect, the present disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73.

[0042] In another aspect, the present disclosure provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74.

[0043] In another aspect, the present disclosure provides an expression vector comprising the above nucleic acid molecule.

[0044] In another aspect, the present disclosure provides an isolated cell comprising the above nucleic acid molecule.

[0045] In another aspect, the present disclosure provides an isolated cell comprising the above expression vector. In certain embodiments, the cell is a mammalian cell.

[0046] In another aspect, the present disclosure provides a method for producing a binding protein, the method comprising culturing an isolated cell under suitable conditions and recovering the binding protein.

[0047] In another aspect, the present disclosure provides a method for producing the above binding protein, comprising: (a) culturing a host cell under conditions suitable for expressing a plurality of recombinant polypeptides, the plurality comprising: (i) a polypeptide comprising the amino acid sequence of SEQ ID NO: 72; (ii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 73; and (iii) a polypeptide comprising the amino acid sequence of SEQ ID NO: 74; and (b) optionally, recovering the expressed recombinant polypeptides.

[0048] In another aspect, the present disclosure provides a binding protein produced by the above-described production method. In another aspect, the present disclosure provides a method for treating or preventing a disease or disorder, the method comprising administering the above-described pharmaceutical composition to a subject in need thereof.

[0049] In another aspect, the present disclosure provides a method for treating or preventing cancer, the method comprising administering the above-described pharmaceutical composition to a subject in need thereof.

[0050] In another aspect, the present disclosure provides a method for treating or preventing multiple myeloma, the method comprising administering the above-described pharmaceutical composition to a subject in need thereof. In certain embodiments, the multiple myeloma is relapsed multiple myeloma. In certain embodiments, the multiple myeloma is refractory multiple myeloma. In certain embodiments, the multiple myeloma is smoldering multiple myeloma.

[0051] In another aspect, the present disclosure provides a method for treating or preventing light chain amyloidosis (LCA), the method comprising administering the above-described pharmaceutical composition to a subject in need thereof. In certain embodiments, the LCA is relapsed LCA. In certain embodiments, the LCA is refractory LCA.

[0052] In another aspect, the present disclosure provides a method for restoring or enhancing the activity of NKp46-expressing cells in a patient in need thereof, the method comprising administering the above-described pharmaceutical composition to the patient.

[0053] In another aspect, the present disclosure provides a method for removing cancer cells in a patient in need thereof, the method comprising administering the above-described pharmaceutical composition to the patient.

[0054] In another aspect, the present disclosure provides a method of inducing or increasing NK cell-mediated lysis of cancer cells in a patient in need thereof, the method comprising administering the above-described pharmaceutical composition to the patient. In certain embodiments, the cancer cells express BCMA.

[0055] In another aspect, the present disclosure provides a method of inducing elimination of cancer cells by NK cells in a patient in need thereof, the method comprising administering the above-described pharmaceutical composition to the patient.

[0056] In another aspect, the present disclosure provides a binding protein comprising a first antigen-binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46.

[0057] In certain embodiments, the binding protein further comprises all or part of an immunoglobulin Fc domain or a variant thereof, optionally wherein all or part of the immunoglobulin Fc domain or a variant thereof binds to a human Fc-gamma receptor; all or part of the immunoglobulin Fc domain or a variant thereof binds to a human CD16a (FcγRIIIa) polypeptide; the Fc domain contains a native glycan at amino acid position 297 according to EU numbering; and / or the binding protein is N-glycosylated.

[0058] In certain embodiments, the Fc domain or a variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, at least one Fc heavy chain comprises an engineered intra-chain disulfide bond mediated by a pair of cysteines (C) that replaces: (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334; or (ii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302; (amino acid positions are according to EU numbering).

[0059] In certain embodiments, the first and second Fc heavy chains each contain an L242C / K334C substitution. In certain embodiments, the first and second Fc heavy chains each contain an R292C / V302C substitution.

[0060] In certain embodiments, at least one Fc heavy chain contains a substitution at amino acid position 332 according to EU numbering, optionally, the substitution at amino acid position 332 is glutamic acid (E), optionally, further comprising at least one Fc heavy chain, and further comprising one or more substitutions at amino acid positions 236, 239 or 330 according to EU numbering, optionally, the substitution at amino acid position 236 is alanine (A), the substitution at amino acid position 239 is aspartic acid (D), and the substitution at amino acid position 330 is leucine (L).

[0061] In certain embodiments, at least one Fc heavy chain further comprises aspartic acid (D) at amino acid position 239 and glutamic acid (E) at amino acid position 332 according to EU numbering, or at least one Fc heavy chain further comprises alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, and glutamic acid (E) at amino acid position 332 according to EU numbering, or at least one Fc heavy chain further comprises alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332 according to EU numbering.

[0062] The foregoing and other features and advantages of the present disclosure will be more fully understood from the following detailed description of exemplary embodiments in conjunction with the accompanying drawings.

Brief Description of the Drawings

[0063]

Figure 1A - 1B

Figure 2A - 2B

Figure 3A - 3B

Figure 4

Figure 5

Figure 6

Figure 6 - 1

Figure 6 - 2

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

Figure 14A

Figure 14B - 14D

Figure 14E

Figure 15A

Figure 15B

Figure 16A - 16C

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23A - 23B

Figure 23C

Figure 24A

Figure 24B

Figure 25A

Figure 25B

Figure 26A

Figure 26B

Figure 26C

Figure 26D

Figure 27A

Figure 27B

Figure 27C

Figure 27D

Figure 27E

Figure 27F

Figure 28A

Figure 28B

Figure 29A

Figure 29B

Figure 30A

Figure 30B

Figure 31A

Figure 31B

Figure 32A

Figure 32B

Figure 33A - 33C

Figure 34A - 34B

Figure 35

DETAILED DESCRIPTION OF THE INVENTION

[0064] The present disclosure provides a multifunctional binding protein that binds to one surface biomarker on immune NK cells, namely NKp46, and one target antigen on the cell membranes of normal and malignant cells, namely BCMA, and can redirect NK cells to lyse target cells expressing the BCMA surface biomarker. The multifunctional binding protein of the present disclosure further comprises all or a part of an Fc region or a variant thereof that binds to an Fc - γ receptor (FcγR), particularly an activated Fc - γ receptor (FcγR), such as FcγRIIIa also known as CD16a.

[0065] The present disclosure provides novel Fc domain variants having improved thermal stability (e.g., novel binding polypeptides comprising Fc domain variants). The present disclosure also provides novel Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants) with improved binding to Fc receptors. The present disclosure further provides novel Fc domain variants (e.g., binding polypeptides comprising Fc domain variants) comprising a glycosylated Fc domain that enhances interaction with antibody effector molecules as compared to the wild-type (e.g., unmodified) Fc domain. The present disclosure also provides nucleic acids encoding Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants), recombinant expression vectors and host cells for producing Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants), and pharmaceutical compositions comprising isolated Fc domain variants (e.g., novel binding polypeptides comprising Fc domain variants). Methods of using the Fc domain variants of the present disclosure (e.g., novel binding polypeptides comprising Fc domain variants) for treating one or more diseases or disorders are also provided.

[0066] It should be understood that the methods described in the present disclosure are not limited to the specific methods and experimental conditions disclosed herein because such methods and conditions can vary. It should also be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0067] Furthermore, the experiments described herein use conventional molecular and cellular biological and immunological techniques within the skill of the art, unless otherwise indicated. Such techniques are well known to those of skill in the art and are sufficiently explained in the literature. See, for example, Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., NY, N.Y. (1987 - 2008) (including all supplements), Molecular Cloning: A Laboratory Manual (4th ed.) by M.R. Green and J. Sambrook, and J. Sambrook and Harlow et al., Antibodies: A Laboratory Manual, Chapter 14, Cold Spring Harbor Laboratory, Cold Spring Harbor (2nd ed., 2013).

[0068] Unless otherwise defined, scientific and technical terms used herein have the meanings commonly understood by those of skill in the art. In the case of potential ambiguity, the definitions provided herein shall prevail over dictionary or external definitions. Unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. The use of "or" means "and / or" unless otherwise specified. The use of the term "including" and other forms such as "includes" and "included" is not limiting.

[0069] Generally, the nomenclature used in connection with cell and tissue culture, molecular biology, immunology, microbiology, genetics, and the chemistry of proteins and nucleic acids, as well as hybridization described herein, is well known and commonly used in the art. The methods and techniques provided herein are generally performed according to conventional methods well known in the art, as described in various general and more specific references cited and discussed throughout this specification, unless otherwise indicated. Enzyme reactions and purification techniques are performed according to the manufacturer's specifications, as commonly practiced in the art or as described herein. The nomenclature used in connection with analytical chemistry, synthetic organic chemistry, and pharmaceutical and medicinal chemistry described herein, as well as the experimental procedures and techniques thereof, are well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation and delivery, and treatment of patients.

[0070] Since the present disclosure may be more readily understood, selected terms are defined below.

[0071] The term "polypeptide" refers to any polymer chain of amino acids and includes, unless inconsistent with the context, natural or artificial proteins, polypeptide analogs or variants of protein sequences, or fragments thereof. A polypeptide can be monomeric or multimeric. A polypeptide fragment includes, for example, at least about 5 contiguous amino acids, at least about 10 contiguous amino acids, at least about 15 contiguous amino acids, or at least about 20 contiguous amino acids.

[0072] The term "isolated protein" or "isolated polypeptide" refers to a protein or polypeptide that, by virtue of its origin or source of derivation, is not associated with the naturally associated components that accompany it in its native state; that is substantially free of other proteins from the same species; that is expressed by cells from a different species; or that does not occur in nature. Thus, a protein or polypeptide that is chemically synthesized or produced in a cell line different from the cells from which it is naturally derived is "isolated" from its naturally associated components. A protein or polypeptide may also be made substantially free of its naturally associated components by isolating it using protein purification techniques well known in the art.

[0073] As used herein, the term "binding protein" or "binding polypeptide" refers to a protein or polypeptide (e.g., an antibody or an immunoadhesin) that contains at least one binding site involved in selective binding to a target antigen of interest (e.g., a human target antigen). Exemplary binding sites include antibody variable domains, ligand binding sites of receptors, or receptor binding sites of ligands. In certain embodiments, the binding protein or binding polypeptide contains multiple (e.g., 2, 3, 4, or more) binding sites. In certain embodiments, the binding protein or binding polypeptide is a therapeutic enzyme.

[0074] The term "ligand" refers to any substance that can bind to, or is capable of binding to, another substance. Similarly, the term "antigen" refers to any substance against which an antibody can be generated. The term "antigen" is commonly used with respect to antibody binding substrates, and the term "ligand" is often used with respect to receptor binding substrates, but these terms are not intended to distinguish one from the other and encompass a broad range of overlapping chemical entities. To avoid ambiguity, antigens and ligands are used interchangeably throughout this specification. An antigen / ligand can be a peptide, polypeptide, protein, aptamer, polysaccharide, sugar molecule, carbohydrate, lipid, oligonucleotide, polynucleotide, synthetic molecule, inorganic molecule, organic molecule, and any combination thereof.

[0075] The dissociation constant (K D ) can be determined, for example, by surface plasmon resonance. Generally, surface plasmon resonance analysis measures real-time binding interactions between a ligand (target antigen on a biosensor matrix) and an analyte (binding protein in solution) by surface plasmon resonance (SPR) using a BIAcore system (Pharmacia Biosensor; Piscataway, NJ). Surface plasmon analysis can also be performed by immobilizing the analyte (binding protein on a biosensor matrix) and presenting the ligand (target antigen). As used herein, "K D The term "dissociation constant" refers to the dissociation constant of the interaction between a particular binding protein and a target antigen.

[0076] As used herein, the term "specifically binds" refers to a binding activity of up to about 1×10 -6 M, about 1 x 10 -7 M, about 1 x 10 -8 M, about 1 x 10 -9 M, about 1 x 10 -10 M, about 1 x 10 -11 M, about 1 x 10 -12 The dissociation constant (K D ) and / or binds to an antigen with an affinity that is at least about 2-fold greater than its affinity for a non-specific antigen. Specific binding of an antibody can be binding to a target antigen via the CDR sequences. An antibody can also specifically bind to an FcR, such as FcRn or FcγRIIIa, via the Fc region.

[0077] As used herein, the term "antibody" refers to such an assembly (e.g., an intact antibody molecule, an immunoadhesin, or a variant thereof) that has significant known specific immunoreactive activity against an antigen of interest (e.g., a tumor-associated antigen). Antibodies and immunoglobulins comprise light and heavy chains, with or without interchain covalent bonds between them. Basic immunoglobulin structure in vertebrate systems is relatively well understood.

[0078] As will be discussed in more detail below, the general term "antibody" includes five different classes of antibodies that can be biochemically distinguished. Although all five classes of antibodies are clearly within the scope of the present disclosure, the following discussion generally relates to the IgG class of immunoglobulin molecules. With respect to IgG, an immunoglobulin comprises two identical light chains with a molecular weight of approximately 23,000 daltons and two identical heavy chains with a molecular weight of 53,000 - 70,000. The four chains are linked by disulfide bonds in a "Y" configuration in which the light chains support the heavy chains starting from the mouth of the "Y" and continuing through the variable regions.

[0079] The light chains of immunoglobulins are classified into either kappa (κ) or lambda (λ). Each heavy chain class can bind to either a kappa light chain or a lambda light chain. Generally, when an immunoglobulin is produced by any of a hybridoma, B cell, or genetically engineered host cell, the light and heavy chains covalently bond to each other, and the "tail" portions of the two heavy chains bind to each other by either a covalent disulfide bond or a non-covalent bond. In the heavy chain, the amino acid sequence extends from the N-terminus at the branched end of the "Y" configuration to the C-terminus at the bottom of each chain. Those skilled in the art will understand that the heavy chains are classified as gamma (γ), mu (μ), alpha (α), delta (δ), or epsilon (ε), and that there are several subclasses among them (e.g., γ1 - γ4). It is this property of the chain that determines the "class" of the antibody to be IgG, IgM, IgA, or IgE, respectively. Immunoglobulin isotype subclasses (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, etc.) are well-characterized and are known to confer functional specialization. Each modified version of these classes and isotypes is readily distinguishable to those skilled in the art in view of the present disclosure and is therefore within the scope of the present disclosure.

[0080] Both the light and heavy chains are divided into regions of structural and functional homology. The term "region" refers to a part or portion of an immunoglobulin or antibody chain and includes the constant or variable regions, as well as more discrete parts or portions of such regions. For example, the light chain variable region includes "complementary determining regions" or "CDRs" that are interspersed between "framework regions" or "FRs" as defined herein.

[0081] The regions of an immunoglobulin heavy or light chain can be defined as "constant" (C) regions or "variable" (V) regions based on the relative lack of sequence variation within the regions of various class members in the case of "constant regions", or based on significant variation within the regions of various class members in the case of "variable regions". The terms "constant region" and "variable region" can also be used functionally. In this regard, it will be understood that the variable region of an immunoglobulin or antibody determines antigen recognition and specificity. Conversely, the constant region of an immunoglobulin or antibody confers important effector functions such as secretion, transplacental mobility, Fc receptor binding, complement binding, etc. The subunit structure and three-dimensional conformation of the constant regions of the various immunoglobulin classes are well known.

[0082] The constant and variable regions of immunoglobulin heavy and light chains are folded into domains. The term "domain" refers to a globular region of a heavy or light chain that includes, for example, a peptide loop (e.g., containing 3 - 4 peptide loops) stabilized by β - pleated sheets and / or intra - chain disulfide bonds. The constant region domain on the light chain of an immunoglobulin is synonymously referred to as the "light chain constant region domain", "CL region", "CL domain" or "CK domain". The constant domains on the heavy chain (e.g., hinge, CH1, CH2 or CH3 domains) are synonymously referred to as the "heavy chain constant region domain", "CH" region domain or "CH domain". The variable domain on the light chain is synonymously referred to as the "light chain variable region domain", "VL region domain" or "VL domain". The variable domain on the heavy chain is synonymously referred to as the "heavy chain variable region domain", "VH region domain" or "VH domain".

[0083] By convention, the amino acid numbering of the variable constant region domains increases as they become more distal from the antigen-binding site or amino terminus of the immunoglobulin or antibody. The N-terminus of each heavy and light immunoglobulin chain is the variable region, and the C-terminus is the constant region. The CH3 domain and the CL domain include the carboxy termini of the heavy and light chains, respectively. Thus, the domains of the light chain immunoglobulin are arranged in a VL-CL orientation, and the domains of the heavy chain are arranged in a VH-CH1-hinge-CH2-CH3 orientation.

[0084] The assignment of amino acids to each variable domain region follows the definitions of Kabat, Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, MD, 1987 and 1991). Kabat also provides a widely used numbering convention (Kabat numbering) that assigns the same number to corresponding residues between different heavy chain variable regions or between different light chain variable regions. CDR 1, 2, and 3 of the VL domain are also referred to herein as CDR-L1, CDR-L2, and CDR-L3, respectively. CDR 1, 2, and 3 of the VH domain are also referred to herein as CDR-H1, CDR-H2, and CDR-H3, respectively. If so, the assignment of CDRs can follow IMGT® (Lefranc et al., Developmental & Comparative Immunology 27:55-77; 2003) instead of Kabat. The numbering of the heavy chain constant region is by the EU index as described in Kabat (Kabat, Sequences of Proteins of Immunological Interest, National Institutes of Health, Bethesda, MD, 1987 and 1991).The exact amino acid sequence boundaries of a given CDR or FR can be readily determined using any of several well-known schemes, including those described by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. ("Kabat" numbering scheme), Al-Lazikani et al., (1997) JMB 273, 927-948 ("Chothia" numbering scheme), MacCallum et al., J. Mol. Biol. 262:732-745 (1996), "Antibody-antigen interactions: Contact analysis and binding site topography," J. Mol. Biol. 262, 732-745. ("Contact" numbering scheme), Lefranc M P et al., "IMGT unique numbering for immunoglobulin and T cell receptor variable domains and Ig superfamily V-like domains," Dev Comp Immunol, 2003 January;27(1):55-77 ("IMGT" numbering scheme), and Honegger A and Pluckthun A, "Yet another numbering scheme for immunoglobulin variable domains: an automatic modeling and analysis tool," J Mol Biol, 2001 Jun. 8;309(3):657-70 (AHo numbering scheme).

[0085] The boundaries of a given CDR or FR may vary depending on the scheme used for identification. For example, the Kabat scheme is based on structural alignment, while the Chothia scheme is based on structural information. The numbering for both the Kabat and Chothia schemes is based on the most common antibody region sequence lengths, and insertions are accommodated by inserted letters, such as "30a", and deletions appear in some antibodies. The two schemes place specific insertions and deletions ("indels") at different positions, resulting in different numberings. The contact scheme is based on the analysis of complex crystal structures and is similar to the Chothia numbering scheme in many respects.

[0086] As used herein, the CDRs of an antibody can be determined according to the numbering system referred to as "IMGT" described in Lefranc (1999), The Immunologist, vol. 7:132-136 and Lefranc et al. (1999), Nucleic Acids Res., vol. 27:209-212.

[0087] As used herein, the CDRs of an antibody can be determined according to the Chothia numbering scheme that refers to the positions of immunoglobulin structural loops. Chothia and Lesk (1987), J. Mol. Biol., vol. 196:901-917; Al-Lazikani et al. (1997), J. Mol. Biol., vol. 273:927-948; Chothia et al. (1992), J. Mol. Biol., vol. 227:799-817; Tramontano A et al. (1990), J. Mol. Biol. vol. 215(1):175-82.

[0088] As used herein, the CDRs of an antibody can be determined according to the Honegger-Pluckthun numbering scheme described in Honnegger and Pluckthun (2001), J. Mol. Biol., vol. 309(3):657-670.

[0089] As used herein, the term "VH domain" includes the amino-terminal variable domain of an immunoglobulin heavy chain, and the term "VL domain" includes the amino-terminal variable domain of an immunoglobulin light chain.

[0090] As used herein, the term "CH1 domain" includes the first (most amino-terminal) constant region domain of an immunoglobulin heavy chain extending, for example, from positions approximately 114 to 223 (EU positions 118 to 215) of the Kabat numbering system. The CH1 domain is adjacent to the VH domain, is at the amino terminus of the hinge region of the immunoglobulin heavy chain molecule, and does not form part of the Fc region of the immunoglobulin heavy chain.

[0091] As used herein, the term "hinge region" includes the part of the heavy chain molecule that connects the CH1 domain to the CH2 domain. The hinge region contains approximately 25 residues, is flexible, and thus allows the two N-terminal antigen-binding regions to move independently. The hinge region can be subdivided into three different domains: an upper, a middle, and a lower hinge domain (Roux et al. J. Immunol. 1998, 161:4083).

[0092] As used herein, the term "CH2 domain" includes the portion of a heavy chain immunoglobulin molecule extending, for example, from positions approximately 244 to 360 (EU positions 231 to 340) of the Kabat numbering system. The CH2 domain is unique in that it is not closely paired with another domain. Rather, two N-linked branched carbohydrate chains are sandwiched between the two CH2 domains of an intact native IgG molecule. In one embodiment, the binding polypeptide of the present disclosure includes a CH2 domain derived from an IgG1 molecule (e.g., a human IgG1 molecule).

[0093] As used herein, the term "CH3 domain" includes the portion of the heavy chain immunoglobulin molecule that extends approximately 110 residues from the N-terminus of the CH2 domain, for example, positions approximately 361 to 476 (EU positions 341 to 445) of the Kabat numbering system. The CH3 domain typically forms the C-terminal portion of the antibody. However, in some immunoglobulins, additional domains may extend from the CH3 domain to form the C-terminal portion of the molecule (e.g., the CH4 domain in the μ chain of IgM and the ε chain of IgE). In one embodiment, the binding polypeptide of the present disclosure includes a CH3 domain derived from an IgG1 molecule (e.g., a human IgG1 molecule).

[0094] As used herein, the term "CL domain" includes the constant region domain of the immunoglobulin light chain that extends from, for example, Kabat position approximately 107A to Kabat position approximately 216. The CL domain is adjacent to the VL domain. In one embodiment, the binding polypeptide of the present disclosure includes a CL domain derived from a kappa light chain (e.g., a human kappa light chain).

[0095] The variable region of an antibody enables the antibody to selectively recognize and specifically bind to an epitope on an antigen. That is, the VL domain and VH domain of the antibody combine to form the variable region (Fv) that defines the three-dimensional antigen-binding site. More specifically, the antigen-binding site is defined by three complementarity-determining regions (CDRs) of each of the heavy chain variable region and the light chain variable region. As used herein, the term "antigen-binding site" includes the site that specifically binds to an antigen (e.g., a cell surface or soluble antigen). The antigen-binding site includes the immunoglobulin heavy chain and light chain variable regions, and the binding site formed by these variable regions determines the specificity of the antibody. The antigen-binding site is formed by different variable regions for each antibody. The modified antibody of the present disclosure includes at least one antigen-binding site.

[0096] In certain embodiments, the binding polypeptide of the present disclosure comprises at least two antigen-binding domains that provide for the association of the binding polypeptide with a selected antigen. The antigen-binding domains need not be derived from the same immunoglobulin molecule. In this regard, the variable regions may be derived from any type of animal capable of initiating a humoral response and inducing the production of immunoglobulins against a desired antigen. Thus, the variable regions of the binding polypeptide can be, for example, of mammalian origin, such as human, mouse, rat, goat, sheep, non-human primates (such as cynomolgus monkeys, macaques, etc.), lupine or camelids (such as camels, llamas and related species).

[0097] In a naturally occurring antibody, the six CDRs present on each monomeric antibody are short discontinuous sequences of amino acids that are specifically arranged to form an antigen-binding site when the antibody assumes its three-dimensional conformation in an aqueous environment. The remaining portions of the heavy and light variable domains exhibit less intermolecular variability in the amino acid sequence and are referred to as framework regions. The framework regions predominantly assume a β-sheet conformation, and the CDRs form loops that connect and in some cases form part of the β-sheet structure. Thus, these framework regions serve to form a scaffold that positions the six CDRs in the correct orientation by non-covalent intermolecular interactions. The antigen-binding domain formed by the arranged CDRs defines a surface that is complementary to an epitope on an immunoreactive antigen. This complementary surface facilitates the non-covalent binding of the antibody to the immunoreactive antigen epitope.

[0098] Exemplary binding polypeptides include antibody variants. As used herein, the term "antibody variant" refers to an antibody that has been modified such that it does not occur naturally, for example, synthetic and engineered forms of antibodies that contain at least two heavy chain moieties but do not contain two complete heavy chains (e.g., domain-deleted antibodies or minibodies); antibodies in multispecific forms that have been modified to bind to two or more different antigens or different epitopes on a single antigen (e.g., bispecific, trispecific, etc.); heavy chain molecules linked to scFv molecules, etc. Further, the term "antibody variant" includes multivalent forms of antibodies (e.g., trivalent, tetravalent, etc. antibodies that bind to three, four, or more copies of the same antigen).

[0099] As used herein, the term "valence" refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds to one target molecule or a specific site on a target molecule. If a polypeptide contains two or more target binding sites, each target binding site can specifically bind to the same or different molecules (e.g., different ligands or different antigens, or different epitopes on the same antigen). The subject binding polypeptide typically has at least one binding site specific for a human antigen molecule. For example, a typical IgG1 monoclonal antibody is specific for one target antigen. A bivalent antibody contains antigen-binding domains that target two different antigens, or two antigen-binding domains that target one antigen. Similarly, a trivalent antibody can be a monospecific antibody having three targeting domains for a single antigen. A trivalent antibody can be bispecific if it binds to a first antigen having two binding domains and a second antigen having another binding domain. A trivalent antibody can be trispecific and bind to three different targets.

[0100] The term "specificity" refers to the ability to specifically bind to a given target antigen (e.g., a human target antigen). The binding polypeptide can be monospecific and can include one or more binding sites that specifically bind to the target, or the polypeptide can be multispecific and can include two or more binding sites that specifically bind to the same or different targets. In certain embodiments, the binding polypeptide is specific for two different (e.g., non-overlapping) portions of the same target. In certain embodiments, the binding polypeptide is specific for two or more targets. Exemplary binding polypeptides (e.g., antibodies) that include antigen-binding sites that bind to antigens expressed on tumor cells are known in the art, and one or more CDRs from such antibodies can be included in the antibodies described herein.

[0101] As used herein, the term "antigen" or "target antigen" refers to a molecule or a portion of a molecule that can be bound by a binding site of a binding polypeptide. The target antigen can have one or more epitopes.

[0102] The term "about" or "approximately" means within about 20% within, such as within about 10% within, within about 5% within, or within about 1% or less of a given value or range.

[0103] As used herein, "administering" or "administration" refers to the act of injecting or otherwise physically delivering a substance that is present ex vivo (e.g., an isolated binding polypeptide provided herein) to a patient by, but not limited to, the lungs (e.g., inhalation), mucosa (e.g., intranasal), intradermal, intravenous, intramuscular, subcutaneous delivery, and / or any other physical delivery method described herein or known in the art. When a disease or its symptoms are being managed or treated, the administration of the substance is typically performed after the onset of the disease or its symptoms. When a disease or its symptoms are being prevented, the administration of the substance is typically performed before the onset of the disease or its symptoms and can be continued chronically to delay or reduce the appearance or magnitude of disease-related symptoms.

[0104] As used herein, the term "composition" is intended to encompass a product that contains a specific ingredient (e.g., an isolated binding polypeptide provided herein) in any chosen amount, as well as any product that results directly or indirectly from any chosen combination of specific amounts of specific ingredients.

[0105] "Effective amount" means an amount of an active pharmaceutical (e.g., an isolated binding polypeptide of the present disclosure) sufficient to achieve a desired physiological outcome in an individual in need of the agent. The effective amount can vary between individuals depending on the health and condition of the individual being treated, the taxonomic group of the individual being treated, the formulation of the composition, the assessment of the medical condition of the individual, and other relevant factors.

[0106] As used herein, the terms "subject" and "patient" are used interchangeably. As used herein, a subject can be a mammal such as a non - primate (e.g., cow, pig, horse, cat, dog, rat, etc.) or a primate (e.g., monkey and human). In certain embodiments, as used herein, the term "subject" refers to a vertebrate such as a mammal. Mammals include, but are not limited to, humans, non - human primates, wild animals, feral animals, livestock, sport animals, and pets.

[0107] As used herein, the term "treatment" refers to any protocol, method, and / or agent that can be used for the prevention, management, treatment, and / or amelioration of a disease or symptoms associated therewith. In some embodiments, the term "treatment" refers to any protocol, method, and / or agent that can be used for modulating an immune response against an infection or symptoms associated therewith in a subject. In some embodiments, the terms "treatment(s)" and "therapy(ies)" refer to biological therapies, supportive therapies, and / or other therapies useful for the prevention, management, treatment, and / or amelioration of a disease or symptoms associated therewith known to those of ordinary skill in the art, such as medical practitioners. In other embodiments, the terms "treatment(s)" and "therapy(ies)" refer to biological therapies, supportive therapies, and / or other therapies useful for modulating an immune response against an infection or symptoms associated therewith in a subject known to those of ordinary skill in the art, such as medical practitioners.

[0108] As used herein, the terms "treat", "treatment", and "treating" refer to a decrease or amelioration in the progression, severity, and / or duration of a disease or symptoms associated therewith resulting from the administration of one or more treatments (including, but not limited to, the administration of one or more prophylactic or therapeutic agents, such as the isolated binding polypeptides provided herein). As used herein, the term "treating" can also refer to altering the course of a disease in a subject being treated. Therapeutic effects of treatment include, but are not limited to, prevention of the occurrence or recurrence of a disease, alleviation of symptoms, reduction of direct or indirect pathological consequences of a disease, decreased rate of disease progression, improvement or alleviation of a disease state, and remission or improved prognosis.

