Circular RNA encoding a chimeric antigen receptor that targets BCMA

Abstract

Circular RNAs are described herein along with related compositions and methods. In some embodiments, the circular RNAs of the present invention comprise a group I intron fragment, a spacer, an IRES, a duplex-forming region, and an expression sequence. In some embodiments, the expression sequence encodes an antigen. In some embodiments, the circular RNAs of the present invention have improved expression, functional stability, immunogenicity, ease of production, and / or half-life compared to linear RNA. In some embodiments, the methods and constructs of the present invention result in improved circularization efficiency, splicing efficiency, and / or purity compared to existing RNA circularization approaches. TIFF2025525390000636.tif72151

Description

[Technical Field]

[0001] cross reference This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 355,527, filed June 24, 2022, and U.S. Patent Application No. 17 / 853,576, filed June 29, 2022, the contents of which are incorporated herein by reference in their entirety for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing XML in computer readable form, which is incorporated herein by reference. Created on May 31, 2023, this XML copy is named OBS-027WO_SL.txt and is 6,585,018 bytes in size. [Background technology]

[0003] Background of the Invention Conventional gene therapy involves the use of DNA to insert desired genetic information into host cells. DNA introduced into cells is usually integrated to some extent into the genome of one or more transfected cells, allowing the introduced genetic material to function long-term in the host. While there may be substantial benefits to such persistent function, the integration of foreign DNA into the host genome can also have many adverse effects. For example, if the introduced DNA is inserted into an intact gene, it may result in a mutation that disrupts or even completely eliminates the function of the endogenous gene. Therefore, DNA-based gene therapy can result in the impairment of vital genetic functions in the treated host, such as the loss or harmful reduction of the production of essential enzymes, or the disruption of genes useful for regulating cell growth, resulting in uncontrolled cell proliferation or cancerous cell growth. In addition, conventional DNA-based gene therapy requires the inclusion of a strong promoter sequence for effective expression of the desired gene product, which may also cause undesirable changes in the regulation of normal gene expression in cells. DNA-based genetic material can result in the induction of unwanted anti-DNA antibodies, which in turn can induce potentially fatal immune responses. Gene therapy approaches using viral vectors can also result in harmful immune responses. Depending on the circumstances, viral vectors may even be integrated into the host genome. In addition, the production of clinical-grade viral vectors is also expensive and time-consuming. Targeted delivery of introduced genetic material using viral vectors can also be difficult to control. Therefore, while DNA-based gene therapy for the delivery of secreted proteins using viral vectors has been evaluated (U.S. Patent No. 6,066,626; U.S. Patent Application Publication No. 2004 / 0110709), these approaches may be limited for various reasons.

[0004] In contrast to DNA, RNA does not carry the risk of being stably integrated into the genome of transfected cells, so the use of RNA as a gene therapy agent is substantially safer, eliminating the concern that the introduced genetic material will disrupt the normal function of essential genes or cause mutations that will lead to harmful or tumorigenic effects.Exogenous promoter sequences are not required for the effective translation of encoded proteins, which also avoids potential harmful side effects.In addition, mRNA does not need to enter the nucleus to perform its function, while DNA must overcome this major obstacle.

[0005] Circular RNA is useful for designing and producing stable forms of RNA.The circularization of RNA molecules provides advantages for the study of RNA structure and function, especially for molecules that are prone to folding into inactive conformations (Wang and Ruffner, 1998).Circular RNA is also of particular interest in the research field of RNA-based control of gene expression and therapeutics, including protein replacement therapy and vaccination, and can be useful for in vivo applications.

[0006] Prior to the present invention, there were three main techniques for producing circularized RNA in vitro: splint-mediated, permuted intron-exon, and RNA ligase-mediated. However, existing methodologies are limited by the size of the RNA they can circularize, thus limiting their therapeutic applications. Summary of the Invention

[0007] overview In one aspect, provided herein is a precursor RNA polynucleotide comprising: a. a 5'-enhanced intron element, b. a 5'-enhanced exon element, c. a core functional element, d. a 3'-enhanced exon element, and e. a 3'-enhanced intron element, wherein the core functional element comprises: i. a translation initiation element (TIE), ii. a coding element encoding a CAR that specifically binds to BCMA, and iii. optionally, a stop codon or stop cassette. In some embodiments, the CAR comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3690-3695.

[0008] In some embodiments, the translation initiation element (TIE) comprises a UTR or a fragment thereof, an aptamer complex or a fragment thereof, or a combination thereof. In some embodiments, the UTR or a fragment thereof comprises a viral internal ribosome entry site (IRES) or a eukaryotic IRES. In some embodiments, the 5'-enhanced intron element comprises a Group I intron or a fragment thereof. In some embodiments, the 3'-enhanced intron element comprises a Group I intron or a fragment thereof. In some embodiments, the 5'-enhanced intron element further comprises a first nucleotide or the first and second nucleotides of a 3' Group I intron splice site dinucleotide. In some embodiments, the 3'-enhanced intron element further comprises a second nucleotide of a 3' Group I intron splice site dinucleotide.

[0009] In one aspect, provided herein is a circular RNA polynucleotide comprising a coding element encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding molecule that specifically binds to BCMA and comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3690-3695. In some embodiments, the circular RNA polynucleotide disclosed herein further comprises a polynucleotide sequence encoding a CAR comprising an antigen binding molecule that specifically binds to CD19. In some embodiments, the coding element is codon-optimized. In some embodiments, the CAR comprises the amino acid sequence of SEQ ID NO: 3690. In some embodiments, the circular RNA is formed from a precursor RNA polynucleotide transcribed from a vector or DNA, including a PCR product, a linearized plasmid, a non-linearized plasmid, a linearized minicircle, a non-linearized minicircle, a viral vector, a cosmid, ceDNA, or an artificial chromosome. In some embodiments, the circular RNA polynucleotide disclosed herein further comprises a translation initiation element (TIE), wherein the TIE comprises an internal ribosome entry site (IRES). In some embodiments, the IRES is derived from an enterovirus, bopivirus, missivirus, gallivirus, ostivirus, cardiovirus, kobuvirus, rabovirus, salivirus, caliciviridae, parechovirus, hunnivirus, tottorivirus, passerivirus, cosavirus, citiniivirus, shambavirus, alexivirus, or meghrivirus. In some embodiments, the circular RNA polynucleotide disclosed herein further comprises an internal spacer sequence. In some embodiments, the circular RNA polynucleotide disclosed herein further comprises 1 to 100 naturally occurring nucleotides derived from a naturally occurring exon.

[0010] In one aspect, provided herein is a pharmaceutical composition comprising: a. a circular RNA polynucleotide comprising a coding element encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding molecule that specifically binds to BCMA; and b. a nanoparticle and, optionally, a targeting moiety operably linked to the nanoparticle.

[0011] In some embodiments, the nanoparticles are lipid nanoparticles, core-shell particles, or biodegradable nanoparticles. In some embodiments, the nanoparticles comprise one or more cationic lipids, ionizable lipids, or poly-β-amino esters. In some embodiments, the nanoparticles comprise one or more non-cationic lipids. In some embodiments, the nanoparticles comprise one or more PEG-modified lipids, polyglutamic acid lipids, or hyaluronic acid lipids. In some embodiments, the nanoparticles comprise cholesterol. In some embodiments, the nanoparticles comprise arachidonic acid, leukotrienes, or oleic acid.

[0012] In one aspect, provided herein is an improved expression construct encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding molecule that specifically binds to BCMA, and the improvement comprises a circular RNA polynucleotide expression sequence.

[0013] In one aspect, provided herein is a method of treating a subject in need thereof, comprising administering a therapeutically effective amount of a composition comprising a circular RNA disclosed herein, a nanoparticle, and, optionally, a targeting moiety operably linked to the nanoparticle.

[0014] In some embodiments, the subject is diagnosed with acute myeloid leukemia (AML); alveolar rhabdomyosarcoma; B-cell malignancies; bladder cancer (e.g., bladder carcinoma); bone cancer; brain cancer (e.g., medulloblastoma and glioblastoma multiforme); breast cancer; cancer of the anus, anal canal, or anorectum; eye cancer; intrahepatic bile duct cancer; joint cancer; cervical cancer; gallbladder cancer; pleural cancer; cancer of the nose, nasal cavity, or middle ear; oral cancer; vulvar cancer; chronic lymphocytic leukemia; chronic bone marrow cancer; colon cancer; esophageal cancer, cervical cancer; fibrosarcoma; gastrointestinal carcinoid tumor; head and neck cancer (e.g., head and neck squamous cell carcinoma); Hodgkin's lymphoma; hypopharyngeal cancer; kidney cancer cancer); laryngeal cancer; leukemia; liquid tumors; lipoma; liver cancer; lung cancer (e.g., non-small cell lung cancer, lung adenocarcinoma, and small cell lung cancer); lymphoma; mesothelioma; mast cell tumor; melanoma; multiple myeloma; nasopharyngeal carcinoma; non-Hodgkin's lymphoma; B-chronic lymphocytic leukemia; hairy cell leukemia; Burkitt lymphoma; ovarian cancer; pancreatic cancer; peritoneal cancer; cancer of the omentum; mesenteric cancer; pharyngeal cancer; prostate cancer; rectal cancer; renal cancer; skin cancer; small intestine cancer; soft tissue cancer; solid tumor; synovial sarcoma; gastric cancer; teratoma; testicular cancer; thyroid cancer; and ureteral cancer.

[0015] In one aspect, the present specification provides a eukaryotic cell comprising the circular RNA polynucleotide disclosed herein.In some embodiments, the eukaryotic cell is an immune cell.In some embodiments, the eukaryotic cell is a T cell, a dendritic cell, a macrophage, a B cell, a neutrophil or a basophil.

[0016] In one aspect, provided herein is a circular RNA polynucleotide expression vector encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding molecule that specifically binds to BCMA.

[0017] In some embodiments, the CAR disclosed herein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3690-3695.

[0018] In some embodiments, the circular RNA polynucleotide expression vectors disclosed herein further comprise a polynucleotide sequence encoding a CAR comprising an antigen binding molecule that specifically binds to CD19.

[0019] In some embodiments, the protein coding or non-coding sequences are codon optimized.

[0020] In some embodiments, the circular RNA polynucleotide expression vectors disclosed herein are optimized to lack at least one microRNA binding site present in the equivalent polynucleotide prior to optimization.

[0021] In some embodiments, the circular RNA polynucleotide expression vectors disclosed herein are optimized to lack at least one RNA editing sensitive site present in the equivalent polynucleotide prior to optimization.

[0022] In some embodiments, the circular RNA polynucleotide expression vectors disclosed herein have an in vivo duration of therapeutic effect in humans of at least 20 hours.

[0023] In some embodiments, the circular RNA polynucleotide expression vectors disclosed herein have a functional half-life of at least 6 hours.

[0024] In some aspects, the circular RNA polynucleotide expression vectors disclosed herein have the same or greater duration of therapeutic effect in human cells than an equivalent linear RNA polynucleotide containing the same expression sequence.

[0025] In some aspects, the circular RNA polynucleotide expression vectors disclosed herein have a longer duration of therapeutic effect in vivo in humans than an equivalent linear RNA polynucleotide with the same expression sequence.

[0026] In some embodiments, the precursor RNA polynucleotide is transcribed from a vector or DNA, including a PCR product, a linearized plasmid, a non-linearized plasmid, a linearized minicircle, a non-linearized minicircle, a viral vector, a cosmid, ceDNA, or an artificial chromosome.

[0027] In some embodiments, the pharmaceutical composition comprises a circular RNA polynucleotide expression vector disclosed herein, a nanoparticle, and, optionally, a targeting moiety operably linked to the nanoparticle.

[0028] In some embodiments, the nanoparticles are lipid nanoparticles, core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymeric nanoparticles, polyplexes, or biodegradable polymeric nanoparticles.

[0029] In some aspects, the pharmaceutical compositions disclosed herein comprise a targeting moiety, wherein the targeting moiety mediates receptor-mediated endocytosis, endosomal fusion, or direct fusion into selected cells of a selected cell population or tissue without isolation or purification of the cells.

[0030] In some aspects, the pharmaceutical compositions disclosed herein comprise a targeting moiety operably linked to a nanoparticle.

[0031] In some embodiments, the targeting moiety is a small molecule, scFv, nanobody, peptide, cyclic peptide, bi- or tricyclic peptide, minibody, polynucleotide aptamer, engineered scaffold protein, heavy chain variable region, light chain variable region, or fragments thereof.

[0032] In some embodiments, pharmaceutical compositions are disclosed herein, wherein less than 1% by weight of the polynucleotide in the composition is double-stranded RNA, a DNA splint, a DNA template, or triphosphorylated RNA.

[0033] In some embodiments, pharmaceutical compositions are disclosed herein, wherein less than 1% by weight of the polynucleotides and proteins in the pharmaceutical composition are double-stranded RNA, DNA splints, DNA templates, triphosphorylated RNA, phosphatase proteins, protein ligases, RNA polymerases, and capping enzymes.

[0034] In one aspect, provided herein is a pharmaceutical composition comprising a circular RNA polynucleotide disclosed herein and a pharmaceutical salt, buffer, diluent, or combination thereof.

[0035] In one aspect, provided herein is an improved expression construct encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen binding molecule that specifically binds to BCMA, the improvement comprising a circular RNA polynucleotide expression vector.

[0036] In one aspect, provided herein is a circular RNA polynucleotide expression vector encoding a chimeric antigen receptor (CAR), wherein the CAR comprises a means for specifically binding to BCMA.

[0037] In one aspect, provided herein is a recombinant cell expressing a CAR encoded by a circular RNA polynucleotide expression vector disclosed herein.

[0038] In some embodiments, the cell is an immune cell.

[0039] In some embodiments, the immune cell is a T cell, an NK cell, or a macrophage.

[0040] In one aspect, provided herein is a precursor RNA polynucleotide comprising, in the following order: a. a 5' enhanced intronic element, b. a 5' enhanced exon element, c. a core functional element, d. a 3' enhanced exon element, and e. a 3' enhanced intronic element, wherein the core functional element comprises, in the following order: i. a translation initiation element (TIE), ii. a coding element encoding a CAR that specifically binds to BCMA, and iii. optionally, a stop codon or stop cassette.

[0041] In one aspect, provided herein is a precursor RNA polynucleotide comprising, in the following order: a. a 5' enhanced intronic element, b. a 5' enhanced exonic element, c. a core functional element, d. a 3' enhanced exonic element, and e. a 3' enhanced intronic element, wherein the core functional element comprises, in the following order: i. a coding region encoding a CAR that specifically binds to BCMA, ii. optionally, a stop codon or stop cassette, and iii. a translation initiation element (TIE).

[0042] In some aspects, the core functional elements further comprise non-coding elements.

[0043] In some embodiments, the TIE comprises an untranslated region (UTR) or a fragment thereof, an aptamer complex or a fragment thereof, or a combination thereof.

[0044] In some embodiments, the UTR or fragment thereof is derived from a viral or eukaryotic messenger RNA. In some embodiments, the UTR or fragment thereof comprises a viral internal ribosome entry site (IRES) or a eukaryotic IRES. In some embodiments, the IRES comprises a sequence selected from Table A or a fragment thereof. In some embodiments, the IRES comprises one or more modified nucleotides compared to a wild-type viral IRES or a eukaryotic IRES.

[0045] In some embodiments, the aptamer complex or fragment thereof comprises a natural or synthetic aptamer sequence. In some embodiments, the aptamer complex or fragment thereof comprises a sequence selected from any of the ASCII tables. In some embodiments, the aptamer complex or fragment thereof comprises more than one aptamer.

[0046] In some embodiments, the TIE comprises a UTR and an aptamer complex. In some embodiments, the UTR is located upstream of the aptamer complex. In some embodiments, the TIE further comprises an accessory element. In some embodiments, the accessory element comprises an miRNA binding site or a fragment thereof, a restriction site or a fragment thereof, an RNA editing motif or a fragment thereof, a zip code element or a fragment thereof, an RNA transport element or a fragment thereof, or a combination thereof. In some embodiments, the accessory element comprises a binding domain to an IRES trans-acting factor (ITAF). In some embodiments, the binding domain comprises a polyA tract, a polyC tract, a polyAC tract, a polypyrimidine tract, or a combination or variant thereof. In some embodiments, the ITAF comprises poly(rC)-binding protein 1 (PCBP1), PCBP2, PCBP3, PCBP4, poly(A)-binding protein 1 (PABP1), polypyrimidine-tract binding protein (PTB), an Argonaute protein family member, HNRNPK (heterogeneous nuclear ribonucleoprotein K protein), or La protein, or a fragment or combination thereof.

[0047] In some embodiments, the non-coding element comprises more than one non-coding element. In some embodiments, the non-coding element comprises between 50 and 15,000 nucleotides in length. In some embodiments, the non-coding element sequence comprises or consists of a sequence selected from any of the ASCII tables.

[0048] In some embodiments, the core functional element comprises a termination sequence. In some embodiments, the termination sequence is located at the 5' end of the 3'-enhanced exon element. In some embodiments, the termination sequence is a stop codon. In some embodiments, the termination sequence is a termination cassette. In some embodiments, the termination cassette comprises one or more stop codons in one or more frames. In some embodiments, each frame comprises a stop codon. In some embodiments, each frame comprises two or more stop codons.

[0049] In some embodiments, the 5'-enhanced intron element comprises a 3' intron fragment. In some embodiments, the 3' intron fragment further comprises the first nucleotide or the first and second nucleotides of a 3' Group I intron splice site dinucleotide. In some embodiments, the 3' intron fragment is located at the 3' end of the 5'-enhanced intron element. In some embodiments, the Group I intron comprises or is derived from a bacteriophage, a viral vector, an organelle genome, or a nuclear rDNA gene. In some embodiments, the nuclear rDNA gene comprises a nuclear rDNA gene from a fungus, a plant, or an alga, or a fragment thereof.

[0050] In some embodiments, the 5'-enhanced intron element comprises a leader untranslated sequence located at the 5' end. In some embodiments, the leader untranslated sequence comprises a spacer. In some embodiments, the leader untranslated sequence comprises the last nucleotide of the transcription start site. In some embodiments, the leader untranslated sequence comprises 1 to 100 additional nucleotides.

[0051] In some embodiments, the 5' enhanced intron element comprises a 5' affinity sequence. In some embodiments, the 5' affinity sequence comprises a polyA, polyAC, or polypyrimidine sequence. In some embodiments, the 5' affinity sequence comprises 10-100 nucleotides. In some embodiments, the 5' enhanced intron element comprises a 5' external spacer sequence. In some embodiments, the 5' external spacer sequence is located between the 5' affinity sequence and the 3' intron fragment. In some embodiments, the 5' external spacer sequence has a length of about 6-60 nucleotides. In some embodiments, the 5' external spacer sequence comprises or consists of a sequence selected from any of the ASCII tables.

[0052] In some embodiments, the 5' enhanced intron element comprises, in the following order: a. leading untranslated sequence; b. 5' affinity sequence; c. 5' external spacer sequence; and d. a 3' intron fragment comprising the first nucleotide of the 3' Group I intron splice site; wherein the leading untranslated sequence comprises the last nucleotide and 1-100 nucleotides of the transcription start site.

[0053] In some embodiments, the 5' enhanced intron element comprises, in the following order: a. leading untranslated sequence; b. a 5' external spacer sequence; c. a 5' affinity sequence; and d. a 3' intron fragment comprising the first nucleotide of the 3' Group I splice site; wherein the leading untranslated sequence comprises the last nucleotide and 1-100 nucleotides of the transcription start site.

[0054] In some embodiments, the 5' enhanced intron element comprises, in the following order: a. leader untranslated sequence; b. 5' affinity sequence; c. 5' external spacer sequence; and d. a 3' intron fragment comprising the first and second nucleotides of a 3' Group I intron splice site; wherein the leader untranslated sequence comprises the last nucleotide and 1-100 nucleotides of the transcription start site; and the 5' enhanced exon element comprises a 3' exon fragment lacking the second nucleotide of the 3' Group I splice site dinucleotide.

[0055] In some embodiments, the 5' enhanced intron element comprises, in the following order: a. a leading untranslated sequence; b. a 5' external spacer sequence; c. a 5' affinity sequence; and d. a 3' intron fragment comprising the first and second nucleotides of a 3' Group I splice site; wherein the leading untranslated sequence comprises the last nucleotide and 1 to 100 nucleotides of the transcription start site; and the 5' enhanced exon element comprises a 3' exon fragment lacking the second nucleotide of the 3' Group I splice site dinucleotide.

[0056] In some embodiments, the 5'-enhanced exon element comprises a 3' exon fragment. In some embodiments, the 3' exon fragment further comprises the second nucleotide of a 3' Group I intron splice site dinucleotide. In some embodiments, the 3' exon fragment comprises 1 to 100 naturally occurring nucleotides derived from a naturally occurring exon. In some embodiments, the naturally occurring exon is derived from a Group I intron-containing gene or a fragment thereof. In some embodiments, the naturally occurring exon is derived from an Anabaena bacterium, a T4 phage virus, a Twort bacteriophage, a Tetrahymena, or an Azoarcus bacterium.

[0057] In some embodiments, the 5'-enhanced exon element comprises a 5' internal spacer sequence located downstream of the 3' exon fragment. In some embodiments, the 5' internal spacer sequence is about 6-60 nucleotides in length. In some embodiments, the 5' internal spacer sequence comprises or consists of a sequence selected from any of the ASCII tables.

[0058] In some embodiments, the 5'-enhanced exon element comprises, in the following order: a. a 3' exon fragment comprising the second nucleotide of the 3' Group I intron splice site dinucleotide; and b. a 5' internal spacer sequence, wherein the 3' exon fragment comprises between 1 and 100 naturally occurring nucleotides derived from the naturally occurring exon.

[0059] In some embodiments, the 5'-enhanced exon element comprises, in the following order: a. a 3' exon fragment; and b. a 5' internal spacer sequence, wherein the 3' exon fragment comprises 1 to 100 naturally occurring nucleotides from a naturally occurring exon; and the 5'-enhanced intron element comprises a 3' intron fragment comprising the first and second nucleotides of a 3' Group I splice site dinucleotide.

[0060] In some embodiments, the 3'-enhanced exon element comprises a 5' exon fragment. In some embodiments, the 5' exon fragment comprises the first nucleotide of a 5' Group I intron fragment. In some embodiments, the 5' exon fragment further comprises 1 to 100 nucleotides from a naturally occurring exon. In some embodiments, the naturally occurring exon is from a Group I intron-containing gene or a fragment thereof.

[0061] In some embodiments, the 3'-enhanced exon element comprises a 3' internal spacer sequence. In some embodiments, the 3' internal spacer sequence is located between the termination sequence and the 5' exon fragment. In some embodiments, the 3' internal spacer is about 6-60 nucleotides in length. In some embodiments, the 3' internal spacer comprises or consists of a sequence selected from any of the ASCII tables.

[0062] In some embodiments, the 3'-enhanced exon element comprises a. a 3' internal spacer sequence; and b. a 5' exon fragment comprising the first nucleotide of a 5' Group I intron splice site dinucleotide, wherein the 5' exon fragment comprises between 1 and 100 nucleotides derived from the native exon.

[0063] In some embodiments, the 3'-enhanced exon element comprises: a. a 3' internal spacer sequence; and b. a 5' exon fragment, wherein the 5' exon fragment comprises 1 to 100 nucleotides from a naturally occurring exon; and the 3'-enhanced intron element comprises a 5' intron fragment comprising the first and second nucleotides of a 5' Group I intron splice site dinucleotide.

[0064] In some embodiments, the 3' enhanced intron element comprises a 5' intron fragment. In some embodiments, the 5' intron fragment comprises the second nucleotide of the 5' Group I intron splice site dinucleotide.

[0065] In some embodiments, the 3'-enhanced intron element comprises a trailing untranslated sequence located at the 3' end of the 5' intron, hi some embodiments, the trailing untranslated sequence comprises between 3 and 12 nucleotides.

[0066] In some embodiments, the 3'-enhanced intron fragment comprises a 3' external spacer sequence. In some embodiments, the 3' external spacer sequence is located between the 5' intron fragment and the following untranslated sequence. In some embodiments, the 3' external spacer sequence has a length of 6 to 60 nucleotides. In some embodiments, the 3' external spacer sequence comprises or consists of a sequence selected from any of the ASCII tables.

[0067] In some embodiments, the 3'-enhanced intron element comprises a 3' affinity sequence. In some embodiments, the 3' affinity sequence is located between the 3' external spacer sequence and the following untranslated sequence. In some embodiments, the 3' affinity sequence comprises a polyA, polyAC, or polypyrimidine sequence. In some embodiments, the affinity sequence comprises 10 to 100 nucleotides.

[0068] In some embodiments, the 5'-enhanced intron element further comprises a 5' exo duplex sequence; wherein the 3'-enhanced intron element further comprises a 3' exo duplex sequence. In some embodiments, the 5' exo duplex sequence and the 3' exo duplex sequence are fully or partially complementary to each other. In some embodiments, the 5' exo duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3' exo duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3' exo duplex sequence is from about 6 to about 50 nucleotides. In some embodiments, the 5' exo duplex sequence is from about 6 to about 50 nucleotides. In some embodiments, the 3' exo duplex sequence comprises or consists of a sequence selected from any of the ASCII tables. In some embodiments, the 5' exo duplex sequence comprises or consists of a sequence selected from any of the ASCII tables.

[0069] In some embodiments, the 5'-enhanced exonic element further comprises a 5'-internal duplex sequence; and wherein the 3'-enhanced exonic element further comprises a 3'-internal duplex sequence. In some embodiments, the 5'-internal duplex sequence and the 3'-internal duplex sequence are fully or partially complementary to one another. In some embodiments, the 5'-internal duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3'-internal duplex sequence comprises fully synthetic or partially synthetic nucleotides. In some embodiments, the 3'-internal duplex sequence is from about 6 to about 19 nucleotides. In some embodiments, the 5'-internal duplex sequence is from about 6 to about 19 nucleotides. In some embodiments, the 3'-internal duplex sequence comprises or consists of a sequence selected from any of an ASCII table. In some embodiments, the 5'-internal duplex sequence comprises or consists of a sequence selected from any of an ASCII table.

[0070] In some embodiments, the 3' enhanced intron fragment comprises, in the following order: a. a 5' intron fragment comprising the second nucleotide of the 5' Group I intron splice site dinucleotide; b. a 3' external spacer sequence; and c. a 3' affinity sequence.

[0071] In some embodiments, the 3'-enhanced intron fragment comprises, in the following order: a. a 5' intron fragment comprising the first and second nucleotides of a 5' Group I intron splice site dinucleotide; b. a 3' external spacer sequence; and c. a 3' affinity sequence, wherein the 3'-enhanced exon element comprises a 5' exon fragment lacking the first nucleotide of the 5' Group I intron splice site dinucleotide.

[0072] In some embodiments, the precursor RNA polynucleotides provided comprise, in the following order: a. leading untranslated sequence; b. 5' affinity sequence; c. 5' external duplex sequence; d. 5' spacer sequence; e. 3' intron fragment; f. 3' exon fragment; g. 5' internal duplex sequence; h. 5' internal spacer sequence; i. translation initiation element; j. coding element; k. termination sequence; l. 3' internal spacer sequence; m. 3' internal duplex sequence; n. 5' exon fragment; o. 5' intron fragment; p. 3' external duplex sequence; q. 3' affinity sequence; and r. trailing untranslated sequence.

[0073] In some embodiments, the precursor RNA polynucleotides provided comprise, in the following order: a. leading untranslated sequence; b. 5' affinity sequence; c. 5' external spacer sequence; d. 3' intron fragment; e. 3' exon fragment; f. 5' internal duplex sequence; g. 5' internal spacer sequence; h. non-coding element; i. 3' internal spacer sequence; j. 3' internal duplex sequence; k. 5' exon fragment; l. 5' intron fragment; m. 3' external spacer sequence; n. 3' affinity sequence; and o. trailing untranslated sequence.

[0074] In some embodiments, the precursor RNA polynucleotides provided comprise, in the following order: a. leader untranslated sequence; b. 5' affinity sequence; c. 5' external spacer sequence; d. 3' intron fragment; e. 3' exon fragment; f. 5' internal duplex sequence; g. 5' internal spacer sequence; h. translation initiation element; i. coding element encoding a CAR that specifically binds to BCMA; j. termination sequence; k. 3' internal spacer sequence; l. 3' internal duplex sequence; m. 5' exon fragment; n. 5' intron fragment; o. 3' external spacer sequence; and p. 3' affinity sequence.

[0075] In some embodiments, the precursor RNA polynucleotides provided comprise, in the following order: a. a leading untranslated sequence; b. a 5' affinity sequence; c. a 5' external spacer sequence; d. a 3' intron fragment; e. a 3' exon fragment; f. a 5' internal spacer sequence; g. a translation initiation element; h. a coding element encoding a CAR that specifically binds to BCMA; i. a termination sequence; j. a 3' internal spacer sequence; k. a 5' exon fragment; l. a 5' intron fragment; m. a 3' external spacer sequence; and n. a 3' affinity sequence.

[0076] In some embodiments, the precursor RNA polynucleotides provided comprise, in the following order: a. leading untranslated sequence; b. 5' affinity sequence; c. 5' external spacer sequence; d. 3' intron fragment; e. 3' exon fragment; f. 5' internal spacer sequence; g. non-coding element; h. 3' internal spacer sequence; i. 5' exon fragment; j. 5' intron fragment; k. 3' external spacer sequence; l. 3' affinity sequence; and m. trailing untranslated sequence.

[0077] In some embodiments, the precursor RNA polynucleotides provided comprise, in the following order: a. leading untranslated sequence; b. 5' affinity sequence; c. 5' external duplex sequence; d. 5' spacer sequence; e. 3' intron fragment; f. 3' exon fragment; g. 5' internal duplex sequence; h. 5' internal spacer sequence; i. termination sequence; j. coding element encoding a CAR that specifically binds to BCMA; k. translation initiation element; l. 3' internal spacer sequence; m. 3' internal duplex sequence; n. 5' exon fragment; o. 5' intron fragment; p. 3' external duplex sequence; q. 3' affinity sequence; and r. trailing untranslated sequence.

[0078] In some embodiments, the coding element comprises two or more protein coding regions. In some embodiments, the precursor RNA polynucleotide comprises a polynucleotide sequence encoding a proteolytic cleavage site or a ribosomal stuttering element between the first and second expressed sequences. In some embodiments, the ribosomal stuttering element is a self-cleaving spacer. In some embodiments, the precursor RNA polynucleotide comprises a polynucleotide sequence encoding a 2A ribosomal stuttering peptide.

[0079] In some embodiments, the core functional elements comprise two or more internal ribosome entry sites (IRES). In some embodiments, the core functional elements comprise a TIE, a coding element, a termination sequence, optionally a spacer, a TIE, a coding element, and a termination sequence, wherein the TIE comprises an IRES.

[0080] Also provided herein are circular RNA polynucleotides produced from the precursor RNA polynucleotides provided herein. In some embodiments, the precursor RNA polynucleotide is transcribed from a vector or DNA, including a PCR product, a linearized plasmid, a non-linearized plasmid, a linearized minicircle, a non-linearized minicircle, a viral vector, a cosmid, ceDNA, or an artificial chromosome. In some embodiments, the circular RNA polynucleotide is composed of naturally occurring nucleotides. In some embodiments, the protein-coding or non-coding sequence is codon-optimized. In some embodiments, the circular RNA polynucleotide is about 0.1 to about 15 kilobases in length. In some embodiments, the circular RNA polynucleotide is optimized to lack at least one microRNA-binding site present in an equivalent polynucleotide prior to optimization. In some embodiments, the circular RNA polynucleotide is optimized to lack at least one RNA editing-sensitive site present in an equivalent polynucleotide prior to optimization. In some embodiments, the circular RNA polynucleotide has an in vivo therapeutic effect duration of at least 20 hours in humans. In some embodiments, the circular RNA polynucleotide has a functional half-life of at least 6 hours. In some embodiments, the circular RNA polynucleotide has a duration of therapeutic effect in human cells that is equal to or greater than that of an equivalent linear RNA polynucleotide comprising the same expression sequence, hi some embodiments, the circular RNA polynucleotide has a longer duration of therapeutic effect in vivo in humans than an equivalent linear RNA polynucleotide with the same expression sequence.

[0081] Also provided herein is a method for producing a translation initiation element (TIE), comprising: a. obtaining a viral untranslated region (UTR); b. determining a functional unit of the UTR that can bind to an initiation factor and / or initiate translation by progressively deleting sequences; c. removing non-functional units of the UTR; and optionally modifying the ends of the UTR. In some embodiments, the modification of the ends of the UTR is about 1 percent to 75% of the viral UTR. In some embodiments, the functional unit of the UTR is determined by performing a deletion scan from the 5' and 3' ends of the UTR or a mutation scan along the entire length of the UTR to identify important regions.

