CRISPR interference therapy for C9ORF72 repeat expansion diseases
Patent Information
- Application Number
- JP2024570737
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-05-31
- Filing Date
- 2023-05-31
- Publication Date
- 2026-05-26
AI Technical Summary
Current treatments are lacking for amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) caused by C9orf72 hexanucleotide repeat expansions, which lead to motor neuron disease and dementia, with no effective therapies available to address the underlying genetic cause.
The use of guide RNAs and CRISPR/Cas systems, including lipid nanoparticles or viral vectors, to target and suppress transcription from the C9orf72 exon 1A transcription start site and hexanucleotide repeat expansions, reducing the expression of pathogenic transcripts and dipeptide repeat proteins.
This approach selectively inhibits the expression of sense and antisense transcripts containing hexanucleotide repeats, potentially ameliorating symptoms of ALS and FTLD by reducing toxic RNA foci and dipeptide repeat proteins, offering a therapeutic and prophylactic strategy for these diseases.
Smart Images

Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims the benefit of U.S. Patent Application No. 63 / 365,558, filed May 31, 2022, which is incorporated by reference herein in its entirety for all purposes.
[0002] Reference to sequence listing submitted as an XML file via EFS WEB The sequence listing in file 057766-596446.xml is 180 kilobytes, was created on May 30, 2023, and is incorporated herein by reference. [Background technology]
[0003] Amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD) are progressive, fatal neurodegenerative diseases that cause motor neuron disease in the case of ALS and dementia in the case of FTLD. The most common cause of familial ALS is an expansion of GGGGCC (G4C2) hexanucleotide repeats between two alternative 5' non-coding exons of the C9orf72 gene. Normal individuals have 3-35 G4C2 repeats, whereas ALS or FTLD patients have hundreds or thousands of repeats. The physiological function of the C9orf72 protein is not well understood, and no disease-causing mutations have been identified in its coding sequence. No effective treatments are currently available. Summary of the Invention [Means for solving the problem]
[0004] Disclosed herein are guide RNAs targeting the C9orf72 gene and CRISPR / Cas systems, lipid nanoparticles or viral vectors comprising such CRISPR / Cas systems, and cells or animals comprising such CRISPR / Cas systems. Also provided are methods of suppressing transcription from the C9orf72 exon 1A transcription start site and / or methods of suppressing transcription of sense and / or antisense transcripts comprising hexanucleotide repeat expansion sequences in the C9orf72 gene, and the use of CRISPR / Cas systems in prophylactic and therapeutic applications for the treatment and / or prevention of C9orf72 hexanucleotide repeat expansion-related diseases and / or for ameliorating at least one symptom associated with such diseases.
[0005] In one aspect, provided is a method of suppressing transcription from the C9orf72 exon 1A transcription start site, or a method of suppressing transcription of a sense or antisense transcript containing a hexanucleotide repeat expansion sequence in the C9orf72 gene in a cell. Some such methods involve contacting the C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence. Some such methods involve contacting the C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the second guide RNA target sequence. Some such methods involve (a) contacting the C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence, and / or (b) contacting the C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the first guide RNA target sequence. In some such methods, the method comprises option (a). In some such methods, the method comprises option (b).In some such methods, the method includes options (a) and (b).
[0006] In some such methods, option (a) includes contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex including a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site, and / or option (b) includes contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex including a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some such methods, option (a) includes contacting the C9orf72 gene with at least three CRISPR / Cas complexes, each CRISPR / Cas complex including a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence upstream or near the C9orf72 exon 1A transcription start site, and / or option (b) includes contacting the C9orf72 gene with at least three CRISPR / Cas complexes, each CRISPR / Cas complex including a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0007] In some such methods, the C9orf72 hexanucleotide repeat expansion sequence has more than 30, more than 100, more than 200, more than 300, more than 400, or more than 500 repeats of the hexanucleotide sequence G4C2.
[0008] In some such methods, the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site. In some such methods, the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.
[0009] In some such methods, the nuclease-inactive Cas protein is not fused to a heterologous transcriptional repressor domain and the guide RNA is not linked to a heterologous transcriptional repressor domain.
[0010] In some such methods, the binding reduces or abolishes the expression of transcripts starting at C9orf72 exon 1A. In some such methods, the binding reduces or abolishes the expression of transcripts starting at C9orf72 exon 1A but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B. In some such methods, the binding reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts. In some such methods, the binding reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B. In some such methods, the binding reduces or abolishes the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts. In some such methods, the binding reduces or abolishes the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B.
[0011] In some such methods, the method comprises (a) introducing into the cell a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a first guide RNA or one or more DNAs encoding the first guide RNA, and / or (b) introducing into the cell a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a second guide RNA or one or more DNAs encoding the second guide RNA.
[0012] In some such methods, the first guide RNA is a single guide RNA (sgRNA). In some such methods, the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein. In some such methods, the nuclease-inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein, or Neisseria meningitidis Cas9 protein. In some such methods, the nuclease-inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such methods, the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian cells or human cells. In some such methods, the method comprises (a) introducing the first guide RNA in the form of RNA, optionally, the first guide RNA comprising at least one modification, and / or (b) introducing the second guide RNA in the form of RNA, optionally, the second guide RNA comprising at least one modification. In some such methods, the at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate linkages between nucleotides. In some such methods, the method comprises introducing a nucleic acid encoding the nuclease-inactive Cas protein, the nucleic acid comprising mRNA encoding the nuclease-inactive Cas protein, optionally, the mRNA encoding the nuclease-inactive Cas protein comprising at least one modification.In some such methods, the method comprises (a) introducing a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA, and / or (b) introducing a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA. In some such methods, (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors, and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors. In some such methods, the one or more vectors are one or more viral vectors. In some such methods, the one or more viral vectors are one or more adeno-associated virus (AAV) vectors. In some such methods, (a) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein, and the first guide RNA or the one or more DNAs encoding the first guide RNA are associated with lipid nanoparticles, and / or (b) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein, and the second guide RNA or the one or more DNAs encoding the second guide RNA are associated with lipid nanoparticles.
[0013] In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 72 to 111 and 113. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 72 to 111 and 113. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 32 to 71 and 112. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 93 to 95. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93 to 95. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 53 to 55. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 34. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118 to 121.In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118 to 121. In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114 to 117. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 34.
[0014] In some such methods, the cells are nerve cells, and optionally, the nerve cells are motor neurons. In some such methods, the cells are in vitro or ex vivo. In some such methods, the cells are in vivo in a subject, and optionally, the subject is human. In some such methods, the cells are nerve cells in the brain of the subject. In some such methods, the subject has or is at risk of developing a C9orf72 hexanucleotide repeat expansion-related disorder. In some such methods, the C9orf72 hexanucleotide repeat expansion-related disorder is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In some such methods, (a) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a first guide RNA or one or more DNAs encoding the first guide RNA are administered to the subject by intracerebroventricular injection, intracranial injection, or intrathecal injection, and / or (b) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a second guide RNA or one or more DNAs encoding the second guide RNA are administered to the subject by intracerebroventricular injection, intracranial injection, or intrathecal injection. In some such methods, the cells are mammalian cells, and the C9orf72 gene is a mammalian C9orf72 gene. In some such methods, the cells are human cells. In some such methods, the cells are mouse cells. In some such methods, the C9orf72 gene contains a human C9orf72 promoter. In some such methods, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.
[0015] In another aspect, provided are methods of suppressing transcription from the C9orf72 exon 1A transcription start site or suppressing transcription of sense or antisense transcripts containing hexanucleotide repeat expansion sequences in the C9orf72 gene in a subject. Some such methods include (a) administering to the subject a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment that targets a first guide RNA target sequence upstream of or in the vicinity of the C9orf72 exon 1A transcription start site, and the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence, and / or (b) administering to the subject a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a second guide RNA or one or more DNAs encoding the second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment that targets a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, and the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex that binds to the second guide RNA target sequence. In another aspect, provided are methods of preventing, treating, or ameliorating at least one symptom or indication of a C9orf72 hexanucleotide repeat expansion-related disease or disorder.Some such methods include (a) administering to a subject in need thereof a first pharmaceutical composition comprising a therapeutically effective amount of a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a first guide RNA or one or more DNAs encoding a first guide RNA, wherein the first guide RNA comprises a first DNA targeting segment targeting a first guide RNA target sequence upstream of or in the vicinity of the C9orf72 exon 1A transcription start site, and the first guide RNA and the nuclease-inactive Cas protein form a first CRISPR / Cas complex that binds to the first guide RNA target sequence, and / or (b) administering to a subject in need thereof a second pharmaceutical composition comprising a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a second guide RNA or one or more DNAs encoding a second guide RNA, wherein the second guide RNA comprises a second DNA targeting segment targeting a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, and the second guide RNA and the nuclease-inactive Cas protein form a second CRISPR / Cas complex that binds to the second guide RNA target sequence. In some such methods, the C9orf72 hexanucleotide repeat expansion-related disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). In some such methods, the method comprises option (a). In some such methods, the method comprises option (b). In some such methods, the method comprises options (a) and (b).
[0016] In some such methods, option (a) involves administering to the subject at least two guide RNAs, each guide RNA targeting a different guide RNA target sequence upstream of or in the vicinity of the C9orf72 exon 1A transcription start site, and / or option (b) involves administering to the subject at least two guide RNAs, each guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some such methods, option (a) involves administering to the subject at least three guide RNAs, each guide RNA targeting a different guide RNA target sequence upstream of or in the vicinity of the C9orf72 exon 1A transcription start site, and / or option (b) involves administering to the subject at least three guide RNAs, each guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0017] In some such methods, the C9orf72 hexanucleotide repeat expansion sequence has more than 30, more than 100, more than 200, more than 300, more than 400, or more than 500 repeats of the hexanucleotide sequence G4C2. In some such methods, the administration is by intracerebroventricular injection, intracranial injection, or intrathecal injection.
[0018] In some such methods, the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site. In some such methods, the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.
[0019] In some such methods, the nuclease-inactive Cas protein is not fused to a heterologous transcriptional repressor domain and the guide RNA is not linked to a heterologous transcriptional repressor domain.
[0020] In some such methods, the binding reduces or abolishes the expression of transcripts starting at C9orf72 exon 1A. In some such methods, the binding reduces or abolishes the expression of transcripts starting at C9orf72 exon 1A but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B. In some such methods, the binding reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts. In some such methods, the binding reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B. In some such methods, the binding reduces or abolishes the expression of both sense nuclease-inactive and antisense C9orf72 hexanucleotide repeat-containing transcripts. In some such methods, the binding reduces or abolishes the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B.
[0021] In some such methods, the first guide RNA is a single guide RNA (sgRNA). In some such methods, the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein. In some such methods, the nuclease-inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein, or Neisseria meningitidis Cas9 protein. In some such methods, the nuclease-inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such methods, the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian cells or human cells. In some such methods, the method comprises (a) administering the first guide RNA in the form of RNA, optionally, the first guide RNA comprises at least one modification, and / or (b) administering the second guide RNA in the form of RNA, optionally, the second guide RNA comprises at least one modification. In some such methods, the at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate linkages between nucleotides. In some such methods, the method comprises administering a nucleic acid encoding a nuclease-inactive Cas protein, the nucleic acid comprises mRNA encoding the nuclease-inactive Cas protein, optionally, the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification.In some such methods, the method comprises (a) administering a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA, and / or (b) administering a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA. In some such methods, (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors, and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors. In some such methods, the one or more vectors are one or more viral vectors. In some such methods, the one or more viral vectors are one or more adeno-associated virus (AAV) vectors. In some such methods, (a) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein, and the first guide RNA or the one or more DNAs encoding the first guide RNA are associated with lipid nanoparticles, and / or (b) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein, and the second guide RNA or the one or more DNAs encoding the second guide RNA are associated with lipid nanoparticles.
[0022] In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 32-71 and 112. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 93-95. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93-95. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 53-55. In some such methods, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such methods, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such methods, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 34. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118-121.In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118 - 121. In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114 - 117. In some such methods, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such methods, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such methods, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 34.
[0023] In some such methods, the binding occurs in the nerve cells of the subject, and optionally, the nerve cells are motor neurons. In some such methods, the nerve cells are present in the brain of the subject. In some such methods, the subject is a mammalian subject and the C9orf72 gene is a mammalian C9orf72 gene. In some such methods, the subject is a human subject. In some such methods, the subject is a mouse subject. In some such methods, the C9orf72 gene comprises a human C9orf72 promoter. In some such methods, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.
[0024] In another aspect, a CRISPR / Cas system is provided. Some such systems include (a) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a first guide RNA or one or more DNAs encoding the first guide RNA, the first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site, the first guide RNA and the nuclease-inactive Cas protein forming a first CRISPR / Cas complex that binds to the first guide RNA target sequence, a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a first guide RNA or one or more DNAs encoding the first guide RNA, and / or (b) a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a second guide RNA or one or more DNAs encoding the second guide RNA, the second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, the second guide RNA and the nuclease-inactive Cas protein forming a second CRISPR / Cas complex that binds to the second guide RNA target sequence, a nuclease-inactive Cas protein or a nucleic acid encoding a nuclease-inactive Cas protein, and a second guide RNA or one or more DNAs encoding the second guide RNA. In some such systems, the CRISPR / Cas system includes option (a). In some such systems, the CRISPR / Cas system includes option (b). In some such systems, the CRISPR / Cas system includes options (a) and (b).
[0025] In some such systems, option (a) includes at least two guide RNAs, each of which targets a different guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site, and / or option (b) includes at least two guide RNAs, each of which targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some such systems, option (a) includes at least three guide RNAs, each of which targets a different guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site, and / or option (b) includes at least three guide RNAs, each of which targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0026] In some such systems, the first guide RNA target sequence is within 250 nucleotides, within 225 nucleotides, within 200 nucleotides, within 175 nucleotides, within 150 nucleotides, within 125 nucleotides, within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site. In some such systems, the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.
[0027] In some such systems, the nuclease-inactive Cas protein is not fused to a heterologous transcriptional repressor domain and the guide RNA is not linked to a heterologous transcriptional repressor domain.
[0028] In some such systems, the binding reduces or abolishes the expression of transcripts starting at C9orf72 exon 1A. In some such systems, the binding reduces or abolishes the expression of transcripts starting at C9orf72 exon 1A but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B. In some such systems, the binding reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts. In some such systems, the binding reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B. In some such systems, the binding reduces or abolishes the expression of both sense nuclease-inactive and antisense C9orf72 hexanucleotide repeat-containing transcripts. In some such systems, the binding reduces or abolishes the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts but does not reduce or abolish the expression of transcripts starting at C9orf72 exon 1B.
[0029] In some such systems, the first guide RNA is a single guide RNA (sgRNA). In some such systems, the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein. In some such systems, the nuclease-inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein, or Neisseria meningitidis Cas9 protein. In some such systems, the nuclease-inactive Cas protein is derived from Streptococcus pyogenes Cas9 protein. In some such systems, the nucleic acid encoding the nuclease-inactive Cas protein is codon-optimized for expression in mammalian cells or human cells. In some such systems, the CRISPR / Cas system comprises (a) a first guide RNA in the form of RNA, optionally comprising at least one modification, the first guide RNA, and / or (b) a second guide RNA in the form of RNA, optionally comprising at least one modification, the second guide RNA. In some such systems, the at least one modification comprises a 2'-O-methyl modified nucleotide and / or a phosphorothioate bond between nucleotides. In some such systems, the CRISPR / Cas system comprises a nucleic acid encoding a nuclease-inactive Cas protein, the nucleic acid comprises an mRNA encoding the nuclease-inactive Cas protein, and optionally, the mRNA encoding the nuclease-inactive Cas protein comprises at least one modification.In some such systems, the CRISPR / Cas system comprises (a) a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a first guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA, and / or (b) a nucleic acid encoding a nuclease-inactive Cas protein and one or more DNAs encoding a second guide RNA, wherein the nucleic acid encoding the nuclease-inactive Cas protein comprises DNA. In some such systems, (a) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors, and / or (b) the DNA encoding the nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are in one or more vectors. In some such systems, the one or more vectors are one or more viral vectors. In some such systems, the one or more viral vectors are one or more adeno-associated virus (AAV) vectors. In some such systems, (a) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein, and the first guide RNA or the one or more DNAs encoding the first guide RNA are associated with lipid nanoparticles, and / or (b) the nuclease-inactive Cas protein or the nucleic acid encoding the nuclease-inactive Cas protein, and the second guide RNA or the one or more DNAs encoding the second guide RNA are associated with lipid nanoparticles.
[0030] In some such systems, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such systems, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 72-111 and 113. In some such systems, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 32-71 and 112. In some such systems, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 93-95. In some such systems, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93-95. In some such systems, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 53-55. In some such systems, the first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such systems, the first DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such systems, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 34. In some such systems, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118-121.In some such systems, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118 - 121. In some such systems, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114 - 117. In some such systems, the second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74. In some such systems, the second DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 74. In some such systems, the second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 34.
[0031] In some such systems, the C9orf72 gene is a mammalian C9orf72 gene. In some such systems, the C9orf72 gene comprises a human C9orf72 promoter. In some such systems, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.
[0032] In another aspect, a pharmaceutical composition is provided that comprises any of the above CRISPR / Cas systems and a pharmaceutically acceptable carrier.
[0033] In another aspect, a composition is provided that includes a guide RNA or one or more DNAs encoding a guide RNA. In some such compositions, the guide RNA includes a DNA targeting segment that targets a guide RNA target sequence in the C9orf72 gene, the guide RNA target sequence is within a C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, and the guide RNA can bind to a nuclease-inactive Cas protein and target the nuclease-inactive Cas protein to the guide RNA target sequence.
[0034] In some such compositions, binding of the Cas protein to the guide RNA target sequence reduces or abolishes the expression of transcripts that initiate in C9orf72 exon 1A. In some such compositions, binding of the Cas protein to the guide RNA target sequence reduces or abolishes the expression of transcripts that initiate in C9orf72 exon 1A, but does not reduce or abolish the expression of transcripts that initiate in C9orf72 exon 1B. In some such compositions, binding of the Cas protein to the guide RNA target sequence reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts. In some such compositions, binding of the Cas protein to the guide RNA target sequence reduces or abolishes the expression of C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or abolish the expression of transcripts that initiate in C9orf72 exon 1B. In some such compositions, binding of the Cas protein to the guide RNA target sequence reduces or abolishes the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts. In some such compositions, binding of the Cas protein to the guide RNA target sequence reduces or abolishes the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or abolish the expression of transcripts that initiate in C9orf72 exon 1B.
[0035] In some such compositions, the guide RNA is a single guide RNA (sgRNA). In some such compositions, the nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein. In some such compositions, the nuclease-inactive Cas9 protein is derived from Streptococcus pyogenes Cas9 protein, Staphylococcus aureus Cas9 protein, Campylobacter jejuni Cas9 protein, Streptococcus thermophilus Cas9 protein, or Neisseria meningitidis Cas9 protein. In some such compositions, the nuclease-inactive protein is derived from Streptococcus pyogenes Cas9 protein. In some such compositions, the CRISPR / Cas system comprises a guide RNA in the form of RNA, and optionally, the guide RNA comprises at least one modification. In some such compositions, the at least one modification comprises 2'-O-methyl modified nucleotides and / or phosphorothioate linkages between nucleotides. In some such compositions, the one or more DNAs encoding the guide RNA are in one or more vectors. In some such compositions, the one or more vectors are one or more viral vectors. In some such compositions, the one or more viral vectors are one or more adeno-associated virus (AAV) vectors. In some such compositions, the guide RNA or the one or more DNAs encoding the guide RNA are associated with lipid nanoparticles.
[0036] In some such compositions, the DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 118 - 121. In some such compositions, the DNA targeting segment is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 118 - 121. In some such compositions, the first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 114 - 117.
[0037] In some such compositions, the C9orf72 gene is a mammalian C9orf72 gene. In some such compositions, the C9orf72 gene comprises a human C9orf72 promoter. In some such compositions, the C9orf72 gene is a human C9orf72 gene or a humanized C9orf72 gene.
[0038] In another aspect, a pharmaceutical composition is provided that comprises any of the above compositions and a pharmaceutically acceptable carrier.
Brief Description of the Drawings
[0039]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Mode for Carrying Out the Invention
[0040] Definitions As used interchangeably herein, the terms "protein", "polypeptide", and "peptide" include polymeric forms of amino acids of any length, including coded and non-coded amino acids, and chemically or biochemically modified or derivatized amino acids. These terms also include modified polymers such as polypeptides having modified peptide backbones. The term "domain" refers to any part of a protein or polypeptide that has a specific function or structure.
[0041] Proteins are said to have an "N-terminus" and a "C-terminus". The term "N-terminus" relates to the start of a protein or polypeptide that has an amino acid with a free amine group (-NH2) at its end. The term "C-terminus" relates to the end of an amino acid chain (protein or polypeptide) terminated by a free carboxyl group (-COOH).
[0042] As used interchangeably herein, the terms "nucleic acid" and "polynucleotide" include polymeric forms of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, or analogs or modified versions thereof. These include single-stranded, double-stranded, and multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, and polymers containing purine bases, pyrimidine bases, or other natural, chemically modified, biochemically modified, unnatural, or derivatized nucleotide bases.
