Combination of a recombinant virus expressing interleukin-12 with a PD-1 / PD-L1 inhibitor

A recombinant poxvirus expressing IL-12 and a PD-1/PD-L1 inhibitor addresses the limitations of existing cancer therapies by enhancing immune responses and targeting cancer cells effectively, improving treatment efficacy and safety.

JP2025526369APending Publication Date: 2025-08-13ASTRAZENECA AB
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025504072
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-07-27
Filing Date
2023-07-26
Publication Date
2025-08-13

AI Technical Summary

Technical Problem

Existing cancer therapies, including recombinant viruses and immune checkpoint inhibitors, face challenges with limited efficacy and adverse events, particularly in cancers resistant to immune checkpoint inhibitor therapy.

Method used

A therapeutic combination of a recombinant poxvirus encoding interleukin-12 (IL-12) and a PD-1 or PD-L1 inhibitor, utilizing specific promoters and attenuated strains, is used to enhance tumor-specific immune responses and target cancer cells while minimizing off-target effects.

Benefits of technology

The combination effectively lyses cancer cells, increases interferon-γ production, and enhances tumor-specific immune responses, offering improved therapeutic outcomes with reduced adverse events compared to individual treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025526369000012
    Figure 2025526369000012
  • Figure 2025526369000013
    Figure 2025526369000013
  • Figure 2025526369000014
    Figure 2025526369000014
Patent Text Reader

Abstract

The present disclosure relates to a therapeutic combination comprising (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) and (ii) a PD-1 inhibitor or a PD-L1 inhibitor. Methods of treating cancer and enhancing tumor-specific immune responses comprising administering the therapeutic combination are also provided.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This international application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 369,605, filed July 27, 2022, which is incorporated herein by reference in its entirety.

[0002] Reference to sequence listings submitted electronically The contents of the electronically submitted XML Sequence Listing (Name: 2943_230PC01_SequenceListing_ST26; Size: 48,263 bytes; and Creation Date: July 19, 2023) submitted with this application are hereby incorporated by reference in their entirety.

[0003] The present disclosure relates to a combination comprising (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) and (ii) an inhibitor of PD-1 / PD-L1, which can be used to treat cancer, including cancers that are resistant to immune checkpoint inhibitor therapy. [Background technology]

[0004] Recombinant viruses, including recombinant poxviruses, have become an emerging therapeutic platform for the treatment of cancer because they offer advantages over traditional treatment modalities such as chemotherapy. For example, recombinant viruses can selectively replicate in cancer cells while sparing normal cells and tissues, thereby reducing off-target cell death and toxicity, potentially providing much higher levels of efficacy and specificity than traditional cancer therapies. Recombinant viruses can be engineered to intracellularly express therapeutic transgenes, such as transgenes important in cancer biological pathways. Cancer cells are ideal hosts for many viruses because they can inactivate antiviral interferon pathways or possess mutated tumor suppressor genes that allow viral replication to proceed unimpeded.

[0005] Interleukin-12 (IL-12) is considered a potential candidate for anticancer therapy and is being evaluated by introducing it into viral vectors, such as adenoviral vectors. IL-12 is a cytokine with immunoregulatory and antiangiogenic functions. IL-12 acts as a key regulator of cell-mediated immune responses through the induction of T helper 1 differentiation and induces cell-mediated immunity by promoting interferon-gamma (IFN-γ) production, proliferation, and cytolytic activity of natural killer cells and T cells. The multifunctional properties of IL-12 have led to the investigation of this cytokine as an anticancer agent. However, despite promising results in animal models, minimal antitumor effects of IL-12 and unacceptable adverse events in early clinical trials have dampened expectations for the successful use of this cytokine.

[0006] Immune checkpoint inhibitors, such as PD-1 and PD-L1 targeting molecules, have demonstrated some success as cancer treatments. However, not all cancers respond to checkpoint inhibitors, and some cancers develop resistance to checkpoint inhibitors. Summary of the Invention [Problem to be solved by the invention]

[0007] Thus, there remains a need for new cancer therapies that have increased efficacy and / or reduced adverse events. [Means for solving the problem]

[0008] In some embodiments, the present disclosure provides a therapeutic combination comprising: (a) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12); and (b) a programmed death protein 1 (PD-1) inhibitor or a programmed death ligand 1 (PD-L1) inhibitor. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter. In some embodiments, the poxvirus belongs to the Orthopoxvirus genus. In some embodiments, the poxvirus belonging to the Orthopoxvirus genus is an oncolytic vaccinia virus. In some embodiments, the oncolytic vaccinia virus is selected from the group consisting of Copenhagen (Cop), Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, and LIVP viral strains. In some embodiments, the genome comprises at least 150 kb, at least about 175 kb, at least about 180 kb, at least about 185 kb, at least about 190 kb, at least about 192 kb, or at least about 194 kb. In some embodiments, the poxvirus is attenuated. In some embodiments, the poxvirus is not NYVAC.

[0009] In some embodiments of the therapeutic combination disclosed herein, the late promoter is selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. In some embodiments, the late promoter is selected from pA14L, pA26L, and pF17R. In some embodiments, the late promoter is pA14L. In some embodiments, the late promoter is pF17R. In some embodiments, the late promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23.

[0010] In some embodiments, the intermediate promoter is selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L. In some embodiments of the therapeutic combinations disclosed herein, the intermediate promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of any one of SEQ ID NOs:25-31.

[0011] In some embodiments of the therapeutic combinations disclosed herein, the IL-12 is human IL-12. In some embodiments, the IL-12 is a fusion protein comprising an IL-12 p40 subunit and an IL-12 p35 subunit. In some embodiments, the IL-12 p40 subunit is N-terminal to the IL-12 p35 subunit. In some embodiments, the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO: 17, or an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 17. In some embodiments, the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO: 19, or an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the IL-12 p40 subunit and the IL-12 p35 subunit are fused into a single polypeptide via an amino acid linker. In some embodiments, the amino acid linker is about 5 to about 10 amino acids in length. In some embodiments, the amino acid linker is 7 amino acids in length. In some embodiments, the amino acid linker is a glycine-serine linker. In some embodiments, the amino acid linker comprises the amino acid sequence of SEQ ID NO: 18. In some embodiments, the IL-12 comprises the amino acid sequence of SEQ ID NO: 20, or an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 20. In some embodiments, the IL-12 p40 subunit and the IL-12 p35 subunit are fused directly into a single polypeptide.In some embodiments, the heterologous nucleic acid sequence encoding IL-12 comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 comprises the nucleotide sequence of SEQ ID NO: 21.

[0012] In some embodiments of the therapeutic combinations disclosed herein, the poxvirus is deficient in thymidine kinase (TK) activity. In some embodiments, the poxvirus lacks a functional J2R gene. In some embodiments, the poxvirus is deficient in ribonucleotide reductase (RR) activity. In some embodiments, the poxvirus lacks a functional I4L gene. In some embodiments, the poxvirus lacks a functional F4L gene. In some embodiments, a heterologous nucleic acid sequence encoding IL-12 is inserted into the J2R locus of the poxvirus genome. In some embodiments, the insertion renders the J2R gene non-functional, and optionally, the J2R locus is completely deleted by the insertion. In some embodiments, a heterologous nucleic acid sequence encoding IL-12 is inserted into the I4L locus of the poxvirus genome. In some embodiments, the insertion renders the I4L gene non-functional, and optionally, the I4L locus is not fully deleted by the insertion. In some embodiments, a heterologous nucleic acid sequence encoding IL-12 is inserted into the F4L locus of a poxvirus genome. In some embodiments, the insertion renders the F4L gene non-functional, and optionally, the F4L locus is not fully deleted by the insertion. In some embodiments,

[0013] In some embodiments of the therapeutic combinations disclosed herein, the poxvirus further comprises one or more therapeutic genes in its genome, hi some embodiments, the one or more therapeutic genes are selected from the group consisting of suicide genes, immunomodulatory genes, anti-angiogenic genes, immune checkpoint inhibitor genes, antibody-encoding genes, extracellular matrix degradation or regulatory genes, and combinations thereof.

[0014] In some embodiments, the therapeutic combinations disclosed herein are capable of lysing one or more cancer cells. In some embodiments, the recombinant poxvirus is capable of expressing at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL, or about 8.3 μg / mL of IL-12 in cancer cells 72 hours post-infection at a multiplicity of infection (MOI) of 10-2. In some embodiments, the cancer cells are renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, bile duct cancer, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma cells. In some embodiments, the cancer cells are A549, HT29, MIA PaCa-2, A375, RPMI7591, Sk-Mel-5, OVCAR3, OVCAR4, NCI-H292, NCI-H460, SW780, TCCSUP, T24, Huh7, Hep3B, Panc1, Hup-T3, DAN-G, MDA-MB-435, HCC38, BT20, SW1417, WiDr, HCT-116, SNU5, NCI-N87, Kato III, A CHN, A 498, PC-3, or MM.1R cells.

[0015] In some embodiments of the therapeutic combinations disclosed herein, the virus is produced in chicken embryo fibroblasts (CEF), HeLa cells, EB66® cells, Vero cells, HEK293 cells, PerC6 cells, BHK21 cells, or MRC5 cells. In some embodiments of the therapeutic combinations disclosed herein, the virus is produced in chicken embryo fibroblasts (CEF).

[0016] In some embodiments of the therapeutic combinations disclosed herein, the recombinant poxvirus is capable of increasing interferon (IFN)-γ.

[0017] In some embodiments of the therapeutic combinations disclosed herein, the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or antigen-binding fragment thereof, or an anti-PD-L1 antibody or antigen-binding fragment thereof. In some embodiments, the anti-PD-1 antibody or antigen-binding fragment thereof, or the anti-PD-L1 antibody or antigen-binding fragment thereof is produced in Chinese hamster ovary (CHO) cells. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is a small molecule. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is a PD-1 inhibitor. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is a PD-L1 inhibitor. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is selected from the group consisting of durvalumab, nivolumab, pembrolizumab, lambrolizumab, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, pidilizumab, GLS-010, STI-1110, AGEN2034, MGA012, IBI308, AMP-224, BMS-936559, atezolizumab, MPDL3280A, RG7446, avelumab, STI-1014, CX-072, KN035, and CK-301. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or antigen-binding fragment thereof comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 32, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 34, a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 35, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 36, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 37. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 39.

[0018] In some embodiments of the therapeutic combinations disclosed herein, the anti-PD-L1 antibody or antigen-binding fragment thereof further comprises an Fc variant, wherein the Fc variant comprises at least one amino acid substitution selected from the group consisting of 234F, 235F, and 331S, as numbered according to the EU index as set forth in Kabat.

[0019] In some embodiments of the therapeutic combinations disclosed herein, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab.

[0020] In some embodiments, the present disclosure provides a therapeutic combination comprising: (a) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter; and (b) durvalumab. In some embodiments, the therapeutic combination is for (i) treating cancer, (ii) inhibiting cancer growth, or (iii) enhancing a tumor-specific immune response in a subject.

[0021] In some aspects, the present disclosure provides a therapeutic combination, wherein the therapeutic combination is a kit of parts comprising: (a) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12); and (b) a programmed death protein 1 (PD-1) inhibitor or a programmed death ligand 1 (PD-L1) inhibitor.

[0022] In some embodiments, the present disclosure provides a method of treating cancer in a subject, the method comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) and (ii) a programmed death protein 1 (PD-1) inhibitor or a programmed death ligand 1 (PD-L1) inhibitor. In some embodiments, the present disclosure provides a method of inhibiting the growth of cancer in a subject, the method comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) and (ii) a PD-1 inhibitor or a PD-L1 inhibitor. In some embodiments, the present disclosure provides a method of enhancing a tumor-specific immune response in a subject with cancer, the method comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) and (ii) a PD-1 inhibitor or a PD-L1 inhibitor. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late or intermediate promoter.