[0082] Also provided herein is a pharmaceutical composition comprising a circular RNA polynucleotide provided herein, a nanoparticle, and, optionally, a targeting moiety operably linked to the nanoparticle. In some embodiments, the nanoparticle is a lipid nanoparticle, a core-shell nanoparticle, a biodegradable nanoparticle, a biodegradable lipid nanoparticle, a polymer nanoparticle, a polyplex, or a biodegradable polymer nanoparticle. In some embodiments, the pharmaceutical composition comprises a targeting moiety, wherein the targeting moiety mediates receptor-mediated endocytosis, endosomal fusion, or direct fusion into selected cells of a selected cell population or tissue without cell isolation or purification. In some embodiments, the pharmaceutical composition comprises a targeting moiety operably linked to the nanoparticle. In some embodiments, the targeting moiety is a small molecule, scFv, nanobody, peptide, cyclic peptide, bi- or tricyclic peptide, minibody, polynucleotide aptamer, engineered scaffold protein, heavy chain variable region, light chain variable region, or fragment thereof. In some embodiments, less than 1% by weight of the polynucleotide in the composition is double-stranded RNA, a DNA splint, a DNA template, or triphosphorylated RNA. In some embodiments, less than 1% by weight of the polynucleotides and proteins in the pharmaceutical composition are double-stranded RNA, DNA splints, DNA templates, triphosphorylated RNA, phosphatase proteins, protein ligases, RNA polymerases, and capping enzymes.

[0083] Also provided herein are pharmaceutical compositions comprising a circular RNA polynucleotide provided herein and a liposome, a dendrimer, a carbohydrate carrier, a glycan nanomaterial, a fusome, an exosome, or a combination thereof.

[0084] Also provided herein are pharmaceutical compositions comprising a circular RNA polynucleotide provided herein and a pharmaceutical salt, buffer, diluent, or combinations thereof.

[0085] Also provided herein are methods of treating a subject in need thereof, comprising administering a therapeutically effective amount of a composition comprising a circular RNA polynucleotide provided herein, a nanoparticle, and, optionally, a targeting moiety operably linked to the nanoparticle. In some embodiments, the targeting moiety is a small molecule, scFv, nanobody, peptide, cyclic peptide, bi- or tricyclic peptide, minibody, heavy chain variable region, engineered scaffold protein, light chain variable region, or fragment thereof. In some embodiments, the nanoparticle is a lipid nanoparticle, a core-shell nanoparticle, or a biodegradable nanoparticle. In some embodiments, the nanoparticle comprises one or more cationic lipids, ionizable lipids, or poly-β-aminoesters. In some embodiments, the nanoparticle comprises one or more non-cationic lipids. In some embodiments, the nanoparticle comprises one or more PEG-modified lipids, polyglutamic acid lipids, or hyaluronic acid lipids. In some embodiments, the nanoparticle comprises cholesterol. In some embodiments, the nanoparticle comprises arachidonic acid, leukotrienes, or oleic acid. In some embodiments, the composition comprises a targeting moiety, wherein the targeting moiety selectively mediates receptor-mediated endocytosis into cells of a selected cell population without cell selection or purification. In some embodiments, the nanoparticle comprises more than one circular RNA polynucleotide.In some embodiments, the subject is diagnosed with acute myeloid leukemia (AML); alveolar rhabdomyosarcoma; B-cell malignancies; bladder cancer (e.g., bladder carcinoma); bone cancer; brain cancer (e.g., medulloblastoma and glioblastoma multiforme); breast cancer; cancer of the anus, anal canal, or anorectum; eye cancer; intrahepatic bile duct cancer; joint cancer; cervical cancer; gallbladder cancer; pleural cancer; cancer of the nose, nasal cavity, or middle ear; oral cancer; vulvar cancer; chronic lymphocytic leukemia; chronic bone marrow cancer; colon cancer; esophageal cancer, cervical cancer; fibrosarcoma; gastrointestinal carcinoid tumor; head and neck cancer (e.g., head and neck squamous cell carcinoma); Hodgkin's lymphoma; hypopharyngeal cancer The patient has a cancer selected from the group consisting of: cancer; renal cancer; laryngeal cancer; leukemia; liquid tumors; lipoma; liver cancer; lung cancer (e.g., non-small cell lung cancer, lung adenocarcinoma, and small cell lung cancer); lymphoma; mesothelioma; mast cell tumor; melanoma; multiple myeloma; nasopharyngeal carcinoma; non-Hodgkin's lymphoma; B-chronic lymphocytic leukemia; hairy cell leukemia; Burkitt lymphoma; ovarian cancer; pancreatic cancer; peritoneal cancer; omental cancer; mesenteric cancer; pharyngeal cancer; prostate cancer; rectal cancer; renal cancer; skin cancer; small intestine cancer; soft tissue cancer; solid tumor; synovial sarcoma; gastric cancer; teratoma; testicular cancer; thyroid cancer; and ureteral cancer. In some embodiments, the subject has an autoimmune disorder selected from scleroderma, Graves' disease, Crohn's disease, Sjogren's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrine syndrome, type I diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveoretinitis, polymyositis, colitis, thyroiditis, and a systemic autoimmune disease typified by human lupus.

[0086] Also provided herein is a eukaryotic cell comprising the circular RNA polynucleotide or pharmaceutical composition provided herein.In some embodiments, the eukaryotic cell is a human cell.In some embodiments, the eukaryotic cell is an immune cell.In some embodiments, the eukaryotic cell is a T cell, a dendritic cell, a macrophage, a B cell, a neutrophil, or a basophil.

[0087] Also provided herein are prokaryotic cells comprising the circular RNA polynucleotides provided herein.

[0088] In another aspect, provided herein is a method for purifying circular RNA, comprising hybridizing an oligonucleotide conjugated to a solid surface with an affinity sequence.

[0089] In some embodiments, one or more copies of the affinity sequence are present in the precursor RNA. In some embodiments, the precursor RNA is a precursor as described herein. In some embodiments, the circular RNA is a circular RNA as described herein. In some embodiments, the affinity sequence is removed during the formation of the circular RNA. In some embodiments, the method includes separating the circular RNA from the precursor RNA.

[0090] In some embodiments, the affinity sequence comprises a polyA sequence. In some embodiments, the oligonucleotide that hybridizes to the affinity sequence is a deoxythymidine oligonucleotide. In some embodiments, the affinity sequence comprises a dedicated binding site (DBS). In some embodiments, the DBS is TIFF2025525390000002.tif4128. In some embodiments, the oligonucleotide that hybridizes to the affinity sequence comprises a sequence complementary to DBS.

[0091] In another aspect, provided herein is a method for purifying circular RNA, comprising: a. contacting a composition comprising linear RNA and circular RNA with a binding agent that preferentially binds linear RNA over circular RNA; and b. separating RNA that is bound to the binding agent from RNA that is not bound to the binding agent.

[0092] In some embodiments, the binding agent is conjugated to a solid support. In some embodiments, the solid support comprises agarose, an agarose-derived resin, cellulose, cellulose fibers, magnetic beads, a high-throughput microtiter plate, a non-agarose resin, a glass surface, a polymer surface, or a combination thereof. In some embodiments, the solid support comprises agarose or cellulose.

[0093] In some embodiments, the binding agent comprises an oligonucleotide that is complementary to a sequence that is present in the linear RNA and that is absent from the circular RNA. In some embodiments, the binding agent comprises an oligonucleotide that is 100% complementary to a sequence that is present in the linear RNA and that is absent from the circular RNA. In some embodiments, the sequence that is present in the linear RNA and that is absent from the circular RNA is an affinity sequence. In some embodiments, the sequence that is present in the linear RNA and that is absent from the circular RNA comprises a polyA sequence. In some embodiments, the binding agent comprises an oligonucleotide that comprises a poly-deoxythymidine sequence. In some embodiments, the sequence that is present in the linear RNA and that is absent from the circular RNA comprises a DBS sequence. In some embodiments, the DBS sequence is The circular RNA comprises the nucleotide sequence of TIFF2025525390000003.tif4128. In some embodiments, the sequence present in the linear RNA and absent from the circular RNA is 10-150 nucleotides in length. In some embodiments, the sequence present in the linear RNA and absent from the circular RNA is 10-70 nucleotides in length. In some embodiments, the sequence present in the linear RNA and absent from the circular RNA is 20-30 nucleotides in length. In some embodiments, the sequence present in the linear RNA and absent from the circular RNA is present at two positions in the linear RNA. In some embodiments, the sequence present in the linear RNA and absent from the circular RNA is encoded in the linear RNA during transcription of the linear RNA. In some embodiments, the sequence present in the linear RNA and absent from the circular RNA is enzymatically added to the linear RNA. In some embodiments, the linear RNA does not comprise a methylguanylate cap. In some embodiments, the linear RNA comprises a precursor RNA or a fragment thereof.

[0094] In some embodiments, the precursor RNA is a precursor RNA described herein or a fragment thereof. In some embodiments, the precursor RNA is produced using in vitro transcription (IVT). In some embodiments, the fragment comprises an intron. In some embodiments, the linear RNA comprises a prematurely terminated RNA or an RNA formed by abortive transcription.

[0095] In some embodiments, the circular RNA comprises the circular RNA described herein.In some embodiments, the circular RNA is produced using a method comprising splicing precursor RNA.In some embodiments, the sequence that exists in linear RNA and is missing in circular RNA is excised during splicing.In some embodiments, the circular RNA is less than 6 kilobases in size.

[0096] In some embodiments, the separating step comprises removing the unbound RNA from the solid support, hi some embodiments, the removing comprises eluting the unbound RNA from the solid support.

[0097] In some embodiments, the method includes a step of heating the composition. In some embodiments, the method includes a buffer exchange. In some embodiments, the buffer exchange occurs before the contacting step. In some embodiments, the buffer exchange occurs after the separating step. In some embodiments, the buffer exchange occurs before the contacting step, and the resulting buffer contains more than 1 mM monovalent salt. In some embodiments, the monovalent salt is NaCl or KCl. In some embodiments, the resulting buffer contains Tris. In some embodiments, the resulting buffer contains EDTA. In some embodiments, the buffer exchange occurs after the separating step into a storage buffer, wherein the storage buffer contains 1 mM sodium citrate, pH 6.5. In some embodiments, the method includes a step of filtering the circular RNA after the separating step. [Brief explanation of the drawings]

[0098] [Figure 1A] Figures 1A-1E show luminescence in the supernatants of HEK293 (Figures 1A, 1D, and 1E), HepG2 (Figure 1B), or 1C1C7 (Figure 1C) cells 24 hours after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 1B] See legend to Figure 1A. [Figure 1C] See legend to Figure 1A. [Figure 1D] See legend to Figure 1A. [Figure 1E] See legend to Figure 1A. [Figure 2] Figures 2A-2C show luminescence in the supernatant of HEK293 (Figure 2A), HepG2 (Figure 2B), or 1C1C7 (Figure 2C) cells 24 h after transfection with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences with different lengths. [Figure 3] Figures 3A and 3B show the stability of selected IRES constructs over a 3 day period in HepG2 (Figure 3A) or 1C1C7 (Figure 3B) cells as measured by luminescence. [Figure 4] 4A and 4B show protein expression from selected IRES constructs in Jurkat cells as measured by luminescence from Gaussia luciferase secreted into the cell supernatant. [Figure 5] Figures 5A and 5B show the stability of selected IRES constructs in Jurkat cells over a 3 day period as measured by luminescence. [Figure 6A] Figures 6A and 6B show a comparison of the 24-hour luminescence (Figure 6A) or relative luminescence over a 3-day period (Figure 6B) of modified linear RNA, unpurified circular RNA, or purified circular RNA encoding Gaussia luciferase. [Figure 6B] See legend to Figure 6A. [Figure 7A] Figures 7A-7F show the transcript induction of IFNγ (Figure 7A), IL-6 (Figure 7B), IL-2 (Figure 7C), RIG-I (Figure 7D), IFN-β1 (Figure 7E), and TNFα (Figure 7F) after electroporation of modified linear RNA, unpurified circular RNA, or purified circular RNA into Jurkat cells. [Figure 7B] See legend to Figure 7A. [Figure 7C] See legend to Figure 7A. [Figure 7D] See legend to Figure 7A. [Figure 7E] See legend to Figure 7A. [Figure 7F] See legend to Figure 7A. [Figure 8A] Figures 8A-8C show a comparison of the luminescence of circular and modified linear RNAs encoding Gaussia luciferase in human primary monocytes (Figure 8A) and macrophages (Figures 8B and 8C). [Figure 8B] See legend to Figure 8A. [Figure 8C] See legend to Figure 8A. [Figure 9] 9A-9B show the relative luminescence over 3 days (FIG. 9A) or 24-hour luminescence (FIG. 9B) in the supernatant of primary T cells after transduction with circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences. [Figure 10A] Figures 10A-10C show the 24-hour luminescence (Figure 10A) or relative luminescence over 3 days (Figure 10B) in the supernatants of primary T cells after transduction with circular or modified linear RNA containing a Gaussia luciferase expression sequence, and the 24-hour luminescence in PBMCs (Figure 10C). [Figure 10B] See legend to Figure 10A. [Figure 10C] See legend to Figure 10A. [Figure 11] 11A and 11B show the HPLC chromatogram (FIG. 11A) and circularization efficiency (FIG. 11B) of RNA constructs with different permutation sites. [Figure 12] Figures 12A and 12B show the HPLC chromatograms (Figure 12A) and circularization efficiencies (Figure 12B) of RNA constructs with different introns and / or permutation sites. [Figure 13A] Figures 13A and 13B show the HPLC chromatograms (Figure 13A) and circularization efficiencies (Figure 13B) of three RNA constructs with and without homologous arms. [Figure 13B] See legend to Figure 13A. [Figure 14] Circularization efficiencies of three RNA constructs in the absence of homologous arms or in the presence of homologous arms of various lengths and GC content are shown. [Figure 15] Figures 15A and 15B show HPLC chromatograms illustrating the contribution of strong homology arms to improved splicing efficiency, the relationship between circularization efficiency and nicking in selected constructs, and combinations of permutation sites and homology arms hypothesized to show improved circularization efficiency. [Figure 16] Fluorescence images of mock-electroporated T cells (left) or T cells electroporated with circular RNA encoding a CAR (right) are shown, co-cultured with Raji cells expressing GFP and firefly luciferase. [Figure 17] Brightfield (left), fluorescent (center), and overlaid (right) images of T cells mock-electroporated (top) or electroporated with circular RNA encoding a CAR (bottom) and co-cultured with Raji cells expressing GFP and firefly luciferase are shown. [Figure 18] Specific lysis of Raji target cells by mock-electroporated T cells or T cells electroporated with circular RNAs encoding different CAR sequences is shown. [Figure 19] Figures 19A and 19B show the luminescence in the supernatants of Jurkat cells (left) or resting primary human CD3+ T cells (right) 24 hours after transduction with linear or circular RNAs containing a Gaussia luciferase expression sequence and various IRES sequences (Figure 19A), and the relative luminescence over a 3-day period (Figure 19B). [Figure 20A] Figures 20A-20F show the transcript induction of IFN-β1 (Figure 20A), RIG-I (Figure 20B), IL-2 (Figure 20C), IL-6 (Figure 20D), IFNγ (Figure 20E), and TNFα (Figure 20F) after electroporation of modified linear RNA, unpurified circular RNA, or purified circular RNA into human CD3+ T cells. [Figure 20B] See legend to Figure 20A. [Figure 20C] See legend to Figure 20A. [Figure 20D] See legend to Figure 20A. [Figure 20E]See legend to Figure 20A. [Figure 20F] See legend to Figure 20A. [Figure 21A] Figures 21A and 21B show specific lysis of Raji target cells by human primary CD3+ T cells electroporated with CAR-encoding circRNA, as determined by detection of firefly luminescence (Figure 21A), and IFNγ transcript induction 24 hours after electroporation with different amounts of circular or linear RNA encoding the CAR sequence (Figure 21B). [Figure 21B] See legend to Figure 21A. [Figure 22] Figures 22A and 22B show the specific lysis of target or non-target cells by human primary CD3+ T cells electroporated with circular or linear RNA encoding a CAR at different E:T ratios, as determined by detection of firefly luminescence (Figure 22A and Figure 22B). [Figure 23] Specific lysis of target cells by human CD3+ T cells electroporated with RNA encoding a CAR is shown at 1, 3, 5, and 7 days after electroporation. [Figure 24] Specific lysis of target cells by human CD3+ T cells electroporated with circular RNA encoding CD19- or BCMA-targeting CARs. [Figure 25] Figure 1 shows the total luminal flux of organs harvested from CD-1 mice given circular RNA encoding FLuc and formulated with 50% lipid 10b-15, 10% DSPC, 1.5% PEG-DMG, and 38.5% cholesterol. [Figure 26] Luminescence-enhanced images of organs harvested from CD-1 mice given circular RNA encoding FLuc formulated with 50% lipid 10b-15, 10% DSPC, 1.5% PEG-DMG, and 38.5% cholesterol are shown. [Figure 27A]Figures 27A-27F show molecular characterization of lipids 10a-26 and 10a-27. Figure 27A shows the proton nuclear magnetic resonance (NMR) spectrum of lipid 10a-26. Figure 27B shows the retention time of lipid 10a-26 measured by liquid chromatography-mass spectrometry (LC-MS). Figure 27C shows the mass spectrum of lipid 10a-26. Figure 27D shows the proton NMR spectrum of lipid 10a-27. Figure 27E shows the retention time of lipid 10a-27 measured by LC-MS. Figure 27F shows the mass spectrum of lipid 10a-27. [Figure 27B] See legend to Figure 27A. [Figure 27C] See legend to Figure 27A. [Figure 27D] See legend to Figure 27A. [Figure 27E] See legend to Figure 27A. [Figure 27F] See legend to Figure 27A. [Figure 28A] Figures 28A-28C show the molecular characterization of lipid 22-S14 and its synthetic intermediates. Figure 28A shows the NMR spectrum of 2-(tetradecylthio)ethan-1-ol. Figure 28B shows the NMR spectrum of 2-(tetradecylthio)ethyl acrylate. Figure 28C shows the NMR spectrum of bis(2-(tetradecylthio)ethyl)3,3'-((3-(2-methyl-1H-imidazol-1-yl)propyl)azanediyl)dipropionate (lipid 22-S14). [Figure 28B] See legend to Figure 28A. [Figure 28C] See legend to Figure 28A. [Figure 29] Figure 1 shows the NMR spectrum of bis(2-(tetradecylthio)ethyl) 3,3'-((3-(1H-imidazol-1-yl)propyl)azanediyl)dipropionate (lipid 93-S14). [Figure 30A]Figures 30A-30C show the molecular characterization of heptadecan-9-yl 8-((3-(2-methyl-1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-54). Figure 30A shows the proton NMR spectrum of lipid 10a-54. Figure 30B shows the retention time of lipid 10a-54 measured by LC-MS. Figure 30C shows the mass spectrum of lipid 10a-54. [Figure 30B] See legend to Figure 30A. [Figure 30C] See legend to Figure 30A. [Figure 31A] Figures 31A-31C show the molecular characterization of heptadecan-9-yl 8-((3-(1H-imidazol-1-yl)propyl)(8-(nonyloxy)-8-oxooctyl)amino)octanoate (lipid 10a-53). Figure 31A shows the proton NMR spectrum of lipid 10a-53. Figure 31B shows the retention time of lipid 10a-53 measured by LC-MS. Figure 31C shows the mass spectrum of lipid 10a-53. [Figure 31B] See legend to Figure 31A. [Figure 31C] See legend to Figure 31A. [Figure 32] Figure 32A shows the total luminous flux of spleens and livers collected from CD-1 mice receiving circular RNA encoding firefly luciferase (FLuc) and formulated with the ionizable lipid of interest, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. Figure 32B shows the mean radiance for the biodistribution of protein expression. [Figure 33]Figure 33A shows images highlighting luminescence of organs collected from CD-1 mice given circular RNA encoding FLuc formulated with the ionizable lipids 22-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. Figure 33B shows whole-body IVIS images of CD-1 mice given circular RNA encoding FLuc formulated with the ionizable lipids 22-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. [Figure 34] Figure 34A shows images highlighting luminescence of organs collected from CD-1 mice given circular RNA encoding FLuc formulated with ionizable lipids 93-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. Figure 34B shows whole-body IVIS images of CD-1 mice given circular RNA encoding FLuc formulated with ionizable lipids 93-S14, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. [Figure 35]Figure 35A shows images highlighting luminescence of organs collected from CD-1 mice given circular RNA encoding FLuc formulated with ionizable lipids 10a-26, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. Figure 35B shows whole-body IVIS images of CD-1 mice given circular RNA encoding FLuc formulated with ionizable lipids 10a-26, DSPC, cholesterol, and DSPE-PEG 2000 (Avanti Polar Lipids Inc.) in a weight ratio of 16:1:4:1 or a molar ratio of 62:4:33:1. [Figure 36A] Figures 36A-36D show images highlighting the luminescence of organs harvested from c57BL / 6J mice receiving circular RNA encoding FLuc encapsulated in lipid nanoparticles formed with lipid 10b-15 (Figure 36A), lipid 10a-53 (Figure 36B), or lipid 10a-54 (Figure 36C). PBS was used as a control (Figure 36D). [Figure 36B] See legend to Figure 36A. [Figure 36C] See legend to Figure 36A. [Figure 36D] See legend to Figure 36A. [Figure 37] Figures 37A and 37B show the relative luminescence in lysates of human PBMCs after 24 hours of incubation with test lipid nanoparticles containing circular RNA encoding firefly luciferase. [Figure 38] Figures 38A and 38B show the expression of GFP (Figure 38A) and CD19 CAR (Figure 38B) in human PBMCs after incubation with test lipid nanoparticles containing circular RNA encoding either GFP or CD19 CAR. [Figure 39] 1 shows the expression of anti-mouse CD19 CAR in 1C1C7 cells lipotransfected with circular RNAs containing the anti-mouse CD19 CAR expression sequence and various IRES sequences. [Figure 40]