[0109] BCMA As used herein, the term "BCMA" refers to B cell maturation antigen. BCMA (also known as TNFRSF17, BCM or CD269) is a member of the tumor necrosis factor receptor (TNFR) family and is expressed primarily on terminally differentiated B cells, such as memory B cells and plasma cells. Its ligands are called B cell activating factor (BAFF) and a proliferation-inducing ligand (APRIL) of the TNF family. BCMA is involved in mediating the survival of plasma cells for maintaining long-term humoral immunity. The BCMA gene is encoded on chromosome 16 and generates a primary 35 mRNA transcript that is 994 nucleotides long (NCBI accession NM_001192.2) encoding a 184 amino acid protein (NP_001183.2). A second antisense transcript derived from the BCMA locus has been described and may play a role in the regulation of BCMA expression. (Laabi Y. et al., Nucleic Acids Res., 1994, 22:1147-1154) Additional transcriptional variants have been described with unknown significance (Smirnova A S et al. Mol Immunol., 2008, 45(4):1179-1183. A second isoform, also known as TV4, has been identified (Uniprot identifier Q02223-2). "BCMA" includes proteins that are variants of full-length wild-type BCMA, such as point mutations, fragments, insertions, deletions, and splice variants.

[0110] Natural killer cell As used herein, the term "natural killer cell" or "NK cell" refers to a subpopulation of lymphocytes involved in innate immunity. NK cells can be identified by the expression of certain surface antigens including CD16, CD56 and / or CD57, NKp46 for human NK cells, the absence of alpha / beta or gamma / delta TCR complexes on the cell surface, the ability to bind to and kill cells that do not express "self" MHC / HLA antigens by activating certain cell lysis mechanisms, the ability to kill tumor cells or other diseased cells that express ligands for NK activating receptors, and the ability to release protein molecules called cytokines that stimulate or inhibit the immune response. Any of these characteristics and biological properties can be used to identify NK cells using methods well known in the art. Any subpopulation of NK cells is also encompassed by the term NK cells. In the context of this specification, "activated" NK cells refer to biologically active NK cells, including NK cells having the ability to lyse target cells or enhance the immune function of other cells. NK cells can be obtained by various techniques known in the art, such as isolation from blood samples, cytapheresis, tissue or cell collection. Protocols useful for assays involving NK cells can be found in Natural Killer Cells Protocols (edited by Campbell KS and Colonna M), Human Press, pp. 219-238 (2000).

[0111] NKp46 As used herein, the "NKp46" marker, also known as "CD335" or "NKP46" or "NK-p46" or "LY94", or "natural cytotoxicity triggering receptor 1", refers to a protein or polypeptide encoded by the Ncr1 gene. The reference sequence for the full-length human NKp46 protein is available from the NCBI database under accession number NP_004820. The human NKp46 mRNA sequence is described in NCBI accession number NM_004829.

[0112] NK cell engager As used herein, an isolated effector-competent polypeptide includes a multispecific antibody in an NK cell engager format. An "NK cell engager" refers to a binding protein that includes an activating NK cell receptor, an antigen-specific targeting region, and optionally a monoclonal antibody domain targeting an Fc region (Gauthier, et al. (2019) Cell, 177:1701-13). NK cells express CD16a, also known as FcγRIIIa, which binds with low affinity to the Fc portion of an antibody (Cerwenka and Lanier (2018) Science 359:6383). Engagement of CD16a requires less compared to CD3 engagement due to less steric hindrance and is further facilitated by the absence of accessory molecules. Upon recognition of antibody-decorated target cells, NK cells mediate antibody-dependent cell cytotoxicity (ADCC) and kill the target cells (Lo Nigro (2019) Ann Transl Med 7:105). Utilizing this naturally occurring mechanism, engaging CD16 in combination with NKp46 (another activating NK cell receptor) can generate a trifunctional natural killer cell engager (i.e., NKCE), which can result in impressive therapeutic outcomes. For a review of NK cell engagers, see Demaria et al. (2021) Eur. J. Immunology 51(8):1934, which is incorporated herein by reference in its entirety.

[0113] Trifunctional NKCEs are more potent in vitro than clinical therapeutic antibodies targeting the same antigen, have in vivo pharmacokinetics similar to those of full IgG antibodies, and have no off-target effects. See International Application No. PCT / IB21 / 62494, which is incorporated herein by reference in its entirety.

[0114] Fc domain In certain aspects of the present disclosure, an Fc domain, such as an Fc domain variant, is provided. As used herein, the terms "Fc region" or "Fc domain" refer to the portion of the heavy chain constant region that begins at the hinge region immediately upstream of the papain cleavage site (i.e., residue 216 in IgG, with the first residue of the heavy chain constant region being 114) and ends at the C-terminus of the antibody. Thus, a complete Fc region includes at least the hinge domain, CH2 domain, and CH3 domain.

[0115] The Fc region of an antibody is involved in non-antigen binding and can mediate effector functions by binding to Fc receptors. There are several different types of Fc receptors, which are classified based on the type of antibody they recognize. For example, Fc-gamma receptors (FcγR) bind to IgG-class antibodies, Fc-alpha receptors (FcαR) bind to IgA-class antibodies, and Fc-epsilon receptors (FcεR) bind to IgE-class antibodies. The neonatal Fc receptor (FcRn) interacts with the Fc region of an antibody to promote antibody recycling by salvage from normal lysosomal degradation. FcγR belongs to a family that includes several members, such as FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, and FcγRIIIb.

[0116] As used herein, the terms "native Fc" or "wild-type Fc" refer to molecules corresponding to the sequences of non-antigen-binding fragments produced by other means, whether resulting from digestion of an antibody or in monomeric or multimeric form, and can include the hinge region. The original immunoglobulin source of native Fc is typically of human origin and can be any immunoglobulin, such as IgG1 and IgG2. Native Fc molecules are composed of monomeric polypeptides that can be linked into dimeric or multimeric forms by covalent (i.e., disulfide bonds) and non-covalent bonds. The number of intermolecular disulfide bonds between the monomeric subunits of native Fc molecules ranges from 1 to 4 depending on the class (e.g., IgG, IgA, and IgE) or subclass (e.g., IgG1, IgG2, IgG3, IgA1, and IgGA2). An example of native Fc is a disulfide-bonded dimer resulting from papain digestion of IgG. As used herein, the term "native Fc" can be used for monomers, dimers, and multimers alike.

[0117] As used herein, the terms "Fc domain variant", "Fc variant", or "modified Fc" refer to molecules or sequences that are modified from native / wild-type Fc but still contain the binding site for FcR. Thus, the term "Fc variant" can include molecules or sequences that are humanized from non-human native Fc. Furthermore, since native Fc provides structural features or biological activities not required for the antibody-like binding polypeptides described herein, it can include regions that can be removed. Thus, the term "Fc variant" includes molecules or sequences that lack one or more native Fc sites or residues, or in which one or more Fc sites or residues are modified and affect or are involved in: (1) disulfide bond formation, (2) incompatibility with a selected host cell, (3) N-terminal heterogeneity upon expression in a selected host cell, (4) glycosylation, (5) interaction with complement, (6) binding to Fc receptors other than salvage receptors, or (7) antibody-dependent cell cytotoxicity (ADCC).

[0118] As used herein, the term "effector-competent Fc variant" or "effector-competent polypeptide" refers to an Fc domain having one or more Fc effector functions as further described herein.

[0119] In certain exemplary embodiments, the Fc variants characterized herein have one or more of an increased serum half-life, enhanced FcRn binding affinity, enhanced FcRn binding affinity at acidic pH, enhanced FcγRIIIa binding affinity, and / or similar thermal stability as compared to wild-type Fc.

[0120] FcγRIIIa V176, or FcγRIIIa V158, or human CD16a-V receptor, or CD16a V refers to a polypeptide construct that binds to the Fc region of a natural antibody, mediates antibody-dependent cell cytotoxicity, and contains a fragment of the CD16 human receptor having valine (V) at position 176 or position 158, which has also been reported in the literature as allotype CD16a V176 or allotype CD16a V158.

[0121] FcγRIIIa F176, or FcγRIIIa F158, or human CD16a-F receptor, or CD16a F refers to a polypeptide construct that binds to the Fc region of a natural antibody, mediates antibody-dependent cell cytotoxicity, and contains a fragment of the CD16 human receptor having phenylalanine (F) at position 176 or position 158, which has also been reported in the literature as allotype CD16a F176 or allotype CD16a F158.

[0122] As used herein, the term "Fc domain" encompasses native / wild-type Fc and Fc variants and sequences as defined herein. Similar to Fc variants and native Fc molecules, the term "Fc domain" includes molecules in monomeric or multimeric forms, whether digested from whole antibodies or produced by other means.

[0123] In certain exemplary embodiments, the Fc domains described herein are thermally stabilized.

[0124] In certain exemplary embodiments, the Fc domains described herein are glycosylated (e.g., via N-linked glycosylation). In certain exemplary embodiments, the Fc domain comprises N-linked glycosylation at an N-linked glycosylation motif that includes, for example, the amino acid sequence NXT or NXS (where X is any amino acid residue other than proline). In certain exemplary embodiments, the Fc domain is glycosylated at amino acid position 297 according to EU numbering.

[0125] In certain exemplary embodiments, the Fc domains described herein are effector competent.

[0126] In certain exemplary embodiments, the Fc domains described herein are any combination of thermally stabilized, glycosylated, and effector competent.

[0127] Thermally stabilized Fc domain variants The structure of the constant antibody domain is similar to that of the variable domain, which consists of β-strands connected by loops and short helices. The CH2 domain of the heavy constant region exhibits weak carbohydrate-mediated intermolecular protein interactions, in contrast to the extensive intermolecular interactions shown by other domains. The isolated mouse CH2 domain is relatively unstable at physiological temperature (Feige et al., 2004, J. Mol. Biol. 344:107-118), but previous studies have demonstrated that the thermal stability of the CH2 domain can be enhanced by the addition of intramolecular disulfide bonds, and that these can be used as scaffolds for conjugates (Gong et al., 2009, J. Biol. Chem. 284:14203-210).

[0128] Effector-enhanced Fc domain mutants that exhibit increased thermal instability (i.e., decreased thermal stability) compared to the wild-type Fc domain are known. For example, the S239D / I332E and S239D / I332E / A330L mutants result in a decrease in the stability of the CH2 domain, as shown by a decrease in the melting temperature (Tm) in differential scanning calorimetry (DSC) analysis. G236A / S239D / A330L / I332E shows a decrease in the thermal shift measurement of the protein and a significant decrease in the half-life in hFcγR transgenic mice when compared to the wild type. (See Liu et al. (2014) J. Biol. Chem. 289(6):3571, and for a review Liu et al. (2020) Antibodies 9(4):64)

[0129] Effector-enhanced Fc domain mutants with improved FcγR binding and not significantly decreased stability compared to the wild type are known. (See, for example, Igawa et al., European Patent No. 2 940 135)

[0130] It has further been discovered that thermostabilized Fc domain mutants can be produced by introducing one or more disulfide bonds into the Fc domain. Thus, in one aspect, the present disclosure provides Fc domain mutants comprising one or more engineered (e.g., non-natural) disulfide bonds, such as intramolecular disulfide bonds mediated by, for example, one or more cysteine pairs.

[0131] In certain exemplary embodiments, the disulfide bond is an intramolecular disulfide bond between two CH2 regions of the Fc domain. In certain exemplary embodiments, the disulfide bond is an intramolecular disulfide bond between two CH3 regions of the Fc domain. In certain exemplary embodiments, two or more intramolecular disulfide bonds are present between two CH2 regions of the Fc domain and / or between two CH3 regions of the Fc domain.

[0132] The tendency of thermal stability, or the Fc domain (e.g., an Fc domain with or without a binding polypeptide) to unfold can be determined using various methods known in the art. For example, the unfolding or denaturation temperature can be measured by nanoformat differential scanning calorimetry (nanoDSC) or nanoformat differential scanning fluorimetry (nanoDSF) (Wen et al., 2020 Anal. Biochem. 593:113581). The detectable temperature at which the protein begins to unfold is Tonset.

[0133] In certain exemplary embodiments, the Tonset of a thermally stabilized Fc domain variant (e.g., having one or more engineered disulfide bonds) is increased compared to an unstabilized Fc domain variant. In certain exemplary embodiments, the Tonset of a thermally stabilized Fc domain variant is about 1.0 °C, about 1.5 °C, about 2.0 °C, about 2.5 °C, about 3.0 °C, about 3.5 °C, about 4.0 °C, about 4.5 °C, about 5.0 °C, about 5.5 °C, about 6.0 °C, about 6.5 °C, about 7.0 °C, about 7.5 °C, about 8.0 °C, about 8.5 °C, about 9.0 °C, about 9.5 °C, about 10.0 °C, about 10.5 °C, about 11.0 °C, about 11.5 °C, about 12.0 °C, about 12.5 °C, about 13.0 °C, about 13.5 °C, about 14.0 °C, about 14.5 °C, about 15.0 °C, about 15.5 °C, about 16.0 °C, about 16.5 °C, about 17.0 °C, about 17.5 °C, about 18.0 °C, about 18.5 °C, about 19.0 °C, about 19.5 °C, about 20.0 °C, about 20.5 °C, about 21.0 °C, about 21.5 °C, about 22.0 °C, about 22.5 °C, about 23.0 °C, about 23.5 °C, about 24.0 °C, about 24.5 °C or about 25.0 °C higher than that of an unstabilized Fc domain variant.

[0134] In certain exemplary embodiments, the thermostabilized Fc domain variant has one or more amino acid substitution pairs selected from the group consisting of cysteine substitutions at the following positions: amino acid positions 242 and 334; amino acid positions 240 and 334; amino acid positions 287 and 306; amino acid positions 292 and 302; amino acid positions 323 and 332; amino acid positions 259 and 306; amino acid positions 350 and 441; amino acid positions 343 and 431; amino acid positions 375 and 404; amino acid positions 375 and 396; and amino acid positions 348 and 439 (according to EU numbering). (Wozniak-Knopp et al., 2012, PLoS One 7:e30083; Jacobsen et al., 2017 J. Biol. Chem. 202:1865-75; see WO 2014 / 153063 pamphlet for review)

[0135] In certain exemplary embodiments, the thermostabilized Fc domain variant comprises engineered (e.g., non-natural) intramolecular disulfide bonds mediated by a pair of cysteines that substitute for (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334; (ii) alanine (A) at amino acid position 287 and leucine (L) at amino acid position 306; or (iii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302, according to EU numbering.

[0136] In certain exemplary embodiments, the thermostabilized Fc domain variant comprises engineered (e.g., non-natural) intramolecular disulfide bonds mediated by a pair of cysteines that substitute for (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334; and (ii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302, according to EU numbering.

[0137] In certain exemplary embodiments, the thermostabilized Fc domain variant comprises engineered (e.g., non-natural) intramolecular disulfide bonds mediated by a pair of cysteines that replace leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334. In certain exemplary embodiments, the thermostabilized Fc domain variant comprises engineered (e.g., non-natural) intramolecular disulfide bonds mediated by a pair of cysteines that replace alanine (A) at amino acid position 287 and leucine (L) at amino acid position 306. In certain exemplary embodiments, the thermostabilized Fc domain variant comprises engineered (e.g., non-natural) intramolecular disulfide bonds mediated by a pair of cysteines that replace arginine (R) at amino acid position 292 and valine (V) at amino acid position 302. In certain exemplary embodiments, the thermostabilized Fc domain variant can comprise at least one engineered intramolecular disulfide bond. In certain exemplary embodiments, the thermostabilized Fc domain variant can comprise two or more engineered intramolecular disulfide bonds.

[0138] Effector-enhanced Fc domain variant In one aspect, the present disclosure provides an Fc domain variant comprising effector-enhancing amino acid substitutions.

[0139] In one embodiment, an Fc domain variant having modified FcγRIIIa binding, comprising one or more amino acid substitutions, as disclosed herein. In one embodiment, an Fc domain variant having enhanced FcγRIIIa binding affinity, having one or more amino acid substitutions, as disclosed herein. In one embodiment, the Fc domain variant having enhanced FcγRIIIa binding affinity comprises two or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant having enhanced FcγRIIIa binding affinity comprises three or more amino acid substitutions as disclosed herein. In one embodiment, the Fc domain variant having enhanced FcγRIIIa binding affinity comprises four or more amino acid substitutions as disclosed herein.

[0140] In one embodiment, an Fc domain variant having modified FcRn binding comprises an Fc domain having one or more amino acid substitutions disclosed herein. In one embodiment, an Fc domain variant having enhanced FcRn binding affinity comprises an Fc domain having one or more amino acid substitutions disclosed herein. In one embodiment, an Fc domain variant having enhanced FcRn binding affinity comprises an Fc domain having two or more amino acid substitutions disclosed herein. In one embodiment, an Fc domain variant having enhanced FcRn binding affinity comprises an Fc domain having three or more amino acid substitutions disclosed herein.

[0141] In some embodiments, the Fc domain variant may exhibit species-specific FcRn binding affinity. In one embodiment, the Fc domain variant may exhibit FcRn binding affinity. In one embodiment, the Fc domain variant may exhibit cynomolgus monkey FcRn binding affinity. In some embodiments, the Fc domain variant may exhibit cross-species FcRn binding affinity. Such Fc domain variants are said to be cross-reactive across one or more different species. In one embodiment, the Fc domain variant may exhibit FcRn binding affinity for both human and cynomolgus monkey.

[0142] The neonatal Fc receptor (FcRn) interacts with the Fc region of an antibody and promotes recycling by rescuing from normal lysosomal degradation. This process occurs in endosomes at acidic pH (e.g., pH less than 6.5), but is a pH-dependent process that does not occur under physiological pH conditions of the bloodstream (e.g., non-acidic pH). In some embodiments, the Fc domain variant has enhanced FcRn binding affinity at acidic pH compared to the wild-type Fc domain. In some embodiments, the Fc domain variant has enhanced FcRn binding affinity at a pH less than 7.0, such as about pH 6.5, about pH 6.0, about pH 5.5, about pH 5.0, compared to the wild-type Fc domain. In some embodiments, the Fc domain variant has enhanced FcRn binding affinity at a pH less than 7.0, such as about pH 6.5, about pH 6.0, about pH 5.5, about pH 5.0, compared to the FcRn binding affinity of the wild-type Fc domain at elevated non-acidic pH. The elevated non-acidic pH can be, for example, a pH greater than 7.0, about pH 7.0, about pH 7.4, about pH 7.6, about pH 7.8, about pH 8.0, about pH 8.5, about pH 9.0.

[0143] In certain embodiments, it may be desirable for the Fc domain variant to exhibit substantially the same FcRn binding affinity as the wild-type Fc domain at non-acidic pH. In some embodiments, it may be desirable for the Fc domain variant to exhibit lower FcRn binding affinity at non-acidic pH than a binding polypeptide comprising a modified Fc domain having a double amino acid substitution M428L / N434S according to EU numbering (see U.S. Patent No. 8,088,376). Thus, in some cases it may be desirable for the Fc domain variant to exhibit minimal perturbation to pH-dependent FcRn binding.

[0144] In some embodiments, the Fc domain variant having enhanced FcRn binding affinity at acidic pH has a decreased (i.e., slower) FcRn off-rate compared to the wild-type Fc domain. In some embodiments, compared to the FcRn binding affinity of the binding polypeptide at elevated non-acidic pH, the Fc domain variant having enhanced FcRn binding affinity at acidic pH has a slower FcRn off-rate at acidic pH compared to the FcRn off-rate of the wild-type Fc domain at elevated non-acidic pH.

[0145] Certain embodiments include an Fc domain variant in which at least one amino acid in one or more of the constant region domains is deleted or otherwise modified so as to provide a desired biochemical characteristic, such as decreased or enhanced effector function, the ability to non-covalently dimerize, increased ability to localize to the site of a tumor, decreased serum half-life, or increased serum half-life, when compared to a fully unaltered antibody of substantially the same immunogenicity.

[0146] In certain other embodiments, the Fc domain variant includes a constant region derived from different antibody isotypes (e.g., constant regions derived from two or more of human IgG1, IgG2, IgG3, or IgG4). In other embodiments, the Fc domain variant includes a chimeric hinge (i.e., a hinge that includes a hinge portion derived from hinge domains of different antibody isotypes, such as the upper hinge domain derived from an IgG4 molecule and the IgG1 middle hinge domain). In certain embodiments, the Fc domain can be mutated to increase or decrease effector function using techniques known in the art.

[0147] In some embodiments, the Fc domain variant has an altered binding affinity for Fc receptors. There are several different types of Fc receptors, which are classified based on the type of antibody they recognize. For example, Fc-gamma receptors (FcγR) bind IgG class antibodies, Fc-alpha receptors (FcαR) bind IgA class antibodies, and Fc-epsilon receptors (FcεR) bind IgE class antibodies. FcγR belongs to a family that includes several members, such as FcγRI, FcγRIIa, FcγRIIb, FcγRIIIa, and FcγRIIIb. In some embodiments, the Fc domain variant has an altered FcγRIIIa binding affinity compared to the wild-type Fc domain. In some embodiments, the Fc domain variant has a reduced FcγRIIIa binding affinity compared to the wild-type Fc domain. In some embodiments, the Fc domain variant has an enhanced FcγRIIIa binding affinity compared to the wild-type Fc domain. In some embodiments, the Fc domain variant-modified Fc domain has an approximately the same FcγRIIIa binding affinity compared to the wild-type Fc domain.

[0148] In certain embodiments, the Fc domain variant comprises an antibody constant region that mediates one or more effector functions (e.g., an IgG constant region, e.g., a human IgG constant region, e.g., a human IgG1 constant region). For example, binding of the C1 complex to the antibody constant region can activate the complement system. Activation of the complement system is important in the opsonization and lysis of cellular pathogens. Activation of the complement system also stimulates the inflammatory response and can be involved in autoimmune hypersensitivity. Further, antibodies bind to receptors on various cells via the Fc domain (the Fc receptor binding site on the antibody Fc region binds to the Fc receptor (FcR) on the cell). There are several Fc receptors specific for different classes of antibodies, including IgG (gamma receptor), IgE (epsilon receptor), IgA (alpha receptor), and IgM (mu receptor). Binding of the antibody to the Fc receptor on the cell surface causes several important and diverse biological responses, including phagocytosis and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (referred to as antibody-dependent cell-mediated cytotoxicity or ADCC), release of inflammatory mediators, placental transfer, and regulation of immunoglobulin production. In some embodiments, the Fc domain variant, e.g., a binding polypeptide (e.g., an antibody, an immunoadhesin, or an antibody variant), binds to the Fc-gamma receptor. In alternative embodiments, the Fc domain variant lacks one or more effector functions (e.g., ADCC activity) and / or comprises a constant region that cannot bind to the Fcγ receptor.

[0149] In certain exemplary embodiments, the effector-enhanced Fc domain variant has one or more amino acid substitutions selected from the group consisting of: aspartic acid (D) at amino acid position 221; cysteine (C) at amino acid position 222; tyrosine (Y) at amino acid position 234; alanine (A) at amino acid position 236; tryptophan (W) at amino acid position 236; aspartic acid (D) at amino acid position 239; leucine (L) at amino acid position 243; glutamic acid (E) at amino acid position 267; phenylalanine (F) at amino acid position 268; proline (P) at amino acid position 292; alanine (A) at amino acid position 298; leucine (L) at amino acid position 300; isoleucine (I) at amino acid position 305; threonine (T) at amino acid position 324; tryptophan (W) at amino acid position 326; alanine (A) at amino acid position 326; leucine (L) at amino acid position 330; glutamic acid (E) at amino acid position 332; alanine (A) at amino acid position 333; serine (S) at amino acid position 333; alanine (A) at amino acid position 334; alanine (A) at amino acid position 336; arginine (R) at amino acid position 345; leucine (L) at amino acid position 396 (according to EU numbering). (For a review, see Saunders, 2009, Front. Immunol. doi:10.3389 / fimmu.2019.01296)

[0150] In some embodiments, the Fc domain variant can include amino acid substitutions at positions selected from amino acid positions 236, 239, 330, and 332 according to EU numbering. In some embodiments, the substitutions can include alanine (A) at amino acid position 236, aspartic acid (D) at amino acid 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332 according to EU numbering. In some embodiments, the Fc domain variant can include double amino acid substitutions at any two amino acid positions selected from alanine (A) at amino acid position 236, aspartic acid (D) at amino acid 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant can include triple amino acid substitutions at any three amino acid positions selected from alanine (A) at amino acid position 236, aspartic acid (D) at amino acid 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant can include quadruple amino acid substitutions at any four amino acid positions selected from alanine (A) at amino acid position 236, aspartic acid (D) at amino acid 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant can include a combination of amino acid substitutions including aspartic acid (D) at amino acid 239 and glutamic acid (E) at amino acid position 332. In some embodiments, the Fc domain variant can include a combination of amino acid substitutions including alanine (A) at amino acid position 236, aspartic acid (D), and glutamic acid at amino acid position 332.

[0151] In some embodiments, the Fc domain variant may further include an amino acid substitution at amino acid position 256 and / or 307 according to EU numbering. In some embodiments, the Fc domain variant may include a combination of amino acid substitutions including aspartic acid (D) at amino acid position 256 and glutamine (Q) at amino acid position 307 (see Mackness et al., 2019 MAbs 11:1276 - 88; see International Publication No. 2019147973A1, which is incorporated herein by reference in its entirety).

[0152] Glycosylated Fc domain variant In certain exemplary embodiments, the binding protein is glycosylated. Glycosylation of antibodies at conserved positions within their constant regions is known to have a significant impact on antibody function, particularly effector functions such as those described above (see, for example, Boyd et al (Mol. Immunol, 32:1311 - 1318, 1996)). Glycosylation of the binding proteins of the present disclosure in which one or more carbohydrate moieties are added, substituted, deleted or modified is contemplated. In some embodiments, the glycosylation of the Fc domain of the binding protein is N-linked glycosylation. Introduction of the asparagine-X-serine or asparagine-X-threonine motif creates potential sites for enzymatic attachment of carbohydrate moieties and can thus be used to engineer glycosylation of the Fc domain variant. Raju et al. (Biochemistry 40:8868 - 8876, 2001) increased the terminal sialylation of TNFR-IgG immunoadhesin through a process of regalactosylation and / or resialylation using β-1,4-galactosyltransferase and / or alpha,2,3-sialyltransferase. Increasing terminal sialylation is thought to increase the half-life of immunoglobulins.

[0153] Antibodies, like most glycoproteins, are typically produced as a mixture of glycoforms. This mixture is particularly evident when the antibody is produced in eukaryotic cells, especially mammalian cells. Various methods have been developed for producing defined glycoforms (see Zhang et al., 2004, Science 303:371; Sears et al., 2001, Science 291:2344; Wacker et al., 2002, Science 298:1790; Davis et al., 2002, Chem. Rev. 102:579; Hang et al., 2001, Acc. Chem. Res. 34:727). In some embodiments, the glycosylated Fc domain contains a native glycan at amino acid position 297 according to EU numbering. Glycosylation of asparagine at amino acid position 297 in the CH2 domain of IgG1 is known to promote the interaction between the Fc domain and FcγR. Elimination of this glycosylation site eliminates effector function (Leabman, et al., 2013, MAbs 5:896 - 903). In particularly illustrative embodiments, the Fc domain contains glycosylation at amino acid position 297 at wild - type levels or near wild - type levels according to EU numbering.

[0154] In some embodiments, the glycosylated Fc domain variant contains a engineered glycan or a non - native glycan. In some embodiments, the engineered glycan or non - native glycan is a modified glycan that can be conjugated to a therapeutic molecule (e.g., an antibody - drug conjugate).

[0155] Fc - containing binding polypeptide In one aspect, the disclosure provides an isolated Fc domain variant that comprises or is complexed with (e.g., fused to) at least one binding domain (e.g., at least one binding polypeptide). In certain embodiments, the binding domain comprises one or more antigen - binding domains. The antigen - binding domain need not be derived from the same molecule as the parent Fc domain. In certain embodiments, the Fc domain variant is present in an antibody.

[0156] In one embodiment, the Fc domain variant is present in or complexed with an antibody. Any antibody from any source or species can be used with the Fc domain variants disclosed herein. Suitable antibodies include, but are not limited to, chimeric antibodies, humanized antibodies or human antibodies. Suitable antibodies include, but are not limited to, full-length antibodies, monoclonal antibodies, polyclonal antibodies, or single-domain antibodies such as VHH antibodies.

[0157] In certain exemplary embodiments, the Fc domain variant can be bound or complexed to an antigen-binding fragment of an antibody. The term "antigen-binding fragment" refers to an immunoglobulin or polypeptide fragment of an antibody that binds to an antigen or competes with an intact antibody for antigen binding (i.e., specific binding) (i.e., using the intact antibody from which they are derived). Antigen-binding fragments can be produced by recombinant or biochemical methods well known in the art. Exemplary antigen-binding fragments include Fv, Fab, Fab' and (Fab')2. In certain exemplary embodiments, the binding polypeptide of the present disclosure comprises at least one antigen-binding fragment and an Fc domain variant.