[0043] Nucleic acids are said to have a "5' end" and a "3' end" because the mononucleotides react in such a way that the 5'-phosphate of one mononucleotide pentose ring binds in one direction via a phosphodiester bond to the adjacent 3'-oxygen. The ends of an oligonucleotide are referred to as the "5' end" if its 5'-phosphate is not linked to the 3'-oxygen of a mononucleotide pentose ring. The ends of an oligonucleotide are referred to as the "3' end" if its 3'-oxygen is not linked to the 5'-phosphate of another mononucleotide pentose ring. A nucleic acid sequence can also be said to have 5' and 3' ends even if it is present within a larger oligonucleotide. In either a linear or circular DNA molecule, distinct elements are referred to as "upstream" or "downstream" 5' or 3' elements.
[0044] The term "targeting vector" refers to a recombinant nucleic acid that can be introduced into a target location in a cell's genome by homologous recombination, non-homologous end-joining-mediated ligation, or any other recombination means.
[0045] The term "viral vector" refers to a recombinant nucleic acid that contains at least one element of viral origin and contains elements sufficient or permissive for packaging into viral vector particles. The vector and / or particle can be utilized for the purpose of transferring DNA, RNA, or other nucleic acids into cells in vitro, ex vivo, or in vivo. Many forms of viral vectors are known.
[0046] The term "isolated" with respect to cells, tissues, proteins, and nucleic acids includes cells, tissues, proteins, and nucleic acids that are relatively purified with respect to other bacteria, viruses, cells, or other components that may normally be present in situ, up to substantially pure preparations of those cells, tissues, proteins, and nucleic acids, and also includes those substantially pure preparations. The term "isolated" also includes proteins and nucleic acids that are chemically synthesized, having no naturally occurring counterpart, and thus are substantially free of contamination by other cells, tissues, proteins, and nucleic acids, or are separated or purified from most other components (e.g., cellular components) that are naturally associated with them (e.g., other cellular proteins, polynucleotides, or other components).
[0047] The term "wild-type" includes entities having a structure and / or activity as found in a normal state or context (as contrasted with mutants, diseased, modified, etc.). Wild-type genes and polypeptides often exist in multiple different forms (e.g., alleles).
[0048] The term "endogenous sequence" refers to a nucleic acid sequence that naturally occurs in a cell or subject. For example, the endogenous C9orf72 sequence in humans refers to the native C9orf72 sequence that naturally occurs at the human C9orf72 locus.
[0049] "Exogenous" molecules or sequences include molecules or sequences that do not normally occur in a cell in that form. Normal occurrence includes occurrence with respect to a particular developmental stage and environmental conditions of the cell. Exogenous molecules or sequences can include, for example, variant versions of the corresponding endogenous sequence within the cell, such as humanized versions of an endogenous sequence, or sequences that are within the cell but correspond to an endogenous sequence in a different form (i.e., not chromosomal). In contrast, endogenous molecules or sequences include molecules or sequences that normally occur in a particular cell, at a particular developmental stage, and under particular environmental conditions in that form.
[0050] The term "heterologous" when used in the context of a nucleic acid or protein indicates that the nucleic acid or protein contains at least two segments that do not naturally occur together within the same molecule. For example, the term "heterologous" when used with respect to a segment of a nucleic acid or a segment of a protein indicates that the nucleic acid or protein contains two or more sub-sequences that are not found in the same relationship (e.g., bound together) to each other in nature. As an example, a "heterologous" region of a nucleic acid vector is a segment of nucleic acid within or attached to another nucleic acid molecule that is not found associated with other molecules in nature. For example, a heterologous region of a nucleic acid vector can include a coding sequence adjacent to a sequence not found associated with coding sequences in nature. Similarly, a "heterologous" region of a protein is a segment of amino acids within or attached to another peptide molecule that is not found associated with other peptide molecules in nature (e.g., a fusion protein, or a tagged protein). Similarly, a nucleic acid or protein can contain a heterologous label or a heterologous secretion or localization sequence.
[0051] "Codon optimization" (i.e., an "optimized codon" array) takes advantage of the degeneracy of codons, as shown by the diversity of the combinations of three-base pair codons that specify amino acids, and generally involves modifying a nucleic acid sequence to enhance expression in a particular host cell by replacing at least one codon of a native sequence with a codon that is more frequently or most frequently used in the genes of the host cell while maintaining the native amino acid sequence. For example, a nucleic acid encoding a polypeptide of interest can be modified to alternative codons that are used at a higher frequency in a given prokaryotic or eukaryotic cell, including, but not limited to, bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, hamster cells, or any other host cell, compared to the naturally occurring nucleic acid sequence. Codon usage tables are readily available, for example, in the "Codon Usage Database". These tables can be applied in a variety of ways. See Nakamura et al. (2000) Nucleic Acids Res. 28(1):292, which is hereby incorporated by reference in its entirety for all purposes. Computer algorithms (e.g., see Gene Forge) are also available for codon optimization of specific sequences for expression in a particular host.
[0052] The term "locus" refers to a particular location (position) on a chromosome of a genome of an organism, such as a gene (or significant sequence), a DNA sequence, a polypeptide coding sequence, or a position. For example, the "C9orf72 locus" can refer to the specific location of the C9orf72 gene, the C9orf72 DNA sequence, or the C9orf72 position on the chromosome of the genome of an organism identified as having such a sequence. The "C9orf72 locus" can include regulatory elements of the C9orf72 gene, such as, for example, enhancers, promoters, 5' and / or 3' untranslated regions (UTRs), or combinations thereof.
[0053] The term "gene", when referring to its natural occurrence, refers to a DNA sequence in a chromosome that may contain at least one coding region and at least one non-coding region. The DNA sequence in a chromosome that encodes a product (e.g., without limitation, an RNA product and / or a polypeptide product) such that the gene corresponds to a full-length RNA (including 5' and 3' untranslated sequences) may include coding regions interrupted by non-coding introns as well as sequences located adjacent to the coding regions at both the 5' and 3' ends. Additionally, other non-coding sequences including regulatory sequences (e.g., without limitation, promoters, enhancers, and transcription factor binding sites), polyadenylation signals, internal ribosome entry sites, silencers, insulator sequences, and matrix attachment regions may also be present in the gene. These sequences may be in close proximity (e.g., without limitation, within 10 kb) to the coding region of the gene or at distant sites, and they affect the level or rate of transcription and translation of the gene.
[0054] The term "allele" refers to variant forms of a gene. Some genes have various different forms located at the same position on a chromosome, or locus. A diploid organism has two alleles at each locus. Each pair of alleles represents the genotype at a particular locus. The genotype is described as homozygous when there are two identical alleles at a particular locus and heterozygous when the two alleles are different.
[0055] A "promoter" is a regulatory region of DNA that typically contains a TATA box that can direct RNA polymerase II to initiate RNA synthesis at an appropriate transcription start site for a particular polynucleotide sequence. The promoter may additionally contain other regions that affect the rate of transcription initiation. The promoter sequences disclosed herein regulate the transcription of operably linked polynucleotides. The promoter can be active in one or more of the cell types disclosed herein (e.g., human cells, human liver cells, or human hepatocytes). The promoter can be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmentally regulated promoter), or a spatially restricted promoter (e.g., a cell-specific or tissue-specific promoter). Examples of promoters can be found, for example, in International Publication No. WO 2013 / 176772, which is hereby incorporated by reference in its entirety for all purposes.
[0056] "Operably linked" or "operably connected" includes the juxtaposition of two or more components (e.g., a promoter and another sequence element) such that both components function properly and at least one of the components allows the possibility of mediating a function that extends to at least one of the other components. For example, a promoter can be operably linked to a coding sequence if the promoter controls the level of transcription of the coding sequence in response to the presence or absence of one or more transcription regulatory factors. Operable linkage can include the fact that such sequences are in proximity to each other, or that they act in trans (e.g., a regulatory sequence can act at a distance to control the transcription of a coding sequence).
[0057] The methods and compositions provided herein use a variety of different components. Some of the components throughout the description may have active variants and fragments. The term "functional" refers to the innate ability of a protein or nucleic acid (or a fragment or variant thereof) that exhibits a biological activity or function. The biological function of a functional fragment or variant may be the same as or actually altered (e.g., with respect to their specificity or selectivity or efficacy) compared to the original molecule, but retains the basic biological function of the molecule.
[0058] The term "variant" refers to a nucleotide sequence that differs (e.g., by only 1 nucleotide) from the most common sequence in a population, or a protein sequence that differs (e.g., by only 1 amino acid) from the most common sequence in a population.
[0059] The term "fragment", when referring to a protein, means a protein that has fewer amino acids than the full-length protein. The term "fragment", when referring to a nucleic acid, means a nucleic acid that has fewer nucleotides than the full-length nucleic acid. A fragment can be, for example, an N-terminal fragment (i.e., removal of a portion of the C-terminus of the protein), a C-terminal fragment (i.e., removal of a portion of the N-terminus of the protein), or an internal fragment (i.e., removal of portions of each of the N-terminus and C-terminus of the protein) when referring to a protein fragment. A fragment can be, for example, a 5’ fragment (i.e., removal of a portion of the 3’ terminus of the nucleic acid), a 3’ fragment (i.e., removal of a portion of the 5’ terminus of the nucleic acid), or an internal fragment (i.e., removal of portions of each of the 5’ terminus and 3’ terminus of the nucleic acid) when referring to a nucleic acid fragment.
[0060] "Sequence identity" or "identity" in the context of two polynucleotide or polypeptide sequences refers to residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. For proteins, when percentage of sequence identity is used, the positions of residues that are not identical often differ by conservative amino acid substitutions, where a conservative amino acid substitution is one in which an amino acid residue is substituted by another amino acid residue having similar chemical properties (e.g., charge or hydrophobicity), and thus does not change the functional properties of the molecule. When sequences differ by conservative substitutions, the percent sequence identity can be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well known. Typically, this involves scoring a conservative substitution as a partial rather than a complete mismatch, thereby increasing the percentage of sequence identity. Thus, for example, if identical amino acids are given a score of 1 and non-conservative substitutions are given a score of 0, a conservative substitution is given a score between 0 and 1. Scoring for conservative substitutions is calculated, for example, as implemented in the program PC / GENE (Intelligenetics, Mountain View, California).
[0061] "Percentage of sequence identity" includes a value determined by comparing two optimally aligned sequences (with the maximum number of completely matching residues) over a comparison window, where the portion of the polynucleotide sequence in the comparison window may include additions or deletions (i.e., gaps) when compared to a reference sequence (without additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions where the same nucleotide base or amino acid residue occurs in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Unless otherwise specified (e.g., the shorter sequence contains concatenated non-homologous sequences), the comparison window is the full length of the shorter of the two sequences being compared.
[0062] Unless otherwise specified, sequence identity / similarity values include those obtained using the following parameters: a GAP weight of 50 and a length weight of 3, and the % identity and % similarity of nucleotide sequences using the nwsgapdna.cmp scoring matrix; a GAP weight of 8 and a length weight of 2, and the % identity and % similarity of amino acid sequences using the BLOSUM62 scoring matrix; or values obtained using GAP version 10 with any equivalent program. "Equivalent program" includes any sequence comparison program that, when compared to the corresponding alignment generated by GAP version 10 for any two sequences in question, generates an alignment with the same nucleotide or amino acid residue matches and the same percent sequence identity.
[0063] The term "conservative amino acid substitution" refers to the substitution of an amino acid that is normally present in a sequence with a different amino acid of similar size, charge, or polarity. Examples of conservative substitutions include the substitution of one nonpolar (hydrophobic) residue, such as isoleucine, valine, or leucine, with another nonpolar residue. Similarly, examples of conservative substitutions include the substitution of one polar (hydrophilic) residue with another, such as between arginine and lysine, between glutamine and asparagine, or between glycine and serine. Additionally, the substitution of one basic residue, such as lysine, arginine, or histidine, with another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid, with another acidic residue, are additional examples of conservative substitutions. Examples of non-conservative substitutions include the substitution of a nonpolar (hydrophobic) amino acid residue, such as isoleucine, valine, leucine, alanine, or methionine, with a polar (hydrophilic) residue, such as cysteine, glutamine, glutamic acid, or lysine, and / or the substitution of a polar residue with a nonpolar residue. A typical classification of amino acids is summarized below.
[0064]
Table 1
[0065] A "homologous" sequence (e.g., a nucleic acid sequence) includes a sequence that is identical or substantially similar to a known reference sequence, for example, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the known reference sequence. Homologous sequences can include, for example, orthologous sequences and paralogous sequences. For example, homologous genes typically derive from a common ancestral DNA sequence either through a speciation event (orthologous genes) or a gene duplication event (paralogous genes). "Ortholog" genes include genes in various species that have evolved from a common ancestral gene by speciation. Orthologs typically retain the same function during the process of evolution. "Paralogous" genes include genes related by duplication within the genome. Paralogs can evolve new functions during the process of evolution.
[0066] The term "in vitro" includes an artificial environment and processes or reactions that occur within an artificial environment (e.g., a test tube or isolated cells or cell lines). The term "in vivo" includes a natural environment (e.g., cells or organisms or a body) and processes or reactions that occur within a natural environment. The term "ex vivo" includes cells removed from an individual's body and processes or reactions that occur within such cells.
[0067] A composition or method that "comprises" or "includes" one or more recited elements may contain other elements not specifically recited. For example, a composition that "comprises" or "includes" a protein may contain the protein alone or in combination with other components. The transitional phrase "consisting essentially of" means that the scope of the claim is to be interpreted as encompassing the specified elements in the claim, and also those elements that do not materially affect the basic and novel characteristics of the claimed invention. Thus, the term "consisting essentially of" as used in the claims of the present invention is not intended to be interpreted as equivalent to "comprising".
[0068] "Optional" or "optionally" means that the subsequent recited event or circumstance may or may not occur, and the description includes examples of when the event or circumstance occurs and when it does not.
[0069] The specification of a range of values includes all integers within that range, or defining that range, and all sub-ranges defined by the integers within that range. For example, 5 to 10 nucleotides is understood to be 5, 6, 7, 8, 9, or 10 nucleotides, while 5 to 10% is understood to include all possible values up to and including 5% and 10%.
[0070] At least 17 nucleotides out of 20 nucleotide sequences is understood to include 17, 18, 19, or 20 nucleotides of the provided sequence, thereby providing an upper limit even when one is not specifically provided, as is clearly understood. Similarly, up to 3 nucleotides is understood to encompass 0, 1, 2, or 3 nucleotides, providing a lower limit even when one is not specifically provided. When "at least", "up to", or other similar language modifies a number, it can be understood to modify each number in the series.
[0071] As used herein, "less than" or "lower than" are understood to mean the value adjacent to the clause and, logically, the lower value or integer down to 0 from the context. For example, a double-stranded region of "less than 2 nucleotide base pairs" has 2, 1, or 0 nucleotide base pairs. When "less than" or "lower than" is present before a series of numbers or ranges, it is understood that each of the numbers within that series or range is modified.
[0072] As used herein, when the maximum amount of a value is expressed as 100% (e.g., 100% inhibition), it is understood that the value is limited by the detection method. For example, 100% inhibition is understood as inhibition relative to a level below the detection level of the assay.
[0073] Unless otherwise apparent from the context, the term "about" encompasses values that are ±5% of the recited value. In certain embodiments, the term "about" encompasses variations or errors acceptable within the art, e.g., 2 standard deviations from the mean, or the sensitivity of the method used to make the measurement, or a percentage of values acceptable within the art, e.g., as associated with age. When "about" is present before the first value of a series, it can be understood to modify each value of the series.
[0074] The term "and / or" refers to any and all possible combinations of one or more of the associated listed items, as well as the absence of combinations when interpreted as alternatives ("or"), and includes these.
[0075] The term "or" refers to any one member of a particular list and also includes any combination of the members of that list.
[0076] The singular forms of the articles "a", "an", and "the" include references to the plural, unless the context clearly dictates otherwise. For example, the term "protein" or "at least one protein" can include multiple proteins, including mixtures thereof.
[0077] By "statistically significant" is meant p ≤ 0.05.
[0078] If there is a conflict between the sequences in the present application and the indicated accession number or the position in the accession number, the sequences in the present application shall prevail.
[0079] 1. General Introduction Sense and antisense repeat expansion C9orf72 RNAs detected as cytoplasmic and nuclear foci by fluorescence in situ hybridization (FISH) can sequester RNA-binding proteins and cause cytotoxicity. Furthermore, dipeptide repeat (DPR) proteins have been proposed to be produced from C9orf72 GGGGCC (G4C2) repeat expansion sense and antisense RNAs by a non-canonical process called repeat-associated nonAUG (RAN) translation, and there is strong evidence that DPR proteins are cytotoxic. DPR proteins can be translated from all sense and antisense reading frames. Sense DPR proteins include glycine-alanine, glycine-arginine, and glycine-proline DPR proteins. Antisense DPR proteins include proline-arginine, proline-alanine, and glycine-proline. Since G4C2 repeat-containing RNAs are thought to be pathogenic either by themselves or as templates for dipeptide repeat protein translation, common therapeutic strategies are either to inhibit their synthesis or to promote their destruction.
[0080] Transcription of the C9orf72 gene starts with two alternative non-coding exons: exon 1A (upstream) and exon 1B (downstream). The G4C2 repeat is present between exons 1A and 1B. Exons 1A and 1B can be spliced to exon 2, which is the first protein-coding exon, to produce mRNAs with alternative 5’ untranslated regions. In healthy individuals with short G4C2 repeat expansions, transcription mainly starts with exon 1B. RNA containing exon 1A is rare, and repeat-containing RNA is undetectable. People affected by C9orf72 ALS or FTLD accumulate transcripts in which exon 1A is spliced to exon 2, and both sense and antisense repeat-containing RNAs, as well as the DPR proteins translated from them, can be detected by in situ hybridization and immunohistochemistry. See Figure 1. These pathological findings suggest that longer disease-associated G4C2 repeat expansions promote the use of the upstream exon 1A transcription start site, which is the only way in which repeat-containing RNAs and their DPR proteins can be produced. Also, the production of antisense repeat-containing RNAs, which depends on long repeat expansions, would be associated with an increased use of the upstream transcription start site.
[0081] Therefore, a possible treatment strategy for C9orf72 repeat expansion diseases would be to inhibit or abolish transcription starting with exon 1A upstream of the G4C2 repeat while maintaining transcription starting with exon 1B downstream of the repeat that sustains the production of mRNA for C9orf72 protein synthesis. CRISPR interference (CRISPRi) technology uses catalytically dead Cas proteins (dCas proteins) lacking endonuclease activity to regulate genes in an RNA-guided manner. CRISPRi can sterically repress transcription by blocking either transcription initiation or elongation. This is achieved by designing guide RNAs complementary to the promoter or coding sequence, respectively. The advantage of CRISPRi over normal Cas9 is that it does not induce double-strand breaks in DNA and thus there is less chance of off-target DNA cleavage and DNA damage, which can be very harmful to cells and organisms as a whole.
[0082] Disclosed herein are guide RNAs and CRISPR / Cas systems targeting the C9orf72 locus or gene, lipid nanoparticles or viral vectors comprising such CRISPR / Cas systems, and cells or animals comprising such CRISPR / Cas systems. Also provided are methods of using a CRISPR / Cas system to suppress transcription from the C9orf72 exon 1A transcription start site in the C9orf72 gene and / or to suppress transcription of sense and / or antisense transcripts comprising a hexanucleotide repeat expansion, and the use of a CRISPR / Cas system in prophylactic and therapeutic applications for the treatment and / or prevention of C9orf72 hexanucleotide repeat expansion-related diseases and / or for ameliorating at least one symptom associated with such diseases. The CRISPR / Cas systems disclosed herein can target promoter elements upstream of or in the vicinity of exon 1A or the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, selectively or preferentially reducing or eliminating transcripts starting at exon 1A or sense or antisense transcripts comprising a hexanucleotide repeat expansion while retaining transcripts starting at exon 1B.
[0083] The CRISPR / Cas systems disclosed herein can, for example, reduce or eliminate the expression of transcripts starting at C9orf72 exon 1A. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of sense C9orf72 hexanucleotide repeat-containing transcripts. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts. The CRISPR / Cas systems disclosed herein can also, for example, reduce or eliminate the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts. The CRISPR / Cas systems disclosed herein can, for example, selectively or preferentially reduce or eliminate the expression of transcripts starting at C9orf72 exon 1A as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., reduce the expression of transcripts starting at C9orf72 exon 1A to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B). The CRISPR / Cas systems disclosed herein can also, for example, selectively or preferentially reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., reduce the expression of transcripts containing C9orf72 hexanucleotide repeats to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B). The CRISPR / Cas systems disclosed herein can also, for example, selectively or preferentially reduce or eliminate the expression of sense C9orf72 hexanucleotide repeat-containing transcripts as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (e.g., reduce the expression of sense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B).The CRISPR / Cas systems disclosed herein can also selectively or preferentially reduce or eliminate the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts (e.g., reduce the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B), compared to, for example, the effect on the expression of transcripts starting at C9orf72 exon 1B. The CRISPR / Cas systems disclosed herein can also selectively or preferentially reduce or eliminate the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts (e.g., reduce the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B), compared to, for example, the effect on the expression of transcripts starting at C9orf72 exon 1B. In the CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates the expression of transcripts starting at C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some of the CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates the expression of C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some of the CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates the expression of sense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some of the CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B.In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces or eliminates the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces the expression of poly-GA dipeptide repeat proteins. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces the expression of poly-GP dipeptide repeat proteins. In some CRISPR / Cas systems disclosed herein, the CRISPR / Cas system reduces the expression of both poly-GA dipeptide repeat proteins and poly-GP dipeptide repeat proteins.