[0023] In some embodiments of the methods disclosed herein, the poxvirus belongs to the Orthopoxvirus genus. In some embodiments, the poxvirus belonging to the Orthopoxvirus genus is an oncolytic vaccinia virus. In some embodiments, the oncolytic vaccinia virus is selected from the group consisting of Copenhagen (Cop), Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, and LIVP virus strains. In some embodiments, the genome comprises at least 150 kb, at least about 175 kb, at least about 180 kb, at least about 185 kb, at least about 190 kb, at least about 192 kb, or at least about 194 kb. In some embodiments, the poxvirus is attenuated. In some embodiments, the poxvirus is not NYVAC.

[0024] In some embodiments of the methods disclosed herein, the late promoter is selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. In some embodiments, the late promoter is selected from pA14L, pA26L, and pF17R. In some embodiments, the late promoter is pA14L. In some embodiments, the late promoter is pF17R. In some embodiments, the late promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23.

[0025] In some embodiments of the methods disclosed herein, the intermediate promoter is selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, and pA27L. In some embodiments, the intermediate promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of any one of SEQ ID NOs:25-31.

[0026] In some embodiments of the methods disclosed herein, the IL-12 is human IL-12. In some embodiments, the IL-12 is a fusion protein comprising the IL-12 p40 subunit and the IL-12 p35 subunit. In some embodiments, the IL-12 is a fusion protein comprising the IL-12 p40 subunit and the IL-12 p35 subunit. In some embodiments, the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO: 17, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 17. In some embodiments, the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO: 19, or an amino acid sequence at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments, the IL-12 p40 subunit and the IL-12 p35 subunit are fused into a single polypeptide via an amino acid linker. In some embodiments, the amino acid linker is about 5 to about 10 amino acids in length, and optionally, the amino acid linker is 7 amino acids in length. In some embodiments, the amino acid linker is a glycine-serine linker. In some embodiments, the amino acid linker comprises the amino acid sequence of SEQ ID NO: 18. In some embodiments, the IL-12 comprises the amino acid sequence of SEQ ID NO: 20, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 20. In some embodiments, the IL-12 p40 subunit and the IL-12 p35 subunit are fused directly into a single polypeptide.

[0027] In some embodiments of the methods disclosed herein, the heterologous nucleic acid sequence encoding IL-12 comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO:21, optionally, the heterologous nucleic acid sequence encoding IL-12 comprises the nucleotide sequence of SEQ ID NO:21.

[0028] In some embodiments of the methods disclosed herein, the recombinant poxvirus is defective in thymidine kinase (TK) activity. In some embodiments, the recombinant poxvirus lacks a functional J2R gene. In some embodiments, the recombinant poxvirus is defective in ribonucleotide reductase (RR) activity. In some embodiments, the recombinant poxvirus lacks a functional I4L gene. In some embodiments, the recombinant poxvirus lacks a functional F4L gene. In some embodiments, a heterologous nucleic acid sequence encoding IL-12 is inserted into the J2R locus of the poxvirus genome. In some embodiments, the insertion renders the J2R gene non-functional, and optionally, the J2R locus is completely deleted by the insertion.

[0029] In some embodiments of the methods disclosed herein, the recombinant poxvirus is capable of lysing one or more cancer cells. In some embodiments, the recombinant poxvirus is capable of expressing at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL, or about 8.3 μg / mL of IL-12 in cancer cells 72 hours post-infection at a multiplicity of infection (MOI) of 10.

[0030] In some embodiments of the methods disclosed herein, the recombinant poxvirus is capable of increasing interferon (IFN)-γ.

[0031] In some embodiments of the methods disclosed herein, the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or antigen-binding fragment thereof, or an anti-PD-L1 antibody or antigen-binding fragment thereof. In some embodiments, the anti-PD-1 antibody or antigen-binding fragment thereof, or the anti-PD-L1 antibody or antigen-binding fragment thereof is produced in Chinese hamster ovary (CHO) cells. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is a small molecule. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is a PD-1 inhibitor. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is a PD-L1 inhibitor. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, lambrolizumab, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, pidilizumab, GLS-010, STI-1110, AGEN2034, MGA012, IBI308, AMP-224, BMS-936559, atezolizumab, MPDL3280A, RG7446, durvalumab, avelumab, STI-1014, CX-072, KN035, and CK-301. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or antigen-binding fragment thereof comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 32, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 34, a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 35, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 36, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO: 37. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 39. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof further comprises an Fc variant, wherein the Fc variant comprises at least one amino acid substitution selected from the group consisting of 234F, 235F, and 331S, as numbered according to the EU index as set forth in Kabat. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab.

[0032] In some embodiments of the methods disclosed herein, the cancer is renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, bile duct cancer, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma. In some embodiments, the cancer is resistant to immune checkpoint inhibitor therapy. In some embodiments, the cancer is resistant to a PD1 inhibitor. In some embodiments, the cancer is resistant to a PD-L1 inhibitor.

[0033] In some embodiments of the methods disclosed herein, the effective amount for each dose of recombinant poxvirus is 1×10 3 pfu ~ 1 × 10 12 pfu, optionally 1 × 10 4 pfu ~ 1 × 10 11 pfu, optionally 1 × 10 5 pfu ~ 1 × 10 10 pfu, optionally 5 × 10 7 pfu ~ 4 × 10 9 Contains pfu.

[0034] In some embodiments of the methods disclosed herein, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab and the effective amount of durvalumab for an individual dose is 10 mg / kg. In some embodiments of the methods disclosed herein, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab and the effective amount of durvalumab for an individual dose is 1500 mg. In some embodiments, durvalumab is administered at a dose of 10 mg / kg every 2 weeks, 1500 mg every 4 weeks, or 1500 mg every 3 weeks.

[0035] In some embodiments of the methods disclosed herein, administration results in an enhanced therapeutic effect compared to treatment with the recombinant poxvirus alone or treatment with a PD-1 inhibitor or PD-L1 inhibitor alone. In some embodiments, the subject is a human. In some embodiments, administration is intramuscular. In some embodiments, administration is intravenous. In some embodiments, intravenous administration is via intravenous infusion. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab and administration is at a dose of 10 mg / kg every two weeks. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab and administration is at a dose of 1500 mg / kg every three weeks or every four weeks. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab and administration is at a dose of 1500 mg / kg every four weeks. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab and administration is at a dose of 1500 mg / kg every three weeks.

[0036] In some embodiments of the methods disclosed herein, the recombinant poxvirus and / or the PD-1 inhibitor or PD-L1 inhibitor are administered more than once. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient prior to administration of the recombinant poxvirus. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient simultaneously with the recombinant poxvirus. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor and the recombinant poxvirus are administered in separate pharmaceutical compositions. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor and the recombinant poxvirus are administered in the same pharmaceutical composition. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient after administration of the recombinant poxvirus.

[0037] Also provided herein, in some embodiments, is a composition comprising a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding IL-12, for use in treating cancer in a subject in need thereof, wherein the composition is for administration in combination with a PD-1 inhibitor or a PD-L1 inhibitor, and optionally, wherein treatment comprises any one of the methods disclosed herein.

[0038] Also provided herein, in some embodiments, is a composition comprising a PD-1 inhibitor or a PD-L1 inhibitor for use in treating cancer in a subject in need thereof, wherein the composition is for administration in combination with a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding IL-12, and optionally, wherein treatment comprises any one of the methods disclosed herein.

[0039] Also provided herein in some embodiments is a pharmaceutical composition comprising a recombinant poxvirus comprising in its genome (i) a heterologous nucleic acid sequence encoding IL-12, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, optionally wherein the recombinant poxvirus is a recombinant poxvirus used in any one of the methods disclosed herein, and / or the PD-1 inhibitor or PD-L1 inhibitor is a PD-1 inhibitor or PD-L1 inhibitor used in any one of the methods disclosed herein. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab.

[0040] Also provided herein in some embodiments is a kit comprising a unit dosage form of (i) a pharmaceutical composition comprising a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, optionally wherein the recombinant poxvirus is a recombinant poxvirus used in any one of the methods disclosed herein, and / or the PD-1 inhibitor or PD-L1 inhibitor is a PD-1 inhibitor or PD-L1 inhibitor used in any one of the methods disclosed herein. In some embodiments of the kits disclosed herein, the PD-1 inhibitor or PD-L1 inhibitor is durvalumab. [Brief explanation of the drawings]

[0041] [Figure 1] FIG. 1 is a schematic diagram of the plasmid pTG19409. [Figure 2] Luciferase expression from six late promoters after infection / transfection of DF-1 cells is shown. [Figure 3A-B] Luciferase expression is shown 6 hours (A) and 24 hours (B) after infection of MIA PaCa-2 cells with 10 different recombinant vaccinia viruses. [Figure 4] Luciferase expression after infection of HeLa cells is shown. [Figure 5] Luciferase expression after infection of HCT-116 cells is shown. [Figure 6] GFP-positive cells are shown 6 and 24 hours after infection of human PBMCs. [Figure 7] Luciferase expression is shown 6 and 24 hours after infection of human PBMCs. [Figure 8] 1 shows the sequence of the hIL-12 expression cassette of COPTG19673 (SEQ ID NO: 21). [Figure 9] 1 is a schematic map of plasmid pTG19673. [Figure 10]1 is a schematic map of plasmid pTG19674. [Figure 11] Figure 1 shows the expression of IL-12 in the supernatant of A549 cells infected with primary research stocks COPTG19673 and COPTG19674 as measured by ELISA. [Figure 12A-C] Replication of VACV-IL-12 (COPTG19673 and COPTG19674) and armless control VACV (VVTG18058) in human tumor cell lines A549 (A), Mi PaCa-2 (B), and HT-29 (C) at 24, 48, and 72 hours postinfection is shown. [Figure 13] Replication of VACV-IL-12 (COPTG19673 and COPTG19674) and armless control VACV (VVTG18058) in manufacturer cells (HeLa and CEF) at 72 hours post-infection is shown. Results are the average of triplicate wells. [Figure 14A-C] Figure 1 shows the oncolytic activity of COPTG19673, COPTG19674, and empty VACV (VVTG18058) at various MOIs in three different human tumor cell lines: A549 (A), MIA PaCa-2 (B), and HT-29 (C). Results shown are the mean + / - SD of triplicate determinations and are expressed as percentage of cell viability (100% corresponds to mock-infected cells). [Figure 15] Figure 1 shows the expression levels of vIL-12 in the supernatants of A549, MIA PaCa-2, and HT-29 cells infected with COPTG19673 and COPTG19674 at an MOI of 0.01 after 3 days of incubation post-infection. Results are the mean and SD of triplicate determinations of three samples. [Figures 16A-F] Figure 1 shows the biological activity of IL-12 after incubation of HEK-Blue™ IL-12 cells with supernatants from COPTG19673-infected tumor cell lines (A-C) and COPTG19674-infected tumor cell lines (D-F) compared to rhIL-12, as determined using the HEK-Blue IL-12 cell reporter assay. Results are expressed as the mean ± SD of duplicate determinations. [Figures 17A-F]Figure 1 shows the biological activity of IL-12 after incubation of NK-92 cells with supernatants from COPTG19673-infected tumor cell lines (A-C) and COPTG19674-infected tumor cell lines (D-F) compared to rhIL-12, as determined using an NK-92 proliferation assay. [Figure 18]