[0039] Figure 1 shows the cytotoxicity of anti-mouse CD19 CAR to mouse T cells. The CD19 CAR is encoded by and expressed from circular RNA, which is electroporated into mouse T cells. [Figure 41A] Figures 41A-41C show the number of B cells in the peripheral blood (Figures 40A and 40B) or spleen (Figure 40C) in C57BL / 6J mice injected every other day with test lipid nanoparticles encapsulating circular RNA encoding an anti-mouse CD19 CAR. [Figure 41B] See legend to Figure 41A. [Figure 41C] See legend to Figure 41A. [Figure 42] Figures 42A and 42B compare the expression levels of anti-human CD19 CAR expressed from circular RNA to that expressed from linear mRNA. [Figure 43] Figures 43A and 43B compare the cytotoxic effect of anti-human CD19 CAR expressed from circular RNA to that expressed from linear mRNA. [Figure 44] Shows the cytotoxicity of two CARs (anti-human CD19 CAR and anti-human BCMA CAR) expressed from a single circular RNA in T cells. [Figure 45A] Figure 45A shows representative FACS plots with the frequency of tdTomato expression in various splenic immune cell subsets after treatment with LNPs formed with lipids 10a-27 or 10a-26 or lipid 10b-15. Figure 45B shows quantification of the proportion of myeloid, B, and T cells expressing tdTomato, corresponding to the proportion of each cell population successfully transfected with Cre circular RNA (mean + standard deviation, n = 3). Figure 45C shows the proportion of additional splenic immune cell populations, including NK cells, classical monocytes, non-classical monocytes, neutrophils, and dendritic cells, expressing tdTomato after treatment with lipids 27 and 26 (mean + standard deviation, n = 3). [Figure 45B] See legend to Figure 45A. [Figure 45C] See legend to Figure 45A. [Figure 46A] Figure 46A shows the design of an exemplary RNA construct with a built-in polyA sequence in an intron. Figure 46B shows the chromatography pattern of unpurified circular RNA. Figure 46C shows the chromatography pattern of affinity-purified circular RNA. Figure 46D shows the immunogenicity of circular RNA prepared with various in vitro transcription (IVT) conditions and purification methods. (Commercial = commercial IVT mixture; Custom = custom IVT mixture; Aff = affinity-purified; Enz = enzyme-purified; GMP:GTP ratio = 8, 12.5, or 13.75). [Figure 46B] See legend to Figure 46A. [Figure 46C] See legend to Figure 46A. [Figure 46D] See legend to Figure 46A. [Figure 47] Figure 47A shows an exemplary RNA construct design with a dedicated binding sequence of TATAATTCTACCCTATTGAGGCATTGACTA (SEQ ID NO: 3667) as an alternative to polyA for hybridization purification. Figure 47B shows the chromatographic pattern of unpurified circular RNA. Figure 47C shows the chromatographic pattern of affinity-purified circular RNA. [Figure 48] Figure 48A shows the chromatographic pattern of unpurified circular RNA encoding dystrophin, and Figure 48B shows the chromatographic pattern of enzyme-purified circular RNA encoding dystrophin. [Figure 49] Figures 49A and 49B compare the expression (Figure 49A) and stability (Figure 49B) of purified circRNAs with different 5' spacers between the 3' intron fragment / 5' internal duplex region and the IRES in Jurkat cells. (AC = only A and C were used in the spacer sequence; UC = only U and C were used in the spacer sequence.) [Figure 50] Luminescence expression levels and stability of expression from circular RNAs containing the indicated native or modified IRES elements in primary T cells are shown. [Figure 51]1 shows the luminescence expression levels and stability of expression from circular RNAs containing the indicated native or modified IRES elements in HepG2 cells. [Figure 52] 1 shows the luminescence expression levels and stability of expression from circular RNAs containing the indicated native or modified IRES elements in 1C1C7 cells. [Figure 53] 1 shows the luminescence expression level and stability from circular RNA containing an IRES element or a hybrid IRES element with an untranslated region (UTR) inserted in HepG2 cells. "Scr" refers to Scrambled, which was used as a control. [Figure 54] 1C shows the luminescence expression level and stability of expression from a circular RNA containing a variable stop codon cassette operably linked to an IRES and Gaussia luciferase coding sequence in 1C1C7 cells. [Figure 55] 1C shows the luminescence expression level and stability of expression from a circular RNA containing an IRES and a variable untranslated region (UTR) inserted before the start codon of the Gaussia luciferase coding sequence in 1C1C7 cells. [Figure 56] 1 shows the expression level of human erythropoietin (hEPO) in Huh7 cells from a circular RNA containing two miR-122 target sites downstream from the hEPO coding sequence. [Figure 57] 1 shows the in vitro luminescence expression levels from LNPs transfected with circular RNA encoding firefly luciferase in SupT1 cells (derived from a human T cell tumor line) and MV4-11 cells (derived from a human macrophage line). [Figure 58] 1 shows a comparison of ApoE-dependence of primary human T cells transfected with circular RNA-containing LNPs based on formulations with different helper lipids, PEG-lipids, and ionizable lipid:phosphate ratios. [Figure 59] 1 shows the uptake of LNPs containing circular RNA encoding eGFP into activated primary human T cells in the presence or absence of ApoE3 support. [Figure 60] 1 shows expression in immune cells from LNPs containing circular RNA encoding the Cre fluorescent protein in a Cre reporter mouse model. [Figure 61] 1 shows immune cell expression of mOX40L in wild-type mice after intravenous injection of LNPs transfected with circular RNA encoding mOX40L. [Figure 62A] Figures 62A-62C show a single administration of mOX40L as LNPs transfected with circular RNA capable of expressing mOX40L. Figures 62A and 62B provide the percent expression of mOX40L in splenic T cells, CD4+ T cells, CD8+ T cells, B cells, NK cells, dendritic cells, and other myeloid cells. Figure 62C provides the weight change of mice 24 hours after transfection. [Figure 62B] See legend to Figure 62A. [Figure 62C] See legend to Figure 62A. [Figure 63] Figures 63A-63C show B cell depletion in mice after intravenous transfection of circular RNA with LNP. Figure 63A quantifies B cell depletion by B220+ B cells among viable CD45+ immune cells, and Figure 63B compares B cell depletion by B220+ B cells among viable CD45+ immune cells compared to luciferase-expressing circular RNA. Figure 63C provides the B cell weight gain of transfected cells. [Figure 64] Figures 64A and 64B show CAR expression levels in peripheral blood (Figure 64A) and spleen (Figure 64B) upon treatment with LNP encapsulating circular RNA expressing anti-CD19 CAR. Anti-CD20 (aCD20) and luciferase-encoding circular RNA (oLuc) were used for comparison. [Figure 65]Figures 65A-65C show the overall frequency of anti-CD19 CAR expression, the frequency of anti-CD19 CAR expression on the cell surface, and the effect of IRES-specific circular RNA encoding an anti-CD19 CAR on T cells on the anti-tumor response. Figure 65A shows the anti-CD19 CAR geometric mean fluorescence intensity, Figure 65B shows the percentage of anti-CD19 CAR expression, and Figure 65C shows the percentage of target cell lysis achieved by the anti-CD19 CAR (CK = caprine kobuvirus; AP = Apodemus picornavirus; CK* = codon-optimized caprine kobuvirus; PV = parabovirus; SV = salivirus). [Figure 66] CAR expression levels in A20 FLuc target cells when treated with IRES-specific circular RNA constructs are shown. [Figure 67] Figures 67A and 67B show luminescence expression levels for cytosolic (Figure 67A) and surface (Figure 67B) proteins from circular RNA in primary human T cells. [Figure 68A] Figures 68A-68F show luminescence expression in human T cells when treated with IRES-specific circular constructs. Expression in circular RNA constructs was compared to linear mRNA. Figures 68A, 68B, and 68G provide Gaussia luciferase expression in multiple donor cells. Figures 68C, 68D, 68E, and 68F provide Firefly luciferase expression in multiple donor cells. [Figure 68B] See legend to Figure 68A. [Figure 68C] See legend to Figure 68A. [Figure 68D] See legend to Figure 68A. [Figure 68E] See legend to Figure 68A. [Figure 68F] See legend to Figure 68A. [Figure 68G] See legend to Figure 68A. [Figure 69]Figures 69A and 69B show the expression of anti-CD19 CAR (Figure 69A and Figure 69B) and anti-BCMA CAR (Figure 69B) on firefly luciferase-expressing K562 cells in human T cells after treatment with lipid nanoparticles surrounding circular RNA encoding either anti-CD19 CAR or anti-BCMA CAR. [Figure 70] Figures 70A and 70B show the expression levels of anti-CD19 CAR resulting from specific antigen-dependent in vitro delivery of circular RNA encoding the anti-CD19 CAR via electroporation. Figure 70A shows the lysis of Nalm6 cells by the anti-CD19 CAR. Figure 70B shows the lysis of K562 cells by the anti-CD19 CAR. [Figure 71A] Figures 71A-71E show transfection of LNP mediated by the use of ApoE3 in a solution containing LNP and green fluorescent protein (GFP)-expressing circular RNA. Figure 71A shows the survival and death results. Figures 71B, 71C, 71D, and 71E provide expression frequencies for multiple donors. [Figure 71B] See legend to Figure 71A. [Figure 71C] See legend to Figure 71A. [Figure 71D] See legend to Figure 71A. [Figure 71E] See legend to Figure 71A. [Figure 72A] Figures 72A, 72B, 72C, 72D, 72E, 72F, 72G, 72H, 72I, 72J, 72K, and 72L show the total luminous flux and percent expression for various lipid formulations. See Example 74. [Figure 72B] See legend to Figure 72A. [Figure 72C] See legend to Figure 72A. [Figure 72D] See legend to Figure 72A. [Figure 72E] See legend to Figure 72A. [Figure 72F] See legend to Figure 72A. [Figure 72G] See legend to Figure 72A. [Figure 72H] See legend to Figure 72A. [Figure 72I] See legend to Figure 72A. [Figure 72J] See legend to Figure 72A. [Figure 72K] See legend to Figure 72A. [Figure 72L] See legend to Figure 72A. [Figure 73A] Figures 73A-73C show the circularization efficiency of RNA molecules encoding the stabilized (double proline mutant) SARS-CoV2 spike protein. Figure 73A shows in vitro transcription products of a circRNA encoding the approximately 4.5 kb SARS-CoV2 spike. Figure 73B shows a histogram of spike protein surface expression via flow cytometry after transfection of 293 cells with spike-encoding circRNA. 24 hours after transfection, transfected 293 cells were stained with CR3022 primary antibody and APC-labeled secondary antibody. Figure 73C shows a flow cytometry plot of spike protein surface expression on 293 cells after transfection of spike-encoding circRNA. 24 hours after transfection, transfected 293 cells were stained with CR3022 primary antibody and APC-labeled secondary antibody. [Figure 73B] See legend to Figure 73A. [Figure 73C] See legend to Figure 73A. [Figure 74] Multiple control adjuvant strategies are provided. The circRNA shown in the figure involves an in vitro unpurified sense circular RNA splicing reaction using GTP as an indicator molecule. 3p-circRNA involves not only purified sense circular RNA but also a mixture of purified antisense circular RNAs containing triphosphorylated 5' ends. Bars indicate the in vivo cytokine response to formulated circRNAs generated using the indicated strategies. [Figure 75A]Figures 75A-75C illustrate intramuscular delivery of LNPs containing circular RNA constructs. Figure 75A provides live systemic flux after 6 hours, and Figure 75B provides systemic IVIS 6 hours after administration of 1 μg of LNP-circular RNA construct. Figure 75C provides ex vivo expression profiles over 24 hours. [Figure 75B] See legend to Figure 75A. [Figure 75C] See legend to Figure 75A. [Figure 76] Figures 76A and 76B show the expression of multiple circular RNAs from a single lipid formulation. Figure 76A provides the hEPO titer from single and mixed sets of LNPs containing circular RNA constructs, while Figure 76B provides the total flux of bioluminescence expression from single or mixed sets of LNPs containing circular RNA constructs. [Figure 77A] Figures 77A-77C illustrate the expression of SARS-CoV2 spike protein from circular RNAs encoding spike SARS-CoV2 protein. Figure 77A shows the frequency of spike CoV2 expression; Figure 77B shows the geometric mean fluorescence intensity (gMFI) of spike CoV2 expression; Figure 77C compares the gMFI expression of the constructs with the frequency of expression. [Figure 77B] See legend to Figure 77A. [Figure 77C] See legend to Figure 77A. [Figure 78] The general sequence construct of a linear RNA polynucleotide precursor (10) is shown. The provided sequence is illustrated, from 5' to 3', as 5'-enhanced intronic elements (20), 5'-enhanced exonic elements (30), core functional elements (40), 3'-enhanced exonic elements (50), and 3'-enhanced intronic elements (60). [Figure 79] Various exemplary repeats of the 5'-enhanced exon element (20) are shown. As shown, one repeat of the 5'-enhanced exon element (20) includes, in 5' to 3' order, a leading untranslated sequence (21), a 5' affinity tag (22), a 5' external duplex region (24), a 5' external spacer (26), and a 3' intron fragment (28). [Figure 80] Various exemplary repeats of the 5'-enhanced exon element (30) are shown. As shown, one repeat of the 5'-enhanced exon element (30) includes, in 5' to 3' order, a 3' exon fragment (32), a 5' internal duplex region (34), and a 5' internal spacer (36). [Figure 81] Various exemplary repeats of the core functional element (40) are shown. As shown, one repeat of the core functional element (40) includes a TIE (42), a coding region (46), and a termination region (e.g., a stop codon or termination cassette) (48). Another repeat is shown to show the core functional element (47) including a non-coding region (47). [Figure 82] Various exemplary repeats of the 3'-enhanced exon element (50) are shown. As shown, one repeat of the 3'-enhanced exon element (50) includes, in 5' to 3' order, a 3' internal spacer (52), a 3' internal duplex region (54), and a 5' exon fragment (56). [Figure 83] Various exemplary repeats of the 3'-enhanced intron element (60) are shown. As shown, one repeat of the 3'-enhanced intron element (60) includes, in the following order: a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and terminal untranslated sequence (69). [Figure 84] Various exemplary repeats of the translation initiation element (TIE) (42) are shown. As shown, the TIE (42) sequence in one repeat is an IRES (43) alone. In another repeat, the TIE (42) is an aptamer (44). In two different repeats, the TIE (42) is a combination of an aptamer (44) and an IRES (43). In another repeat, the TIE (42) is an aptamer complex (45). [Figure 85]An exemplary linear RNA polynucleotide precursor (10) is illustrated, comprising, in 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' external duplex region (24), a 5' external spacer (26), a 3' intron fragment (28), a 3' exon fragment (32), a 5' internal duplex region (34), a 5' internal spacer (36), a TIE (42), a coding element (46), a termination region (48), a 3' internal spacer (52), a 3' internal duplex region (54), a 5' exon fragment (56), a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69). [Figure 86] An exemplary linear RNA polynucleotide precursor (10) is illustrated, comprising, in 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' external duplex region (24), a 5' external spacer (26), a 3' intron fragment (28), a 3' exon fragment (32), a 5' internal duplex region (34), a 5' internal spacer (36), a coding element (46), a termination region (48), a TIE (42), a 3' internal spacer (52), a 3' internal duplex region (54), a 5' exon fragment (56), a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69). [Figure 87] An exemplary linear RNA polynucleotide precursor (10) is illustrated, comprising, in 5' to 3' order: a leading untranslated sequence (21), a 5' affinity tag (22), a 5' external duplex region (24), a 5' external spacer (26), a 3' intron fragment (28), a 3' exon fragment (32), a 5' internal duplex region (34), a 5' internal spacer (36), a non-coding element (47), a 3' internal spacer (52), a 3' internal duplex region (54), a 5' exon fragment (56), a 5' intron fragment (62), a 3' external spacer (64), a 3' external duplex region (66), a 3' affinity tag (68), and a terminal untranslated sequence (69). [Figure 88]The general circular RNA (8) structure formed after splicing is illustrated. The circular RNA shown contains the 5' exon element (30), the core functional element (40), and the 3' exon element (50). [Figure 89A] Figures 89A-89E illustrate various ways in which accessory elements (70) (e.g., miRNA binding sites) can be included in a linear RNA polynucleotide. Figure 89A shows a linear RNA polynucleotide containing accessory elements (70) in the spacer region. Figure 89B shows a linear RNA polynucleotide containing accessory elements (70) located between each outer duplex region and an exon fragment. Figure 89C shows accessory elements (70) within a spacer. Figure 89D illustrates various repeats of accessory elements (70) located within a core functional element. Figure 89E illustrates accessory elements (70) located within an internal ribosome entry site (IRES). [Figure 89B] See legend to Figure 89A. [Figure 89C] See legend to Figure 89A. [Figure 89D] See legend to Figure 89A. [Figure 89E] See legend to Figure 89A. [Figure 90A] Figures 90A-90C illustrate the screening of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE at various in vitro doses in primary human (Figure 90A), mouse (Figure 90B), and cynomolgus monkey (Figure 90C) hepatocytes. [Figure 90B] See legend to Figure 90A. [Figure 90C] See legend to Figure 90A. [Figure 91A] Figures 91A-91C illustrate the screening of various in vitro doses of LNPs formulated with circular RNA encoding firefly luciferase and bearing a TIE in primary human hepatocytes from three different donors (Donor 1 - Figure 91A; Donor 2 - Figure 91B; and Donor 3 - Figure 91C). [Figure 91B] See legend to Figure 91A. [Figure 91C] See legend to Figure 91A. [Figure 92] Illustrates the in vitro expression of LNPs formulated with circular RNA encoding GFP and bearing a TIE in HeLa, HEK293, and HUH7 human cell models. [Figure 93] 1 illustrates the in vitro expression of LNPs formulated with circular RNA encoding the GFO protein and bearing a TIE in primary human hepatocytes. [Figure 94A] Figures 94A and 94B illustrate the in vitro expression of a circular RNA encoding firefly luciferase and bearing a TIE in mouse myoblast (Figure 94A) and primary human muscle myoblast (Figure 94B) cells. [Figure 94B] See legend to Figure 94A. [Figure 95A] Figures 95A and 95B illustrate the in vitro expression of a circular RNA encoding firefly luciferase and bearing a TIE in myoblasts and differentiated primary human skeletal muscle myotubes. Figure 95A provides data for cells obtained from human donor 1; Figure 95B provides data for cells obtained from human donor 2. [Figure 95B] See legend to Figure 95A. [Figure 96A] Figures 96A and 96B illustrate the cell-free in vitro translation of circular RNAs of variable sizes. In Figure 96A, circular RNAs encoding firefly luciferase and linear mRNAs encoding firefly luciferase were tested for expression. In Figure 96B, human and mouse cells were fed circular RNAs encoding ATP7B protein. Some of the circular RNAs tested were codon-optimized. Circular RNAs expressing firefly luciferase were used for comparison. [Figure 96B] See legend to Figure 96A. [Figure 97A]Figures 97A and 97B show an exemplary RNA circularization process. The schematic shown in Figure 97A illustrates the autocatalytic circularization process. Briefly, a precursor RNA molecule containing an intron segment and accessory elements that enhance circularization efficiency undergoes splicing, resulting in a synthetic circular RNA and two excised intron / accessory sequence segments (spliced-out intron segments / fragments). Some circularized RNA (oRNA) is nicked during synthesis. Figure 97B shows an exemplary chromatogram showing the peak retention of different species after size-exclusion HPLC analysis. [Figure 97B] See legend to Figure 97A. [Figure 98] An exemplary negative selection purification method for circular RNA molecules, such as oRNA, is shown. Oligonucleotides complementary to sequences present in precursor RNAs (such as intron segments or external accessory regions) but not in the oRNA are bound to a solid support, such as beads. The oRNA preparation is washed from the beads; precursor RNAs, partially spliced RNAs, incomplete transcripts, and post-spliced intron segments bind to the oligonucleotides under certain buffer conditions, while oRNAs and nicked oRNAs pass through. The flow-through fraction is collected for further processing. [Figure 99A]Figures 99A and 99B show an exemplary negative selection purification method for circular RNA molecules, such as oRNA. The schematic shown in Figure 99A illustrates enzymatic polyadenylation of in vitro transcription reaction products containing oRNA and linear RNA, resulting in polyadenylation of only the linear RNA. The mixture of linear and circular RNA is washed under specific buffer conditions from beads conjugated with deoxythymidine oligonucleotides ("oligo-dT"). The polyadenylated linear RNA anneals to the beads, while the oRNA passes through for collection. Figure 99B shows an exemplary SEC-HPLC chromatogram of the in vitro transcription (IVT) reaction product before polyadenylation and purification (left panel) and the eluate after polyadenylation using E. coli polyA polymerase and purification with oligo-dT beads in binding buffer (right panel). [Figure 99B] See legend to Figure 99A. [Figure 100] Figures 100A and 100B show an exemplary circular RNA enzymatic purification method. In this method, oRNA is synthesized by IVT in the presence of excess GMP and autocatalytically spliced during the process. The resulting reaction product is digested with Xrn1 (a 5' to 3' exonuclease that requires a 5'-terminal monophosphate) and RNase R (a 3' to 5' exonuclease) to remove non-circular RNA molecules. Figure 100A shows such Xrn1 and RNase R digestion of linear RNA. Figure 100B shows exemplary SEC-HPLC chromatograms of the IVT reaction product before enzymatic digestion (left panel) and the final enzymatically purified material (right panel). [Figure 101]Figures 101A and 101B show the induction of expression of immune stimulatory markers, RIG-1 and IFNB1 RNA, after transfection of cells with various RNA preparations as indicated. All RNA preparations, except for the commercially available 3php RNA, were produced using in vitro transcription and circularization of RNA containing an Anabaena permuted intron, a GLuc reading frame, strong homology arms, 5' and 3' spacers, and a CVB3 IRES. Expression of RIG-1 and IFNB1 RNA was measured using RT-qPCR. In Figure 101, "IVT" indicates the crude reaction mixture; "+GMP" indicates the crude reaction mixture in which in vitro transcription was performed in the presence of 12.5-fold GMP relative to GTP; "+HPLC" indicates the reaction mixture purified by HPLC; "+HPLC / GMP" indicates the reaction mixture in which in vitro transcription was performed in the presence of 12.5-fold GMP relative to GTP and purified by HPLC; "3phpRNA" indicates a positive control containing triphosphate hairpin RNA (tlrl-hprna, Invivogen); and "mock" indicates a preparation containing no RNA. Figure 101A shows the immune stimulation of HeLa cells, and Figure 101B shows the immune stimulation of A594 cells. [Figure 102] Figures 102A and 102B show the expression levels of anti-CD19 CARs in human T cells resulting from in vitro delivery of various circular RNAs encoding chimeric antigen receptors via electroporation. Figure 102A provides representative dot plots from FACS analysis of human T cell expression of CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζ CARs. Figure 102B shows cumulative data for MFI of CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζ expression collected via fluorescence-activated cell sorting (FACS). [Figure 103A]Figures 103A-103C illustrate the cytotoxic response against tumor cells when T cells were electroporated with circular RNAs encoding CD19-41BBζ and CD19-CD28ζ and then co-cultured with the tumor cells. Figure 103A provides the % specific lysis of tumor cells after co-culture with T cells expressing oRNAs encoding CD19-41BBζ, CD19-CD28ζ, HER2-41BBζ, and HER2-CD28ζ CARs compared to T cells expressing circular RNA encoding mOX40L. Figures 103B and 103C show the IFN-γ and IL-2 cytokines, in pg / mL, respectively, secreted by T cells expressing the listed oRNAs compared to circular RNA encoding mOX40L after co-culture with tumor cells. [Figure 103B] See legend to Figure 103A. [Figure 103C] See legend to Figure 103A. [Figure 104A] Figures 104A and 104B show in vivo mOX40L expression in splenic and peripheral blood T cells of humanized mice after intravenous administration of LNPs formulated with circular RNA encoding mOX40L. LNPs were formulated with PBS (labeled "vehicle" in the figures), or LNP-oRNA constructs were formulated with lipid 10b-15 (Table 10b, lipid 15), 10a-27 (Table 10a, lipid 27), or 10a-26 (Table 10a, lipid 26). Figure 104A shows mOX40L detection in T cells in the spleen of humanized mice. Figure 104B shows mOX40L detection in T cells in the peripheral blood of humanized mice. [Figure 104B] See legend to Figure 104A. [Figure 105] Figure 1 illustrates B cell aplasia in humanized mice after intravenous administration of LNPs formulated with circular RNA encoding an anti-CD19 chimeric antigen receptor (CAR). Representative FACS dot plots from peripheral blood of untreated (left) and treated (right) animals show the percentage of B cells 6 days after intravenous administration. [Figure 106]Figures 106A and 106B show the % killing of Nalm6 tumor cells after co-culture with LNP-oRNA encoding a CAR or control (Figure 106A) and chimeric antigen receptor (CAR) surface expression after in vitro transfection with LNP-circular RNA (oRNA) encoding CD19-41BBζ or CD19-CD28ζ CARs (Figure 106B). Figure 106A illustrates Nalm6 tumor cell killing after co-culture of T cells transfected with LNP-oRNA constructs encoding CARs for CD19-41BBζ CAR and CD19-CD28ζ CAR, in addition to HER2-41BBz, HER2-CD28z, or control LNP-oRNA mOX40L. Figure 106B provides the mean fluorescence intensity (MFI) of CAR surface expression on T cells treated with LNP-oRNA CAR constructs. [Figure 107] Figure 1 shows antigen-dependent tumor regression as measured by total luminous flux (in photons / second) after mice were treated with either PBS, PBMCs, LNP-oRNA encoding mOx40L, LNP-oRNA encoding CD19-41BBζ ("CD19-41BBζ isCAR"), oRNA encoding CD19-CD28ζ ("CD19-CD28ζ isCAR"), LNP-oRNA encoding HER2-41BBz CAR ("HER2-41BBz isCAR"), or LNP-oRNA encoding HER2-CD28z CAR ("HER2-CD28z isCAR"). PBS and PBMC solutions lacking oRNA were used as negative controls. [Figure 108A]Figure 108A shows BCMA CAR expression detected using soluble BCMA. PE after electroporation of an exemplary circular RNA (circRNA) encoding the BCMA-41BBζ CAR at a dose of 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells is compared to "mock" control T cells not electroporated with any circRNA. Expression was analyzed in T cells 24, 48, and 72 hours after introduction of the circular RNA. Figure 108B shows BCMA CAR expression quantified using geometric mean fluorescence intensity (gMFI) activity over a 24-hour period after introduction of circular RNA encoding the BCMA-41BBζ CAR at a dose of 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells. "A," "B," and "C" correspond to "DNA template A," "DNA template B," and "DNA template C," respectively, in Table 28, i.e., circular RNA construct "A" comprises the IRES sequence of DNA template A and the BCMA sequence of DNA template A; circular RNA construct "B" comprises the IRES sequence of DNA template B and the BCMA sequence of DNA template B; circular RNA construct "C" comprises the IRES sequence of DNA template C and the BCMA sequence of DNA template C, etc. [Figure 108B] See legend to Figure 108A. [Figure 109A]Figures 109A-109G show anti-BCMA chimeric antigen receptor (CAR) expression after electroporation of circular RNA into T cells for an exemplary circular RNA encoding the BCMA-41BBζ CAR. "A," "B," "C," "D," and "E" correspond to "DNA template A," "DNA template B," "DNA template C," "DNA template D," and "DNA template E," respectively, in Table 28. "Mock" in the figures represents data for control T cells that were not electroporated with circular RNA. Figure 109A shows the percent CAR expression detected by soluble BCMA PE detection reagent over 24 to 72 hours after electroporation of circRNAs formed from DNA template A, DNA template B, and DNA template C and administered into T cells at either 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells. Figure 109B shows the geometric mean fluorescence intensity (gMFI) of T cells detected by soluble BCMA PE detection reagent over 24 to 72 hours after electroporation of circRNAs formed from DNA template A, DNA template B, and DNA template C and delivered into T cells at either 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells. Figure 109C provides fluorescence-activated cell sorting (FACS) imaging 24 hours after transfection of T cells with the circular RNAs shown in Figures 109A and 109B at a dose of 30 ng. Figure 109D shows the percent CAR expression detected by soluble BCMA PE detection reagent over 24 to 96 hours after electroporation of circRNAs formed from DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E and delivered into T cells at either 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells.Figure 109E shows the percent CAR expression detected by anti-Whitlow PE detection reagent over 24 to 96 hours after electroporation of circRNAs formed from DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E and delivered into T cells at either 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells. Figure 109F shows the percent CAR expression detected by anti-G4S detection reagent over 24 to 96 hours after electroporation of circRNAs formed from DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E and delivered into T cells at either 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells. Figure 109G shows the average MFI (%) of T cells detected by soluble BCMA PE detection reagent over 24 to 96 hours after electroporation of circRNAs formed from DNA template A, DNA template B, DNA template C, DNA template D, and DNA template E, delivered into T cells at either 10 ng, 30 ng, or 100 ng per 0.1 x 10 T cells. [Figure 109B] See legend to Figure 109A. [Figure 109C] See legend to Figure 109A. [Figure 109D] See legend to Figure 109A. [Figure 109E] See legend to Figure 109A. [Figure 109F] See legend to Figure 109A. [Figure 109G] See legend to Figure 109A. [Figure 110] An exemplary gating method was used to analyze flow cytometry results for T cells electroporated with BCMA CAR-encoding circular RNA at a dose of 10 ng x 10. BCMA CAR expression was detected with either soluble BCMA PE, anti-Whitlow PE, or anti-G4S linker. [Figure 111]Expression of target proteins on multiple myeloma positive cells (e.g., MM1S, NCI-H929, and RPMI-8226) and negative target cell lines (e.g., Nalm6 target cell line) is shown. [Figure 112] The percentage of viable T cells collected 24 hours after electroporation of circular RNA containing BCMA-41BBζ CAR or CD19-CD28ζ CAR is shown, compared to a "mock" solution containing only electroporation buffer solution without circular RNA. "F," "C," "G," "H," "A," "I," and "J" correspond to "DNA template F," "DNA template C," "DNA template G," "DNA template H," "DNA template A," "DNA template I," and "DNA template J" used to form the circular RNA. [Figure 113A] Figures 113A-113D provide gMFI collected from various circular RNA constructs encoding BCMA-41BBζ or BCMA-CD28ζ CARs or CD19-CD28ζ CARs electroporated into T cells at a dosage of 50 ng per 0.1 x 10 T cells, compared to "mock" control T cells lacking any circular RNA (containing only electroporation buffer). Each circular RNA solution was dosed with either soluble BCMA (sBCMA-PE), anti-Whitlow-PE, or anti-G4S linker PE (G4S-AF647) detection reagent. Figure 113A shows a histogram of gMFI collected from the cells. Figures 113B-113D provide the gMFI per cell, where gMFI was collected using sBCMA-PE (Figure 113B), anti-Whitlow-PE (Figure 113C), and G4S-AF647 (Figure 113D) detection reagents. "F," "C," "G," "H," "A," "I," and "J" correspond to "DNA template F," "DNA template C," "DNA template G," "DNA template H," "DNA template A," "DNA template I," and "DNA template J" used to form circular RNA. [Figure 113B] See legend to Figure 113A. [Figure 113C] See legend to Figure 113A. [Figure 113D] See legend to Figure 113A. [Figure 114] An exemplary gating process for oCAR-T cells 24 hours after electroporation is shown. The top row of boxes (left to right) provides FACS imaging of lymphocytes, CD3-negative cells, viable T cells, and BCMA-positive cells. The bottom two boxes are histograms of BCMA CARs detected by either soluble BCMA or anti-Whitlow detection reagent (bottom left) or anti-GS4-PE fluorescence (bottom right). [Figure 115A] Figures 115A-115C show the percent expression of the detection reagents used (i.e., soluble BCMA PE (labeled "sBCMA" in Figure 115A), anti-Whitlow-PE (labeled "Whitlow" in Figure 115B), and anti-G4S linker PE (labeled "G4S" in Figure 115C)). Percent expression was calculated from the presence of the relevant detection reagent 24 hours after electroporation of circular RNA encoding BCMA-41BBζ, BCMA-CD28ζ, or HER2 CAR gated on viable T cells. "F," "C," "G," "H," "A," "I," and "J" correspond to "DNA template F," "DNA template C," "DNA template G," "DNA template H," "DNA template A," "DNA template I," and "DNA template J" used to form the circular RNA. "Mock" in the figures represents data for control T cells in which circular RNA was not electroporated. [Figure 115B] See legend to Figure 115A. [Figure 115C] See legend to Figure 115A. [Figure 116A]Figures 116A-116E show BCMA expression via gMFI (Figures 116A, 116B, and 116D) or percent soluble BCMA PE detection (labeled "%sBCMA-PE") (Figures 116C or 116E) after electroporation of circular RNA encoding BCMA-41BBζ, BCMA-CD-CD28ζ, or CD19-CD28ζ gated on CD3+ cells. "Mock" indicates a T cell solution in which no circular RNA construct was electroporated. Figure 116A provides histograms using 24- and 48-hour collections of soluble BCMA-PE or anti-Whitlow.PE detection for circular RNA constructs. Figures 116B and 116C provide gMFI and %sBCMA-PE expression over 24-72 hours for each construct after CD3+ cells containing circular RNA were cocultured with multiple myeloma (MM1S) cells. Figures 116D and 116E provide the gMFI and %sBCMA-PE expression 72 hours after electroporation for each construct after CD3+ cells containing circular RNA were cocultured with multiple myeloma (MM1S), NCI-H929 (labeled "H929" in the figure), Nalm6, or K562.CD19 cells. "C," "G," "H," "A," "I," and "J" correspond to "DNA template C," "DNA template G," "DNA template H," "DNA template A," "DNA template I," and "DNA template J" used to form the circular RNA. "Mock" in the figure represents data for control T cells that were not electroporated with circular RNA. [Figure 116B] See legend to Figure 116A. [Figure 116C] See legend to Figure 116A. [Figure 116D] See legend to Figure 116A. [Figure 116E] See legend to Figure 116A. [Figure 117A]Figures 117A-117C show the cytotoxicity of circular RNA constructs encoding the BCMA-41BBζ chimeric antigen receptor (CAR) (where the circular RNA comprises a BCMA sequence and an IRES sequence from Tables 28, 30, or 31), the CD19-CD28ζ CAR, or the HER2-CD28ζ CAR against various cell types over a period of 0 to 72 or 96 hours after coculture. Figure 117A provides the cytotoxicity against MM1S cells of each of the circular RNAs encoding the CAR constructs at a dose of either 10 or 30 ng per 0.1 x 10 T cells. Mock T cells (i.e., T cells that were not electroporated with circular RNA, designated "Mock" in the figure) and MM1S cells that were not cocultured with T cells, designated "MM1S" in Figure 117A, were used as controls. Figure 117B provides the cytotoxicity of each circular RNA encoding a CAR construct against Nalm6 cells at a dose of either 10 or 30 ng per 0.1 x 10 T cells. Mock T cells (i.e., T cells not electroporated with circular RNA, labeled "Mock" in the figure) and Nalm6 cells not co-cultured with T cells, labeled "Nalm6" in Figure 117B, were used as controls. Figure 117C provides the cytotoxicity of each circular RNA encoding a CAR construct against a CD19 T stable cell line at a dose of 20 ng per 0.1 x 10 T cells. Mock T cells (i.e., tumor T cells not electroporated with circular RNA, labeled "Mock" in the figure) and CD19 T stable cells not co-cultured with T cells, labeled "Tumor" in Figure 117C, were used as controls. % cytotoxicity was calculated by (green area + red area / green area) generated by Viable Cell Analysis Portfolio System Imaging. "A," "B," "C," "F," and "K" correspond to "DNA template A," "DNA template B," "DNA template C," "DNA template F," and "DNA template K," respectively, used to form the circular RNA. [Figure 117B] See legend to Figure 117A. [Figure 117C] See legend to Figure 117A. [Figure 118A] Figures 118A-118C show an analysis of the cytotoxicity of various engineered circular RNAs across multiple cell types. Figure 118A provides FACS imaging of cells (e.g., lymphocytes, CD3-negative cells, viable cells, and BCMA-positive cells) 24 hours after co-culture of oCAR-T cells formed from the introduction of a circular RNA containing a 3' Anabaena exon, a caprine kobuvirus internal ribosome entry site (IRES), a BCMA-41BBζ CAR, and a 5' Anabaena exon. Figure 118B shows the percent cytotoxicity obtained from circular RNAs encoding BCMA-41BBζ, CD19-CD28ζ, or HER2-CD28ζ CARs against MM1S (Figure 118B) or Nalm6 (Figure 118C). "MM1S + Mock" and "MM1S" in Figure 118B refer to MM1S cells co-cultured with T cells that were not transfected with circular RNA. In the case shown in Figure 118C, "Nalm6+Mock" and "Nalm6" refer to Nalm6 cells co-cultured with T cells that were not transfected with circular RNA. "A," "B," "C," "F," and "K" correspond to "DNA template A," "DNA template B," "DNA template C," "DNA template F," and "DNA template K" used to form circular RNA. [Figure 118B] See legend to Figure 118A. [Figure 118C] See legend to Figure 118A. [Figure 119A]Figure 119A shows FACS imaging of "Mock+MM1S" (i.e., MM1S tumor cells co-cultured with T cells that were not electroporated with circular RNA, "Mock+Nalm6" (i.e., Nalm6 tumor cells co-cultured with T cells that were not electroporated with circular RNA), "Mock+H929" (i.e., NCI-H929 tumor cells co-cultured with T cells that were not electroporated with circular RNA), and "Mock+K562.CD19" (i.e., K562.CD19 tumor cells co-cultured with T cells that were not electroporated with circular RNA). Figure 119B shows FACS imaging of CD19+CD3+ cells. [Figure 119B] See legend to Figure 119A. [Figure 120A] Figures 120A-120D show the % target cell viability (top) and % target cell killing (bottom) of T cells after co-culture in which circular RNA derived from a DNA template in Tables 28, 30, and / or 31 was electroporated and then co-cultured with target cells (e.g., MM1S (Figure 120A), NCI-H929 (labeled "H929" in Figure 120B), Nalm6 (Figure 120C), or K562.CD19 (Figure 120D)) for 24 (left) or 48 (right) hours. "Mock + MM1S" (i.e., MM1S tumor cells cocultured with T cells that were not electroporated with circular RNA), "Mock + Nalm6" (i.e., Nalm6 tumor cells cocultured with T cells that were not electroporated with circular RNA), "Mock + H929" (i.e., NCI-H929 tumor cells cocultured with T cells that were not electroporated with circular RNA), and "Mock + K562.CD19" (i.e., K562.CD19 tumor cells cocultured with T cells that were not electroporated with circular RNA). "A," "G," "C," "F," "H," "I," and "J" correspond to "DNA template A," "DNA template G," "DNA template C," "DNA template F," "DNA template H," "DNA template I," and "DNA template J" used to form circular RNA. [Figure 120B] See legend to Figure 120A. [Figure 120C] See legend to Figure 120A. [Figure 120D] See legend to Figure 120A. [Figure 121A] Figures 121A and 121B show the secretion of IFNγ cytokines produced from circular RNAs encoding BCMA-41BBζ, CD19-CD28ζ, and HER2-CD28ζ CARs at doses of 10, 30, or 100 ng per 0.1 x 10 T cells in MM1S (Figure 121A) or Nalm6 (Figure 121B) cells after co-culture of MM1S or Nalm6 with T cells containing circular RNA. Cytotoxicity levels were calculated using a cytokine and chemokine kit (e.g., MSD). "MM1S + Mock" refers to MM1S tumor cells co-cultured with T cells that were not electroporated with circular RNA. "MM1S" refers to tumor cells that were not co-cultured with T cells. "Nalm6 + Mock" refers to Nalm6 tumor cells co-cultured with T cells that were not electroporated with circular RNA. "Nalm6" refers to tumor cells that were not co-cultured with T cells. "A," "B," "C," "F," and "K" correspond to "DNA template A," "DNA template B," "DNA template C," "DNA template F," and "DNA template K," respectively, used to form the circular RNA. [Figure 121B] See legend to Figure 121A. [Figure 122A]Figures 122A-122P show cytokine levels (pg / mL) at 24 and 48 hours (left and right in the figures, respectively) in co-cultured T cells and target cells containing circular RNA encoding BMCA-41BBζ, BCMA-CD28ζ, or CD19-CD28ζ CARs. Target cells include MM1S (Figures 122A, 122E, 122I, and 122M), NCI-H929 (labeled "H929") (Figures 122B, 122F, 122J, 122N), Nalm6 (Figures 122C, 122G, 122K, 122O), and K562.CD19 (Figures 122D, 122H, 122L, 122P). Figures 122A-122D provide INFγ cytokine levels, Figures 122E-122H provide TNFα cytokine levels, Figures 122I-122L provide IL-2 cytokine levels, and Figures 122M-122P provide GM-CSF levels. "A," "G," "C," "F," "H," "I," and "J" correspond to "DNA template A," "DNA template G," "DNA template C," "DNA template F," "DNA template H," "DNA template I," and "DNA template J" used to form circular RNA. [Figure 122B] See legend to Figure 122A. [Figure 122C] See legend to Figure 122A. [Figure 122D] See legend to Figure 122A. [Figure 122E] See legend to Figure 122A. [Figure 122F] See legend to Figure 122A. [Figure 122G] See legend to Figure 122A. [Figure 122H] See legend to Figure 122A. [Figure 122I] See legend to Figure 122A. [Figure 122J] See legend to Figure 122A. [Figure 122K] See legend to Figure 122A. [Figure 122L] See legend to Figure 122A. [Figure 122M] See legend to Figure 122A. [Figure 122N] See legend to Figure 122A. [Figure 122O] See legend to Figure 122A. [Figure 122P] See legend to Figure 122A. [Figure 123] Figure 1 shows the percent apoptosis (e.g., % apoptotic target cells = (green area + red area) / green area) of target cells (e.g., Nalm6) collected from a viable cell analysis portfolio system (e.g., IncuCyte) 72 hours after introduction of circular RNA encoding HER2 CAR. The green area indicates target cells. The red area indicates Annexin V reagent present in apoptotic cells. For the control, Nalm6 without circular RNA was used. [Figure 124A] Figures 124A-124C show % Annexin V / phase after activated PBMC T cells were transfected with circular RNA encoding HER2.28ζ, HER2.BBζ, or CD19.28ζ CARs and cocultured with BT474 (Figure 124A), SKBR3 (Figure 124B), and JIMT1 (Figure 124C) HER2-positive cells. For comparison, activated PBMC T cells lacking any circular RNA were used (labeled "mock"). The "% Annexin V / phase" referenced in Figures 124A-124C relates to the percentage of apoptotic cells per phase. "K," "L," and "M" correspond to the "DNA template K," "DNA template L," and "DNA template M" used to form the circular RNAs. [Figure 124B] See legend to Figure 124A. [Figure 124C] See legend to Figure 124A. [Figure 125A]Figure 125A shows that frozen and fresh LNPs delivered CAR expression of three different circular RNA constructs encoding HER2 CARs. "Mock" cells were T cells given empty LNPs (no circular RNA). Figure 125B provides the % cytotoxicity collected from a viable cell analysis portfolio system (e.g., IncuCyte) analysis of T cells containing circular RNA constructs encoding HER2-28ζ, HER2-BBζ, or CD19-28ζ CARs co-cultured with BT-474 target cells at a 1:1 E:T ratio, where the circular RNA was delivered using fresh or frozen LNPs. The fresh and frozen LNPs contained ionizable lipids from Table 10c. Figure 125C provides the cytokine release (top graph in Figure 125C: INFγ and bottom graph in Figure 125C: TNFα) produced by T cells co-cultured in BT-474 for each circular RNA construct. "K," "L," and "F" correspond to "DNA template K," "DNA template L," and "DNA template F" used to form the circular RNA. "Fresh" indicates that the LNPs were not previously frozen. "Frozen" indicates that the LNPs were previously frozen. [Figure 125B] See legend to Figure 125A. [Figure 125C] See legend to Figure 125A. [Figure 126A]Figures 126A-126L show anti-HER2 expression of circular RNAs encoding HER2.28ζ, HER2.BBζ, or CD19.28ζ CARs intravenously injected and delivered using lipid nanoparticles to the JIMT-1 (Figures 126A-126L) and BT-474 (Figures 126G-126L) mouse models. Figures 126C-126F are spider plots of the data collected in Figures 126A-126B. Figures 126I-126L are spider plots of the data collected in Figures 126G and 126H. "K," "L," and "F" correspond to "DNA template K," "DNA template L," and "DNA template F" used to form the circular RNAs. "Fresh" indicates that the LNPs were not previously frozen. "Frozen" indicates that the LNPs were previously frozen. [Figure 126B] See legend to Figure 126A. [Figure 126C] See legend to Figure 126A. [Figure 126D] See legend to Figure 126A. [Figure 126E] See legend to Figure 126A. [Figure 126F] See legend to Figure 126A. [Figure 126G] See legend to Figure 126A. [Figure 126H] See legend to Figure 126A. [Figure 126I] See legend to Figure 126A. [Figure 126J] See legend to Figure 126A. [Figure 126K] See legend to Figure 126A. [Figure 126L] See legend to Figure 126A. DETAILED DESCRIPTION OF THE INVENTION

[0099] Detailed Description The present invention provides, inter alia, methods and compositions for treating autoimmune disorders, deficiency diseases, or cancers based on circular RNA therapy. In particular, the present invention provides a method for treating autoimmune disorders, deficiency diseases, or cancers by administering to a subject in need of treatment a composition comprising a circular RNA encoding at least one therapeutic protein at an effective dose and administration interval such that the intensity, severity, or frequency of, or the onset of, at least one symptom or characteristic of the associated disease or disorder is reduced, or the onset is delayed.