[0084] II. CRISPR / Cas Systems Targeting the C9orf72 Gene The methods and compositions disclosed herein utilize a clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated (Cas) system or components of such a system to suppress transcription from the C9orf72 exon 1A transcription start site and / or to suppress transcription of sense and / or antisense transcripts containing hexanucleotide repeat expansions in the C9orf72 gene in a cell. C9orf72 can be, for example, a human or mouse C9orf72 or a humanized C9orf72 gene. The cell can be, for example, in a subject such as a human (e.g., a nerve cell). The CRISPR / Cas system disclosed herein uses a nuclease-inactive Cas protein (i.e., a catalytically dead Cas protein) and can act through the CRISPR interference mechanism to sterically inhibit transcription. For example, the nuclease-inactive Cas protein may not be fused to a heterologous transcriptional repressor domain, and the guide RNA may not be linked to a heterologous transcriptional repressor domain. CRISPR interference (CRISPRi) technology uses a catalytically dead Cas protein (dCas protein) lacking endonuclease activity to regulate genes in an RNA-guided manner. CRISPRi can sterically inhibit transcription by blocking either transcription initiation or elongation. This is achieved by designing guide RNAs complementary to the promoter or coding sequence, respectively.
[0085] A. C9orf72, Hexanucleotide Repeat Expansions, and Related Diseases Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, is the most frequent adult-onset paralytic disorder characterized by the loss of upper and / or lower motor neurons. ALS occurs in over 20,000 individuals throughout the United States, with approximately 5,000 new cases occurring each year. Frontotemporal dementia (FTD; also known as Pick's disease, frontotemporal lobar degeneration, or FTLD) is a group of disorders caused by progressive cell degeneration in the frontal or temporal lobes of the brain. FTD is reported to account for 10% - 15% of all dementia cases. A hexanucleotide repeat expansion between exons 1A and 1B, two non-coding exons of the human C9orf72 gene, has been associated with both ALS and FTD. The G4C2 hexanucleotide repeat expansion is estimated to account for approximately 50% of familial and many non-familial ALS cases. It is present in approximately 25% of familial FTD cases and approximately 8% of sporadic FTD cases.
[0086] Many pathological aspects associated with the hexanucleotide repeat expansion in C9orf72 have been reported, such as the repeat length-dependent formation of RNA foci, sequestration of specific RNA-binding proteins, and the accumulation and aggregation of dipeptide repeat proteins (e.g., poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), and poly(proline-arginine)) resulting from repeat-associated non-AUG (RAN) translation in those neurons.
[0087] C9orf72 has been reported to regulate endosomal transport, but much of the cellular function of C9orf72 remains unknown. Indeed, C9orf72 is a gene encoding an uncharacterized protein with an unknown function.
[0088] Although it is unknown how C9orf72 hexanucleotide repeat expansions cause motor neuron disease and dementia, two common postmortem pathological findings in C9orf72 ALS and FTD patients are associated with the repeat expansions: (1) sense repeat-containing RNAs and antisense repeat-containing RNAs can be visualized as discrete foci in neurons and other cells, and (2) dipeptide repeat proteins - poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), and poly(proline-arginine) - synthesized by repeat-associated non-AUG-dependent translation from sense repeat-containing RNAs and antisense repeat-containing RNAs can be detected in cells. One disease hypothesis proposes that repeat-containing RNAs visualized as foci disrupt cellular RNA metabolism by sequestering RNA-binding proteins. Another disease hypothesis posits that dipeptide repeat proteins exert broad toxic effects on RNA metabolism, proteostasis, and nucleocytoplasmic transport. If C9orf72 repeat-containing RNA transcripts, either by themselves or as templates for the translation of dipeptide repeat proteins, contribute to the etiology in ALS and FTD, a common therapeutic strategy would be to inhibit the synthesis of hexanucleotide repeat-containing RNAs.
[0089] The C9orf72 gene produces transcripts from two transcription start sites. The upstream site initiates transcription at alternative non-coding exon 1A, while the downstream site initiates transcription at alternative exon 1B. Both exon 1A and 1B can be spliced to exon 2, which contains the start of the protein-coding sequence. The pathogenic hexanucleotide repeat expansion is located between exon 1A and 1B. Thus, transcription initiated from exon 1A can produce repeat-containing RNAs, but initiation from exon 1B cannot.
[0090] Mouse C9orf72 transcript variants have been reported. See, for example, Koppers et al. (2015) Ann. Neurol. 78:426-438 and Atkinson et al. (2015) Acta Neuropathologica Communications 3:59, each of which is hereby incorporated by reference in its entirety for all purposes. Genomic information for three reported mouse C9orf72 transcript variants is also available on the Ensembl website under the names ENSMUST00000108127 (V1), ENSMUST00000108126 (V2), and ENSMUST00000084724 (V3). Exemplary non-human (e.g., rodent) C9orf72 mRNA and amino acid sequences are set forth in SEQ ID NOs: 22-25. The mRNA and amino acid sequences of mouse C9orf72 can be found at GenBank accession numbers NM_001081343 and NP_001074812, respectively, which are hereby incorporated by reference in their entirety for all purposes. The sequences of NM_001081343.1 and NP_001074812.1 are set forth in SEQ ID NOs: 22 and 23, respectively. The mRNA and amino acid sequences of rat C9orf72 can be found at GenBank accession numbers NM_001007702 and NP_001007703, respectively, which are hereby incorporated by reference in their entirety for all purposes. The sequences of NM_001007702.1 and NP_001007703.1 are set forth in SEQ ID NOs: 24 and 25, respectively.
[0091] Human C9orf72 transcript variants are also known. One human C9orf72 transcript variant lacks multiple exons in the central and 3' coding regions, and its 3' terminal exon extends beyond the splice site used in variant 3 (see below), which results in a novel 3' untranslated region (UTR) compared to variant 3. This variant encodes a significantly shorter polypeptide, and its C-terminal amino acids are different compared to those encoded by two other variants. The mRNA and amino acid sequences of this variant can be found in GenBank accession numbers NM_145005.6 and NP_659442.2, respectively, and the entire sequences are incorporated herein by reference for all purposes. The sequences of NM_145005.6 and NP_659442.2 are set forth in SEQ ID NO: 26 and SEQ ID NO: 27, respectively. A second human C9orf72 transcript variant (2) has a different 5' untranslated region (UTR) compared to variant 3. The mRNA and amino acid sequences of this variant can be found in GenBank accession numbers NM_018325.4 and NP_060795.1, respectively, and the entire sequences are incorporated herein by reference for all purposes. The sequences of NM_018325.4 and NP_060795.1 are set forth in SEQ ID NO: 28 and SEQ ID NO: 29, respectively. A third human C9orf72 transcript variant (3) contains the longest sequence among the three reported variants and encodes a longer isoform. The mRNA and amino acid sequences of this variant can be found in GenBank accession numbers NM_001256054.2 and NP_001242983.1, respectively, and the entire sequences are incorporated herein by reference for all purposes. The sequences of NM_001256054.2 and NP_001242983.1 are set forth in SEQ ID NO: 30 and SEQ ID NO: 31, respectively. Variants 2 and 3 encode the same protein.
[0092] B. CRISPR / Cas System The methods and compositions disclosed herein utilize a clustered regularly interspaced short palindromic repeat (CRISPR) / CRISPR-associated (Cas) system or components of such a system to inhibit transcription from the C9orf72 exon 1A transcription start site and / or to inhibit the transcription of sense and / or antisense transcripts containing hexanucleotide repeat expansion sequences in the C9orf72 gene in a cell. The CRISPR / Cas systems disclosed herein use nuclease-inactive Cas proteins (i.e., catalytically dead Cas proteins) and can act through the CRISPR interference mechanism to sterically inhibit transcription. For example, the nuclease-inactive Cas protein may not be fused to a heterologous transcriptional repressor domain, and the guide RNA may not be linked to a heterologous transcriptional repressor domain. CRISPR interference (CRISPRi) technology uses catalytically dead Cas proteins (dCas proteins) lacking endonuclease activity to regulate genes in an RNA-guided manner. CRISPRi can sterically inhibit transcription by blocking either transcription initiation or elongation. This is achieved by designing guide RNAs complementary to the promoter or coding sequence, respectively.
[0093] The CRISPR / Cas system includes transcripts and other elements involved in the expression of the Cas gene or that direct its activity. The CRISPR / Cas system can be, for example, a type I, type II, type III system, or type V system (e.g., subtype V-A or subtype V-B). The methods and compositions disclosed herein can employ a CRISPR / Cas system by utilizing a CRISPR complex (including a guide RNA (gRNA) complexed with a Cas protein) for site-specific binding of nucleic acids. A CRISPR / Cas system targeting the C9orf72 gene includes a Cas protein (or a nucleic acid encoding a Cas protein) and one or more guide RNAs (or DNAs encoding one or more guide RNAs), each of the one or more guide RNAs targeting a different guide RNA target sequence at the target genomic locus.
[0094] The CRISPR / Cas systems used in the compositions and methods disclosed herein need not be naturally occurring. Non-naturally occurring systems include any that show the involvement of human hand, such as one or more components of the system being modified or mutated from their naturally occurring state, containing at least substantially no at least one other component with which they are naturally associated in nature, or being associated with at least one other component with which they are not naturally associated. For example, some CRISPR / Cas systems use a non-naturally occurring CRISPR complex that includes a non-naturally occurring gRNA and a Cas protein together, use a non-naturally occurring Cas protein, or use a non-naturally occurring gRNA.
[0095] (1) Target genomic locus The guide RNAs and CRISPR / Cas systems described in the compositions and methods disclosed herein target guide RNA target sequences within the C9orf72 gene. The C9orf72 gene can be, for example, a mammalian C9orf72 gene. In certain examples, the C9orf72 gene includes a human C9orf72 promoter. In certain examples, the C9orf72 gene is the human C9orf72 gene. In another specific example, the C9orf72 gene is a humanized C9orf72 gene. For example, the C9orf72 gene can be a non-human animal (e.g., non-human mammal, rodent, rat, or mouse) C9orf72 gene in which a human hexanucleotide repeat expansion sequence and adjacent human sequences are inserted into the endogenous C9orf72 locus, replacing the corresponding endogenous sequences. See, for example, U.S. Patent Application Publication No. 2020-0196581 and International Publication No. 2020 / 131632, each of which is incorporated herein by reference in its entirety for all purposes.
[0096] Optionally, the C9orf72 gene contains a C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. The C9orf72 hexanucleotide repeat expansion sequence is generally a nucleotide sequence containing at least two tandem repeats (i.e., consecutive repeats adjacent to each other without intervening sequences) of the hexanucleotide sequence G4C2. The hexanucleotide repeat expansion sequence can have any number of repeats. Optionally, the hexanucleotide repeat expansion sequence has more than about 30 repeats. In some embodiments, the hexanucleotide repeat expansion sequence has more than about 100 repeats, more than about 200 repeats, more than about 300 repeats, more than about 400 repeats, more than about 500 repeats, more than about 600 repeats, more than about 700 repeats, more than about 800 repeats, more than about 900 repeats, or more than about 1000 repeats.
[0097] The guide RNA target sequence(s) can be upstream of or near the C9orf72 exon 1A transcription start site and / or within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. Transcription of the C9orf72 gene begins with two alternative non-coding exons: exon 1A (upstream) and exon 1B (downstream). The G4C2 repeat is present between exons 1A and 1B. Exons 1A and 1B can be spliced to exon 2, which is the first protein-coding exon, to produce an mRNA with alternative 5' untranslated regions. In healthy individuals with short G4C2 repeat expansions, transcription mainly begins with exon 1B. RNA containing exon 1A is rare, and repeat-containing RNA is undetectable. Individuals affected by C9orf72 ALS or FTLD accumulate transcripts in which exon 1A is spliced to exon 2, and both sense and antisense repeat-containing RNAs, as well as the DPR proteins translated from them, can be detected by in situ hybridization and immunohistochemistry.
[0098] In one example, the guide RNA target sequence can be within about 250 nucleotides, about 225 nucleotides, about 200 nucleotides, about 175 nucleotides, about 150 nucleotides, about 125 nucleotides, about 100 nucleotides, about 75 nucleotides, about 50 nucleotides, about 25 nucleotides, about 20 nucleotides, or about 10 nucleotides of the C9orf72 exon 1A transcription start site. In another example, the guide RNA target sequence can be within about 100, about 75, about 50, about 25, about 20, or about 10 of the C9orf72 exon 1A transcription start site.
[0099] In one example, the guide RNA target sequence can be within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0100] In some of the compositions and methods disclosed herein, two or more guide RNAs or CRISPR / Cas systems are used to target two or more guide RNA target sequences in the C9orf72 gene. In one example, each of the two or more guide RNA target sequences is upstream of or near the C9orf72 exon 1A transcription start site described above. In another example, each of the two or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some of the compositions and methods disclosed herein, three or more guide RNAs or CRISPR / Cas systems are used to target three or more guide RNA target sequences in the C9orf72 gene. In one example, each of the three or more guide RNA target sequences is upstream of or near the C9orf72 exon 1A transcription start site described above. In another example, each of the three or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In another example, at least one guide RNA target sequence is upstream of or near the C9orf72 exon 1A transcription start site as described above, and at least one guide RNA target sequence is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0101] Some compositions or CRISPR / Cas systems include a first guide RNA that includes a first DNA targeting segment targeting a first guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A. For example, the first guide RNA target sequence can be within about 250 nucleotides, about 225 nucleotides, about 200 nucleotides, about 175 nucleotides, about 150 nucleotides, about 125 nucleotides, about 100 nucleotides, about 75 nucleotides, or about 50 nucleotides of the transcription start site of C9orf72 exon 1A. Alternatively, the first guide RNA target sequence can be within about 100 nucleotides, about 75 nucleotides, or about 50 nucleotides of the transcription start site of C9orf72 exon 1A or any other position disclosed herein. Some compositions or CRISPR / Cas systems include at least two guide RNAs, each different guide RNA targeting a different guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A. Some compositions or CRISPR / Cas systems include at least three guide RNAs, each different guide RNA targeting a different guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A. For example, each guide RNA target sequence can be within about 250 nucleotides, about 225 nucleotides, about 200 nucleotides, about 175 nucleotides, about 150 nucleotides, about 125 nucleotides, about 100 nucleotides, about 75 nucleotides, or about 50 nucleotides of the transcription start site of C9orf72 exon 1A. Alternatively, each guide RNA target sequence can be within about 100 nucleotides, about 75 nucleotides, or about 50 nucleotides of the transcription start site of C9orf72 exon 1A or any other position disclosed herein.
[0102] Some compositions or CRISPR / Cas systems include a guide RNA comprising a DNA targeting segment that targets a guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. Some compositions or CRISPR / Cas systems include at least two guide RNAs, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. Some compositions or CRISPR / Cas systems include at least three guide RNAs, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0103] Some compositions or CRISPR / Cas systems include: (a) a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A, and (b) a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some compositions or CRISPR / Cas systems, part (a) may include at least two guide RNAs, and each different guide RNA targets a different guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A. In some compositions or CRISPR / Cas systems, part (a) may include at least three guide RNAs, and each different guide RNA targets a different guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A. In some compositions or CRISPR / Cas systems, part (b) may include at least two guide RNAs, and each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some compositions or CRISPR / Cas systems, part (b) may include at least three guide RNAs, and each different guide RNA targets a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0104] (2) Cas protein Cas proteins generally include at least one RNA recognition or binding domain that can interact with a guide RNA. Cas proteins can also include a nuclease domain (e.g., a DNase domain or an RNase domain), a DNA binding domain, a helicase domain, a protein-protein interaction domain, a dimerization domain, and other domains. Some such domains (e.g., the DNase domain) can be derived from natural Cas proteins. Other such domains can be added to create a modified Cas protein. The nuclease domain has catalytic activity against nucleic acid cleavage, including cleavage of the covalent bond of a nucleic acid molecule. The cleavage can produce blunt ends or sticky ends and can be single-stranded or double-stranded. For example, wild-type Cas9 protein typically produces blunt cleavage products. Alternatively, wild-type Cpf1 protein (e.g., FnCpf1) can yield cleavage products with a 5-nucleotide 5’ overhang where cleavage occurs after the 18th base pair from the PAM sequence in the non-target strand and after the 23rd base in the target strand. A Cas protein can have full cleavage activity and create a double-strand break at a target genomic locus (e.g., a double-strand break with blunt ends), or can be a nickase that creates a single-strand break at a target genomic locus. The Cas proteins used in the CRISPR / Cas systems and methods disclosed herein are nuclease-inactive Cas proteins (i.e., catalytically dead Cas proteins).
[0105] Examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas9 (Csn1 or Csx12), Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, and Cu1966, as well as homologs or modified versions thereof.
[0106] Exemplary Cas proteins are Cas9 proteins or proteins derived from Cas9 proteins. Cas9 proteins are from the type II CRISPR / Cas system and typically share four important motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins include those from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., derived from Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemijer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, Neisseria meningitidis, or Campylobacter jejuni. Additional examples of Cas9 family members are described in International Publication No. WO 2014 / 131833, which is hereby incorporated by reference in its entirety for all purposes. S.Cas9 derived from pyogenes (SpCas9) (e.g., assigned UniProt accession number Q99ZW2) is an exemplary Cas9 protein. An exemplary SpCas9 protein sequence is shown in SEQ ID NO: 1 (encoded by the DNA sequence set forth in SEQ ID NO: 2). Smaller Cas9 proteins (e.g., Cas9 proteins such as SaCas9 and CjCas9 and Nme2Cas9 whose coding sequences are compatible with the maximum AAV packaging capacity when combined with the guide RNA coding sequences and regulatory elements of the guide RNA of Cas9 and guide RNA) are other exemplary Cas9 proteins. For example, Cas9 derived from S. aureus (SaCas9) (e.g., assigned UniProt accession number J7RUA5) is another exemplary Cas9 protein. Similarly, Cas9 derived from Campylobacter jejuni (CjCas9) (e.g., assigned UniProt accession number Q0P897) is another exemplary Cas9 protein. See, for example, Kim et al. (2017) Nat. Commun. 8:14500, which is incorporated herein by reference in its entirety for all purposes. SaCas9 is smaller than SpCas9, and CjCas9 is smaller than both SaCas9 and SpCas9. Cas9 derived from Neisseria meningitidis (Nme2Cas9) is another exemplary Cas9 protein. See, for example, Edraki et al. (2019) Mol.Reference is made to Cell 73(4):714-726, which is hereby incorporated by reference in its entirety for all purposes. Cas9 proteins from Streptococcus thermophilus (e.g., Streptococcus thermophilus LMD-9 Cas9 encoded by the CRISPR1 locus (St1Cas9) or Streptococcus thermophilus Cas9 from the CRISPR3 locus (St3Cas9)) are other exemplary Cas9 proteins. Cas9 from Francisella novicida (FnCas9) or the RHA Francisella novicida Cas9 variant that recognizes an alternative PAM (E1369R / E1449H / R1556A substitution) are other exemplary Cas9 proteins. These and other exemplary Cas9 proteins are provided, for example, in Cebrian-Serrano and Davies (2017) Mamm. Genome 28(7):247-261, which is hereby incorporated by reference in its entirety for all purposes. Examples of Cas9 coding sequences, Cas9 mRNAs, and Cas9 protein sequences are provided in International Publication No. WO 2013 / 176772, International Publication No. WO 2014 / 065596, International Publication No. WO 2016 / 106121, International Publication No. WO 2019 / 067910, International Publication No. WO 2020 / 082042, U.S. Patent Application Publication No. 2020 / 0270617, International Publication No. WO 2020 / 082041, U.S. Patent Application Publication 2020 / 0268906, International Publication No. WO 2020 / 082046, and U.S. Patent Application Publication 2020 / 0289628, each of which is hereby incorporated by reference in its entirety for all purposes. Specific examples of ORF and Cas9 amino acid sequences are provided in Table 30 of paragraph
[0449] of International Publication No. WO 2019 / 067910, and specific examples of Cas9 mRNAs and ORFs are provided in paragraphs
[0214] -
[0234] of International Publication No. WO 2019 / 067910. Also, reference is made to Table 24 in International Publication No. WO 2020 / 082046(A2) (pp. 84-85) and International Publication No. WO 2020 / 069296, each of which is hereby incorporated by reference in its entirety for all purposes..
[0107] Another example of a Cas protein is the CRISPR protein from Cpf1 (Prevotella and Francisella 1; Cas12a). Cpf1 is a large protein (about 1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain of Cas9, along with a counterpart of the characteristic arginine-rich cluster of Cas9. However, Cpf1 lacks the HNH nuclease domain present in the Cas9 protein, and in contrast to Cas9 which contains a long insert including the HNH domain, the RuvC-like domain is continuous in the Cpf1 sequence. See, for example, Zetsche et al. (2015) Cell 163(3):759-771, which is hereby incorporated by reference in its entirety for all purposes. Exemplary Cpf1 proteins are derived from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44 17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6, Lachnospiraceae bacterium MA2020, Candidates Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae. Cpf1 derived from Francisella novicida U112 (FnCpf1; assigned UniProt accession number A0Q7Q2) is an exemplary Cpf1 protein.
[0108] Another example of a Cas protein is CasX (Cas12e). CasX is an RNA-guided DNA endonuclease that generates sticky double-strand breaks in DNA. CasX is less than 1000 amino acids in size. Exemplary CasX proteins are from Deltaproteobacteria (DpbCasX or DpbCas12e) and Planctomycetes (PlmCasX or PlmCas12e). Similar to Cpf1, CasX uses a single RuvC active site for DNA cleavage. See, for example, Liu et al. (2019) Nature 566(7743):218-223, which is hereby incorporated by reference in its entirety for all purposes.