[0039] Figure 1 shows the replication yields of VACVwt, armless control VACV (VVTG18058), COPTG19673, and COPTG19674 in human hepatocytes. Results are expressed as the replication yield, which corresponds to the ratio of viral load to input / output. Results are the average of triplicate wells. [Figure 19] Figure 1 shows the replication of VACVwt, VVTG18058, and COPTG19673 and COPTG19674 on human PBMCs. Results are expressed as replication yield, which corresponds to the ratio of viral load between input and output. Results are the average of triplicate wells. [Figure 20] Figure 29 shows the efficacy of virus-mediated tumor regression in cultured human tumor cells incubated with VACV IL-12 at different MOIs in each of three independent experiments to determine the mean EC50 of cell lysis (see also, e.g., Figure 29B). [Figure 21A-B] Virus recovered from tumors by plaque-forming assay (PFU of virus per gram of tumor tissue) (A) and intratumoral IL-12 (ng of IL-12 per gram of tumor) using a human IL-12-specific ELISA (B) are shown. Asterisks indicate time points where virus and transgene determinations were not performed. [Figures 22A-E] Experimental protocol (A), spider plots of tumor growth in C57BL / 6 mice subcutaneously implanted with MC38 colon tumors after multiple doses and intratumorally administered VACV expressing murine IL-12 (B-D), and Kaplan-Meier plot of tumor-bearing mouse survival (E) are shown. CR, complete tumor response to therapy with no detectable tumor burden; *, p=0.0024 by log-rank (Mantel-Cox) for comparison of three or more groups. [Figures 23A-E]Expression of murine IL-12 in the peripheral blood of mice 4 and 24 hours after intratumoral administration of VACV muIL-12 (A), and expression of the cytokines IFNγ (B), CXCL10 (C), IL-6 (D), and TNFα (E) are shown. *, p<0.05, one-way ANOVA with Tukey's post-hoc test. [Figure 24A-H] Figure 1 shows the antitumor activity of luciferase-expressing VACV (VACV luc) determined using primary tumors (PDX: patient-derived xenografts) from cancer-bearing patients implanted in immunocompromised NOD / SCID mice. Each tumor tested was either left untreated (open circles, gray line) or administered 1e7 VACV luc virus (closed squares, black line). Because each patient's primary tumors contained only one untreated and one treated tumor, each open circle and closed square represent a pair, but for simplicity, the graphs are grouped by tumor type. [Figure 25A-F] Shown are mRNA expression levels of IL-12RB1 (A), IL-12RB2 (B), NKp46 (NK cells) (C), PD-L1 (D), CXCL9 (E), and CXCL10 (F) genes across mouse stroma isolated from bladder, head and neck, liver, colon, lung, and ovarian cancer patient-derived xenograft models from VACV-luciferase-treated mice 48 hours after treatment on days 0 and 14. [Figures 26A-E] Figure 1 shows the efficiency of VACV-IL12 infection in human tumors in vitro, as measured by detection of IL-12p70 in supernatants from dissociated tumor cell cultures (A), expression of IL-12p70 in supernatants from tumor slice cultures (B), levels of IFNγ mRNA (C), levels of IFNγ protein (D), and levels of B8R mRNA (E). ****<0.0001, one-way ANOVA with Tukey's correction for multiple comparisons. Each dot represents one to four replicates per condition, from one slice. [Figure 26F] FIG. 1 is a schematic diagram showing the timing of VACV infection, transgene production, and immune activation. [Figure 27A-C]We demonstrate that COPTG19673 selectively replicates in tumor cells versus normal human cells, with no observable amplification in PBMCs and minimal replication in normal hepatocytes (HUCPG and HUCPI) and normal human dermal fibroblasts (NHDF) versus cancer cells (SW780). [Figure 28A-C] The experimental protocol (A), the efficacy and overall response of oncolytic VACV across multiple tumor indications (B), and the replication kinetics observed 48 hours after the first and third doses (C) are shown: CRC, colorectal cancer; HN, head and neck squamous cell carcinoma. [Figure 29A-E] Figure 1 shows the oncolytic activity of VACV-Luc and VACV IL-12 (COPTG1673) across 30 human cancer cell lines representing 12 tumor indications. Figure A shows the oncolytic activity of VACV-Luc in cultured human cancer cell lines. Figure B shows the oncolytic activity of VACV-IL12 in cultured human cancer cell lines (see also Figure 20). Figure C shows the correlation between VACV Luc and VACV-IL12 tumor regression in human tumor cell lines. Figures D and E show VACV-IL12 transgene production and replication in tumor cell lines 5 days after infection. [Figure 30A-F] Figures A-C show the antitumor efficacy of VACV IL-12 (COPTG1673) in a human xenograft tumor model. Figures A-C show the change in mean tumor burden over time at various doses of VACV-IL12 compared to VACV-Luc in mice bearing SW780, NCI-H292, and HCT-116 tumors. Figures D and E show the viral load and recovered intratumoral IL-12 over time at each dose in SW780 tumor-implanted mice. Figure F shows the human IL-12 in mouse plasma over time at each dose level of VACV-IL12 compared to VACV-Luc in the SW780 tumor model. [Figure 31A-D]Gene expression analysis of TSC cultures after VACV IL-12 (COPTG1673) infection is shown. Panel A shows the production of IL-12p70 in VACV-IL12-infected cells compared to mock-infected or VACV GFP-infected groups. Panels B–D show the production of IFN proteins (IFNγ in Panel B, IFNα2a in Panel C, and IFNβ in Panel D) in VACV-IL12-infected cells compared to mock-infected or VACV GFP-infected groups. [Figure 32A-H] VACV-muIL12 exhibits similar oncolytic activity and IL-12 bioactivity to VACV IL-12 (COPTG1673) in human tumor cells. Figure A shows the dose-dependent relationship between culture supernatant dilution of VACV-IL12-infected cells and rat IFNγ neutralization. Figures B–C show viral (Figure B) and IL-12 transgene (Figure C) production by VACV-GFP and VACV-muIL12 across three tumor cell lines. Figures D–F show percent survival versus multiplicity of infection for VACV-GFP and VACV-muIL12 in each cancer cell line. Figures G–H show plasma levels of IL-12p70 (Figure G) and IFNγ (Figure H) over time in rats implanted with F98 rat gliomas and intravenously treated with vehicle, VACV-luc, or three doses of VACV-muIL12. [Figure 33A-E] VACV-muIL12 exhibits similar oncolytic activity and IL-12 bioactivity to VACV IL-12 (COPTG1673) in cultured human tumor cells. Figures A–C show percent viability versus multiplicity of infection for VACV-LUC, VACV-muIL12, and VACV-huIL12 using cultured SW780 bladder, NCI-H292 lung, and HCT-116 colorectal tumor cell lines. Figure D shows the concentrations of IL-12p70 produced by VACV-Luc, VACV-muIL12, and VACV-huIL12 in human and mouse cells for SW780, NCI-H292, and HCT-116 tumor cell lines. Figure E shows IL-12 activity at varying concentrations of recombinant human IL-12 (rIL-12) and IL-12 measured in cell culture supernatants from cultured SW780 tumor cells treated with VACV-muIL12, VACV-huIL12, or VACV-Luc. [Fig. 34A-F] These results demonstrate that VACV-muIL12 exhibits similar oncolytic activity as VACV-LUC in mouse tumor cells and produces IL-12 at moderate viral replication across tumor cell lines. Figures A–D show percent survival versus multiplicity of infection for VACV-Luc and VACV-muIL12 in mouse tumor cell lines. Figure E shows the IL-12 concentrations produced by VACV-muIL-12 and VACV-Luc in multiple mouse tumor cell lines over a 5-day period. Figure F shows the viral load recovered in each mouse tumor cell line on day 5 for VACV-luc and VACV-muIL12. [Fig. 35A-G] These results show that VACV-muIL12 enhances antitumor immune responses in a syngeneic CT26 tumor model in mice. Figure A shows the general procedure. Figure B shows the survival curves for the vehicle control, VACV-Luc (1 x 10 PFU), and VACV-muIL12 (1 x 10 PFU). ****, p<0.0001. Figures C-E show the changes in tumor burden for the vehicle control, VACV-Luc, and VACV-muIL12. Figure F shows the plasma concentrations of IL12p70 in mice 4 and 24 hours after injection for the vehicle control, VACV-Luc, and VACV-muIL12. Figure G shows the plasma concentrations of IFN-γ in mice 4 and 24 hours after injection for the vehicle control, VACV-Luc, and VACV-muIL12. **=p<0.01, ***=p<0.001. [Figure 36A-C] Figure 1 shows tumor burden over time in CT26 tumor-implanted mice after treatment with vehicle (A), VACV-LUC (B), or VACV-muIL12 (C). The Y-axis represents tumor burden, and the X-axis represents time in days. [Figure 37A-B] 1 shows the results of an ex vivo splenocyte restimulation assay after VACV administration, in which cells were stimulated with either the VACV-specific peptide A52L (A) or the tumor-associated peptide antigen AH-1 (B). DETAILED DESCRIPTION OF THE INVENTION

[0042] In order that this disclosure may be more readily understood, certain terms are first defined. As used herein, unless otherwise expressly provided herein, each of the following terms shall have the meaning indicated below. Additional definitions are set forth throughout the application.

[0043] definition Generally, the nomenclatures and techniques used in connection with cell and tissue culture, molecular biology, and protein and oligonucleotide or polynucleotide chemistry and hybridization described herein are those well known and commonly used in the art. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may likewise be referred to by their commonly accepted one-letter codes.

[0044] Throughout this application, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. The terms "a" (or "an") and "one or more" and "at least one" may be used interchangeably herein. In certain embodiments, the words "a" or "an" mean "single." In other embodiments, the terms "a" or "an" include "two or more" or "plural."

[0045] The term "about" includes the recited number plus or minus 10%. Thus, "about 10" means 9 to 11. Reference herein to "about" a value or parameter includes (and describes) aspects directed to that value or parameter itself. For example, a description referring to "about X" includes a description of "X."

[0046] The term "or" is used to mean "and / or" unless expressly specified to refer to alternatives only or unless the alternatives are mutually exclusive, although the present disclosure supports definitions that refer to alternatives only and "and / or." Furthermore, as used herein, "and / or" should be considered a specific disclosure of each of two specific features or components, regardless of the presence or absence of other features or components. Thus, the term "and / or" used in phrases such as "A and / or B" is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Similarly, the term "and / or" when used in expressions such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B, or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0047] As used in the specification and claims, the words "comprising" (and any form of comprising, e.g., "comprise" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "includes" and "include"), or "containing" (and any form of containing, e.g., "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any recombinant virus (e.g., poxvirus), method, system, host cell, expression vector, and / or composition of the disclosure.

[0048] The use of the term "for example" and its corresponding abbreviation "eg" (whether italicized or not) means that, unless expressly stated otherwise, the particular term recited is a representative example of the present disclosure and is not intended to be limited to the particular example referenced or described.

[0049] "Nucleic acid," "nucleic acid molecule," "nucleotide," "nucleotide sequence," "oligonucleotide," or "polynucleotide" refers to a polymeric compound comprising covalently linked nucleotides. The term "nucleic acid" includes ribonucleic acid (RNA) and deoxyribonucleic acid (DNA), both of which may be single- or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA.

[0050] "Gene" refers to a collection of nucleotides that encodes a genetic product of either RNA or protein. Genes include cDNA and genomic DNA molecules.

[0051] As used herein, a "functional" gene (including a functional transgene) refers to a gene that is capable of expressing an RNA or protein product, which RNA or protein product retains at least one functional activity. As used herein, a "non-functional" gene (including a non-functional transgene) refers to a gene that is incapable of expressing an RNA or protein product that retains any functional activity. A non-functional gene can refer to a gene that has been completely removed or replaced. A non-functional gene can also refer to a gene that has been partially removed or replaced, where the partial removal or replacement renders the remainder of the gene incapable of expressing an active RNA or protein product.

[0052] A "coding sequence" is a nucleic acid sequence that can be transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. "Regulatory sequences" include nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence that influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, and stem-loop structures. The boundaries of a coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxyl) terminus. Coding sequences include, but are not limited to, prokaryotic sequences, cDNA from mRNA, genomic DNA sequences, and synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence can be located 3' of the coding sequence.

[0053] "Open reading frame", abbreviated ORF, refers to a nucleic acid sequence, either DNA, cDNA or RNA, of a length that includes a translation initiation signal or start codon, e.g., ATG or AUG, and a stop codon, and that can potentially be translated into a polypeptide sequence.

[0054] "Homologous recombination" refers to the insertion of a foreign DNA sequence (the "insert DNA sequence") into another DNA molecule (the "target DNA sequence"). In some cases, the insert DNA sequence is targeted to a specific site within the target DNA sequence for homologous recombination. In targeted homologous recombination, the insert DNA sequence typically contains a sufficiently long region of sequence homology with that of the target DNA sequence to allow complementary binding and integration of the insert DNA sequence into the target DNA sequence. Longer regions of complementarity and greater degrees of sequence similarity generally increase the efficiency of homologous recombination.