[0100] As disclosed herein, improved circular RNA therapeutics, along with related compositions and methods, enable, among other things, circular RNA stability, increased expression, and prolonged half-life. In some embodiments, the circular RNA of the present invention is transcribed from a linear RNA polynucleotide construct comprising enhanced intronic elements, enhanced exonic elements, and core functional elements. In some embodiments, the enhanced intronic elements comprise a post-splicing Group I intron fragment, a spacer, a duplex sequence, an affinity sequence, and a unique untranslated sequence that enables optimal circularization. In some embodiments, the enhanced exonic elements comprise an exonic fragment, a spacer, and a duplex sequence to aid in the circularization process and maintain the stability of the circular RNA after circularization. Within the same embodiment, the core functional elements comprise essential elements for protein translation, such as a translation initiation element (TIE), coding or non-coding elements, and a termination sequence (e.g., a stop codon or termination cassette). Together, the core functional elements, including the enhanced intronic elements, enhanced exonic elements, and coding elements, provide a circular RNA polynucleotide that is optimal for encoding a therapeutic protein. In one aspect, the core functional elements, including enhanced intronic elements, enhanced exonic elements, and non-coding elements, provide a circular RNA polynucleotide that is optimal for eliciting the immune system as an adjuvant.

[0101] Also disclosed herein are DNA templates (e.g., vectors) for producing circular RNA. In some embodiments, the DNA template comprises a 3'-enhanced intron fragment, a 3'-enhanced exon fragment, a core functional element, a 5'-enhanced exon fragment, and a 5'-enhanced intron fragment. In some embodiments, these elements are located in the DNA template in the above order.

[0102] Additional embodiments include circular RNA polynucleotides comprising circular RNA polynucleotides produced using the DNA templates provided herein (e.g., circular RNAs comprising 3'-enhanced exonic elements, core functional elements, and 5'-enhanced exonic elements), compositions comprising such circular RNAs, cells comprising such circular RNAs, and methods of using and producing such DNA templates, circular RNAs, compositions, and cells.

[0103] In some embodiments, provided herein are methods comprising administering a circular RNA polynucleotide provided herein into a cell for therapeutic or useful protein production. In some embodiments, the methods are advantageous in providing for the production of a desired polypeptide within a eukaryotic cell with a longer half-life than linear RNA due to the resistance of circular RNA to ribonucleases.

[0104] Circular RNA polynucleotides lack the free ends required for exonuclease-mediated degradation, making them resistant to some mechanisms of RNA degradation and extending their half-life compared to comparable linear RNA. Circularization can stabilize RNA polynucleotides, which generally suffer from short half-lives, and can improve the overall effectiveness of exogenous mRNA in various applications. In an embodiment, the functional half-life of the circular RNA polynucleotides provided herein in eukaryotic cells (e.g., mammalian cells, e.g., human cells) is at least 20 hours (e.g., at least 80 hours) as assessed by protein synthesis.

[0105] Various aspects of the present invention are described in detail in the following sections. The use of the sections is not intended to limit the invention. Each section may be applied to any aspect of the present invention. In this application, the use of "or" means "and / or" unless otherwise stated.

[0106] 1. Definition As used herein, the terms "circRNA," "circular polyribonucleotide," "circular RNA," "circularized RNA," or "oRNA" are used interchangeably and refer to polyribonucleotides that form a circular structure through covalent bonds. As used herein, such terms also include preparations containing circRNA, circular polyribonucleotide, circular RNA, or oRNA.

[0107] As used herein, the term "DNA template" refers to a DNA sequence that can be transcribed into a linear RNA polynucleotide. For example, a DNA template can include, but is not limited to, a DNA vector, a PCR product, or a plasmid.

[0108] As used herein, the term "3' Group I intron fragment" refers to a sequence having 75% or greater similarity to the 3' proximal end of a native Group I intron, including the splice site dinucleotide.

[0109] As used herein, the term "5' Group I intron fragment" refers to a sequence having 75% or greater similarity to the 5' proximal end of a native Group I intron, including the splice site dinucleotide.

[0110] As used herein, the term "permutation site" refers to the site in a Group I intron where cleavage occurs prior to intron permutation, generating 3' and 5' Group I intron fragments that are permuted to flank the stretch of precursor RNA that is to be circularized.

[0111] As used herein, the term "splice site" refers to a dinucleotide that is partially or completely contained in a Group I intron and between which the phosphodiester bond is cleaved during RNA circularization. (As used herein, "splice site" refers to one or more dinucleotides between which phosphodiester bond cleavage occurs during the splicing reaction. A "5' splice site" refers to the naturally occurring 5' dinucleotide of an intron, e.g., a Group I intron, whereas a "3' splice site" refers to the naturally occurring 3' dinucleotide of an intron.)

[0112] As used herein, the term "expressed sequence" refers to a nucleic acid sequence that encodes a product, such as a peptide or polypeptide, a regulatory nucleic acid, or a non-coding nucleic acid. An exemplary expressed sequence that encodes a peptide or polypeptide can include multiple nucleotide triplets, termed "codons," each of which can encode an amino acid.

[0113] As used herein, a "coding element" or "coding region" is a region located within an expressed sequence that encodes one or more proteins or polypeptides (e.g., therapeutic proteins).

[0114] As used herein, a "non-coding element" or "non-coding nucleic acid" is a region located within an expression sequence that does not itself encode a protein or polypeptide, but may have other regulatory functions, including, but not limited to, allowing the overall polynucleotide to act as a biomarker or adjuvant for a particular cell.

[0115] As used herein, the term "therapeutic protein" refers to any protein that has a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect when administered directly or indirectly to a subject in the form of a translated nucleic acid.

[0116] As used herein, the term "immunogenic" refers to the potential to induce an immune response against a substance. An immune response can be induced when an organism's immune system or certain immune cells are exposed to an immunogenic substance. The term "non-immunogenic" refers to the lack or absence of an immune response above a detectable threshold against a substance. When an organism's immune system or certain immune cells are exposed to a non-immunogenic substance, no immune response is detected. In some embodiments, the non-immunogenic cyclic polyribonucleotides provided herein do not induce an immune response above a predetermined threshold as measured by an immunogenicity assay. In some embodiments, when an organism's immune system or certain immune cells are exposed to the non-immunogenic cyclic polyribonucleotides provided herein, no innate immune response is detected. In some embodiments, when an organism's immune system or certain immune cells are exposed to the non-immunogenic cyclic polyribonucleotides provided herein, no adaptive immune response is detected.

[0117] As used herein, the term "circularization efficiency" refers to a measure of the rate of formation of the resulting amount of circular polyribonucleotide compared to its linear starting material.

[0118] As used herein, the term "translation efficiency" refers to the rate or amount of protein or peptide production from a ribonucleotide transcript. In some embodiments, translation efficiency can be expressed as the amount of protein or peptide produced per given amount of transcript encoding the protein or peptide.

[0119] The term "nucleotide" refers to ribonucleotides, deoxyribonucleotides, modified forms thereof, or analogs thereof. Nucleotides include species containing purines, such as adenine, hypoxanthine, guanine, and derivatives and analogs thereof, as well as pyrimidines, such as cytosine, uracil, thymine, and derivatives and analogs thereof. Nucleotide analogs include nucleotides with modifications in the chemical structure of the base, sugar, and / or phosphate, including, but not limited to, 5'-position pyrimidine modifications, 8'-position purine modifications, modifications with the exocyclic amine of cytosine, and 5-bromo-uracil substitution; and 2'-position sugar modifications (including, but not limited to, sugar-modified ribonucleotides in which the 2'-OH is replaced with a group such as H, OR, R, halo, SH, SR, NH, NHR, NR, or CN (where R is an alkyl moiety as defined herein)). Nucleotide analogs are also meant to include nucleotides having bases such as inosine, queosine, and xanthine; sugars such as 2'-methylribose; and non-natural phosphodiester and peptide linkages such as methylphosphonate and phosphorothioate linkages. Nucleotide analogs include 5-methoxyuridine, 1-methylpseudouridine, and 6-methyladenosine.

[0120] The terms "nucleic acid" and "polynucleotide" are used interchangeably herein to describe polymers of any length, for example, more than about 2 bases, more than about 10 bases, more than about 100 bases, more than about 500 bases, more than about 1000 bases, or up to about 10,000 bases or more, composed of nucleotides, such as deoxyribonucleotides or ribonucleotides, which can be produced enzymatically or synthetically (for example, as described in U.S. Pat. No. 5,948,902 and the references cited therein), and can hybridize with naturally occurring nucleic acids in a sequence-specific manner similar to two naturally occurring nucleic acids, for example, can participate in Watson-Crick base pairing interactions. An "oligonucleotide" is a polynucleotide containing less than 1000 nucleotides, for example, less than 500 nucleotides or less than 100 nucleotides. Naturally occurring nucleic acids are composed of nucleotides containing guanine, cytosine, adenine, thymine, and uracil-containing nucleotides (G, C, A, T, and U, respectively). As used herein, "poly A" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine. As used herein, "poly T" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing thymine. As used herein, "poly AC" refers to a polynucleotide or a portion of a polynucleotide consisting of nucleotides containing adenine or cytosine.

[0121] As used herein, the terms "ribonucleic acid" and "RNA" refer to a polymer composed of ribonucleotides.

[0122] As used herein, the terms "deoxyribonucleic acid" and "DNA" refer to a polymer composed of deoxyribonucleotides.

[0123] "Isolated" or "purified" generally refers to the isolation of a substance (e.g., in some embodiments, a compound, polynucleotide, protein, polypeptide, polynucleotide composition, or polypeptide composition) such that the substance constitutes a significant percentage (e.g., greater than 1%, greater than 2%, greater than 5%, greater than 10%, greater than 20%, greater than 50%, or more, typically up to about 90%-100%) of the sample in which it is present. In certain embodiments, a substantially purified component constitutes at least 50, 60, 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% of the sample. In additional embodiments, a substantially purified component constitutes about 80%-85%, or 90%-95%, 95-99%, 96-99%, 97-99%, or 95-100% of the sample. Techniques for purifying polynucleotides and polypeptides of interest are well known in the art and include, for example, ion exchange chromatography, affinity chromatography, and sedimentation according to density. Generally, a substance is purified when it is present in a sample in an amount greater than that found in nature relative to other components of the sample.

[0124] As used herein, the terms "duplex," "double-stranded," or "hybridized" refer to a nucleic acid formed by hybridization of two single strands of nucleic acid containing complementary sequences. In most cases, genomic DNA is double-stranded. The sequences can be fully complementary or partially complementary.

[0125] As used herein, "unstructured" with respect to RNA refers to an RNA sequence that is not predicted by RNA structure prediction tools to form structures (e.g., hairpin loops) with itself or with other sequences within the same RNA molecule. In some embodiments, unstructured RNAs can be functionally characterized using nuclease protection assays.

[0126] As used herein, "structured" with respect to RNA refers to an RNA sequence that is predicted by RNA Fold software or similar prediction tools to form structures (e.g., hairpin loops) with itself or with other sequences within the same RNA molecule.

[0127] As used herein, two "duplex sequences," "duplex regions," "multiple duplex regions," "homologous arms," or "homology regions" can be any two regions that are thermodynamically favorable for cross-pairing in a sequence-specific interaction. In some embodiments, two duplex sequences, duplex regions, homologous arms, or homology regions share a sufficient level of sequence identity with each other's reverse complements to act as substrates for a hybridization reaction. As used herein, polynucleotide sequences have "homology" if they are identical or share sequence identity with their reverse complements or "complementary" sequences. The percent sequence identity between a homology region and the reverse complement of the corresponding homology region can be any percentage of sequence identity that allows hybridization to occur. In some embodiments, an internal duplex region of a polynucleotide of the present invention can form a duplex with another internal duplex region but not with an external duplex region.

[0128] As used herein, an "affinity sequence" or "affinity tag" is a region of a polynucleotide sequence ranging from one nucleotide to hundreds or thousands of nucleotides that contains a repeating set of nucleotides for the purpose of aiding in the purification of the polynucleotide sequence. For example, an affinity sequence can include, but is not limited to, a polyA or polyAC sequence. In some embodiments, affinity tags are used in purification methods referred to herein as "affinity purification," in which selective binding of a binder to a molecule containing the affinity tag facilitates its separation from molecules that do not contain the affinity tag. In some embodiments, the affinity purification method is a "negative selection" purification method, in which undesired species, such as linear RNA, are selectively bound and removed, and desired species, such as circular RNA, are eluted and separated from the undesired species.

[0129] As used herein, "spacer" refers to a region of a polynucleotide sequence ranging from one nucleotide to hundreds or thousands of nucleotides that separates two other elements along the polynucleotide sequence. The sequence can be defined or can be random. Spacers are typically non-coding. In some embodiments, a spacer comprises a double-stranded region.

[0130] Linear nucleic acid molecules are said to have a "5'-end" (5' end) and a "3'-end" (3' end) because the nucleic acid phosphodiester bonds are at the 5' and 3' carbons of the sugar moiety of the substituent mononucleotide. The terminal nucleotide of a polynucleotide in which the new bond is to the 5' carbon is its 5'-terminal nucleotide. The terminal nucleotide of a polynucleotide in which the new bond is to the 3' carbon is its 3'-terminal nucleotide. As used herein, a terminal nucleotide is the nucleotide at the end position of either the 3'- or 5'-end.

[0131] As used herein, a "lead untranslated sequence" is a region of a polynucleotide sequence ranging from one nucleotide to several hundred nucleotides located at the 5'-most upstream end of the polynucleotide sequence. The sequence can be defined or random. The lead untranslated sequence is non-coding.

[0132] As used herein, a "terminal untranslated sequence" is a region of a polynucleotide sequence ranging from one nucleotide to several hundred nucleotides located at the most downstream 3' end of the polynucleotide sequence. The sequence can be defined or random. Terminal untranslated sequences are non-coding.

[0133] "Transcription" refers to the formation or synthesis of an RNA molecule by an RNA polymerase using a DNA molecule as a template. The present invention is not limited with respect to the RNA polymerase used for transcription. For example, in some embodiments, a T7-type RNA polymerase can be used.

[0134] "Translation" refers to the formation of a polypeptide molecule by ribosomes from an RNA template.

[0135] It should be understood that the terms used herein are for the purpose of describing particular embodiments only and are not intended to be limiting. As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, a reference to a "cell" includes a combination of two or more cells, or an entire culture of cells; a reference to a "polynucleotide" includes, as a practical matter, many copies of that polynucleotide. As used herein, unless otherwise specified or clear from the context, the term "or" is understood to be inclusive. Unless otherwise defined herein and in the remainder of the specification below, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0136] As used herein, unless otherwise specified or clear from the context, the term "about" is understood to be within the normal tolerance in the art, for example, within 2 standard deviations of the mean. "About" can be understood to be within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.9%, 0.8%, 0.7%, 0.6%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, or 0.01% of the stated value. Unless otherwise clear from the context, all numerical values provided herein are modified by the term "about."

[0137] As used herein, the term "encoding" refers broadly to any process in which information in a polymer macromolecule is used to direct the production of a second molecule that is different from the first molecule. The second molecule may have a chemical structure that is different from the chemical nature of the first molecule.

[0138] By "co-administering" is meant administering a therapeutic agent provided herein in conjunction with one or more additional therapeutic agents sufficiently close in time so that the therapeutic agent provided herein can potentiate the effect of the one or more additional therapeutic agents, or vice versa.

[0139] As used herein, the terms "treat" and "prevent," and words derived therefrom, do not necessarily mean 100% or complete treatment or prevention. Rather, there are varying degrees of treatment or prevention that those skilled in the art will recognize as having potential benefit or therapeutic effect. The treatment or prevention provided by the methods disclosed herein can include treatment or prevention of one or more conditions or symptoms of a disease. For purposes herein, "prevention" can also encompass delaying the onset of a disease, or its symptoms or conditions.

[0140] As used herein, "aptamer" generally refers to either a single oligonucleotide of a defined sequence or a mixture of such nucleotides, which mixture retains the property of specifically binding to a target molecule (e.g., eukaryotic initiation factor, 40S ribosome, poly C-binding protein, poly A-binding protein, polypyrimidine tract-binding protein, Argonaute protein family, heterogeneous nuclear ribonucleoproteins K and La, and related RNA-binding proteins). Therefore, as used herein, "aptamer" refers to both a single sequence and multiple sequences of nucleotides as defined herein above. The term "aptamer" is meant to refer to a single- or double-stranded nucleic acid capable of binding to a protein or other molecule. Generally, aptamers preferably contain about 10 to about 100 nucleotides, preferably about 15 to about 40 nucleotides, and more preferably about 20 to about 40 nucleotides. Oligonucleotides within these lengths are readily prepared by conventional techniques. Optionally, an aptamer can further comprise a minimum of approximately 6 nucleotides, preferably 10 nucleotides, and more preferably 14 or 15 nucleotides necessary to induce specific binding.

[0141] "Eukaryotic initiation factor" or "eIF" refers to a protein or protein complex used to assemble the initiator tRNA, 40S and 60S ribosomal subunits required to initiate eukaryotic translation.

[0142] As used herein, "internal ribosome entry site" or "IRES" refers to an RNA sequence or structural element ranging in size from 10 nt to 1000 nt or more that can initiate translation of a polypeptide in the absence of a typical RNA cap structure. IRESs are typically about 500 nt to about 700 nt in length.

[0143] As used herein, an "miRNA site" refers to a stretch of nucleotides within a polynucleotide that can form a duplex with at least eight nucleotides of a naturally occurring miRNA sequence.

[0144] As used herein, an "endonuclease site" refers to a stretch of nucleotides within a polynucleotide that can be recognized and cleaved by an endonuclease protein.

[0145] As used herein, "bicistronic RNA" refers to a polynucleotide containing two expressed sequences encoding two separate proteins. These expressed sequences may be separated by a nucleotide sequence encoding a cleavable peptide, such as a protease cleavage site. They may also be separated by a ribosome skipping element.

[0146] As used herein, the term "ribosome skipping element" refers to a nucleotide sequence that encodes a short peptide sequence that can trigger the production of two peptide chains from the translation of one RNA molecule. Without wishing to be bound by theory, it is hypothesized that ribosome skipping elements function by (1) terminating the translation of the first peptide chain and restarting the translation of the second peptide chain; or (2) cleaving a peptide bond in the peptide sequence encoded by the ribosome skipping element by the intrinsic protease activity of the encoded peptide or by another protease in the environment (e.g., cytosol).

[0147] As used herein, the term "co-formulated" refers to a nanoparticle formulation comprising two or more nucleic acids, or comprising a nucleic acid and another active drug substance. Typically, the ratio is defined as an equimolar or ratiometric amount of the two or more nucleic acids, or the nucleic acid and the other active drug substance.

[0148] As used herein, a "transfer vehicle" includes any of the standard pharmaceutical carriers, diluents, excipients, etc. generally intended for use in connection with the administration of biologically active agents, including nucleic acids.

[0149] As used herein, the phrase "lipid nanoparticle" refers to a delivery vehicle comprising one or more cationic or ionizable lipids, stabilizing lipids, structural lipids, and helper lipids.

[0150] As used herein, the phrase "ionizable lipid" refers to any of several lipid species that have a net positive charge at a selected pH, such as physiological pH 4, and a neutral charge at other pHs, such as physiological pH 7.

[0151] In some embodiments, the lipids disclosed herein, such as ionizable lipids, contain one or more cleavable groups. The terms "cleave" and "cleavable" are used herein to mean that one or more chemical bonds (e.g., one or more of covalent bonds, hydrogen bonds, van der Waals forces, and / or ionic interactions) between atoms within or adjacent to the subject functional group can be broken (e.g., hydrolyzed) or broken upon exposure to selected conditions (e.g., enzymatic conditions). In certain embodiments, the cleavable group is a disulfide functional group, and in certain embodiments, a disulfide group that can be cleaved upon exposure to selected biological conditions (e.g., intracellular conditions). In certain embodiments, the cleavable group is an ester functional group that can be cleaved upon exposure to selected biological conditions. For example, the disulfide group can be cleaved enzymatically or by hydrolysis, oxidation, or reduction reactions. When such a disulfide functional group is cleaved, one or more functional moieties or groups (e.g., one or more head groups and / or tail groups) attached thereto can be released. Exemplary cleavable groups may include, but are not limited to, disulfide groups, ester groups, ether groups, and any derivatives thereof (e.g., alkyl esters and aryl esters). In certain embodiments, the cleavable group is not an ester group or an ether group. In some embodiments, the cleavable group is attached (e.g., attached by one or more of hydrogen bonds, van der Waals forces, ionic interactions, and covalent bonds) to one or more functional moieties or groups (e.g., at least one head group and at least one tail group). In certain embodiments, at least one of the functional moieties or groups is hydrophilic (e.g., a hydrophilic head group comprising one or more of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino, and pyridyl).

[0152] As used herein, the term "hydrophilic" is used qualitatively to indicate that a functional group is water-loving, and typically, such groups are water-soluble. For example, compounds are disclosed herein that include a cleavable disulfide (SS) functional group attached to one or more hydrophilic groups (e.g., hydrophilic head groups), where such hydrophilic groups include or are selected from the group consisting of imidazole, guanidinium, amino, imine, enamine, optionally substituted alkylamino (e.g., alkylamino, e.g., dimethylamino), and pyridyl.

[0153] In certain embodiments, at least one of the functional groups of the moiety comprising the compounds disclosed herein is hydrophobic in nature (e.g., a hydrophobic tail group comprising a naturally occurring lipid such as cholesterol). As used herein, the term "hydrophobic" is used qualitatively to indicate that the functional group avoids water; typically, such groups are not water-soluble. For example, compounds are disclosed herein that include a cleavable functional group (e.g., a disulfide (SS) group) attached to one or more hydrophobic groups, where such hydrophobic groups include one or more naturally occurring lipids such as cholesterol, and / or optionally substituted saturated or unsaturated C6-C20 alkyl and / or optionally substituted saturated or unsaturated C6-C20 acyl.

[0154] The compounds described herein may also include one or more isotopic substitutions.For example, H can be any isotopic form including 1H, 2H (D or deuterium) and 3H (T or tritium); C can be any isotopic form including 12C, 13C and 14C; O can be any isotopic form including 16O and 18O; F can be any isotopic form including 18F and 19F, etc.

[0155] In describing the present invention, which may include compounds and pharmaceutically acceptable salts thereof, pharmaceutical compositions containing such compounds, and methods of using such compounds and compositions, the following terms, if present, have the following meanings unless otherwise indicated. As described herein, it should also be understood that any of the moieties defined below may be substituted with various substituents, and that each definition is intended to include such substituted moieties within their scope as set forth below. Unless otherwise indicated, the term "substituted" should be defined as set forth below. It should further be understood that the terms "group" and "radical" can be considered interchangeable when used herein.

[0156] When a range of values is listed, it is intended to encompass each value and subrange within that range. For example, "C alkyl" is intended to encompass C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, C, and C alkyl.

[0157] In certain embodiments, the compounds disclosed herein comprise, for example, at least one hydrophilic head group and at least one hydrophobic tail group, each of which is attached to at least one cleavable group, thereby making such compounds amphiphilic. When used herein to describe a compound or composition, the term "amphiphilic" means that it can dissolve in both polar (e.g., aqueous) and non-polar (e.g., lipid) environments. For example, in certain embodiments, the compounds disclosed herein comprise at least one lipophilic tail group (e.g., cholesterol or C6-C20 alkyl) and at least one hydrophilic head group (e.g., imidazole), each of which is attached to a cleavable group (e.g., disulfide).

[0158] It should be noted that the terms "head group" and "tail group" used describe the compounds of the invention, particularly the functional groups that comprise such compounds, and are used for ease of reference to describe the orientation of one or more functional groups relative to other functional groups. For example, in certain embodiments, a hydrophilic head group (e.g., guanidinium) is attached (e.g., by one or more of hydrogen bonding, van der Waals forces, ionic interactions, and covalent bonding) to a cleavable functional group (e.g., a disulfide group), which is in turn attached to a hydrophobic tail group (e.g., cholesterol).

[0159] As used herein, the term "alkyl" refers to both straight-chain and branched-chain C1-C40 hydrocarbons (e.g., C6-C20 hydrocarbons), including both saturated and unsaturated hydrocarbons. In certain embodiments, alkyls can contain one or more cyclic alkyls and / or one or more heteroatoms, such as oxygen, nitrogen, or sulfur, and can optionally be substituted with substituents (e.g., one or more of alkyl, halo, alkoxyl, hydroxy, amino, aryl, ether, ester, or amide). In certain embodiments, contemplated alkyls include (9Z,12Z)-octadeca-9,12-diene. For example, the use of a designation such as "C6-C20" is intended to refer to an alkyl (e.g., straight-chain or branched, including alkenes and alkyls) having the recited range of carbon atoms. In some embodiments, an alkyl group has 1 to 10 carbon atoms ("C1-10 alkyl"). In some embodiments, an alkyl group has 1 to 9 carbon atoms ("C1-9 alkyl"). In some embodiments, an alkyl group has 1 to 8 carbon atoms ("C1-8 alkyl"). In some embodiments, an alkyl group has 1 to 7 carbon atoms ("C1-7 alkyl"). In some embodiments, an alkyl group has 1 to 6 carbon atoms ("C1-6 alkyl"). In some embodiments, an alkyl group has 1 to 5 carbon atoms ("C1-5 alkyl"). In some embodiments, an alkyl group has 1 to 4 carbon atoms ("C1-4 alkyl"). In some embodiments, an alkyl group has 1 to 3 carbon atoms ("C1-3 alkyl"). In some embodiments, an alkyl group has 1 to 2 carbon atoms ("C1-2 alkyl"). In some embodiments, an alkyl group has 1 carbon atom ("C1 alkyl"). Examples of C1-6 alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, pentyl, hexyl, and the like.

[0160] As used herein, "alkenyl" refers to a group of straight-chain or branched hydrocarbon groups having 2 to 20 carbon atoms, one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 carbon-carbon double bonds), and optionally one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 carbon-carbon triple bonds) ("C2-20 alkenyl"). In certain embodiments, the alkenyl does not contain any triple bonds. In some embodiments, an alkenyl group has 2 to 10 carbon atoms ("C2-10 alkenyl"). In some embodiments, an alkenyl group has 2 to 9 carbon atoms ("C2-9 alkenyl"). In some embodiments, an alkenyl group has 2 to 8 carbon atoms ("C2-8 alkenyl"). In some embodiments, an alkenyl group has 2 to 7 carbon atoms ("C2-7 alkenyl"). In some embodiments, an alkenyl group has 2 to 6 carbon atoms ("C2-6 alkenyl"). In some embodiments, an alkenyl group has 2 to 5 carbon atoms ("C2-5 alkenyl"). In some embodiments, an alkenyl group has 2 to 4 carbon atoms ("C2-4 alkenyl"). In some embodiments, an alkenyl group has 2 to 3 carbon atoms ("C2-3 alkenyl"). In some embodiments, an alkenyl group has 2 carbon atoms ("C2 alkenyl"). The one or more carbon-carbon double bonds can be internal (e.g., 2-butenyl) or terminal (e.g., 1-butenyl). Examples of C2-4 alkenyl groups include ethenyl (C2), 1-propenyl (C3), 2-propenyl (C3), 1-butenyl (C4), 2-butenyl (C4), butadienyl (C4), and the like. Examples of C2-6 alkenyl groups include not only the C2-4 alkenyl groups mentioned above, but also pentenyl (C5), pentadienyl (C5), hexenyl (C6), etc. Additional examples of alkenyl include heptenyl (C7), octenyl (C8), octatrienyl (C8), etc.

[0161] As used herein, "alkynyl" refers to a group of straight-chain or branched hydrocarbon groups having 2 to 20 carbon atoms, one or more carbon-carbon triple bonds (e.g., 1, 2, 3, or 4 carbon-carbon triple bonds), and optionally one or more carbon-carbon double bonds (e.g., 1, 2, 3, or 4 carbon-carbon double bonds) ("C2-20 alkynyl"). In certain embodiments, an alkynyl does not contain any double bonds. In some embodiments, an alkynyl group has 2 to 10 carbon atoms ("C2-10 alkynyl"). In some embodiments, an alkynyl group has 2 to 9 carbon atoms ("C2-9 alkynyl"). In some embodiments, an alkynyl group has 2 to 8 carbon atoms ("C2-8 alkynyl"). In some embodiments, an alkynyl group has 2 to 7 carbon atoms ("C2-7 alkynyl"). In some embodiments, an alkynyl group has 2 to 6 carbon atoms ("C2-6 alkynyl"). In some embodiments, an alkynyl group has 2 to 5 carbon atoms ("C2-5 alkynyl"). In some embodiments, an alkynyl group has 2 to 4 carbon atoms ("C2-4 alkynyl"). In some embodiments, an alkynyl group has 2 to 3 carbon atoms ("C2-3 alkynyl"). In some embodiments, an alkynyl group has 2 carbon atoms ("C2 alkynyl"). The one or more carbon-carbon triple bonds can be internal (e.g., 2-butynyl) or terminal (e.g., 1-butynyl). Examples of C2-4 alkynyl groups include, but are not limited to, ethynyl (C2), 1-propynyl (C3), 2-propynyl (C3), 1-butynyl (C4), 2-butynyl (C4), and the like. Examples of C2-6 alkenyl groups include not only the C2-4 alkynyl groups mentioned above, but also pentynyl (C5), hexynyl (C6), etc. Additional examples of alkynyl include heptynyl (C7), octynyl (C8), etc.

[0162] As used herein, "alkylene," "alkenylene," and "alkynylene" refer to divalent radicals of alkyl, alkenyl, and alkynyl groups, respectively. When a range or number of carbons is provided for a particular "alkylene," "alkenylene," or "alkynylene" group, it is understood that the range or number refers to the range or number of carbons in a linear, divalent carbon chain. "Alkylene," "alkenylene," and "alkynylene" groups may be substituted or unsubstituted with one or more substituents described herein.

[0163] As used herein, the term "aryl" refers to aromatic groups containing 6 to 10 carbons in the ring portion (e.g., monocyclic, bicyclic, and tricyclic structures). Aryl groups may be substituted via available carbon atoms and, in certain embodiments, may contain one or more heteroatoms such as oxygen, nitrogen, or sulfur. In some embodiments, an aryl group has 6 ring carbon atoms ("C6 aryl"; e.g., phenyl). In some embodiments, an aryl group has 10 ring carbon atoms ("C10 aryl"; e.g., naphthyl, such as 1-naphthyl and 2-naphthyl).