[0109] Another example of a Cas protein is CasΦ (CasPhi or Cas12j), which is uniquely found in bacteriophages. CasΦ is less than 1000 amino acids in size (e.g., 700 - 800 amino acids). CasΦ cleavage generates sticky 5’ overhangs. The single RuvC active site in CasΦ enables crRNA processing and DNA cleavage. See, for example, Pausch et al. (2020) Science 369(6501):333-337, which is hereby incorporated by reference in its entirety for all purposes.
[0110] A Cas protein can be a modified Cas protein (i.e., a Cas protein variant), or a fragment of a wild-type or modified Cas protein.
[0111] An example of a modified Cas protein is the modified SpCas9-HF1 protein, which is a high-fidelity variant of Streptococcus pyogenes Cas9 with modifications (N497A / R661A / Q695A / Q926A) designed to reduce non-specific DNA contacts. See, for example, Kleinstiver et al. (2016) Nature 529(7587):490-495, which is hereby incorporated by reference in its entirety for all purposes. Another example of a modified Cas protein is the modified eSpCas9 variant (K848A / K1003A / R1060A) designed to reduce off-target effects. See, for example, Slaymaker et al. (2016) Science 351(6268):84-88, which is hereby incorporated by reference in its entirety for all purposes. Other SpCas9 variants include K855A and K810A / K1003A / R1060A. These and other modified Cas proteins are described, for example, in Cebrian-Serrano and Davie (2017) Mamm. Genome 28(7):247-261, which is hereby incorporated by reference in its entirety for all purposes. Another example of a modified Cas9 protein is xCas9, which is a SpCas9 variant that can recognize an expanded range of PAM sequences. See, for example, Hu et al. (2018) Nature 556:57-63, which is hereby incorporated by reference in its entirety for all purposes.
[0112] The Cas protein can be modified to increase or decrease one or more of nucleic acid binding affinity, nucleic acid binding specificity, and enzymatic activity. The Cas protein can also be modified to alter other activities or properties of the protein, such as stability. For example, one or more nuclease domains of the Cas protein can be modified, deleted, or inactivated, or the Cas protein can be truncated to remove domains that are not essential for the function of the protein, or the activity or properties of the Cas protein can be optimized (e.g., enhanced or reduced).
[0113] Cas proteins can include at least one nuclease domain, such as a DNase domain. For example, wild-type Cpf1 protein generally contains a RuvC-like domain that, presumably in a dimeric conformation, cleaves both strands of the target DNA. Similarly, CasX and CasΦ generally contain a single RuvC-like domain that cleaves both strands of the target DNA. Cas proteins can also include at least two nuclease domains, such as a DNase domain. For example, wild-type Cas9 protein generally contains a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC domain and the HNH domain can each cleave different strands of double-stranded DNA to effect a double-strand break in the DNA. See, for example, Jinek et al. (2012) Science 337(6096):816-821, which is hereby incorporated by reference in its entirety for all purposes.
[0114] One or more of the nuclease domains can be deleted or mutated such that they are no longer functional or reduce the reduced nuclease activity. For example, if one of the nuclease domains is deleted or mutated in the Cas9 protein, the resulting Cas9 protein can be referred to as a nickase and can generate single-strand breaks within double-stranded target DNA, but cannot generate double-strand breaks (i.e., it can cleave complementary or non-complementary strands, but not both). If none of the nuclease domains are deleted or mutated in the Cas9 protein, the Cas9 protein retains double-strand break-inducing activity. An example of a mutation that converts Cas9 to a nickase is the D10A (from alanine to aspartic acid at position 10 of Cas9) mutation in the RuvC domain of Cas9 from S. pyogenes. Similarly, H939A (from histidine to alanine at amino acid position 839), H840A (from histidine to alanine at amino acid position 840), or N863A (from asparagine to alanine at amino acid position N863) in the HNH domain of Cas9 from S. pyogenes can convert Cas9 to a nickase. Other examples of mutations that convert Cas9 to a nickase include the corresponding mutations for Cas9 from S. thermophilus. See, for example, Sapranauskas et al. (2011) Nucleic Acids Res. 39(21):9275-9282 and International Publication No. WO 2013 / 141680, each of which is incorporated herein by reference in its entirety for all purposes. Such mutations can be generated using methods such as site-directed mutagenesis, PCR-mediated mutagenesis, or total gene synthesis. Other examples of mutations that create nickases can be found, for example, in International Publication Nos. WO 2013 / 176772 and WO 2013 / 142578, each of which is incorporated herein by reference in its entirety for all purposes.
[0115] Examples of inactivating mutations in the catalytic domain of xCas9 are the same as those described above for SpCas9. Examples of inactivating mutations in the catalytic domain of Staphylococcus aureus Cas9 protein are also known. For example, the Staphylococcus aureus Cas9 enzyme (SaCas9) may include a substitution at position N580 (e.g., N580A substitution) or a substitution at position D10 (e.g., D10A substitution) to generate a Cas nickase. See, for example, International Publication No. WO 2016 / 106236, which is incorporated herein by reference in its entirety for all purposes. Examples of inactivating mutations in the catalytic domain of Nme2Cas9 are also known (e.g., D16A or H588A). Examples of inactivating mutations in the catalytic domain of St1Cas9 are also known (e.g., D9A, D598A, H599A, or N622A). Examples of inactivating mutations in the catalytic domain of St3Cas9 are also known (e.g., D10A or N870A). Examples of inactivating mutations in the catalytic domain of CjCas9 are also known (e.g., a combination of D8A or H559A). Examples of inactivating mutations in the catalytic domain of FnCas9 and RHA FnCas9 are also known (e.g., N995A).
[0116] Examples of inactivating mutations in the catalytic domain of Cpf1 proteins are also known. For Cpf1 proteins from Francisella novicida U112 (FnCpf1), Acidaminococcus sp. BV3L6 (AsCpf1), Lachnospiraceae bacterium ND2006 (LbCpf1), and Moraxella bovoculi 237 (MbCpf1 Cpf1), such mutations can include mutations at position 908, 993, or 1263 of AsCpf1 or corresponding positions in Cpf1 orthologs, or at position 832, 925, 947, or 1180 of LbCpf1 or corresponding positions in Cpf1 orthologs. Such mutations can include, for example, one or more of the mutations D908A, E993A, and D1263A of AsCpf1 or corresponding mutations in Cpf1 orthologs, or D832A, E925A, D947A, and D1180A of LbCpf1 or corresponding mutations in Cpf1 orthologs. See, for example, U.S. Patent Application Publication No. 2016 / 0208243, which is hereby incorporated by reference in its entirety for all purposes.
[0117] Examples of inactivating mutations in the catalytic domain of CasX proteins are also known. For CasX proteins from Deltaproteobacteria, D672A, E769A, and D935A (individually or in combination) or corresponding positions in other CasX orthologs are inactivated. See, for example, Liu et al. (2019) Nature 566(7743):218 - 223, which is hereby incorporated by reference in its entirety for all purposes.
[0118] Examples of inactivating mutations in the catalytic domain of CasΦ proteins are also known. For example, D371A and D394A are inactivating mutations, either alone or in combination. See, for example, Pausch et al. (2020) Science 369(6501):333 - 337, which is hereby incorporated by reference in its entirety for all purposes.
[0119] The Cas protein can also be operably linked to a heterologous polypeptide as a fusion protein. Reference is made to International Publication No. WO 2014 / 089290, which is hereby incorporated by reference in its entirety for all purposes. The Cas protein can also be fused to a heterologous polypeptide that provides increased or decreased stability. The fusion domain or heterologous polypeptide can be located internally within the N-terminus, C-terminus, or Cas protein.
[0120] As an example, the Cas protein can be fused to one or more heterologous polypeptides that provide intracellular localization. Such heterologous polypeptides can include, for example, one or more nuclear localization signals (NLSs) such as a single-part SV40 NLS and / or a bipartite alpha importin NLS for targeting the nucleus, a mitochondrial localization signal for targeting mitochondria, an ER retention signal, and the like. See, for example, Lange et al. (2007) J. Biol. Chem. 282(8):5101-5105, which is hereby incorporated by reference in its entirety for all purposes. Such intracellular localization signals can be placed anywhere within the N-terminus, C-terminus, or Cas protein. The NLS can contain a stretch of basic amino acids and can be a single-part sequence or a bipartite sequence. Optionally, the Cas protein can contain two or more NLSs, including an NLS (e.g., an alpha importin NLS or a single-part NLS) at the N-terminus and an NLS (e.g., an SV40 NLS or a bipartite NLS) at the C-terminus. The Cas protein can also contain two or more NLSs at the N-terminus and / or two or more NLSs at the C-terminus.
[0121] The Cas protein can be fused with, for example, 1 to 10 NLSs (e.g., fused with 1 to 5 NLSs, can be fused with 1 NLS). When one NLS is used, the NLS may be linked at the N-terminus or C-terminus of the Cas protein sequence. The NLS may also be inserted within the Cas protein sequence. Alternatively, the Cas protein may be fused with two or more NLSs. For example, the Cas protein may be fused with 2, 3, 4, or 5 NLSs. In a specific example, the Cas protein may be fused with two NLSs. In certain situations, the two NLSs may be the same (e.g., two SV40 NLSs) or different. For example, the Cas protein can be fused with two SV40 NLS sequences linked at the carboxy terminus. Alternatively, the Cas protein may be fused with two NLSs, one linked at the N-terminus and one at the C-terminus. In other examples, the Cas protein may be fused with three NLSs or fused without an NLS. The NLS can be, for example, a single partial sequence such as SV40 NLS, PKKKRKV (SEQ ID NO: 3) or PKKKRRV (SEQ ID NO: 4). The NLS can be a bipartite sequence such as the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 5). In a specific example, a single PKKKRKV (SEQ ID NO: 3) NLS can be linked at the C-terminus of the Cas protein. One or more linkers may optionally be included at the fusion site.
[0122] The Cas protein can also be operably linked to a cell-permeable domain or protein transduction domain. For example, the cell-permeable domain can be derived from the HIV-1 TAT protein, the TLM cell-permeable motif from human hepatitis B virus, MPG, Pep-1, VP22, a cell-permeable peptide from herpes simplex virus, or a polyarginine peptide sequence. See, for example, International Publication Nos. WO 2014 / 089290 and WO 2013 / 176772, each of which is hereby incorporated by reference in its entirety for all purposes. The cell-permeable domain can be located at the N-terminus, C-terminus, or anywhere within the Cas protein.
[0123] Cas proteins can also be operably linked to heterologous polypeptides, such as fluorescent proteins, purification tags, or epitope tags, to facilitate tracking or purification. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., eCFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (e.g., mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein.Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and calmodulin.
[0124] Cas proteins can also be tethered to a labeled nucleic acid. Such tethering (i.e., physical linkage) can be achieved via covalent or non-covalent interactions, and the tethering can be direct (e.g., via direct fusion or chemical bond that can be achieved by modification of cysteine or lysine residues on the protein or intein modification), or via one or more intervening linker or adapter molecules such as streptavidin or an aptamer. See, for example, Pierce et al. (2005) Mini Rev. Med. Chem. 5(1):41-55, Duckworth et al. (2007) Angew. Chem. Int. Ed. Engl. 46(46):8819-8822; Schaeffer and Dixon (2009) Australian J. Chem. 62(10):1328-1332; Goodman et al. (2009) Chembiochem. 10(9):1551-1557; and Khatwani et al. (2012) Bioorg. Med. Chem. 20(14):4532-4539, each of which is hereby incorporated by reference in its entirety for all purposes. Non-covalent strategies for synthesizing protein-nucleic acid conjugates include the biotin-streptavidin and nickel-histidine methods. Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately functionalized nucleic acids and proteins using various chemicals. Some of these chemicals involve direct binding of oligonucleotides to amino acid residues on the protein surface (e.g., lysine amine or cysteine thiol), while other more complex schemes require the involvement of post-translational modification of the protein or catalytic or reactive protein domains. Methods for covalent attachment of a protein to a nucleic acid can include, for example, chemical cross-linking of an oligonucleotide to a protein lysine or cysteine residue, expressed protein ligation, chemoenzymatic methods, and the use of photoaptamers. The labeled nucleic acid can be tethered to the C-terminus, N-terminus, or internal region of the Cas protein. In one example, the labeled nucleic acid is tethered to the C-terminus or N-terminus of the Cas protein.Similarly, the Cas protein can be tethered to the 5' end, 3' end, or internal region of the labeled nucleic acid. That is, the labeled nucleic acid can be tethered in any orientation and polarity. For example, the Cas protein can be tethered to the 5' end or 3' end of the labeled nucleic acid.
[0125] The Cas protein can be provided in any form. For example, the Cas protein can be provided in the form of a protein such as a Cas protein complexed with gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA. Optionally, the nucleic acid encoding the Cas protein can be codon-optimized for efficient translation to the protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to alternative codons that are more frequently used in bacterial cells, yeast cells, human cells, non-human cells, mammalian cells, rodent cells, mouse cells, rat cells, or any other host cell of interest, compared to the naturally occurring polynucleotide sequence. When the nucleic acid encoding the Cas protein is introduced into a cell, the Cas protein can be expressed transiently, conditionally, or constitutively within the cell.
[0126] The nucleic acid encoding the Cas protein can be stably integrated into the genome of the cell and operably linked to an active promoter within the cell. Alternatively, the nucleic acid encoding the Cas protein can be operably linked to a promoter in an expression construct. The expression construct can direct the expression of a gene or other nucleic acid sequence of interest (e.g., the Cas gene) and includes any nucleic acid construct capable of transferring such a nucleic acid sequence of interest into a target cell. For example, the nucleic acid encoding the Cas protein can be present within a vector containing DNA encoding the gRNA. Alternatively, the nucleic acid can be in a vector or plasmid separate from the vector containing DNA encoding the gRNA. Promoters that can be used in the expression construct include, for example, promoters active in human cells, human nerve cells, or human motor nerve cells. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Optionally, the promoter can be a bidirectional promoter that drives the expression of both the Cas protein in one direction and the guide RNA in the other direction. Such a bidirectional promoter can consist of (1) a complete conventional unidirectional Pol III promoter containing three external control elements, a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box, and (2) a second basic Pol III promoter containing a PSE and a TATA box fused in the reverse direction to the 5' end of the DSE. For example, in the H1 promoter, the DSE is adjacent to the PSE and the TATA box, and the promoter can be made bidirectional by creating a hybrid promoter in which the reverse transcription is controlled by adding a PSE and a TATA box derived from the U6 promoter. See, for example, U.S. Patent Application Publication No. 2016 / 0074535, which is hereby incorporated by reference in its entirety for all purposes. Simultaneous expression of the genes encoding the Cas protein and the guide RNA using a bidirectional promoter makes it possible to generate a compact expression cassette and facilitate delivery. In certain embodiments, the promoter is approved by a regulatory authority for use in humans.In certain embodiments, the promoter drives expression in neurons.
[0127] Various promoters can be used to drive Cas expression or Cas9 expression. In some methods, small promoters are used so that the Cas or Cas9 coding sequence can be compatible with the AAV construct. For example, Cas or Cas9 and one or more gRNAs (e.g., one gRNA or two gRNAs or three gRNAs or four gRNAs) can be delivered via LNP-mediated delivery (e.g., in the form of RNA) or adeno-associated virus (AAV)-mediated delivery (e.g., AAV8-mediated delivery). For example, the nuclease agent can be CRISPR / Cas9, and Cas9 mRNA and gRNAs (e.g., targeting the C9orf72 gene (e.g., the human C9orf72 gene) upstream or in the vicinity of the exon 1A transcription start site) can be delivered via LNP-mediated delivery or AAV-mediated delivery. Cas or Cas9 and gRNA(s) can be delivered in a single AAV or via two separate AAVs. For example, the first AAV can carry the Cas or Cas9 expression cassette, and the second AAV can carry the gRNA expression cassette. Similarly, the first AAV can carry the Cas or Cas9 expression cassette, and the second AAV can carry two or more gRNA expression cassettes. Alternatively, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and a gRNA expression cassette (e.g., a gRNA coding sequence operably linked to a promoter). Similarly, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and two or more gRNA expression cassettes (e.g., a gRNA coding sequence operably linked to a promoter). Various promoters such as the U6 promoter or small tRNA Gn can be used to drive the expression of gRNAs. Similarly, various promoters can be used to drive the expression of Cas9. For example, small promoters are used so that the Cas9 coding sequence can be compatible with the AAV construct. Similarly, small Cas9 proteins (e.g., using SaCas9 or CjCas9 to maximize the AAV packaging capacity).
[0128] The Cas protein provided as mRNA can be modified to improve stability and / or immunogenic properties. The modification can be performed on one or more nucleosides within the mRNA. The mRNA encoding the Cas protein can also be capped. The Cas mRNA can further include a polyadenylation (polyA or poly(A) or polyadenine) tail. For example, the Cas mRNA can include a modification to one or more nucleosides within the mRNA, the Cas mRNA can be capped, and the Cas mRNA can include a poly(A) tail.
[0129] (3) Guide RNA "Guide RNA" or "gRNA" is an RNA molecule that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within a target DNA. The guide RNA can include two segments: a "DNA targeting segment" (also referred to as the "guide sequence") and a "protein binding segment". A "segment" includes a section or region of a molecule, e.g., a continuous range of nucleotides in an RNA. Some gRNAs, such as those for Cas9, can include two separate RNA molecules: an "activator RNA" (e.g., tracrRNA) and a "targeter RNA" (e.g., CRISPR RNA or crRNA). Other gRNAs are single RNA molecules (single RNA polynucleotides), which can also be referred to as "single molecule gRNAs", "single guide RNAs", or "sgRNAs". See, for example, International Publication Nos. WO 2013 / 176772, WO 2014 / 065596, WO 2014 / 089290, WO 2014 / 093622, WO 2014 / 099750, WO 2013 / 142578, and WO 2014 / 131833, each of which is hereby incorporated by reference in its entirety for all purposes. The guide RNA can refer to either a CRISPR RNA (crRNA) or a combination of a crRNA and a trans-activating CRISPR RNA (tracrRNA). The crRNA and tracrRNA can be associated as a single RNA molecule (single guide RNA or sgRNA), or in two separate RNA molecules (dual guide RNA or dgRNA). For example, in the case of Cas9, the single guide RNA can include a crRNA fused to a tracrRNA (e.g., via a linker). For example, in the case of Cpf1 and Cas, only the crRNA is required to achieve binding to the target sequence. The terms "guide RNA" and "gRNA" include both bimolecular (i.e., modular) gRNAs and single molecule gRNAs. In some of the methods and compositions disclosed herein, the gRNA is a S. pyogenes Cas9 gRNA or an equivalent thereof.In some of the methods and compositions disclosed herein, the gRNA is an S. aureus Cas9 gRNA or an equivalent thereof.
[0130] Exemplary two-molecule gRNAs include a crRNA-like (“CRISPR RNA” or “targeter RNA” or “crRNA” or “crRNA repeat”) molecule and a corresponding tracrRNA-like (“trans-activating CRISPR RNA” or “activator RNA” or “tracrRNA”) molecule. The crRNA includes both the DNA targeting segment (single-stranded) of the gRNA and a stretch of nucleotides that forms half of the dsRNA duplex of the protein-binding segment of the gRNA. Examples of crRNA tails (for use with, e.g., S. pyogenes Cas9) located downstream (3′) of the DNA targeting segment include, consist essentially of, or consist of GUUUUAGAGCUAUGCU (SEQ ID NO: 6) or GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 7). Any of the DNA targeting segments disclosed herein can bind to the 5′ end of SEQ ID NO: 6 or 7 to form a crRNA.
[0131] The corresponding tracrRNA (activator-RNA) contains a stretch of nucleotides that forms the other half of the dsRNA duplex of the protein-binding segment of the gRNA. The stretch of nucleotides of the crRNA is complementary to the stretch of nucleotides of the tracrRNA and hybridizes with it to form the dsRNA duplex of the protein-binding domain of the gRNA. Thus, each crRNA can be said to have a corresponding tracrRNA. Examples of tracrRNA sequences (e.g., for use with S. pyogenes Cas9) include any one of AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU (SEQ ID NO:8), AAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO:9), or GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (SEQ ID NO:10), consist essentially of, or consist of.
[0132] In systems where both crRNA and tracrRNA are required, the crRNA and the corresponding tracrRNA hybridize to form the gRNA. In systems where only crRNA is required, the crRNA can be the gRNA. The crRNA additionally provides a single-stranded DNA targeting segment that hybridizes to the complementary strand of the target DNA. When used for intracellular modification, the exact sequence of a given crRNA or tracrRNA molecule can be designed to be specific to the species in which the RNA molecule is used. See, for example, Mali et al. (2013) Science 339(6121):823-826; Jinek et al. (2012) Science 337(6096):816-821; Hwang et al. (2013) Nat. Biotechnol. 31(3):227-229; Jiang et al. (2013) Nat. Biotechnol. 31(3):233-239, and Cong et al. (2013) Science 339(6121):819:823, each of which is hereby incorporated by reference in its entirety for all purposes.