[0055] "Heterologous" refers to the relationship of one nucleic acid or amino acid sequence to one or more different nucleic acid or amino acid sequences, indicating that the sequences are not found joined in the same position, structure, and orientation in nature. The joining of heterologous sequences creates a juxtaposition of non-natural sequences. Such joining is the product of engineering performed in the laboratory. The product of such joining may be referred to as "recombinant."

[0056] Two heterologous nucleic acid or amino acid sequences can be directly linked (fused) or linked by a "linker." In certain embodiments, the linker is a chemical linker. In certain embodiments, the linker comprises one or more amino acids. A glycine-serine linker contains both glycine and serine amino acids in any ratio, e.g., GGGS.

[0057] "Operably linked" means that the polynucleotide of interest is linked to a regulatory element that allows for expression of the polynucleotide sequence. In some embodiments provided herein, the regulatory element is a promoter.

[0058] "Promoter" refers to a nucleic acid sequence that either directly or indirectly controls the transcription of a nucleic acid coding sequence to which it is operably linked.

[0059] An "endogenous promoter" is a promoter that is naturally associated with a gene or nucleic acid sequence. An endogenous promoter can be obtained, for example, by isolating the 5' non-coding sequences located upstream of the coding segment and / or exon. A "recombinant" or "heterologous" promoter is a promoter that is not normally associated with a nucleic acid sequence in its natural environment.

[0060] A "late promoter" is a promoter naturally associated with the expression of late genes. An "intermediate promoter" is a promoter that controls the expression of genes that follow the expression of early genes but are not controlled by late promoters. Genes that are expressed early in the viral life cycle and precede the expression of intermediate and late genes are termed "early promoters." Expression of late and intermediate genes controlled by intermediate / late promoters is dependent on viral replication (as opposed to expression of early genes, whose expression is independent of viral replication). The time frames for expression of early, intermediate, and late promoters are distinguishing factors, as discussed in Yang, et al., J. Virol., Vol. 85, No. 19, p. 9899-9908 (2011), citing Baldick et al., J. Virol., 67: 3515-3527, (1993), each of which is incorporated herein by reference. Baldick disclosed that early, intermediate, and late mRNAs could be detected at 20, 100, and 140 minutes, respectively, after synchronous infection of HeLa cells with VACV. Yang constructed genome-wide early, intermediate, and late transcription maps and revealed distinctive characteristics of intermediate and late promoters. As used herein, the terms "intermediate promoter" and "late promoter" can refer to any of the intermediate and late promoters discussed in Yang, particularly those shown in Figure 8.

[0061] Representative late promoters include, but are not limited to, pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. Representative intermediate promoters include, but are not limited to, pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L.

[0062] A "vector" refers to a carrier nucleic acid molecule or vehicle that can be introduced into a cell where it can be replicated. An "expression vector" refers to a vector containing a nucleic acid sequence encoding at least part of a gene product that can be transcribed. Expression vectors typically contain one or more control sequences necessary for the transcription and / or translation of an operably linked coding sequence. Vectors can be introduced into desired host cells by known methods, including, but not limited to, transfection, transduction, cell fusion, and lipofection.

[0063] "Transfection" refers to the introduction of an exogenous nucleic acid molecule into a cell. A "transfected" cell contains an exogenous nucleic acid molecule inside the cell, and a "transformed" cell is one in which the exogenous nucleic acid molecule inside the cell induces a phenotypic change in the cell.

[0064] The terms "peptide," "polypeptide," and "protein" are used interchangeably herein to refer to polymeric forms of amino acids of any length, and can include coded and non-coded amino acids, chemically or biochemically modified or derivatized amino acids, and polypeptides with modified peptide backbones.

[0065] The beginning of a protein or polypeptide is known as the "N-terminus" (or amino-terminus, NH2-terminus, N-terminal end, or amine-terminus), which refers to the free amine (-NH2) group of the first amino acid residue of the protein or polypeptide. The end of a protein or polypeptide is known as the "C-terminus" (or carboxy-terminus, carboxyl-terminus, C-terminal end, or COOH-terminus), which refers to the free carboxyl group (-COOH) of the last amino acid residue of the protein or polypeptide.

[0066] As used herein, "amino acid" refers to a compound containing both a carboxyl (-COOH) and an amino (-NH2) group. "Amino acid" refers to both natural and unnatural (e.g., synthetic) amino acids. Natural amino acids with three-letter and one-letter abbreviations include alanine (Ala; A); arginine (Arg, R); asparagine (Asn; N); aspartic acid (Asp; D); cysteine (Cys; C); glutamine (Gln; Q); glutamic acid (Glu; E); glycine (Gly; G); histidine (His; H); isoleucine (Ile; I); leucine (Leu; L); lysine (Lys; K); methionine (Met; M); phenylalanine (Phe; F); proline (Pro; P); serine (Ser; S); threonine (Thr; T); tryptophan (Trp; W); tyrosine (Tyr; Y); and valine (Val; V).

[0067] An "amino acid substitution" in a polypeptide or protein refers to a polypeptide or protein containing one or more substitutions of a wild-type or naturally occurring amino acid at that amino acid residue with an amino acid that is different from the wild-type or naturally occurring amino acid. The substituted amino acid may be a synthetic or naturally occurring amino acid. In some embodiments, the substituted amino acid is a naturally occurring amino acid selected from the group consisting of A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, and V. Substitution variants may be described using an abbreviation system. For example, a substitution variant in which the fifth amino acid residue has been substituted can be abbreviated as "X5Y," where "X" is the wild-type or naturally occurring amino acid that is replaced, "5" is the position of the amino acid residue within the amino acid sequence of the protein or polypeptide, and "Y" is the replacing amino acid or non-wild-type or non-natural amino acid.

[0068] An "isolated" polypeptide, protein, peptide, or nucleic acid has been removed from its natural environment. It should also be understood that an "isolated" polypeptide, protein, peptide, or nucleic acid can be formulated with an excipient, e.g., a diluent or auxiliary agent, and still be considered isolated.

[0069] The term "recombinant," when used in reference to a nucleic acid molecule, peptide, polypeptide, or protein, means or results from a new combination of genetic material not known to occur in nature. Recombinant molecules can be produced by any of the well-known techniques available in the field of recombinant technology, including, but not limited to, polymerase chain reaction (PCR), gene splicing (e.g., using restriction endonucleases), and solid-phase synthesis of nucleic acid molecules, peptides, or proteins.

[0070] "Poxvirus" refers to viruses of the Poxviridae family, including, for example, viruses of the Orthopoxvirus genus. The "genome" of a recombinant poxvirus provided herein includes a poxvirus genome that contains one or more deletions (removals) of endogenous sequences (genes or nucleotides) and / or additions of one or more heterologous sequences (genes and / or nucleotides). For example, a recombinant poxvirus genome can refer to the genome of an attenuated poxvirus.

[0071] "Oncolytic virus" refers to a DNA or RNA virus that preferentially infects and kills cancer cells compared to normal cells. Oncolytic viruses can kill cancer cells through a number of mechanisms, including direct oncolysis or apoptosis of infected cells, apoptotic death of uninfected cells, and by inducing an immune response against the cancer cells. In direct oncolysis, the virus causes lysis or apoptosis of host cells as a direct result of replication or infection.

[0072] "Oncolytic activity" refers to the ability of a virus to preferentially infect and kill cancer cells relative to normal cells. Cancer cell death can be caused by preferentially infecting, replicating, and destroying cancer cells (referred to as "direct cytotoxic activity") and by simulating and amplifying the host's anti-cancer immune response, which can establish persistent immunity in addition to destroying existing cancer cells. Oncolytic activity can be detected by known methods, including, but not limited to, detecting cell death or apoptosis, inhibiting cell proliferation, and / or detecting a reduction in tumor size.

[0073] A virus is considered "cytotoxic" if it reduces the cell viability of treated target cells relative to untreated target cells. Methods for determining viral cytotoxicity are known, including cytotoxicity assays that measure cell necrosis and / or apoptosis after viral infection, such as the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay and other related tetrazolium salt-based assays (e.g., XTT, MTS, or WST), ATP assays, apoptosis assays such as TUNEL staining of infected cells, DNA fragmentation assays, DNA laddering assays, and cytochrome C release assays. Another method for measuring cytotoxicity is to monitor tumor size and location before and after treatment. In some cases, it may be desirable to monitor the size over several time points to obtain information about the increase or decrease in tumor or metastasis size.

[0074] An "attenuated virus" refers to a virus that is non-pathogenic and has reduced toxicity to normal or non-cancerous cells. An attenuated virus can be attenuated in pathogenicity or recombinantly modified to be non-pathogenic in normal tissues. In some embodiments, the modification does not affect, or only minimally affects, the oncolytic ability of the virus.

[0075] A "pathogenic virus" is a virus that causes disease. In some embodiments, the recombinant poxvirus provided herein is not a pathogenic virus.

[0076] "Replication competent" refers to the ability of a virus to replicate in a cell or cell line and produce infectious progeny virus particles. Viruses that can produce infectious progeny virus particles in a cell or cell line are considered "replication competent," while viruses that cannot produce infectious progeny virus particles in a cell or cell line are considered "replication deficient." Viral replication can be expressed as the ratio of virus produced by infected cells to the amount used to infect the cells, and is referred to as the "amplification factor." An amplification factor of 1 or greater means that the amount of virus produced from infected cells is equal to or greater than the amount used to infect the cells, indicating replication has occurred, whereas an amplification factor of less than 1 means that the amount of virus produced from infected cells is less than the amount used to infect the cells, indicating no replication has occurred within the cells.

[0077] As used herein, the terms "interleukin-12," "IL-12," and "IL12" refer to a protein comprising a p35 subunit (IL-12A) and a p40 subunit (IL-12B). The p35 and p40 subunits can be expressed as separate proteins that heterodimerize, or can be expressed together as a single fusion protein.

[0078] The terms "cell proliferative disorder" and "proliferative disorder" refer to disorders associated with some degree of abnormal cell proliferation. Cell proliferative disorders can include cancer.

[0079] "Cancer" or "cancerous" refers to the physiological condition in mammals characterized by unregulated cell growth, lack of differentiation, local tissue invasion and / or metastasis. "Tumor" refers to an abnormal growth of cells in a tissue. The terms "cancer," "cancerous," "cell proliferative disorder," "proliferative disorder," and "tumor" are not mutually exclusive.

[0080] An "effective amount" refers to an amount sufficient to reproducibly produce a detectable result, for example, in vitro or when administered to a patient. A "therapeutically effective amount" refers to an amount sufficient to produce a therapeutically significant change in one or more symptoms of the condition when administered to a patient having the condition. In one embodiment, a therapeutically effective amount is sufficient to treat cancer.

[0081] A "PD-1 inhibitor" refers to an agent that reduces the amount or activity of PD-1. For example, a PD-1 inhibitor can be an agent that binds to the PD-1 protein and inhibits its interaction with PD-L1. A PD-1 inhibitor can be, for example, an antibody or antigen-binding fragment thereof that binds to PD-1, a peptide-based inhibitor, a small molecule, or an antibody-drug conjugate. In some embodiments, the PD-1 inhibitor is an antibody or antigen-binding fragment thereof that binds to PD-1. PD-1 inhibitors include, but are not limited to, pembrolizumab (Keytruda), nivolumab (Opdivo), and cemiplimab (Libtayo).

[0082] A "PD-L1 inhibitor" refers to an agent that reduces the amount or activity of PD-L1. For example, a PD-L1 inhibitor can be an agent that binds to the PD-L1 protein and inhibits its interaction with PD-1. A PD-L1 inhibitor can be, for example, an antibody or antigen-binding fragment thereof that binds to PD-L1, a peptide-based inhibitor, a small molecule, or an antibody-drug conjugate. In some embodiments, the PD-L1 inhibitor is an antibody or antigen-binding fragment thereof that binds to PD-L1. PD-L1 inhibitors include atezolizumab (Tecentriq), avelumab (Bavencio), and durvalumab (Imfinzi).