[0164] As used herein, "heteroaryl" refers to a group of five- to ten-membered monocyclic or bicyclic 4n+2 aromatic ring systems (e.g., having 6 or 10 electrons shared in a cyclic array) having ring carbon atoms and one to four ring heteroatoms provided in the aromatic ring system, where each heteroatom is independently selected from nitrogen, oxygen, and sulfur ("five- to ten-membered heteroaryl"). In heteroaryl groups containing one or more nitrogen atoms, the point of attachment can be at a carbon or nitrogen atom, valence permitting. Heteroaryl bicyclic ring systems can contain one or more heteroatoms in one or both rings. "Heteroaryl" includes ring systems in which a heteroaryl ring, as defined above, is fused with one or more carbocyclic or heterocyclic groups, where the point of attachment is on the heteroaryl ring, in which case the number of ring members continues to designate the number of ring members in the heteroaryl ring system. "Heteroaryl" also includes ring systems in which a heteroaryl ring, as defined above, is fused to one or more aryl groups, where the point of attachment is on either the aryl ring or the heteroaryl ring, and in that case the number of ring members refers to the number of ring members in the fused (aryl / heteroaryl) ring system. In bicyclic heteroaryl groups in which one ring does not contain a heteroatom (e.g., indolyl, quinolinyl, carbazolyl, etc.), the point of attachment can be on either ring, i.e., on the ring containing the heteroatom (e.g., 2-indolyl) or on the ring without the heteroatom (e.g., 5-indolyl).

[0165] The term "cycloalkyl" refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon group of 3 to 12, 3 to 8, 4 to 8, or 4 to 6 carbons, e.g., derived from a cycloalkane, designated "C4-8 cycloalkyl." Exemplary cycloalkyl groups include, but are not limited to, cyclohexane, cyclopentane, cyclobutane, and cyclopropane.

[0166] As used herein, "heterocyclyl" or "heterocyclic" refers to a radical of a 3- to 10-membered non-aromatic ring system having ring carbon atoms and 1 to 4 ring heteroatoms, where each heteroatom is independently selected from nitrogen, oxygen, sulfur, boron, phosphorus, and silicon ("3- to 10-membered heterocyclyl"). In heterocyclyl groups containing one or more nitrogen atoms, the point of attachment can be at a carbon atom or a nitrogen atom, where valence permits. Heterocyclyl groups can be either monocyclic ring systems ("monocyclic heterocyclyl") or fused, bridged, or spiro ring systems, e.g., bicyclic ring systems ("bicyclic heterocyclyl"), and can be saturated or partially unsaturated. Heterocyclyl bicyclic ring systems can contain one or more heteroatoms in one or both rings. "Heterocyclyl" also includes ring systems in which a heterocyclyl ring, as defined above, is fused to one or more carbocyclic groups, and the point of attachment is on either the carbocyclic ring or the heterocyclyl ring, or in which a heterocyclyl ring, as defined above, is fused to one or more aryl or heteroaryl groups, and the point of attachment is on the heterocyclyl ring; in such cases, the number of ring members continues to refer to the number of ring members of the heterocyclyl ring system. The terms "heterocycle," "heterocyclyl," "heterocyclyl ring," "heterocyclic group," "heterocyclic moiety," and "heterocyclic radical" may be used interchangeably.

[0167] As used herein, "cyano" refers to --CN.

[0168] The terms "halo" and "halogen," as used herein, refer to an atom selected from fluorine (fluoro, F), chlorine (chloro, Cl), bromine (bromo, Br), and iodine (iodo, I). In certain embodiments, a halo group is either fluoro or chloro.

[0169] The term "alkoxy," as used herein, refers to an alkyl group that is attached to another moiety through an oxygen atom (-O(alkyl)). Non-limiting examples include, for example, methoxy, ethoxy, propoxy, and butoxy.

[0170] As used herein, "oxo" refers to -C=O.

[0171] In general, the term "substituted," whether accompanied by the word "optionally," means that at least one hydrogen atom present on a group (e.g., a carbon or nitrogen atom) is replaced with an acceptable substituent, e.g., a substituent that, upon substitution, results in a stable compound, e.g., a compound that does not spontaneously undergo transformation by rearrangement, cyclization, elimination, or other reaction. Unless otherwise indicated, a "substituted" group has a substituent at one or more substitutable positions of the group. And, when more than one position in any given structure is substituted, the substituents are either the same or different at each position.

[0172] As used herein, "pharmaceutically acceptable salt" refers to a salt that is suitable, within the scope of sound medical judgment, for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic reaction, etc., and that is commensurate with a reasonable risk / benefit ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of the present invention include those derived from suitable inorganic and organic acids and bases. Examples of pharmaceutically acceptable non-toxic acid addition salts are salts of amino groups formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid, and perchloric acid, or organic acids such as acetic acid, oxalic acid, maleic acid, tartaric acid, citric acid, succinic acid, or malonic acid, or by using other methods used in the art, such as ion exchange. Other pharmaceutically acceptable salts include adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate Pharmaceutically acceptable salts include salts such as lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Pharmaceutically acceptable salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and N(C1-4 alkyl)4 salts.Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, etc. Further pharmaceutically acceptable salts include, where appropriate, non-toxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, lower alkylsulfonates, and arylsulfonates.

[0173] In typical embodiments, the present invention is intended to encompass the compounds disclosed herein, as well as pharmaceutically acceptable salts, pharmaceutically acceptable esters, tautomeric forms, polymorphs, and prodrugs of such compounds. In some embodiments, the present invention includes pharmaceutically acceptable addition salts, pharmaceutically acceptable esters, solvates (e.g., hydrates) of addition salts, tautomeric forms, polymorphs, enantiomers, mixtures of enantiomers, stereoisomers, or mixtures of stereoisomers (pure or as racemic or non-racemic mixtures) of the compounds described herein.

[0174] The compounds described herein may contain one or more asymmetric centers and therefore may exist in various isomeric forms, such as enantiomers and / or diastereomers.For example, the compounds described herein may be in the form of individual enantiomers, diastereomers or geometric isomers, or may be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomers.Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high-pressure liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric synthesis. See, for example, Jacques et al., Enantiomers, Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, Stereochemistry of Carbon Compounds (McGraw-Hill, NY, 1962); and Wilen, Tables of Resolving Agents and Optical Resolutions p. 268 (EL Eliel, Ed., University of Notre Dame Press, Notre Dame, IN 1972). The present invention further encompasses the compounds described herein as individual isomers substantially free of other isomers or as mixtures of various isomers.

[0175] In certain embodiments, compounds and delivery vehicles (e.g., lipid nanoparticles) comprising such compounds exhibit enhanced (e.g., increased) ability to transfect one or more target cells. Accordingly, methods of transfecting one or more target cells are also provided herein. Such methods generally involve contacting one or more target cells with the compounds and / or pharmaceutical compositions disclosed herein, thereby transfecting the one or more target cells with the circular RNA encapsulated therein. As used herein, the term "transfect" or "transfection" refers to the intracellular introduction of one or more encapsulated materials (e.g., nucleic acids and / or polynucleotides) into a cell, or preferably a target cell. The term "transfection efficiency" refers to the relative amount of such encapsulated materials (e.g., polynucleotides) taken up, introduced, and / or expressed by a target cell subjected to transfection. In some embodiments, transfection efficiency can be estimated by the amount of reporter polynucleotide product produced by the target cell after transfection. In some embodiments, the delivery vehicle has high transfection efficiency. In some embodiments, the transfer vehicle has a transfection efficiency of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90%.

[0176] As used herein, the term "liposome" generally refers to a vesicle composed of lipids (e.g., amphiphilic lipids) arranged in one or more spherical bilayers. Such liposomes may be unilamellar or multilamellar vesicles with a membrane formed from a lipophilic material and an aqueous interior containing encapsulated circRNA for delivery to one or more target cells, tissues, and organs. In certain embodiments, the compositions described herein contain one or more lipid nanoparticles. Examples of suitable lipids (e.g., ionizable lipids) that can be used to form contemplated liposomes and lipid nanoparticles include one or more of the compounds disclosed herein (e.g., HGT4001, HGT4002, HGT4003, HGT4004, and / or HGT4005). Such liposomes and lipid nanoparticles may also contain additional ionizable lipids such as C12-200, DLin-KC2-DMA, and / or HGT5001, helper lipids, structural lipids, PEG-modified lipids, MC3, DLinDMA, DLinkC2DMA, cKK-E12, ICE, HGT5000, DODAC, DDAB, DMRIE, DOSPA, DOGS, DODAP, DODMA, DMDMA, DODAC, DLenDMA, DMRIE, CLinDMA, CpLinDMA, DMOBA, DOcarbDAP, DLinDAP, DLincarbDAP, DLinCDAP, KLin-K-DMA, DLin-K-XTC2-DMA, HGT4003, and combinations thereof.

[0177] As used herein, the phrase "biodegradable lipid" or "degradable lipid" refers to any of several lipid species that are degraded in the host environment within minutes, hours, or days, ideally making them less toxic and less likely to accumulate in the host over time. Common modifications to lipids include, among others, ester and disulfide bonds to enhance the biodegradability of lipids.

[0178] As used herein, the phrase "biodegradable PEG lipid" or "degradable PEG lipid" refers to any of several lipid species in which the PEG molecule is cleaved from the lipid in a host environment within minutes, hours, or days, ideally reducing their immunogenicity. Common modifications to PEG lipids include, among others, ester and disulfide bonds to enhance the lipid's biodegradability.

[0179] In certain embodiments of the present invention, delivery vehicles (e.g., lipid nanoparticles) are prepared to encapsulate one or more materials or therapeutic agents (e.g., circRNA). The process of incorporating a desired therapeutic agent (e.g., circRNA) into a delivery vehicle is referred to herein as "loading" or "encapsulation" (Lasic, et al., FEBS Lett., 312: 255-258, 1992). The substance (e.g., circRNA) loaded or encapsulated in the delivery vehicle may be located entirely or partially within the internal space of the delivery vehicle, within the bilayer membrane of the delivery vehicle, or associated with the outer surface of the delivery vehicle.

[0180] As used herein, the term "structured lipids" also refers to sterols and lipids that contain sterol moieties.

[0181] As defined herein, "sterols" are a subgroup of steroids consisting of steroid alcohols.

[0182] As used herein, the term "PEG" means any polyethylene glycol or other polyalkylene ether polymer.

[0183] As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-PEGylated lipid") is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid.

[0184] As used herein, a "phospholipid" is a lipid that includes a phosphate moiety and one or more carbon chains, such as unsaturated fatty acid chains.

[0185] All nucleotide sequences disclosed herein can represent RNA sequences or corresponding DNA sequences. It is understood that deoxythymidine (dT or T) in DNA is transcribed into uridine (U) in RNA. Thus, "T" and "U" are used interchangeably in nucleotide sequences herein.

[0186] As used herein, " sequence identity " or statements including, for example, "the sequence that is 50% identical to " refer to the degree to which sequences are identical nucleotide by nucleotide or amino acid by amino acid across a comparison window.Therefore, " sequence identity percentage " can be calculated by comparing two optimally aligned sequences across a comparison window, determining the number of positions where the same nucleic acid base (for example, A, T, C, G, I) or the same amino acid residue (for example, Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys and Met) exists in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions within the comparison window (i.e., window size), and multiplying the result by 100 to obtain the percentage of sequence identity. Included are nucleotides and polypeptides that have at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of the reference sequences described herein, and typically wherein the polypeptide variant maintains at least one biological activity of the reference polypeptide.

[0187] The expression sequences in the polynucleotide construct may be separated by a "cleavage site" sequence, which allows the polypeptides encoded by the expression sequences to be separately expressed by the cell after translation.

[0188] A "self-cleaving peptide" refers to a peptide that is translated without a peptide bond between two adjacent amino acids, or a peptide that functions such that when a protein and a polypeptide comprising the self-cleaving peptide are produced, they are immediately cleaved or separated into distinct and separate first and second polypeptides without the need for any external cleavage activity.

[0189] The α and β chains of the αβ TCR are generally considered to have two domains or regions each: a variable domain / region and a constant domain / region. The variable domain consists of the connection of the variable region and the linking region. Thus, in this specification and claims, the term "TCR alpha variable domain" refers to the connection of the TRAV region and the TRAJ region, and the term TCR alpha constant domain refers to the extracellular TRAC region or a C-terminal truncated TRAC sequence. Similarly, the term "TCR beta variable domain" refers to the connection of the TRBV region and the TRBD / TRBJ region, and the term TCR beta constant domain refers to the extracellular TRBC region or a C-terminal truncated TRBC sequence.

[0190] As used herein, "autoimmunity" is defined as a persistent and progressive immune response to non-infectious self-antigens, distinct from infectious non-self-antigens derived from bacteria, viruses, fungi, or parasites that invade and persist in mammals and humans. Autoimmune conditions include scleroderma, Graves' disease, Crohn's disease, Sjögren's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrine syndrome, type I diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uveitis, polymyositis, colitis, and thyroiditis, as well as systemic autoimmune diseases typified by human lupus. As used herein, "autoantigen" or "self-antigen" refers to an antigen or epitope that is native to a mammal and immunogenic in that mammal.

[0191] As used herein, the term "cationic lipid" or "ionizable lipid" refers to any of several lipid species that have a net positive charge at a selected pH, such as physiological pH.

[0192] The term "antibody" (Ab) includes, but is not limited to, a glycoprotein immunoglobulin that specifically binds to an antigen. Generally, an antibody may comprise at least two heavy (H) chains and two light (L) chains, or antigen-binding molecules thereof, interconnected by disulfide bonds. Each H chain may comprise a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region. The heavy chain constant region may comprise three constant domains: CH1, CH2, and CH3. Each light chain may comprise a light chain variable region (abbreviated herein as VL) and a light chain constant region. The light chain constant region may comprise one constant domain, CL. The VH and VL regions may be further subdivided into hypervariable regions, called complementarity-determining regions (CDRs), interspersed with more conserved regions, called framework regions (FRs). Each VH and VL may contain three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant regions of the Abs may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component of the classical complement system. Antibodies can include, for example, monoclonal antibodies, recombinantly produced antibodies, monospecific antibodies, multispecific antibodies (including bispecific antibodies), human antibodies, engineered antibodies, humanized antibodies, chimeric antibodies, immunoglobulins, synthetic antibodies, tetrameric antibodies comprising two heavy chain and two light chain molecules, antibody light chain monomers, antibody heavy chain monomers, antibody light chain dimers, antibody heavy chain dimers, antibody light chain-antibody heavy chain pairs, intrabodies, antibody fusions (sometimes referred to herein as "antibody conjugates"), heteroconjugate antibodies, single domain antibodies, monovalent antibodies, single chain antibodies or single chain variable fragments (scFv), camelized antibodies, affibodies, Fab fragments, F(ab')2 fragments, disulfide-linked variable fragments (sdFv), anti-idiotypic (anti-id) antibodies (including, for example, anti-anti-Id antibodies), minibodies, domain antibodies, synthetic antibodies (sometimes referred to herein as "antibody mimetics"), and antigen-binding fragments of any of the above.In some aspects, the antibodies described herein refer to polyclonal antibody populations.

[0193] Immunoglobulins can be derived from any of the commonly known isotypes, including, but not limited to, IgA, secretory IgA, IgG, and IgM. IgG subclasses are also well known to those skilled in the art and include, but are not limited to, human IgG1, IgG2, IgG3, and IgG4. "Isotype" refers to the Ab class or subclass (e.g., IgM or IgG1) encoded by the heavy chain constant region gene. The term "antibody" includes, by way of example, both natural and non-natural Abs; monoclonal and polyclonal Abs; chimeric and humanized Abs; human or non-human Abs; fully synthetic Abs; and single-chain Abs. Non-human Abs can be humanized by recombinant methods to reduce their immunogenicity in humans. Unless explicitly stated and the context indicates otherwise, the term "antibody" also includes antigen-binding fragments or portions of any of the aforementioned immunoglobulins, including monovalent and bivalent fragments or portions, as well as single-chain Abs.

[0194] An "antigen-binding molecule," "antigen-binding portion," or "antibody fragment" refers to any molecule comprising an antigen-binding portion (e.g., CDR) of the antibody from which the molecule is derived. An antigen-binding molecule may comprise an antigen complementarity-determining region (CDR). Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, dAbs, linear antibodies, scFv antibodies, and multispecific antibodies formed from antigen-binding molecules. Peptibodies (i.e., Fc fusion molecules comprising a peptide-binding domain) are another example of a suitable antigen-binding molecule. In some embodiments, the antigen-binding molecule binds to an antigen on a tumor cell. In some embodiments, the antigen-binding molecule binds to an antigen on a cell involved in a hyperproliferative disease or a viral or bacterial antigen. In some embodiments, the antigen-binding molecule binds to BCMA. In further embodiments, the antigen-binding molecule is an antibody fragment comprising one or more of its complementarity-determining regions (CDRs) that specifically bind to an antigen. In further embodiments, the antigen-binding molecule is a single-chain variable fragment (scFv). In some embodiments, the antigen-binding molecule comprises or consists of an avimer.

[0195] As used herein, the terms "variable region" and "variable domain" are used interchangeably and are common in the art. A variable region typically refers to a portion of an antibody, generally a light or heavy chain, typically approximately 110-120 amino acids at the amino terminus of a mature heavy chain and approximately 90-115 amino acids within the mature light chain, which vary significantly in sequence among antibodies and are responsible for the binding and specificity of a particular antibody to its particular antigen. Sequence variability is concentrated in regions called complementarity-determining regions (CDRs), while more highly conserved regions within the variable domain are called framework regions (FRs). While not wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with its antigen. In some embodiments, the variable region is a human variable region. In some embodiments, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In certain embodiments, the variable region is a primate (e.g., non-human primate) variable region. In some embodiments, the variable region comprises rodent or murine CDRs and primate (eg, non-human primate) framework regions (FR).

[0196] The terms "VL" and "VL domain" are used interchangeably to refer to the light chain variable region of an antibody or antigen-binding molecule thereof.

[0197] The terms "VH" and "VH domain" are used interchangeably to refer to the heavy chain variable region of an antibody or antigen-binding molecule thereof.

[0198] Several definitions of CDRs are commonly used: Kabat numbering, Chothia numbering, AbM numbering, or contact numbering. The AbM definition is a compromise between the two, used by Oxford Molecular's AbM antibody modeling software. The contact definition is based on the analysis of available complex crystal structures. The term "Kabat numbering" and similar terms are recognized in the art and refer to a system for numbering the amino acid residues of the heavy and light chain variable regions of an antibody or its antigen-binding molecule. In certain aspects, the CDRs of an antibody can be determined according to the Kabat numbering system (see, for example, Kabat EA & Wu TT (1971) Ann NY Acad Sci 190: 382-391 and Kabat EA et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, US Department of Health and Human Services, NIH Publication No. 91-3242). Using the Kabat numbering system, the CDRs in an antibody heavy chain molecule are typically located at amino acid positions 31-35 (CDR1), 50-65 (CDR2), and 95-102 (CDR3), which may optionally include one or two additional amino acids after 35 (designated 35A and 35B in the Kabat numbering scheme). Using the Kabat numbering system, the CDRs in an antibody light chain molecule are typically located at amino acid positions 24-34 (CDR1), 50-56 (CDR2), and 89-97 (CDR3). In specific embodiments, the CDRs of the antibodies described herein are determined according to the Kabat numbering scheme.In certain aspects, the CDRs of an antibody may be determined according to the Chothia numbering scheme, which refers to the position of the immunoglobulin structural loops (see, e.g., Chothia C & Lesk AM, (1987), J Mol Biol 196: 901-917; Al-Lazikani B et al, (1997) J Mol Biol 273: 927-948; Chothia C et al., (1992) J Mol Biol 227: 799-817; Tramontano A et al, (1990) J Mol Biol 215(1): 175-82; and U.S. Patent No. 7,709,226). Typically, using the Kabat numbering convention, the Chothia CDR-H1 loop is located at amino acids 26-32, 33, or 34 in the heavy chain, the Chothia CDR-H2 loop is located at amino acids 52-56 in the heavy chain, and the Chothia CDR-H3 loop is located at amino acids 95-102 in the heavy chain, whereas the Chothia CDR-L1 loop is located at amino acids 24-34 in the light chain, the Chothia CDR-L2 loop is located at amino acids 50-56 in the light chain, and the Chothia CDR-L3 loop is located at amino acids 89-97 in the light chain. The end of the Chothia CDR-HI loop, when numbered using the Kabat numbering convention, varies between H32 and H34 depending on the length of the loop (this is because the Kabat numbering scheme places insertions at H35A and H35B; if neither 35A nor 35B are present, the loop ends at 32; if only 35A is present, the loop ends at 33; and if both 35A and 35B are present, the loop ends at 34). In specific embodiments, the CDRs of the antibodies described herein have been determined according to the Chothia numbering scheme.

[0199] As used herein, the terms "constant region" and "constant domain" are interchangeable and have the general meaning in the art. The constant region is the antibody portion, such as the carboxyl terminal portion of the light chain and / or heavy chain, that is not directly involved in binding the antibody to the antigen but can exhibit various effector functions, such as interacting with Fc receptors. The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence than the immunoglobulin variable domain.

[0200] "Binding affinity" generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen). Unless otherwise indicated, as used herein, "binding affinity" refers to the intrinsic binding affinity that reflects a 1:1 interaction between members of a binding pair (e.g., an antibody and an antigen). The affinity of a molecule X for its partner Y can generally be represented by a dissociation constant (KD or Kd). Affinity can be measured and / or expressed in several ways known in the art, including, but not limited to, the equilibrium dissociation constant (KD) and the equilibrium association constant (KA or Ka). KD is calculated from the quotient koff / koff, while Ka is calculated from the quotient koff / koff. koff refers to the association rate constant of, for example, an antibody to an antigen, and koff refers to the dissociation rate of, for example, an antibody to an antigen. koff and koff can be determined by techniques known to those skilled in the art, such as BIACORE® or KinExA.

[0201] As used herein, a "conservative amino acid substitution" refers to an amino acid residue replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). In some embodiments, one or more amino acid residues within the CDRs or framework regions of an antibody or antigen-binding molecule thereof may be replaced with amino acid residues having a similar side chain.

[0202] As used herein, the term "heterologous" means from any source other than the native sequence.

[0203] As used herein, "epitope" is a term used in the art and refers to a localized region of an antigen to which an antibody can specifically bind. An epitope can be, for example, consecutive amino acids of a polypeptide (linear or consecutive epitope), or an epitope can be, for example, composed of two or more non-contiguous regions of one or more polypeptides (conformational epitope, non-linear epitope, discontinuous epitope, or discontinuous epitope). In some embodiments, the epitope to which an antibody binds can be determined by, for example, NMR spectroscopy, X-ray diffraction crystallography, ELISA assay, hydrogen / deuterium exchange mass spectrometry (e.g., liquid chromatography electrospray mass spectrometry), array-based oligopeptide scanning assay, and / or mutagenesis mapping (e.g., site-directed mutagenesis mapping). In the case of X-ray crystallography, crystallization can be achieved using any of the methods known in the art (e.g., Giege R et al., (1994) Acta Crystallogr D Biol Crystallogr 50(Pt 4): 339-350; McPherson A (1990) Eur J Biochem 189: 1-23; Chayen NE (1997) Structure 5: 1269-1274; McPherson A (1976) J Biol Chem 251: 6300-6303).Antibody:antigen crystals may be studied using well-known X-ray diffraction techniques and refined using computer software such as X-PLOR (Yale University, 1992, distributed by Molecular Simulations, Inc.; e.g., Meth Enzymol (1985) volumes 114 & 115, eds. Wyckoff HW et al.; U.S. Patent Application Publication No. 2004 / 0014194), and BUSTER (see Bricogne G (1993) Acta Crystallogr D Biol Crystallogr 49(Pt 1): 37-60; Bricogne G (1997) Meth Enzymol 276A: 361-423, ed. Carter CW; Roversi P et al., (2000) Acta Crystallogr D Biol Crystallogr 56(Pt 10): 1316-1323).

[0204] As used herein, an antigen-binding molecule, antibody, or antigen-binding molecule thereof "cross-competes" with a reference antibody or its antigen-binding molecule if the interaction between the antigen and the first binding molecule, antibody, or its antigen-binding molecule blocks, restricts, inhibits, or otherwise reduces the ability of the reference binding molecule, reference antibody, or its antigen-binding molecule to interact with the antigen. Cross-competition can be complete, e.g., binding of the binding molecule to the antigen completely blocks the ability of the reference binding molecule to bind to the antigen, or it can be partial, e.g., binding of the binding molecule to the antigen reduces the ability of the reference binding molecule to bind to the antigen. In some embodiments, an antigen-binding molecule that cross-competes with a reference antigen-binding molecule binds to the same epitope as the reference antigen-binding molecule or an overlapping epitope. In other embodiments, an antigen-binding molecule that cross-competes with a reference antigen-binding molecule binds to a different epitope than the reference antigen-binding molecule. To determine whether one antigen-binding molecule competes with another antigen-binding molecule, numerous types of competitive binding assays are available; for example, solid-phase direct or indirect radioimmunoassays (RIA); solid-phase direct or indirect enzyme immunoassays (EIA); sandwich competition assays (Stahli et al., 1983, Methods in Enzymology 9:242-253); solid-phase direct biotin-avidin EIA (Kirkland et al., 1986, J. Immunol. 137:3614-3619); solid-phase direct label assays, solid-phase direct label sandwich assays (Harlow and Lane, 1988, Antibodies, A Laboratory Manual, Cold Spring Harbor Press); solid-phase direct label RIA using 1-125 label (Morel et al., 1988, Molec. Immunol. 25:7-15); solid-phase direct biotin-avidin EIA (Cheung, et al., 1990, Virology 176:546-552); and direct label RIA (Moldenhauer et al., 1990, Scand. J. Immunol. 32:77-82) can be used.

[0205] As used herein, the terms "immunospecifically bind," "immunospecifically recognize," "specifically bind," and "specifically recognize" are similar terms in the context of antibodies and refer to a molecule that binds to an antigen (e.g., an epitope or immune complex), as understood by those of skill in the art. For example, a molecule that specifically binds to an antigen may generally bind with lower affinity to other peptides or polypeptides, as determined by, for example, immunoassays, a BIACORE®, a KinExA 3000 instrument (Sapidyne Instruments, Boise, ID), or other assays known in the art. In specific embodiments, a molecule that specifically binds to an antigen binds to the antigen with a K A that is at least 2 logs, 2.5 logs, 3 logs, 4 logs, or more greater than the K A for binding to another antigen.

[0206] "Antigen" refers to any molecule that can elicit an immune response or be bound by an antibody or antigen-binding molecule. The immune response can include antibody production, activation of specific immunologically competent cells, or both. Those skilled in the art will readily understand that any macromolecule, including virtually any protein or peptide, can function as an antigen. Antigens can be endogenously expressed, i.e., expressed by genomic DNA, or recombinantly expressed. Antigens can be specific to a particular tissue, such as cancer cells, or can be widely expressed. Furthermore, fragments of larger molecules can act as antigens. In some embodiments, the antigen is a tumor antigen.

[0207] The term "autologous" refers to any material derived from the same individual that is later reintroduced. For example, the engineered autologous cell therapy (eACT™) method described herein involves the collection of lymphocytes from a patient, which are then engineered to express, for example, a CAR construct, and subsequently administered back into the same patient.

[0208] The term "allogeneic" refers to any material derived from one individual and then introduced into another individual of the same species, for example, allogeneic T cell transplantation.

[0209] "Cancer" refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth result in the formation of malignant tumors that can invade adjacent tissues and metastasize to distant parts of the body via the lymphatic system or bloodstream. "Cancer" or "cancerous tissue" can include tumors. Examples of cancers that can be treated by the methods disclosed herein include, but are not limited to, cancers of the immune system, including lymphoma, leukemia, myeloma, and other white blood cell malignancies. In some embodiments, the methods disclosed herein are useful for treating cancers of, for example, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal cancer, gastric cancer, testicular cancer, uterine cancer, multiple myeloma, Hodgkin's disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B-cell lymphoma (PMBC), diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), esophageal cancer, small intestine cancer, endocrine system cancer, thyroid cancer, parathyroid cancer, adrenal cancer, urethral cancer, penile cancer, chronic myeloma, thyroid cancer ... The compositions may be used to reduce tumor size in tumors resulting from myeloid or acute leukemia, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non-T-cell ALL), chronic lymphocytic leukemia (CLL), childhood solid tumors, lymphocytic lymphoma, bladder cancer, kidney or ureter cancer, central nervous system (CNS) neoplasms, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers including cancer induced by asbestos, other B-cell malignancies, and combinations of the foregoing cancers.In some aspects, the methods disclosed herein are useful for treating tumors of, for example, sarcomas and carcinomas, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, Kaposi's sarcoma, soft tissue sarcoma, and other sarcomas, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, hepatocellular carcinoma, lung cancer, colorectal cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma (e.g., of the pancreas, colon, ovary, lung, breast, stomach, prostate, cervix, or esophagus), sweat gland carcinoma, It can be used to reduce the size of tumors derived from sebaceous carcinoma, papillary carcinoma, papillary adenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatocellular carcinoma, bile duct carcinoma, choriocarcinoma, Wilms' tumor, cervical cancer, testicular tumor, bladder cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal pelvis cancer, CNS tumors (e.g., glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, meningioma, melanoma, neuroblastoma, and retinoblastoma). Certain cancers may be responsive to chemotherapy or radiation therapy, or the cancer may be refractory. Refractory cancer refers to cancer that is not amenable to surgical intervention, the cancer is initially refractory to chemotherapy or radiation therapy, or the cancer becomes refractory over time.

[0210] As used herein, " anti-tumor effect " refers to the biological effect that can be manifested as a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in tumor cell proliferation, a reduction in the number of metastases, an increase in overall survival or progression-free survival, an increase in life expectancy, or an improvement in various physiological symptoms associated with tumors.Anti-tumor effect can also refer to the prevention of tumor development, for example, vaccination.

[0211] As used herein, "cytokine" refers to a non-antibody protein released by one cell in response to contact with a specific antigen; the cytokine interacts with a second cell to mediate a response in the second cell. As used herein, "cytokine" is meant to refer to a protein released by one cell population that acts on another cell as an intercellular mediator. Cytokines can be endogenously expressed by cells or administered to a subject. Cytokines can be released by immune cells, including macrophages, B cells, T cells, neutrophils, dendritic cells, eosinophils, and mast cells, to propagate an immune response. Cytokines can induce various responses in recipient cells. Cytokines can include homeostatic cytokines, chemokines, pro-inflammatory cytokines, effector and acute-phase proteins. For example, homeostatic cytokines, including interleukin (IL) 7 and IL-15, can promote immune cell survival and proliferation, while pro-inflammatory cytokines can promote an inflammatory response. Examples of homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN) gamma. Examples of pro-inflammatory cytokines include, but are not limited to, IL-1a, IL-1b, IL-6, IL-13, IL-17a, IL-23, IL-27, tumor necrosis factor (TNF)-alpha, TNF-beta, fibroblast growth factor (FGF)2, granulocyte-macrophage colony-stimulating factor (GM-CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF). Examples of effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), TGF-beta, IL-35, and perforin. Examples of acute phase proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA).

[0212] The term "lymphocyte" as used herein includes natural killer (NK) cells, T cells, or B cells. NK cells are a type of cytotoxic (cytotoxic) lymphocyte that represents a major component of the innate immune system. NK cells reject tumor- and virus-infected cells. They act through the process of apoptosis, or programmed cell death. They are named "natural killers" because they do not require activation to kill cells. T cells play a major role in cell-mediated immunity (antibody-independent). T cell receptors (TCRs) distinguish T cells from other lymphocyte types. The thymus, a specialized organ of the immune system, is the primary site for T cell maturation. Helper T cells (e.g., CD4+ cells), cytotoxic T cells (TCs, cytotoxic T lymphocytes, CTLs, T-killer cells, cytolytic T cells, CD8+ These include: memory T cells (also known as T cells or killer T cells), memory T cells ((i) stem memory cells (TSCM), which, like naive cells, are CD45RO-, CCR7+, CD45RA+, CD62L+ (L-selectin), CD27+, CD28+, and IL-7Ra+, but also express large amounts of CD95, IL-2R, CXCR3, and LFA-1, exhibiting many functional properties unique to memory cells; (ii) central memory cells (TCM), which express L-selectin and CCR7 and secrete IL-2 but not IFNγ or IL-4; and (iii) effector memory cells (TEM), which do not express L-selectin or CCR7 but produce effector cytokines such as IFNγ and IL-4), regulatory T cells (Treg, suppressor T cells, or CD4+ CD25+ or CD4+ There are many types of T cells, including FoxP3+ regulatory T cells, natural killer T cells (NKT), and gamma delta T cells. B cells, on the other hand, play a major role in humoral immunity (antibody-mediated immunity). B cells can manufacture antibodies, act as antigen-presenting cells (APCs), and, after activation by antigen interaction, become both short-lived and long-lived memory B cells and plasma cells. In mammals, immature B cells are formed in the bone marrow.