[0158] In some embodiments, the binding polypeptide comprises a single-chain variable region sequence (ScFv). A single-chain variable region sequence comprises a single polypeptide having one or more antigen-binding sites, for example a VL domain linked to a VH domain by a flexible linker. ScFv molecules can be constructed in a VH-linker-VL orientation or a VL-linker-VH orientation. The flexible hinge linking the VL and VH domains that make up the antigen-binding site contains from about 10 to about 50 amino acid residues. Linker peptides are known in the art. The binding polypeptide can comprise at least one scFv and / or at least one constant region. In one embodiment, the binding polypeptide of the present disclosure can comprise at least one scFv linked or fused to an Fc domain variant.

[0159] In some embodiments, the conjugate polypeptides of the present disclosure are multivalent (e.g., tetravalent) antibodies produced by fusing a DNA sequence encoding an antibody to a ScFv molecule (e.g., a modified ScFv molecule). For example, in one embodiment, these sequences are combined such that the ScFv molecule (e.g., a modified ScFv molecule) is linked to an Fc domain variant via a flexible linker (e.g., a gly / ser linker) at its N-terminus or C-terminus. In another embodiment, the tetravalent antibodies of the present disclosure can be made by fusing a ScFv molecule to a linking peptide that is fused to an Fc domain variant to construct a ScFv-Fab tetravalent molecule.

[0160] In another embodiment, the conjugate polypeptides of the present disclosure are modified minibodies. The modified minibodies of the present disclosure are dimer molecules composed of two polypeptide chains each containing a ScFv molecule fused to an Fc domain variant via a connecting peptide. Minibodies can be made by constructing the ScFv component and linking the peptide components using methods described in the art (see, e.g., U.S. Patent No. 5,837,821 or International Publication No. 94 / 09817A1). In another embodiment, tetravalent minibodies can be constructed. Tetravalent minibodies can be constructed in the same manner as minibodies, except that two ScFv molecules are linked using a flexible linker. The linked scFv-scFv construct is then attached to an Fc domain variant.

[0161] In another embodiment, the binding polypeptide of the present disclosure comprises a diabody. A diabody is a dimeric tetravalent molecule that has polypeptides each similar to an scFv molecule but typically has a short (less than 10, e.g., about 1 to about 5) amino acid residue linker connecting both variable domains, such that the VL and VH domains on the same polypeptide chain cannot interact. Instead, the VL and VH domains of one polypeptide chain interact with the VH and VL domains on a second polypeptide chain (see, e.g., WO 02 / 02781). The diabody of the present disclosure comprises an scFv-like molecule fused to an Fc domain variant.

[0162] In another embodiment, the binding polypeptide of the present disclosure comprises a single domain antibody (sdAb), also referred to as a VHH or nanobody. Nanobody® is a registered trademark of Ablynx. A VHH comprises a variable heavy chain domain lacking a light chain. Similar to a conventional VH domain, a VHH comprises four FRs and three CDRs. VHHs have advantages over conventional antibodies. Since they are approximately 10-fold smaller than IgG molecules, properly folded functional VHHs can be produced by in vitro expression while achieving high yields. Furthermore, VHHs are very stable and resistant to the action of proteases. The properties and production of VHHs are reviewed by Harmsen and De Haard HJ (Appl. Microbiol. Biotechnol. 2007 November;77(1):13-22).

[0163] In certain exemplary embodiments, the Fc domain is fused to one or more VHHs.

[0164] In other embodiments, the binding polypeptide comprises a multispecific or multivalent antibody, such as a tandem variable domain (TVD) polypeptide, that includes one or more variable domains in series on the same polypeptide chain. Exemplary TVD polypeptides include the "double head" or "diabody" configurations described in U.S. Patent No. 5,989,830. In the diabody arrangement, the variable domains of two different antibodies are expressed in tandem orientation on two separate chains (one heavy chain and one light chain), with one polypeptide chain having two VH domains in series optionally separated by a peptide linker (VH1-linker-VH2), and the other polypeptide chain consisting of complementary VL domains connected in series optionally by a peptide linker (VL1-linker-VL2). In the crossover double head arrangement, the variable domains of two different antibodies are expressed in tandem orientation on two separate polypeptide chains (one heavy chain and one light chain), with one polypeptide chain having two VH domains in series optionally separated by a peptide linker (VH1-linker-VH2), and the other polypeptide chain consisting of complementary VL domains connected in series optionally by a peptide linker in the opposite orientation (VL2-linker-VL1). Further antibody variants based on the "diabody" format include the dual variable domain IgG (DVD-IgG) bispecific antibody (see U.S. Patent No. 7,612,181 and the TBTI format (see U.S. Patent Application Publication No. 2010 / 0226923A1). In some embodiments, the binding polypeptide comprises a multispecific or multivalent antibody that includes one or more variable domains in series on the same polypeptide chain fused to an Fc domain variant.

[0165] In another embodiment, the binding polypeptide comprises a crossover dual variable domain IgG (CODV-IgG) bispecific antibody based on the "double head" arrangement (see U.S. Patent Application Publication No. 20120251541A1, which is incorporated herein by reference in its entirety).

[0166] In other embodiments, the binding polypeptide comprises a CrossMab or CrossMab-Fab multispecific format (see WO 2009 / 080253 pamphlet and Schaefer, et al., PNAS (2011), 108:11187-1191). Antibody variants based on the CrossMab format have an exchange of antibody domains within one arm of a bispecific IgG antibody that allows for correct chain association.

[0167] In other embodiments, the glycosylation effector competent polypeptide comprises a multispecific antibody in a T cell engager format. A "T cell engager" refers to a protein directed against the host's immune system, more specifically the cytotoxic activity of T cells, and a binding protein directed against a tumor target protein. In some embodiments, the isolated effector competent polypeptide comprises a multispecific antibody in an NK cell engager format. An "NK cell engager" refers to a binding protein comprising an activating NK cell receptor, an antigen-specific targeting region, and a monoclonal antibody fragment targeting an Fc region (Gauthier, et al. Cell (2019), 177:1701-13).

[0168] The binding polypeptides of the disclosure comprising the Fc domain variants described herein can comprise the CDR sequences or variable domain sequences of a known "parent" antibody. In some embodiments, the parent antibody and the antibodies of the disclosure can share similar or identical sequences except for modifications to the Fc domain disclosed herein.

[0169] Cross-over dual variable In certain embodiments, "cross-over dual variable" or "CODV" refers to an antigen-binding domain comprising at least two polypeptide chains that specifically bind to at least one target antigen or at least one target epitope and form at least two antigen-binding sites, wherein at least one polypeptide chain has the structure represented by the formula: VL1-L1-VL2-L2-CL[[I]] and includes the structure represented by: At least one polypeptide chain has the formula: VH2-L3-VH1-L4-CH1[II] wherein VL1 is the first immunoglobulin light chain variable domain, VL2 is the second immunoglobulin light chain variable domain, VH1 is the first immunoglobulin heavy chain variable domain, VH2 is the second immunoglobulin heavy chain variable domain, CL is the immunoglobulin light chain constant domain, CH1 is the immunoglobulin CH1 heavy chain constant domain, L1, L2, L3, and L4 are amino acid linkers, and one or more of L1, L2, L3, and L4 may optionally be absent, The polypeptide of formula I and the polypeptide of formula II form an interchanged light chain-heavy chain pair.

[0170] In certain exemplary embodiments, the binding protein of the present disclosure comprises a "CODV-OL1" format comprising three polypeptide chains that form two antigen-binding sites, and one polypeptide chain has the formula: VL1-L1-VL2-L2-CL[I] comprising the structure represented by One polypeptide chain has the formula: VH2-L3-VH1-L4-CH1-hinge-CH2-CH3[III] comprising the structure represented by One polypeptide chain has the formula: hinge-CH2-CH3[IV] comprising the structure represented by wherein CL is the immunoglobulin light chain constant domain, CH1 is the immunoglobulin CH1 heavy chain constant domain, CH2 is the immunoglobulin CH2 heavy chain constant domain, CH3 is the immunoglobulin CH3 heavy chain constant domain, The hinge is an immunoglobulin hinge region that connects the CH1 domain and the CH2 domain, L1, L2, L3, and L4 are amino acid linkers, and one or more of L1, L2, L3, and L4 may optionally be absent, The polypeptide of Formula I and the polypeptide of Formula II form an interchain light chain-heavy chain pair.

[0171] In certain embodiments, the CODV antigen-binding domain specifically binds to at least one target antigen or at least one target epitope and comprises four polypeptide chains that form four antigen-binding sites, and two of the polypeptide chains each have the formula: VL1-L1-VL2-L2-CL[I] comprising the structure represented by Two of the polypeptide chains each have the formula: VH2-L3-VH1-L4-CH1-Fc[II] comprising the structure represented by wherein VL1 is a first immunoglobulin light chain variable domain, VL2 is a second immunoglobulin light chain variable domain, VH1 is a first immunoglobulin heavy chain variable domain, VH2 is a second immunoglobulin heavy chain variable domain, CL is an immunoglobulin light chain constant domain, CH1 is an immunoglobulin CH1 heavy chain constant domain, Fc is an immunoglobulin hinge region and CH2 and CH3 immunoglobulin heavy chain constant domains, L1, L2, L3, and L4 are amino acid linkers, and one or more of L1, L2, L3, and L4 may optionally be absent, The polypeptide of Formula I and the polypeptide of Formula II form an interchain light chain-heavy chain pair, the VH1 / VL1 pair comprises a first antigen-binding specificity, and the VH2 / VL2 pair comprises a second antigen-binding specificity.

[0172] In certain embodiments, the antigen-binding proteins described herein are trispecific and / or trivalent antigen-binding proteins that comprise four polypeptide chains that form three antigen-binding sites that specifically bind to one or more different antigen targets, wherein the first polypeptide chain has the formula: VL2-L1-VL1-L2-CL[I] and comprises the structure represented by: The second polypeptide chain has the formula: VH1-L3-VH2-L4-CH1-hinge-CH2-CH3[II] and comprises the structure represented by: The third polypeptide chain has the formula: VH3-CH1-hinge-CH2-CH3[III] and comprises the structure represented by: The fourth polypeptide chain has the formula: VL3-CL[IV] and comprises the structure represented by: wherein VL1 is the first immunoglobulin light chain variable domain, VL2 is the second immunoglobulin light chain variable domain, VL3 is the third immunoglobulin light chain variable domain, VH1 is the first immunoglobulin heavy chain variable domain, VH2 is the second immunoglobulin heavy chain variable domain, VH3 is the third immunoglobulin heavy chain variable domain, CL is the immunoglobulin light chain constant domain, CH1 is the immunoglobulin CH1 heavy chain constant domain, CH2 is the immunoglobulin CH2 heavy chain constant domain, CH3 is the immunoglobulin CH3 heavy chain constant domain, hinge is the immunoglobulin hinge region that connects the CH1 domain and the CH2 domain, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 may optionally be absent, The polypeptide of formula I and the polypeptide of formula II form an interchain-heavy chain pair.

[0173] In certain embodiments, the first polypeptide chain and the second polypeptide chain have an orientation that forms two different antigen-binding sites. In some embodiments, VH1 and VL1 form a binding pair and form a first antigen-binding site. In some embodiments, VH2 and VL2 form a binding pair and form a second antigen-binding site. In some embodiments, a third polypeptide and a fourth polypeptide form a third antigen-binding site. In some embodiments, VH3 and VL3 form a binding pair and form a third antigen-binding site.

[0174] Such antigen-binding proteins include at least three antigen-binding sites. It is at least a trivalent antigen-binding molecule. In certain embodiments, it specifically binds to one antigen target, i.e., it is a monospecific antigen-binding molecule. In another embodiment, it specifically binds to two different antigen targets, i.e., it is a bispecific antigen-binding molecule. In another embodiment, it specifically binds to three different antigen targets, i.e., it is a trispecific antigen-binding molecule.

[0175] The examples listed above are not intended to limit the scope of the present disclosure in any way, and it has been shown that linkers containing randomly selected amino acids selected from the group consisting of valine, leucine, isoleucine, serine, threonine, lysine, arginine, histidine, aspartic acid, glutamic acid, asparagine, glutamine, glycine, and proline are suitable for the antibody-like binding proteins described herein.

[0176] In certain embodiments of the binding protein, (a) L1, L2, L3, and L4 are each independently of zero amino acid length or contain a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP, and GGSGSSGSGG, or (b) L1, L2, L3, and L4 each independently contain a sequence selected from the group consisting of GGGGSGGGGS, GGGGSGGGGSGGGGS, S, RT, TKGPS, GQPKAAP, and GGSGSSGSGG.

[0177] In certain embodiments, L1 and L2 each contain the amino acid sequence GGGGSGGGGS.

[0178] In certain embodiments, L3 and L4 do not each exist.

[0179] Further details regarding the CODV antibody format, various substitutions of the CODV antibody format, and linkers are further described in International Publication No. WO 2012 / 135345A1 and International Publication No. WO 2017 / 180913A2, the entire contents of which are incorporated herein by reference.

[0180] Nucleic Acids and Vectors In one aspect, polynucleotides encoding the binding proteins disclosed herein are provided. Also provided are methods of making binding proteins that include expressing these polynucleotides.

[0181] The polynucleotides encoding the binding proteins disclosed herein are typically inserted into an expression vector for introduction into a host cell that can be used to produce the desired amount of the claimed binding protein. Accordingly, in certain aspects, the present disclosure provides expression vectors containing the polynucleotides disclosed herein, as well as host cells containing these vectors and polynucleotides.

[0182] For the purposes of this specification and the claims, the term "vector" or "expression vector" is used herein to mean a vector used to introduce and express a desired gene in a cell. As is known to those skilled in the art, such vectors can be readily selected from the group consisting of plasmids, phages, viruses, and retroviruses. Generally, a vector includes a selectable marker, appropriate restriction sites to facilitate cloning of the desired gene, and the ability to enter and / or replicate in eukaryotic or prokaryotic cells.

[0183] A number of expression vector systems can be used. For example, one class of vectors utilizes DNA elements derived from animal viruses such as bovine papillomavirus, polyomavirus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV, or MoMLV), or SV40 virus. Others involve the use of polycistronic systems with internal ribosome binding sites. Additionally, cells that have integrated the DNA into their chromosomes can be selected by introducing one or more markers that enable the selection of transfected host cells. The markers can provide prototrophy for auxotrophic hosts, biocide resistance (e.g., antibiotics), or resistance to heavy metals such as copper. The selectable marker gene can be ligated directly to the DNA sequence to be expressed or introduced into the same cell by co-transformation. Further elements may also be required for optimal synthesis of mRNA. These elements can include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals. In some embodiments, the cloned variable region genes are inserted into an expression vector together with the heavy chain constant region gene and the light chain constant region gene (such as human genes) synthesized as described above.

[0184] In other embodiments, the glycosylated effector competent polypeptides described herein can be expressed using a polycistronic construct. In such expression systems, multiple gene products of interest, such as the heavy and light chains of an antibody, can be produced from a single polycistronic construct. These systems advantageously result in relatively high levels of polypeptides in eukaryotic host cells using an internal ribosome entry site (IRES). Suitable IRES sequences are disclosed in U.S. Patent No. 6,193,980, which is incorporated herein by reference. Those skilled in the art will understand that such expression systems can be used to effectively produce the full range of polypeptides disclosed in this application.

[0185] More generally, once a vector or DNA sequence encoding a binding protein of the disclosure is prepared, the expression vector may be introduced into a suitable host cell. That is, the host cell can be transformed. Introduction of the plasmid into the host cell can be performed by various techniques well known to those skilled in the art. These techniques include, but are not limited to, transfection (including electroporation and electrophoresis), protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped DNA, microinjection, and infection with intact virus. See, for example, Ridgway, A.A.G. “Mammalian Expression Vectors” Chapter 24.2, pp. 470-472 in Vectors, Rodriguez and Denhardt, Eds. (Butterworths, Boston, MA 1988). The transformed cells are grown under conditions suitable for the production of the light and heavy chains and assayed for the synthesis of the heavy chain protein and / or light chain protein. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescence-activated cell sorter analysis (FACS), immunohistochemistry, and the like.

[0186] As used herein, the term "transformation" is used in a broad sense to refer to the introduction of DNA into a recipient host cell that changes the genotype and results in a change in the recipient cell.

[0187] Similarly, "host cell" refers to a cell constructed using recombinant DNA technology and transformed with a vector encoding at least one heterologous gene. In the description of the process of isolating a polypeptide from a recombinant host, the terms "cell" and "cell culture" are used synonymously for the purpose of indicating a source of antibody, unless otherwise specified. In other words, the recovery of a polypeptide from a "cell" can mean recovery from either the spin-down whole cells or the cell culture containing both the medium and the suspended cells.

[0188] In one embodiment, the host cell line used for the expression of the binding protein is of eukaryotic or prokaryotic origin. In one embodiment, the host cell line used for the expression of the binding protein is of bacterial origin. In one embodiment, the host cell line used for the expression of the binding protein is of mammalian origin. One of ordinary skill in the art can determine the specific host cell line that is most suitable for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, DG44 and DUXB11 (Chinese hamster ovary line, DHFR minus), HELA (human cervical cancer), CVI (monkey kidney strain), COS (derivative of CVI with SV40 T antigen), R1610 (Chinese hamster fibroblast) BALBC / 3T3 (mouse fibroblast), HAK (hamster kidney strain), SP2 / O (mouse myeloma), BFA-1c1BPT (bovine endothelial cell), RAJI (human lymphocyte), 293 (human kidney). In one embodiment, the cell line provides altered glycosylation of the antibody expressed therefrom, e.g., afucosylation (e.g., PER.C6® (Crucell) or FUT8 knockout CHO cell line (POTELLIGENT™ cell) (Biowa, Princeton, NJ)). In one embodiment, NS0 cells may be used. Host cell lines are typically available from the commercial service American Tissue Culture Collection or from the public literature.

[0189] In vitro production allows for scale-up to obtain large amounts of the desired binding protein. Techniques for culturing mammalian cells under tissue culture conditions are known in the art and include, for example, homogeneous suspension culture in an airlift reactor or continuous stirred reactor, or culture of cells immobilized or captured, for example, within hollow fibers, within microcapsules, on agarose microbeads, or on a ceramic cartridge. If necessary and / or desired, the solution of the polypeptide can be purified by conventional chromatographic methods, such as gel filtration, ion exchange chromatography, chromatography on DEAE-cellulose, and / or (immuno)affinity chromatography.

[0190] One or more genes encoding glycosylated binding proteins can also be expressed in non-mammalian cells such as bacteria, yeast, or plant cells. In this context, it will be understood that various unicellular microorganisms other than mammals (such as bacteria) can also be transformed, that is, these microorganisms can be grown by culture or fermentation. Bacteria sensitive to transformation include Enterobacteriaceae such as Escherichia coli or Salmonella strains, Bacillaceae such as Bacillus subtilis, members of Pneumococcus, Streptococcus, and Haemophilus influenzae. It will be further understood that when expressed in bacteria, the Fc domain variant and / or binding polypeptide can be part of inclusion bodies. The binding protein must be isolated, purified, and then assembled into a functional molecule.

[0191] In addition to prokaryotes, eukaryotic microorganisms can also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among eukaryotic microorganisms, although many other strains are commonly available. For expression in Saccharomyces, plasmid YRp7, for example, (Stinchcomb et al., Nature, 282:39 (1979); Kingsman et al., Gene, 7:141 (1979); Tschemper et al., Gene, 10:157 (1980)) is commonly used. This plasmid already contains the TRP1 gene, which provides a selectable marker for yeast mutant strains lacking the ability to grow in tryptophan, such as ATCC No. 44076 or PEP4-1 (Jones, Genetics, 85:12 (1977)). The presence of the trpl lesion as a characteristic of the yeast host cell genome provides an effective environment for detecting transformation by growth in the absence of tryptophan.

[0192] Method of Use / Treatment Method In one aspect, the disclosure provides a method of treating a disease or disorder in a subject in need thereof, comprising administering to the subject an effective amount of the binding protein disclosed herein. In certain embodiments, the disclosure provides kits and methods for treating diseases and disorders, such as cancer, in mammalian subjects in need of such treatment. In certain embodiments, the disclosure provides kits and methods for treating diseases and disorders, such as amyloidosis or multiple myeloma, in mammalian subjects in need of such treatment.

[0193] In certain embodiments, the disease is cancer. In certain embodiments, the cancer is a blood cancer. In certain embodiments, the blood cancer is a plasma cell malignancy. In certain embodiments, the plasma cell malignancy is multiple myeloma. In certain embodiments, the multiple myeloma is relapsed / refractory multiple myeloma, newly diagnosed multiple myeloma, or smoldering multiple myeloma. In certain other embodiments, the disease is light chain amyloidosis (LCA). In certain embodiments, the LCA is relapsed / refractory LCA, newly diagnosed LCA, or smoldering LCA. The binding proteins of the present disclosure are useful for several different applications. For example, in one embodiment, the subject binding protein is useful for reducing or eliminating cells having an epitope recognized by the binding protein. In another embodiment, the subject binding protein is effective for reducing or eliminating the concentration of soluble antigen in circulation. In another embodiment, the subject binding protein is effective as an NK cell engager. In one embodiment, the Fc domain variant may reduce tumor size, inhibit tumor growth, and / or extend the survival period of tumor-bearing animals. Accordingly, the present disclosure also relates to a method of treating tumors in a human or other animal by administering an effective non-toxic amount of the binding protein of the present disclosure to the human or other animal.

[0194] In another embodiment, the subject binding protein is useful for treating other disorders including, but not limited to, infectious diseases, autoimmune disorders, inflammatory disorders, or cancer. The disease may optionally be identified as being characterized by cells that express BCMA (e.g., cells that cause the disease, B lymphocytes or other immune cells that cause the disease). For example, cancer cells, particularly blood cancers or plasma cell malignancies, can be characterized as expressing BCMA on the surface of the cancer cells. Accordingly, the present disclosure relates to methods of treating various pathologies that would benefit from using, for example, an effector competent polypeptide of a subject with an extended half-life.

[0195] One of ordinary skill in the art could determine the effective non-toxic amount of the binding protein for the purpose of treating malignant tumors by routine experimentation. For example, the therapeutically active amount of the binding proteins of the present disclosure can vary according to factors such as disease stage (e.g., stage I vs. stage IV), the age, sex, medical comorbidities (e.g., immunosuppression or disease) and weight of the subject, and the ability of the modified antibody to induce a desired response in the subject.

[0196] In general, the compositions provided in the present disclosure can be used for prophylactically or therapeutically treating any neoplasm that contains an antigen marker that enables targeting of cancerous cells by the binding protein.

[0197] Method of treatment / use for multiple myeloma In one aspect, the present disclosure relates to the treatment and prevention of multiple myeloma.

[0198] The term "multiple myeloma (MM)" (also known as plasmacytoma, myelomatosis, or Kahler disease) is a progressive blood cancer of plasma cells, a type of white blood cell that normally produces antibodies. This condition is characterized by an excessive number of plasma cells in the bone marrow and the overproduction of intact monoclonal immunoglobulins or free monoclonal light chains. Clinically, the disease is diagnosed, staged, and treated based on various parameters including hemoglobin and serum calcium concentrations, the amount of monoclonal (or myeloma) protein (M protein) in serum and / or urine, the number of lytic bone lesions based on a skeletal survey, and the presence or absence of renal insufficiency. Additional approaches to characterizing the condition include the detection of more than 10 percent (10%) plasma cells on bone marrow examination, the presence of soft tissue plasmacytomas, and the detection of free kappa and lambda serum immunoglobulin light chains. Bone marrow examination is performed using standard histological and immunohistochemical techniques. Further cytogenetic analysis of the bone marrow sample can be performed to determine prognosis. Follow-up examinations consist of chemistry and bone marrow evaluations when clinically indicated due to its invasiveness.

[0199] In certain embodiments, the methods of the invention include treating patients with relapsed and / or refractory MM, or patients with MM who have received one or more prior treatments for MM. In certain embodiments, the multiple myeloma is relapsed / refractory multiple myeloma (RR / MM). In some embodiments, the patient has received at least one or two prior treatments for multiple myeloma (e.g., thalidomide analogs such as lenalidomide, proteasome inhibitors, or autologous stem cell transplantation (ASCT)) and has demonstrated disease progression during or after completion of the last treatment.

[0200] "Relapsed MM" refers to multiple myeloma that has been previously treated, progressed, and requires initiation of further treatment, but does not meet the criteria for either primary "refractory" or relapsed and refractory MM. Clinical criteria for determining relapse are well known to those of skill in the art. For example, clinical criteria developed by the International Myeloma Working Group (IMWG) include an increase in serum M component of >1 gm / dL, the development of new soft tissue plasmacytomas or bone lesions, and an increase in the size of existing plasmacytomas or bone lesions.

[0201] "Refractory MM" refers to multiple myeloma that is non-responsive (e.g., unable to achieve minimal response during treatment or develops progressive disease). In certain embodiments, the multiple myeloma is non-responsive during primary or salvage therapy or progresses within 60 days of the last therapy.

[0202] In certain embodiments, the MM is "relapsed and refractory MM". "Relapsed and refractory MM" is non-responsive during salvage therapy (e.g., therapy administered after failure of treatment with primary therapy) or progresses within 60 days of the last therapy in patients who have achieved minimal or better response at some point prior to progression in the current disease course.

[0203] In certain embodiments, the MM is primary refractory MM. Primary refractory MM is an MM disease that is non-responsive in patients who have not achieved a minimal response or greater with any treatment.

[0204] In certain embodiments, the MM is pre-cancerous or "smoldering" MM. Smoldering multiple myeloma is a pre-cancerous state that changes certain proteins in the blood and / or increases plasma cells in the bone marrow but does not cause symptoms of the disease. However, about half of the people diagnosed with this condition develop multiple myeloma within 5 years. Patients are closely monitored for evidence of progression to active multiple myeloma. Patients are diagnosed with smoldering multiple myeloma if they meet certain criteria: a blood test showing an M protein in the blood of more than 3 g / dl, or a 24-hour urine test showing more than 500 mg of protein, or a bone marrow biopsy showing that plasma cells make up 10% to 59% of the blood cells in the bone marrow; there are no signs of abnormal bone lesions or kidney damage that active myeloma could cause. Currently, there is no approved treatment for smoldering multiple myeloma.

[0205] "Disease response" can be determined according to standard criteria for hematological malignancies and staging. Methods for evaluating disease response in hematological malignancies are known to those skilled in the art. For example, methods for evaluating disease response include the Eastern Cooperative Oncology Group (ECOG) performance status and International Myeloma Working Group Response Criteria (see Oken, et al., Am. J. Clin. Oncol. 1982; 5(6): 649-655 and Kumar, et al., Lancet Oncol. 2016; 17(8): 328-346, respectively). Methods for evaluating disease response also include quantification of disease markers, bone marrow biopsy and / or aspiration, radiographic imaging of plasmacytomas, skeletal surveys, M protein quantification (serum and / or 24-hour urine), and free light chain levels or urine light chain levels, serum β2-microglobulin, lymph node biopsy, radiation oncology evaluation (by x-ray, computed tomography (CT) scan, positron emission tomography (PET) scan, or magnetic resonance imaging (MRI)), and blood cell counts including blast counts. This list of evaluation methods should be understood to be non-limiting.

[0206] Subsequently, based on the results obtained from the evaluation of disease response, the disease response can be stratified according to standard criteria for the underlying disease and classified as complete response or complete remission (CR), partial response (PR), stable disease (SD), or progressive disease (PD).

[0207] In another aspect, the present disclosure provides a method of treating or preventing multiple myeloma in a subject in need thereof, the method comprising administering to the subject a binding protein disclosed herein comprising a first antigen-binding domain having binding specificity for BCMA and a second antigen-binding domain having binding specificity for a natural killer (NK) cell marker.

[0208] In one aspect, the present disclosure provides a method of treating or preventing multiple myeloma in a subject in need thereof, the method comprising administering to the subject a binding protein comprising a first antigen-binding domain having binding specificity for BCMA and a second antigen-binding domain having binding specificity for a natural killer (NK) cell marker, wherein the first antigen-binding domain comprises a. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and b. a first immunoglobulin light chain variable domain (VL1) comprising an LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I or N, and X6 is R or K; and an LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G.

[0209] In certain embodiments, the first antigen-binding domain having binding specificity for BCMA comprises a. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3); and b. An LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I or N, and X6 is R or K; and an LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G, comprising a first immunoglobulin light chain variable domain (VL1).

[0210] In certain embodiments, VL1 is a. An LCDR1 sequence comprising the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9), b. An LCDR1 sequence comprising the amino acid sequence of CRSSTGTVTPSNYAN (SEQ ID NO: 10), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12), c. An LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), an LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and an LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15), or d. An LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), an LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and an LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0211] In certain embodiments, a. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55. b. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50. c. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51. d. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52. e. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53, or f. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 54.

[0212] In certain embodiments, a. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 55, or b. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 50, or c. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 51, or d. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 52, or e. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 53, or f. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 54.