[0083] As used herein, the terms "antibody" and "immunoglobulin" are used interchangeably and refer to an antibody molecule that recognizes and specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or a combination of the foregoing (e.g., glycoprotein), via at least one antigen recognition site within the variable region of the immunoglobulin molecule. The term "antibody" encompasses monoclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, bispecific antibodies, and any other immunoglobulin molecule, so long as the antibody exhibits the desired biological activity. Antibodies may be any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or their subclasses (isotypes) (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) (based on the identity of the heavy chain constant domains, called alpha, delta, epsilon, gamma, and mu, respectively). Different classes of antibodies have different, well-known subunit structures and three-dimensional configurations. For the structure and properties of different classes of antibodies, see, e.g., Basic and Clinical Immunology, 8th Ed., Daniel P. Stites, Abba I. Terr and Tristram G. Parslow (eds.), Appleton & Lange, Norwalk, CT, 1994, page 71, and Chapter 6.

[0084] The term "antibody fragment" refers to a portion of an antibody. An "antigen-binding fragment" of an antibody refers to a portion of an antibody that binds to an antigen. An antigen-binding fragment of an antibody may include an antigen-determining region of the antibody (e.g., a complementarity-determining region (CDR)). Examples of antigen-binding fragments of an antibody include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, and single-chain antibodies. An antigen-binding fragment of an antibody may be monovalent or multivalent (e.g., bivalent). Antigen-binding fragments of an antibody may be obtained from any animal species, including rodents (e.g., mice, rats, or hamsters) and humans, or may be artificially generated.

[0085] An "antigen-binding domain" or "antigen-binding region" refers to the monovalent portion of an antibody that binds to an antigen. An "antigen-binding domain" may comprise an antigen-determining region of an antibody (e.g., a complementarity-determining region (CDR)). Antibodies or antigen-binding fragments thereof (including monospecific and multispecific (e.g., bispecific) antibodies or antigen-binding fragments thereof) may comprise an antigen-binding domain.

[0086] In natural antibodies, the six "complementarity-determining regions" or "CDRs" present in each antigen-binding domain are short, discontinuous sequences of amino acids that are specifically positioned to form the antigen-binding domain as the antibody assumes its three-dimensional shape in an aqueous environment. The remainder of the amino acids in the antigen-binding domain, referred to as the "framework" regions, exhibit less intramolecular variability. The framework regions generally adopt a β-sheet conformation, with the CDRs forming loops that connect, and in some cases are part of, the β-sheet structure. Thus, the framework regions act to form a scaffold that provides positioning of the CDRs in a correct orientation through intrachain noncovalent interactions. The antigen-binding domain formed by the positioned CDRs defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface promotes noncovalent binding of the antibody to its cognate epitope. The amino acids that constitute the CDRs and framework regions, respectively, have been precisely defined and can be readily identified by one of skill in the art for any given heavy or light chain variable region (see "Sequences of Proteins of Immunological Interest," Kabat, E., et al., USDapartment of Health and Human Services, (1983); and Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987), which are incorporated herein by reference in their entireties).

[0087] The term "Kabat numbering" and similar terms are recognized in the art and refer to a system for numbering amino acid residues within the heavy and light chain variable regions of an antibody or antigen-binding fragment thereof. In certain embodiments, CDRs may be determined according to the Kabat numbering system (see, e.g., Kabat EA & Wu TT (1971) Ann NY Acad Sci 190:382-391 and Kabat EA et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, USDapartment of Health and Human Services, NIH Publication No. 91-3242). Using the Kabat numbering system, the CDRs in an antibody heavy chain molecule are typically located at amino acid positions 31-35 (which may optionally include one or two additional amino acids following 35, designated 35A and 35B in the Kabat numbering scheme) (CDR1), 50-65 (CDR2), and 95-102 (CDR3). Using the Kabat numbering system, the CDRs in an antibody light chain molecule are typically located at amino acid positions 24-34 (CDR1), 50-56 (CDR2), and 89-97 (CDR3). In some embodiments, the CDRs of the antibodies described herein are determined according to the Kabat numbering system.

[0088] Chothia instead refers to the location of the structural loops (Chothia and Lesk, J. Mol. Biol. 196:901-917 (1987)). The end of the Chothia CDR-H1 loop, when numbered using the Kabat numbering convention, varies from H32 to H34 depending on the length of the loop (this is because the Kabat numbering scheme places insertions at H35A and H35B; if neither 35A nor 35B are present, the loop ends at 32; if only 35A is present, the loop ends at 33; and if both 35A and 35B are present, the loop ends at 34). The AbM hypervariable regions represent a compromise between the Kabat CDRs and the Chothia structural loops and are used by Oxford Molecular's AbM antibody modeling software.

[0089] [Table 1]

[0090] As used herein, the term "heavy chain," when used in reference to an antibody, can refer to any distinct type, e.g., alpha (a), delta (d), epsilon (e), gamma (g), and mu (m), which give rise to the IgA, IgD, IgE, IgG, and IgM classes of antibodies, respectively, including the subclasses of IgG, e.g., IgG1, IgG2, IgG3, and IgG4, based on the amino acid sequence of the constant domain. Heavy chain amino acid sequences are well known in the art. In certain embodiments provided herein, the heavy chain is a human heavy chain.

[0091] As used herein, the term "light chain," when used in reference to an antibody, can refer to any distinct type, such as κ (kappa) or λ (lambda), based on the amino acid sequence of the constant domain. Light chain amino acid sequences are well known in the art. In certain embodiments provided herein, the light chain is a human light chain.

[0092] Both light and heavy chains are divided into regions of structural and functional homology. The terms "constant" and "variable" are used functionally. In this regard, it is recognized that the variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity. Conversely, the constant domains of the light (CL) and heavy chains (CH1, CH2, or CH3) confer important biological properties, such as secretion, transplacental transfer, Fc receptor binding, complement binding, etc. By convention, the numbering of constant region domains increases as they become more distant from the antigen-binding site or amino terminus of the antibody. The N-terminal portion is the variable region, and the C-terminal portion contains the constant region; indeed, the CH3 and CL domains comprise the carboxy termini of the heavy and light chains, respectively.

[0093] As described above, the variable regions enable a binding molecule to selectively recognize and specifically bind to an epitope on an antigen. That is, the VL and VH domains of a binding molecule, e.g., an antibody, or a subset of its complementarity-determining regions (CDRs), combine to form the variable regions that define a three-dimensional antigen-binding site. This quaternary binding molecule structure forms the antigen-binding site present at the end of each arm of the Y. More specifically, the antigen-binding site is defined by the three CDRs of each of the VH and VL chains.

[0094] A "monoclonal" antibody or antigen-binding fragment thereof refers to a population of homogeneous antibodies or antigen-binding fragments involved in highly specific recognition and binding of a single antigenic determinant or epitope. This is in contrast to polyclonal antibodies, which typically contain different antibodies directed against different antigenic determinants. The term "monoclonal" antibody or antigen-binding fragment thereof encompasses both intact and full-length monoclonal antibodies, as well as antibody fragments (e.g., Fab, Fab', F(ab')2, Fv), single-chain (scFv) variants, fusion proteins containing an antibody portion, and any other modified immunoglobulin molecule containing an antigen recognition site. Furthermore, a "monoclonal" antibody or antigen-binding fragment thereof refers to antibodies and antigen-binding fragments thereof produced by any number of methods, including, but not limited to, by hybridoma, phage selection, recombinant expression, and transgenic animals.

[0095] As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin, and include antibodies isolated from human immunoglobulin libraries described below and in, for example, U.S. Pat. No. 5,939,598 by Kucherlapati et al., or from animals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins.

[0096] "Patient," "subject," and "individual" are used interchangeably and refer to an animal to which treatment is provided, including humans and non-human animals, including, for example, primates, cows, pigs, sheep, goats, dogs, cats, rabbits, and rodents, as well as non-mammals such as chickens, amphibians, and reptiles. In one embodiment, the subject is a human. In one embodiment, the subject is a human with cancer. In another embodiment, the subject is an experimental animal or an animal disease model.

[0097] The terms "treat" or "treatment" refer to therapeutic treatments whose purpose is to reduce or eliminate one or more symptoms. Beneficial or desired results include, but are not limited to, elimination of symptoms, alleviation of symptoms, reduction in the severity of a condition, stabilization of a condition (e.g., not worsening), or slowing or retarding the progression of a condition. Treating cancer can include inducing cell death of cancer cells or cells within a tumor.

[0098] "Tumor progression" refers to the stages of a tumor, including tumor formation, tumor growth and proliferation, invasion, and metastasis. "Inhibition of tumor progression" refers to inhibiting the initiation, growth, proliferation, or spread of a tumor, and includes, for example, inhibiting or reducing tumor growth; reducing the number of cancer cells; reducing tumor size; inhibiting or reducing cancer cell invasion into adjacent peripheral organs and / or tissues; inhibiting or reducing metastasis; increasing the survival time of a patient or patient population after treatment; and / or reducing the mortality rate of a patient or patient population at a given time point after treatment.

[0099] The terms "combination," "therapeutic combination," "combination composition," "combination therapy," or "pharmaceutical combination," as used herein, can include a fixed combination in one unit dosage form, separate unit dosage forms, or a kit of parts or instructions for combined administration, in which the recombinant poxvirus and the PD-1 / PD-L1 inhibitor can be administered simultaneously or separately and independently within a time interval. The combined pharmaceutical composition can be adapted for simultaneous, separate, or sequential administration. Thus, administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) or consecutive administration in any order.

[0100] Recombinant poxvirus, method for producing recombinant poxvirus, and composition containing same Provided herein is a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter. Such recombinant poxviruses are particularly advantageous in that they exhibit cell specificity that preferentially kills cancer cells while minimizing deleterious effects on healthy, non-cancerous cells.

[0101] In some embodiments, the poxvirus belongs to the Orthopoxvirus genus. In some embodiments, the poxvirus belonging to the Orthopoxvirus genus is a vaccinia virus. In some embodiments, the poxvirus belonging to the Orthopoxvirus genus is an oncolytic vaccinia virus. In some embodiments, the oncolytic vaccinia virus is selected from the group consisting of Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, LIVP, and Copenhagen (Cop) strains. In some embodiments, the oncolytic vaccinia virus is selected from the Copenhagen (Cop) strain.

[0102] In some embodiments of the recombinant poxvirus provided herein, the genome of the recombinant poxvirus comprises at least 150 kilobases (kb), at least 175 kb, at least 180 kb, at least 185 kb, at least 190 kb, at least 192 kb, or at least 194 kb. In some embodiments of the recombinant poxvirus provided herein, the genome of the recombinant poxvirus comprises between about 150 kb and 200 kb.

[0103] In some embodiments, the recombinant poxvirus is attenuated.

[0104] As provided herein, a variety of late promoters can be used in recombinant poxviruses. In some embodiments of the recombinant poxviruses disclosed herein, the recombinant poxvirus comprises a late promoter selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R. In some embodiments, the late promoter is selected from pA14L, pA26L, and pF17R. In some embodiments, the late promoter is pA14L or pF17R. In some embodiments, the late promoter is pA14L. In some embodiments, the late promoter is pF17R.

[0105] The sequences of the late promoters pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R are provided in Table 1 below.

[0106] [Table 2]

[0107] As provided herein, various intermediate promoters can be used in recombinant poxviruses. In some embodiments of the recombinant poxviruses disclosed herein, the recombinant poxvirus comprises an intermediate promoter selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L.

[0108] The sequences of the intermediate promoters pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L are provided in Table 2 below.

[0109] [Table 3]

[0110] In some embodiments, the late promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 11.

[0111] In some embodiments, the late promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 22. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 22.

[0112] In some embodiments, the late promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 13.

[0113] In some embodiments, the late promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 23. In some embodiments, the late promoter comprises the nucleotide sequence of SEQ ID NO: 23.

[0114] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 25. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 25.

[0115] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 26. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO:26.

[0116] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 27. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO:27.

[0117] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 28. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO:28.

[0118] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 29. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 29.

[0119] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 30. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 30.

[0120] In some embodiments, the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 31. In some embodiments, the intermediate promoter comprises the nucleotide sequence of SEQ ID NO: 31.