[0213] The term "genetically engineered" or "engineered" refers to methods of modifying the genome of a cell, including, but not limited to, deleting a coding or non-coding region or portion thereof, or inserting a coding region or portion thereof. In some embodiments, the modified cell is a lymphocyte, e.g., a T cell, which may be obtained from either a patient or a donor. The cell may be modified to express an exogenous construct, e.g., a chimeric antigen receptor (CAR) or a T cell receptor (TCR), that is integrated into the genome of the cell.

[0214] An "immune response" refers to the action of cells of the immune system (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, and neutrophils) and soluble macromolecules (including Abs, cytokines, and complement) produced by any of these cells or the liver, resulting in the selective targeting, binding, damaging, destroying, and / or elimination from the vertebrate body of invading pathogens, pathogen-infected cells or tissues, cancerous or other abnormal cells, or, in the case of autoimmunity or pathological inflammation, normal human cells or tissues.

[0215] As used herein, a "costimulatory signal" refers to a signal that, in combination with a primary signal, such as TCR / CD3 ligation, results in a T cell response, including, but not limited to, proliferation and / or up-regulation or down-regulation of key molecules.

[0216] As used herein, a "costimulatory ligand" includes a molecule on an antigen-presenting cell that specifically binds to a cognate costimulatory molecule on a T cell. Binding of the costimulatory ligand provides a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, etc. Costimulatory ligands induce signals in addition to the primary signal provided by the stimulatory molecule, for example, by binding of the T cell receptor (TCR) / CD3 complex with a peptide-loaded major histocompatibility complex (MHC) molecule. Costimulatory ligands may include, but are not limited to, 3 / TR6, 4-IBB ligand, agonists or antibodies that bind to Toll-like receptors, B7-1 (CD80), B7-2 (CD86), CD30 ligand, CD40, CD7, CD70, CD83, herpesvirus entry mediator (HVEM), human leukocyte antigen G (HLA-G), ILT4, immunoglobulin-like transcript (ILT)3, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), a ligand that specifically binds to B7-H3, lymphotoxin beta receptor, MHC class I chain-related protein A (MICA), MHC class I chain-related protein B (MICB), OX40 ligand, PD-L2, or programmed death (PD)LI. Costimulatory ligands include, but are not limited to, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, 4-1BB, B7-H3, CD2, CD27, CD28, CD30, CD40, CD7, ICOS, a ligand that specifically binds to CD83, lymphocyte function-associated antigen-1 (LFA-1), natural killer cell receptor C (NKG2C), OX40, PD-1, or tumor necrosis factor superfamily member 14 (TNFSF14 or LIGHT).

[0217] A "costimulatory molecule" is a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation.Costimulatory molecules include 4-1BB / CD137, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD33, CD45, CD100 (SEMA4D), CD103, CD134, CD137, CD154, CD16, CD160 (BY55), CD18, CD19, CD19a, CD2, CD22, CD247, CD27, CD276 (B7-H3), CD28, CD29, and CD3 (alpha ; beta; delta; epsilon; gamma; zeta), CD30, CD37, CD4, CD4, CD40, CD49a, CD49D, CD49f, CD5, CD64, CD69, CD7, CD80, CD83 ligand, CD84, CD86, CD8 alpha, CD8 beta, CD9, CD96 (Tactile), CD1-1a, CD1-1b, CD1-1c, CD1-1d, CDS, CEACAM1, CRT AM, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, ICAM-1, ICOS, Ig alpha (CD79a), IL2R beta, IL2R gamma, IL7R alpha, integrin, ITGA4, ITGA4, ITGA6, IT GAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT (tumor necrosis factor superfamily member 14; TNFSF14), LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1(CD1 la / CD18), MHC class I molecules, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX40, PAG / Cbp, PD-1, PSGL1, SELPLG (CD162), signaling lymphocyte activation molecule, SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF, TNFr, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1, or VLA-6, or fragments, truncations, or combinations thereof.

[0218] As used herein, "vaccine" refers to a composition for generating immunity for the prevention and / or treatment of disease. Thus, a vaccine is a pharmaceutical containing an antigen, intended for use in humans or animals to generate specific protective and prophylactic substances when administered to humans or animals.

[0219] As used herein, "neoantigen" refers to a class of tumor antigens that arise from tumor-specific mutations of expressed proteins.

[0220] As used herein, a "fusion protein" is a protein having at least two domains encoded by separate genes, which genes are linked for transcription of a single peptide.

[0221] 2. DNA template, precursor RNA, and circular RNA According to the present invention, transcription of a DNA template provided herein (e.g., comprising a 3'-enhanced intron element, a 3'-enhanced exon element, a core functional element, a 5'-enhanced exon element, and a 5'-enhanced intron element) results in the formation of a precursor linear RNA polynucleotide that can be circularized. In some embodiments, the DNA template comprises a vector, a PCR product, a plasmid, a minicircle DNA, a cosmid, an artificial chromosome, a complementary DNA (cDNA), an extrachromosomal DNA (ecDNA), or a fragment thereof. In certain embodiments, the minicircle DNA may be linearized or non-linearized. In certain embodiments, the plasmid may be linearized or non-linearized. In some embodiments, the DNA template may be single-stranded. In other embodiments, the DNA template may be double-stranded. In some embodiments, the DNA template comprises, in whole or in part, a viral, bacterial, or eukaryotic vector.

[0222] The present invention, as provided herein, includes DNA templates that share the same sequence (e.g., 3'-enhanced intron elements, 3'-enhanced exon elements, core functional elements and 5'-enhanced exon elements, 5'-enhanced intron elements) as a precursor linear RNA polynucleotide prior to splicing of the precursor linear RNA polynucleotide. In some embodiments, the linear precursor RNA polynucleotide undergoes splicing, resulting in the removal of the 3'-enhanced intron elements and 5'-enhanced intron elements during the circularization process. In some embodiments, the resulting circular RNA polynucleotide lacks the 3'-enhanced intron fragment and the 5'-enhanced intron fragment, but maintains the 3'-enhanced exon fragment, core functional elements and 5'-enhanced exon elements.

[0223] In some embodiments, the precursor linear RNA polynucleotide comprises one or more guanosine nucleotides or nucleosides (e.g., GTP) and divalent cations (e.g., Mg 2+ In some embodiments, the 3'-enhanced exon elements, 5'-enhanced exon elements, and / or core functional elements, in whole or in part, promote circularization of a precursor linear RNA polynucleotide to form a circular RNA polynucleotide provided herein.

[0224] In certain embodiments, the circular RNAs provided herein are produced intracellularly. In some embodiments, precursor RNAs are transcribed in the cytoplasm by bacteriophage RNA polymerase using a DNA template (e.g., in some embodiments, using a vector provided herein) or in the nucleus by host RNA polymerase II, and then circularized.

[0225] In certain embodiments, the circular RNAs provided herein are injected into an animal (e.g., a human), thereby expressing the polypeptide encoded by the circular RNA molecule inside the animal.

[0226] In some embodiments, the DNA (e.g., vectors), linear RNA (e.g., precursor RNA), and / or circular RNA polynucleotides provided herein are 300 to 10,000, 400 to 9,000, 500 to 8,000, 600 to 7,000, 700 to 6,000, 800 to 5,000, 900 to 5,000, 1,000 to 5,000, 1,100 to 5,000, 1,200 to 5,000, 1,300 to 5,000, 1,400 to 5,000, and / or 1,500 to 5,000 nucleotides in length. In some embodiments, a polynucleotide is at least 300nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, 1100nt, 1200nt, 1300nt, 1400nt, 1500nt, 2000nt, 2500nt, 3000nt, 3500nt, 4000nt, 4500nt, or 5000nt in length. In some embodiments, a polynucleotide is no more than 3000nt, 3500nt, 4000nt, 4500nt, 5000nt, 6000nt, 7000nt, 8000nt, 9000nt, or 10000nt in length. In some embodiments, the length of the DNA, linear RNA, and / or circular RNA polynucleotides provided herein is about 300nt, 400nt, 500nt, 600nt, 700nt, 800nt, 900nt, 1000nt, 1100nt, 1200nt, 1300nt, 1400nt, 1500nt, 2000nt, 2500nt, 3000nt, 3500nt, 4000nt, 4500nt, 5000nt, 6000nt, 7000nt, 8000nt, 9000nt, or 10000nt.

[0227] In some embodiments, the circular RNAs provided herein have greater functional stability than mRNAs containing the same expressed sequence, hi some embodiments, the circular RNAs provided herein have greater functional stability than mRNAs containing the same expressed sequence, 5moU modifications, optimized UTRs, caps, and / or polyA tails.

[0228] In some embodiments, the circular RNA polynucleotides provided herein have a functional half-life of at least 5, 10, 15, 20, 30, 40, 50, 60, 70, or 80 hours. In some embodiments, the circular RNA polynucleotides provided herein have a functional half-life of 5 to 80, 10 to 70, 15 to 60, and / or 20 to 50 hours. In some embodiments, the circular RNA polynucleotides provided herein have a longer (e.g., at least 1.5-fold longer, at least 2-fold longer) functional half-life than an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, the functional half-life can be assessed by detecting functional protein synthesis.

[0229] In some embodiments, the circular RNA polynucleotides provided herein have a half-life of at least 5, 10, 15, 20, 30, 40, 50, 60, 70, or 80 hours. In some embodiments, the circular RNA polynucleotides provided herein have a half-life of 5 to 80, 10 to 70, 15 to 60, and / or 20 to 50 hours. In some embodiments, the circular RNA polynucleotides provided herein have a longer half-life (e.g., at least 1.5-fold longer, at least 2-fold longer) than an equivalent linear RNA polynucleotide encoding the same protein. In some embodiments, the circular RNA polynucleotide or pharmaceutical composition thereof has a functional half-life in human cells that is equal to or greater than a predetermined threshold value. In some embodiments, the functional half-life is determined by a functional protein assay. For example, in some embodiments, the functional half-life is determined by an in vitro luciferase assay, wherein the activity of Gaussia luciferase (GLuc) is measured every 1, 2, 6, 12, or 24 hours in the culture medium of human cells (e.g., HepG2) expressing the circular RNA polynucleotide for 1, 2, 3, 4, 5, 6, 7, or 14 days. In other embodiments, the functional half-life is determined by an in vivo assay, wherein the level of the protein encoded by the expressed sequence of the circular RNA polynucleotide is measured in patient serum or tissue samples every 1, 2, 6, 12, or 24 hours for 1, 2, 3, 4, 5, 6, 7, or 14 days. In some embodiments, the predetermined threshold is the functional half-life of a reference linear RNA polynucleotide comprising the same expressed sequence as the circular RNA polynucleotide.

[0230] In some embodiments, the circular RNAs provided herein can have a higher magnitude of expression than comparable linear mRNAs, for example, 24 hours after administration of the RNA to cells. In some embodiments, the circular RNAs provided herein have a higher magnitude of expression than mRNAs containing the same expression sequence, 5moU modifications, optimized UTRs, caps, and / or polyA tails.

[0231] In some embodiments, the circular RNAs provided herein may be less immunogenic than comparable mRNAs when exposed to an organism's immune system or certain types of immune cells. In some embodiments, the circular RNAs provided herein are associated with regulating cytokine production when exposed to an organism's immune system or certain types of immune cells. For example, in some embodiments, the circular RNAs provided herein are associated with reduced production of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα when exposed to an organism's immune system or certain types of immune cells, compared to mRNAs containing the same expression sequences. In some embodiments, the circular RNAs provided herein are associated with reduced transcription induction of IFN-β1, RIG-I, IL-2, IL-6, IFNγ, and / or TNFα when exposed to an organism's immune system or certain types of immune cells, compared to mRNAs containing the same expression sequences. In some embodiments, the circular RNAs provided herein are less immunogenic than mRNAs containing the same expression sequences. In some embodiments, the circular RNAs provided herein are less immunogenic than mRNAs containing the same expression sequence, 5moU modifications, optimized UTRs, caps, and / or polyA tails.

[0232] In certain embodiments, the circular RNA provided herein can be directly transfected into cells, or can be transfected in the form of a DNA vector and transcribed in cells.The transcription of the circular RNA from the transfected DNA vector can be mediated by added polymerase or the polymerase encoded by the nucleic acid transfected in cells, or preferably by endogenous polymerase.

[0233] A. Enriched intronic and exonic elements As presented in the present invention, enhanced intron and exon elements can include spacers, duplex regions, affinity sequences, intron fragments, exon fragments, and various untranslated elements, which sequences within the enhanced intron or exon elements are positioned to optimize circularization or protein expression.

[0234] In certain embodiments, the DNA templates, precursor linear RNA polynucleotides, and circular RNAs provided herein comprise a first (5') and / or second (3') spacer. In some embodiments, the DNA templates or precursor linear RNA polynucleotides comprise one or more spacers in the enhanced intron elements. In some embodiments, the DNA templates or precursor linear RNA polynucleotides comprise one or more spacers in the enhanced exon elements. In certain embodiments, the DNA templates or linear RNA polynucleotides comprise a spacer in the 3'-enhanced intron fragment and a spacer in the 5'-enhanced intron fragment. In certain embodiments, the DNA templates, precursor linear RNA polynucleotides, or circular RNAs comprise a spacer in the 3'-enhanced exon fragment and another spacer in the 5'-enhanced exon fragment, which aids in circularization or protein expression due to the symmetry created across the sequence.

[0235] In some embodiments, including a spacer between the 3' Group I intron fragment and the core functional element may preserve the secondary structure of those regions by preventing them from interacting, thus increasing splicing efficiency. In some embodiments, the first spacer (between the 3' Group I intron fragment and the core functional element) and the second spacer (between the two expression sequences and the core functional element) contain additional base-pairing regions that are predicted to base pair to each other, but not to the first and second duplex regions. In other embodiments, the first spacer (between the 3' Group I intron fragment and the core functional element) and the second spacer (between one of the core functional elements and the 5' Group I intron fragment) contain additional base-pairing regions that are predicted to base pair to each other, but not to the first and second duplex regions. In some embodiments, such spacer base-pairing brings the Group I intron fragments into close proximity with each other, further increasing splicing efficiency. Furthermore, in some embodiments, the combination of base pairing between the first and second duplex regions and, separately, base pairing between the first and second spacers promotes the formation of a splicing bubble containing a group I intron fragment flanked by adjacent regions of base pairing. A typical spacer is a contiguous sequence having one or more of the following properties: 1) predicted to avoid interference with proximal structures, such as an IRES, expression sequence, aptamer, or intron; 2) at least 7 nt in length and no more than 100 nt; 3) located adjacent to the 3' intron fragment and / or adjacent to the 5' intron fragment; and 4) comprising one or more of the following: a) an unstructured region at least 5 nt in length, b) a base-paired region at least 5 nt in length to a distal sequence comprising another spacer, and c) a structured region at least 7 nt in length limited in extent by the sequence of the spacer. The spacer may have several regions, including unstructured regions, base-paired regions, hairpin / structured regions, and combinations thereof.In embodiments, the spacer has a structured region with a high GC content. In embodiments, a region within a spacer base-pairs with another region within the same spacer. In embodiments, a region within a spacer base-pairs with a region within another spacer. In embodiments, the spacer comprises one or more hairpin structures. In embodiments, the spacer comprises one or more hairpin structures having a stem of 4 to 12 nucleotides and a loop of 2 to 10 nucleotides. In embodiments, there is an additional spacer between the 3' group I intron fragment and the core functional element. In embodiments, this additional spacer prevents the structured region of the IRES or TIE aptamer from interfering with folding of the 3' group I intron fragment or reduces the extent to which this occurs. In some embodiments, the 5' spacer sequence is at least 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, or 30 nucleotides in length. In some embodiments, the 5' spacer sequence is 100, 90, 80, 70, 60, 50, 45, 40, 35, or 30 nucleotides or less in length. In some embodiments, the 5' spacer sequence is 5-50, 10-50, 20-50, 20-40, and / or 25-35 nucleotides in length. In certain embodiments, the 5' spacer sequence is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In one embodiment, the 5' spacer sequence is a poly(A) sequence. In another embodiment, the 5' spacer sequence is a polyAC sequence. In one embodiment, the spacer comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polyAC content. In one embodiment, the spacer comprises about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% polypyrimidine (C / T or C / U) content.

[0236] In some embodiments, the DNA templates and precursor linear RNA polynucleotides and circular RNA polynucleotides provided herein comprise a first (5') duplex region and a second (3') duplex region. In certain embodiments, the DNA templates and precursor linear RNA polynucleotides comprise a 5' external duplex region located within the 3'-enhanced intron fragment and a 3' external duplex region located within the 5'-enhanced intron fragment. In some embodiments, the DNA templates, precursor linear RNA polynucleotides and circular RNA polynucleotides comprise a 5' internal duplex region located within the 3'-enhanced exon fragment and a 3' internal duplex region located within the 5'-enhanced exon fragment. In some embodiments, the DNA polynucleotides and precursor linear RNA polynucleotides comprise a 5' external duplex region, a 5' internal duplex region, a 3' internal duplex region, and a 3' external duplex region.

[0237] In certain embodiments, the first and second duplex regions may form a perfect or imperfect duplex. Thus, in certain embodiments, at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the first and second duplex regions may be base-paired to each other. In some embodiments, the duplex region is predicted to have less than 50% (e.g., less than 45%, less than 40%, less than 35%, less than 30%, or less than 25%) base-pairing with unintended sequences in the RNA (e.g., non-duplex region sequences). In some embodiments, including such duplex regions at the ends of the precursor RNA strands and adjacent to or very close to the group I intron fragments brings the group I intron fragments into close proximity with each other, enhancing splicing efficiency. In some embodiments, the duplex region is 3 to 100 nucleotides in length (e.g., 3 to 75 nucleotides, 3 to 50 nucleotides, 20 to 50 nucleotides, 35 to 50 nucleotides, 5 to 25 nucleotides, 9 to 19 nucleotides in length). In some embodiments, the duplex region is about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. In some embodiments, the duplex region has a length of about 9 to about 50 nucleotides. In one embodiment, the duplex region has a length of about 9 to about 19 nucleotides. In some embodiments, the duplex region has a length of about 20 to about 40 nucleotides. In a specific embodiment, the duplex region has a length of about 30 nucleotides.

[0238] In other embodiments, the DNA template, precursor linear RNA polynucleotide, or circular RNA polynucleotide does not contain any double-stranded region to optimize translation or circularization.

[0239] As provided herein, a DNA template or a precursor linear RNA polynucleotide may comprise an affinity tag. In some embodiments, the affinity tag is located in the 3'-enhanced intron element. In some embodiments, the affinity tag is located in the 5'-enhanced intron element. In some embodiments, both (3' and 5') enhanced intron elements each comprise an affinity tag. In one embodiment, the affinity tag of the 3'-enhanced intron element is the same length as the affinity tag in the 5'-enhanced intron element. In some embodiments, the affinity tag of the 3'-enhanced intron element is the same sequence as the affinity tag in the 5'-enhanced intron element. In some embodiments, the affinity sequence is positioned to optimize oligo dT purification.

[0240] In some embodiments, one or more affinity tags present in the precursor linear RNA polynucleotide are removed during circularization. See, e.g., Figures 97A and 97B. In some embodiments, affinity tags are added to the remaining linear RNA after RNA circularization. In some such embodiments, affinity tags are enzymatically added to the linear RNA. The presence of one or more affinity tags in the linear RNA and their absence in the circular RNA can facilitate the purification of the circular RNA. In some embodiments, such purification is performed using negative selection or affinity purification methods. In some embodiments, such purification is performed using a binding agent that preferentially or specifically binds to the affinity tag.

[0241] In some embodiments, the affinity tag comprises a polyA region. In some embodiments, the polyA region is at least 15, 30, or 60 nucleotides in length. In some embodiments, the affinity tag comprising a polyA region is present at two positions in the precursor linear RNA. In some embodiments, one or both polyA regions are 15 to 50 nucleotides in length. In some embodiments, one or both polyA regions are 20 to 25 nucleotides in length. The polyA sequence is removed during circularization. Thus, the circular RNA can be separated from its precursor RNA using oligonucleotides that hybridize to the polyA sequence, such as deoxythymidine oligonucleotides (oligo(dT)) conjugated to a solid surface (e.g., a resin).

[0242] In some embodiments, the affinity tag comprises a sequence that is missing from the circular RNA product. In some such embodiments, the sequence that is missing from the circular RNA product is a dedicated binding site (DBS). In some embodiments, the DBS is an unstructured sequence, i.e., a sequence that does not form a defined structural element, such as a hairpin loop, a continuous dsRNA region, or a triple helix. In some embodiments, the DBS sequence forms a random coil. In some embodiments, the DBS comprises at least 25% GC content, at least 50% GC content, at least 75% GC content, or at least 100% GC content. In some embodiments, the DBS comprises at least 25% AC content, at least 50% AC content, at least 75% AC content, or 100% AC content. In some embodiments, the DBS is at least 15, 30, or 60 nucleotides in length. In some embodiments, the affinity tag comprising the DBS is present at two positions in the precursor linear RNA. In some embodiments, the DBS sequences are each independently 15 to 50 nucleotides in length, hi some embodiments, the DBS sequences are each independently 20 to 25 nucleotides in length.

[0243] In some embodiments, the DBS sequence is removed during circularization. Thus, a binder comprising an oligonucleotide comprising a sequence complementary to DBS can be used to facilitate the purification of circular RNA. For example, the binder can comprise an oligonucleotide complementary to DBS conjugated to a solid surface (e.g., a resin).

[0244] In some embodiments, affinity sequences or other types of affinity handles, such as biotin, are added to linear RNA by ligation. In some embodiments, oligonucleotides comprising affinity sequences are ligated to linear RNA. In some embodiments, oligonucleotides conjugated with affinity handles are ligated to linear RNA. In some embodiments, a solution comprising linear RNA ligated with affinity sequences or handles and circular RNA that does not contain affinity sequences or handles is contacted with a binder comprising a solid support conjugated with an oligonucleotide complementary to the affinity sequence or a binding partner of the affinity handle, whereby the linear RNA binds to the binder, and the circular RNA is eluted or separated from the solid support.

[0245] Any of the purification methods for circular RNA described herein may include one or more buffer exchange steps. In some embodiments, buffer exchange occurs after in vitro transcription (IVT) and before additional purification steps. In some such embodiments, the IVT reaction solution is buffer exchanged into a buffer containing Tris. In some embodiments, the IVT reaction solution is buffer exchanged into a buffer containing greater than 1 mM or greater than 10 mM of one or more monovalent salts, such as NaCl or KCl, and optionally EDTA. In some embodiments, buffer exchange occurs after circular RNA purification is complete. In some embodiments, buffer exchange occurs after IVT and after circular RNA purification. In some embodiments, buffer exchange occurs after circular RNA purification, including exchanging the circular RNA into water or a storage buffer. In some embodiments, the storage buffer contains 1 mM sodium citrate, pH 6.5.

[0246] In certain embodiments, the 3'-enhanced intron element comprises a leader untranslated sequence. In some embodiments, the leader untranslated sequence is at the 5' end of the 3'-enhanced intron fragment. In some embodiments, the leader untranslated sequence consists of the final nucleotide of the transcription start site (TSS). In some embodiments, the TSS is selected from a viral, bacterial, or eukaryotic DNA template. In one embodiment, the leader untranslated sequence comprises the final nucleotide of the TSS and 0 to 100 additional nucleotides. In some embodiments, the TSS is a terminal spacer. In one embodiment, the leader untranslated sequence comprises a guanosine at the 5' end upon translation by RNA T7 polymerase.

[0247] In certain embodiments, the 5'-enhanced intron element comprises a trailing untranslated sequence. In some embodiments, the 5'-enhanced intron element is located at the 3' end of the 5'-enhanced intron element. In some embodiments, the trailing untranslated sequence is a partial restriction digest sequence. In one embodiment, the trailing untranslated sequence is, in whole or in part, a restriction digest site used to linearize a DNA template. In some embodiments, the restriction digest site is, in whole or in part, derived from a naturally occurring viral, bacterial, or eukaryotic DNA template. In some embodiments, the trailing untranslated sequence is a terminal restriction site fragment.

[0248] a. Enriched intron fragment According to the present invention, the 3'-enhanced intron element and the 5'-enhanced intron element each comprise an intron fragment. In certain embodiments, the 3'-intron fragment is a contiguous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 3'-proximal fragment of a naturally occurring Group I intron that includes the 3'-splice site dinucleotide. Typically, the 5'-intron fragment is a contiguous sequence that is at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 5'-proximal fragment of a naturally occurring Group I intron that includes the 5'-splice site dinucleotide. In some embodiments, the 3' intron fragment comprises the first nucleotide of a 3' Group I splice site dinucleotide. In some embodiments, the 5' intron fragment comprises the first nucleotide of a 5' Group I splice site dinucleotide. In other embodiments, the 3' intron fragment comprises the first and second nucleotides of a 3' Group I intron fragment splice site dinucleotide; the 5' intron fragment comprises the first and second nucleotides of a 3' Group I intron fragment dinucleotide.

[0249] b. Enriched exon fragments In certain embodiments, as provided herein, the DNA template, the linear precursor RNA polynucleotide, and the circular RNA polynucleotide each comprise an enhanced exon fragment. In some embodiments, in 5' to 3' order, the 3' enhanced exon element is located upstream of the core functional element. In some embodiments, in 5' to 3' order, the 5' enhanced intron element is located downstream of the core functional element.

[0250] According to the present invention, the 3'-enhanced exon element and the 5'-enhanced exon element each comprise an exon fragment. In some embodiments, the 3'-enhanced exon element comprises a 3'-exon fragment. In some embodiments, the 5'-enhanced exon element comprises a 5'-exon fragment. In certain embodiments, as provided herein, the 3'-exon fragment and the 5'-exon fragment comprise 1 to 100 nucleotides of a Group I intron fragment and exon sequence, respectively. In certain embodiments, the 3'-intron fragment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 3'-proximal fragment of a naturally occurring Group I intron, including the 3'-splice site dinucleotide. Typically, the 5' Group I intron fragment is a contiguous sequence at least 75% homologous (e.g., at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% homologous) to the 5'-proximal fragment of a naturally occurring Group I intron containing the 5' splice site dinucleotide. In some embodiments, the 3' exon fragment contains the second nucleotide of the 3' Group I intron splice site dinucleotide and 1-100 nucleotides of exon sequence. In some embodiments, the 5' exon fragment contains the first nucleotide of the 5' Group I intron splice site dinucleotide and 1-100 nucleotides of exon sequence. In some embodiments, the exon sequence partially or entirely comprises a naturally occurring exon sequence derived from a viral, bacterial, or eukaryotic DNA vector. In other embodiments, the exon sequences further comprise synthetic, genetically modified (eg, containing modified nucleotides), or other engineered exon sequences.

[0251] In one embodiment, when the 3' intron fragment contains both nucleotides of the 3' Group I splice site dinucleotide and the 5' intron fragment contains both nucleotides of the 5' Group I splice site dinucleotide, the exon fragment located within the 5' enhanced exon element and the 3' enhanced exon element does not contain the Group I splice site dinucleotide.

[0252] c. Exemplary permutations of enriched intronic and exonic elements By way of example and not limitation, in some embodiments, a 3'-enhanced intron element comprises the following, in 5' to 3' order: leading untranslated sequence, a 5' affinity tag, an optional 5' external duplex region, a 5' external spacer, and a 3' intron fragment. In the same embodiments, a 3'-enhanced exon element comprises the following, in 5' to 3' order: a 3' exon fragment, an optional 5' internal duplex region, an optional 5' internal duplex region, and a 5' internal spacer. In the same embodiments, a 5'-enhanced exon element comprises the following, in 5' to 3' order: a 3' internal spacer, an optional 3' internal duplex region, and a 5' exon fragment. In still the same embodiments, a 3'-enhanced intron element comprises the following, in 5' to 3' order: a 5' intron fragment, a 3' external spacer, an optional 3' external duplex region, a 3' affinity tag, and a trailing untranslated sequence.

[0253] B. Core Functional Elements In some embodiments, the DNA template, the linear precursor RNA polynucleotide, and the circular RNA polynucleotide comprise a core functional element. In some embodiments, the core functional element comprises a coding element or a non-coding element. In certain embodiments, the core functional element may comprise both a coding element and a non-coding element. In some embodiments, the core functional element further comprises a translation initiation element (TIE) upstream of the coding element or the non-coding element. In some embodiments, the core functional element comprises a termination element. In some embodiments, the termination element is located downstream of the TIE and the coding element. In some embodiments, the termination element is located downstream of the coding element but upstream of the TIE. In certain embodiments, where the coding element comprises a non-coding region, the core functional element lacks a TIE and / or a termination element.

[0254] a. Code or non-code element In some embodiments, the polynucleotides herein comprise coding elements or non-coding elements, or a combination of both. In some embodiments, the coding elements comprise expression sequences. In some embodiments, the coding elements encode at least one therapeutic protein.

[0255] In some embodiments, the circular RNA encodes two or more polypeptides. In some embodiments, the circular RNA is bicistronic RNA. The sequences encoding the two or more polypeptides can be separated by a nucleotide sequence encoding a ribosome skipping element or a protease cleavage site. In certain embodiments, the ribosome skipping element encodes the zosea asigna virus 2A peptide (T2A), the porcine teschovirus-12A peptide (P2A), the foot-and-mouth disease virus 2A peptide (F2A), the equine rhinitis A virus 2A peptide (E2A), the cytoplasmic polyhedrosis virus 2A peptide (BmCPV 2A), or the silkworm (B. mori) flacherie virus 2A peptide (BmIFV 2A).

[0256] b. Translation initiation element (TIE) As provided herein, in some embodiments, a core functional element comprises at least one translation initiation element (TIE). TIEs are designed to enable translation efficiency of the encoded protein. Thus, an optimal core functional element composed only of non-coding elements lacks any TIE. In some embodiments, a core functional element comprising one or more coding elements further comprises one or more TIEs.

[0257] In some embodiments, the TIE comprises an untranslated region (UTR). In certain embodiments, the TIE provided herein comprises an internal ribosome entry site (IRES). The inclusion of an IRES allows for the translation of one or more open reading frames (e.g., open reading frames forming an expression sequence) from the circular RNA. The IRES element attracts the eukaryotic ribosomal translation initiation complex and promotes translation initiation. See, for example, Kaufman et al., Nuc. Acids Res. (1991) 19:4485-4490; Gurtu et al., Biochem. Biophys. Res. Comm. (1996) 229:295-298; Rees et al., BioTechniques (1996) 20: 102-110; Kobayashi et al., BioTechniques (1996) 21:399-402; and Mosser et al., BioTechniques 1997 22 150-161.

[0258] To drive protein expression, the circular RNA comprises an IRES operably linked to the protein-coding sequence. Exemplary IRES sequences are provided in Table A_IRES. In some embodiments, the circular RNAs disclosed herein comprise an IRES sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an IRES sequence in Table A_IRES. In some embodiments, the circular RNAs disclosed herein comprise an IRES sequence in Table A_IRES. Modifications of the IRES and accessory sequences are disclosed herein to increase or decrease IRES activity, for example, by truncating the 5' and / or 3' end of the IRES, adding a spacer 5' to the IRES, modifying the six nucleotides 5' of the translation start site (Kozak sequence), modifying alternative translation start sites, and creating chimeric / hybrid IRES sequences. In some embodiments, the IRES sequence in the circular RNA disclosed herein comprises one or more of these modifications compared to a native IRES (e.g., a native IRES disclosed in Table A_IRES).

[0259] Numerous IRES sequences are available, including those derived from a wide variety of viruses, from the encephalomyocarditis virus (EMCV) UTR (Jang et al. J. Virol. (1989) 63: 1651-1660), polio leader sequence, hepatitis A virus leader, hepatitis C virus IRES, human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(25): 15125-15130), IRES elements from foot-and-mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24:2697-2700), and picornavirus leader sequences such as the giardia virus IRES (Garlapati et al., J. Biol. Chem. (2004) 279(5):3389-3397).