[0213] In certain embodiments, the second antigen-binding domain having binding specificity for an NK cell marker is a. A second immunoglobulin heavy chain variable domain (VH2), comprising: i. An HCDR1 sequence consisting of the amino acid sequence of DYVIN (SEQ ID NO: 80), an HCDR2 sequence consisting of the amino acid sequence of EYPGSGTNYYNEKFKA (SEQ ID NO: 81), and an HCDR3 sequence consisting of the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21); ii. An HCDR1 sequence containing SDYAWN (SEQ ID NO: 22), an HCDR2 sequence containing YITYSGSTSYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence containing GGYYGSSWGVFAY (SEQ ID NO: 24); iii. An HCDR1 sequence containing EYTMH (SEQ ID NO: 25), an HCDR2 sequence containing GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and an HCDR3 sequence containing RGGSFDY (SEQ ID NO: 27); iv. An HCDR1 sequence containing SFTMH (SEQ ID NO: 28), an HCDR2 sequence containing YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and an HCDR3 sequence containing GSSRGFDY (SEQ ID NO: 30); or v. An HCDR1 sequence containing SDYAWN (SEQ ID NO: 31), an HCDR2 sequence containing YITYSGSTNYNPSLKS (SEQ ID NO: 32), and an HCDR3 sequence containing CWDYALYAMDC (SEQ ID NO: 33), and a second immunoglobulin heavy chain variable domain, b. A second immunoglobulin light chain variable domain (VL2), comprising: i. An LCDR1 sequence containing the amino acid sequence of RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence containing the amino acid sequence of YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence containing the amino acid sequence of QQGNTRPWT (SEQ ID NO: 36); ii. An LCDR1 sequence containing RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence containing NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence containing QHHYGTPWT (SEQ ID NO: 39); iii. An LCDR1 sequence containing RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence containing YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence containing QNGHSFPLT (SEQ ID NO: 42); iv. An LCDR1 sequence containing RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence containing AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence containing QHFWGTPRT (SEQ ID NO: 45); or v. A second immunoglobulin light chain variable domain comprising an LCDR1 sequence containing RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence containing NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence containing QHHYDTPLT (SEQ ID NO: 48).

[0214] In certain embodiments, a. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64, or b. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65, or c. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66, or d. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67, or e. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68, or f. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69, or g. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70, or h.VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 63, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 71.

[0215] In certain embodiments, a. VH2 comprises the amino acid sequence of SEQ ID NO: 56 and VL2 comprises the amino acid sequence of SEQ ID NO: 64, or b. VH2 comprises the amino acid sequence of SEQ ID NO: 57 and VL2 comprises the amino acid sequence of SEQ ID NO: 65, or c. VH2 comprises the amino acid sequence of SEQ ID NO: 58 and VL2 comprises the amino acid sequence of SEQ ID NO: 66, or d. VH2 comprises the amino acid sequence of SEQ ID NO: 59 and VL2 comprises the amino acid sequence of SEQ ID NO: 67, or e. VH2 comprises the amino acid sequence of SEQ ID NO: 60 and VL2 comprises the amino acid sequence of SEQ ID NO: 68, or f. VH2 comprises the amino acid sequence of SEQ ID NO: 61 and VL2 comprises the amino acid sequence of SEQ ID NO: 69, or g. VH2 comprises the amino acid sequence of SEQ ID NO: 62 and VL2 comprises the amino acid sequence of SEQ ID NO: 70, or h. VH2 comprises the amino acid sequence of SEQ ID NO: 63 or VL2 comprises the amino acid sequence of SEQ ID NO: 71.

[0216] In certain embodiments, the method further comprises all or a portion of an immunoglobulin Fc domain or a variant thereof.

[0217] In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the Fc domain or a variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a pair of cysteines.

[0218] In certain embodiments, the subject has been treated or therapeutically treated prior to treatment with an NKCE as disclosed herein. In certain embodiments, the multiple myeloma is relapsed / refractory multiple myeloma.

[0219] Treatment method / use for light chain amyloidosis In one aspect, the present disclosure relates to the treatment and prevention of light chain amyloidosis (LCA).

[0220] In certain embodiments, the present disclosure provides kits and methods for treating amyloidosis in a mammalian subject in need of such treatment for diseases and disorders, e.g., LCA. Current standards of care for LCA are limited due to tolerance in this population with frequent organ dysfunction. Thus, the need for additional therapeutic agents for effective and safe LCA remains unmet.

[0221] In another aspect, the present disclosure provides a method of treating or preventing light chain amyloidosis in a subject in need thereof, the method comprising administering to the subject a binding protein disclosed herein comprising a first antigen-binding domain having binding specificity for BCMA and a second antigen-binding domain having binding specificity for a natural killer (NK) cell marker.

[0222] In one aspect, the present disclosure provides a method of treating or preventing LCA in a subject in need thereof, the method comprising administering to the subject a binding protein comprising a first antigen-binding domain having binding specificity for BCMA and a second antigen-binding domain having binding specificity for a natural killer (NK) cell marker, wherein the first antigen-binding domain comprises a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3), and b. An LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I or N, and X6 is R or K; and an LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G, comprising a first immunoglobulin light chain variable domain (VL1).

[0223] In certain embodiments, the first antigen-binding domain having binding specificity for BCMA is a. A first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3), b. An LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, and X4 is N or Y; an LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I or N, and X6 is R or K; and an LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, and X9 is N or G, comprising a first immunoglobulin light chain variable domain (VL1).

[0224] In certain embodiments, VL1 is a. An LCDR1 sequence comprising the amino acid sequence of CASSTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9) b. An LCDR1 sequence comprising the amino acid sequence of b.CRSSTGTVTPSNYAN (SEQ ID NO: 10), an LCDR2 sequence comprising the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and an LCDR3 sequence comprising the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12), c. An LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPSNYAN (SEQ ID NO: 13), an LCDR2 sequence comprising the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and an LCDR3 sequence comprising the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15), or d. An LCDR1 sequence comprising the amino acid sequence of CASSTGAVTPGYYAN (SEQ ID NO: 16), an LCDR2 sequence comprising the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and an LCDR3 sequence comprising the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18).

[0225] In certain embodiments, a. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55, b. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50, c. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51, d. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52, e. VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53, or f.VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 54.

[0226] In certain embodiments, a. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 55, or b. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 50, or c. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 51, or d. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 52, or e. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 53, or f. VH1 comprises the amino acid sequence of SEQ ID NO: 49, and VL1 comprises the amino acid sequence of SEQ ID NO: 54.

[0227] In certain embodiments, the second antigen-binding domain having binding specificity for an NK cell marker is a. a second immunoglobulin heavy chain variable domain (VH2), wherein i. an HCDR1 sequence consisting of the amino acid sequence of DYVIN (SEQ ID NO: 80), an HCDR2 sequence consisting of the amino acid sequence of EIYPGSGTNYYNEKFKA (SEQ ID NO: 81), and an HCDR3 sequence consisting of the amino acid sequence of RGRYGLYAMDY (SEQ ID NO: 21); ii. an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), an HCDR2 sequence comprising YITYSGSTSYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence comprising GGYYGSSWGVFAY (SEQ ID NO: 24); iii. an HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), an HCDR2 sequence comprising GISPNIGGTSYNQKFKG (SEQ ID NO: 26), and an HCDR3 sequence comprising RGGSFDY (SEQ ID NO: 27); iv. An HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), an HCDR2 sequence comprising YINPSSGYTEYNQKFKD (SEQ ID NO: 29), and an HCDR3 sequence comprising GSSRGFDY (SEQ ID NO: 30); or v. A second immunoglobulin heavy chain variable domain comprising an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), an HCDR2 sequence comprising YITYSGSTNYNPSLKS (SEQ ID NO: 32), and an HCDR3 sequence comprising CWDYALYAMDC (SEQ ID NO: 33), and b. A second immunoglobulin light chain variable domain (VL2) comprising i. An LCDR1 sequence comprising the amino acid sequence of RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence comprising the amino acid sequence of YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence comprising the amino acid sequence of QQGNTRPWT (SEQ ID NO: 36); ii. An LCDR1 sequence comprising RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence comprising QHHYGTPWT (SEQ ID NO: 39); iii. An LCDR1 sequence comprising RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence comprising YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence comprising QNGHSFPLT (SEQ ID NO: 42); iv. An LCDR1 sequence comprising RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence comprising AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence comprising QHFWGTPRT (SEQ ID NO: 45); or v. A second immunoglobulin light chain variable domain comprising an LCDR1 sequence comprising RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence comprising NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence comprising QHHYDTPLT (SEQ ID NO: 48).

[0228] In certain embodiments, a. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64, or b. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65, or c. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66, or d. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67, or e. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68, or f. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69, or g. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70, or h. VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 63, and VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 71.

[0229] In certain embodiments, a. VH2 comprises the amino acid sequence of SEQ ID NO: 56, and VL2 comprises the amino acid sequence of SEQ ID NO: 64, or b. VH2 comprises the amino acid sequence of SEQ ID NO: 57, and VL2 comprises the amino acid sequence of SEQ ID NO: 65, or c. VH2 comprises the amino acid sequence of SEQ ID NO: 58, and VL2 comprises the amino acid sequence of SEQ ID NO: 66, or d. VH2 comprises the amino acid sequence of SEQ ID NO: 59, and VL2 comprises the amino acid sequence of SEQ ID NO: 67, or e. VH2 comprises the amino acid sequence of SEQ ID NO: 60, and VL2 comprises the amino acid sequence of SEQ ID NO: 68, or f. VH2 comprises the amino acid sequence of SEQ ID NO: 61, and VL2 comprises the amino acid sequence of SEQ ID NO: 69, or g. VH2 comprises the amino acid sequence of SEQ ID NO: 62, and VL2 comprises the amino acid sequence of SEQ ID NO: 70, or h. VH2 comprises the amino acid sequence of SEQ ID NO: 63, or VL2 comprises the amino acid sequence of SEQ ID NO: 71.

[0230] In certain embodiments, the method further comprises all or part of an immunoglobulin Fc domain or a variant thereof.

[0231] In certain embodiments, the Fc domain is an IgG1 Fc domain. In certain embodiments, the Fc domain or a variant thereof comprises a first Fc heavy chain and a second Fc heavy chain. In certain embodiments, the first Fc heavy chain or the second Fc heavy chain comprises a pair of cysteines.

[0232] In certain embodiments, the NK cell marker is selected from NKp46, NKp30, NKp44, CD16, CD56, CD57, KIR receptors (e.g., KIR2DL1, KIR2DL2, KIR2DL3, KIR2DL5A, KIR2DL5B, KIR3DL1, KIR3DL2, and KIR3DL3), CD94, and NKG2. In certain embodiments, the NK cell marker is NKp46.

[0233] In certain embodiments, the method further comprises the selection of a subject having light chain amyloidosis, the selection comprising a. diagnosing a subject having light chain amyloidosis, b. determining the disease staging based on the prognostic system disclosed herein, and / or c. determining that the subject has not received a pre - diagnosis of multiple myeloma.

[0234] In certain embodiments, the subject is treatment - naive.

[0235] In certain embodiments, the subject has received or is receiving one or more therapeutic agents for light chain amyloidosis (e.g., chemotherapy, autologous stem cell transplantation, immunomodulatory agents, immunotherapy, proteasome inhibitors, and any combination thereof). In certain embodiments, the subject has received at least one proteasome inhibitor.

[0236] In certain embodiments, the LCA is relapsed / refractory LCA.

[0237] In one aspect, the present disclosure is a method of treating or preventing LCA in a subject in need thereof, comprising administering to the subject a binding protein comprising a first antigen-binding domain having binding specificity for BCMA and a second antigen-binding domain having binding specificity for NKp46, a. The first antigen-binding domain comprises i. a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDETNR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFDP (SEQ ID NO: 3), and ii. a first immunoglobulin light chain variable domain (VL1) comprising an LCDR1 sequence comprising the amino acid sequence of CX1SSTGX2VTPX3X4YAN (SEQ ID NO: 4), wherein X1 is R or A, X2 is T or A, X3 is S or G, X4 is N or Y, an LCDR2 sequence comprising the amino acid sequence of DNNX5X6PP (SEQ ID NO: 5), wherein X5 is S, I or N, X6 is R or K, and an LCDR3 sequence comprising the amino acid sequence of ALX7X8GX9QWV (SEQ ID NO: 6), wherein X7 is W or Y, X8 is F or Y, X9 is N or G, b. The second antigen-binding domain comprises The HCDR1 sequence containing i.DYVIN (SEQ ID NO: 19), the HCDR2 sequence containing EIYPGSGTNYYNEKFKA (SEQ ID NO: 20), and the HCDR3 sequence containing RGRYGLYAMDY (SEQ ID NO: 21), and ii. The LCDR1 sequence containing RASQDISNYLN (SEQ ID NO: 34), the LCDR2 sequence containing YTSRLHS (SEQ ID NO: 35), and the LCDR3 sequence containing QQGNTRPWT (SEQ ID NO: 36).

[0238] In one aspect, the present disclosure is a method of treating or preventing LCA in a subject in need thereof, comprising administering to the subject a binding protein comprising a first antigen-binding domain having binding specificity for BCMA and a second antigen-binding domain having binding specificity for NKp46, a. The first antigen-binding domain comprises i. VH1 comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, ii. VL1 comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55, b. The second antigen-binding domain comprises i. VH2 comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, ii. VL1 comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64. Including.

[0239] In certain embodiments, the binding protein is administered by intraarterial, intraperitoneal, intramuscular, subcutaneous, rectal, or intravaginal administration. In certain embodiments, the binding protein is administered by subcutaneous administration.

[0240] In certain embodiments, the Fc domain variant comprises the ADE mutation (G236 / S239D / I332E) in CH2 to enhance ADCC activity.

[0241] In certain embodiments, the F domain variant comprises a disulfide bond substitution (R292C / V302C) in CH2 for stabilization.

[0242] In certain embodiments, the Fc domain variant comprises a knob-into-hole mutation (KIH) in CH3 to promote heterodimer formation in the Fc domain. In certain embodiments, the "knob" mutations are at positions C482 / W494, and the "hole" mutations are at positions C129 / S146 / A148 / V187. In some embodiments, the Fc domain variant comprises an RF mutation (H435R / Y436F) in one CH3 to facilitate purification of the heterodimer in the Fc domain.

[0243] In certain embodiments, the disease is amyloidosis or an amyloid disease. As used herein, the terms "amyloidosis" or "amyloid disease" refer to diseases or disorders that fall within the category of plasma cell dyscrasias. Amyloidosis or an amyloid disease occurs when amyloid accumulates in organs and interferes with normal physiological function. As used herein, the term "amyloid" refers to abnormal fibrous extracellular proteinaceous deposits found in organs and tissues. Amyloid is not normally found in the body but can be formed from several different types of proteins. Amyloid is typically insoluble and is structurally dominated by a β-sheet structure. Organs that can be affected include the heart, kidney, liver, spleen, nervous system, skin, and gastrointestinal tract. The term "amyloidosis" is used to refer to a cluster of diseases that share a common feature, namely, extracellular deposition of a pathological insoluble protofibrillar protein in organs and tissues.

[0244] A prominent feature of amyloid diseases is the production of amyloid, which is characterized by a fibrous morphology with a diameter of about 5 to 15 nm that binds to the dye congo red and exhibits fluorescent birefringence when bound to the dye thioflavin T. The fibers can form a secondary structure called protofilaments consisting of pleated β-sheets, which renders them resistant to degradation. Toyama and Weissman(2011),Annu Rev Biochem,80:557-585;Picken(2020),Acta Haematol,vol.143:322-334.

[0245] In certain embodiments, amyloidosis or an amyloid disease is light chain amyloidosis or amyloid light chain amyloidosis. The current classification of amyloid is based on the type of amyloid protein. For example, amyloid is called "A" (in the case of amyloid), followed by an abbreviation of the protein type: AL (amyloid derived from immunoglobulin light chains). The terms "amyloid light chain amyloidosis" or "light chain amyloidosis" or "LCA" are also referred to as AL amyloidosis, AL, ALA or AL primary amyloidosis and are the most common form of systemic amyloidosis in the United States and developed countries. Picken(2020),Acta Haematol,vol.143:322-334. A patient may present with LCA of the first case (newly diagnosed LCA), or the LCA may be recurrent and / or refractory (recurrent / refractory LCA). LCA is the most common form of systemic amyloidosis and is associated with an underlying plasma cell disorder. Abnormal plasma cells are derived from a single plasma cell source and secrete toxic fibril-forming free light chains. These plasma cells have been shown to be BCMA positive (Godara et al.2019.Blood 134(Supplement _1):4409). In certain embodiments, a patient having LCA is treatment-naive. In some embodiments, a patient having LCA has received or is receiving one or more therapeutic agents for light chain amyloidosis (e.g., chemotherapy, autologous stem cell transplantation, immunomodulatory agents, immunotherapy, proteasome inhibitors, and any combination thereof).

[0246] In certain embodiments, a binding protein comprising a binding protein comprising an Fc domain variant is useful for several different applications. For example, in one embodiment, the subject binding protein is useful for reducing or eliminating cells having an epitope recognized by the binding domain of the Fc domain variant. In another embodiment, the subject Fc domain variant is effective for reducing or eliminating the concentration of a soluble antigen in circulation. In another embodiment, the subject Fc domain variant is effective as a T cell engager.

[0247] In another embodiment, a subject binding protein comprising one comprising an Fc domain variant is useful for the treatment of diseases or disorders associated with abnormal monoclonal B cells or plasma cells. In one embodiment, the abnormal monoclonal B cells or plasma cells express BCMA.

[0248] The binding protein can be particularly useful for the treatment of diseases or disorders within the category of plasma cell disorders. In one embodiment, the plasma cell disorder is not multiple myeloma. In one embodiment, the plasma cell disorder is amyloidosis, such as LCA (light chain amyloidosis, also called AL (primary) amyloidosis, systemic amyloidosis, AL, or ALA).

[0249] LCA is a hematological disorder mainly caused by clonal plasma cells that produce misfolded immunoglobulin light chains. These abnormal light chains form toxic aggregates in plasma cells and deposit fibrils (amyloid) in organs and tissues, leading to severe and sometimes permanent organ dysfunction. LCA can affect any organ except the brain. Li et al. (2019), J Int Med Res., 47(4):1778 - 1786. The mechanism by which amyloidogenic immunoglobulin light chains cause organ dysfunction is not well characterized, but both amyloid deposits and pre - fibrillar aggregates are likely to have a cytotoxic effect on the underlying organ (). Primary LCA is LCA that does not consider or is not associated with complications of multiple myeloma.

[0250] Symptoms depend on the affected underlying organ and are generally recognized in the later stages of disease progression. Initial signs and symptoms of LCA include swelling of the ankles and legs; severe fatigue and weakness (e.g., shortness of breath; numbness, tingling, or pain in the hands or feet), diarrhea or constipation, unintentional significant weight loss; enlarged tongue, skin changes (thickening or easy bruising around the eyes, or purple spots, etc.), irregular heartbeat, or difficulty swallowing, but are not limited to these. Clinical features of more severe LCA include involvement and / or dysfunction of the heart, kidneys, liver, and gastrointestinal tract, as well as neuropathy and macroglossia. Heart lesions (e.g., heart failure and arrhythmias) are the most common LCA symptoms and represent the single worst prognostic feature. Bianchi et al. (2021), Cardiooncology, vol.3:4.

[0251] Diagnostic criteria for LCA include (1) the presence of a systemic syndrome, (2) histological documentation of amyloid, (3) evidence of a monoclonal plasma cell disorder (e.g., based on bone marrow or fat aspirate and / or targeted biopsy and serological parameters), and (4) amyloidosis classification for the identification of Ig light chains (e.g., via LC - MS or immunoelectron microscopy). Koh (2020) Blood Res., 55(Suppl):S54 - S57.

[0252] The disease outcome of LCA patients can be predicted based on a multi-stage prognostic system. Currently, there are four different prognostic models: (1) Mayo Model 2004 (Dispenzieri et al. (2004), J Clin Oncol., vol. 22: 3751-7); (2) Mayo Model 2012 (Kumar et al. (2012), J Clin Oncol., vol. 30: 989-95); (3) European Model 2015 (Muchtar et al. (2019), Leukemia, vol. 33: 811-4); (4) Boston University Score 2019 (Lilleness et al. (2019), Blood, vol. 133: 215-23). Mayo Model 2012 and European Model 2015 showed the best predictive performance in recent validation studies. Vaxman et al. (2020) Blood Rev, 40: 100636.

[0253] Autologous stem cell transplantation (ASCT) is the most effective treatment for patients with LCA. Sanchorawala (2020), Acta Haematol, vol. 143: 381-387. Cardiac biomarkers are often tested for the assessment of ASCT eligibility because troponin T levels > 0.06 ng / ml or NT-proBNP levels > 5000 ng / L are associated with high transplant-related mortality. Gavriatopoulou et al. (2018), Leukemia, vol. 32: 1183-1898. Most patients with LCA are ineligible for stem cell transplantation and may receive single-agent or combination chemotherapy and / or immunotherapy regimens to eradicate the underlying plasma cells. The standard treatment for intermediate-risk patients was oral melphalan / dexamethasone (Mdex), bortezomib-based regimens (BMDex, or VCD). However, the treatment-related mortality was considerable (24%). Id. Patients who cannot achieve rapid response rates are considered for second-line treatment, i.e., immunomodulatory drugs (IMIDs). IMIDs include thalidomide, lenalidomide, and pomalidomide, as well as their combinations with alkylating agents. However, immunotherapy has low tolerance in patients, especially those with cardiac LCA. Sidiqi & Gertz (2021), Blood Cancer Journal, vol. 11: 90. Overall, the currently used LCA treatment regimens are often difficult for patients to tolerate, especially in patients who are often subject to the persistent side effects of treatments that exacerbate disease symptoms. Hassan and Sanchorawala (2022), Hemato, vol. 3: 38-46. More recently, daratumumab (anti-CD38)-VCD was approved as the standard treatment in newly diagnosed LCA patients based on the phase 3 ANDROMEDA study (NCT03201965) (Kastritis et al. 2021. NEJM, 385: 46-58).

[0254] The therapeutically effective amount of the NK cell engager disclosed herein is a dosage or amount sufficient to induce a "therapeutic response" in a subject, e.g., an improvement in at least one measure of an amyloid disease, e.g., a decrease in the size of existing amyloid deposits or plaques, a decrease in the amyloid deposition rate, or an improvement in organ function as measured by standard techniques. Examples of common presenting symptoms specific to a common target organ and examples of improved organ function are summarized below.

[0255] Heart Commonly presenting symptoms of amyloid deposits are dyspnea on exertion, orthopnea, paroxysmal nocturnal dyspnea, lower extremity edema, pleural effusion, jugular venous distension, arrhythmia, syncope, and angina pectoris. A decrease in the level of the patient's N-terminal pro-brain natriuretic peptide (NT-proBNP), or a decrease in the patient's New York Heart Association (NYHA) functional classification level, can be indicators of improvement of the heart. Palladini et al. (2003), Circulation, vol. 107:2440-2445. Improved cardiac function can also be evaluated by measuring cardiac troponin values and by analyzing cardiac MRI and echocardiograms.

[0256] Kidney Common symptoms of amyloid deposition in the kidney are lower extremity edema, generalized edema, and uremia. Proteinuria or the rate of protein excretion in urine and a decrease in the estimated glomerular filtration rate (eGFR) can be indicators of improvement of renal function. Kidney Int. Suppl (2011), vol. 3(1):19-62.

[0257] Liver Common symptoms of amyloid deposits in the liver are right upper quadrant tenderness, hepatomegaly, ascites and / or oliguria. Improvement in alkaline phosphatase (ALP) levels, serum gamma-glutamyltransferase (GGT) levels can be indicators of improvement in liver function. Improvement in other metrics such as hyperlipidemia, coagulation abnormalities, thrombocytopenia, prothrombin time (PT), erythrocyte sedimentation rate, alanine aminotransferase (ALT) and / or aspartate aminotransferase (AST), serum albumin and complement fragment levels also lack specificity for hepatic amyloidosis and can indicate improvement in liver function when these parameters are evaluated prior to any treatment. Park et al. (2003), Medicine, vol. 82(5):291-298.

[0258] GI tract Commonly presenting symptoms of amyloid deposits in the gastrointestinal (GI) tract are loss of motility, GI bleeding, malabsorption, weight loss, anorexia, vomiting, nausea, hematoma, erosion and ulcer, or nodular gastritis. Improvement in GI tract function can be evaluated using conventional imaging (e.g., echography, computed tomography scanner, X-ray, endoscopy).

[0259] Nervous system Commonly presenting symptoms of amyloid deposits near or within nerves are neuropathic pain, numbness, and sensorimotor polyneuropathy characterized by weakness symptoms when progressive. Improvement in nervous system function can be evaluated by electrophysiological tests such as nerve conduction studies (NCS), electromyography (EMG), autonomic function tests (AFT), and quantitative sudomotor axon reflex tests (QSART).

[0260] One of ordinary skill in the art could determine, through routine experimentation, what an effective non-toxic amount of the binding protein or Fc domain variant is for the purpose of treating LCA. For example, the therapeutic active amount of the binding protein, including those containing the Fc domain variants of the present disclosure, can vary according to factors such as the prognostic staging system, the age, sex, medical comorbidities (e.g., immunosuppressive conditions or diseases) and body weight of the subject, and the ability of the modified antibody to induce a desired response in the subject. The dosing regimen can be adjusted to provide an optimal therapeutic response. For example, several divided doses can be administered daily, or the dose can be proportionally reduced as indicated by the urgency of the treatment situation.

[0261] In general, the compositions provided in the present disclosure can be used for the prophylactic or therapeutic treatment of any neoplasm containing an antigen marker that enables the targeting of cancerous cells by a binding protein, including those containing an Fc domain variant.

[0262] The binding proteins of the present disclosure can be administered on multiple occasions. The interval between single administrations can be weekly, monthly or yearly. The interval can also be irregular as indicated by measuring the blood levels of the binding protein or the binding antigen in the patient. In some methods, the dosage is adjusted to achieve a plasma-modified binding polypeptide concentration of about 1 - 1000 μg / ml, and in some methods about 25 - 300 μg / ml. Alternatively, the binding protein can be administered as a sustained release formulation, in which case the required dosing frequency is less. In the case of antibodies, the dosage and frequency vary according to the half-life of the antibody in the patient. Generally, humanized antibodies exhibit the longest half-life, followed by chimeric antibodies and non-human antibodies.

[0263] The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic. In prophylactic applications, the compositions containing the polypeptide of the invention or a cocktail thereof are administered to patients who are not yet in a diseased state in order to enhance the patient's resistance. Such an amount is defined as a "prophylactically effective dose". In this use, the exact amount also depends on the patient's health status and general immunity, but generally ranges from about 0.1 to about 25 mg per dose, particularly from about 0.5 to about 2.5 mg per dose. Over a long period of time, relatively low dosages are administered at relatively infrequent intervals. Some patients continue treatment for the remainder of their lifespan. In therapeutic use, relatively high dosages (e.g., about 1 to 400 mg / kg of antibody / dose, with a dosage of about 5 to 25 mg being more commonly used for radioimmunoconjugates and higher dosages being used for cytotoxin-drug modified antibodies) may be required at relatively short intervals until the progression of the disease is reduced or terminated, or until the patient shows a partial or complete improvement in the disease symptoms. Thereafter, a prophylactic regimen can be administered to the patient.

[0264] The binding proteins of the present disclosure (including those containing Fc variants) can optionally be administered in combination with other agents effective to treat a disorder or condition that requires treatment (e.g., prophylactic or therapeutic). The effective single treatment dosage (i.e., therapeutically effective amount) of the 90Y-labeled modified antibodies of the present disclosure ranges from about 5 to about 75 mCi, for example from about 10 to about 40 mCi. The effective single treatment non-myeloablative dosage of 131I modified antibodies ranges from about 5 to about 70 mCi, or from about 5 to about 40 mCi. The effective single treatment myeloablative dosage (i.e., which may require autologous bone marrow transplantation) of 131I-labeled antibodies ranges from about 30 mCi to about 600 mCi, for example from about 50 mCi to less than about 500 mCi. In combination with chimeric antibodies, for longer circulating half-life I mouse antibodies, the effective single treatment non-myeloablative dosage of iodine-131 labeled chimeric antibodies ranges from about 5 mCi to about 40 mCi, for example less than about 30 mCi. For example, the imaging criteria for 111In labeling are typically less than about 5 mCi.

[0265] The binding protein can be administered as described above, but in other embodiments, it must be emphasized that the polypeptide can be administered as a first-line therapy to otherwise healthy patients. In such embodiments, the binding protein can be administered to patients with normal or average red bone marrow reserve capacity and / or patients who have not received and are not receiving treatment. As used herein, administering a polypeptide in combination with or in conjunction with adjuvant therapy means administering or applying the antibodies that are therapeutically and disclosed continuously, simultaneously, with the same spread, simultaneously, concurrently or simultaneously present. One of ordinary skill in the art will understand that the timing of administration or application of the various components of the combined therapy regimen can be adjusted to enhance the overall effect of the treatment.

[0266] As described above, the binding proteins (including those containing Fc variants) of the present disclosure, their antibodies, therapeutic polypeptides or Fc variant fusion polypeptides can be administered in a pharmaceutically effective amount for the in vivo treatment of mammalian disorders. In this regard, it will be understood that the disclosed binding proteins are formulated to facilitate administration and promote the stability of the active agent.

[0267] Pharmaceutical Compositions and Their Administration Methods for preparing and administering the binding proteins of the present disclosure are well known to those of ordinary skill in the art or can be readily determined by those of ordinary skill in the art. The route of administration of the binding polypeptides of the present disclosure can be oral, parenteral, inhaled or topical. As used herein, the term parenteral includes intravenous administration, intraarterial administration, intraperitoneal administration, intramuscular administration, subcutaneous administration, rectal administration, or intravaginal administration. All of these administration forms are expressly contemplated as being within the scope of the present disclosure, but the administration form is a solution for injection, particularly for intravenous or intraarterial injection or infusion or subcutaneous administration. Generally, pharmaceutical compositions suitable for injection can include buffers (e.g., acetate, phosphate or citrate buffers), surfactants (e.g., polysorbate), optionally stabilizers (e.g., human albumin), etc. In some embodiments, the Fc domain variant can be delivered directly to the site of the harmful cell population, thereby increasing the exposure of the diseased tissue to the therapeutic agent.