[0121] As described above, the recombinant poxvirus provided herein comprises a heterologous nucleic acid sequence encoding IL-12 in its genome. The IL-12 can be human IL-12. The IL-12 can be mouse IL-12.

[0122] In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 is a fusion protein comprising an IL-12 p40 subunit and an IL-12 p35 subunit. The IL-12 p40 subunit can be N-terminal to the IL-12 p35 subunit. Alternatively, the IL-12 p40 subunit can be C-terminal to the IL-12 p35 subunit. The IL-12 p40 subunit and the IL-12 p35 subunit can be fused directly (i.e., without a linker) or fused via a linker. The linker can be, for example, a chemical linker or an amino acid linker. The amino acid linker can be a glycine-serine linker. In some embodiments, the linker is about 5 to about 10 amino acids in length. In some embodiments, the linker is 7 amino acids in length. In some embodiments, the linker comprises the amino acid sequence of SEQ ID NO: 18.

[0123] Widely used vaccinia virus vectors include highly attenuated strains such as New York vaccinia virus (NYVAC). In some embodiments of the recombinant poxvirus disclosed herein, the recombinant poxvirus is not NYVAC.

[0124] In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 17. In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO: 17.

[0125] In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p35 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO: 19.

[0126] In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 17, and the IL-12 p35 subunit comprises an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO: 19. In some embodiments of the recombinant poxvirus disclosed herein, the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO: 17, and the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO: 19.

[0127] In some embodiments of the recombinant poxvirus disclosed herein, the heterologous nucleic acid sequence encoding IL-12 comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, the heterologous nucleic acid sequence encoding IL-12 comprises the nucleotide sequence of SEQ ID NO: 21.

[0128] In some embodiments of the recombinant poxvirus disclosed herein, the heterologous nucleic acid sequence encodes the IL-12 amino acid sequence of SEQ ID NO:20, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:20.

[0129] In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus is defective with respect to thymidine kinase (TK). In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus lacks a functional J2R gene.

[0130] In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus is defective in ribonucleotide reductase (RR) activity. In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus lacks a functional I4L gene. In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus lacks a functional F4L gene. In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus lacks a functional I4L gene and a functional F4L gene.

[0131] In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus is defective in thymidine kinase (TK) and / or ribonucleotide reductase (RR) activity. In some embodiments of the recombinant poxvirus disclosed herein, the poxvirus lacks a functional J2R gene and a functional I4L gene. In some embodiments, the poxvirus lacks a functional J2R gene and a functional F4L gene. In some embodiments, the poxvirus lacks a functional J2R gene, a functional I4L gene, and a functional F4L gene.

[0132] In some embodiments of the recombinant poxvirus disclosed herein, a heterologous nucleic acid sequence encoding IL-12 is inserted into the J2R locus of the poxvirus genome. In some embodiments, the insertion renders the J2R gene non-functional. In some embodiments, the J2R locus is completely deleted by the insertion. In some embodiments, the J2R locus is not fully deleted by the insertion.

[0133] In some embodiments of the recombinant poxvirus disclosed herein, a heterologous nucleic acid sequence encoding IL-12 is inserted into the I4L locus of the poxvirus genome. In some embodiments, the insertion renders the I4L gene non-functional. In some embodiments, the I4L locus is completely deleted by the insertion. In some embodiments, the I4L locus is not fully deleted by the insertion.

[0134] In some embodiments of the recombinant poxvirus disclosed herein, a heterologous nucleic acid sequence encoding IL-12 is inserted into the F4L locus of the poxvirus genome. In some embodiments, the insertion renders the F4L gene non-functional. In some embodiments, the F4L locus is completely deleted by the insertion. In some embodiments, the F4L locus is not fully deleted by the insertion.

[0135] In some embodiments of the recombinant poxvirus disclosed herein, in addition to encoding IL-12, the poxvirus further encodes one or more therapeutic genes. In some embodiments, the one or more therapeutic genes are selected from the group consisting of a suicide gene, an immunomodulatory gene, an anti-angiogenic gene, an immune checkpoint inhibitor gene, an antibody-encoding gene, an extracellular matrix degradation or regulatory gene, or a combination thereof.

[0136] In some embodiments of the recombinant poxvirus disclosed herein, the recombinant poxvirus is capable of lysing one or more cancer cells.

[0137] In some embodiments, the recombinant poxvirus is -2In some embodiments, the recombinant poxvirus can express at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL, or about 8.3 μg / mL of IL-12 in cancer cells (e.g., A549 cells) 72 hours post-infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 50 ng / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 1 μg / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 2 μg / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 3 μg / mL to about 50 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 1 μg / mL to about 40 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 2 μg / mL to about 40 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2In some embodiments, the recombinant poxvirus can express about 3 μg / mL to about 40 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 1 μg / mL to about 30 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 2 μg / mL to about 30 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 3 μg / mL to about 30 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 1 μg / mL to about 25 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 In some embodiments, the recombinant poxvirus can express about 2 μg / mL to about 25 μg / mL of IL-12 in cancer cells 72 hours after infection at a multiplicity of infection (MOI) of 10. -2 At a multiplicity of infection (MOI) of about 10 μg / mL to about 25 μg / mL of IL-12 can be expressed in cancer cells 72 hours after infection.

[0138] In some embodiments, cancer cells that can be lysed by and / or express IL-12 from the recombinant poxvirus provided herein include, but are not limited to, renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, bile duct cancer, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma cells. In some embodiments, such cancer cells are A549, HT29, or MIA PaCa-2 cells.

[0139] In some embodiments of the recombinant poxvirus disclosed herein, the virus is produced in chicken embryo fibroblasts (CEF), HeLa cells, EB66® cells, Vero cells, HEK293 cells, PerC6 cells, BHK21 cells, or MRC5 cells. In some embodiments of the recombinant poxvirus disclosed herein, the virus is produced in chicken embryo fibroblasts (CEF).

[0140] In some embodiments, the recombinant poxvirus is capable of increasing interferon (IFN)-γ.

[0141] In some embodiments, the recombinant poxviruses disclosed herein are produced in suitable host cell lines or suitable producer cells using conventional techniques, including culturing transfected or infected host cells under suitable conditions to allow for the production and recovery of infectious poxvirus particles.

[0142] Also provided herein are methods for producing a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter. In some embodiments, the method for producing a recombinant poxvirus comprises the steps of: a) obtaining or preparing producer cells; b) infecting the obtained or prepared producer cells with a recombinant poxvirus; and c) culturing the infected producer cells under suitable conditions to allow for the production of the recombinant poxvirus. In some embodiments, such methods further comprise the step of: d) recovering the produced recombinant poxvirus from the culture of the producer cells. In some embodiments, such methods further comprise the step of e) purifying the recovered recombinant poxvirus. In some embodiments, the producer cells are chicken embryo fibroblast (CEF), HeLa, EB66®, Vero, HEK293, PerC6, BHK21, or MRC5 cells. In some embodiments, the producer cells are chicken embryo fibroblast (CEF). Recombinant poxviruses produced by such methods are also provided herein.

[0143] In some embodiments, the producer cells in step a) can be cultured in an appropriate medium, which can be supplemented with serum and / or suitable growth factors as needed (e.g., a chemically defined medium that does not contain animal- or human-derived products can be used). An appropriate medium can be selected by one of skill in the art depending on the producer cells. Such media are commercially available. The producer cells are cultured at a temperature of +30°C to +38°C (e.g., about 37°C) for 1 to 8 days before infection. If necessary, the cells can be passaged several times over a 1 to 8 day period to increase the total cell number.

[0144] Also provided herein is a pharmaceutical composition comprising a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter. In some embodiments, the present disclosure provides a pharmaceutical composition comprising a recombinant poxvirus described herein and a pharmaceutically acceptable carrier. In some embodiments, the present disclosure provides a composition comprising a therapeutically effective amount of the recombinant poxvirus and a pharmaceutically acceptable carrier. In some embodiments, the therapeutically effective amount for an individual dose of a recombinant poxvirus described herein is 1×10 3 pfu ~ 1 × 10 12 In some embodiments, the therapeutically effective amount for an individual dose of a recombinant poxvirus described herein is 1 x 10 pfu. 4 pfu ~ 1 × 10 11 In some embodiments, the therapeutically effective amount for an individual dose of a recombinant poxvirus described herein is 1 x 10 pfu. 5 pfu ~ 1 × 10 10 In some embodiments, the therapeutically effective amount for an individual dose of a recombinant poxvirus described herein comprises 5×10 pfu. 7 pfu ~ 4 × 10 9 pfu.

[0145] In some embodiments, the present disclosure provides a pharmaceutical composition recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter for use in treating or preventing a proliferative disease such as cancer. In some embodiments, the cancer is selected from the group consisting of renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, bile duct cancer, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, and malignant glioma.

[0146] PD-1 or PD-L1 inhibitors PD-1 is an important immune checkpoint receptor expressed by activated T cells and B cells and mediates immunosuppression. PD-1 is a member of the CD28 family of receptors, which includes CD28, CTLA-4, ICOS, PD-1, and BTLA. Two cell surface glycoprotein ligands for PD-1, programmed death ligand-1 (PD-L1) and programmed death ligand-2 (PD-L2), have been identified and are expressed on antigen-presenting cells and many human cancers. They have been shown to downregulate T cell activation and cytokine secretion upon binding to PD-1. Inhibition of the PD-1 / PD-L1 interaction mediates potent antitumor activity in preclinical models (U.S. Pat. Nos. 8,008,449 and 7,943,743), and since May 2006, the FDA has approved six immune checkpoint inhibitors against the PD-1 / PD-L1 pathway, including three directed against PD-1 (pembrolizumab, nivolumab, and cemiplimab) and three directed against PD-L1 (atezolizumab, avelumab, and durvalumab) (Ai et al., Drug Des Devel Ther., 14:3625-3649, 2020).

[0147] Any one of the PD-L1 inhibitors and / or PD-1 inhibitors known in the art for the treatment of one or more cancers is suitable for inclusion in the therapeutic combinations and methods described herein.

[0148] In some embodiments, the inhibitor is a PD-1 inhibitor. In some embodiments, the PD-1 inhibitor is an agent that binds to the PD-1 protein and inhibits its interaction with PD-L1. In some embodiments, the PD-1 inhibitor is an antibody or antigen-binding fragment thereof that binds to PD-1. In some embodiments, the PD-1 inhibitor is a peptide-based inhibitor. In some embodiments, the PD-1 inhibitor is a small molecule. In some embodiments, the PD-1 inhibitor is an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof that binds to PD-1.

[0149] In some embodiments, the inhibitor is a PD-L1 inhibitor. In some embodiments, the PD-L1 inhibitor is an agent that binds to the PD-L1 protein and inhibits its interaction with PD-1 and / or CD80. In some embodiments, the PD-L1 inhibitor is an antibody or antigen-binding fragment thereof that binds to PD-L1. In some embodiments, the PD-L1 inhibitor is a peptide-based inhibitor. In some embodiments, the PD-L1 inhibitor is a small molecule. In some embodiments, the PD-L1 inhibitor is an antibody-drug conjugate comprising an antibody or antigen-binding fragment thereof that binds to PD-L1.