[0133] The DNA targeting segment (crRNA) of a given gRNA contains a nucleotide sequence that is complementary to a sequence on the complementary strand of the target DNA, as described in more detail below. The DNA targeting segment of the gRNA interacts with the target DNA in a sequence-specific manner via hybridization (i.e., base pairing). Thus, the nucleotide sequence of the DNA targeting segment varies and can determine the position within the target DNA where the gRNA and target DNA interact. The DNA targeting segment of a desired gRNA can be modified to hybridize to any desired sequence within the target DNA. Naturally occurring crRNAs vary depending on the CRISPR / Cas system and organism, but often contain a targeting segment 21-72 nucleotides in length flanked by two direct repeats (DRs) 21-46 nucleotides in length (see, e.g., International Publication No. WO 2014 / 131833, which is hereby incorporated by reference in its entirety for all purposes). In the case of S. pyogenes, the DR is 36 nucleotides in length and the targeting segment is 30 nucleotides in length. The DR located 3' is complementary to and hybridizes with the corresponding tracrRNA, which then binds to the Cas protein.
[0134] DNA targeting segments can have, for example, a nucleotide length of at least about 12, at least about 15, at least about 17, at least about 18, at least about 19, at least about 20, at least about 25, at least about 30, at least about 35, or at least about 40. Such DNA targeting segments can have, for example, a nucleotide length of about 12 to about 100, about 12 to about 80, about 12 to about 50, about 12 to about 40, about 12 to about 30, about 12 to about 25, or about 12 to about 20. For example, a DNA targeting segment can be about 15 to about 25 nucleotides (e.g., about 17 to about 20 nucleotides, or about 17, 18, 19, or 20 nucleotides). For example, reference is made to U.S. Patent Application Publication No. 2016 / 0024523, which is hereby incorporated by reference in its entirety for all purposes. In the case of Cas9 from S. pyogenes, a canonical DNA targeting segment is 16 - 20 nucleotides in length, or 17 - 20 nucleotides in length. In the case of Cas9 from S. aureus, a typical DNA targeting segment is 21 - 23 nucleotides in length. In the case of Cpf1, a typical DNA targeting segment is at least 16 nucleotides in length or at least 18 nucleotides in length.
[0135] In one example, the DNA targeting segment can be about 20 nucleotides in length. However, shorter and longer sequences can also be used as the targeting segment (e.g., lengths of 15-25 nucleotides such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length). The degree of identity between the DNA targeting segment and the corresponding guide RNA target sequence (or the degree of complementarity between the DNA targeting segment and the other strand of the guide RNA target sequence) can be, for example, about 75%, about 80%, about 85%, about 90%, 95%, or 100%. The DNA targeting segment and the corresponding guide RNA target sequence can contain one or more mismatches. For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches (e.g., where the full length of the guide RNA target sequence is at least 17, at least 18, at least 19, or at least 20 or more nucleotides). For example, the DNA targeting segment of the guide RNA and the corresponding guide RNA target sequence can contain 1-4, 1-3, 1-2, 1, 2, 3, or 4 mismatches where the full length of the guide RNA target sequence is 20 nucleotides.
[0136] As an example, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) having the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91.Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 72-91 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0137] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., mouse C9orf72 guide RNA target sequences upstream of or near the transcriptional start site of C9orf72 exon 1A) may include, consist essentially of, or consist of a DNA targeting segment (i.e., guide sequence) having a sequence (DNA targeting segment) described in one or more or all of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., mouse C9orf72 guide RNA target sequences upstream of or near the transcriptional start site of C9orf72 exon 1A) may include, consist essentially of, or consist of a DNA targeting segment having at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of a sequence (DNA targeting segment) described in one or more or all of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., mouse C9orf72 guide RNA target sequences upstream of or near the transcriptional start site of C9orf72 exon 1A) may include a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to a sequence (DNA targeting segment) described in one or more or all of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., mouse C9orf72 guide RNA target sequences upstream of or near the transcriptional start site of C9orf72 exon 1A) may include a DNA targeting segment that is at least 90% or at least 95% identical to a sequence (DNA targeting segment) described in one or more or all of SEQ ID NOs: 72-91.Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 72-91. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 72-91 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in one or more or all of SEQ ID NOs: 72 to 91 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0138] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) that includes the sequence (DNA targeting segment) set forth in SEQ ID NO: 74. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 74. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 74. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 74.Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from the sequence set forth in SEQ ID NO: 74 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a mouse C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 74 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0139] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) having the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92-111 and 113.Alternatively, a guide RNA targeting the C9orf72 gene upstream of or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92-111 and 113 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 92 to 111 and 113 by at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides and 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0140] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., human C9orf72 guide RNA target sequences upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may contain, consist essentially of, or consist of a DNA targeting segment (i.e., guide sequence) that includes one or more or all of the sequences (DNA targeting segments) described in SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., human C9orf72 guide RNA target sequences upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of one or more or all of the sequences (DNA targeting segments) described in SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., human C9orf72 guide RNA target sequences upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to one or more or all of the sequences (DNA targeting segments) described in SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., human C9orf72 guide RNA target sequences upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may contain a DNA targeting segment that is at least 90% or at least 95% identical to one or more or all of the sequences (DNA targeting segments) described in SEQ ID NOs: 92-111 and 113.Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 92-111 and 113. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that contains a sequence that differs from the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 92-111 and 113 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides, or consists essentially of such a sequence, or consists of such a sequence.Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may include, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 92-111 and 113 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0141] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) having the sequence set forth in any one of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93-95 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence set forth in any one of SEQ ID NOs: 93-95 (DNA targeting segment).Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 93-95 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 93-95 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0142] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., human C9orf72 guide RNA target sequences upstream of or near the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment (i.e., guide sequence) that includes one or more or all of the sequences (DNA targeting segments) set forth in SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., human C9orf72 guide RNA target sequences upstream of or near the transcription start site of C9orf72 exon 1A) may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of one or more or all of the sequences (DNA targeting segments) set forth in SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of the transcription start site of C9orf72 exon 1A (e.g., human C9orf72 guide RNA target sequences upstream of or near the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to one or more or all of the sequences (DNA targeting segments) set forth in SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., human C9orf72 guide RNA target sequences upstream of or near the transcription start site of C9orf72 exon 1A) may contain a DNA targeting segment that is at least 90% or at least 95% identical to one or more or all of the sequences (DNA targeting segments) set forth in SEQ ID NOs: 93-95.Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 93-95. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from the sequences (DNA targeting segments) set forth in one or more or all of SEQ ID NOs: 93-95 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include, consist essentially of, or consist of a DNA targeting segment that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in one or more or all of SEQ ID NOs: 93-95 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0143] As an example, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) may comprise, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) that contains the sequence (DNA targeting segment) set forth in SEQ ID NO: 93. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) may comprise, consist essentially of, or consist of a DNA targeting segment that contains at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 93. Alternatively, a guide RNA targeting the C9orf72 gene upstream of the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 93. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 93.Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 93 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 93 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that contains a sequence that differs from the sequence set forth in SEQ ID NO: 93 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides, consists essentially of such a sequence, or consists of such a sequence. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that contains a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 93 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides, consists essentially of such a sequence, or consists of such a sequence.
[0144] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) that includes the sequence (DNA targeting segment) set forth in SEQ ID NO: 94. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 94. Alternatively, a guide RNA targeting the C9orf72 gene upstream of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 94. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may include a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 94.Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 94 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 94 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from the sequence set forth in SEQ ID NO: 94 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may comprise, consist essentially of, or consist of a DNA targeting segment that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 94 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0145] As an example, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may comprise, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) comprising the sequence (DNA targeting segment) set forth in SEQ ID NO: 95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may comprise, consist essentially of, or consist of a DNA targeting segment comprising at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 95. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 95.Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 95 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 95 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that contains a sequence that differs from the sequence set forth in SEQ ID NO: 95 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides, consists essentially of such a sequence, or consists of such a sequence. Alternatively, a guide RNA targeting the C9orf72 gene upstream of or near the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site) may comprise a DNA targeting segment that contains a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 95 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides, consists essentially of such a sequence, or consists of such a sequence.
[0146] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment having a sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9or2 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment that contains at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides (DNA targeting segment) of the sequence set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121.Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0147] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment having the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121.Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence (DNA targeting segment) set forth in any one of SEQ ID NOs: 118 to 121 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides (DNA targeting segment) of the sequence set forth in any one of SEQ ID NOs: 118 to 121 by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0148] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) that includes the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 118. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence (DNA targeting segment) set forth in SEQ ID NO: 118.Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence set forth in SEQ ID NO: 118 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, the guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence set forth in SEQ ID NO: 118 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides and that comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 118 (DNA targeting segment).
[0149] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) that contains the sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment that contains at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 119 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 119 (DNA targeting segment).Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence set forth in SEQ ID NO: 119 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 119 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0150] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) that includes the sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 120 (DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may contain a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 120 (DNA targeting segment).Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence set forth in SEQ ID NO: 120 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 120 (DNA targeting segment) by 3 or fewer, 2 or fewer, or 1 or fewer nucleotides.
[0151] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may include, consist essentially of, or consist of a DNA targeting segment (i.e., a guide sequence) that includes the sequence set forth in SEQ ID NO: 121 (the DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may include, consist essentially of, or consist of a DNA targeting segment that includes at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 121 (the DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may include a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence set forth in SEQ ID NO: 121 (the DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may include a DNA targeting segment that is at least 90% or at least 95% identical to the sequence set forth in SEQ ID NO: 121 (the DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may include a DNA targeting segment that is at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 121 (the DNA targeting segment). Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may include a DNA targeting segment that is at least 90% or at least 95% identical to at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 121 (the DNA targeting segment).Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from the sequence set forth in SEQ ID NO: 121 (DNA targeting segment) by three or fewer, two or fewer, or one or fewer nucleotides. Alternatively, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion may comprise, consist essentially of, or consist of a DNA targeting segment having a sequence that differs from at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence set forth in SEQ ID NO: 121 (DNA targeting segment) by three or fewer, two or fewer, or one or fewer nucleotides.
[0152] The tracrRNA can be in any form (e.g., full-length tracrRNA or the active portion tracrRNA) and can be of various lengths. They can include primary transcripts or processed forms. For example, the tracrRNA (as part of a single guide RNA or as a separate molecule as part of a two-molecule gRNA) can contain, consist essentially of, or consist of all or part of a wild-type tracrRNA sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85, or more nucleotides of a wild-type tracrRNA sequence). Examples of wild-type tracrRNA sequences from S. pyogenes include 171-nucleotide, 89-nucleotide, 75-nucleotide, and 65-nucleotide versions. See, for example, Deltcheva et al. (2011) Nature 471(7340):602-607; International Publication No. WO 2014 / 093661, each of which is hereby incorporated by reference in its entirety for all purposes. Examples of tracrRNAs within a single guide RNA (sgRNA) include tracrRNA segments found within the +48, +54, +67, and +85 versions of the sgRNA, where “+n” indicates that the maximum +n nucleotides of the wild-type tracrRNA are included in the sgRNA. See US 8,697,359, which is hereby incorporated by reference in its entirety for all purposes.
[0153] The percentage of complementarity between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%). The percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be at least 60% over about 20 consecutive nucleotides. As an example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over 14 consecutive nucleotides at the 5' end of the complementary strand of the target DNA and as low as 0% over the remaining portion. In such a case, the DNA targeting segment can be considered to be 14 nucleotides in length. As another example, the percentage of complementarity between the DNA targeting segment and the complementary strand of the target DNA can be 100% over 7 consecutive nucleotides at the 5' end of the complementary strand of the target DNA and as low as 0% over the remaining portion. In such a case, the DNA targeting segment can be considered to be 7 nucleotides in length. In some guide RNAs, at least 17 nucleotides within the DNA targeting segment are complementary to the complementary strand of the target DNA. For example, the DNA targeting segment can be 20 nucleotides in length and can contain 1, 2, or 3 mismatches with the complementary strand of the target DNA. In one example, the mismatch is not adjacent to the region of the complementary strand corresponding to the protospacer adjacent motif (PAM) sequence (i.e., the reverse complement of the PAM sequence) (e.g., the mismatch is at the 5' end of the DNA targeting segment of the guide RNA or the mismatch is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, or 19 base pairs away from the region of the complementary strand corresponding to the PAM sequence).
[0154] The protein-binding segment of the gRNA can include a stretch of two nucleotides that are complementary to each other. The complementary nucleotides of the protein-binding segment hybridize to form a double-stranded RNA duplex (dsRNA). The protein-binding segment of the gRNA in a subject interacts with a Cas protein, and the gRNA directs the bound Cas protein to a specific nucleotide sequence within the target DNA via the DNA-targeting segment.
[0155] A single guide RNA can include a DNA-targeting segment and a scaffold sequence (i.e., the protein-binding or Cas-binding sequence of the guide RNA). For example, such a guide RNA can have a 5’ DNA-targeting segment bound to a 3’ scaffold sequence. Exemplary scaffold sequences (e.g., for use with S. pyogenes Cas9) are GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU (version 1; SEQ ID NO: 11); GUUGGAACCAUUCAAAACAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 2, SEQ ID NO: 12); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 3, SEQ ID NO: 13); and GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGC (version 4, SEQ ID NO: 14); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUUU (version 5, SEQ ID NO: 15); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (Version 6, SEQ ID NO: 16); GUUUAAGAGCUAUGCUGGAAACAGCAUAGCAAGUUUAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUUUU (Version 7, SEQ ID NO: 17); or, comprises, consists essentially of, or consists of GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGGCACCGAGUCGGUGC (Version 8; SEQ ID NO: 18). In some guide sgRNAs, the four terminal U residues of Version 6 are absent. In some guide sgRNAs, only one, two, or three of the four terminal U residues of Version 6 are present. A guide RNA targeting any of the guide RNA target sequences disclosed herein may comprise, for example, a DNA targeting segment at the 5' end of the guide RNA fused to any of the exemplary guide RNA scaffold sequences at the 3' end of the guide RNA. That is, any of the DNA targeting segments disclosed herein may bind to the 5' end of any of the above scaffold sequences to form a single guide RNA (chimeric guide RNA).
[0156] The guide RNA may contain modifications or sequences that provide additional desirable features (e.g., modified or regulated stability, intracellular targeting, tracking using a fluorescent label, binding sites for proteins or protein complexes, etc.). That is, the guide RNA may contain one or more modified nucleosides or nucleotides, or one or more non-natural and / or naturally occurring components or configurations used instead of or in addition to the standard A, G, C, and U residues. Examples of such modifications include, for example, a 5’ cap (e.g., a 7-methylguanylate cap (m7G)), a 3’ polyadenylation tail (i.e., a 3’ poly(A) tail), a riboswitch sequence (e.g., to enable regulated stability and / or regulated accessibility by a protein and / or protein complex), a stability control sequence, a sequence that forms a dsRNA duplex (i.e., a hairpin), a modification or sequence that targets the RNA to an intracellular location (e.g., the nucleus, mitochondria, chloroplast, etc.), a modification or sequence that provides tracking (e.g., direct binding to a fluorescent molecule, binding to a moiety that facilitates fluorescence detection, a sequence that enables fluorescence detection, etc.), a modification or sequence that provides a binding site for a protein (e.g., a protein that acts on DNA, including transcription activators, transcription repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, etc.), or a combination thereof. Other examples of modifications include engineered stem-loop duplex structures, engineered bulge regions, engineered hairpins at the 3’ of the stem-loop duplex, or any combination thereof. See, for example, U.S. Patent Application Publication No. 2015 / 0376586, which is hereby incorporated by reference in its entirety for all purposes. A bulge can be a region of unpaired nucleotides within a duplex composed of a crRNA-like region and a minimal tracrRNA-like region. A bulge can include, on one side of the duplex, a 5’-XXXY-3’ where X is any purine and Y is a nucleotide that can form a wobble pair with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the duplex.
[0157] Guide RNAs can include modified nucleosides and modified nucleotides, such as, for example, one or both of the unlinked phosphate oxygens and / or one or more modifications or substitutions of the linked phosphate oxygens in the phosphodiester backbone linkage (exemplary backbone modifications), (2) modifications or substitutions of the components of the ribose sugar, such as modifications or substitutions of the 2'-hydroxyl on the ribose sugar (exemplary sugar modifications), (3) substitution of the phosphate moiety by a dephospho linker, such as large-scale substitution (exemplary backbone modifications), (4) modification or substitution of naturally occurring nucleobases with non-standard nucleobases (exemplary base modifications), (5) substitution or modification of the ribose-phosphate backbone (exemplary backbone modifications), (6) modification of the 3'- or 5'-end of the oligonucleotide (e.g., removal, modification or substitution of the terminal phosphate group, or attachment of a moiety, cap or linker, such 3' or 5' cap modifications may include sugar and / or backbone modifications), and (7) one or more of sugar modifications or substitutions (exemplary sugar modifications). Other possible guide RNA modifications include modification or substitution of uracil or poly-uracil tracts. See, for example, International Publication No. WO 2015 / 048577 and U.S. Patent Application Publication No. 2016 / 0237455, each of which is incorporated herein by reference in its entirety for all purposes. Similar modifications can be made to Cas-encoding nucleic acids, such as Cas mRNAs. For example, Cas mRNAs can be modified by using synonymous codons to deplete uridine.
[0158] Combinations of chemical modifications such as those listed above can be used to provide modified gRNAs and / or mRNAs that contain residues (nucleosides and nucleotides) that can have two, three, four, or more modifications. For example, the modified residues can have a modified sugar and a modified nucleobase. In one example, all bases of the gRNA are modified (e.g., all bases have a modified phosphate group such as a phosphorothioate group). For example, all or substantially all phosphate groups of the gRNA can be replaced with phosphorothioate groups. Alternatively or additionally, the modified gRNA can contain at least one modified residue at or near the 5' end. Alternatively or additionally, the modified gRNA can contain at least one modified residue at or near the 3' end.
[0159] Some gRNAs contain one, two, three, or more modified residues. For example, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the positions in the modified gRNA can be modified nucleosides or nucleotides.
[0160] Unmodified nucleic acids can be prone to degradation. Exogenous nucleic acids can also induce an innate immune response. Modifications can help introduce stability and reduce immunogenicity. Some of the gRNAs described herein can contain one or more modified nucleosides or nucleotides to introduce stability against intracellular or serum-based nucleases. Some of the modified gRNAs described herein may show a reduction in the innate immune response when introduced into a population of cells.
[0161] In the dual guide RNA, each of the crRNA and tracrRNA may contain modifications. Such modifications may be at one or both ends of the crRNA and / or tracrRNA. In the sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, and / or internal nucleosides may be modified, and / or the entire sgRNA may be chemically modified. Some gRNAs include 5'-end modifications. Some gRNAs include 3'-end modifications. Some gRNAs include both 5'-end and 3'-end modifications.
[0162] The guide RNAs disclosed herein may include one of the modification patterns disclosed in International Publication No. WO 2018 / 107028 (A1), which is hereby incorporated by reference in its entirety for all purposes. The guide RNAs disclosed herein may also include one of the structure / modification patterns disclosed in U.S. Patent Application Publication No. 2017 / 0114334, which is hereby incorporated by reference in its entirety for all purposes. The guide RNAs disclosed herein may also include one of the structure / modification patterns disclosed in International Publication No. WO 2017 / 136794, International Publication No. WO 2017 / 004279, U.S. Patent Application Publication No. 2018 / 0187186, or U.S. Patent Application Publication No. 2019 / 0048338, each of which is hereby incorporated by reference in its entirety for all purposes.
[0163] As an example, any of the guide RNAs described herein may include at least one modification. In one example, the at least one modification includes a 2'-O-methyl (2'-O-Me) modified nucleotide, a phosphorothioate (PS) bond between nucleotides, a 2'-fluoro (2'-F) modified nucleotide, or a combination thereof. For example, the at least one modification may include a 2'-O-methyl (2'-O-Me) modified nucleotide. Alternatively or additionally, the at least one modification may include a phosphorothioate (PS) bond between nucleotides. Alternatively or additionally, the at least one modification may include a 2'-fluoro (2'-F) modified nucleotide. In one example, the guide RNA described herein includes one or more 2'-O-methyl (2'-O-Me) modified nucleotides and one or more phosphorothioate (PS) bonds between nucleotides.
[0164] The guide RNA can be provided in any form. For example, the gRNA can be provided in the form of RNA as either two molecules (separate crRNA and tracrRNA) or one molecule (sgRNA), and optionally in the form of a complex with a Cas protein. The gRNA can also be provided in the form of DNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecule (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as one DNA molecule or as separate DNA molecules encoding crRNA and tracrRNA, respectively.
[0165] When the gRNA is provided in DNA form, the gRNA can be expressed transiently, conditionally, or constitutively in cells. The DNA encoding the gRNA can be stably integrated into the genome of the cell and operably linked to an active promoter in the cell. Alternatively, the DNA encoding the gRNA can be operably linked to a promoter in an expression construct. For example, the DNA encoding the gRNA can be within a vector containing a heterologous nucleic acid such as a nucleic acid encoding a Cas protein. Alternatively, it can be a separate vector or plasmid from the vector containing the nucleic acid encoding the Cas protein. Promoters that can be used in such expression constructs include, for example, promoters active in human neuronal cells, or human motor neuronal cells. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include RNA polymerase III promoters such as the human U6 promoter, the rat U6 polymerase III promoter, or the mouse U6 polymerase III promoter.
[0166] Alternatively, the gRNA can be prepared by a variety of other methods. For example, the gRNA can be prepared by in vitro transcription using, for example, T7 RNA polymerase (see, e.g., International Publication Nos. WO 2014 / 089290 and WO 2014 / 065596, each of which is incorporated herein by reference in its entirety for all purposes). The guide RNA can also be a synthetically produced molecule prepared by chemical synthesis.