[0268] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions, or suspensions (e.g., physiological saline and buffered media). In the compositions and methods of the present disclosure, pharmaceutically acceptable carriers include, but are not limited to, 0.01 - 0.1 M, e.g., 0.05 M phosphate buffer or 0.8% physiological saline. Other common parenteral vehicles include sodium phosphate solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluids and nutrient replenishers, electrolyte replenishers (e.g., those based on Ringer's dextrose), and the like. Preservatives and other additives (e.g., antimicrobial agents, antioxidants, chelating agents, and inert gases, etc.) may also be present. More specifically, pharmaceutical compositions suitable for injection include sterile aqueous solutions (water-soluble) or dispersions, and sterile powders for the immediate use preparation of sterile injectable solutions or dispersions. In such cases, the composition must be sterile and must be fluid to the extent that it can be easily injected. It must be stable under the conditions of manufacture and storage and typically must be protected from the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants.

[0269] In many cases, isotonic agents, e.g., sugars, polyhydric alcohols such as mannitol, sorbitol, or sodium chloride are included in the composition. By including agents that delay absorption, e.g., aluminum monostearate and gelatin, in the composition, long-term absorption of the injectable composition can be achieved.

[0270] In any case, the sterile injectable solution can be prepared by incorporating the active compound (e.g., the binding protein of the present disclosure) in the required amount into a suitable solvent containing one or a combination of the ingredients listed herein, and then filter sterilizing. Generally, the dispersion is prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the other required ingredients from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, exemplary methods of preparation include vacuum drying and freeze drying from which a powder of the active ingredient and any desired additional ingredients from a previously filter sterilized solution is obtained. The preparations for injection are processed to fill containers such as ampoules, bags, bottles, syringes, or vials, and sealed under sterile conditions according to methods known in the art. They may also be packaged and sold in the form of a kit. Such manufactured products typically have a label or package insert indicating that the relevant composition is useful for treating subjects suffering from or predisposed to an autoimmune disorder or a neoplastic disorder.

[0271] The effective dosage of the composition of the present disclosure for the treatment of the above-mentioned conditions varies depending on many different factors, including the means of administration, the target site, the physiological state of the patient, whether the patient is human or animal, other pharmaceuticals being administered, and whether the treatment is prophylactic or therapeutic. Usually, the patient is human, but non-human mammals including transgenic mammals can also be treated. To optimize safety and efficacy, the therapeutic dosage may be adjusted using conventional methods known to those skilled in the art.

[0272] The pharmaceutical composition according to the present disclosure can include a pharmaceutically acceptable non-toxic and sterile carrier such as physiological saline, a non-toxic buffer, a preservative, etc. For the purposes of this application, the pharmaceutically effective amount of the binding protein is maintained to mean an amount sufficient to achieve effective binding to the antigen and achieve a benefit, for example, to improve the symptoms of a disease or disorder or to detect a substance or cell. In the case of tumor cells, the polypeptide can interact with selected antigens on neoplastic cells or immunoreactive cells and increase the death of those cells. Of course, the pharmaceutical composition of the present disclosure can be administered in single or multiple doses to provide a pharmaceutically effective amount of the modified binding polypeptide.

[0273] In accordance with the scope of the present disclosure, the binding protein of the present disclosure can be administered to a human or other animal according to the above-described treatment method in an amount sufficient to provide a therapeutic or prophylactic effect. The binding protein of the present disclosure can be administered to such a human or other animal in a conventional dosage form prepared by combining the antibody of the present disclosure with a conventional pharmaceutically acceptable carrier or diluent according to known techniques. It will be recognized by those skilled in the art that the form and characteristics of the pharmaceutically acceptable carrier or diluent are determined by the amount of the active ingredient combined therewith, the route of administration, and other well-known variables. Those skilled in the art will further understand that cocktails containing one or more species of the binding polypeptides described in the present disclosure may be found to be particularly effective.

[0274] The contents of the papers, patents, and patent applications, as well as all other documents and electronically available information mentioned or cited in this specification are hereby incorporated by reference in their entirety as if each individual publication had been specifically and individually indicated to be incorporated by reference. The applicant reserves the right to physically incorporate into this application any and all materials and information from such articles, patents, patent applications, or other physical and electronic documents.

[0275] Although the present disclosure has been described with reference to its specific embodiments, various changes may be made without departing from the true spirit and scope of the present disclosure, and it should be understood by those skilled in the art that equivalents can be substituted. It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods described herein can be made using appropriate equivalents without departing from the scope of the embodiments disclosed herein. Further, many modifications may be made to adapt a particular situation, material, composition of matter, process, process step or step to the objectives, spirit and scope of the present disclosure. It is intended that all such modifications fall within the scope of the appended claims. Although specific embodiments have been described in detail herein, this is for illustrative purposes only and is not intended to be limiting. This will be more clearly understood by referring to the following examples.

Example

[0276] The present disclosure is further illustrated by the following examples and should not be construed as further limited.

[0277] Example 1: Design of NKp46-BCMA NKCE Binding Protein Introduction To date, antitumor therapies have focused on the manipulation of effector T cells. T cell engager formats are in clinical development, but their use is limited to blood diseases due to potential toxicity. In contrast, the manipulation of NK cells in cancer via NKCEs is a therapeutic alternative due to the antitumor effector potential of NK cells compared to effector T cells, with a favorable toxicity profile. Figure 1A schematizes an NKp46 NKCE that binds to one arm against an antigen on the surface of tumor cells and the other arm against the NKp46 receptor on NK cells.

[0278] NKp46 NKCE engineered with a unique Fc format (i.e., NKp46-BCMA_CODV-OL1_Fc-ADE-DSB) as shown in Figure 1B engages BCMA on the surface of tumor cells and simultaneously engages both NKp46 and the Fcγ receptor, CD16a. ADCC activity is induced by its novel enhanced Fc competent format. The novel enhanced Fc competent format (hereinafter referred to as "CODV-OL1-ADE-DSB") includes the following: (1) ADE mutations (G236A / S239D / I332E) in CH2 to enhance ADCC activity; (2) DSBs (R292C / V302C) in CH2 for thermal stabilization; (3) Knob-into-hole mutations (KIH) in CH3 to promote heterodimer formation in the Fc-(3a) knob (heavy chain containing VH / VL domains): S354C / T366W and (3b) hole (heavy chain lacking VH / VL domains): Y349C / T366S / L368A / Y407V; and (4) RF mutations (H435R / Y436F) in one CH3 to facilitate purification of the heterodimer in the Fc. This NKp46-BCMA NKCE_Fc CODV-OL1-ADE-DSB contains two linkers GGGGSGGGGS in the light chain, one between VL anti-BCMA and VL anti-NKp46, and one between VL NKp46 and CL.

[0279] Materials and Methods - Human Recombinant Proteins, Cloning, Production, Purification Recombinant Human NKp46 - Cloning, Production, and Purification The sequence encoding the extracellular domain (ECD) of human NKp46 (Gln22 - Asn255, NCBI reference: NM_004829.5) was inserted into an expression vector and a C-terminal 6×His tag was added for purification. The following primers were used for PCR on human PBMC: 5’TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCCTGC3’ (SEQ ID NO: 107) and 5’CCGCCCCGACTCTAGATCAATGGTGATGGTGGTGATGATTCTGGGCAGTGTGATCCC3’ (SEQ ID NO: 108). The sequence of the amplicon was confirmed. Then, the vector was used to transfect a CHO cell line and clones producing the protein were selected. The protein was purified from the culture supernatant using Ni-NTA beads (Qiagen, #1018244), and after performing S200 size exclusion chromatography to ensure removal of aggregates, the downstream questions of the binding kinetics using surface plasmon resonance (SPR) were characterized.

[0280] The sequence encoding the ECD of cynomolgus macaque NKp46 (Pro22 - Asn254, NP_001271509.1) was cloned into an expression vector and a C - terminal Flag - M2 tag was added for purification. The primers used to amplify the sequence predicted from cynomolgus macaque PBMC were as follows: 5’TACGACTCACAAGCTTGCCGCCACCATGTCTTCCACACTCCGTGC3’ (SEQ ID NO: 109) and 5’CCGCCCCGACTCTAGATCACTTGTCATCGTCATCTTTGTAATCATTCTGGGCAGTGTGGTCC3’ (SEQ ID NO: 110). After sequence verification, the vector was used to transfect the CHO - K1SV cell line and producer cell clones were selected. The first three batches were purified by M2 affinity chromatography. The beads were incubated overnight with the supernatant containing the recombinant protein. Then, the beads were washed with PBS 1X and elution was performed with elution peptide at 150 ng / μl in PBS 1X. Then, the protein was dialyzed against PBS 1X. The next batch was purified by affinity chromatography by coupling the anti - NKp46 antibody to AminoLink coupling resin according to the manufacturer's instructions (GE Healthcare, #20381, batch QB213815). Then, the beads were incubated overnight with the supernatant containing the recombinant protein. Then, the beads were washed with PBS 1X and elution was performed using 0.1 M glycine pH 2.5. Then, the protein was dialyzed against TBS buffer pH 7.5, concentrated, and subjected to preparative size - exclusion chromatography on a Superdex 200 Increase 10 / 300 GL column.

[0281] Recombinant human BCMA - Cloning, production, and purification For the generation of recombinant human BCMA (TNFRSF17), a synthetic HEK293 codon-optimized DNA fragment encoding the extracellular domain of human BCMA fused to diphtheria toxin fragment A (DTA) and His6 purification tag was ordered from Atum (Newark, CA, USA). The synthetic DNA fragment was then cloned into the pTT5 mammalian expression vector using Gateway® Cloning technology (Life Technologies-ThermoFisher Scientific, ) to generate a recombinant plasmid for heterologous expression in mammalian cells.

[0282] Expi293F cells (ThermoFisher) were transfected with plasmid DNA using a commercially available protocol. Cells were harvested after 6 days of growth and conditioned medium (CM) was collected by centrifugation. Protein was purified using Ni-NTA agarose (Qiagen). The resin was rotated at 1000×g for 5 minutes and equilibrated 3 times in PBS pH7.2 by decanting / adding fresh PBS each time. The equilibrated resin was added to a roller bottle with CM and rotated at room temperature for 1 hour. 1 ml of resin was used per 200 ml of conditioned medium. After incubation, the CM / resin slurry was poured into a gravity flow column and washed with 10 CV of PBS (pH7.2). Protein was eluted with 10 CV of 600 mM imidazole in PBS. The eluate was buffer exchanged into PBS pH7.2 and concentrated using an Amicon Ultra-15 centrifugal filter (Millipore). Size exclusion chromatography (SEC) was performed using a Superdex 200 (16 / 60) column (Cytiva Life Sciences) run in PBS. The final samples were pooled and concentrated to a final concentration of >5 mg / ml in PBS.

[0283] CODV-OL1 molecule - production and purification Expression plasmids encoding different strands of the corresponding construct were grown in Escherichia coli (E. coli) DH5α. The plasmids used for transfection were prepared from E. coli using the EndoFree Plasmid Mega Kit (Qiagen).

[0284] HEK 293-FS cells growing in F17 serum-free suspension culture (Invitrogen) were transfected with the indicated plasmids using polyethyleneimine transfection reagent. After culturing at 37 °C with 8% CO2 for 6 days, the cells were removed by centrifugation, and the supernatant was passed through a 0.22 μm filter to remove particles.

[0285] The protein was captured with MabSelect SuRe (Cytiva), eluted with 0.1 M citrate buffer pH 3.0, and neutralized with 1 M Tris pH 9. After polishing the protein by size exclusion chromatography (SEC) using Superdex 200 26 / 60 (Cytiva) and 0.22 μm filtration and UV280 concentration determination, the protein was used for further characterization.

[0286] Recombinant control sample The recombinant proteins of human and cynomolgus monkey listed below were produced and purified at Innate Pharma as previously described (LG Cell 2019): human NKp46 (Gln22-Asn255, NCBI reference: NM_004829.5), human neonatal Fc receptor (FcRn, NCBI reference number: P55899), human CD16a (human FcγRIIIA V and F isoform, NCBI reference: AAH36723), human CD32a (human FcγRIIA, NCBI reference: AAH20823), human CD32b (human FcγRIIB, NCBI reference: NP_003992), human CD16b (human FcgRIIIB, NCBI reference: AAI28563), human CD64 (human FcγRI, NCBI reference: P12314), cynomolgus monkey NKp46 (Gln17-Asn254, NP_001271509.1), cynomolgus monkey FcRn (NCBI reference: Q8SPV9), cynomolgus monkey CD16 (NCBI reference number: NP_001270121.1), cynomolgus monkey CD32a (NCBI reference number: NP_001270598.1), cynomolgus monkey CD32b (NCBI reference number: NP_001271060.1) and cynomolgus monkey CD64 (NCBI reference: AAL92095.1). Recombinant human BCMA was purchased from ACRO Biosystems.

[0287]

Table 1

[0288] Example 2: Determination of BCMA receptor density on a panel of myeloma cell lines Introduction B cell maturation antigen (BCMA) expression has been proposed as a marker for the identification of malignant plasma cells in patients with multiple myeloma (MM). Almost all MM tumor cells express BCMA, but normal tissue expression is limited to subsets of plasma cells and mature B cells. Friedman et al. (2018) Hum Gene Ther. 29(5):585 - 601. To determine the number of BCMA molecules per cell, a flow cytometry-based BCMA receptor assay was used to quantify BCMA surface expression, and then an MM cell line was selected that would be a suitable option for downstream analysis of BCMA antibodies.

[0289] A list of the MM cell lines used in this study is shown in Table 2 below.

[0290]

Table 2

[0291] Materials and methods - Analytical procedures for determining the antigen-binding ability to BCMA expression on the surface of MM cell lines by flow cytometry. Experimental setup For BCMA density measurement, CELLQUANT Calibrator (Biocytex, reference: 7208) was used. First, 200,000 MM cells (see the following list for all tested cell lines) were seeded into a 96-well round-bottom plate (TPP, Trasadingen, reference 92097) in 100 mL of reagent 1 at 1× (diluted 1 / 10 in distilled water) + 10 mL of FcR blocking reagent, human (Miltenyi Biotec, Bergisch Gladbach, reference 130 - 059 - 901) for 15 minutes at 4°C.

[0292] Next, before removing the supernatant, the MM cells were spin - down at 300 g for 5 minutes. After adding 50 μL of mouse anti - human BCMA antibody at 10 mg / mL, it was incubated at 4°C for 30 minutes (BD BioLegend, clone 19F2 ref 357502, stock concentration of 0.5 mg / mL, 1 / 50 dilution by mixing 5 μL of anti - BCMA with 245 μL of reagent 1 in a 1:1 ratio).

[0293] For the control isotype, 50 μL of purified mouse IgG2a kappa isotype control at 10 mg / mL was added instead and then incubated at 4°C for 30 minutes (BD BioLegend, reference number 400201, stock concentration 0.5 mg / mL, 1 / 50 dilution by mixing 5 μL of IgG2a with 245 μL of reagent 1 in a 1:1 ratio).

[0294] 200 μL of reagent 1 was added to the wells in a 1:1 ratio, and then two consecutive washing steps were performed by centrifuging at 2000 rpm for 1 minute at 4°C. After removing the supernatant, the cells were resuspended in 50 μL of anti - mouse IgG FITC secondary antibody (when using 15 μL, reagent 3 of the Biocytex kit, reference number 7208, 1.5 μL of reagent 3 + 13.5 μL of reagent 1), which was pre - diluted 1 / 10 with reagent 1. 50 μL containing calibration beads was added to a well dedicated for calibration (reagent 2 of the Biocytex kit), and 5 μL of reagent 3 was finally added to the calibration well (without dilution) to have the same staining conditions as the cells. Then, the 96 - well plate was incubated at 4°C for 20 minutes and protected from light.

[0295] 200 μL of reagent 1 was added to the wells in a 1:1 ratio, and then three consecutive washing steps were performed by centrifuging at 2000 rpm for 1 minute at 4°C. After removing the supernatant, the cells were resuspended in 100 μL of cold PBS and then read using a MACSQuant Analyzer 10 or MACSQuant VYB (Miltenyi Biotec, Bergisch Gladbach).

[0296] Acquisition is performed using the B1 channel for FITC staining and the V1 channel (cell viability marker) for DAPI staining.

[0297] Calculation of BCMA density To determine the BCMA density on MM cell lines based on FITC fluorescence, a linear calibration curve as shown in Table 3 below was created using calibration bead information.

[0298]

Table 3

[0299] For analysis, the BCMA density per cell was calculated using the following formula. BCMA density = 10 (log(FITC BCMA)×a+b) -10 (log(FITCアイソタイプ)×a+b)

[0300] Results Calculation of the BCMA density per cell in a panel of MM cell lines revealed that the EJM cell line had the highest level of BCMA density and the MM1S cell line had the lowest level of BCMA density on the cell surface compared to other MM cell lines used in the panel. Figure 2 shows the ranking of MM cell lines in descending order of BCMA density per cell. Based on these results, cell lines were selected for downstream studies to examine the NKp46-BCMA_Fc binding affinity and cytolytic activity against BCMA in MM cells. In particular, RPMI 8226 has a BCMA density of approximately 2000 sites / cell, which is close to the average in multiple myeloma cells. MM1S has a BCMA density of approximately 800 sites / cell, which approximately corresponds to the level of BCMA expression in healthy plasma cells. MM1R has a BCMA density of approximately 5500 sites / cell and is useful for determining the efficiency of the binding proteins of the present disclosure at high expression levels.

[0301] Example 3: Evaluation of the binding properties of NKp46-BCMA Fc format mutants Introduction Titrated NKp46-BCMA_Fc-ADE-DSB NKCE against RPMI cells to determine the K D values for binding to MM tumor cells as well as donor NK cells. Subsequently, different Fc format variants of NKp46-BCMA-NKCE were tested by SPR to confirm the affinity for two variants of the FcRn and CD16a receptors.

[0302] Materials and Methods Cells The RPMI 8226 multiple myeloma cell line was purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1× non-essential amino acids).

[0303] Titration Assay Resting NK cells and RPMI 8226 cells (1.10 5 cells / well) were stained for 1 hour in a U-bottom 96-well plate with a 1 / 10 serial dilution range of unconjugated molecules starting at 225 μg / mL and 500 μg / mL, respectively. Staining with secondary antibody was performed using goat anti-human IgG, Fcγ fragment specific PE (Jackson Immunoresearch 109-116-170). After staining, cells were resuspended in BD Cellfix and analyzed by flow cytometry. Parameters were recorded and analyzed with FlowJo software. Staining EC50 values were calculated using GraphPad Prism with a four-parameter logistic non-linear regression model.

[0304] SPR Binding Experiment - CD16a For measurement of binding affinity by CD16a, HBS-EP+ buffer (Cytiva, Uppsala, catalog number BR1006-69) was prepared by mixing 100 mL of 10× HBS-EP+ buffer with 900 mL of purified water.

[0305] The affinity capture of human CD16a protein was achieved using a His capture kit (Cytiva, Uppsala, catalog number 28995056). The anti-His capture antibody was diluted 1:20 with running buffer and coupled to a CM5 chip (Cytiva, Uppsala, catalog number 29149603) using standard amine coupling, and approximately 8000 response units (RU) were obtained using an amine coupling kit (Cytiva, Uppsala, catalog number BR-100-50).

[0306] Ten-fold serial 1:1 dilutions of the bispecific antibody in HBS-EP+ assay buffer were prepared at concentrations of 5.8 nmol / L, 11.7 nmol / L, 23.4 nmol / L, 46.8 nmol / L, 93.75 nmol / L, 187.5 nmol / L, 375 nmol / L, 750 nmol / L, 1500 nmol / L, and 3000 nmol / L. The CD16a (V / F) protein was diluted to a concentration of 0.1 ng / mL with HBS-EP+ buffer and used in the experiment at this concentration. CD16a (V176) and CD16a (V176F) were captured on flow cells 2 and 4, respectively, at a flow rate of 10 μL / min for 30 seconds to obtain a maximum response (Rmax) value of approximately 30 RU.

[0307] The measurements were performed in a multi - cycle kinetics experiment. In each multi - cycle experiment, CD16a was captured via an anti - His antibody immobilized on a Series S CM5 sensor chip (human antibody capture kit, Cytiva, Uppsala, catalog number BR1008 - 39). Bispecific antibodies diluted in HBS - EP+ buffer were injected at a flow rate of 30 μL / min for 120 s in a 1:1 dilution series from 5.8 nmol / L to 3000 nmol / L, followed by a dissociation phase injection for 120 s. For double reference, all analyte concentrations were run in duplicate with multiple buffer blanks. Regeneration of the capture surface was performed at 30 μL / min for 30 s using two consecutive injections of a regeneration solution (10 mmol / L glycine pH 1.5). The binding affinity (KD value) of the bispecific antibody to human CD16a was evaluated using the steady - state fit of the SPR response to the measured antibody concentration with Biacore T200 Evaluation Software version 3.0 (Cytiva, Uppsala).

[0308] SPR Binding Experiment - huNKp46 and BCMA For the measurement of binding affinity by huNKp46 and BCMA, serial two - fold dilutions of human NKp46 (concentration range 50 nM to 0.1 nM), cynomolgus NKp46 (concentration range 50 nM to 0.1 nM), human BCMA (concentration range 50 nM to 0.1 nM) and cynomolgus BCMA (PPB - 17990; concentration range 50 nM to 0.1 nM) were prepared in HBS - EP+ assay buffer.

[0309] The affinity capture of mAb samples (FF-20-1319-1, FF-20-1320-1, FF-20-1634-1, FF-20-1635-1, EFF-20-106-1, EFF-20-107-1) was achieved using a human antibody capture kit (Cytiva, Uppsala, catalog number BR1008-39) according to the manufacturer's instructions. The anti-Fc capture antibody was diluted 1:20 with running buffer and coupled to a CM5 chip (Cytiva, Uppsala, catalog number 29149603) using standard amine coupling, and approximately 8000 response units (RU) were obtained using an amine coupling kit (Cytiva, Uppsala, catalog number BR-100-50).

[0310] The antibody was diluted to a concentration of 0.1 - 0.4 μg / mL with HBS-EP+ buffer and used in the experiment at this concentration. The antibody was captured at a flow rate of 10 μL / min for 120 seconds to obtain a maximum response (Rmax) value of approximately 30 RU.

[0311] Measurements were performed in a multi-cycle kinetic experiment for each antibody using a Biacore 8K instrument. In each multi-cycle experiment, the antibody was captured via an anti-hum Fc antibody immobilized on a Series S CM5 sensor chip (human antibody capture kit, Cytiva, Uppsala, catalog number BR1008-39).

[0312] The antigen diluted as described above (concentration range 0.1 nM - 50 nM) was injected at a flow rate of 60 μL / min for 240 seconds, followed by an injection of a dissociation phase for 400 seconds. For double referencing, all analyte concentrations were run in duplicate with multiple buffer blanks. The capture surface was regenerated using a regeneration solution (3 mol / L MgCl2) at 30 μL / min for 60 seconds. A 1:1 binding model with mass transfer limitations was used to evaluate the kinetic binding data using Biacore 8K evaluation software version 1.1.1.7442.

[0313] Results Titration of NKp46-BCMA_Fc-ADE-DSB on RPMI cells and donor NK cells demonstrated that the Fc format of NKp46-BCMA that enhanced ADCC still retained affinity for NKp46 and BCMA targets, as shown in FIGS. 3A and 3B.

[0314] SPR binding analysis with a larger panel of 12 different Fc formats of NKp46-BCMA-NKCE confirmed the affinity for CD16a and FcRn, as shown in FIGS. 4 and 5, respectively. In particular, all ADCC-enhancing molecules demonstrated increased binding to the CD16 (V176) and (F176) variants, as shown in FIG. 4.

[0315] For NKp46-BCMA_Fc-ADE-DSB NKCE, the binding rates to NKp46 (human and cynomolgus monkey), BCMA (human and cynomolgus monkey), and FcγR were also calculated and the results are shown in Tables 4, 5, and 6 below.

[0316] [Table 4]

[0317] [Table 5]

[0318] [Table 6]

[0319] Example 4: Fc-engineered NKp46-BCMA NKCE demonstrates enhanced in vitro cytotoxic activity Introduction NKp46-BCMA NKCEs engineered with different Fc formats, either with enhanced ADCC (Fc-DE, Fc-DE-DSB, Fc-ADE, Fc-ADE-DSB) or without enhanced ADCC (NKp46-BCMA_Fc), were evaluated for their ability to promote lysis of MM tumor cells in the presence of NK donor cells, as well as for the assessment of potential off-target NK cell cytotoxicity. Furthermore, NKp46-BCMA NKCEs were compared to anti-BCMA antibody controls for their MM tumor killing ability.

[0320] Materials and Methods Cells Human NK cells. Healthy human buffy coats were provided by the Etablissement Francais du Sang (EFS, French Blood Service, Marseille; AC-2019-3428). Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats by Ficoll density gradient centrifugation. Human NK cells were purified from PBMCs using bead-based negative selection kits from STEMCELL Technologies or Miltenyi Biotec. MM cell lines. RPMI 8226 and MM1.S multiple myeloma cell lines were purchased from ATCC. Cells were cultured in complete RPMI medium (RPMI-1640 containing 10% FBS, 2 mM L-glutamine, 1 mM sodium pyruvate, and 1× non-essential amino acids).

[0321] NK cell-based cytotoxicity assay For the cytotoxicity assay performed on the MM cell line, the target cells were alternately loaded with Cr-51. Starting at 5, 10 or 15 μg / mL depending on the experiment, a 1 / 10 serial dilution range was performed for the test and control items. The tested molecule, labeled target cells (about 3,000 cells) and human NK cells (about 30,000 cells) from healthy donors (fresh or left overnight) were successively added to each well of a round-bottom 96-well plate to obtain a ratio of 10:1 (E:T). After 4 hours of co-incubation, the supernatant was transferred to a Lumaplate (for Cr-51). In the Cr-51-based cytotoxicity assay, the Cr-51 released from the dead target cells was measured with a TopCount NXT (Microplate Scintillation and Luminescence Counter; Perkin Elmer). The radioactivity was measured by counting the γ-emission for 60 seconds for each well. The results were expressed as cpm = counts per minute. The percent specific lysis was calculated using the following formula: Percent specific lysis (%) = (ER (cpm) - SR (cpm)) / (MR (cpm) - SR (cpm)) × 100 where ER = experimental release, SR = spontaneous release and MR = maximum release.

[0322] The EC for each molecule was determined by drawing an appropriate non-linear regression curve (selection of the "log(agonist) vs response - variable slope (4 parameters)" model) using Graphpad Prism Software. 50 was determined.

[0323] Results As shown in Figure 6, NKp46-BCMA NKCE engineered in Fc formats that enhance ADCC (Fc-DE, Fc-DE-DSB, Fc-ADE, Fc-ADE-DSB) promoted NK cell-mediated MM tumor cell cytotoxic activity more effectively than the non-enhanced ADCC format NKp46-BCMA_Fc. The cytotoxic activity was not impaired by the introduction of DSBs that stabilized the molecule. As shown in Figures 7 and 8, both NKp46-IC_Fc-ADE and NKp46-BCMA_Fc mediated MM tumor cell death to levels similar to or with superior cytotoxic activity as the anti-BCMA antibody in the IgG1 format (BCMA_IgG1) or the anti-BCMA antibody in the defucosylated IgG1 format (Reference-1) in the presence of NK cell effectors.

[0324] Both NKp46-IC_Fc-ADE and NKp46-BCMA_Fc had superior cytotoxic activity against MM tumor cells in the presence of NK cells, but no fratricidal NK cell killing was observed, indicating that NKp46-BCMA NKCE does not induce potential toxic off-target effects (Figure 9). The presence of soluble BCMA in the sera of MM patients has been described. Hipp et al. (2017) Leukemia 31:1743-1751. Soluble BCMA titrated at increasing concentrations in a cytotoxicity assay using MM cell and NK cell co-cultures demonstrated that soluble BCMA slightly affected the potency of NKp46-BCMA NKCE but did not affect the maximum level of MM cell lysis, as shown in Figure 10.

[0325] Example 5: In Vitro Cytotoxicity Assay Using Calcein Release as an Indicator Materials and Methods Whole blood samples: Fresh human peripheral blood mononuclear cells (PBMCs) were isolated from whole blood samples of healthy donors supplied by EFS Ile de France, in accordance with the "terms & conditions" described in Agreement N 12 / EFS / 131 established between EFS Ile de France and Sanofi-Aventis Recherche et Developpement.

[0326] Isolation of human PBMCs from whole blood: Human PBMCs were isolated from whole blood of healthy donors (HDs) by density gradient centrifugation.

[0327] Whole blood was collected from blood bags and diluted with 40 mL of sterile phosphate-buffered saline (PBS). 15 mL of Ficoll-Paque Plus Cytiva (Sigma Aldrich, reference number 17-1440-02) was dispensed into the center of four sepMate-50 tubes (Stemcell ref#85450). Then, 80 mL of diluted blood was gently added to the edge of each sepMate-50 tube containing the Ficoll solution (20 ml / tube). The tubes were centrifuged at 1200 g for 20 minutes at room temperature (RT) without braking. Four buffy coat layers were collected and transferred to two 50 mL tubes. The leukocyte solution was made up to a final volume of 50 mL with sterile PBS. The two tubes were centrifuged twice at 400 g for 10 minutes at room temperature with braking (between each centrifugation, the supernatant was discarded and 50 mL of PBS was added). After the last centrifugation, the pellets were mixed and brought to a volume of 10 mL with RPMI1640 medium supplemented with 10% fetal bovine serum (FBS) and 2 mM L-glutamine (complete culture medium). The total viable PBMC count was defined by Vicell XR counting (Beckman Coulter cell counter).