[0150] In some embodiments, the anti-PD-1 therapy is selected from the group consisting of nivolumab (also known as OPDIVO®, 5C4, BMS-936558, MDX-1106, and ONO-4538), pembrolizumab (Merck; also known as KEYTRUDA®, lambrolizumab, and MK-3475; see WO 2008 / 156712), PDR001 (Novartis; see WO 2015 / 112900), MEDI-0680 (AstraZeneca; also known as AMP-514; see WO 2012 / 145493), cemiplimab (Regeneron; also known as REGN-2810; see WO 2015 / 112800), JS001 (TAIZHOU JUNSHI PHARMA; Si-Yang Liu et al. al., J. Hematol. Oncol. 70:136 (2017)), BGB-A317 (Beigene; see WO 2015 / 35606 and U.S. Patent Application Publication No. 2015 / 0079109), INCSHR1210 (Jiangsu Hengrui Medicine; also known as SHR-1210; WO 2015 / 085847; see Si-Yang Liu et al., J. Hematol. Oncol. 70:136 (2017)), TSR-042 (Tesaro Biopharmaceutical; also known as ANB011; see WO 2014 / 179664), pidilizumab (Medivation / CureTech; see U.S. Pat. No. 8,686,119 B2 or WO 2013 / 014668 A1 ); GLS-010 (Wuxi / Harbin Gloria Pharmaceuticals; also known as WBP3055; Si-Yang Liu et al., J. Hematol. Oncol.70:136 (2017)), AM-0001 (Armo), STI-1110 (Sorrento Therapeutics; see WO 2014 / 194302), AGEN2034 (Agenus; see WO 2017 / 040790), MGA012 (Macrogenics; see WO 2017 / 19846), and IBI308 (Innovent; see WO 2017 / 024465, WO 2017 / 025016, WO 2017 / 132825, and WO 2017 / 133540). In some embodiments, the anti-PD-1 therapy is the PD-1 antagonist AMP-224, which is a recombinant fusion protein consisting of the extracellular domain of the PD-1 ligand programmed death-ligand 2 (PD-L2) and the Fc region of human IgG. AMP-224 is discussed in U.S. Patent Application Publication No. 2013 / 0017199. The contents of each of these references are incorporated herein by reference in their entirety.

[0151] In some embodiments, the anti-PD-L1 therapy is selected from the group consisting of durvalumab (AstraZeneca; also known as IMFINZI™, MEDI-4736; see WO 2011 / 066389), BMS-936559 (also known as 12A4, MDX-1105; see, e.g., U.S. Pat. Nos. 7,943,743 and WO 2013 / 173223), atezolizumab (Roche; also known as TECENTRIQ®; MPDL3280A, RG7446; see U.S. Pat. No. 8,217,149; Herbst et al. (2013) J Clin Oncol 3 l(suppl):3000), avelumab (Pfizer; also known as BAVENCIO®, MSB-0010718C; see WO 2013 / 079174), STI-1014 (Sorrento; see WO 2013 / 181634), CX-072 (Cytomx; see WO 2016 / 149201), KN035 (3D Med / Alphamab; see Zhang et al., Cell Discov. 7:3 (March 2017)), LY3300054 (Eli Lilly Co.; see, e.g., WO 2017 / 034916), and CK-301 (Checkpoint Therapeutics; Gorelik et al., AACR: Abstract 4606 (Apr 2016)), the contents of each of these references are incorporated herein by reference in their entirety.

[0152] In some embodiments of the therapeutic combinations, methods, and uses described herein, the PD-L1 inhibitor is an anti-PD-L1 antibody or antigen-binding fragment thereof. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises the CDR sequences provided in Table 3 (i.e., SEQ ID NOs: 32-37).

[0153] [Table 4]

[0154] In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a VH comprising the amino acid sequence of SEQ ID NO: 38. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a VL comprising the amino acid sequence of SEQ ID NO: 39. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a VH comprising the amino acid sequence of SEQ ID NO: 38 and a VL comprising the amino acid sequence of SEQ ID NO: 39. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises an IgG1 heavy chain (e.g., a human IgG1 heavy chain). In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a kappa light chain (e.g., a human kappa light chain). In some embodiments, the anti-PD-L1 antibody is a human IgG1 kappa monoclonal antibody comprising a VH comprising the amino acid sequence of SEQ ID NO: 38 and a VL comprising the amino acid sequence of SEQ ID NO: 39. In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof is produced in Chinese hamster ovary (CHO) cells. In some embodiments, the anti-PD-L1 antibody is a human IgG1 kappa monoclonal antibody produced in CHO cells, comprising a VH comprising the amino acid sequence of SEQ ID NO: 38 and a VL comprising the amino acid sequence of SEQ ID NO: 39. In some embodiments, the anti-PD-L1 antibody comprises a variant Fc comprising at least one amino acid substitution selected from the group consisting of 234F, 235F, and 331S as numbered according to the EU index as set forth in Kabat. In some embodiments, the anti-PD-L1 antibody comprises a variant Fc comprising amino acid substitutions 234F, 235F, and 331S as numbered according to the EU index as set forth in Kabat. In some embodiments, the anti-PD-L1 antibody is a human IgG1 kappa monoclonal antibody comprising a variant Fc comprising amino acid substitutions 234F, 235F, and 331S as numbered according to the EU index as set forth in Kabat, a VH comprising the amino acid sequence of SEQ ID NO: 38, and a VL comprising the amino acid sequence of SEQ ID NO: 39.In some embodiments, the anti-PD-L1 antibody is a human IgG1 kappa monoclonal antibody comprising a variant Fc comprising amino acid substitutions 234F, 235F, and 331S as numbered according to the EU index as set forth in Kabat, a VH comprising the amino acid sequence of SEQ ID NO: 38, and a VL comprising the amino acid sequence of SEQ ID NO: 39, produced in CHO cells.

[0155] In some embodiments, the anti-PD-L1 antibody or antigen-binding fragment thereof is provided in a 10 mL solution, where each mL of solution contains 50 mg of the antibody or antigen-binding fragment thereof (e.g., durvalumab), L-histidine (2 mg), L-histidine hydrochloride monohydrate (2.7 mg), α,α-trehalose dihydrate (104 mg), polysorbate 80 (0.2 mg), and water for injection, USP. The solution may contain, for example, 120 mg of the antibody or antigen-binding fragment thereof (e.g., durvalumab) in 2.4 mL, or 500 mg of the antibody or antigen-binding fragment thereof (e.g., durvalumab) in 10 mL.

[0156] In some embodiments of the therapeutic combinations, methods, and uses described herein, the PD-L1 inhibitor is durvalumab (Imfinzi®, AstraZeneca). Durvalumab is a human monoclonal antibody that selectively binds to PD-L1 and blocks PD-L1 binding to the PD-1 receptor and the CD80 receptor, as disclosed in U.S. Pat. No. 9,493,565, which is incorporated herein by reference in its entirety. The fragment crystallizable (Fc) domain of durvalumab contains a triple mutation within the constant domain of the IgG1 heavy chain that reduces binding to complement components C1q and Fcγ receptors, which are responsible for mediating antibody-dependent cell-mediated cytotoxicity (ADCC).

[0157] kit Provided herein are kits comprising a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter described herein, or a pharmaceutical composition comprising a recombinant poxvirus described herein. In certain embodiments, the kit comprises a unit dosage form of such a recombinant virus or pharmaceutical composition. In certain embodiments, provided herein are kits comprising one or more containers filled with one or more of the components of a composition described herein, such as a recombinant poxvirus described herein, optionally accompanied by instructions for use.

[0158] In some embodiments, provided herein are kits that include one or more containers filled with one or more of the components of the compositions described herein, such as a recombinant poxvirus described herein, and one or more PD-1 or PD-L1 inhibitors described herein, optionally accompanied by instructions for use. In some embodiments, the kits described herein include a recombinant poxvirus described herein and an anti-PD1 antibody (e.g., pembrolizumab or nivolumab). In some embodiments, the kits described herein include a recombinant poxvirus described herein and an anti-PD-L1 antibody (e.g., durvalumab).

[0159] Therapeutic Uses and Methods Provided herein are methods for inducing apoptosis in cancer cells, comprising contacting the cancer cells with a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, under conditions that induce apoptosis. In some embodiments, the cancer cells may include, but are not limited to, renal cancer cells, prostate cancer cells, breast cancer cells, bladder cancer cells, colorectal cancer cells, lung cancer cells, liver cancer cells, gastric cancer cells, cholangiocarcinoma cells, endometrial cancer cells, pancreatic cancer cells, ovarian cancer cells, head and neck cancer cells, melanoma cells, glioblastoma cells, multiple myeloma cells, or malignant glioma cells.

[0160] Also provided herein are methods of inhibiting the growth of cancer cells or promoting the death of cancer cells, comprising contacting cancer cells with a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, under conditions that inhibit the growth or promote the death of the cancer cells. In some embodiments, the cancer cells may include, but are not limited to, renal cancer cells, prostate cancer cells, breast cancer cells, bladder cancer cells, colorectal cancer cells, lung cancer cells, liver cancer cells, gastric cancer cells, cholangiocarcinoma cells, endometrial cancer cells, pancreatic cancer cells, ovarian cancer cells, head and neck cancer cells, melanoma cells, glioblastoma cells, multiple myeloma cells, or malignant glioma cells.

[0161] In some embodiments of the present disclosure, the method of inducing apoptosis of cancer cells is performed in vitro. In some embodiments of the present disclosure, the method of inhibiting cancer cell growth or promoting cancer cell death is performed in vitro. In some embodiments of the present disclosure, the method of inducing apoptosis of cancer cells is performed in vivo. In some embodiments of the present disclosure, the method of inhibiting cancer cell growth or promoting cancer cell death is performed in vivo.

[0162] Also provided herein is a method of treating cancer in a subject, comprising administering to the subject a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, in an amount effective to treat the cancer.

[0163] Also provided herein is a method for reducing the amount of cancer cells in a subject, comprising administering to the subject a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, to reduce the amount of cancer cells in the subject.

[0164] Also provided herein are methods for eliciting an anti-cancer immune response in a subject, comprising contacting cancer cells with a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, in an amount effective to elicit an anti-cancer immune response. In some embodiments, the anti-cancer immune response comprises activation of an innate immune response or an adaptive immune response against the cancer. In some embodiments, the anti-cancer immune response comprises activation of an innate immune response against the cancer. In some embodiments, the anti-cancer immune response comprises activation of an adaptive immune response against the cancer. In some embodiments, the anti-cancer immune response comprises activation of an innate immune response and an adaptive immune response against the cancer.

[0165] In some embodiments of the methods comprising administering described herein, the administering comprises systemic administration. In some embodiments, the systemic administration is selected from subcutaneous, intramuscular, oral, intravenous, intranasal, transdermal, subcutaneous, and intramuscular administration. In some embodiments, the recombinant poxvirus is administered two or more times.

[0166] In some embodiments of the methods comprising administering described herein, the administering comprises local administration. In some embodiments, the local administration comprises intratumoral administration. In some embodiments, the recombinant poxvirus is administered two or more times.

[0167] In some embodiments, the present disclosure provides methods of treating cancer in a subject, the method comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) and (ii) a programmed death protein 1 (PD-1) inhibitor or a programmed death-ligand 1 (PD-L1) inhibitor. In some embodiments, the present disclosure provides methods of inhibiting the growth of cancer in a subject, the method comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) and (ii) a PD-1 inhibitor or a PD-L1 inhibitor. In some aspects, the present disclosure provides a method of enhancing a tumor-specific immune response in a subject having cancer, the method comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), and (ii) a PD-1 inhibitor or a PD-L1 inhibitor.

[0168] In some embodiments, administration of an immune checkpoint inhibitor in combination with a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) as described herein results in an enhanced therapeutic effect (e.g., a more significant reduction in tumor growth, increased tumor infiltration by lymphocytes, increased progression-free survival, etc.) than observed following treatment with the recombinant poxvirus alone or following treatment with the immune checkpoint inhibitor alone. The enhanced therapeutic effect can be, for example, an enhanced tumor-specific immune response, which can be characterized, for example, by increased IFN-gamma production and / or an increased number of IFN-gamma-secreting cells.

[0169] Furthermore, some cancers are resistant (i.e., insensitive or non-responsive) to treatment with immune checkpoint inhibitors. Furthermore, some cancers that are initially responsive (i.e., sensitive) to treatment with immune checkpoint inhibitors develop resistance to the inhibitor during the course of treatment. Thus, in some embodiments, administration of a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) as described herein in combination with a PD-1 inhibitor or a PD-L1 inhibitor treats cancers that are resistant (or partially resistant) or insensitive (or partially insensitive) to treatment with one or more immune checkpoint inhibitors. In some embodiments, administration of a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12) as described herein, or a composition thereof, to a subject afflicted with a cancer that is resistant (or partially resistant) or insensitive (or partially insensitive) to treatment with one or more immune checkpoint inhibitors results in treatment of the cancer (e.g., reduced tumor growth, increased progression-free survival, etc.). In some embodiments, the cancer is resistant (or partially resistant) or insensitive (or partially insensitive) to treatment with a PD1 inhibitor.