[0167] The guide RNA (or a nucleic acid encoding the guide RNA) can be in a composition comprising one or more guide RNAs (e.g., 1, 2, 3, 4, or more guide RNAs) and a carrier that increases the stability of the guide RNA (e.g., extends the period during which degradation products remain below a threshold, e.g., less than 0.5 wt% of the starting nucleic acid or protein, under predetermined storage conditions such as -20 °C, 4 °C, or ambient temperature, or increases stability in vivo). Non-limiting examples of such carriers include poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-co-glycolic acid) (PLGA) microspheres, liposomes, micelles, reverse micelles, lipid vortices, and lipid nanotubes. Such compositions can further comprise a Cas protein such as Cas9 protein, or a nucleic acid encoding a Cas protein.
[0168] (4) Guide RNA target sequence The target DNA of the guide RNA includes the nucleic acid sequence present in the DNA to which the DNA targeting segment of the gRNA binds when there are conditions sufficient for binding. Suitable DNA / RNA binding conditions include physiological conditions normally present in cells. Other suitable DNA / RNA binding conditions (e.g., conditions in a cell-free system) are known in the art (see, e.g., Molecular Cloning: A Laboratory Manual, 3rd ed. (Sambrook et al., Harbor Laboratory Press 2001), which is incorporated herein by reference in its entirety for all purposes). The strand of the target DNA that is complementary to and hybridizes with the gRNA can be referred to as the "complementary strand," and the strand of the target DNA that is complementary to the "complementary strand" (and thus not complementary to the Cas protein or gRNA) can be referred to as the "non-complementary strand" or "template strand."
[0169] The target DNA includes both the sequence on the complementary strand to which the guide RNA hybridizes and the corresponding sequence on the non-complementary strand (e.g., adjacent to the protospacer adjacent motif (PAM)). As used herein, the term "guide RNA target sequence" specifically refers to the sequence on the non-complementary strand corresponding to the sequence to which the guide RNA hybridizes on the complementary strand (i.e., its reverse complement). That is, the guide RNA target sequence refers to the sequence on the non-complementary strand adjacent to the PAM (e.g., upstream or 5' of the PAM in the case of Cas9). The guide RNA target sequence is equivalent to the DNA targeting segment of the guide RNA but contains thymine instead of uracil. As an example, the guide RNA target sequence of the SpCas9 enzyme can refer to the sequence upstream of the 5'-NGG-3' PAM on the non-complementary strand. The guide RNA is designed to have complementarity to the complementary strand of the target DNA, and hybridization between the DNA targeting segment of the guide RNA and the complementary strand of the target DNA promotes the formation of the CRISPR complex. Complete complementarity is not necessarily required as long as there is sufficient complementarity to cause hybridization and promote the formation of the CRISPR complex. When the guide RNA is referred to herein as targeting the guide RNA target sequence, it means that the guide RNA hybridizes to the complementary strand sequence of the target DNA that is the reverse complement of the guide RNA target sequence on the non-complementary strand.
[0170] The target DNA or guide RNA target sequence can include any polynucleotide and can be located, for example, within the nucleus or cytoplasm of a cell or within cellular organelles such as mitochondria or chloroplasts. The target DNA or guide RNA target sequence can be any nucleic acid sequence that is endogenous or exogenous to the cell. The guide RNA target sequence can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can include both.
[0171] Site-specific binding and cleavage of target DNA by a Cas protein can occur at positions determined by both (i) base pair complementarity between the guide RNA and the complementary strand of the target DNA, and (ii) a short motif called the protospacer adjacent motif (PAM) in the non-complementary strand of the target DNA. The PAM can be adjacent to the guide RNA target sequence. Optionally, the guide RNA target sequence can have the PAM adjacent at the 3' end (e.g., in the case of Cas9). Alternatively, the guide RNA target sequence can have the PAM adjacent at the 5' end (e.g., in the case of Cpf1). For example, the cleavage site of a Cas protein can be about 1 to about 10 or about 2 to about 5 base pairs (e.g., 3 base pairs) upstream or downstream of the PAM sequence (e.g., within the guide RNA target sequence). In the case of SpCas9, the PAM sequence (i.e., on the non-complementary strand) can be 5'-N1GG-3', where N1 is any DNA nucleotide, and the PAM is immediately adjacent to the 3' of the guide RNA target sequence on the non-complementary strand of the target DNA. Thus, the sequence corresponding to the PAM on the complementary strand (i.e., the reverse complement) is 5'-CCN2-3', where N2 is any DNA nucleotide, and is immediately adjacent to the 5' of the sequence where the DNA targeting segment of the guide RNA hybridizes on the complementary strand of the target DNA. In some such cases, N1 and N2 can be complementary, and the N1-N2 base pair can be any base pair (e.g., N1 = C and N2 = G, N1 = G and N2 = C, N1 = A and N2 = T, or N1 = T and N2 = A). In the case of Cas9 from S. aureus, the PAM can be NNGRRT or NNGRR, where N can be A, G, C, or T, and R can be G or A. In the case of Cas9 from C. jejuni, the PAM can be, for example, NNNNACAC or NNNNRYAC, where N can be A, G, C, or T, and R can be G or A. In some cases (e.g., in the case of FnCpf1), the PAM sequence can be upstream of the 5' end and can have the sequence 5'-TTN-3'. In the case of DpbCasX, the PAM can have the sequence 5'-TTCN-3'. In the case of CasΦ, the PAM can have the sequence 5'-TBN-3', where B is G, T, or C.
[0172] An example of a guide RNA target sequence is a 20-nucleotide DNA sequence immediately preceding the NGG motif recognized by the SpCas9 protein. For example, two examples of a guide RNA target sequence and a PAM are GN 19 NGG (SEQ ID NO: 19) or N 20 NGG (SEQ ID NO: 20). See, for example, International Publication No. 2014 / 165825, which is hereby incorporated by reference in its entirety for all purposes. The guanine at the 5' end may facilitate transcription by RNA polymerase in the cell. Other examples of guide RNA target sequences and PAMs may include two guanine nucleotides at the 5' end to facilitate efficient transcription by T7 polymerase in vitro (e.g., GGN 20 NGG, SEQ ID NO: 21). See, for example, International Publication No. 2014 / 065596, which is hereby incorporated by reference in its entirety for all purposes. Other guide RNA target sequences and PAMs may have a length of 4 to 22 nucleotides of SEQ ID NOs: 19 to 21, including 5' G or GG and 3' GG or NGG. Still other guide RNA target sequences and PAMs may have a length of 14 to 20 nucleotides of SEQ ID NOs: 19 to 21.
[0173] The formation of a CRISPR complex hybridized to a target DNA can result in cleavage of one or both strands of the target DNA within or near the region corresponding to the guide RNA target sequence (i.e., the guide RNA target sequence on the non-complementary strand of the target DNA and the reverse complement on the complementary strand to which the guide RNA hybridizes). For example, the cleavage site can be within the guide RNA target sequence (e.g., at a position defined relative to the PAM sequence). A "cleavage site" includes the position in the target DNA where the Cas protein generates a single-stranded or double-stranded break. The cleavage site can be on only one strand (e.g., when a nickase is used) or on both strands of double-stranded DNA. The cleavage site can be at the same position on both strands (generating blunt ends, e.g., Cas9), or can be present at different sites on each strand (generating sticky ends (i.e., overhangs), e.g., Cpf1). Sticky ends can be generated, for example, by using two Cas proteins each of which generates a single-stranded break at a different cleavage site on a different strand, thereby generating a double-stranded break. For example, a first nickase can make a single-stranded break on the first strand of double-stranded DNA (dsDNA), and a second nickase can make a single-stranded break on the second strand of dsDNA such that an overhang sequence is created. In some cases, the guide RNA target sequence or cleavage site of the nickase on the first strand is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100, 250, 500, or 1,000 base pairs away from the guide RNA target sequence or cleavage site of the nickase on the second strand.
[0174] The guide RNA target sequence can also be selected to minimize off-target modification or avoid off-target effects (e.g., by avoiding two or fewer mismatches with off-target genomic sequences).
[0175] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (for example, the mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target the guide RNA target sequence described in any one of SEQ ID NOs: 32 to 51. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (for example, the mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence described in any one of SEQ ID NOs: 32 to 51.
[0176] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (for example, the mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target the guide RNA target sequence described in one or more or all of SEQ ID NOs: 32 to 51. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (for example, the mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence described in one or more or all of SEQ ID NOs: 32 to 51.
[0177] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) can target the guide RNA target sequence set forth in SEQ ID NO: 34. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a mouse C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 34.
[0178] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) can target the guide RNA target sequence set forth in any one of SEQ ID NOs: 52 to 71 and 112. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in any one of SEQ ID NOs: 52 to 71 and 112.
[0179] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) can target one or more or all of the guide RNA target sequences set forth in any of SEQ ID NOs: 52-71 and 112. As another example, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) can target one or more or at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequences set forth in SEQ ID NOs: 52-71 and 112.
[0180] As an example, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) can target the guide RNA target sequence set forth in any one of SEQ ID NOs: 53-55. As another example, a guide RNA targeting the C9orf72 gene upstream of or near the transcriptional start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A) can target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in any one of SEQ ID NOs: 53-55.
[0181] As an example, a combination of guide RNAs targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target one or more or all of the guide RNA target sequences set forth in SEQ ID NOs: 53-55 and 112. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequences set forth in one or more or all of SEQ ID NOs: 53-55.
[0182] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target the guide RNA target sequence set forth in SEQ ID NO: 53. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the C9orf72 exon 1A transcription start site (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the C9orf72 exon 1A transcription start site) may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 53.
[0183] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may target the guide RNA target sequence set forth in SEQ ID NO: 54. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 54.
[0184] As an example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may target the guide RNA target sequence set forth in SEQ ID NO: 55. As another example, a guide RNA targeting the C9orf72 gene upstream or in the vicinity of the transcription start site of C9orf72 exon 1A (e.g., a human C9orf72 guide RNA target sequence upstream or in the vicinity of the transcription start site of C9orf72 exon 1A) may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 55.
[0185] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target the guide RNA target sequence shown in any one of SEQ ID NOs: 114 to 117. As another example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence shown in any one of SEQ ID NOs: 114 to 117.
[0186] As an example, a combination of guide RNAs targeting the C9orf72 hexanucleotide repeat expansion sequence may target one or more or all of the guide RNA target sequences described in SEQ ID NOs: 114 to 117. As another example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence described in any one of SEQ ID NOs: 114 to 117.
[0187] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target the guide RNA target sequence described in SEQ ID NO: 114. As another example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence described in SEQ ID NO: 114.
[0188] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target the guide RNA target sequence described in SEQ ID NO: 115. As another example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence described in SEQ ID NO: 115.
[0189] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target the guide RNA target sequence described in SEQ ID NO: 116. As another example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence described in SEQ ID NO: 116.
[0190] As an example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target the guide RNA target sequence set forth in SEQ ID NO: 117. As another example, a guide RNA targeting the C9orf72 hexanucleotide repeat expansion sequence may target at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the guide RNA target sequence set forth in SEQ ID NO: 117.
[0191] (5) Lipid nanoparticles containing a CRISPR / Cas system or component Lipid nanoparticles comprising a CRISPR / Cas system are also provided. With respect to the CRISPR / Cas system, the lipid nanoparticles can contain Cas proteins in any form (e.g., protein, DNA, or mRNA) and / or can contain guide RNAs in any form (e.g., DNA or RNA). In one example, the lipid nanoparticles contain Cas proteins in the form of mRNA (e.g., the modified RNAs described herein) and guide RNAs in the form of RNA (e.g., the modified guide RNAs disclosed herein). As another example, the lipid nanoparticles can contain Cas proteins in the form of protein and guide RNA(s) in the form of RNA. In a specific example, the guide RNA and the Cas protein are each introduced in the form of RNA via LNP-mediated delivery in the same LNP. As discussed in more detail elsewhere herein, one or more of the RNAs can be modified. Delivery by such methods can result in transient Cas expression and / or the presence of transient guide RNAs, and the biodegradable lipids improve clearance, improve tolerance, and reduce immunogenicity. The lipid formulation can protect the biomolecule from degradation while improving cellular uptake. Lipid nanoparticles are particles that contain multiple lipid molecules physically associated with each other by intermolecular forces. These include microspheres (including monolayer and multilayer vesicles, e.g., liposomes), the dispersed phase in an emulsion, micelles, or the internal phase in a suspension. Such lipid nanoparticles can be used to encapsulate one or more nucleic acids or proteins for delivery. Formulations containing cationic lipids are useful for delivering polyanions such as nucleic acids. Other lipids that can be included are neutral lipids (i.e., uncharged or zwitterionic lipids), anionic lipids, helper lipids that enhance transfection, and stealth lipids that increase the length of time the nanoparticles can exist in vivo. See, for example, International Publication Nos. WO 2016 / 010840 (A1) and WO 2017 / 173054 (A1), each of which is hereby incorporated by reference in its entirety for all purposes. Exemplary lipid nanoparticles can contain a cationic lipid and one or more other components.
[0192] In some LNPs, the cargo can include Cas mRNA (e.g., Cas9 mRNA) and gRNA. The Cas mRNA and gRNA can be present in various ratios.
[0193] Examples of suitable LNPs can be found, for example, in International Publication Nos. WO 2019 / 067992, WO 2020 / 082042, US Patent Application Publication No. 2020 / 0270617, International Publication No. WO 2020 / 082041, US Patent Application Publication No. 2020 / 0268906, International Publication No. WO 2020 / 082046 (see, e.g., pp. 85-86), and US Patent Application Publication No. 2020 / 0289628, each of which is hereby incorporated by reference in its entirety for all purposes. A specific example of using an LNP for delivery to the brain can be found in Nabhan et al. (2016) Sci. Rep. 6:20019, which is hereby incorporated by reference in its entirety for all purposes.
[0194] (6) Vectors containing the CRISPR / Cas system or components The CRISPR / Cas system or its components can be provided in a vector for expression. The vector can include additional sequences such as, for example, an origin of replication, a promoter, and a gene encoding antibiotic resistance.
[0195] Some vectors can be circular. Alternatively, the vector can be linear. The vector can be packaged to be delivered via lipid nanoparticles, liposomes, non-lipid nanoparticles, or virus capsids. Non-limiting exemplary vectors include plasmids, phagemids, cosmids, artificial chromosomes, mini-chromosomes, transposons, viral vectors, and expression vectors.
[0196] Introduction of nucleic acids can also be achieved by viral-mediated delivery, such as AAV-mediated delivery or lentivirus-mediated delivery. The vector can be, for example, a viral vector such as an adeno-associated virus (AAV) vector. The AAV can be of any suitable serotype and can be single-stranded AAV (ssAAV) or self-complementary AAV (scAAV). Other exemplary viruses / viral vectors include retroviruses, lentiviruses, adenoviruses, vaccinia viruses, poxviruses, and herpes simplex viruses. The virus can infect dividing cells, non-dividing cells, or both dividing and non-dividing cells. The virus can be integrated into the host genome or alternatively not integrated into the host genome. Such viruses can also be engineered to have reduced immunogenicity. The virus can be replication-competent or replication-deficient (e.g., having a defect in one or more genes required for additional rounds of virion replication and / or packaging). The viral vector can be genetically modified from their wild-type counterparts. For example, the viral vector can include insertions, deletions, or substitutions of one or more nucleotides to facilitate cloning or to change one or more properties of the vector. Such properties can include packaging capacity, transduction efficiency, immunogenicity, genome integration, replication, transcription, and translation. In some examples, a portion of the viral genome can be deleted so that the virus can package larger-sized exogenous sequences. In some examples, the viral vector can have enhanced transduction efficiency. In some examples, the immune response induced by the virus in the host may be reduced. In some examples, viral genes (such as integrase) that promote integration of viral sequences into the host genome can be mutated so that the virus becomes non-integrating. In some examples, the viral vector can be replication-deficient. In some examples, the viral vector can include exogenous transcriptional or translational control sequences to drive expression of the coding sequences on the vector. In some examples, the virus can be helper-dependent.For example, a virus may require one or more helper components to supply the viral components (such as viral proteins) necessary to amplify the vector and package it into viral particles. In such cases, one or more helper components containing one or more vectors encoding the viral components can be introduced into a host cell or a population of host cells together with the vector system described herein. In other examples, the virus can be helper-free. For example, the virus can amplify and package the vector without a helper virus. In some examples, the vector system described herein may also encode the viral components required for virus amplification and packaging.
[0197] Exemplary virus titers (e.g., AAV titers) can range from about 10 12 to about 10 16 vg / mL. Other exemplary virus titers (e.g., AAV titers) can range from about 10 12 to about 10 16 vg / kg of body weight.
[0198] Adeno-associated virus (AAV) is endemic to multiple species, including humans and non-human primates (NHPs). To date, at least 12 natural serotypes and hundreds of natural variants have been isolated and characterized. See, for example, Li et al. (2020) Nat. Rev. Genet. 21:255-272, which is incorporated herein by reference in its entirety for all purposes. AAV particles are naturally composed of a non-enveloped icosahedral protein capsid containing a single-stranded DNA (ssDNA) genome. Flanking the DNA genome are two inverted terminal repeats (ITRs) that serve as the viral origin of replication and packaging signal. The rep gene encodes four proteins required for viral replication and packaging, while the cap gene encodes three structural capsid subunits that define the AAV serotype, and an assembly activation protein (AAP) that facilitates virion assembly in some serotypes.
[0199] Recombinant adeno-associated virus (rAAV) is currently one of the most commonly used viral vectors in gene therapy for treating human diseases by delivering therapeutic transgenes to target cells in vivo. The rAAV vector is composed of an icosahedral capsid similar to that of native AAV, but the rAAV virion does not encapsidate the AAV protein coding sequence or the AAV replication sequence. These viral vectors are non-replicative. The only viral sequences required in the rAAV vector are the two ITRs, which are necessary to induce genome replication and packaging during the production of the rAAV vector. The rAAV genome lacks the AAV rep and cap genes, rendering them non-replicative in vivo. The rAAV vector is generated by co-expressing the rep and cap genes in trans, together with additional viral helper proteins, in combination with the intended transgene cassette flanked by AAV ITRs.
[0200] In the rAAV genome, the gene expression cassette can be placed between the ITR sequences. Typically, the rAAV genome cassette contains a promoter for driving the expression of the transgene, followed by a polyadenylation sequence. The ITRs flanking the rAAV expression cassette are usually derived from AAV2, the first serotype to be isolated and converted into a recombinant viral vector. Since then, most rAAV production methods have relied on AAV2Rep-based packaging systems. See, for example, Colella et al. (2017) Mol. Ther. Methods Clin. Dev. 8:87-104, which is hereby incorporated by reference in its entirety for all purposes.
[0201] The specific serotype of the recombinant AAV vector affects its in vivo tropism for specific tissues. The AAV capsid protein mediates attachment and entry into target cells, followed by endosomal escape and nuclear transport. Therefore, the choice of serotype when developing an rAAV vector affects which cell types and tissues are most likely to be bound and transduced when the vector is injected in vivo.
[0202] Upon entering the nucleus, the ssDNA genome is released from the virion, and complementary DNA strands are synthesized to generate double-stranded DNA (dsDNA) molecules. The double-stranded AAV genome naturally circularizes via its ITRs and becomes an episome that persists in the nucleus extrachromosomally. Thus, for episomal gene therapy programs, rAAV-delivered rAAV episomes provide long-term promoter-driven gene expression in non-dividing cells. However, this rAAV-delivered episomal DNA is diluted as the cells divide. In contrast, the gene therapy described herein is based on gene insertion that enables long-term gene expression.
[0203] The ssDNA AAV genome consists of two open reading frames, Rep and Cap, flanked by two inverted terminal repeats that enable the synthesis of complementary DNA strands. When constructing an AAV transfer plasmid, the transgene is placed between the two ITRs, and Rep and Cap can be supplied in trans. In addition to Rep and Cap, AAV may require a helper plasmid containing genes from adenovirus. These genes (E4, E2a, and VA) mediate AAV replication. For example, the transfer plasmid, Rep / Cap, and helper plasmid can be transfected into HEK293 cells containing the adenoviral gene E1+ to generate infectious AAV particles. Alternatively, Rep, Cap, and the adenoviral helper genes may be combined as a single plasmid. Similar packaging cells and methods can also be used for other viruses such as retroviruses.
[0204] Multiple serotypes of AAV have been identified. These serotypes differ in the types of cells they infect (i.e., their tropisms) and enable preferential transduction of specific cell types. The term AAV includes, for example, AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64Rl, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and their hybrids, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. The genomic sequences of the various serotypes of AAV, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. An "AAV vector," as used herein, refers to an AAV vector that contains a heterologous sequence (i.e., a nucleic acid sequence that is heterologous to AAV), typically a sequence encoding a heterologous polypeptide of interest. The construct can include the AAV1, AAV2, AAV3, AAV3B, AAV4, AAV5, AAV6, AAV6.2, AAV7, AAVrh.64R1, AAVhu.37, AAVrh.8, AAVrh.32.33, AAV8, AAV9, AAV-DJ, AAV2 / 8, AAVrh10, AAVLK03, AV10, AAV11, AAV12, rh10, and their hybrids, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV capsid sequences. Generally, the heterologous nucleic acid sequence (transgene) is flanked by at least one, and generally two, AAV inverted terminal repeat sequences (ITRs). The AAV vector can be either single-stranded (ssAAV) or self-complementary (scAAV). Serotypes for CNS tissue include AAV1, AAV2, AAV4, AAV5, AAV8, and AAV9.The selectivity of AAV serotypes for gene delivery in neurons is described, for example, in Hammond et al. (2017) PLoS One 12(12):e0188830, which is hereby incorporated by reference in its entirety for all purposes. In a specific example, the AAV-PHP.eB vector is used. The AAV-PHP.eB vector exhibits a high ability to cross the blood-brain barrier and increases its CNS transduction efficiency. In another specific example, the AAV9 vector is used.