[0328] Isolation of NK cells: Human NK cells were purified from PBMCs using the MACSxpress® Whole Blood NK Cell Isolation Kit (Miltenyi) according to the supplier's recommendations. Next, the NK cells were cultured overnight at +37°C, 5% CO2 in complete medium at 5 × 106 cells / mL (so-called "resting" NK cells) before being used in the activation assay. 1 × 10 6 cells were left untreated and their expression of NKp46 and CD16 was evaluated by flow cytometry.

[0329] Cell lines: RPMI8226 (ATCC CCL-155), MM.1R (ATCC CRL-2975), and MM.1S (ATCC CRL-2974) cells are multiple myeloma cell lines (plasmacytomas). They mainly grow in suspension, but some cells can grow adherently (up to 50% in some cases). For maintenance, the cells were resuspended in fresh complete medium at 0.3 × 10 6 cells / mL for 3 or 4 days.

[0330] Stock solutions: Stock solutions of each antibody were stored at 4°C in PBS. On the day of the assay, the product was vortexed to remove potential aggregates and then serially diluted. A dilution range of 200 nM (2-fold concentrated) to 0.02 pM (1 / 10 serial dilution) was performed in complete culture medium.

[0331] Of these serial dilutions, 100 μL was added to each well containing the cell suspension (50 μL of BCMA + RPMI8226 target cells and 50 μL of NK) to obtain final concentrations of 100, 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001 nM. For the conditions of the combination antibody (which does not bind to NKp46 or CD16), the first concentration was 4-fold concentrated to reach the same concentration as the other antibodies tested with 50 μL of NKp46-BCMA-Fc ADE-DSB.

[0332] Cytotoxicity assay: BCMA+RPMI8226 (or MM.1R or MM.1S) target cells were counted on the day of the assay, and the amount of cells required for the experiment was evaluated (5000 cells / well). 1×10 6 / ml of the target cells at a concentration were resuspended in 4 ml of complete medium containing 10 μl of Calcein-AM (50 μg) pre-reconstituted in 25 μl of DMSO. The labeled cells were incubated at 37 °C for 30 minutes in the presence of 5% CO2 (carbon dioxide).

[0333] Serial dilutions of the antibody were prepared and added to a U-bottom 96-well plate (100 μl / well) (Corning® Costar® Ultra-Low Attachment Multiwell 96-Well Plate; Thermo Scientific).

[0334] The target cells were washed three times with 5 ml of complete medium (after each wash, centrifuged at 300 g for 5 minutes and the supernatant was discarded). The final wash was performed with complete medium (ThermoFisher Scientific) containing probenecid (4-fold concentrated). The target cells were counted and seeded at 5000 cells / 50 μl / well. Finally, NK cells at an E / T ratio of 10:1 were added to the suspension of target cells and antibody. As controls, target cells alone and target cells with NK but without antibody were added. Additionally, 2% Triton X was considered to achieve maximum target cell death. Each condition was performed in duplicate. The culture plates were incubated at 37 °C for 4 hours in the presence of 5% CO2, and finally 100 μl of the supernatant was collected and transferred to the flat bottom of a black 96-well microplate for Med binding, and the calcein release from dead target cells was evaluated with a TECAN 1000Pro machine.

[0335] Data analysis: To convert the concentration of the antibody from mg / ml to M, the following formula was used: Concentration (mg / ml) / Molecular weight (Da) = Molar concentration (M) For the killing analysis, the percentage of specific lysis was calculated using the following formula. % Cytotoxicity = [(ER - SR) × 100 / (MR - SR)] ER = Experimental release (target cells + NK + [antibody]) SR = Spontaneous release (target cells only) MR = Maximum release (target cells + 2% Triton X)

[0336] Statistical analysis: The analysis was performed using GraphPad prism 9.1.2. The upper limit of the lysis value corresponded to the maximum lysis observed (average of duplicate values). According to Ratkowsky and Reedy, the maximum half-maximal effective concentration (EC 50 ) value was expressed in pM and calculated using a four-parameter logistic non-linear regression model.

[0337] Results NK cell activation was determined by measuring the % specific lysis of RPMI 8226 cells by NK cells and any of the following: NKp46-BCMA_Fc-ADE-DSB, which engages both NKp46 and CD16a; NKp46-BCMA-Fc incompetent-DSB (a molecule that binds only to NKp46); X-BCMA-ADE-DSB (a molecule that binds only to CD16a); a combination of an NKp46-only binder and a CD16a-only binder or an isotype control antibody (X-BCMA-Fc incompetent-DSB that binds only to BCMA on tumor cells but not on NK cells, and NKp46-X-ADE-DSB that binds to NKp46 and CD16a on NK cells but not on tumor cells). Optimal NK cell activation occurred with NKp46-BCMA_Fc-ADE-DSB compared to combinations of the other four antibodies with a single targeting agent, demonstrating (1) that dual targeting of NKp46 and CD16a results in greater potency and efficacy in tumor cell killing than single engagement, and (2) the importance of having the NKp46 arm and the CD16a arm on the same molecule for optimized potency (Figure 11).

[0338] Furthermore, the high potency of NKp46-BCMA_Fc-ADE-DSB was found to enable strong efficiency in tumor cell killing even in MM cell models expressing low levels of BCMA (e.g., MM1S cells) (Figure 12).

[0339] NKp46-BCMA_Fc-ADE-DSB was also compared with anti-BCMA monoclonal antibodies having enhanced ADCC characteristics (e.g., defucosylated anti-BCMA antibodies). NKp46-BCMA_Fc-ADE-DSB demonstrated equivalent maximum lysis and better potency compared to defucosylated anti-BCMA antibodies in both RPMI 8226 cells and MM1S cells (Figure 13).

[0340] Example 6: Fc-engineered NKp46-BCMA NKCE demonstrates potent and specific in vivo antitumor activity Introduction To evaluate the in vivo efficacy of NKp46-BCMA NKCE against tumor cells, a xenograft mouse model that does not express CD16 was established. Figure 14A is a schematic diagram of the experimental set-up for determining the in vivo NKp46-BCMA_Fc antitumor activity in the xenograft mouse model. Briefly, a 1:1 mixture of green (eGFP) and red (dsRed) fluorescent mouse lymphoma RMA cells that do not express and express human BCMA, respectively, was intravenously (i.v.) injected into human NKp46 gene-transduced Rag1-deficient mice (Tg huNKp46 Rag1 - / -). Tumor-bearing mice (n = 7 per group) were treated once with a total dose of 12.2 picomoles of NKp46-BCMA_Fc or vehicle as a control. At 48 hours after treatment, the livers of the mice were biopsied and the absolute number of infiltrating RMA cells was monitored by flow cytometry. At 48 hours after treatment, the livers of the mice were biopsied and the absolute number of infiltrating RMA cells was monitored by flow cytometry as described below and shown in the corresponding Figures 14B - 14E.

[0341] Materials and Methods In vivo antitumor activity in a short-term model The activity of the BCMA-NKCE molecule was evaluated in a disseminated tumor model using murine RMA leukemia cells that were not transduced with RMA-dsRed-huBCMA Cl.E6 (BCMA-positive) or RMA-eGFP Cl.5A6 (BCMA-negative) for the expression of human BCMA, and were mixed at a 1:1 ratio for injection into the tail vein on day 0 in immunodeficient mice (HuNKp46 Tg Rag1- / -) (N = 14) that express human NKp46 on NK cells. The mice were divided into two groups and treated on day 0 with vehicle (N = 7) or the NKp46-BCMA_Fc molecule (N = 7) at a flat dose of 12.3 picomoles per mouse. On day 2 (48 hours after treatment), the mice were sacrificed and disseminated RMA cells were extracted from the liver by disruption using OctoMacs® and Percoll gradient isolation. RMA cells infiltrating the liver were analyzed and counted by flow cytometry.

[0342] Quantification and statistical analysis Sequential statistical analysis of the obtained data was performed using GraphPad Prism V7. The obtained ratio data were log-transformed for statistical analysis. A normality test (d’Agostino-Pearson) was performed to confirm the use of non-parametric tests (Kruskal-Wallis, followed by post-comparison tests). Each treatment group was systematically compared to the control vehicle group. When the data were not normally distributed, the statistical significance of the difference between paired sample populations was determined using the Wilcoxon matched-pairs signed-rank test. N is the number of samples used in the experiment. Mean or median values are shown, regardless of the presence or absence of error bars indicating SD. Significance is shown as follows. *p ≤ 0.05; **p ≤ 0.01; ***p ≤ 0.001, ****p ≤ 0.0001. Four-parameter non-linear regression analysis was used to calculate the NKp46-BCMA_Fc NKCE EC 50 was calculated.

[0343] Results Prior to engraftment, when analyzed by flow cytometry, there were 1.5-fold more dsRed-huBCMA RMA cells relative to eGFP-huBCMA negative cells, and only RMA dsRed cells expressed BCMA (Figures 14B - 14C). Expression of human BCMA on dsRed RMA cells prior to engraftment (in vitro) and after engraftment (ex vivo) in liver biopsies, analyzed by flow cytometry, was also detectable (Figure 14D). Forty-eight hours after treatment with NKp46-BCMA-Fc or vehicle control, the absolute number (left) and dsRed / eGFP cell ratio (right) of liver-infiltrating RMA cells analyzed by flow cytometry demonstrated that NKp46-BCMA_Fc tumor killing was specific for tumor cells expressing BCMA (Figure 14E).

[0344] Example 7: NKp46-BCMA_Fc-ADE-DSB promotes autologous NK cell activation and multiple myeloma (MM) cell killing ex vivo Introduction Bone marrow and peripheral blood samples containing multiple myeloma cells and autologous immune effector cells were obtained from untreated or standard-of-care diagnosed patients with either de novo or relapsed multiple myeloma, and the cumulative effects of NKp46-BCMA_Fc-ADE-DSB NKCEs ex vivo were evaluated.

[0345] Materials and Methods Cells and Staining Bone marrow and peripheral blood samples were obtained from the MYRACLE cohort (Benaniba et al., BMC Cancer, 2019). Peripheral blood mononuclear cells (PBMC) and bone marrow mononuclear cells (BMMC) were isolated by density gradient centrifugation using Ficoll-Hypaque. Samples from patients who received standard-of-care treatment had been previously treated with daratumumab, carfilzomib, dexamethasone, and lenalidomide.

[0346] Cells (4×10 5The cells / well were incubated for 24 hours in RPMI containing 5% FCS and 3 ng / ml IL-6 in the presence of CTL-NKCE2, NKCE2 (10 μg / ml), reference-4 (20 μg / ml) or obinutuzumab (10 μg / ml). At the end of the incubation, the cells were transferred to a V-bottom plate, the plate was centrifuged at 3000 rpm for 1 minute, and washed once with PBS. A panel of antibodies in BD pharmingen Stain Buffer BSA / Brilliant Stain buffer was added under each condition described in the following table.

[0347] The cells were resuspended in FAC buffer and analyzed by flow cytometry using a FACS Symphony. NK cell activation, described further below, was evaluated by CD107a and CD69 expression on CD3− / CD56+ NK cells, and myeloma cell death was evaluated by the disappearance of CD138+ / CD38+ cells.

[0348]

Table 7

[0349] NK cell activation assay The molecules were added to a U-bottom 96-well plate. Next, 50,000 resting NK cells and 50,000 RPMI 8226 cells were successively added to each well to obtain a 1:1 effector-to-target (E:T) ratio. The control condition was carried out by adding only 50,000 resting NK cells per well. BD GolgiSTOP™ solution (BD Biosciences, 554724) was added at a final dilution of 1 / 6000e in each well (control and experiment). Final 125 ng / mL of Phorbol 12 myristate 13 acetate (PMA, SIGMA, P8139) and 1 μg / mL of final ionomycin (IONO, SIGMA, I0634) were added per well to 50,000 resting NK cells to perform a positive control for NK cell activation. Each condition was performed in duplicate. After 4-hour co-incubation at 37 ± 1 °C and 5 ± 1% CO2, extracellular staining was performed for CD3, CD56, CD69, CD107a, and CD107b markers. After cell fixation and permeabilization, intracellular staining was performed for measurement of intracellular IFNγ, TNFα, and MIP1β production. The antibody mixture was centrifuged at 16000g for 10 minutes at +4 °C to remove potential aggregates. The cells were resuspended in staining buffer (PBS, 0.2% BSA, 2 mM EDTA, 0.02% azide) after the final staining and analyzed by flow cytometry (FC).

[0350] Flow cytometry data were analyzed using FlowJo software. Analysis of percent NK cell activation was performed using GraphPad Prism. The top value of activation corresponded to the maximum activation observed. The maximum half-maximal effective concentration (EC50) value was calculated using a 4-parameter logistic non-linear regression model corresponding to the following equation. [Number]

[0351] Using the same model as for EC50, the bottom calculated value of activation, the top calculated value of activation, the slope, and the 95% confidence interval (CI) value were calculated.

[0352] Results Flow cytometric analysis of PBMCs from MM patients treated with NKp46-BCMA_Fc-ADE-DSB NKCE showed a decrease in the frequency of myeloma cells characterized by the disappearance of CD138+ / CD38+ cells (left panel of Figure 15A), and an increase in activated NK cells as evaluated by CD107a and CD69 expression on CD3- / CD56+ NK cells (middle right panel of Figure 15A), compared to anti-BCMA IgG1 DE antibody or antibody-free controls. These differences in marker expression levels were quantified in corresponding bar graphs as shown in Figure 15B. Figure 16 shows the ex vivo characterization of NKp46-BCMA_Fc-ADE-NKCE tumor killing activity in an autologous setting using bone marrow aspirates from MM patients who had failed at diagnosis or on standard of care (SoC) treatment (daratumumab, isatuximab, proteasome inhibitor, IMID, dexamethasone, alkylating agent, BH3 mimetic, histone deacetylase inhibitor), anti-CD47, CD3-CD38 or CD3-BCMA T cell engagers (TC; treatment class). Samples showing less than 10% lysis were associated with very low E:T ratios.

[0353] NKp46-BCMA_Fc-ADE-DSB NKCE shows similar ex vivo anti-myeloma activity (autologous setting) in patient samples at diagnosis or relapse. No decrease in anti-myeloma activity is observed at relapse.

[0354] These data demonstrate that NKp46-BCMA_Fc-ADE-DSB NKCE activates ex vivo NK cells in primary samples from MM patients, for example, in an autologous assay using myeloma cells and NK cells from the same patient.

[0355] Example 8: Fc-engineered NKp46-BCMA NKCE demonstrates potent and specific in vivo anti-tumor activity and good elimination half-life Introduction This example evaluates the pharmacokinetic (PK) profile and parameters of NKp46-BCMA_Fc-ADE-DSB NKCE after a single intravenous administration (2.5 mg / kg) to female huFcRn Tg32 transgenic mice.

[0356] Materials and Methods PK Study in hFcRn Transgenic Mice Mouse experiments were performed on transgenic Tg32 (B6.Cg-Fcgrttm,1Dcr Tg(FCGRT)32Dcr / DcrJ) mice derived from C57BL / 6 mice and purchased from The Jackson Laboratory (Bar Harbor, Maine). FcRn- / - hFcRn (strain 32) Tg mice have a null mutation for the transgene that expresses the hFcRn α-chain transgene under the control of the mouse gene and its native human promoter. Three Tg32 homozygous naive adult female mice (average body weight 21.4 g) were used at the start of the study.

[0357] For the dosing regimen, NKp46-BCMA_Fc-ADE-DSB NKCE (stock solution: 1.5 mg / ml) was prepared immediately in 10 mM His, 150 mM NaCl, pH 6 buffer diluted in the same buffer and administered intravenously into the tail vein at a dose of 10 mL / kg as a single intravenous dose of 2.5 mg / kg. Animals were evaluated using a serial sampling approach at 0.083, 4, 24, 72, 168, 336, 504 and 672 hours post-dose over a 28-day study period. At each time point, blood samples (approx. 20 μL - serial sampling) were collected from the supine vein into a K3-EDTA collection device. Immediately after collection, the blood samples were placed on wet ice and then centrifuged. Then, 4 μL of plasma was diluted in 60 μl of DPBS (phosphate buffered saline).

[0358] The analytical method was as follows: The concentrations at each time point were determined by a bottom-up LC-MS / MS assay using the following general method: After precipitation of plasma aliquots, the plasma pellets were subjected to protein denaturation, reduction, alkylation, trypsin digestion, and solid-phase extraction prior to analysis of the surrogate peptide. The surrogate peptide VYACEVTHQGLSSPVTK belonging to the Fab region (light chain) was selected for each antibody for quantification according to its selectivity and response factor. Calibration standards were prepared by adding the antibody to plasma at 1, 2.8, 7, 14, 40, 80, and 100 μg / mL. Peptide separation was performed on a Shimadzu UHPLC system equipped with a reverse-phase Xbridge BEH C18 column (2.1×150 mm, 3.5 μM, 300 Å, water) at a flow rate of 600 μL / min with a step gradient of 0.1% formic acid in water and 0.1% formic acid in acetonitrile. For detection, a Sciex API6600 TripleTOF mass spectrometer was used in positive product ion mode, with a source temperature of 500 °C, an ion spray voltage of 5500 V, a curtain gas of 35, and a nebulizer gas of 50. The dwell time was 15 ms for each experiment. The declustering potential was 90 V and the collision energy was 26 V. The 807.4098 m / z fragment of the 626.0 m / z parent ion of the unique surrogate peptide of the antibody was used for concentration determination by comparing the peak area from the MQ4 integration algorithm of MultiQuant software with standards and controls.

[0359] Assay method The NKp46-BCMA_Fc-ADE-DSB NKCE concentration was determined in plasma using a discovery LBA method. NKp46-BCMA_Fc-ADE-DSB NKCE was captured by biotinylated BCMA antigen bound to streptavidin beads on a Gyrolab microstructure disk and detected using a goat anti-human IgGFcg Alexa tag tracer. The lower limit of quantification (LLOQ) value was 1.00 μg / mL.

[0360] Statistical analysis The individual plasma concentration values (expressed in μg / mL) of NKp46-BCMA_Fc-ADE-DSB NKCE were summarized by descriptive statistics (mean, standard deviation (SD), and coefficient of variation (CV%)) and tabulated by sampling time. All results were reported with three significant figures, except for CV% without decimals.

[0361] The individual PK parameters were summarized by descriptive statistics as described above. Individual values and mean values were presented with three significant figures (except that tmax and tlast were appropriately rounded for time values, and only median and range [minimum - maximum] values were reported).

[0362] Results No clinical signs or symptoms were observed during the study.

[0363] The mean and individual values (N = 3) of NKp46-BCMA_Fc-ADE-DSB NKCE plasma concentration (ug / ml) obtained after single IV (2.5 mg / kg) administration of NKp46-BCMA_Fc-ADE-DSB NKCE to female huFcRn tg32 mice are reported in Table 8 below, and the corresponding mean plasma concentration and individual plasma concentration vs. time profiles are shown in Figures 18 and 19, respectively.

[0364] [Table 8]

[0365] The mean and individual values (N = 3) of the pharmacokinetic parameters of NKp46-BCMA_Fc-ADE-DSB NKCE in plasma after single intravenous (2.5 mg / kg) administration of NKp46-BCMA_Fc-ADE-DSB NKCE are shown in Table 9 below.

[0366] [Table 9]

[0367] After intravenous administration at 2.5 mg / kg, the NKp46-BCMA_Fc-ADE-DSB NKCE concentration was quantifiable in plasma up to a maximum of 28 days (the last sampling time), the plasma clearance was estimated to be 6.4 ± 0.546 mL / day / kg, the volume of distribution at steady state was 121 ± 9.82 mL / kg, and a terminal elimination half-life (t1 / 2) of approximately 14 days was obtained.

[0368] Example 9: NKp46-BCMA Fc WT CODV-OL1 exhibits potent antitumor activity in a dose-response manner and demonstrates better activity by co-engaging both CD16 and NKp46 on NK cells. Introduction In huNKp46-Tg x Rag mice transplanted with disseminated mouse EL4 cells expressing human BCMA, the efficacy of NKp46-BCMA Fc WT CODV-OL1 was evaluated. The IgG1-competent Fc domain can bind to all activated mouse FcγRs, recruit mouse effector cells, and induce ADCC with mouse NK cells.

[0369] Materials and Methods On day 0, mice were intravenously inoculated with 0.5 × 10 6 tumor cells. Treatments were administered IP on day 1 after tumor transplantation. The following control antibodies were administered at 5 mg / kg: NKp46-CD16-X Fc WT, which binds to huNKp46 and mouse FcγRs but not to huBCMA; NKp46-X-BCMA with the LALA Fc mutation, which binds to huNKp46 and BCMA but inhibits binding to mouse FcγRs and recruitment of mouse effector cells via CD16; X-CD16-BCMA, which binds to huBCMA and mouse FcγRs but not to huNKp46. NKp46-BCMA Fc WT CODV-OL1 was administered at 5, 0.5, and 0.05 mg / kg. The control group was left untreated.

[0370] Mice were checked daily and adverse clinical reactions were observed. The body weight of each individual mouse was measured daily until the end of the experiment (day 60). Mice were euthanized when they reached a moribund state according to a predefined criterion to avoid animal suffering. Clinical signs associated with conditions considered to be severe were limb paralysis, ascites, palpable intra-abdominal tumor masses, a morbidity rate of 20% or more, or weight loss. The primary efficacy endpoints were the median survival time (MST) per day, the percent increased life span (%ILS), and the long-term survival rate. The individual death date (if any) of each mouse was reported. The MST was determined for each group, the ratio ILS was calculated and expressed as a percentage: %ILS = 100×(T - C) / C where T = MST of the treatment group and C = MST of the control group.

[0371] A dose is considered to be therapeutically active if the %ILS is better than 25% and very active if the %ILS is better than 50% (Johnson JI et al. (2001) Br J Cancer 84(10):1424 - 1431). Relationship between drug activity in NCI preclinical in vitro and in vivo models and early clinical trials. Id.

[0372] Long-term survival rate is defined as the number of mice having a survival period more than twice the MST of the control group relative to the total number of mice in the group expressed as a percentage.

[0373] Results The results are shown in Figure 20 and Table 10.

[0374] NKp46-BCMA Fc WT NKCE induced statistically significant activity at doses of 5, 0.5, and 0.05 mg / kg in the EL4-huBCMA disseminated model, and the ILS compared to the control was 215% and 57% of long-term survivors at a dose of 5, 215% and 62.5% of long-term survivors at a dose of 0.5, and 132% and 12.5% of long-term survivors at a dose of 0.25 mg / kg.

[0375] The control X-CD16-BCMA NKCE induced statistically significant activity at a dose of 5 mg / kg in the EL4-huBCMA disseminated model, with ILS of long-term survivors being 147% and 28.6%, while the control NKp46-X-BCMA NKCE did not induce significant activity at a dose of 5 mg / kg, with an ILS of 84% and no long-term survivors.

[0376] In conclusion, NKp46-BCMA CODV-OL1 NKCE showed dose-dependent activity with robust activity from 0.05 mg / kg, and the activity compared to the NKp46-X-BCMA and X-CD16-BCMA NKCE controls demonstrated the advantage of co-engaging NK cells with both NKp46 and FcγR to improve in vivo efficacy.

[0377]

Table 10

[0378] Example 10: The ADCC-enhanced NKCE shows a clear superiority in vivo compared to the Fc WT NKCE. Introduction In huFcgR-Tg mice transplanted with disseminated mouse EL4 cells expressing human BCMA, the efficacy of surrogate muNKp46-huBCMA Fc WT and Fc-ADE CODV-OL1 was evaluated. The huFcgR-Tg mice were generated by The Rockefeller University (Smith P et al. (2012) PNAS, 109(16):6181-6186), and these mice express all five human Fc γ receptors. The ADE mutation enhances the affinity of the Fc receptor for the human FcgRIIIA receptor expressed by NK cells but not for the mouse ortholog FcgRIV. HuFcgR-Tg mice were used to evaluate the potentially enhanced activity of ADE against WT NKCE. The control surrogate contains an IgG1-competent Fc domain.

[0379] Materials and Methods On day 0, 5×10 mice6 Individual tumor cells were inoculated intravenously. The treatment was administered IP on the first day after tumor transplantation. A control antibody that binds to muNKp46 instead of huBCMA(muNKp46-X) was administered at 5 mg / kg. muNKp46-BCMA Fc WT and Fc-ADE CODV-OL1 were administered at 5, 0.5, and 0.05 mg / kg.

[0380] The mice were checked daily and no adverse clinical reactions were observed. The body weight of each individual mouse was measured daily until the end of the experiment (day 60). The mice were euthanized when they reached a moribund state according to a predetermined criterion to avoid animal suffering. Clinical signs related to conditions considered to be serious were limb paralysis, ascites, palpable internal tumor masses, a morbidity rate of 20% or more, or weight loss.

[0381] The primary efficacy endpoints were the median survival time (MST) per day, the percent increased life span (%ILS), and the long-term survival rate.

[0382] The individual death days (if any) of each mouse were reported. The MST was determined for each group, the ratio ILS was calculated, and expressed as a percentage: %ILS = 100×(T - C) / C where T = the MST of the treatment group and C = the MST of the control group.

[0383] The dose is considered to be therapeutically active if the %ILS is better than 25% and very active if the %ILS is better than 50% (Johnson JI et al. (2001), Br. J. Cancer, 84(10):1424 - 31).

[0384] The long-term survival rate is defined as the number of mice having a survival period more than twice the MST of the control group relative to the total number of mice in the group expressed as a percentage.

[0385] Results The results are shown in Figure 21 and Table 11.

[0386] The surrogate muNKp46-huBCMA Fc WT NKCE did not induce statistically significant activity at doses of 5, 0.5, and 0.05 mg / kg in the EL4-huBCMA disseminated model (compared to the control NKCE group). In contrast, the surrogate muNKp46-huBCMA Fc ADE NKCE induced statistically significant activity at doses of 5 mg / kg and 0.5 mg / kg, and the ILS was over 100% and 90% of long-term survivors. The lower dose of 0.05 mg / kg did not induce statistically significant activity.

[0387] In conclusion, the muNKp46-huBCMA Fc ADE surrogate NKCE showed better activity than the WT Fc surrogate in a dose-dependent manner.

[0388]

Table 11

[0389] Example 11: Chemical Stability / Integrity of the Disulfide Bond R292C_V302C in the NKp46-BCMA CODV-OL1 Molecule under Reducing Conditions Introduction Manipulation of the disulfide bond (DSB) on the Fc CH2 domain enhances stability. See U.S. Provisional Patent Application No. 63 / 193,665, which is hereby incorporated by reference in its entirety. To ensure that the engineered DSBs, R292C_V302C and ADE mutations (G236A / S239D / I332E) in the NKp46-BCMA CODV-OL1 molecule do not abnormally affect the DSB reduction behavior, the reduction rate was measured by DTT and subsequent tryptic peptide mapping.

[0390] Materials and Methods Reduction Sensitivity Assay Serial dilutions of DTT were performed in PBS-E (final DTT concentrations in the assay: 20, 10, 5, 2, 1, 0.5, 0.2, and 0.1 mM). Protein batches FF-20-819-1, FF-20-821-1, and FF-21-170-5 were dialyzed into PBS-E buffer using spin desalting columns to obtain a pH of 7.2 during reduction. Protein samples were normalized to 1.5 mg / mL in PBS-E. Aliquots of the normalized samples were added to portions of each DTT dilution in a PCR plate and mixed after addition. This process was carried out from the lowest to the highest DTT concentration within 1 minute. Reduction was performed by incubating at 25 °C for 10 minutes on a Thermostat C Thermoblock. The reaction was quenched by adding 3 aliquots of NEM stock solution to all wells. To ensure assay consistency, NEM addition was carried out from the lowest to the highest DTT concentration within 1 minute and mixed after addition. The prepared plates were stored at room temperature until measurement by capillary gel electrophoresis (cGE) and mass spectrometry (peptide mapping). Tables 12 and 13 below contain lists of reagents and materials for the reduction susceptibility assay and capillary gel electrophoresis, respectively.

[0391] [Table 12]

[0392] [Table 13]

[0393] After performing the reduction susceptibility assay, samples were measured using the non-reducing protocol of the Protein Clear HR assay according to the manufacturer's instructions.

[0394] To prepare the chip, all assay components were equilibrated to room temperature. The Protein Clear HR Gel matrix was mixed with the Protein Clear HR Dye solution, filtered, and added to the chip wells rinsed according to the manufacturer's instructions.

[0395] The provided assay control VeriMAb standard was diluted with non-reducing sample buffer, denatured at 70 °C for 10 minutes, mixed with water according to the manufacturer's instructions, and loaded into a LabChip GXII Touch instrument for assay calibration. After diluting the Protein Clear HR Ladder 1:10 in water, the indicated volume of ladder solution and Protein Clear HR Wash buffer were transferred to the corresponding tubes and loaded into a LabChip GXII Touch instrument. The calibration process was successfully completed before measuring the samples.

[0396] To prepare the samples, 5 μL of each sample from the reduction-sensitive assay was added to 18 μL of non-reducing sample buffer in a PCR plate, which was sealed and the samples were denatured at 70 °C for 10 minutes on a Thermostat C Thermoblock. After denaturation, the samples were diluted with 35 μL of water. The prepared assay plates were stored at room temperature until measured with a LabChip GXII Touch instrument.