[0260] i. Natural TIEs: viral and eukaryotic / cellular internal ribosome entry sites (IRES) Numerous IRES sequences are available, including those derived from a wide variety of viruses, from the encephalomyocarditis virus (EMCV) UTR (Jang et al., J. Virol. (1989) 63: 1651-1660), polio leader sequence, hepatitis A virus leader, hepatitis C virus IRES, human rhinovirus type 2 IRES (Dobrikova et al., Proc. Natl. Acad. Sci. (2003) 100(25): 15125-15130), IRES elements from foot-and-mouth disease virus (Ramesh et al., Nucl. Acid Res. (1996) 24:2697-2700), and picornavirus leader sequences such as the giardia virus IRES (Garlapati et al., J. Biol. Chem. (2004) 279(5):3389-3397). Various IRES sequences have different abilities to drive protein expression, and the ability of any particular identified or predicted IRES sequence to drive protein expression from a linear mRNA or circular RNA construct is unknown and unpredictable. In certain embodiments, potential IRES sequences can be identified bioinformatically based on the sequence location in the viral sequence. However, the activity of such sequences has not previously been characterized. As demonstrated herein, such IRES sequences may have different protein expression capabilities depending on the cell type, for example, in T cells, hepatocytes, or muscle cells. In some embodiments, the novel IRES sequences described herein may have at least 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 20-, 50-, or 100-fold increased expression in a particular cell type compared to previously described EMCV IRES sequences.

[0261] To drive protein expression, the circular RNA comprises an IRES operably linked to the protein-coding sequence. Exemplary IRES sequences are provided below in Table A_IRES. In some embodiments, the circular RNAs disclosed herein comprise an IRES sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to an IRES sequence in Table A_IRES. In some embodiments, the circular RNAs disclosed herein comprise an IRES sequence in Table A_IRES. Modifications of the IRES and accessory sequences are disclosed herein to increase or decrease IRES activity, for example, by truncating the 5' and / or 3' end of the IRES, adding a spacer 5' to the IRES, modifying the six nucleotides 5' of the translation start site (Kozak sequence), modifying alternative translation start sites, and creating chimeric / hybrid IRES sequences. In some embodiments, the IRES sequence in the circular RNA disclosed herein comprises one or more of these modifications compared to a native IRES (e.g., a native IRES disclosed in Table A_IRES).

[0262] In some embodiments, the IRES is selected from the group consisting of Aarivirus, Ailurivirus, Ampivirus, Anativirus, Aphthovirus, Akuamavirus, Avihepatovirus, Abyssivirus, Bucepivirus, Bopivirus, Cursilivirus, Cardiovirus, Cosavirus, Krahelivirus, Kurohivirus, Danipivirus, Dicipivirus, Diresapivirus, Enterovirus, Erbovirus, Felipivirus, Fipivirus, Gallivirus, Gruhelivirus, Grusopivirus, Harkavirus, Hemipivirus, Hepatovirus, Hunnivirus, Kobuvirus, Kunsaguivirus, Limnipivirus, Ribpivirus, Ludopivirus, Malagasyvirus, These are: Marspivirus, Megrivirus, Missivirus, Mosavirus, Mupivirus, Miropivirus, Orivirus, Ostichivirus, Parabovirus, Parechovirus, Pasivirus, Passerivirus, Pemapivirus, Poesivirus, Potamipivirus, Paigosepivirus, Rabovirus, Rafivirus, Lajidapivirus, Rohelivirus, Rosavirus, Sacobuvirus, Sarivirus, Sapelovirus, Senecavirus, Shambavirus, Sitinivirus, Simapivirus, Tescovirus, Torchvirus, Tottorivirus, Tremovirus, Tropivirus, Hepacivirus, Pegivirus, Pestivirus, and Flavivirus IRES.

[0263] In some embodiments, the IRES is selected from the group consisting of Taura syndrome virus, Triatoma virus, Theiler's encephalomyelitis virus, Simian virus 40, Solenopsis invicta virus 1, Rhopalosiphum padi virus, Reticuloendotheliosis virus, Human poliovirus 1, Plautia stali enteric virus, Kashmir bee virus, Human rhinovirus 2, Homalodisca coagulata virus-1, Human immunodeficiency virus type 1, Small kite P virus, Hepatitis C virus, Hepatitis A virus, Hepatitis GB virus, Foot and mouth disease virus, Human enterovirus 71, Equine rhinitis virus, Ectropis obliqua picorna-like virus, encephalomyocarditis virus, Drosophila C virus, human coxsackievirus B3, Crucifer tobamovirus, cricket paralysis virus, bovine viral diarrhea virus 1, black queen brood virus, aphid fatal paralysis virus, avian encephalomyelitis virus, honeybee acute paralysis virus, hibiscus chlorotic ringspot virus, swine fever virus, human FGF2, human SFTPA1, human AML1 / RUNX1, Drosophila antennapedia, human AQ P4, human AT1R, human BAG-1, human BCL2, human BiP, human c-IAPl, human c-myc, human eIF4G, mouse NDST4L, human LEF1, mouse HIF1 alpha, human n.myc, mouse Gtx, human p27kipl, human PDGF2 / c-sis, human p53, human Pim-1, mouse Rbm3, Drosophila reaper, dog Scamper, Drosophila Ubx, human UNR, mouse UtrA, human VEGF-A, human XIAP, Drosophila hairless, S. cerevisiae (S.cerevisiae) TFIID, Saccharomyces cerevisiae YAP1, Tobacco etch virus, Turnip crinkle virus, EMCV-A, EMCV-B, EMCV-Bf, EMCV-Cf, EMCV pEC9, Picobirnavirus, HCV QC64, Human cosavirus E / D, Human cosavirus F, Human cosavirus JMY, Rhinovirus NAT001, HRV14, HRV89, HRVC-02, HRV-A21, Salivirus A SH1, Sarivirus FHB, Sarivirus NG-J1, Human Parechovirus 1, Kurohivirus B, Yc-3, Rosavirus M-7, Shambavirus A, Pasivirus A, Pasivirus A2, Echovirus E14, Human Parechovirus 5, Aichivirus, Hepatitis A virus HA16, Phopivirus, CVA10, Enterovirus C, Enterovirus D, Enterovirus J, Human Pegivirus 2, GBV-C GT110, GBV-C K1737, GBV-C Iowa, Pegivirus A1220, Pacivirus A3, Sapelovirus, Rosavirus B, Bakunsa virus, Tremovirus A, Swine Pacivirus 1, PLV-CHN, Pacivirus A, Citinivirus, Hepacivirus K, Hepacivirus A, BVDV1, Border disease virus, BVDV2, CSFV-PK15C, SF573 dicistrovirus, Hubei picorna-like virus, CRPV, Sarivirus A BN5, Sarivirus A BN2, Sarivirus A 02394, Sarivirus A GUT, Sarivirus A CH, Sarivirus A SZ1, Sarivirus FHB, CVB3, CVB1, Echovirus 7, CVB5, EVA71, CVA3, CVA12, EV24, or an IRES sequence for an aptamer against eIF4G.

[0264] In some embodiments, the IRES comprises, in whole or in part, a eukaryotic or cellular IRES. In certain embodiments, the IRES is from a human gene, wherein the human gene is ABCF1, ABCG1, ACAD10, ACOT7, ACSS3, ACTG2, ADCYAP1, ADK, AGTR1, AHCYL2, AHI1, AKAP8L, AKR1A1, ALDH3A1, ALDOA, ALG13, AMMECR1L, ANGPTL4, ANK3, AOC3, AP4B1, AP4E1, APAF1, APBB1, APC, APH1A, APOBEC3D, APOM, APP, AQP4, ARHGAP36, ARL13 B, ARMC8, ARMCX6, ARPC1A, ARPC2, ARRDC3, ASAP1, ASB3, ASB5, ASCL1, ASMTL, ATF2, ATF3, ATG4A, ATP5B, ATP6V0A1, ATXN3, AURKA, AURKA, AURKA, A URKA, B3GALNT1, B3GNTL1, B4GALT3, BAAT, BAG1, BAIAP2, BAIAP2L2, BAZ2A, BBX, BCAR1, BCL2, BCS1L, BET1, BID, BIRC2, BPGM, BPIFA2, BRINP2, BSG , BTN3A2, C12orf43, C14orf93, C17orf62, C1orf226, C21orf62, C2orf15, C4BPB, C4orf22, C9orf84, CACNA1A, CALCOCO2, CAPN11, CASP12, CASP8 AP2, CAV1, CBX5, CCDC120, CCDC17, CCDC186, CCDC51, CCN1, CCND1, CCNT1, CD2BP2, CD9, CDC25C, CDC42, CDC7, CDCA7L, CDIP1, CDK1, CDK11A, CDKN1 B, CEACAM7, CEP295NL, CFLAR, CHCHD7, CHIA, CHIC1, CHMP2A, CHRNA2, CLCN3, CLEC12A, CLEC7A, CLECL1, CLRN1, CMSS1, CNIH1, CNR1, CNTN5, COG4, COMMD1, COMMD5, CPEB1, CPS1, CRACR2B, CRBN, CREM, CRYBG1, CSDE1, CSF2RA, CSNK2A1, CSTF3, CTCFL, CTH, CTNNA3, CTNNB1, CTNNB1, CTNND1, CTSL,<h2 style=";text-align:left;direction:ltr">CUTA、CXCR5、CYB5R3、CYP24A1、CYP3A5、DAG1、DAP3、DAP5、DAXX、DCAF4、DCAF7、DCLRE1A、DCP 1A、DCTN1、DCTN2、DDX19B、DDX46、DEFB123、DGKA、DGKD、DHRS4、DHX15、DIO3、DLG1、DLL4、DMD UTR、DMD ex5、DMKN、DNAH6、DNAL4、DUSP13、DUSP19、DYNC1I2、DYNLRB2、DYRK1A、ECI2、ECT2、EIF1AD、EIF2B4、EIF4G1、EIF4G2、EIF4G3、 ELANE、ELOVL6、ELP5、EMCN、ENO1、EPB41、ERMN、ERVV-1、ESRRG、ETFB、ETFBKMT、ETV1、ETV4、EXD1、EXT1、EZH2、FAM111B、FAM157 A、FAM213A、FBXO25、FBXO9、FBXW7、FCMR、FGF1、FGF1、FGF1A、FG F2、FGF2、FGF-9、FHL5、FMR1、FN1、FOXP1、FTH1、FUBP1、G3BP1、G ABBR1、GALC、GART、GAS7、ガストリン、GATA1、GATA4、GFM2、GHR、GJB2 、GLI1、GLRA2、GMNN、GPAT3、GPATCH3、GPR137、GPR34、GPR55、GP R89A、GPRASP1、GRAP2、GSDMB、GSTO2、GTF2B、GTF2H4、GUCY1B2、HAX1、HCST、HIGD1A、HIGD1B、HIPK1、HIST1H1C、HIST1H3H、HK1、 HLA-DRB4、HMBS、HMGA1、HNRNPC、HOPX、HOXA2、HOXA3、HPCAL1、HR、HSP90AB1、HSPA1A、HSPA4L、HSPA5、HYPK、IFFO1、IFT74、IFT8 1, IGF1, IGF1R, IGF1R, IGF2, IL11, IL17RE, IL1RL1, IL1RN, IL32, IL6, ILF2, ILVBL, INSR, INTS13, IP6K1, ITGA4, ITGAE, KCNE4, KERA, KIAA0355, KIAA0895L, KIAA1324, KIAA1522, KIAA1683, KIF2C, KIZ, KLHL31, KLK7, KRR1, KRT14, KRT17, KRT33A, KRT6AKRTAP10-2、KRTAP13-3、KRTAP13-4、KRTAP5-11、KRTCAP2、LACRT、LAMB1、LA MB3、LANCL1、LBX2、LCAT、LDHA、LDHAL6A、LEF1、LINC-PINT、LMO3、LRRC4C、LR RC7、LRTOMT、LSM5、LTB4R、LYRM1、LYRM2、MAGEA11、MAGEA8、MAGEB1、MAGEB1 6、MAGEB3、MAPT、MARS、MC1R、MCCC1、METTL12、METTL7A、MGC16025、MGC16025 、MIA2、MIA2、MITF、MKLN1、MNT、MORF4L2、MPD6、MRFAP1、MRPL21、MRPS12、MS I2、MSLN、MSN、MT2A、MTFR1L、MTMR2、MTRR、MTUS1、MYB、MYC、MYCL、MYCN、MYL1 0、MYL3, MYLK, MYO1A, MYT2, MZB1, NAP1L1, NAV1, NBAS, NCF2, NDRG1, NDST2 NDUFA7、NDUFB11、NDUFC1、NDUFS1、NEDD4L、NFAT5、NFE2L2、NFE2L2、NFIA、NH EJ1、NHP2、NIT1、NKRF、NME1-NME2、NPAT、NR3C1、NRBF2、NRF1、NTRK2、NUDCD 1、NXF2、NXT2、ODC1、ODF2、OPTN、OR10R2、OR11L1、OR2M2、OR2M3、OR2M5、OR2T 10、OR4C15、OR4F17、OR4F5、OR5H1、OR5K1、OR6C3、OR6C75、OR6N1、OR7G2、p5 3、P2RY4、PAN2、PAQR6、PARP4、PARP9、PC、PCBP4、PCDHGC3、PCLAF、PDGFB、PDZ RN4、HAIR、PEMT、PEX2、PFKM、PGBD4、PGLYRP3、PHLDA2、PHTF1、PI4KB、PIGC、 PIM1、PKD2L1、PKM、PLCB4、PLD3、PLAKHA1、PLKHB1、PLS3、PML、PNMA5、PNN、P OC1A、POC1B、POLD2、POLD4、POU5F1、PPIG、PQBP1、PRAME、PRPF4、PRR11、PRRT 1、PRSS8、PSMA2、PSMA3、PSMA4、PSMD11、PSMD4、PSMD6、PSME3、PSMG3、PTBP3、PTCH1, PTHLH, PTPRD, PUS7L, PVRIG, QPRT, RAB27A, RAB7B, RABGGTB, RAET1E, RALGDS, RALYL, RARB, RCVRN, REG3G, RFC5, RGL4, RGS19, RGS3, RHD, RINL, R IPOR2, RITA1, RMDN2, RNASE1, RNASE4, RNF4, RPA2, RPL17, RPL21, RPL26L1, RPL28, RPL29, RPL41, RPL9, RPS11, RPS13, RPS14, RRBP1, RSU1, RTP2, RUNX1, RUNX1T1、RUNX1T1、RUNX2、RUSC1、RXRG、S100A13、S100A4、SAT1、SCHIP1、SCMH1、SEC14L1、SEMA4A、SERPINA1、SERPINB4、SERTAD3、SFTPD、SH3D19、SHC1、 SHMT1, SHPRH, SIM1, SIRT5, SLC11A2, SLC12A4, SLC16A1, SLC25A3, SLC26A9, SLC5A11, SLC6A12, SLC6A19, SLC7A1, SLFN11, SLIRP, SMAD5, SMARCAD1, SMN 1、SNCA、SNRNP200、SNRPB2、SNX12、SOD1、SOX13、SOX5、SP8、SPARCL1、SPATA12、SPATA31C2、SPN、SPOP、SQSTM1、SRBD1、SRC、SREBF1、SRPK2、SSB、SSB、SSBP1、ST3GAL6、STAB1、STAMBP、STAU1、STAU1、STAU1、STAU1、STAU1、STK16、STK24、STK38、STMN1、STX7、SULT2B1、SYK、SYNPR、TAF1C、TAGLN、TANK、TAS2R40 、TBC1D15、TBXAS1、TCF4、TDGF1、TDP2、TDRD3、TDRD5、TESK2、THAP6、THBD、THTPA、TIAM2、TKFC、TKTL1、TLR10、TM9SF2、TMC6、TMCO2、TMED10、TMEM116、TM EM126A, TMEM159, TMEM208, TMEM230, TMEM67, TMPRSS13, TMUB2, TNFSF4, TNIP3, TP53, TP53, TP73, TRAF1, TRAK1, TRIM31, TRIM6, TRMT1, TRMT2B, TRPM7,TRPM8, TSPEAR, TTC39B, TTLL11, TUBB6, TXLNB, TXNIP, TXNL1, TXNRD1, TYROBP, U2AF1, UBA1, UBE2D3, UBE2I, UBE2 L3, UBE2V1, UBE2V2, UMPS, UNG, UPP2, USMG5, USP18, UTP14A, UTRN, UTS2, VDR, VEGFA, VEGFA, VEPH1, VIPAS39, VPS2 9, VSIG10L, WDHD1, WDR12, WDR4, WDR45, WDYHV1, WRAP53, XIAP, XPNPEP3, YAP1, YWHAZ, YY1AP1, ZBTB32, ZNF146, ZNF250, ZNF385A, ZNF408, ZNF410, ZNF423, ZNF43, ZNF502, ZNF512, ZNF513, ZNF580, ZNF609, ZNF707, or ZNRD1.

[0265] ii. Synthetic TIEs: Aptamer complexes, modified nucleotides, IRES variants and other engineered TIEs As contemplated herein, in certain embodiments, a translation initiation element (TIE) comprises a synthetic TIE. In some embodiments, the synthetic TIE comprises an aptamer complex, a synthetic IRES, or other engineered TIE capable of initiating translation of a linear or circular RNA polynucleotide.

[0266] In some embodiments, one or more aptamer sequences can bind to components of eukaryotic initiation factors to enhance or initiate translation. In some embodiments, aptamers can be used to enhance translation in vivo and in vitro by promoting specific eukaryotic initiation factors (eIFs) (e.g., the aptamers of WO2019081383A1 can bind to eukaryotic initiation factor 4F (eIF4F)). In some embodiments, aptamers or aptamer complexes can bind to EIF4G, EIF4E, EIF4A, EIF4B, EIF3, EIF2, EIF5, EIF1, EIF1A, 40S ribosome, PCBP1 (poly C-binding protein), PCBP2, PCBP3, PCBP4, PABP1 (poly A-binding protein), PTB, Argonaute protein family, HNRNPK (heterogeneous nuclear ribonucleoprotein K), or La protein.

[0267] c. Closing array In certain embodiments, the core functional element comprises a termination sequence. In some embodiments, the termination sequence comprises a stop codon. In one embodiment, the termination sequence comprises a stop cassette. In some embodiments, the termination cassette comprises at least two stop codons. In some embodiments, the termination cassette comprises at least two frames of stop codons. In some embodiments, the frames of stop codons in the termination cassette each comprise one, two, or more stop codons. In some embodiments, the termination cassette comprises a termination cassette flanked by LoxP or RoxStopRox, or frt. In some embodiments, the termination cassette comprises a lox-stop-lox termination cassette.

[0268] C. variant In certain embodiments, the circular RNA polynucleotides provided herein comprise modified RNA nucleotides and / or modified nucleosides. In some embodiments, the modified nucleosides are m 5 In another embodiment, the modified nucleoside is m 5In another embodiment, the modified nucleoside is m 6 A(N 6 In another embodiment, the modified nucleoside is s 2 In another embodiment, the modified nucleoside is U (2-thiouridine). In another embodiment, the modified nucleoside is Ψ (pseudouridine). In another embodiment, the modified nucleoside is Um (2'-O-methyluridine). In another embodiment, the modified nucleoside is m 1 A(1-methyladenosine);m 2 A(2-methyladenosine); Am(2'-O-methyladenosine); ms 2 m 6 A(2-methylthio-N 6 -methyladenosine);i 6 A(N 6 -Isopentenyladenosine);ms 2 i6A(2-methylthio-N 6 Isopentenyladenosine);io 6 A(N 6 -(cis-hydroxyisopentenyl)adenosine);ms 2 io 6 A(2-methylthio-N 6 -(cis-hydroxyisopentenyl)adenosine);g 6 A(N 6 -glycinylcarbamoyl adenosine);t 6 A(N 6 -threonylcarbamoyl adenosine);ms 2 t 6 A(2-methylthio-N 6 -threonylcarbamoyl adenosine);m 6 t 6 A(N 6 -methyl-N 6 -threonylcarbamoyladenosine);hn 6 A(N 6 -hydroxynorvalylcarbamoyl adenosine);ms 2 hn 6 A(2-methylthio-N 6-Hydroxynorvalylcarbamoyl adenosine; Ar(p)(2'-O-ribosyladenosine (phosphate)); I(inosine); m 1 I(1-methylinosine);m 1 Im(1,2'-O-dimethylinosine);m 3 C(3-methylcytidine); Cm(2'-O-methylcytidine); s 2 C(2-thiocytidine);ac 4 C(N 4 -acetylcytidine);f 5 C(5-formylcytidine);m 5 Cm(5,2'-O-dimethylcytidine);ac 4 Cm(N 4 -acetyl-2'-O-methylcytidine);k 2 C(lycidin);m 1 G(1-methylguanosine);m 2 G(N 2 -methylguanosine);m 7 G(7-methylguanosine); Gm(2'-O-methylguanosine); m 2 2G(N 2 ,N 2 -dimethylguanosine);m 2 Gm(N 2 ,2'-O-dimethylguanosine);m 2 2Gm(N 2 ,N 2 ,2'-O-trimethylguanosine;Gr(p)(2'-O-ribosylguanosine(phosphate));yW(wybutosine);o2yW(peroxywybutosine);OHyW(hydroxywybutosine);OHyW*(native hydroxywybutosine);imG(wybutosine);mimG(methylwybutosine);Q(queuosine);oQ(epoxyqueuosine);galQ(galactosyl-queuosine);manQ(mannosyl-queuosine);preQ0(7-cyano-7-deazaguanosine);preQ1(7-aminomethyl-7-deazaguanosine);G + (Archaeosin); D(Dihydrouridine); m 5 Um(5,2'-O-dimethyluridine);s 4 U(4-thiouridine);m5 s 2 U(5-methyl-2-thiouridine);s 2 Um(2-thio-2'-O-methyluridine); acp 3 U(3-(3-amino-3-carboxypropyl)uridine);ho 5 U(5-hydroxyuridine);mo 5 U(5-methoxyuridine); cmo 5 U(uridine 5-oxyacetic acid);mcmo 5 U(uridine 5-hydroxyacetic acid methyl ester);chm 5 U(5-(carboxyhydroxymethyl)uridine);mchm 5 U(5-(carboxyhydroxymethyl)uridine methyl ester);mcm 5 U(5-methoxycarbonylmethyluridine); mcm 5 Um (5-methoxycarbonylmethyl-2'-O-methyluridine); mcm 5 s 2 U(5-methoxycarbonylmethyl-2-thiouridine);nm 5 S 2 U(5-aminomethyl-2-thiouridine);mnm 5 U(5-methylaminomethyluridine); mnm 5 s 2 U(5-methylaminomethyl-2-thiouridine);mnm 5 se 2 U(5-methylaminomethyl-2-selenouridine);ncm 5 U(5-carbamoylmethyluridine);ncm 5 Um(5-carbamoylmethyl-2'-O-methyluridine);cmnm 5 U(5-carboxymethylaminomethyluridine);cmnm 5 Um (5-carboxymethylaminomethyl-2'-O-methyluridine); cmnm 5 s 2 U(5-carboxymethylaminomethyl-2-thiouridine);m 6 2A(N 6 ,N 6 -dimethyladenosine; Im (2'-O-methylinosine); m 4C(N 4 -methylcytidine);m 4 Cm(N 4 ,2'-O-dimethylcytidine);hm 5 C(5-hydroxymethylcytidine);m 3 U(3-methyluridine); cm 5 U(5-carboxymethyluridine);m 6 Am(N 6 ,2'-O-dimethyladenosine);m 6 2Am(N 6 ,N 6 ,O-2'-trimethyladenosine);m 2,7 G(N 2 ,7-dimethylguanosine);m 2,2,7 G(N 2 ,N 2 ,7-trimethylguanosine);m 3 Um(3,2'-O-dimethyluridine);m 5 D(5-methyldihydrouridine);f 5 Cm(5-formyl-2'-O-methylcytidine);m 1 Gm(1,2'-O-dimethylguanosine);m 1 Am(1,2'-O-dimethyladenosine);τm 5 U(5-taurinomethyluridine);τm 5 s 2 U(5-taurinomethyl-2-thiouridine); imG-14(4-demethylwyosine); imG2(isowyosine); or ac 6 A(N 6 -acetyladenosine).

[0269] In some embodiments, the modified nucleoside is pyridin-4-one ribonucleoside, 5-aza-uridine, 2-thio-5-aza-uridine, 2-thiouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uridine, 1- Taurinomethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine Idouridine, 5-aza-cytidine, pseudoisocytidine, 3-methyl-cytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl-pseudoisocytidine, pyrrolo-cytidine, pyrrolo-pseudoisocytidine, 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine , Zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-Diaminopurine, 1-methyladenosine, N6-methyladenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N6-glycinylcarbamoyladenosine, N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, 7-methyladenine, 2-methylthio-adenine, 2-methoxy-adenine, inosine, 1-methyl-inosine, wyosine, wyobutosine, 7-deaza-guanosine In another embodiment, the modifications may include compounds selected from the group consisting of 5-methylcytosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dimethyl-6-thio-guanosine. In another embodiment, the modifications are independently selected from the group consisting of 5-methylcytosine, pseudouridine, and 1-methylpseudouridine.

[0270] In some embodiments, modified ribonucleosides include 5-methylcytidine, 5-methoxyuridine, 1-methyl-pseudouridine, N6-methyladenosine, and / or pseudouridine. In some embodiments, such modified nucleosides provide additional stability and resistance to immune activation.

[0271] In certain embodiments, polynucleotides may be codon-optimized. A codon-optimized sequence may be one in which codons in a polynucleotide encoding a polypeptide are substituted to enhance the expression, stability, and / or activity of the polypeptide. Factors that influence codon optimization include, but are not limited to, one or more of the following: (i) variation in codon bias between two or more organisms or genes or between synthetically constructed bias tables; (ii) variation in the degree of codon bias within an organism, gene, or set of genes; (iii) systematic variation of codons, including context; (iv) variation of codons with their decoding tRNAs; (v) variation of codons with GC% across triplets or at a single position; (vi) variation in the degree of similarity to a reference sequence, e.g., a natural sequence; (vii) variation in codon frequency cutoff; (viii) structural properties of mRNA transcribed from a DNA sequence; (ix) prior knowledge of the function of the DNA sequence underlying the design of the codon substitution set; and / or (x) systematic variation of the codon set for each amino acid. In some embodiments, codon-optimized polynucleotides can minimize ribozyme clashes and / or limit structural interference between the expressed sequence and core functional elements.

[0272] 3. Payload In some embodiments, the expressed sequence encodes a therapeutic protein. In some embodiments, the therapeutic protein is selected from the proteins listed in the table below.

[0273] TIFF2025525390000004.tif66169TIFF2025525390000005.tif208169TIFF2025525390000006.tif208169TIFF2025525390000007.tif212169TIFF2025525390000008.tif208169TIFF2025525390000009.tif208169TIFF2025525390000010.tif190169TIFF2025525390000011.tif208169TIFF2025525390000012.tif209169TIFF2025525390000013.tif195169

[0274] In some embodiments, the expression sequence encodes a therapeutic protein. In some embodiments, the expression sequence encodes a cytokine, e.g., IL-12p70, IL-15, IL-2, IL-18, IL-21, IFN-α, IFN-β, IL-10, TGF-beta, IL-4, or IL-35, or a functional fragment thereof. In some embodiments, the expression sequence encodes an immune checkpoint inhibitor. In some embodiments, the expression sequence encodes an agonist (e.g., a TNFR family member such as CD137L, OX40L, ICOSL, LIGHT, or CD70). In some embodiments, the expression sequence encodes a chimeric antigen receptor. In some embodiments, the expression sequence encodes an inhibitory receptor agonist (e.g., PDL1, PDL2, galectin-9, VISTA, B7H4, or MHCII) or an inhibitory receptor (e.g., PD1, CTLA4, TIGIT, LAG3, or TIM3). In some embodiments, the expressed sequence encodes an inhibitory receptor antagonist. In some embodiments, the expressed sequence encodes one or more TCR chains (alpha and beta or gamma and delta chains). In some embodiments, the expressed sequence encodes a secreted T cell or immune cell engager (e.g., a bispecific antibody, such as CD3, CD137, or CD28, and a tumor-expressed protein, such as a BiTE targeting CD19, CD20, or BCMA). In some embodiments, the expressed sequence encodes a transcription factor (e.g., FOXP3, HELIOS, TOX1, or TOX2). In some embodiments, the expressed sequence encodes an immunosuppressive enzyme (e.g., IDO or CD39 / CD73). In some embodiments, the expressed sequence encodes a GvHD (e.g., an anti-HLA-A2 CAR-Treg).

[0275] In some embodiments, polynucleotide encodes a protein that is composed of subunits that are encoded by more than one gene.For example, the protein can be a heterodimer, with each chain or subunit of the protein being encoded by a separate gene.More than one circRNA molecule can be delivered in a transfection vehicle, with each circRNA encoding a separate subunit of the protein.Alternatively, a single circRNA can be engineered to encode more than one subunit.In certain embodiments, separate circRNA molecules that encode each subunit can be administered in separate transfection vehicles.

[0276] A. antigen-recognition receptor a. Chimeric Antigen Receptor (CAR) Chimeric antigen receptors (CARs or CAR-Ts) are genetically engineered receptors. These engineered receptors can be inserted into immune cells, including T cells, via the circular RNA described herein and expressed by the immune cells. With regard to CARs, a single receptor can be programmed to recognize a specific antigen and, upon binding to that antigen, activate immune cells to attack and destroy cells bearing that antigen. If these antigens are present on tumor cells, immune cells expressing the CAR can target and kill the tumor cells. In some embodiments, the CAR encoded by the polynucleotide comprises (i) an antigen-binding molecule that specifically binds to the target antigen, (ii) a hinge domain, a transmembrane domain, and an intracellular domain, and (iii) an activation domain.

[0277] In some embodiments, the orientation of the CAR according to the present disclosure comprises an antigen-binding domain (such as an scFv) in tandem with a costimulatory domain and an activation domain. The costimulatory domain may comprise one or more of an extracellular portion, a transmembrane portion, and an intracellular portion. In other embodiments, multiple costimulatory domains may be utilized in tandem.

[0278] The present invention contemplates the use of CARs as disclosed, for example, in International Application No. PCT / US2020 / 034418, U.S. Provisional Patent Application No. 62 / 851,548, filed May 22, 2019; U.S. Provisional Patent Application No. 62 / 857,121, filed June 4, 2019; International Application No. PCT / US2019 / 035531, filed June 5, 2019, U.S. Provisional Patent Application No. 62 / 943,796, filed December 4, 2019; U.S. Provisional Patent Application No. 62 / 943,779, filed December 4, 2019; and U.S. Provisional Patent Application No. 62 / 972,194, filed February 10, 2020, the teachings of which are incorporated herein by reference in their entireties.

[0279] i. Antigen-binding domain CARs can be engineered to bind to antigens (such as cell surface antigens) by incorporating an antigen-binding molecule that interacts with the target antigen. In some embodiments, the antigen-binding molecule is an antibody fragment thereof, such as one or more single-chain antibody fragments (scFvs). An scFv is a single-chain antibody fragment having the variable regions of the heavy and light chains of an antibody linked together. See U.S. Patent Nos. 7,741,465 and 6,319,494, and Eshhar et al., Cancer Immunol Immunotherapy (1997) 45: 131-136. An scFv retains the ability of the parent antibody to specifically interact with the target antigen. An scFv is useful in chimeric antigen receptors because it can be engineered to be expressed as part of a single chain together with other CAR components. Id. See also Krause et al., J. Exp. Med., Volume 188, No. 4, 1998 (619-626); Finney et al., Journal of Immunology, 1998, 161: 2791-2797. It is recognized that an antigen-binding molecule is typically contained within the extracellular portion of the CAR so that it can recognize and bind to an antigen of interest. Bispecific and multispecific CARs with specificity for multiple targets of interest are contemplated within the scope of the present invention.

[0280] In some embodiments, the antigen-binding molecule comprises a single chain, wherein the heavy chain variable region and the light chain variable region are linked by a linker. In some embodiments, the VH is located at the N-terminus of the linker, and the VL is located at the C-terminus of the linker. In other embodiments, the VL is located at the N-terminus of the linker, and the VH is located at the C-terminus of the linker. In some embodiments, the linker comprises at least about 5, at least about 8, at least about 10, at least about 13, at least about 15, at least about 18, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 amino acids.

[0281] In some embodiments, the antigen-binding molecule comprises a nanobody. In some embodiments, the antigen-binding molecule comprises a DARPin. In some embodiments, the antigen-binding molecule comprises an anticalin or other synthetic protein capable of specifically binding to a target protein.