[0205] Directivity can be further refined by pseudotyping, which is a mixture of the capsid and the genome from different viral serotypes. For example, AAV2 / 5 denotes a virus containing the genome of serotype 2 packaged in the capsid of serotype 5. The use of pseudotyped viruses can not only improve transduction efficiency but also change directivity. Hybrid capsids derived from different serotypes can also be used to modify the directivity of the virus. For example, AAV-DJ contains a hybrid capsid from eight serotypes and exhibits high infectivity across a wide range of cell types in vivo. AAV-DJ8 is another example that exhibits the characteristics of AAV-DJ but with enhanced uptake into the brain. AAV serotypes can also be modified by mutations. Examples of mutated modifications of AAV2 include Y444F, Y500F, Y730F, and S662V. Examples of mutated modifications of AAV3 include Y705F, Y731F, and T492V. Examples of mutated modifications of AAV6 include S663V and T492V. Other pseudotyped / modified AAV variants include AAV2 / 1, AAV2 / 6, AAV2 / 7, AAV2 / 8, AAV2 / 9, AAV2.5, AAV8.2, and AAV / SASTG.
[0206] To accelerate the expression of the transgene, self-complementary AAV (scAAV) variants can be used. AAV relies on the cell's DNA replication machinery to synthesize the complementary strand of the single-stranded DNA genome of AAV, so the expression of the transgene may be delayed. To address this delay, scAAV containing complementary sequences that can spontaneously anneal upon infection can be used, eliminating the need for host cell DNA synthesis. However, single-stranded AAV (ssAAV) vectors can also be used.
[0207] To increase the packaging capacity, long transgenes can be split between two AAV transfer plasmids, the first being a 3' splice donor and the second being a 5' splice acceptor. Upon co-infection of cells, these viruses can form concatemers and be spliced together to express the full-length transgene. This enables the expression of longer transgenes, but the efficiency of expression is reduced. Similar methods for increasing capacity utilize homologous recombination. For example, the transgene can be split between two transfer plasmids, but there is substantial sequence overlap such that co-expression induces homologous recombination and the expression of the full-length transgene.
[0208] In certain AAVs, the cargo can include a nucleic acid encoding one or more guide RNAs (e.g., DNA encoding a guide RNA, or DNA encoding two or more guide RNAs). In certain AAVs, the cargo can include a nucleic acid encoding a Cas protein such as Cas9 (e.g., DNA), and DNA encoding one or more guide RNAs (e.g., DNA encoding a guide RNA, or DNA encoding two or more guide RNAs).
[0209] For example, Cas or Cas9 and one or more gRNAs (e.g., one gRNA or two gRNAs or three gRNAs or four gRNAs) can be delivered via LNP-mediated delivery (e.g., in the form of RNA) or adeno-associated virus (AAV)-mediated delivery. For example, Cas9 mRNA and gRNA can be delivered via LNP-mediated delivery, or DNA encoding Cas9 and DNA encoding gRNA can be delivered via AAV-mediated delivery. Cas or Cas9 and gRNA(s) can be delivered in a single AAV or via two separate AAVs. For example, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry a gRNA expression cassette. Similarly, the first AAV can carry a Cas or Cas9 expression cassette, and the second AAV can carry two or more gRNA expression cassettes. Alternatively, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and a gRNA expression cassette (e.g., a gRNA coding sequence operably linked to a promoter). Similarly, a single AAV can carry a Cas or Cas9 expression cassette (e.g., a Cas or Cas9 coding sequence operably linked to a promoter) and two or more gRNA expression cassettes (e.g., a gRNA coding sequence operably linked to a promoter). Various promoters, such as the U6 promoter or small tRNA Gln, can be used to drive the expression of gRNA. Similarly, various promoters can be used to drive the expression of Cas9. For example, a small promoter is used so that the Cas9 coding sequence can be compatible with the AAV construct. Similarly, a small Cas9 protein (e.g., using SaCas9 or CjCas9 to maximize the AAV packaging capacity).
[0210] III. Method for suppressing transcription from the C9orf72 exon 1A transcription start site in a cell or subject, and method for preventing, treating, or ameliorating at least one symptom or indication of a C9orf72 hexanucleotide repeat expansion-related disease Also disclosed herein is the use of the CRISPR / Cas system described herein for a method of suppressing transcription from the C9orf72 exon 1A transcription start site and / or a method of suppressing transcription of sense and / or antisense transcripts containing hexanucleotide repeat expansions, and for prophylactic and therapeutic applications for the treatment and / or prevention of C9orf72 hexanucleotide repeat expansion-related diseases and / or for ameliorating at least one symptom associated with such diseases. Such methods can, for example, reduce or abolish the expression of transcripts starting at C9orf72 exon 1A. Such methods can also, for example, reduce or abolish the expression of C9orf72 hexanucleotide repeat-containing transcripts. Such methods can also, for example, reduce or abolish the expression of sense C9orf72 hexanucleotide repeat-containing transcripts. Such methods can also, for example, reduce or abolish the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts. Such methods can also, for example, reduce or abolish the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts. Such methods can selectively or preferentially reduce or abolish the expression of transcripts starting at C9orf72 exon 1A compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., reduce the expression of transcripts starting at C9orf72 exon 1A to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B). Such methods can also selectively or preferentially reduce or abolish the expression of C9orf72 hexanucleotide repeat-containing transcripts compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., reduce the expression of C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B).Such methods can also selectively or preferentially reduce or eliminate the expression of sense C9orf72 hexanucleotide repeat-containing transcripts (e.g., reduce the expression of sense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting from C9orf72 exon 1B), compared to, for example, the effect on the expression of transcripts starting from C9orf72 exon 1B. Such methods can also selectively or preferentially reduce or eliminate the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts (e.g., reduce the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting from C9orf72 exon 1B), compared to, for example, the effect on the expression of transcripts starting from C9orf72 exon 1B. Such methods can also selectively or preferentially reduce or eliminate the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts (e.g., reduce the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting from C9orf72 exon 1B), compared to, for example, the effect on the expression of transcripts starting from C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of transcripts starting from C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts starting from C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting from C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of sense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting from C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting from C9orf72 exon 1B.In some methods, the CRISPR / Cas system reduces or eliminates the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some methods disclosed herein, the CRISPR / Cas system reduces the expression of poly-GA dipeptide repeat proteins. In some methods disclosed herein, the CRISPR / Cas system reduces the expression of poly-GP dipeptide repeat proteins. In some methods disclosed herein, the CRISPR / Cas system reduces the expression of both poly-GA dipeptide repeat proteins and poly-GP dipeptide repeat proteins.
[0211] A. Methods for suppressing transcription from the C9orf72 exon 1A transcription start site in a cell or subject Various methods are provided for suppressing transcription from the C9orf72 exon 1A transcription start site and / or for suppressing transcription of sense and / or antisense transcripts containing a hexanucleotide repeat expansion sequence using a CRISPR / Cas system (e.g., a Cas protein or nucleic acid encoding the same and one or more C9orf72-targeting gRNAs or DNA encoding the same) as described elsewhere herein.
[0212] The C9orf72 gene can be present in an animal or a cell, and the method can be performed in vitro, ex vivo, or in vivo. Animals include mammals, fish, and birds. Mammals can be, for example, non-human mammals, humans, rodents, rats, mice, or hamsters. In one example, the animal is a human. Other non-human mammals include, for example, non-human primates (e.g., cynomolgus monkeys), monkeys, apes, cats, dogs, rabbits, horses, bulls, deer, bison, livestock (e.g., bovine species such as cows, castrated cows, etc.; ovine species such as sheep, goats, etc.; and porcine species such as pigs and wild boars). Birds include, for example, chickens, turkeys, ostriches, geese, ducks, etc. Domesticated animals and agricultural animals are also included. The animal in the method disclosed herein can be a human or a non-human animal. In a specific example, the C9orf72 gene is in a human or human cells. The term "non-human" excludes humans. Specific examples of non-human animals include rodents such as mice and rats, or non-human primates such as cynomolgus monkeys.
[0213] The cells used in the method can be derived from any type of animal, and they can be in any type of undifferentiated or differentiated state. The cells can be in vitro, ex vivo, or in vivo. For example, the cells can be non-human totipotent cells, pluripotent cells (e.g., human pluripotent cells, or non-human pluripotent cells such as mouse embryonic stem (ES) cells or rat ES cells), or non-pluripotent cells. Totipotent cells include undifferentiated cells that can give rise to any cell type, and pluripotent cells include undifferentiated cells that have the ability to develop into two or more differentiated cell types. In some embodiments, human cells are not totipotent cells. In some embodiments, human cells are not pluripotent cells.
[0214] The cells provided herein can also be germ cells (e.g., sperm or oocytes) or non-human germ cells. The cells can be mitotically competent cells or mitotically inactive cells, meiotically competent cells or meiotically inactive cells. Similarly, the cells can also be primary somatic cells or non-primary somatic cells. Somatic cells include any cells that are not gametes, germ cells, gametocytes, or undifferentiated stem cells. For example, the cells can be hepatocytes, kidney cells, hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratinocytes, blood cells, melanocytes, monocytes, mononuclear cells, monocyte progenitor cells, B cells, erythroblast-megakaryocyte cells, eosinophils, macrophages, T cells, pancreatic beta cells, exocrine cells, pancreatic progenitor cells, endocrine progenitor cells, adipocytes, preadipocytes, neurons, glial cells, neural stem cells, neurons, hepatoblasts, hepatocytes, cardiomyocytes, skeletal myoblasts, smooth muscle cells, duct cells, acinar cells, alpha cells, beta cells, delta cells, PP cells, bile duct cells, white or brown adipocytes, or eye cells (e.g., Muller cells, retinal pigment epithelial cells, retinal microvascular endothelial cells, retinal pericytes, conjunctival epithelial cells, conjunctival fibroblasts, iris pigment epithelial cells, corneal cells, lens epithelial cells, non-pigmented ciliary epithelial cells, choroidal fibroblasts, photoreceptor cells, ganglion cells, bipolar cells, horizontal cells, or amacrine cells). For example, the cells can be nerve cells such as motor neurons. The cells provided herein can be normal healthy cells or diseased cells or variant-bearing cells such as cells containing a hexanucleotide repeat expansion at the C9orf72 locus.
[0215] The non-human animals can be from any genetic background. For example, suitable mice can be from the 129 strain, C57BL / 6 strain, hybrids of 129 and C57BL / 6, BALB / c strain, or Swiss Webster strain. Examples of the 129 strain include 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1 / SV, 129S1 / Svlm), 129S2, 129S4, 129S5, 129S9 / SvEvH, 129S6 (129 / SvEvTac), 129S7, 129S8, 129T1, and 129T2. See, for example, Festing et al. (1999) Mamm. Genome 10(8):836, which is hereby incorporated by reference in its entirety for all purposes. Examples of the C57BL strain include C57BL / A, C57BL / An, C57BL / GrFa, C57BL / Kal_wN, C57BL / 6, C57BL / 6J, C57BL / 6ByJ, C57BL / 6NJ, C57BL / 10, C57BL / 10ScSn, C57BL / 10Cr, and C57BL / 01a. Suitable mice can also be from hybrids of the aforementioned 129 strain and the aforementioned C57BL / 6 strain (e.g., 50% 129 and 50% C57BL / 6). Similarly, suitable mice can be from hybrids of the aforementioned 129 strain or hybrids of the aforementioned BL / 6 strain (e.g., the 129S6 (129 / SvEvTac) strain).
[0216] Similarly, rats can be from, for example, the ACI rat strain, Dark Agouti (DA) rat strain, Wistar rat strain, LEA rat strain, Sprague Dawley (SD) rat strain, or Fisher rat strains such as Fisher F344 or Fisher F6. Rats can also be obtained from strains derived from hybrids of two or more of the above-mentioned strains. For example, suitable rats can be from the DA strain or the ACI strain. The ACI rat strain has a white belly and feet, and RT1 av1It is characterized by having black agouti with a haplotype. Such strains are available from various sources including Harlan Laboratories. The Dark Agouti (DA) rat strain has an agouti coat and RT1 av1 is characterized by having a haplotype. Such rats are available from various sources including Charles River and Harlan Laboratories. In some cases, suitable rats may be derived from inbred rat strains. See, for example, U.S. Patent Application Publication No. 2014 / 0235933, which is hereby incorporated by reference in its entirety for all purposes.
[0217] CRISPR / Cas reagents can be introduced into cells or animals by any form and by any means as described elsewhere in this specification, and all or some of them can be introduced simultaneously or sequentially in any combination as described elsewhere in this specification.
[0218] In some methods, the method comprises contacting the C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment that targets a first guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence. For example, the first guide RNA target sequence can be within about 250 nucleotides, within about 225 nucleotides, within about 200 nucleotides, within about 175 nucleotides, within about 150 nucleotides, within about 125 nucleotides, within about 100 nucleotides, within about 75 nucleotides, or within about 50 nucleotides of the transcriptional start site of C9orf72 exon 1A. Alternatively, the first guide RNA target sequence can be within about 100 nucleotides, within about 75 nucleotides, or within about 50 nucleotides of the transcriptional start site of C9orf72 exon 1A or any other position disclosed herein. In some methods, the method can comprise contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, and each different guide RNA targeting a different guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A. In another example, the method can comprise contacting the C9orf72 gene with at least three CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, and each different guide RNA targeting a different guide RNA target sequence upstream of or near the transcriptional start site of C9orf72 exon 1A. For example, each guide RNA target sequence can be within about 250 nucleotides, within about 225 nucleotides, within about 200 nucleotides, within about 175 nucleotides, within about 150 nucleotides, within about 125 nucleotides, within about 100 nucleotides, within about 75 nucleotides, or within about 50 nucleotides of the transcriptional start site of C9orf72 exon 1A.Alternatively, each guide RNA target sequence can be within about 100 nucleotides, within about 75 nucleotides, or within about 50 nucleotides of the C9orf72 exon 1A transcription start site or any other position disclosed herein.
[0219] In some methods, the method comprises contacting the C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment that targets a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex binds to the first guide RNA target sequence. In some methods, the method can comprise contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some methods, the method can comprise contacting the C9orf72 gene with at least three or at least four CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0220] In some such methods, the method comprises (a) contacting the C9orf72 gene with a first CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a first guide RNA comprising a first DNA targeting segment targeting a first guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A, wherein the first CRISPR / Cas complex binds to the first guide RNA target sequence, and / or (b) contacting the C9orf72 gene with a second CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a second guide RNA comprising a second DNA targeting segment targeting a second guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene, wherein the second CRISPR / Cas complex may comprise binding to the first guide RNA target sequence. In some methods, part (a) may comprise contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A. In some methods, part (a) may comprise contacting the C9orf72 gene with at least three CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence upstream of or near the transcription start site of C9orf72 exon 1A. In some methods, part (b) may comprise contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.In some methods, part (b) may involve contacting the C9orf72 gene with at least three or at least four CRISPR / Cas complexes, each CRISPR / Cas complex comprising a nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0221] Examples and variations of Cas proteins and guide RNAs that can be used in this method are described elsewhere in this specification.
[0222] The guide RNA can be introduced into the animal or cell in the form of, for example, RNA (e.g., in vitro transcribed RNA such as the modified guide RNAs disclosed herein), or in the form of DNA encoding the guide RNA. When introduced in the form of DNA, the DNA encoding the guide RNA can be operably linked to an active promoter within the cell or within the cells of the animal. For example, the guide RNA can be delivered via AAV and expressed in vivo under the U6 promoter. Such DNA can be in one or more expression constructs. For example, such an expression construct can be a component of a single nucleic acid molecule. Alternatively, they can be separated in any combination between two or more nucleic acid molecules (i.e., the DNA encoding one or more CRISPR RNAs and the DNA encoding one or more tracrRNAs can be components of separate nucleic acid molecules).
[0223] Similarly, the Cas protein can be introduced into an animal or a cell in any form. For example, the Cas protein can be provided in the form of a protein such as a Cas protein complexed with a gRNA. Alternatively, the Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as RNA (e.g., messenger RNA (mRNA)) or DNA, such as the modified mRNA disclosed herein. Optionally, the nucleic acid encoding the Cas protein can be codon-optimized for efficient translation into protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to alternative codons that are used more frequently in mammalian cells, human cells, rodent cells, mouse cells, rat cells, or any other target host cell as compared to the naturally occurring polynucleotide sequence. When the nucleic acid encoding the Cas protein is introduced into a cell or an animal, the Cas protein can be transiently, conditionally, or constitutively expressed in the cells of the cell or the animal.
[0224] In one example, the Cas protein is introduced in the form of mRNA (e.g., the modified mRNA disclosed herein), and the guide RNA is introduced in the form of RNA (e.g., together in the same lipid nanoparticle), such as the modified gRNA disclosed herein.
[0225] The guide RNA can be modified as disclosed elsewhere herein. Similarly, the Cas mRNA can be modified as disclosed elsewhere herein.
[0226] The guide RNAs and CRISPR / Cas systems described in the compositions and methods disclosed herein target guide RNA target sequences within the C9orf72 gene. The C9orf72 gene can be, for example, a mammalian C9orf72 gene. In certain examples, the C9orf72 gene includes a human C9orf72 promoter. In some such compositions, the C9orf72 gene is a human C9orf72 gene. In some such compositions, the C9orf72 gene is a humanized C9orf72 gene. For example, the C9orf72 gene can be a non-human animal (e.g., a non-human mammal, rodent, rat, or mouse) C9orf72 gene in which a human hexanucleotide repeat expansion sequence and adjacent human sequences have been inserted into the endogenous C9orf72 locus to replace the corresponding endogenous sequences. See, for example, U.S. Patent Application Publication No. 2020-0196581 and International Publication No. 2020 / 131632, each of which is incorporated herein by reference in its entirety for all purposes.
[0227] Optionally, the C9orf72 gene includes a C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. The C9orf72 hexanucleotide repeat expansion sequence is generally a nucleotide sequence that includes at least two tandem repeats (i.e., consecutive repeats adjacent to each other without intervening sequences) of the hexanucleotide sequence G4C2. The hexanucleotide repeat expansion sequence can have any number of repeats. Optionally, the hexanucleotide repeat expansion sequence has more than about 30 repeats. In some embodiments, the hexanucleotide repeat expansion sequence has more than about 100 repeats, more than about 200 repeats, more than about 300 repeats, more than about 400 repeats, more than about 500 repeats, more than about 600 repeats, more than about 700 repeats, more than about 800 repeats, more than about 900 repeats, or more than about 1000 repeats.
[0228] The guide RNA target sequence(s) can be upstream of or near the transcription start site of C9orf72 exon 1A and / or within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. Transcription of the C9orf72 gene starts with two alternative non-coding exons: exon 1A (upstream) and exon 1B (downstream). The G4C2 repeat is present between exon 1A and 1B. Exons 1A and 1B can be spliced to exon 2, which is the first protein-coding exon, to produce an mRNA with an alternative 5' untranslated region. In healthy people with short G4C2 repeat expansions, transcription mainly starts with exon 1B. RNA containing exon 1A is rare, and repeat-containing RNA is undetectable. People affected by C9orf72 ALS or FTLD accumulate transcripts in which exon 1A is spliced to exon 2, and both sense and antisense repeat-containing RNAs, as well as the DPR proteins translated from them, can be detected by in situ hybridization and immunohistochemistry.
[0229] In one example, the guide RNA target sequence can be within about 250 nucleotides, about 225 nucleotides, about 200 nucleotides, about 175 nucleotides, about 150 nucleotides, about 125 nucleotides, about 100 nucleotides, about 75 nucleotides, about 50 nucleotides, about 25 nucleotides, about 20 nucleotides, or about 10 nucleotides of the C9orf72 exon 1A transcription start site. In another example, the guide RNA target sequence can be within about 100, about 75, about 50, about 25, about 20, or about 10 of the C9orf72 exon 1A transcription start site.
[0230] In one example, the guide RNA target sequence can be within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0231] In some of the compositions and methods disclosed herein, two or more guide RNAs or CRISPR / Cas systems are used to target two or more guide RNA target sequences in the C9orf72 gene. In one example, each of the two or more guide RNA target sequences is upstream of or near the C9orf72 exon 1A transcription start site described above. In another example, each of the two or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In some of the compositions and methods disclosed herein, three or more guide RNAs or CRISPR / Cas systems are used to target three or more guide RNA target sequences in the C9orf72 gene. In one example, each of the three or more guide RNA target sequences is upstream of or near the C9orf72 exon 1A transcription start site described above. In another example, each of the three or more guide RNA target sequences is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. In another example, at least one guide RNA target sequence is upstream of or near the C9orf72 exon 1A transcription start site as described above, and at least one guide RNA target sequence is within the C9orf72 hexanucleotide repeat expansion sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
[0232] The guide RNA target sequences can be selected to minimize off-target modification or avoid off-target effects (e.g., by avoiding two or fewer mismatches with off-target genomic sequences).
[0233] Methods for measuring the expression of transcripts starting at C9orf72 exon 1A, the expression of transcripts starting at C9orf72 exon 1B, and the expression of sense and antisense C9orf72 hexanucleotide repeat-containing transcripts are known and described elsewhere in this specification. Evaluation of expression (or measurement of RNA foci and dipeptide repeats as described elsewhere in this specification) can be performed in any cell type (e.g., neuronal cells such as motor neurons).