[0397] After measurement, the data were analyzed using LabChip Reviewer Software. All peaks with a relative peak area of 0.85% or more were integrated. The relative peak area [%] of the remaining intact molecules was plotted against the DTT concentration and the curve was fitted by a four-parameter logistic model / sigmoid dose-response model (Xlfit, one-site dose response, model 205). The area of the sample without added DTT was used for normalization and set to 100%. The DTT concentration of each sample at which 50% of the intact molecules remained was used as the EC50 value to evaluate the sensitivity of the molecule to reduction.

[0398] Antibody sample preparation after reduction assay for tryptic peptide mapping experiments After performing the reduction susceptibility assay, the sample was subjected to a digestion procedure. 100 μg per antibody sample was denatured by buffer exchange with a 0.5 mL Zeba Spin Desalting Column (Thermo Fisher Scientific, catalog number 89883) using 0.2 mol / L histidine chloride, 5.6 mmol / L guanidinium hydrochloride pH 6. The buffer exchange was repeated once to ensure complete removal of NEM. The sample was then reduced by adding 10 mmol / L TCEP (tris(2-carboxyethyl)phosphine, Thermo Fisher Scientific, catalog number T2556) at 37 °C for 1 hour. Subsequently, the buffer was exchanged to 20 mmol / L histidine chloride, 0.5 mmol / L TCEP, pH 6 with a 0.5 mL Zeba Spin Desalting Columns (Thermo Fisher Scientific, catalog number 89883). The antibody was digested with trypsin at 37 °C overnight at an enzyme-to-substrate ratio of 1:20. The digestion was stopped by adding 7 μL of 10% formic acid solution, and the sample was frozen at -80 °C until further analysis.

[0399] Detection of Modified Peptides by Liquid Chromatography Tandem Mass Spectrometry The peptides were analyzed using a Vanquish(™) Flex UHPLC system coupled to an orbitrap Fusion(™) Lumos(™) Tribrid(™) mass spectrometer equipped with an EASY-ETD ion source (Thermo Fisher Scientific, San Jose, CA, USA). For peptide separation, a two-component solvent system was used: (A) 0.1% formic acid and (B) 90% acetonitrile, 0.1% formic acid. 2 μg of the trypsin-digested sample was separated for 50 minutes with a 1-hour gradient using linearly increasing concentrations of solvent B, followed by washing with 95% B for 5 minutes and re-equilibrating with 5% solvent B for 5 minutes on a Hypersil GOLDTM C18 LC column (150 mm × 2.1 mm, particle size 1.9 μm, Thermo Fisher Scientific, catalog number 25003-152130-V). Peptides separated on the column were detected with the following important settings: the mass range was set to 375 - 2000, the target of the automatic gain control (AGC) was 4.0e5, the maximum injection time was 50 ms, and a full MS spectrum was acquired with a resolution of 120,000 (defined at 200 m / z) using a 1 μ scan. After accumulating a 5.0e4 AGC target within a 200 ms injection time, data-dependent (MS / MS) spectra were acquired in the top 5 data-dependent mode using a resolution of 15,000 (defined at 200 m / z). Ions were isolated with a 1.6 Th isolation window and fragmented using HCD, EthcD, or EtciD with 30% normalized collision energy. Dynamic exclusion was set to 10 seconds.

[0400] Data processing The acquired MS data was processed using Expressionist software (GeneData version 13.5) and inspected manually to ensure accurate assignment and relative quantification accuracy. The mass spectra were searched against the amino acid sequences of the sample molecules. The important settings were the mass tolerances of the MS and MS / MS spectra, which were set to 10 ppm each. The post-translational modifications considered within the search parameters were the NEM modification for cysteine and the general N-terminal glycosylation using the IgG N-glycan library from Expressionist.

[0401] Results The EC50 value was calculated from the dose-response curve as shown in Fig. 22. The decrease in the main peak of the non-reduced sample by DTT measured by capillary electrophoresis (cGE) was the same for CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB, indicating that neither the ADE mutation in the CH2 domain nor the engineered disulfide bonds affected the protein's reduction sensitivity.

[0402] The proteins from the reduction sensitivity assay analyzed by peptide mapping, CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB, showed similar reduction behavior of the reduction-sensitive intermolecular disulfide bonds (DSBs) as shown in Fig. 23A (CODV-OL1 wt), Fig. 23B (CODV-OL1 ADE), and Fig. 23C (CODV-OL1 ADE-DSB). Based on the dose-response curve, the EC50 value was estimated to be in the range of 1.2 - 1.5 mM of DTT for the three proteins, indicating that the engineered DSBs have the same reduction stability as typical intermolecular DSBs.

[0403] CODV-OL1 wt, CODV-OL1 ADE, and CODV-OL1 ADE-DSB - expression yields Antibodies were prepared as follows: Expression plasmids encoding different strands of the corresponding construct were grown in E. coli DH5α. The plasmids used for transfection were prepared from E. coli using the EndoFree Plasmid Mega Kit (Qiagen). HEK 293-FS cells growing in F17 serum-free suspension culture (Invitrogen) were transfected with the indicated plasmids using polyethyleneimine transfection reagent. After culturing at 37 °C with 8% CO₂ for 6 days, the cells were removed by centrifugation and the supernatant was passed through a 0.22 μm filter to remove particles. The protein was captured with MabSelect SuRe (Cytiva), eluted with 0.1 M citrate buffer pH 3.0, and neutralized with 1 M Tris pH 9. After polishing the protein by size exclusion chromatography (SEC) using Superdex 200 26 / 60 (Cytiva), 0.22 μm filtration, and UV280 concentration determination, the protein was used for further characterization. The yields are reported in Table 14 below.

[0404]

Table 14

[0405] Antibodies with a normal IgG1 Fc backbone demonstrated a sample yield of 25.2 mg / L, while antibodies with ADE or DE mutations in the Fc backbone showed a strong decrease of less than 5 mg / L in sample yield. Antibodies with IgG1 Fc having ADE or DE mutations and disulfide bonds demonstrated a sample yield similar to that of the WT.

[0406] Example 12: In Vitro Cytokine Release in PBMCs in Co-Culture of BCMA-Positive RPMI 8226 MM Tumor Cells with NKp46-BCMA_Fc-ADE-DSB Materials and Methods In Vitro Safety Procedure of IncuCyte S3 (PBMC + MM 1R-RFP, Effector:Target Ratio = 3:1) One day after PBMC purification, both PBMC and MM1R-RFP were counted using Vi-Cell XR (Beckman Coulter, Brea).

[0407] Target cells: The MM1R cell line was purchased from ATCC / Northwestern University BDW and transfected with Incucyte Nuclight Red lentivirus (EssenBiosciences, reference number 4476) to express mKate2 Red Fluorescent Protein (RFP) which can be tracked over several days using an Incucyte incubator. Selection of MM1R-RFP cells was obtained by the addition of puromycin dihydrochloride hydrate (Thermo Scientific, Denmark, reference number 10781691) at a final concentration of 1 μg / ml in the culture medium [RPMI medium 1640 (1x) (GIBCO, Denmark, reference number 31870-025) containing 20% fetal bovine serum heat-inactivated FBS (Biowest, reference number S140H-100) and 1% L-glutamine 200 mM (100x) (Denmark, GIBCO, reference number 25030-024)].

[0408] Since MM1R-RFP are semi-adherent cells, the culture medium was removed and placed in a 50 ml Falcon tube with 5 ml of 1x PBS used to wash the Nunc EasY flask 75 cm 2 (Thermo Scientific, Denmark). The remaining adherent cells were detached by adding 1 ml / 75 cm 2 flask of Accutase Cell Detachment Solution (Corning, reference number 25-058-CI). The action of Accutase was stopped after 5 minutes at 37 °C with 9 ml of culture medium (RPMI + 20% FBS, final volume 10 ml), and MM1R-RFP cells were counted in Vi-Cell XR. An appropriate number of cells were prepared and seeded at a density of 30,000 cells / well (50 μl / well) to have a 3:1 E:T ratio.

[0409] Antibodies: All Abs were prepared by concentrating them 2-fold in RPMI culture medium (because 50 μl of target cells + 100 μl of Ab 2X + 50 μl of PBMC were added to each well). The antibodies used in the experiment were diluted 1 / 100-fold with the medium in a Deepwell plate (Axigen, reference number P-DW-11-C-S). The starting concentration of all Abs, except for the CD3-BCMA T cell engager, which had an initial concentration of 100 nM (about 200 nM), was 1000 nM (about 2000 nM was calculated), and three dilutions were performed.

[0410] Effector cells: Total PBMCs were prepared at a density of 300,000 cells / well (50 μl / well) (E:T ratio 3:1). After counting, the required number of PBMCs were centrifuged at 300 g for 5 minutes (acceleration = 9, brake = 9) and resuspended in an appropriate volume of RPMI culture medium containing human IgG (Sigma-Aldrich, reference number I4506) at a concentration of 4 mg / ml to a final concentration of 1 mg / ml with a final volume / well of 200 μl: [50 μl of MM1 R-RFP + 100 μl of antibody (2-fold) + 50 μl of PBMC].

[0411] The cells were seeded into a 96-well plate with poly D (Greiner bio-one, reference number 655946), and the outer wells were filled with 200 μl of 1X PBS.

[0412] After seeding tumor cells (50 μl / well) + Ab (100 μl / well) + PBMC (50 μl / well), the plate was centrifuged at 100 g for 1 minute at room temperature and placed in an incubator of IncuCyte S3 (Essen BioScience), but the plate was read only after at least 30 minutes to avoid temperature differences.

[0413] The plate on IncuCyte S3 was read using the following parameters: analysis type (Basic Analyzer), RED, objective lens 10X, 4 images / well, time point 48 hours (images every 4 hours), acquisition time 400 ms.

[0414] After 48 hours, the Incucyte scanner was stopped, and the plates were centrifuged at 300 g for 5 minutes. Then, 100 μl of supernatant / well was collected for cytokine release analysis using the Human Proinflammatory I (4-Plex) Kit V-Plex.

[0415] Procedure for cytokine release analysis using the Human Proinflammatory I (4-Plex) Kit V-Plex For cytokine release analysis, the Human Proinflammatory I (4-Plex) Kit V-Plex was used (MSD, reference number K15052D-1).

[0416] First, a calibration range was prepared: The lyophilized tube was reconstituted with 1000 μl of Diluent 2 (Calibrator, reference number C0049-2) and left standing for 30 minutes. Seven serial dilutions of 1 / 4 were made with Diluent 2 (i.e., 75 μl of Cx + 225 μl of Diluent 2). The last tube n8 was considered the negative control (Diluent 2 alone = 0), while tube n1 was the starting solution without dilution.

[0417] Subsequently, samples were prepared with a 1 / 100 dilution for DART (i.e., 50 μl / well, prepared as 5 μl DART / concentration + 495 μl Diluent 2) and a 1 / 5 dilution (i.e., 50 μl / well, prepared as 100 μl Ab / concentration + 400 μl Diluent 2) for the other antibodies.

[0418] The secondary antibody was diluted in Diluent 3: 100 μl of IFNγ + 100 μl of IL1β + 100 μl of IL6 + 100 μl of TNFα + 4600 μl of Diluent 3 (final volume 5 ml), and then 25 μl of the secondary Ab mixture was dispensed into all wells.

[0419] Before adding the sample to the plate, the plate was washed three times with 150 μl of PBS 1X tween 0.05% (washing buffer prepared using 500 μl of Tween 20 in 1 L of PBS 1X). Subsequently, 50 μl / well of the diluted sample to be tested and 50 μl / well of the standard range were added. The plate was covered with film and left to stand for 2 hours while stirring at room temperature.

[0420] The plate was washed three times with 150 μl of washing buffer, 25 μl of secondary Ab was added to the sample (the plate was tapped for better distribution of the secondary Ab), the plate was covered with film again, and left to stand for 2 hours while stirring at room temperature. Three steps of washing with 150 μl of washing buffer were performed, and 150 μl of reading buffer (4-fold, prepared by 1 / 2 dilution in H2O) was added to all wells. The plate was read on an MSD device 1250.

[0421] Results As shown in FIGS. 24A and 24B, NKp46-BCMA_Fc-ADE-DSB mediated potent cytotoxicity against BCMA-expressing cells, but cytokine release from PBMCs in the co-culture was minimal. As shown in FIGS. 25A and 25B, NKp46-BCMA_Fc-ADE-DSB also mediated reduced MM1R tumor cell proliferation while inducing minimal cytokine release. The decrease in cytokine release in vitro indicates a favorable safety profile.

[0422] Example 13. In vitro characterization of NK cell activation and cytokine / chemokine production by resting NK cells in the presence of MM cells and the in vitro properties of NKCE. This example is directed towards characterizing the in vitro efficacy of NKp46-BCMA_Fc-ADE-DSB on NK cell activation and cytokine / chemokine production in the presence of a BCMA-positive cell line (RPMI 8226 multiple myeloma cells).

[0423] Materials and Methods Peripheral blood mononuclear cells: To isolate peripheral blood mononuclear cells (PBMCs), the buffy coat was diluted approximately 1 / 5 with RPMI and transferred to a Pancoll tube at room temperature. The tube was centrifuged at 800 g for 20 minutes without braking. The first cell wash was performed in RPMI using centrifugation at 400 g for 10 minutes at room temperature with braking. The second cell wash was performed in RPMI using centrifugation at 130 g for 10 minutes at room temperature with braking.

[0424] Collection of NK cells: Human NK cells were purified from PBMC samples by negative selection using manual magnetic labeling and subsequent manual separation by an LS column according to the protocol recommended by the supplier using an NK cell isolation kit (Miltenyi). Then, the NK cells were cultured in complete RPMI at 37 ± 1 °C, 5 ± 1% CO2 for approximately 24 hours at 1 × 10 6 cells / mL (so-called "resting" NK cells) prior to use in the activation assay.

[0425] The survival criteria for effector cells were set at 90% or higher. The cell surface expression of both CD16a and NKp46 on resting NK cells was monitored by flow cytometry on the day of the experiment.

[0426] NK cell activation assay The NKCE molecule was added to the wells of a U-bottom 96-well plate. 50,000 resting (e.g., non-activated) NK cells and 50,000 RPMI 8226 MM cells were successively added to each well to obtain a 1:1 effector:target (E:T) ratio. Control conditions were carried out by adding only 50,000 resting NK cells to each well. GolgiStop™ (BD Biosciences) solution was added to each well (control and experimental) at a final dilution of 1 / 1500 to block extracellular intracellular protein transport and accumulate cytokines in the Golgi complex. A positive control for NK cell activation was performed by using phorbol 12-myristate 13-acetate (PMA) at a final concentration of 125 ng / mL and ionomycin at a final concentration of 1 μg / mL added to 50,000 resting NK cells. Each condition was performed in triplicate.

[0427] After co-incubating at 37 ± 1 °C for 4 hours, the cells were stained by staining for extracellular markers (CD3, Cd56, CD69, CD107a and CD107b) for flow cytometry analysis. After the fixation and permeabilization steps, intracellular staining was performed for IFNγ, TNFα and MIP1β. The cells were fixed for 15 minutes after the last staining using Cytofix (BD Biosciences) and analyzed by flow cytometry using an LSR Fortessa™ X-20. The FSC-A, FSC-H, FSC-W, SSC-A, SSC-H, SSC-W, FL-1, FL-3, FL-6, FL-7, FL-9, FL-13 and FL-16 parameters were recorded with BD FACSDiva software and the analysis was performed with FlowJo software.

[0428] Analysis of the percentage of NK cell activation and the median fluorescence intensity (MedFI) of activation markers was performed using GraphPad Prism. The top value of activation corresponded to the maximum activation observed. The maximum half-maximal effective concentration (EC 50 ) value was calculated using a four-parameter logistic non-linear regression model corresponding to the following equation. [Number]

[0429] EC 50 Using the same model as, the calculated values at the bottom of activation, the top calculated value of activation, the slope, and the 95% confidence interval (CI) values were calculated.

[0430] Flow cytometry analysis of the purity and phenotype of resting NK cells and target cells The resting NK cells used in the NK cell activation experiment were analyzed for purity, expression of CD16a, and NKp46. RPMI 8226 MM cells were analyzed for expression of CD32 and BCMA.

[0431] On the day of the experiment, resting NK cells and target cells were stained. 1×10 5 Cells / well were stained in a U-bottom 96-well plate using antibodies conjugated to dyes (allophycocyanin, Pacific Blue, or phycoerythrin).

[0432] Results; NK cell activation was evaluated as follows: 1) expression of activation markers (CD69 and CD107a / b) on the cell surface, and 2) intracellular production of cytokines (IFNγ, TNFα) and chemokines (MIP1β). Seven NK cell donors were evaluated in the study.

[0433] As shown in Figures 26A - 26D, in the absence of RPMI 8226 MM cells, the positive control PMA-ionomycin activated NK cells by inducing the expression of CD69 and CD107a / b. In contrast, NKp46-BCMA_Fc-ADE-DSB and control NKCE induced non-sigmoid dose-response activation from 4.88 ng / mL and reached a maximum concentration (4.88 μg / mL) of approximately 40% of CD69-positive cells (CD69 MedFI around 150) and 14% of CD107-positive cells (CD107 MedFI around 90).

[0434] In the presence of RPMI 8226 MM cells, NK cells were not activated in the absence of the molecule. The addition of control NKCE induced a low level of NK cell activation, similar to the activation obtained in the absence of target cells. The addition of NKp46-BCMA_Fc-ADE-DSB induced a sigmoid dose response for NK cell activation that was higher than the activation obtained with control NKCE. More precisely, a saturation phase was observed for NKp46-BCMA_Fc-ADE-DSB at approximately 48.8 ng / mL for CD69 expression (approximately 60% of positive cells and 351 MedFI on NK cells) and CD107a / b expression (approximately 22% of positive cells and 132 MedFI on NK cells) (Table 15).

[0435]

Table 15

[0436] Since a saturation phase and a sigmoid dose response were obtained for NKp46-BCMA_Fc-ADE-DSB for CD69 expression, EC 50 was extracted from 7 selected donors (Table 16). Considering the production levels of CD107a / b (less than approximately 20% of positive cells for 3 out of 7 donors), EC 50 was not estimated for the CD107a / b activation marker.

[0437]

Table 16

[0438] Secretion of IFNγ, TNFα, and MIP1β by NK cells In the same experiment, the production of intracellular cytokines (IFNγ and TNFα) and chemokine MIP1β by NK cells was measured. The release of TNFα, IFNγ, and MIP1β was proportional to NK cell activation: higher NK cell activation led to higher cytokine / chemokine production (Figures 27A - 27F).

[0439] In the absence of RPMI 8226 MM cells and NKp46-BCMA_Fc-ADE-DSB, detectable TNFα and IFNγ were not produced by NK cells, while MIP1β was produced by approximately 80% of NK cells. Addition of the positive control (PMA-ionomycin) induced production of TNFα (approximately 84% for D584) and IFNγ (approximately 83% for D584) by NK cells and increased MIP1β (approximately 100% for D584). In contrast, addition of NKp46-BCMA_Fc-ADE-DSB induced very low target-dependent expression of IFNγ and TNFα in a dose-dependent manner, with a maximum value of activation observed in less than 20% of positive cells (8 ± 5% for IFNγ and 12 ± 7% for TNFα). MIP1β was produced by NK cells at 4.88 ng / mL and reached approximately 95% of positive cells (approximately 5400 MIP1β MedFI on NK cells) in the dose response of the two molecules.

[0440] The results showed that the presence of RPMI 8226 MM cells alone was not sufficient to induce cytokine secretion by NK cells in the absence of NKCE molecules. Addition of high concentrations of control NKCE molecules induced low or very low production of cytokines by NK cells and high production of MIP1β with a sigmoid dose response. Addition of NKp46-BCMA_Fc-ADE-DSB induced cytokine and chemokine production. For the three cytokines / chemokines, the maximum levels of production were achieved at concentrations in the range of 4.88 - 48.8 ng / mL of NKp46-BCMA_Fc-ADE-DSB depending on the donor. For the 7 donors tested, the percentage of NK cells producing TNFα or IFNγ was approximately 12 ± 7 (TNFα MedFI on NK cells: 39 ± 7) and 8 ± 5 (IFNγ MedFI on NK cells: 137 ± 30), respectively, and the percentage of NK cells producing MIP1β was approximately 94 ± 2 (MIPβ MedFI on NK cells: 10145 ± 4416) at the highest NKp46-BCMA_Fc-ADE-DSB concentration (Table 17).

[0441] Since saturation phase and sigmoid dose responses were obtained for TNFα, IFNγ and MIP1β production with respect to NKp46 - BCMA_Fc - ADE - DSB, the top values of activation (TNFα, IFNγ and MIP1β) and EC 50 were observed for MIP1β from 7 test donors. Considering the levels of TNFα and IFNγ production (less than 20% of positive cells), EC 50 was not estimated for these two cytokines (Table 18).

[0442]

Table 17

[0443]

Table 18

[0444] Example 14: In Vitro Cytokine Release Assay of NKp46 - BCMA_Fc - ADE - DSB Using Co - Cultured Human Donor Whole Blood Cells and RPMI (Multiple Myeloma) Cell Lines Introduction To evaluate the variability / range of responses observed in this assay, whole blood cells from 11 human donors were co-cultured with RPMI-8226-RFP cells treated with either NKp46-BCMA_Fc-ADE-DSB or a negative or positive control. The co-cultures were incubated overnight at 37 °C with 1, 10, 100 and 300 μg / mL of NKp46-BCMA_Fc-ADE-DSB prepared from two different batches (CER or GMP) or a negative or positive control detailed in the Materials and Methods section below. Treatment control groups included two negative controls (untreated co-culture and co-culture treated with isotype control 300 μg / mL) and three positive controls: human anti-CD3 / CD28 T cell activator (25 μg / mL; ImmunoCult™), anti-CD52 recombinant antibody (alemtuzumab 100 μg / mL; Campath-1H®), and an internal BCMA T cell engager tool compound (TCE-BCMA 100 μg / mL).

[0445] Materials and Methods The RPMI 8226 cell line was obtained from ATCC (American Type Culture Collection, USA) and transfected with red fluorescent protein (RFP). These modified RPMI 8226-RFP cells were cultured in RPMI 1640 medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) and 1% penicillin-streptomycin (10,000 U / mL, Thermo Fisher Scientific, Inc.) at +37 °C in a humidified atmosphere of 5% CO2.

[0446] On the day of the cytokine release assay, cells were counted and viability was assessed using a Cellometer (Nexelcom, Lawrence, MA, USA). RPMI-8226-RFP cells were adjusted to a concentration of 800,000 cells / mL, and 25 μL of cells were seeded per well at a final density of 20,000 cells / well in a 96-well tissue culture plate (Thermo Fisher Scientific, Inc.).

[0447] NKp46-BCMA_Fc-ADE-DSB and the control were dissolved in RPMI 1640 medium, GlutaMax (Thermo Fisher Scientific, Inc.) supplemented with 10% w / v fetal bovine serum and 1% penicillin-streptomycin (10,000 U / mL). 25 μL of NKp46-BCMA_Fc-ADE-DSB and the control were added in triplicate per well. The negative controls were medium only and an isotype control at a final concentration of 300 μg / mL. Positive controls with each concentration are listed above and are also labeled in Figures 28 - 32.

[0448] Whole blood from 11 consented donors was venipunctured into 10 mL vacutainer tubes containing sodium-heparin anticoagulant. The samples were gently mixed and maintained at ambient conditions until the start of the study. After adding RPMI-8226-RFP cells to either NKp46-BCMA_Fc-ADE-DSB or the treatment control group, fresh whole blood samples (200 μL) from the donors were added to the wells, and the plates were incubated at +37°C in a humidified atmosphere of 5% CO2 for 24 hours.

[0449] At the end of the incubation period, the plates were centrifuged at 500 × g for 10 minutes. Plasma was collected from these plates and then transferred directly to a new 96-well cell culture plate and then centrifuged at 2000 × g for 10 minutes to remove remaining cell debris. The final plasma samples were transferred to new 96-well culture plates and used for immediate assessment of cytokine levels.

[0450] According to the manufacturer's instructions (Mesoscale Discovery, Rockville, Maryland, USA), plasma samples were evaluated for the levels of granulocyte-macrophage colony-stimulating factor (GM-CSF; quantification range 0.33 - 10,200 pg / mL), interferon gamma (IFN-γ; quantification range 9.45 - 27,000 pg / mL), interleukin-1 beta (IL-1β; quantification range 0.35 - 4430 pg / mL), interleukin-2 (IL-2; quantification range 1.24 - 1990 pg / mL), interleukin-4 (IL-4; quantification range 0.16 - 1,780 pg / mL), interleukin-6 (IL-6; quantification range 0.89 - 2,050 pg / mL), interleukin-8 (IL-8; quantification range 0.35 - 2,180 pg / mL), interleukin-10 (IL-10; quantification range 0.35 - 3,770 pg / mL), macrophage inflammatory protein 1 alpha (MIP-1α; quantification range 14.5 - 5,580 pg / mL) and tumor necrosis factor alpha (TNF-α; quantification range 0.66 - 2,940 pg / mL) using the MSD U-PLEX assay (catalog number K15067L-2; Lot number 404471).

[0451] Cytokine levels were defined using a calibration curve for each cytokine by fitting the signal from the calibration standards with a weighting of 1 / Y 2 to a 4-parameter logistic or sigmoid dose response model. Calculations to determine cytokine concentrations were performed using MSD DISCOVERY WORKBENCH analysis version 4.0 (Mesoscale Discovery, Rockville, Maryland, USA), and concentrations were expressed in units of pg / mL.

[0452] Cytokine data (triplicates) were analyzed, and the coefficient of variation (%CV) between the triplicates was calculated using GraphPad Prism software, version 9.1.2 (GraphPad Software, San Diego, CA, USA). A sigmoid dose-response four-parameter variable slope calculation with the bottom constraint set to 0 was used for the analysis. Samples with technical errors and no detection were reported as undetected (UD). Samples with concentrations below the lower limit of quantification (LLOQ) were reported as LLOQ, and this value was used for all calculations. Samples with concentrations above the upper limit of quantification (ULOQ) were reported as the extrapolated value obtained, and this value was used for all calculations. The fold change in cytokine levels was calculated for each treated sample compared to the negative control (untreated co-cultures) [overall mean (with SD) and median (Q1 and Q3: first and third quartiles)].

[0453] Results As shown in Figures 28 - 32, the positive controls, anti-CD3 / CD28 and TCE-BCMA, demonstrated a strong increase in cytokine release for IFN-γ (Figure 28A), MIP-1α (Figure 28B), TNF-α (Figure 29A), IL-1β (Figure 29B), IL-6 (Figure 30A), IL-8 (Figure 30B), IL-2 (Figure 31A), GM-CSF (Figure 31B), IL-4 (Figure 32A) and IL-10 (Figure 32B) when compared to the negative controls (untreated and isotype controls). The positive control, anti-CD52, induced cytokine release of IFN-γ (Figure 28A), IL-6 (Figure 30A), MIP-1α (Figure 28B), IL-1β (Figure 29B) and IL-8 (Figure 30B), but did not induce cytokines typically associated with T cell responses such as IL-2 (Figure 28A), IL-10 (Figure 31A), GM-CSF (Figure 31B) or IL-4 (Figure 32A). Notably, NKp46-BCMA_Fc-ADE-DSB induced the secretion of only IFN-γ (Figure 28A) and MIP-1α (Figure 28B), and no changes were reported for all other cytokines evaluated.

[0454] When compared to untreated whole blood and RPMI 8226-RFP co-cultures (negative controls), there was a clear NKp46-BCMA_Fc-ADE-DSB-related increase in IFN-γ and MIP-1α across all donors at all tested concentrations (1, 10, 100, and 300 μg / mL). IFN-γ levels (Figure 28A) in samples incubated with NKp46-BCMA_Fc-ADE-DSB were higher (3 - 6-fold) than the negative control but significantly lower than the positive control at all tested concentrations. There was no NKp46-BCMA_Fc-ADE-DSB-related concentration dependence for the increase in IFN-γ, and the levels were comparable to the isotype control, suggesting that IFN-γ secretion is not related to BCMA binding activity but rather is involved in NK cell engagement by NKp46-BCMA_Fc-ADE-DSB. NKp46-BCMA_Fc-ADE-DSB-induced MIP-1α (Figure 28B) levels were slightly higher (1 - 3-fold) than the negative control but significantly lower than the positive control. There were no differences in cytokine release profiles between the two NKp46-BCMA_Fc-ADE-DSB batches (CER and GMP) tested.

[0455] Collectively, the results indicate that the risk of CRS for NKp46-BCMA_Fc-ADE-DSB in humans is considered low. These results also support the results from the in vitro cytokine release assay (PBMC) shown in Example 12 and support the conclusion that NKp46-BCMA_Fc-ADE-DSB has a favorable safety profile.

[0456] Example 15: Analysis of NK Cell Activation and MM Cell Lysis in Response to NKp46 Bispecific Antibody Introduction This example evaluated the ability of NKp46-BCMA_Fc-ADE-DSB to activate NK cells from MM peripheral blood and induce MM cell death. Karpas 620 MM as target cells was co-incubated with PBMC from MM patients (n = 13, Table 18) as effector cells at an E:T ratio of 10:1 in the presence of increasing concentrations of NKp46-BCMA_Fc-ADE-DSB, isotype control antibody (10 mg / ml), or daratumumab (10 mg / ml).