[0282] In some embodiments, the CAR is selected from the group consisting of CD19, CD123, CD22, CD30, CD171, CS-1, C-type lectin-like molecule-1, CD33, epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (GD2), ganglioside GD3, TNF receptor family member B-cell maturation (BCMA), Tn antigen (Tn Ag) or (GaINAca-Ser / Thr)), prostate-specific membrane antigen (PSMA), receptor tyrosine kinase-like orphan receptor 1 (ROR1), Fms-like tyrosine kinase 3 (FLT3), tumor-associated glycoprotein 72 (TAG72), CD38, CD44v6, carcinoembryonic antigen (CEA), epithelial cell adhesion molecule (EPCAM), B7H3 (CD276), KIT (CD117), interleukin-13 receptor subunit alpha-2, mesothelin, interleukin-11 receptor alpha (IL-11Ra), prostate stem cell antigen (PSCA), protease serine 21, vascular endothelial growth factor receptor 2 (VEGFR2), Lewis (Y) antigen, CD24, platelet-derived growth factor receptor beta (PDGFR-beta), stage-specific embryonic antigen-4 (SSEA-4), CD20, folate receptor alpha, HER2, HER3, mucin 1 Cell surface-associated (MUC1), epidermal growth factor receptor (EGFR), neural cell adhesion molecule (NCAM), prostase, prostatic acid phosphatase (PAP), elongation factor 2 mutated (ELF2M), ephrin B2, fibroblast activation protein alpha (FAP), insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX), proteasome (prosome, macropain) subunit, beta, 9 (LMP2), glycoprotein 100 (gp100), breakpoint cluster region (BC) R) and Abelson murine leukemia viral oncogene homolog 1 (Abl) oncogene fusion protein (bcr-abl), tyrosinase, ephrin type A receptor 2 (EphA2), fucosyl GM1, sialyl Lewis adhesion molecule (sLe), ganglioside GM3, transglutaminase 5 (TGS5), high molecular weight melanoma-associated antigen (HMWMAA), o-acetyl-GD2 ganglioside (OAcGD2), folate receptor beta, tumor endothelial marker 1 (TEM1 / CD248),Tumor endothelial marker 7-related (TEM7R), claudin 6 (CLDN6), thyroid-stimulating hormone receptor (TSHR), G protein-coupled receptor class C group 5, member D (GPRC5D), chromosome X open reading frame 61 (CXORF61), CD97, CD179a, anaplastic lymphoma kinase (ALK), polysialic acid, placenta-specific 1 (PLAC1), hexasaccharide moiety of globoH glycoceramide (GloboH), mammary differentiation antigen (NY-BR-1), uroplakin 2 (UPK2), hepatitis A virus cellular receptor 1 (HAVCR1), adrenergic receptor beta 3 (ADRB3), pannexin 3 (PANX3), G protein-coupled receptor GPR20, lymphocyte antigen 6 complex, locus K9 (LY6K), olfactory receptor 51E2 (OR51E2), TCR gamma alternate reading frame protein (TARP), Wilms tumor protein (WT1), cancer / testis antigen 1 (NY-ESO-1), cancer / testis antigen 2 (LAGE-1a), MAGE family members (including MAGE-A1, MAGE-A3, and MAGE-A4), ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML), sperm protein 17 (SPA17), X antigen family, member 1A (XAGE1), angiopoietin-binding cell surface receptor 2 (Tie 2), melanoma cancer testis antigen-1 (MAD-CT-1), melanoma cancer testis antigen-2 (MAD-CT-2), Fos-related antigen 1, tumor protein p53 (p53), p53 mutant, prostein, surviving, telomerase, prostate cancer tumor antigen-1, melanoma antigen 1 recognized by T cells, rat sarcoma (Ras) mutant, human telomerase reverse transcriptase (hTERT), sarcoma translocation breakpoint, melanoma inhibitor of apoptosis (ML-IAP) ), ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene), N-acetylglucosaminyl-transferase V (NA17), paired box protein Pax-3 (PAX3), androgen receptor, cyclin B1, v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN), Ras homolog family member C (RhoC), tyrosinase-related protein 2 (TRP-2), cytochrome P450 1B1 (CYP1B1),CCCTC-binding factor (zinc finger protein)-like, squamous cell carcinoma antigen 3 recognized by T cells (SART3), paired box protein Pax-5 (PAX5), proacrosin-binding protein sp32 (OY-TES1), lymphocyte-specific protein tyrosine kinase (LCK), A-kinase anchor protein 4 (AKAP-4), synovial sarcoma X breakpoint 2 (SSX2), receptor for advanced glycation end products (RAGE-1), renal ubiquitous 1 (RU1), renal ubiquitous 2 (RU2), legumain, human papillomavirus E6 (HPV E6), human papillomavirus E7 (HPV E7), intestinal carboxylesterase, heat shock protein 70-2 mutant (mutated) hsp70-2), CD79a, CD79b, CD72, leukocyte-associated immunoglobulin-like receptor 1 (LAIR1), Fc fragment of IgA receptor (FCAR or CD89), leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2), CD300 molecule-like family member f (CD300LF), C-type lectin domain family 12 member A (CLEC12A), bone marrow stromal cell antigen 2 (BST2), EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2), lymphocyte antigen 75 (LY75), glypican-3 (GPC3), Fc receptor-like 5 (FCRL5), MUC16, 5T4, 8H9, ανβθ integrin, ανβ6 integrin, alpha-fetoprotein (AFP), B7-H6, c a-125, CA9, CD44, CD44v7 / 8, CD52, E-cadherin, EMA (epithelial membrane antigen), epithelial glycoprotein-2 (EGP-2), epithelial glycoprotein-40 (EGP-40), ErbB4, epithelial tumor antigen (ETA), folate-binding protein (FBP), kinase insert domain receptor (KDR), kappa light chain, L1 cell adhesion molecule, MUC18, NKG2D, carcinoembryonic antigen (h5T4), tumor / testis antigen 1B, GAGE, GAGE-1, BAGE, SCP-1, CTZ9, SAGE, CAGE, CT10, MART-1, immunoglobulin lambda-like polypeptide 1 (IGLL1), hepatitis B surface antigen-binding protein (HBsAg), viral capsid antigen (VCA), early antigen (EA), EBV nuclear antigen (EBNA), HHV-6 p41 early antigen, HHV-6B U94 latent antigen, HHV-6B p98 late antigen,The antigen-binding domain comprises an antigen specific for an antigen selected from the group consisting of cytomegalovirus (CMV) antigen, large T antigen, small T antigen, adenovirus antigen, respiratory syncytial virus (RSV) antigen, hemagglutinin (HA), neuraminidase (NA), parainfluenza type 1 antigen, parainfluenza type 2 antigen, parainfluenza type 3 antigen, parainfluenza type 4 antigen, human metapneumovirus (HMPV) antigen, hepatitis C virus (HCV) core antigen, HIV p24 antigen, human T-cell lymphotropic virus (HTLV-1) antigen, Merkel cell polyomavirus small T antigen, Merkel cell polyomavirus large T antigen, Kaposi's sarcoma-associated herpesvirus (KSHV) lytic nuclear antigen, and KSHV latent nuclear antigen. In some embodiments, the antigen-binding domain comprises SEQ ID NO: 3547 and / or 3548.

[0283] BCMA B-cell maturation antigen (BCMA), also known as CD269, is a member of the tumor necrosis factor receptor superfamily, i.e., TNFRSF17 (Thompson et al., J. Exp. Medicine, 192 (1): 129-135, 2000). Human BCMA is almost exclusively expressed on plasma cells and multiple myeloma cells (see, e.g., Novak et al., Blood, 103 (2): 689-694, 2004; Neri et al., Clinical Cancer Research, 73 (19): 5903-5909; Felix et al., Mol. Oncology, 9 (7): 1348-58, 2015). BCMA can bind to B-cell activating factor (BAFF) and proliferation-inclusive ligand (APRIL) (e.g., Mackay et al., 2003 and Kalled et al., Immunological Review, 204: 43-54, 2005). BCMA can be a suitable tumor antigen target for immunotherapeutic agents against multiple myeloma. High-affinity antibodies can block the binding of BCMA to its native ligands, BAFF and APRIL.

[0284] Table 1. Human BCMA protein sequence TIFF2025525390000014.tif62161

[0285] In some embodiments, the anti-BCMA binding moiety that specifically binds to an epitope on BCMA is derived from an amino acid sequence selected from SEQ ID NOs:3684-3689.

[0286] Table 2. Peptide sequences of BCMA epitopes TIFF2025525390000015.tif66161

[0287] In some embodiments, the CAR comprises an antigen-binding domain specific for TNF receptor family member B-cell maturation (BCMA). In some embodiments, the BCMA antigen-binding domain selectively binds to BCMA. In some embodiments, the BCMA antigen-binding domain binds to BCMA on target cells.

[0288] In some embodiments, a BCMA CAR disclosed herein comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 3690-3695. In some embodiments, a BCMA CAR comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3690-3695.

[0289] TIFF2025525390000016.tif200161TIFF2025525390000017.tif193161

[0290] In some embodiments, a BCMA CAR disclosed herein comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 338-417. In some embodiments, a BCMA CAR comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 3696-3775.

[0291] Table 3. Exemplary BCMA sequences TIFF2025525390000018.tif166161TIFF2025525390000019.tif214161TIFF202 5525390000020.tif214161TIFF2025525390000021.tif220161TIFF20255253900 00022.tif220161TIFF2025525390000023.tif217161TIFF2025525390000024.t if215161TIFF2025525390000025.tif215161TIFF2025525390000026.tif184161

[0292] In some embodiments, the HER2 CAR comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence from the HER2 CAR sequence of construct L described herein. In some embodiments, the CD19 CAR comprises an amino acid sequence having at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to an amino acid sequence from the CD19 CAR sequence of construct M described herein.

[0293] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence shown below for any of constructs A through M, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR shown below for any of constructs A through M. In some embodiments, the circular RNA further comprises a CD28 or 4-1BB costimulatory domain as described herein.

[0294] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct A, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct A. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct A, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct A. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0295] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct B, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct B. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct B, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct B. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0296] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct C, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct C. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct C, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct C. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0297] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct D, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct D. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct D, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct D. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0298] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct E, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct E. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct E, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct E. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0299] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct F, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct F. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct F, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct F. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0300] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct G, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct G. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct G, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct G. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0301] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct H, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct H. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct H, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct H. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0302] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct I, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct I. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct I, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct I. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0303] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct J, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct J. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct J and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct J. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0304] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct K, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct K. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct K, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct K. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0305] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct L, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct L. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct L, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct L. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0306] In some embodiments, the circular RNA comprises an IRES sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct M, and a CAR sequence encoding a polypeptide having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct M. In some embodiments, the circular RNA comprises an IRES sequence having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the IRES sequence of construct M, and a CAR sequence encoding a polypeptide having at least 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the CAR of construct M. In some embodiments, the circular RNA exhibits increased expression and / or activity compared to a suitable control having an alternative IRES. In some embodiments, the circular RNA further comprises a CD28z costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain. In some embodiments, the circular RNA further comprises a 4-1BB costimulatory domain described herein, and optionally exhibits increased activity compared to a suitable control having an alternative costimulatory domain.

[0307] TIFF2025525390000027.tif75164TIFF2025525390000028.tif219164TIFF2025525390000029.tif219164TIFF202552539000003 0.tif219164TIFF2025525390000031.tif219164TIFF2025525390000032.tif219164TIFF2025525390000033.tif219164TIFF2025 525390000034.tif219164TIFF2025525390000035.tif219164TIFF2025525390000036.tif219164TIFF2025525390000037.tif21 9164TIFF2025525390000038.tif219164TIFF2025525390000039.tif219164TIFF2025525390000040.tif219164TIFF20255253900 00041.tif219164TIFF2025525390000042.tif219164TIFF2025525390000043.tif219164TIFF2025525390000044.tif214164TIF F2025525390000045.tif219164TIFF2025525390000046.tif219164TIFF2025525390000047.tif219164TIFF2025525390000048.t if219164TIFF2025525390000049.tif219164TIFF2025525390000050.tif219164TIFF2025525390000051.tif219164TIFF2025525 390000052.tif219164TIFF2025525390000053.tif219164TIFF2025525390000054.tif219164TIFF2025525390000055.tif181164

[0308] ii. Hinge / spacer domain In some embodiments, a CAR of the present disclosure comprises a hinge domain or spacer domain. In some embodiments, the hinge / spacer domain may comprise a truncated hinge / spacer domain (THD), where the THD domain is a truncated version of the complete hinge / spacer domain ("CHD"). In some embodiments, the extracellular domain comprises ErbB2, glycophorin A (GpA), CD2, CD3 delta, CD3 epsilon, CD3 gamma, CD4, CD7, CD8a, CD8[T CD11a (IT GAL), CD11b (IT GAM), CD11c (IT GAX), CD11d (IT GAX), CD11d (IT GAX), CD11e (IT GAX), CD11f (IT GAX), CD11g (IT GAX), CD11h (IT GAX), CD11i ...GAD), CD18(ITGB2), CD19(B4), CD27(TNFRSF7), CD28, CD28T, CD29(ITGB1), CD30(TNFRSF8), CD40(TNFRSF5), CD48( SLAMF2), CD49a(ITGA1), CD49d(ITGA4), CD49f(ITGA6), CD66a(CEACAM1), CD66b(CEACAM8), CD66c(CEACAM6), CD66d (CEACAM3), CD66e (CEACAM5), CD69 (CLEC2), CD79A (B cell antigen receptor complex-associated alpha chain), CD79B (B cell antigen receptor complex-associated beta chain), CD84 (SLAMF5), CD96 (Tactile), CD100 (SEMA4D), CD103 (ITGAE), CD134 (0X40), CD137 (4-1BB), CD150 (SLAMF1), CD158A (KIR2D) L1), CD158B1(KIR2DL2), CD158B2(KIR2DL3), CD158C(KIR3DP1), CD158D(KIRDL4), CD158F1(KIR2DL5A), CD158F2(K IR2DL5B), CD158K(KIR3DL2), CD160(BY55), CD162(SELPLG), CD226(DNAM1), CD229(SLAMF3), CD244(SLAMF4), CD247 (CD3-zeta), CD258(LIGHT), CD268(BAFFR), CD270(TNFSF14), CD272(BTLA), CD276(B7-H3), CD279(PD-1), CD314(NKG 2D), CD319(SLAMF7), CD335(NK-p46), CD336(NK-p44), CD337(NK-p30), CD352(SLAMF6), CD353(SLAMF8), CD355(CRTAM), CD357 (TNFRSF18), inducible T cell costimulatory molecule (ICOS), LFA-1 (CD11a / CD18), NKG2C, DAP-10, ICAM-1, NKp80 (KLRF1), IL-2R beta, IL-2R gamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS (GrpL), SLP-76 (LCP2), PAG1 / CBP, CD83 ligand, Fc gamma receptor, MHC class 1 molecule, MHC class 2 molecule, TNF receptor protein, immunoglobulin protein, cytokine receptor, integrin, activating NK cell receptor, Toll ligand receptor, and fragments or combinations thereof (e.g., including all or fragments thereof). The hinge or spacer domain may be derived from either natural or synthetic sources.

[0309] In some embodiments, the hinge or spacer domain is located between the antigen-binding molecule (e.g., scFv) and the transmembrane domain. In this orientation, the hinge / spacer domain provides spacing between the antigen-binding molecule and the cell membrane surface on which the CAR is expressed. In some embodiments, the hinge or spacer domain is from or derived from an immunoglobulin. In some embodiments, the hinge or spacer domain is selected from the hinge / spacer region of IgG1, IgG2, IgG3, IgG4, IgA, IgD, IgE, IgM, or fragments thereof. In some embodiments, the hinge or spacer domain comprises, is derived from, or is derived from the hinge / spacer region of CD8 alpha. In some embodiments, the hinge or spacer domain comprises, is derived from, or is derived from the hinge / spacer region of CD28. In some embodiments, the hinge or spacer domain comprises a fragment of the hinge / spacer region of CD8alpha or a fragment of the hinge / spacer region of CD28, wherein the fragment is anything less than the entire hinge / spacer region. In some embodiments, the fragment of the CD8alpha hinge / spacer region or the fragment of the CD28 hinge / spacer region comprises an amino acid sequence that excludes at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 amino acids at the N-terminus or C-terminus, or both, of the CD8alpha hinge / spacer region or CD28 hinge / spacer region.

[0310] iii. Transmembrane domain The CAR of the present disclosure may further comprise a transmembrane domain and / or an intracellular signaling domain. The transmembrane domain may be designed to be fused with the extracellular domain of the CAR. It may be fused in the same way as the intracellular domain of the CAR. In some embodiments, a transmembrane domain that naturally associates with one of the domains in the CAR is used. In some examples, the transmembrane domain may be selected or modified (e.g., by amino acid substitution) to avoid binding of such domain to the transmembrane domain of the same or different surface membrane protein, in order to minimize interaction with other members of the receptor complex. The transmembrane domain may be derived from either natural or synthetic sources. If the source is natural, the domain may be derived from any membrane-bound or transmembrane protein.

[0311] Transmembrane regions include receptor tyrosine kinases (e.g., ErbB2), glycophorin A (GpA), 4-1BB / CD137, activating NK cell receptors, immunoglobulin proteins, B7-H3, BAFFR, BFAME (SEAMF8), BTEA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8 alpha, CD8 beta, CD96 (Tactile), CD1 la, CD1 lb, CD1 lc, CD1 Id, CDS, CEACAM1, and CRT. AM, cytokine receptor, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (EIGHTR), IA4, ICAM-1, ICAM-1, Ig alpha (CD79a), IE-2R beta, IE-2R gamma, IE-7R alpha, inducible T cell costimulator (ICOS), integrin, ITGA4, ITGA4, ITGA6, IT GAD, ITGAE, ITGAE, IT GAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, EAT, LFA-1, LFA-1, ligand specifically binding to CD83, LIGHT, LIGHT, LTBR, Ly9 (CD229), lymphocyte function-associated antigen-1 (LFA-1; CD1-la / CD18), MHC class 1 molecule, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SEL It may be derived from (i.e., comprise) PLG (CD162), signaling lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A; Lyl08), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6, or a fragment, truncated form or combination thereof.

[0312] In some embodiments, suitable intracellular signaling domains include, but are not limited to, activated macrophage / myeloid cell receptor CSFR1, MYD88, CD14, TIE2, TLR4, CR3, CD64, TREM2, DAP10, DAP12, CD169, Dectin-1, CD206, CD47, CD163, CD36, MARCO, TIM4, MERTK, F4 / 80, CD91, C1QR, LOX-1, CD68, SRA, BAI-1, ABCA7, CD36, CD31, lactoferrin, or fragments, truncations, or combinations thereof.

[0313] In some embodiments, the receptor tyrosine kinase is selected from the group consisting of insulin receptor (InsR), insulin-like growth factor I receptor (IGF1R), insulin receptor-related receptor (IRR), platelet-derived growth factor receptor alpha (PDGFRa), platelet-derived growth factor receptor beta (PDGFRfi), KIT proto-oncogene receptor tyrosine kinase (Kit), colony-stimulating factor 1 receptor (CSFR), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 1 (VEGFR-1), kinase insert domain receptor (VEGFR-2), fms-related tyrosine kinase 2 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 1 (VEGFR-1), fms-related tyrosine kinase 2 (VEGFR-2), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 2 (VEGFR-2), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 1 (VEGFR-1), fms-related tyrosine kinase 2 (VEGFR-2), fms-related tyrosine kinase 3 (FLT3 ...3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine kinase 3 (FLT3), fms-related tyrosine Protein tyrosine kinase 4 (VEGFR-3), fibroblast growth factor receptor 1 (FGFR1), fibroblast growth factor receptor 2 (FGFR2), fibroblast growth factor receptor 3 (FGFR3), fibroblast growth factor receptor 4 (FGFR4), protein tyrosine kinase 7 (CCK4), neurotrophic receptor tyrosine kinase 1 (trkA), neurotrophic receptor tyrosine kinase 2 (trkB), neurotrophic receptor tyrosine kinase 3 (trkC), receptor tyrosine kinase-like orphan receptor 1 (ROR1), receptor tyrosine kinase-like orphan receptor 2 ( ROR2), muscle-associated receptor tyrosine kinase (MuSK), MET proto-oncogene, receptor tyrosine kinase (MET), macrophage-stimulating 1 receptor (Ron), AXL receptor tyrosine kinase (Axl), TYR03 protein tyrosine kinase (Tyro3), MER proto-oncogene, tyrosine kinase (Mer), tyrosine kinase with immunoglobulin-like and EGF-like domains 1 (TIE1), TEK receptor tyrosine kinase (TIE2), EPH receptor A1 (EphAl), EPH receptor A2 (EphA2), (EPH receptor A 3) EphA3, EPH receptor A4 (EphA4), EPH receptor A5 (EphA5), EPH receptor A6 (EphA6), EPH receptor A7 (EphA7), EPH receptor A8 (EphA8), EPH receptor A10 (EphAlO), EPH receptor B1 (EphBl), EPH receptor B2 (EphB2), EPH receptor B3 (EphB3), EPH receptor B4 (EphB4), EPH receptor B6 (EphB6), ret proto-oncogene (Ret), receptor-like tyrosine kinase (RYK), discoidin domain receptor tyrosine kinase 1 (DDR1),It may be derived from (e.g., include) discoidin domain receptor tyrosine kinase 2 (DDR2), c-ros oncogene 1, receptor tyrosine kinase (ROS), apoptosis-related tyrosine kinase (Lmrl), lemur tyrosine kinase 2 (Lmr2), lemur tyrosine kinase 3 (Lmr3), leukocyte receptor tyrosine kinase (LTK), ALK receptor tyrosine kinase (ALK), or serine / threonine / tyrosine kinase 1 (STYK1).

[0314] iv. Costimulatory domain In certain embodiments, the CAR comprises a costimulatory domain. In some embodiments, the costimulatory domain comprises 4-1BB (CD137), CD28, or both, and / or an intracellular T cell signaling domain. In preferred embodiments, the costimulatory domain is human CD28, human 4-1BB, or both, and the intracellular T cell signaling domain is human CD3 zeta (ζ). 4-1BB, CD28, and CD3 zeta may comprise less than the entire 4-1BB, CD28, or CD3 zeta, respectively. Chimeric antigen receptors may incorporate costimulatory (signaling) domains to enhance their efficacy. See U.S. Patent Nos. 7,741,465 and 6,319,494, as well as Krause et al. and Finney et al. (supra), Song et al., Blood 119:696-706 (2012); Kalos et al., Sci Transl. Med. 3:95 (2011); Porter et al., N. Engl. J. Med. 365:725-33 (2011), and Gross et al., Amur. Rev. Pharmacol. Toxicol. 56:59-83 (2016).

[0315] In some embodiments, the costimulatory domain comprises the amino acid sequence of SEQ ID NO:3544 or 3546.

[0316] v. Intracellular signaling domain The intracellular (signaling) domain of the engineered T cells disclosed herein can provide signaling to the activation domain, which then activates at least one of the normal effector functions of an immune cell. The effector function of a T cell can be, for example, cytolytic or helper activity, including the secretion of cytokines.

[0317] In some embodiments, suitable intracellular signaling domains include 4-1BB / CD137, activating NK cell receptor, immunoglobulin proteins, B7-H3, BAFFR, BLAME (SLAMF8), BTLA, CD100 (SEMA4D), CD103, CD160 (BY55), CD18, CD19, CD19a, CD2, CD247, CD27, CD276 (B7-H3), CD28, CD29, CD3 delta, CD3 epsilon, CD3 gamma, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8 alpha, CD8 beta, CD96 (Tactile), CD1 la, CD1 lb, CD1 lc, CD1 ld, CDS, CEACAM1, CRT AM, cytokine receptor, DAP-10, DNAM1 (CD226), Fc gamma receptor, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, Ig alpha (CD79a), IL-2R beta, IL-2R gamma, IL-7R alpha, inducible T cell costimulator (ICOS), integrin, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, ITGB1, KIRDS2, LAT, LFA-1, ligand specifically binding to CD83, LIGHT, LTBR, Ly9 (CD229), Lyl08, lymphocyte function-associated antigen-1 (LFA-1; CD1-1a / CD18), MHC class 1 molecule, N including, but not limited to (e.g., comprising), KG2C, NKG2D, NKp30, NKp44, NKp46, NKp80 (KLRF1), OX-40, PAG / Cbp, programmed death-1 (PD-1), PSGL1, SELPLG (CD162), signaling lymphocyte activation molecule (SLAM protein), SLAM (SLAMF1; CD150; IPO-3), SLAMF4 (CD244; 2B4), SLAMF6 (NTB-A), SLAMF7, SLP-76, TNF receptor protein, TNFR2, TNFSF14, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6, or fragments, truncations or combinations thereof.

[0318] CD3 is an element of the T cell receptor on native T cells and has been shown to be a key intracellular activation element in CARs. In some embodiments, the CD3 is CD3 zeta. In some embodiments, the activation domain comprises an amino acid sequence that is at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the polypeptide sequence of SEQ ID NO:3545.

[0319] b. T cell receptor (TCR) TCRs are described using the International Immunogenetics (IMGT) TCR nomenclature and are linked to the IMGT public database of TCR sequences. Native alpha-beta heterodimeric TCRs have an alpha chain and a beta chain. Generally, each chain may contain a variable region, a joining region, and a constant region; beta chains usually also contain a short diversity region between the variable and joining regions, although this diversity region is often considered part of the joining region. Each variable region may contain three CDRs (complementarity-determining regions) embedded in a framework sequence, one of which is a hypervariable region called CDR3. There are several types of alpha chain variable (Vα) regions and several types of beta chain variable (Vβ) regions, distinguished by their framework, CDR1 and CDR2 sequences, and partially defined CDR3 sequences. Vα types are referenced by unique TRAV numbers in the IMGT nomenclature. Thus, "TRAV21" defines a TCR Vα region with a unique framework and CDR1 and CDR2 sequences, and a CDR3 sequence that is partially defined by amino acid sequences that are conserved among TCRs, but also includes amino acid sequences that vary among TCRs. Similarly, "TRBV5-1" defines a TCR Vβ region with a unique framework and CDR1 and CDR2 sequences, but only a partially defined CDR3 sequence.

[0320] The joining regions of the TCR are similarly defined by the unique IMGT TRAJ and TRBJ nomenclature, and the constant regions by the IMGT TRAC and TRBC nomenclature.

[0321] The beta chain diversity region is referred to by the abbreviation TRBD in the IMGT nomenclature, and as mentioned above, the linked TRBD / TRBJ regions are often together considered the linking region.

[0322] The unique sequences defined by the IMGT nomenclature are widely known and accessible to those working in the TCR field. For example, they can be found in the IMGT public database. "T cell Receptor Factsbook" (2001) LeFranc and LeFranc, Academic Press, ISBN 0-12-441352-8 also discloses sequences defined b...

Claims

1. A cyclic RNA polynucleotide encoding a chimeric antigen receptor (CAR), wherein the CAR comprises an antigen-binding molecule that specifically binds to BCMA, and includes a CDR containing CDRs 1, CDR2, and CDR3, which are determined by Kabat numbering, Chothia numbering, AbM numbering, or contact numbering of an amino acid sequence selected from the group consisting of SEQ ID NO: 3696 to 3775.

2. The cyclic RNA polynucleotide according to Claim 1, wherein the CAR comprises an amino acid sequence having at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with an amino acid sequence selected from the group consisting of SEQ ID NO: 3690 to 3695.

3. The cyclic RNA polynucleotide according to claim 1 or 2, wherein the CAR comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 3696 to 3775.

4. The cyclic RNA polynucleotide according to claim 1 or 2, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 3691.

5. The cyclic RNA polynucleotide according to claim 1 or 2, wherein the CAR comprises the amino acid sequence of SEQ ID NO: 3690.

6. The cyclic RNA polynucleotide according to claim 1 or 2, wherein the antigen-binding molecule that specifically binds to BCMA comprises the amino acid sequences of SEQ ID NO: 3708, SEQ ID NO: 3709, or both SEQ ID NO: 3708 and SEQ ID NO: 3709.

7. The cyclic RNA polynucleotide according to claim 1 or 2, wherein the antigen-binding molecule that specifically binds to BCMA comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 3708, 3709, 3740, 3741, 3742, 3743, 3744, and 3745.

8. The cyclic RNA polynucleotide according to claim 1 or 2, further comprising a polynucleotide sequence encoding a CAR containing an antigen-binding molecule that specifically binds to CD19.

9. A circular RNA polynucleotide according to claim 1 or 2, comprising a translation initiation element (TIE) including an intrasequence ribosome entry site (IRES).

10. A circular RNA polynucleotide according to claim 1 or 2, wherein the protein-coding sequence or non-protein-coding sequence is codon-optimized.

11. The circular RNA polynucleotide according to claim 1 or 2, formed from a PCR product, a linearized plasmid, a non-linearized plasmid, a linearized minicircle, a non-linearized minicircle, a viral vector, a cosmid, ceDNA, or a precursor RNA polynucleotide transcribed from a vector or DNA comprising an artificial chromosome.

12. The cyclic RNA polynucleotide according to claim 1 or 2, further comprising an internal spacer sequence.

13. The cyclic RNA polynucleotide according to claim 1 or 2, further comprising 1 to 100 natural nucleotides derived from natural exons.

14. A pharmaceutical composition comprising a cyclic RNA polynucleotide according to claim 1, nanoparticles, and optionally a target-directed moiety functionally linked to the nanoparticles.

15. The pharmaceutical composition according to claim 14, wherein the nanoparticles are lipid nanoparticles, core-shell nanoparticles, biodegradable nanoparticles, biodegradable lipid nanoparticles, polymer nanoparticles, polyplex, or biodegradable polymer nanoparticles.

16. The pharmaceutical composition according to claim 14, wherein the nanoparticles comprise one or more cationic lipids, ionizable lipids, or polyβ-aminoesters.

17. The pharmaceutical composition according to claim 14, wherein the nanoparticles comprise one or more non-cationic lipids.

18. The pharmaceutical composition according to claim 14, wherein the nanoparticles comprise one or more PEG-modified lipids, polyglutamic acid lipids, or hyaluronic acid lipids.

19. The pharmaceutical composition according to claim 14, wherein the nanoparticles comprise arachidonic acid, leukotriene, or oleic acid.

20. Use of a pharmaceutical composition for the manufacture of a pharmacopoeia for treating a subject having a disease or disorder, comprising a cyclic RNA polynucleotide according to claim 1 or 2, nanoparticles, and optionally, a target-directed moiety functionally linked to the nanoparticles.

21. The target conditions include acute myeloid leukemia (AML); alveolar rhabdomyosarcoma; B-cell malignancies; bladder cancer (e.g., bladder carcinoma); bone cancer; brain cancer (e.g., medulloblastoma and glioblastoma multiforme); breast cancer; cancer of the anus, anal canal, or anorectum; eye cancer; Intrahepatic cholangiocarcinoma; joint cancer; cervical cancer; gallbladder cancer; pleural cancer; cancer of the nose, nasal cavity, or middle ear; oral cancer; vulvar cancer; chronic lymphocytic leukemia; chronic bone marrow cancer; colon cancer; esophageal cancer, cervical cancer; fibrosarcoma; gastrointestinal carcinoid tumors; head and neck cancer (e.g., head and neck squamous cell carcinoma); Hodgkin lymphoma; hypopharyngeal cancer; kidney cancer; laryngeal cancer; leukemia; humoral neoplasms; lipoma; liver cancer; lung cancer (e.g., non-small cell lung cancer, lung adenocarcinoma, and small cell lung cancer); lymphoma; Mesothelioma; mast cell tumor; melanoma; The use of claim 20, having cancer selected from the group consisting of multiple myeloma; nasopharyngeal cancer; non-Hodgkin lymphoma; chronic lymphocytic leukemia B; hairy cell leukemia; Burkitt lymphoma; ovarian cancer; pancreatic cancer; peritoneal cancer; reticular cancer (cancer of the omentum); mesenteric cancer; pharyngeal cancer; prostate cancer; rectal cancer; renal cancer; skin cancer; small intestine cancer; soft tissue cancer; solid tumors; synovial sarcoma; gastric cancer; teratoma; testicular cancer; thyroid cancer; and ureteral cancer.

22. The use according to claim 20, wherein the subject has an autoimmune disorder selected from systemic autoimmune diseases typically represented by scleroderma, Graves' disease, Crohn's disease, Sjögren's disease, multiple sclerosis, Hashimoto's disease, psoriasis, myasthenia gravis, autoimmune polyendocrine syndrome, type 1 diabetes mellitus (TIDM), autoimmune gastritis, autoimmune uretinitis, polymyositis, colitis, thyroiditis, and human lupus.

23. A eukaryotic cell comprising a cyclic RNA polynucleotide according to claim 1 or 2 or the pharmaceutical composition according to claim 14.

24. A human cell, the eukaryotic cell according to claim 23.

25. An immune cell, the eukaryotic cell according to claim 24.

26. The eukaryotic cell according to claim 25, which is a T cell, dendritic cell, macrophage, B cell, neutrophil, or basophil.

Images