[0234] In some methods, the percent expression obtained from the C9orf72 exon 1A transcription start site in treated cells (e.g., neuronal cells such as motor neurons), compared to control untreated cells or compared to before administration (in vitro, ex vivo, or in vivo), is less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%. The percent expression obtained can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0235] In some methods, the percent decrease in expression from the C9orf72 exon 1A transcription start site in treated cells (e.g., neuronal cells such as motor neurons), compared to control untreated cells or compared to before administration (in vitro, ex vivo, or in vivo), is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0236] In some methods, the percent expression obtained of the C9orf72 hexanucleotide repeat-containing transcript in treated cells (e.g., nerve cells such as motor neurons) as compared to control untreated cells or as compared to before administration (in vitro, ex vivo, or in vivo) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%. The percent expression obtained can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0237] In some methods, the percent decrease in the expression of the C9orf72 hexanucleotide repeat-containing transcript in treated cells (e.g., nerve cells such as motor neurons) as compared to control untreated cells or as compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0238] In some methods, the percent expression obtained of the sense C9orf72 hexanucleotide repeat-containing transcript in treated cells (e.g., nerve cells such as motor neurons) as compared to control untreated cells or as compared to before (in vitro, ex vivo, or in vivo) administration can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%. The percent expression obtained can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0239] In some methods, the percent decrease in the expression of sense C9orf72 hexanucleotide repeat-containing transcripts in treated cells (e.g., nerve cells such as motor neurons) as compared to control untreated cells or as compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0240] In some methods, the resulting percent expression of antisense C9orf72 hexanucleotide repeat-containing transcripts in treated cells (e.g., nerve cells such as motor neurons) as compared to control untreated cells or as compared to before administration (in vitro, ex vivo, or in vivo) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%. The resulting percent expression can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0241] In some methods, the percent decrease in the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0242] In some methods, the resulting percent expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%. The resulting percent expression can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0243] In some methods, the percent decrease in the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts in treated cells (e.g., nerve cells such as motor neurons) compared to control untreated cells or compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0244] In some methods, the percent decrease in the expression of poly-GA dipeptide repeat protein in treated cells (e.g., nerve cells such as motor neurons) compared to control untreated cells or compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0245] In some methods, the percent decrease in the poly-GP dipeptide repeat protein in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0246] In some methods, the percent decrease in the expression of the poly-GA dipeptide repeat protein and the poly-GP dipeptide repeat protein in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0247] Such methods can, for example, reduce or eliminate the expression of transcripts starting at C9orf72 exon 1A. Such methods can also, for example, reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats. Such methods can also, for example, reduce or eliminate the expression of sense C9orf72 hexanucleotide repeat-containing transcripts. Such methods can also, for example, reduce or eliminate the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts. Such methods can also, for example, reduce or eliminate the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts. Such methods can selectively or preferentially reduce or eliminate the expression of transcripts starting at C9orf72 exon 1A as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., reduce the expression of transcripts starting at C9orf72 exon 1A to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B). Such methods can also, for example, selectively or preferentially reduce or eliminate the expression of transcripts containing C9orf72 hexanucleotide repeats as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (i.e., reduce the expression of transcripts containing C9orf72 hexanucleotide repeats to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B). Such methods can also, for example, selectively or preferentially reduce or eliminate the expression of sense C9orf72 hexanucleotide repeat-containing transcripts as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (e.g., reduce the expression of sense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B). Such methods can also, for example, selectively or preferentially reduce or eliminate the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (e.g., reduce the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts to a greater extent than reducing the expression of transcripts starting at C9orf72 exon 1B).Such methods can also selectively or preferentially reduce or eliminate the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts, for example, as compared to the effect on the expression of transcripts starting at C9orf72 exon 1B (e.g., reducing the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts more substantially than reducing the expression of transcripts starting at C9orf72 exon 1B). In some methods, the CRISPR / Cas system reduces or eliminates the expression of transcripts starting at C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of sense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of antisense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. In some methods, the CRISPR / Cas system reduces or eliminates the expression of both sense and antisense C9orf72 hexanucleotide repeat-containing transcripts, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B.
[0248] Some methods result in a decrease in sense and / or antisense repeat-containing RNA foci in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo). Some methods result in a decrease in dipeptide repeat proteins (e.g., poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), and / or poly(proline-arginine)) synthesized by repeat-related non-AUG-dependent translation from sense and antisense repeat-containing RNA in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo).
[0249] B. Preventive or therapeutic uses The CRISPR / Cas systems disclosed herein for targeting the C9orf72 gene, as well as methods for suppressing transcription from the C9orf72 exon 1A transcription start site and / or suppressing transcription of sense and / or antisense transcripts containing hexanucleotide repeat expansions within the C9orf72 gene in a cell, are useful for the treatment and / or prevention of C9orf72 hexanucleotide repeat expansion-related diseases and / or for ameliorating at least one symptom or indication associated with such diseases. In certain examples, the disease is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD). ALS, also known as Lou Gehrig's disease, is the most frequent adult-onset paralytic disorder characterized by the loss of upper and / or lower motor neurons. ALS affects as many as 20,000 individuals throughout the United States, with approximately 5,000 new cases occurring each year. Frontotemporal dementia (also known as Pick's disease, frontotemporal lobar degeneration, or FTLD) is a group of disorders caused by progressive cell degeneration in the frontal or temporal lobes of the brain. FTD is reported to account for 10% - 15% of all dementia cases. Hexanucleotide repeat expansions between exons 1A and 1B, two non-coding exons of the human C9ORF72 gene, have been associated with both ALS and FTD. The G4C2 hexanucleotide repeat expansion is estimated to account for approximately 50% of familial and many non-familial ALS cases. It is present in approximately 25% of familial FTD cases and approximately 8% of sporadic FTD cases.
[0250] Numerous signs or symptoms associated with hexanucleotide repeat expansions in C9ORF72 have been reported, such as repeat length-dependent formation of RNA foci, sequestration of specific RNA-binding proteins, and accumulation and aggregation of dipeptide repeat proteins (e.g., poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), or poly(proline-arginine) dipeptide repeat proteins) resulting from repeat-associated non-AUG (RAN) translation.
[0251] Although it is unknown how the C9orf72 hexanucleotide repeat expansion causes motor neuron disease and dementia, two common postmortem pathological findings in C9orf72 ALS and FTD patients are associated with the repeat expansion: (1) sense and antisense repeat-containing RNAs can be visualized as discrete foci in neurons and other cells, and (2) dipeptide repeat proteins synthesized by repeat-associated non-AUG-dependent translation from sense and antisense repeat-containing RNAs - poly(glycine-alanine), poly(glycine-proline), poly(glycine-arginine), poly(alanine-proline), and poly(proline-arginine) - can be detected in cells. One disease hypothesis proposes that the repeat-containing RNAs visualized as foci disrupt cellular RNA metabolism by sequestering RNA-binding proteins. Another disease hypothesis posits that the dipeptide repeat proteins exert widespread toxic effects on RNA metabolism, proteostasis, and nucleocytoplasmic transport.
[0252] Another symptom or indication is the expression of repeat-containing RNA from the C9orf72 gene. The C9orf72 gene produces transcripts from two transcription start sites. The upstream site initiates transcription in alternative non-coding exon 1A, while the downstream site initiates transcription in alternative exon 1B. Both exon 1A and 1B can be spliced to exon 2, which contains the start of the protein-coding sequence. The pathogenic hexanucleotide repeat expansion is located between exon 1A and 1B. Thus, transcription initiated from exon 1A can produce repeat-containing RNA, but initiation from exon 1B cannot.
[0253] In some methods, the CRISPR / Cas systems disclosed herein for targeting the C9orf72 gene can be administered at therapeutic doses to a subject having a C9orf72 hexanucleotide repeat expansion related disorder. Such methods can include administering a therapeutically effective amount of the CRISPR / Cas system to the subject. The CRISPR / Cas systems disclosed herein for targeting the C9orf72 gene can also be used in the preparation of a pharmaceutical composition or agent for treating a patient suffering from a C9orf72 hexanucleotide repeat expansion related disorder. Therapeutic or pharmaceutical compositions comprising the CRISPR / Cas systems disclosed herein for targeting the C9orf72 gene can be administered with suitable carriers, excipients, and other agents incorporated into the formulation to provide improved uptake, delivery, tolerance, etc. Numerous suitable formulations can be found in Remington’s Pharmaceutical Sciences, Mack Publishing Company, Easton, Pennsylvania, a compendium known to all pharmacists. See also Powell et al., “Compendium of excipients for parenteral formulations” PDA (1998) J. Pharm. Sci. Technol. 52:238-311.
[0254] Similarly, methods for suppressing transcription from the C9orf72 exon 1A transcription start site disclosed herein and / or for suppressing transcription of sense and / or antisense transcripts containing hexanucleotide repeat expansion sequences in the C9orf72 gene can be used to treat C9orf72 hexanucleotide repeat expansion-related diseases. Such a treatment method can include administering a therapeutically effective amount of a pharmaceutical composition comprising the CRISPR / CasC system disclosed herein for targeting the C9orf72 gene to a subject in need thereof. The C9orf72 hexanucleotide repeat expansion-related disease to be treated can be any disease or condition associated with C9orf72 hexanucleotide repeat expansion. Some such methods prevent, treat, or ameliorate at least one symptom of the (above-mentioned) C9orf72 hexanucleotide repeat expansion-related disease, and the method includes administering a therapeutically effective amount of the CRISPR / CasC9 system disclosed herein for targeting the C9orf72 gene to a subject in need thereof. In some methods, the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene can be administered prophylactically or therapeutically to a subject having or at risk of having a C9orf72 hexanucleotide repeat expansion-related disease. The CRISPR / Cas system disclosed herein for targeting the C9orf72 gene can be administered via intracerebroventricular injection, intracranial injection, intrathecal injection, or by any other suitable means.
[0255] A therapeutically effective amount is an amount that produces the desired effect for which it is administered. The exact amount depends on the purpose of the treatment and can be ascertained by one of ordinary skill in the art using known techniques. See, for example, Lloyd (1999) The Art, Science and Technology of Pharmaceutical Compounding.
[0256] The subject can be an animal, optionally a mammal, optionally a human, in need of amelioration, prevention, and / or treatment of a C9orf72 hexanucleotide repeat expansion related disorder. This term includes human subjects having or at risk of having such a disease or disorder.
[0257] The term treat, treating, or treatment refers to the administration of a therapeutic agent, such as a CRISPR / Cas system disclosed herein for targeting the C9orf72 gene, to a subject in need thereof, to reduce or ameliorate the severity of at least one symptom or indication of a C9orf72 hexanucleotide repeat expansion related disorder. This term includes inhibition of disease progression or worsening of symptoms / indications. These terms also include a positive prognosis of the disease (i.e., the subject may not have the disease or the disease may be reduced at the time of administration of a therapeutic agent, such as a CRISPR / Cas system disclosed herein for targeting the C9orf72 gene). The therapeutic agent can be administered to the subject at a therapeutic dose. The terms prevent, preventing, prevention refer to the inhibition of the development of a C9orf72 hexanucleotide repeat expansion related disorder or the symptoms or indications of such a disorder upon administration of a CRISPR / Cas system disclosed herein for targeting the C9orf72 gene.
[0258] In some methods, a single dose of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene may be administered to a subject in need thereof. In other methods, multiple doses of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene may be administered to a subject over a defined period of time. Such methods may include sequentially administering multiple doses of the CRISPR / Cas system disclosed herein to a subject to target the C9orf72 gene. Sequential administration means that each dose of the CRISPR / Cas system is administered to the subject on different days separated by different time points, e.g., at predetermined intervals (e.g., several hours, several days, several weeks, or several months). Some methods include sequentially administering to a patient a single initial dose of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene, followed by one or more secondary doses of the CRISPR / Cas system, and optionally, followed by one or more tertiary doses.
[0259] The initial dose, secondary dose, and tertiary dose refer to the chronological order of administration of the CRISPR / Cas system disclosed herein for targeting the C9orf72 gene. Thus, the initial dose is the dose administered at the start of the treatment regimen (also referred to as the baseline dose), the secondary dose is the dose administered after the initial dose, and the tertiary dose is the dose administered after the secondary dose. The initial dose, secondary dose, and tertiary dose may all contain the same amount of the CRISPR / Cas system, but generally may differ from each other with respect to the frequency of administration. However, in some methods, the amounts of the CRISPR / Cas system included in the initial dose, secondary dose, and / or tertiary dose may differ from each other during the course of the treatment (e.g., adjusted up or down as needed). In some methods, two or more (e.g., 2, 3, 4, or 5) doses are administered at the start of the treatment regimen as a loading dose, followed by subsequent doses (e.g., maintenance doses) administered at a lower frequency.
[0260] Such methods can include administering to a patient any number of secondary doses and / or tertiary doses of the CRISPR / Cas systems disclosed herein to target the C9orf72 gene. In one example, only a single secondary dose is administered to the subject. In another example, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) secondary doses are administered to the subject. Similarly, in another example, only a single tertiary dose is administered to the subject. In other examples, two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) tertiary doses are administered to the subject.
[0261] The frequency with which secondary doses and / or tertiary doses are administered to a subject can vary over the course of the treatment regimen. The frequency of administration can also be adjusted by a physician during the course of treatment according to the needs of an individual subject following clinical examination.
[0262] In some methods, the percent expression obtained from the C9orf72 exon 1A transcription start site in treated cells (e.g., nerve cells such as motor neurons) is less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25% compared to control untreated cells or compared to before administration (in vitro, ex vivo, or in vivo). The percent expression obtained can be, for example, 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0263] In some methods, the percent decrease in expression from the C9orf72 exon 1A transcription start site in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo) can be at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, or at least about 75%. The percent decrease can be, for example, at 1 week after administration, 2 weeks after administration, 3 weeks after administration, or 4 weeks after administration, or any other appropriate time point.
[0264] In some methods, the resulting percent expression of the C9orf72 hexanucleotide repeat-containing transcript in treated cells (e.g., nerve cells such as motor neurons) compared to untreated control cells or compared to before administration (in vitro, ex vivo, or in vivo) can be less than about 90%, less than about 85%, less than about 80%, less than about 75%, less than about 70%, less than about 65%, less than about 60%, less than about 55%, less than about 50%, less than about 45%, less than about 40%, less than about 35%, less than about 30%, or less than about 25%. The resulting percent expression can be, for example, at 1 week after administration, 2 weeks after...
Claims
1. A composition for use in a method for repressing transcription from the C9orf72 exon 1A transcription start site, or for repressing the transcription of a sense transcript or antisense transcript containing a hexanucleotide repeat elongation sequence in the intracellular C9orf72 gene, wherein the composition is (a) comprising a first nuclease-inactive Cas protein or a nucleic acid encoding the first nuclease-inactive Cas protein, and a first guide RNA or one or more DNAs encoding the first guide RNA, wherein the first guide RNA includes a first DNA targeting segment that targets a first guide RNA target sequence upstream of or near the C9orf72 exon 1A transcription start site, The method comprises introducing the first nuclease-inactive Cas protein or the nucleic acid encoding the first nuclease-inactive Cas protein and the first guide RNA or one or more DNAs encoding the first guide RNA into the cells, wherein the first nuclease-inactive Cas protein and the first guide RNA form a first CRISPR / Cas complex that binds to the target sequence of the first guide RNA, and / or (b) A second nuclease-inactive Cas protein or a nucleic acid encoding the second nuclease-inactive Cas protein, and a second guide RNA or one or more DNAs encoding the second guide RNA, wherein the second guide RNA includes a second DNA targeting segment that targets a second guide RNA target sequence in the C9orf72 hexanucleotide repeat extension sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene. The method comprises introducing the second nuclease-inactive Cas protein or the nucleic acid encoding the second nuclease-inactive Cas protein and the second guide RNA or one or more DNAs encoding the second guide RNA into the cells, wherein the second nuclease-inactive Cas protein and the second guide RNA form a second CRISPR / Cas complex that binds to the target sequence of the second guide RNA, and is a composition for use.
2. The method described above is for suppressing transcription from the C9orf72 exon 1A transcription initiation site, The composition includes option (a), The first guide RNA target sequence is within 250 nucleotides of the C9orf72 exon 1A transcription start site. The first nuclease-inactive Cas protein is not fused to the heterologous transcription repressor domain, and the first guide RNA is not ligated to the heterologous transcription repressor domain. The binding of the first CRISPR / Cas complex to the first guide RNA target sequence reduces or eliminates the expression of transcripts starting at C9orf72 exon 1A, but does not reduce or eliminate the expression of transcripts starting at C9orf72 exon 1B. A composition for use according to claim 1.
3. The composition for use according to claim 2, comprising options (a) and (b).
4. The method in option (a) comprises contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex comprising the first nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within 250 nucleotides of the C9orf72 exon 1A transcription start site, and / or The composition for use according to any one of claims 1 to 3, wherein the method in option (b) comprises contacting the C9orf72 gene with at least two CRISPR / Cas complexes, each CRISPR / Cas complex comprising the second nuclease-inactive Cas protein and a different guide RNA, each different guide RNA targeting a different guide RNA target sequence within the C9orf72 hexanucleotide repeat extension sequence between the first non-coding endogenous exon and exon 2 of the C9orf72 gene.
5. The composition for use according to any one of claims 1 to 3, wherein the first guide RNA target sequence is within 100 nucleotides, within 75 nucleotides, or within 50 nucleotides of the C9orf72 exon 1A transcription start site.
6. The composition for use according to any one of claims 1 to 3, wherein the binding reduces or eliminates the expression of a C9orf72 hexanucleotide repeat-containing transcript, and the binding reduces or eliminates the expression of both sense C9orf72 hexanucleotide repeat-containing transcripts and antisense C9orf72 hexanucleotide repeat-containing transcripts.
7. The first guide RNA is a single guide RNA (sgRNA), The composition for use according to any one of claims 1 to 3, wherein the first nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein, and / or the second nuclease-inactive Cas protein is a nuclease-inactive Cas9 protein.
8. The composition for use according to claim 7, wherein the first nuclease-inactive Ca protein is derived from the Streptococcus pyogenes Cas9 protein, and / or the second nuclease-inactive Ca protein is derived from the Streptococcus pyogenes Cas9 protein.
9. The aforementioned method, (a) Introducing the nucleic acid encoding the first nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA, wherein the nucleic acid encoding the first nuclease-inactive Cas protein includes DNA, and / or (b) Introducing the nucleic acid encoding the second nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA, wherein the nucleic acid encoding the second nuclease-inactive Cas protein includes DNA, (i) The DNA encoding the first nuclease-inactive Cas protein and the one or more DNAs encoding the first guide RNA are in one or more vectors, and the one or more vectors are one or more viral vectors, and / or (II) The DNA encoding the second nuclease-inactive Cas protein and the one or more DNAs encoding the second guide RNA are contained in one or more vectors, and the one or more vectors are one or more viral vectors. A composition for use according to any one of claims 1 to 3.
10. The composition for use according to claim 9, wherein the one or more viral vectors in option (I) or option (II) are one or more adeno-associated virus (AAV) vectors.
11. (i) The first DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence described in any one of SEQ ID NOs. 72-111 and 113, and / or (II) The first DNA targeting segment is at least 90% or at least 95% identical to the sequence described in any one of SEQ ID NOs. 72-111 and 113, and / or (III) The first guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence described in any one of SEQ ID NOs: 32-71 and 112. A composition for use according to any one of claims 1 to 3.
12. (i) The second DNA targeting segment comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence described in any one of SEQ ID NOs: 118 to 121, and / or (II) The second DNA targeting segment is at least 90% or at least 95% identical to the sequence described in any one of SEQ ID NOs: 118 to 121, and / or (III) The second guide RNA target sequence comprises at least 17, at least 18, at least 19, or at least 20 consecutive nucleotides of the sequence described in any one of SEQ ID NOs: 114 to 117. A composition for use according to any one of claims 1 to 3.
13. The composition for use according to any one of claims 1 to 3, wherein the cells are nerve cells, and the cells are in vitro or ex vivo.
14. The composition for use according to claim 13, wherein the nerve cells are motor nerve cells.
15. The composition for use according to any one of claims 1 to 3, wherein the cells are present in vivo in a subject, and the cells are nerve cells in the brain of the subject.
16. The composition for use according to claim 15, wherein the subject is a human being.
17. (a) The first nuclease-inactive Cas protein or the nucleic acid encoding the first nuclease-inactive Cas protein, and the first guide RNA or one or more DNAs encoding the first guide RNA are administered to the subject by intraventricular injection, intracranial injection, or intrathecal injection, and / or (b) The second nuclease-inactive Cas protein or the nucleic acid encoding the second nuclease-inactive Cas protein, and the second guide RNA or one or more DNAs encoding the second guide RNA are administered to the subject by intraventricular injection, intracranial injection, or intrathecal injection. The composition for use according to claim 15.
18. The composition for use according to claim 15, wherein the subject has or is at risk of developing C9orf72 hexanucleotide repeat elongation-related disease.
19. The composition for use according to claim 18, wherein the C9orf72 hexanucleotide repeat elongation-related disorder is amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD).
20. The composition for use according to any one of claims 1 to 3, wherein the cell is a mammalian cell and the C9orf72 gene is a mammalian C9orf72 gene.
21. (i) The cell is a human cell, or (II) The cells are mouse cells. The composition for use according to claim 20.