[0457] For this purpose, NKp46-BCMA_Fc-ADE-DSB was used to treat Karpas 620 MM cells (N = 2) or relapsed MM cases (N = 11) that had been co-incubated with PBMC from MM patients at the time of MM diagnosis. Samples were analyzed by flow cytometry for MM cell death due to loss of CD138 expression. In parallel, activation of NK cells (CD3 - CD56 dim ) was evaluated by CD107a and IFNγ expression.

[0458] Materials and Methods (1) Cell purification and co-culture conditions. One day before the MM cell lysis assay, PBMC from MM patients isolated after density gradient centrifugation were immediately stained with CD3-PE and CD56-APC, and the results were analyzed using flow cytometry before NK activation to determine the proportion of CD3- / CD56+ cells. If NK cells represented more than 5% of lymphocytes, PBMC were maintained overnight at 37 °C and 5% CO2 in culture medium containing 10% FCS (FCS from Nature Pharm for preserving NK cells). Resting PBMC and MM target cell lines at a ratio of 10:1 were co-cultured for 4 hours in the presence of the molecule being tested. Then, (i) the expression of the activation marker (CD107a) on NK cells and the intracellular production of the cytokine (IFNγ), and (ii) MM cell death (CD138) were analyzed by flow cytometry.

[0459] (2) Cell preparation, treatment, and control group conditions. 300,000 PBMCs and 30,000 MM target cells (Karpas 620) were collected and counted into each well of a U-bottom 96-well plate to obtain an effector:target (E:T) cell ratio of 10:1. 400,000 PBMCs were kept in an incubator for minimal phenotypic examination of the patient's NK cells (CD56, CD3, CD16, NKp46). The cells were centrifuged at 300 g for 5 minutes, resuspended in medium containing BD GolgiSTOP™ solution (1 / 6000), and dispensed with 300,000 PBMCs and 30,000 MM cells per well. The control conditions were as follows: The negative control was Karpas 620, PBMCs, and Karpas 620 + PBMCs without treatment. The positive control for NK activation was PBMCs treated with 125 ng / ml of phorbol 12 myristate 13 acetate (PMA, Sigma, cat. no. P8139) and 1 mg / ml of ionomycin (Sigma, cat. no. I0634). The treatment group had an isotype control (10 mg / ml) and NKp46-BCMA_Fc-ADE-DSB (10 mg / ml) added to the co-culture samples at 37 ± 1 °C and 5 ± 1% CO2 for 4 hours. Before adding the treatment, the antibody was centrifuged at 16,000 × g for 10 minutes at +4 °C to remove potential aggregates.

[0460] (3) Staining and flow cytometry analysis. After 4-hour co-incubation at 37 ± 1 °C and 5 ± 1% CO2, cells were stained extracellularly or intracellularly for flow cytometry analysis. (3a) Extracellular staining. Cells were transferred to a V-bottom plate, centrifuged at 1900×g for 1 minute, and the supernatant was discarded. Cells were washed with 200 μl of PBS, centrifuged again at 1900×g for 1 minute, and the supernatant was discarded. 50 μl of BD Pharmingen Stain Buffer BSA / Brilliant Stain buffer plus antibody master mix was added to each sample. Antibodies used for NK activation and MM cell death analysis are shown in Table 19 below. Then, the cells were incubated in the dark at 4 °C for 20 minutes. Finally, the cells were washed with 200 μl of staining buffer, centrifuged at 1900 g for 1 minute, and the supernatant was discarded (twice). (3b) Intracellular staining. Cells were resuspended in 100 ml of BD Cytofix / Cytoperm and incubated in the dark at 4 °C for 20 minutes. Cells were washed twice with 200 μl of 1×BD Perm / Wash buffer (10×BD Perm / Wash buffer in distilled H2O), centrifuged at 1900 g for 1 minute, and the supernatant was discarded. Cells were resuspended in 50 μl of antibody master mix + BD Perm / Wash buffer and incubated in the dark at 4 °C for 30 minutes. Then, the cells were washed twice with 200 μl of BD Perm / Wash buffer, centrifuged at 1900 g for 1 minute, and the supernatant was discarded. Finally, the cells were resuspended in 200 μl of staining buffer and flow cytometry analysis was performed. Before acquisition, UltraComp eBeads (Invitrogen) were stained with each antibody fluorophore to set appropriate fluorescence compensation controls. Results were analyzed using BD FACSymphony A5 and BD FACSDiva software. Analysis was performed using FlowJo software.

[0461] [Table 19]

[0462] Results Karpas 620 MM cell death induced by NKp46-BCMA_Fc-ADE-DSB was first analyzed by measuring the loss of CD138 expression by flow cytometry. NKp46-BCMA_Fc-ADE-DSB demonstrated induction of Karpas 620 MM cell death when co-cultured with PBMCs from 10 out of 13 MM patients, regardless of the disease stage. As expected, the isotype control did not induce MM cell death. Interestingly, MM cell death induced by 10 mg / ml of NKp46-BCMA_Fc-ADE-DSB was significant (p = 0.0105, Figure 33A).

[0463] In parallel, the ability of NKp46-BCMA_Fc-ADE-DSB to induce NK cell activation was evaluated by measuring IFNg and CD107a expression on NK cells (Figures 33B and 33C). Expression of IFNg and CD107a was induced more specifically in response to NKp46-BCMA_Fc-ADE-DSB compared to the isotype control. dim

[0464] Collectively, these results indicate that NKp46-BCMA_Fc-ADE-DSB has therapeutic potential for treating patients with primary or refractory MM.

[0465] Example 16. Ex vivo functional activity of NKp46-BCMA_Fc-ADE-DSB against MM patient samples This example evaluates the ability of NKp46-BCMA_Fc-ADE-DSB to induce MM cell death using primary samples from MM patients. Cell death was determined by the reduction of CD138 + MM cells.

[0466] Materials and methods (1) Cell purification and co-culture conditions. On the day of the MM cell death assay, bone marrow mononuclear cells (BMMCs) from MM patients were isolated by density gradient centrifugation using Ficoll-Hypaque and immediately stained with anti-CD138-PE monoclonal antibody, and MM cells (CD138 +Flow cytometry was used to analyze to determine the percentage of (cells). BMMCs or PBMCs were incubated for 18 hours in the presence of a negative control or SAR445514 or daratumumab.

[0467] (2) Cell preparation, treatment, and control group conditions. 400,000 BMMCs were seeded into each well of a U-bottom 96-well plate in RPMI containing 5% FCS and 3 ng / ml of recombinant human IL-6. 600,000 PBMCs were kept in an incubator for minimal phenotypic examination of patient NK cells (CD56, CD3, CD16, NKp46) and to determine BCMA expression on MM cells. Control conditions were as follows: The negative control was BMMCs or PBMCs without treatment. The treatment groups had an isotype control (10 μg / ml), NKp46-BCMA_Fc-ADE-DSB (10 μg / ml) added to the samples at 37 ± 1 °C and 5 ± 1% CO2 for 18 hours. Prior to adding the treatment, the antibody was centrifuged at 16,000 × g for 10 minutes at +4 °C to remove potential aggregates.

[0468] (3) Staining and flow cytometry analysis. After 18-hour co-incubation at 37 ± 1 °C and 5 ± 1% CO2, cells were extracellularly stained for flow cytometry analysis. (3a) Cells were transferred to a V-bottom plate and centrifuged at 1900×g for 1 minute. The supernatant was discarded, and the cells were washed with 200 μl of PBS and centrifuged again at 1900×g for 1 minute. The supernatant was discarded. 50 μl of BD Pharmingen Stain Buffer BSA / Brilliant Stain buffer plus antibody master mix was added to each sample and incubated at 4 °C for 30 minutes in the dark. The cells were washed with 200 μl of BD Pharmingen Stain Buffer BSA, centrifuged at 1900 g for 1 minute, and the supernatant was discarded. This was repeated a second time. The cells were resuspended in 50 μl of 1% paraformaldehyde in PBS and incubated at 4 °C for 15 minutes in the dark. Then, the cells were washed once in 200 μL of BD Pharmingen Stain Buffer BSA and resuspended in 200 μL of BD Pharmingen Stain Buffer BSA for flow cytometry analysis.

[0469] Before sample acquisition, UltraComp eBeads (Invitrogen) were stained with each antibody fluorophore to set appropriate fluorescence compensation controls. Samples and eBeads were acquired using a BD FACSymphony A5 equipped with BD FACSDiva software. Analysis was performed using FlowJo software.

[0470] NK cell activation was evaluated by CD3- / CD56 dim expression of CD16, CD107a, and CD69 on NK cells. Myeloma cell death was evaluated by CD138 + disappearance of cells.

[0471]

Table 20

[0472]

Table 21

[0473]

Table 22

[0474] Result The ex vivo activity of NKp46 - BCMA was tested against MM patient samples (N = 16). For this purpose, BMMCs or PBMCs derived from multiple myeloma patients were left untreated, treated with 10 mg / ml NKp46 - BCMA_Fc - ADE - DSB, or treated with 10 μg / mL of isotype control for 18 hours. MM cell death was measured by loss of CD138 expression using flow cytometry. Figures 16A - 16C show the results of comparing ex vivo NKp46 = BCMA_Fc - ADE - DSB NKCE treatment in samples from treatment - naive patients to those who had received prior standard treatment or were included in clinical trials. Patient samples were more responsive to NKp46 - BCMA_Fc - ADE - DSB treatment when treatment - naive to daratumumab (Figure 16A), and slightly less likely to respond when patients had multiple relapses (Figure 16B). Figure 16C shows that samples were less responsive to NKp46 - BCMA_Fc - ADE - DSB after >4 TC relapses.

[0475] These data demonstrate that NKp46 - BCMA_Fc - ADE - DSB NKCE induces MM cell death in samples from MM patients at different stages of the disease (diagnosis or relapse).

[0476] Example 17. Pharmacokinetics (PK) and safety study after repeated subcutaneous administration in cynomolgus monkeys Methods and Materials A stock solution of NKp46 - BCMA_Fc - ADE - DSB was provided at a concentration of 50 mg / mL in 10 mM histidine, pH 5.5, 8% sucrose, 0.05% PS80 and 10 μM EDTA.

[0477] Dosage level and administration: Non-human primates (NHP) cynomolgus monkeys (Macaca fascicularis) of both sexes (male and female) were administered NKp46-BCMA_Fc-ADE-DSB subcutaneously (SC, dorsal region) at 1 mL / kg once a week (on days 1, 8, and 15) for 3 weeks.

[0478]

Table 23

[0479] Samples collected: Plasma was collected for pharmacokinetic (PK) and cytokine evaluation. PK samples: Plasma samples for PK data were collected at the following time points: on day 1, 1, 5, and 24 hours; on day 8, 0 and 24 hours; on day 15, 0, 1, 5, 24, and 144 hours.

[0480] Cytokine (INF-g, IL-6, IL-8, and TNF-a) evaluation: Sampling time points were before treatment, 5 hours and 24 hours after each dosing (on days 1, 8, and 15). Sampling sites were the femoral vein, saphenous vein, and / or radial vein. Blood samples (0.5 mL) were collected into K2-EDTA sampling tubes. Measurement of INF-g, IL-6, IL-8, and TNF-α in monkey plasma samples was performed using the electrochemiluminescence immunoassay (ECLIA) method from Mesoscale Discovery (U-PLEX Proinflam Combo 1 (NHP) SECTOR assay kit, catalog number K15070K-2). All variations were expressed as compared to the baseline value (before the first dosing on day 1). Due to analytical variability, an increase in cytokine was considered biologically significant if the value was more than 2-fold higher than the corresponding baseline value. Grading was applied as follows: change of 2-fold or less: no biologically relevant change; change of 3 - 10-fold: very minimal increase; change of 11 - 100-fold: minimal increase; change of 101 - 1000-fold: moderate increase; and change of 1001-fold or more: significant increase.

[0481] Results The concentration of NKp46-BCMA_Fc-ADE-DSB in plasma was determined using a discovery immunoassay performed on the Gyrolab platform. The descriptive statistics (mean and %CV) of the NKp46-BCMA_Fc-ADE-DSB PK parameters in plasma after weekly SC dosing of cynomolgus monkeys with NKp46-BCMA_Fc-ADE-DSB are shown in Table 24. The individual NKp46-BCMA_Fc-ADE-DSB PK parameters are shown in Table 25. The individual (and mean) NKp46-BCMA_Fc-ADE-DSB plasma concentration values are shown in Table 26.

[0482]

Table 24

[0483] After three times a week of SC administration, slight accumulation of NKp46-BCMA_Fc-ADE-DSB was observed in plasma on days 8 and 15, and the accumulation ratios were in the range of 1.6 - 2.6 at 25,000 and 50,000 μg / kg / adm (i.e., 25 and 50 mg / kg / adm), respectively (Figure 34A and Figure 34B). Overall, after SC dosing of NKp46-BCMA_Fc-ADE-DSB in monkeys, the bioavailability was close to 90%.

[0484]

Table 25

[0485]

Table 26

[0486] Cytokine (INF-g, IL-6, IL-8, and TNF-a) evaluation: Cytokines (INF-g, IL-6, IL-8, and TNF-α) were measured in plasma samples collected at the time points specified in the Methods and Materials section. No changes in IFN-g and TNF-α levels were observed in any of the animals after weekly SC dosing. For IL-6 (Figure 35), only a transient, very minimal (maximum 10-fold change in female 25) to minimal (maximum 21-fold change in female 24) increase was observed after the highest dose tested of 50 mg / kg / adm. For IL-8, a very minimal increase (maximum 6-fold change) was observed in both animals administered 25 mg / kg / adm.

[0487] Example 18. Study of NKp46-BCMA NKCE Binding Protein in Patients with Multiple Myeloma This is a first-in-human phase 1 / phase 2 study to evaluate the NKp46-BCMA NKCE disclosed herein in participants with relapsed / refractory multiple myeloma (r / r MM).

[0488] The study consists of three parts. First, a dose escalation phase in r / r MM participants to evaluate several doses administered to determine two doses to be tested in the dose optimization part. Second, a dose optimization phase to determine the pre-recommended phase 2 dose (pRP2D) and to evaluate the two doses determined from the dose escalation phase to determine the schedule of NKp46-BCMA NKCE. Third, a dose expansion phase to evaluate the preliminary efficacy of the confirmed recommended phase 2 dose (cRP2D) and to conduct the schedule of NKp46-BCMA NKCE in r / r MM pat...

Claims

**Claim 1** A binding protein comprising a first antigen-binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein (a) said first ABD comprises (a1) a first immunoglobulin heavy chain variable domain (VH1) comprising an HCDR1 sequence comprising the amino acid sequence of GFTFSNFGMH (SEQ ID NO: 1), an HCDR2 sequence comprising the amino acid sequence of VIWSDENR (SEQ ID NO: 2), and an HCDR3 sequence comprising the amino acid sequence of DQQYCSSDSCFTWFD P (SEQ ID NO: 3), (a2) CX １ SSTGX ２ VTPX ３ X ４ An LCDR1 sequence containing the amino acid sequence of YAN (SEQ ID NO: 4), wherein X １ is R or A, and X ２ is T or A, and X ３ is S or G, and X ４ is N or Y, an LCDR1 sequence, DNNX ５ X ６ An LCDR2 sequence containing the amino acid sequence of PP (SEQ ID NO: 5), wherein X ５ is S, I or N, and X ６ is R or K, an LCDR2 sequence, and ALX ７ X ８ GX ９ An LCDR3 sequence containing the amino acid sequence of QWV (SEQ ID NO: 6), wherein X ７ is W or Y, and X ８ is F or Y, and X ９ is N or G, and comprises a first immunoglobulin light chain variable domain (VL1) containing an LCDR3 sequence and (b) said second ABD is a binding protein comprising binding specificity for NKp46. **Claim 2** wherein (b) said second ABD comprises (b1) a second immunoglobulin heavy chain variable domain (VH2) comprising - an HCDR1 sequence comprising DYVIN, an HCDR2 sequence comprising EIYPGSGTNYYNEEKFKA, and an HCDR3 sequence comprising RGRYGLYAMDY, - an HCDR1 sequence comprising GYTFSDYVIN (SEQ ID NO: 19), an HCDR2 sequence comprising EIYPGSGTN (SEQ ID NO: 20), and an HCDR3 sequence comprising RGRYGLYAMDY (SEQ ID NO: 21), - an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 22), an HCDR2 sequence comprising YITYSGSSTYNPSLES (SEQ ID NO: 23), and an HCDR3 sequence comprising GGYYGS SWGVFAY (SEQ ID NO: 24), - an HCDR1 sequence comprising EYTMH (SEQ ID NO: 25), an HCDR2 sequence comprising GISPNIGGTSYNQKFK G (SEQ ID NO: 26), and an HCDR3 sequence comprising RGGSF DY (SEQ ID NO: 27), - an HCDR1 sequence comprising SFTMH (SEQ ID NO: 28), an HCDR2 sequence comprising YINPSSGYTEYNQKFK D (SEQ ID NO: 29), and an HCDR3 sequence comprising GSSRGF DY (SEQ ID NO: 30), or - an HCDR1 sequence comprising SDYAWN (SEQ ID NO: 31), an HCDR2 sequence comprising YITYSGS TNYNPSLK S (SEQ ID NO: 32), and an HCDR3 sequence comprising CW DYALYAMD C (SEQ ID NO: 33), and a second immunoglobulin heavy chain variable domain (VH2), and (b2) a second immunoglobulin light chain variable domain (VL2) comprising - An LCDR1 sequence containing -RASQDISNYLN (SEQ ID NO: 34), an LCDR2 sequence containing YTSRLHS (SEQ ID NO: 35), and an LCDR3 sequence containing QQGNTRPWT (SEQ ID NO: 36), - An LCDR1 sequence containing -RVSENIYSYLA (SEQ ID NO: 37), an LCDR2 sequence containing NAKTLAE (SEQ ID NO: 38), and an LCDR3 sequence containing QHHYGTPWT (SEQ ID NO: 39), - An LCDR1 sequence containing -RASQSISDYLH (SEQ ID NO: 40), an LCDR2 sequence containing YASQSIS (SEQ ID NO: 41), and an LCDR3 sequence containing QNGHSFPLT (SEQ ID NO: 42), - An LCDR1 sequence containing -RASENIYSNLA (SEQ ID NO: 43), an LCDR2 sequence containing AATNLAD (SEQ ID NO: 44), and an LCDR3 sequence containing QHFWGTPRT (SEQ ID NO: 45), or - An LCDR1 sequence containing -RTSENIYSYLA (SEQ ID NO: 46), an LCDR2 sequence containing NAKTLAE (SEQ ID NO: 47), and an LCDR3 sequence containing QHHYDTPLT (SEQ ID NO: 48), and a second immunoglobulin light chain variable domain (VL2) containing The binding protein according to claim 1, comprising

3. Wherein said VL1 is - An LCDR1 sequence containing the amino acid sequence of -CASSGTGTVTPSNYAN (SEQ ID NO: 7), an LCDR2 sequence containing the amino acid sequence of DNNSRPP (SEQ ID NO: 8), and an LCDR3 sequence containing the amino acid sequence of ALWFGNQWV (SEQ ID NO: 9), - An LCDR1 sequence containing the amino acid sequence of -CRSSTGTVTPSNYAN (SEQ ID NO: 10), an LCDR2 sequence containing the amino acid sequence of DNNSRPP (SEQ ID NO: 11), and an LCDR3 sequence containing the amino acid sequence of ALWFGNQWV (SEQ ID NO: 12), - An LCDR1 sequence containing the amino acid sequence of -CASSGAVTPSNYAN (SEQ ID NO: 13), an LCDR2 sequence containing the amino acid sequence of DNNIKPP (SEQ ID NO: 14), and an LCDR3 sequence containing the amino acid sequence of ALWYGGQWV (SEQ ID NO: 15), or - An LCDR1 sequence containing the amino acid sequence of -CASSGAVTPGYYAN (SEQ ID NO: 16), an LCDR2 sequence containing the amino acid sequence of DNNNKPP (SEQ ID NO: 17), and an LCDR3 sequence containing the amino acid sequence of ALYYGGQWV (SEQ ID NO: 18), The binding protein according to claim 1, comprising

4. - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55, or - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 50, or - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 51, or - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 52, or - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 53, or - the VH1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 54, Optionally, - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises the amino acid sequence of SEQ ID NO: 55, or - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises the amino acid sequence of SEQ ID NO: 50, or - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises the amino acid sequence of SEQ ID NO: 51, or - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises the amino acid sequence of SEQ ID NO: 52, or the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises the amino acid sequence of SEQ ID NO: 53, or - the VH1 comprises the amino acid sequence of SEQ ID NO: 49, and the VL1 comprises the amino acid sequence of SEQ ID NO: 54, the binding protein according to claim 1 or 2.

5. - the VH2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56, and the VL2 comprises an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64, or - the VH2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 57, and the VL2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 65, or - the VH2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 58, and the VL2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 66, or - the VH2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 59, and the VL2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 67, or - the VH2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 60, and the VL2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 68, or - the VH2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 61, and the VL2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 69, or - the VH2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 62, and the VL2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 70, or - the VH2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 63, and the VL2 contains an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 71, Optionally, the VH2 contains the amino acid sequence of SEQ ID NO: 56, and the VL2 contains the amino acid sequence of SEQ ID NO: 64, or the VH2 contains the amino acid sequence of SEQ ID NO: 57, and the VL2 contains the amino acid sequence of SEQ ID NO: 65, or the VH2 contains the amino acid sequence of SEQ ID NO: 58, and the VL2 contains the amino acid sequence of SEQ ID NO: 66, or the VH2 contains the amino acid sequence of SEQ ID NO: 59, and the VL2 contains the amino acid sequence of SEQ ID NO: 67, or the VH2 contains the amino acid sequence of SEQ ID NO: 60, and the VL2 contains the amino acid sequence of SEQ ID NO: 68, or the VH2 contains the amino acid sequence of SEQ ID NO: 61, and the VL2 contains the amino acid sequence of SEQ ID NO: 69, or the VH2 contains the amino acid sequence of SEQ ID NO: 62, and the VL2 contains the amino acid sequence of SEQ ID NO: 70, or The binding protein according to any one of claims 1 to 4, wherein VH2 contains the amino acid sequence of SEQ ID NO: 63 and VL2 contains the amino acid sequence of SEQ ID NO:

71.

6. Further comprising all or part of an immunoglobulin Fc domain or a variant thereof, optionally, All or part of the immunoglobulin Fc domain or a variant thereof binds to a human Fc-γ receptor, All or part of the immunoglobulin Fc domain or a variant thereof binds to a human CD16A (FcγRIII) polypeptide, The Fc domain contains a native glycan at amino acid position 297 according to EU numbering, and / or The binding protein is N-glycosylated, The binding protein according to any one of claims 1 to 5.

7. The binding protein according to claim 6, wherein the Fc domain or a variant thereof comprises a first Fc heavy chain and a second Fc heavy chain.

8. At least one Fc heavy chain has (i) leucine (L) at amino acid position 242 and lysine (K) at amino acid position 334, or (iii) arginine (R) at amino acid position 292 and valine (V) at amino acid position 302 The binding protein according to claim 7, which contains engineered intra-chain disulfide bonds mediated by a pair of cysteines (C) in place of, and the amino acid positions are according to EU numbering.

9. The binding protein according to claim 8, wherein the first and the second Fc heavy chains each contain an L242C / K334C substitution.

10. The binding protein according to claim 8, wherein the first and the second Fc heavy chains each contain an R292C / V302C substitution.

11. At least one Fc heavy chain contains a substitution at amino acid position 332 according to EU numbering, optionally, the substitution at amino acid position 332 is glutamic acid (E), optionally, further comprising at least one Fc heavy chain, and further containing one or more substitutions at amino acid positions 236, 239 or 330 according to EU numbering, optionally, the substitution at amino acid position 236 is alanine (A), the substitution at amino acid position 239 is aspartic acid (D), and the substitution at amino acid position 330 is leucine (L). The binding protein according to any one of claims 7 to 10.

12. At least one Fc heavy chain further comprises aspartic acid (D) at amino acid position 239 and glutamic acid (E) at amino acid position 332 according to EU numbering, or At least one Fc heavy chain further comprises alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, and glutamic acid (E) at amino acid position 332 according to EU numbering, or At least one Fc heavy chain further comprises alanine (A) at amino acid position 236, aspartic acid (D) at amino acid position 239, leucine (L) at amino acid position 330, and glutamic acid (E) at amino acid position 332 according to EU numbering, the binding protein according to any one of claims 7 to 11.

13. Comprising at least two polypeptide chains forming at least two antigen-binding sites, wherein at least one polypeptide chain has the formula: VL1 - L1 - VL2 - L2 - CL[I] including the structure represented by; At least one polypeptide chain has the formula: VH2 - L3 - VH1 - L4 - CH1[II] including the structure represented by; wherein CL is an immunoglobulin light chain constant domain, CH1 is an immunoglobulin CH1 heavy chain constant domain, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 may optionally be absent, the polypeptide of formula I and the polypeptide of formula II form an interchanged light chain - heavy chain pair, Optionally, the binding protein comprises three polypeptide chains forming two antigen-binding sites, and one polypeptide chain has the formula: VL1 - L1 - VL2 - L2 - CL[I] including the structure represented by; One polypeptide chain has the formula: VH2 - L3 - VH1 - L4 - CH1 - hinge - CH2 - CH3[III] including the structure represented by; One polypeptide chain has the formula: hinge - CH2 - CH3[IV] including the structure represented by; wherein CL is an immunoglobulin light chain constant domain, CH1 is an immunoglobulin CH1 heavy chain constant domain, CH2 is an immunoglobulin CH2 heavy chain constant domain, CH3 is an immunoglobulin CH3 heavy chain constant domain, hinge is an immunoglobulin hinge region connecting the CH1 domain and the CH2 domain, L1, L2, L3, and L4 are amino acid linkers, and any one or more of L1, L2, L3, and L4 may optionally be absent. The polypeptide of formula I and the polypeptide of formula II form an interchain light chain - heavy chain pair. The binding protein according to any one of claims 1 to 12.

14. (a) L1, L2, L3, and L4 are each independently of zero amino acid length or contain a sequence selected from the group consisting of GGGGSGGGGGS, GGGGSGGGGGSGGGGGS, S, RT, TKGPS, GQPKAAP, and GGGSGSSGSGG, or (b) L1, L2, L3, and L4 each independently contain a sequence selected from the group consisting of GGGGSGGGGGS, GGGGSGGGGGSGGGGGS, S, RT, TKGPS, GQPKAAP, and GGGSGSSGSGG. The binding protein according to claim 13.

15. (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72, (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73, (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74, The binding protein according to any one of claims 1 to 14, comprising.

16. A binding protein comprising a first antigen - binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, (a) the first ABD comprises a first immunoglobulin heavy - chain variable domain (VH1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 49 and a first immunoglobulin light - chain variable domain (VL1) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 55, (b) the second ABD comprises a second immunoglobulin heavy - chain variable domain (VH2) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 56 and a second immunoglobulin light - chain variable domain (VL2) comprising an amino acid sequence that is at least about 90% identical to the amino acid sequence of SEQ ID NO: 64, optionally, the VH1 comprises the amino acid sequence of SEQ ID NO: 49, the VL1 comprises the amino acid sequence of SEQ ID NO: 55, the VH2 comprises the amino acid sequence of SEQ ID NO: 56, and the VL2 comprises the amino acid sequence of SEQ ID NO:

64.

17. (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74; The binding protein according to claim 16, comprising:

18. A binding protein comprising a first antigen-binding domain (ABD) having binding specificity for BCMA and a second ABD having binding specificity for NKp46, wherein the binding protein is (i) a first polypeptide chain comprising the amino acid sequence of SEQ ID NO: 72; (ii) a second polypeptide chain comprising the amino acid sequence of SEQ ID NO: 73; (iii) a third polypeptide chain comprising the amino acid sequence of SEQ ID NO: 74; A binding protein comprising:

19. The binding protein according to any one of claims 1 to 18 for use as a medicament.

20. The binding protein according to any one of claims 1 to 19 for use in a method for the treatment or prevention of a disease or disorder.

21. The binding protein according to any one of claims 1 to 20 for use in a method for the treatment or prevention of cancer.

22. The binding protein according to any one of claims 1 to 21 for use in a method for the treatment or prevention of multiple myeloma.

23. A pharmaceutical composition comprising the binding protein according to any one of claims 1 to 18.

24. An isolated nucleic acid molecule comprising a nucleotide sequence encoding the binding protein according to any one of claims 1 to 18.

25. An expression vector comprising the nucleic acid molecule according to claim 24.

26. An isolated cell comprising the nucleic acid molecule according to claim 24.

27. An isolated cell comprising the expression vector according to claim 25.

28. The isolated cell according to claim 27, wherein the cell is a mammalian cell.

29. A method for producing the binding protein according to any one of claims 1 to 18, comprising culturing the isolated cell according to claim 26 or 27 under suitable conditions and recovering the binding protein.

30. A method for treating or preventing a disease or disorder, comprising administering to a subject in need thereof the pharmaceutical composition according to claim 23.

31. A method for treating or preventing cancer, comprising administering to a subject in need thereof the pharmaceutical composition according to claim 23.

32. A method for treating or preventing multiple myeloma, comprising administering to a subject in need thereof the pharmaceutical composition according to claim 23.

33. A method for restoring or enhancing the activity of NKp46-expressing cells in a patient in need thereof, comprising administering to the patient the pharmaceutical composition according to claim 23.

34. A method for eliminating cancer cells in a patient in need thereof, comprising administering to the patient the pharmaceutical composition according to claim 23.

35. A method for inducing or increasing NK cell-mediated lysis of cancer cells in a patient in need thereof, comprising administering to the patient the pharmaceutical composition according to claim 23.

Images