[0170] In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient prior to administration of the recombinant poxvirus. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient simultaneously with the recombinant poxvirus. In some embodiments, the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient after administration of the recombinant poxvirus.

[0171] In some aspects, the present disclosure provides for the use of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, or a pharmaceutical composition comprising a PD-1 inhibitor or a PD-L1 inhibitor, in a method of inducing apoptosis of a cancer cell as described herein.

[0172] In some aspects, the present disclosure provides for the use of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, or a pharmaceutical composition comprising a PD-1 inhibitor or a PD-L1 inhibitor, in a method of inhibiting cancer cell growth or promoting cancer cell death as described herein.

[0173] In some aspects, the present disclosure provides for the use of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, or a pharmaceutical composition comprising a PD-1 inhibitor or a PD-L1 inhibitor, in a method of treating cancer in a subject as described herein.

[0174] In some aspects, the present disclosure provides for the use of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, or a pharmaceutical composition comprising a PD-1 inhibitor or a PD-L1 inhibitor, in a method of reducing the amount of cancer cells in a subject as described herein.

[0175] In some aspects, the present disclosure provides for the use of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, or a pharmaceutical composition comprising a PD-1 inhibitor or a PD-L1 inhibitor, in a method of reducing the amount of cancer cells in a subject as described herein.

[0176] In some aspects, the present disclosure provides for the use of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter, or a pharmaceutical composition comprising the recombinant poxvirus described herein, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, or a pharmaceutical composition comprising the PD-1 inhibitor or PD-L1 inhibitor, in a method of eliciting an anti-cancer immune response in a subject as described herein. [Example]

[0177] The examples in this Examples section are offered by way of illustration and not by way of limitation.

[0178] The generation of recombinant vaccinia virus (VACV) vectors COPTG19673 and COPTG19674, which express human IL-12 (hIL-12) under the control of two different promoters, pF17R and pA14L, respectively, is described below. Experiments and analyses related to the selection of the pF17R and pA14L promoters are also described.

[0179] The COPTG19673 and COPTG19674 vectors encode human IL-12 (hIL-12) as a fusion of the p40 and p35 subunits linked by a glycine-serine (GS) linker. The same hIL-12 coding sequence was inserted into the two viruses but under the control of two different late promoters: COPTG19673 contains the pF17R promoter, while COPTG19674 contains the pA14L promoter. The IL-12 transgene was vectored in the Copenhagen strain of vaccinia virus, which has both the thymidine kinase gene (J2R) and the ribonucleotide reductase gene (I4L) deleted as in WO 2009 / 065546 (incorporated herein by reference in its entirety). These two deletions limit viral replication to highly proliferative cells (containing high concentrations of nucleotides), such as tumor cells. Therefore, transgene expression, which is directly dependent on viral genome replication, is restricted to tumor cells (see, e.g., Foloppe et al., 2019, Mol Ther Oncolytics 14:1-14, and Kleinpeter et al., 2016, Oncoimmunology 5:e1220467). An expression cassette containing a promoter and an IL-12 transgene was inserted into the J2R locus of the double-deleted vaccinia virus Copenhagen strain.

[0180] The in vitro characterization of the interleukin-12 expressing oncolytic vaccinia viruses COPTG19673 and COPTG19674 is also described below.

[0181] material virus VVTG18058 (empty VACV, VACV control, or armless control VACV) is a vaccinia virus (Copenhagen strain) lacking the J2R and I4L genes. VVTG18058 was used as an armless control VACV. VVTG18058 was produced in chicken embryo fibroblasts (CEF). Titration was performed by plaque assay using Vero cells.

[0182] COPTG19104 is a vaccinia virus (Copenhagen strain) expressing the fluorescent protein mCherry under the control of the pH5R promoter in the J2R locus. The I4L gene has been deleted. It was used as the starting parent virus for the generation of recombinant viruses.

[0183] VACVwt (also called COPwt) is a deletion-free wild-type vaccinia virus (Copenhagen strain). VACVwt was produced at CEF.

[0184] Cells and cell lines Chicken Embryo Fibroblasts (CEF): CEF cells were isolated from 11-day-old specific pathogen-free (SPF) embryonated eggs (Charles River).

[0185] Vero cells: Vero (ATCC® CCL-81™), a common African green monkey kidney cell line, was cultured in DMEM (Gibco) 4.5 g / L glucose supplemented with 10% FBS, 2 mM L-glutamine, and gentamicin at a final concentration of 40 mg / L. Growth conditions were 37°C and 5% CO.

[0186] human tumor cell lines Human lung cancer cell line A549 (ATCC® CCL-185™) was cultured in DMEM (Gibco) 4.5 g / L glucose supplemented with 10% FBS, 2 mM L-glutamine, and gentamicin at a final concentration of 40 mg / L. Growth conditions were 37°C and 5% CO.

[0187] The human cervical tumor cell line HeLa (ATCC® CCL-2™) was cultured in DMEM (Gibco) supplemented with 10% FBS, 40 mg / L gentamicin at 37° C. and 5% CO 2 .

[0188] The human pancreatic tumor cell line MIA PaCa-2 (ATCC® CCL-1420™) was cultured at 37°C, 5% CO2 in DMEM (ATCC®) supplemented with 10% FBS and containing gentamicin at a final concentration of 40 mg / L.

[0189] The human colon tumor cell line HCT116 (ATCC® CCL-247™) was cultured at 37°C, 5% CO2 in McCoy's 5A (ATCC®) supplemented with 10% FBS and containing gentamicin at a final concentration of 40 mg / L.

[0190] The human colon cancer cell line HT-29 (ATCC® HTB-38) was cultured in McCoy's 5A (Gibco) supplemented with 10% FBS and containing gentamicin at a final concentration of 40 mg / L.

[0191] HEK-Blue™ IL-12 cells (InvivoGen, ref hkb-il12) were cultured in DMEM (Gibco) supplemented with 10% inactivated FBS, 100 μg / ml Normocin™ (InvivoGen), HEK Blue™ selection (Invivogen), and containing penicillin and streptomycin at final concentrations of 100 U / mL and 100 μg / mL, respectively.

[0192] The natural killer cell line NK-92 (ATCC® CRL-2407™) was cultured in alpha minimal essential medium (Gibco) with 1× Glutamax (Gibco), 1.5 g / L sodium bicarbonate (Gibco), 0.2 mM inositol (Sigma), 0.1 mM β-mercaptoethanol (Sigma), 0.02 mM folic acid (Sigma), 150 U / ml recombinant IL-2, and 25% fetal bovine serum.

[0193] Chicken fibroblasts and human cell lines The continuous chicken embryo fibroblast cell line DF-1 (ATCC® CRL-12203™) was cultured in DMEM (Gibco) supplemented with 10% FBS, 2 mM L-glutamine, and 40 mg / L gentamicin at 39°C and 10% CO2.

[0194] Human peripheral blood mononuclear cells (PBMCs) from healthy donors (EFS) were prepared on a Ficoll gradient and cultured in RPMI (SIGMA®) supplemented with 10% FBS and containing gentamicin and glutamine at final concentrations of 40 mg / L and 2 mM, respectively.

[0195] bacteria Escherichia coli DH5α strain (genotype: F-Φ80lacZΔM15 Δ(lacZYA-argF)U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 λ-; Invitrogen, 1826312) was used for cloning and plasmid amplification in LB medium supplemented with 100 μg / mL ampicillin.

[0196] DNA cloning Cloning, plasmid amplification, and other molecular biology procedures were performed according to standard procedures.

[0197] DNA sequencing DNA was sequenced by the Sanger method.

[0198] Example 1: Comparative evaluation of vaccinia virus promoters Construction of reporter transfection plasmid A reporter transfer plasmid was designed to evaluate the strength of different poxvirus promoters. The reporter gene encoded a fusion of Renilla luciferase (RLuc) and Aequorea victoria green fluorescent protein (GFP) separated by a linker (Ala)5-Thr (GenBank: ABZ79968.1). Different poxvirus promoters were inserted upstream of the RLuc-GFP fusion (SEQ ID NO: 1). The expression cassette was inserted into a poxvirus transfer plasmid designed to allow insertion of nucleotide sequences into the J2R locus of the vaccinia virus genome by homologous recombination. This plasmid was derived from the plasmid pUC18, into which flanking sequences of the left arm (L arm) and right arm (R arm) surrounding the J2R locus were cloned. SEQ ID NO: 1: Nucleic acid sequence of RLuc / GFP [ka]

[0199] A synthetic fragment designated "RLuc-GFP" containing a fusion gene encoding the RLuc-GFP protein was synthetically generated and inserted by homologous recombination into a set of transfer plasmids containing PvuII-restricted poxvirus early / late promoters, resulting in the plasmids listed in Table 4. A schematic diagram of the plasmid pTG19409 containing the RLuc-GFP-encoding gene under the expression control of the pH5R promoter is shown in Figure 1.

[0200] [Table 5]

[0201] To evaluate the late promoter, a sequence encoding the RLuc-GFP fusion was cloned immediately downstream of the promoter using its natural start codon. A synthetic fragment containing the late promoter and the start of the RLuc-GFP fusion was synthetically generated and inserted into pTG19409 restricted with SmaI and MscI by homologous recombination, generating the plasmids listed in Table 5.

[0202] [Table 6]

[0203] The resulting reporter transfection plasmids were first tested in transient infection / transfection expression assays to identify the best candidates, some of which were then used in the generation of recombinant poxviruses as described below.

[0204] Cloning, plasmid amplification, and other molecular biology procedures were performed according to standard procedures.

[0205] Transient infection / transfection with luciferase reporter plasmid The reporter transfection plasmid using the RLuc-GFP reporter allows evaluation of cell infection and the accompanying accurate measurement of reporter expression levels.

[0206] To better control the level of expression and minimize off-target expression of different transgenes, several VACV promoters can be used according to their strength or the timing of expression (early, intermediate, or late) during poxvirus infection. Some poxvirus promoters (e.g., p7.5K or pH5R) have both early and late elements, allowing transgenes to be expressed early after viral infection and late during viral genome replication, respectively. Therefore, to further minimize off-target expression of potentially toxic transgenes such as IL-12, transgene expression can be driven by a late promoter that activates only after viral genome replication.

[0207] Six late promoters were selected for preliminary evaluation in transient infection-transfection experiments: pA10L (SEQ ID NO: 9), pA11R (SEQ ID NO: 10), pA14L (SEQ ID NO: 11), pA26L (SEQ ID NO: 12), pF17R (SEQ ID NO: 13), and pG7L (SEQ ID NO: 14). These late promoters were cloned upstream of the gene encoding the fusion RLuc-GFP in a transfer plasmid. These plasmids were evaluated in transient infection-transfection experiments in DF-1 cells. A plasmid encoding firefly luciferase under the control of the p11K7.5 promoter was cotransfected to normalize for transfection variability. Both luciferases were measured after 24 hours (h).

[0208] Briefly, DF-1 cells were cultured in 24-well culture plates and then infected with an empty vaccinia virus (VVTG18058) containing no transgene at an MOI of 1. After 2 hours, 0.5 ng of different Renilla reporter plasmids (see Table 2), 0.5 ng of a control reporter plasmid encoding firefly luciferase under the control of p11K7.5, and 250 ng of the control plasmid pTG15839 encoding GFP under the control of a CMV promoter, complexed with 0.625 μL of Lipofectamine 2000 (Invitrogen) in opti-MEM medium, were added to each well. Transfections were performed in triplicate. The plates were then incubated at 37°C and 5% CO2 for 24 hours. For luciferase measurements, the supernatant was removed, and the cells were lysed and processed according to the "Dual-Luciferase Reporter Assay System" (Promega).

[0209] The results obtained with the six late promoters are illustrated in Figure 2. For each promoter, the ratio of Renilla luciferase / firefly luciferase (R / F) is reported, and the results of two independent experiments are shown. The highest levels of expression were obtained with the pF17R promoter, which was 3-4 times stronger than the pA14L and pA10L promoters. The pA11R, pA26L, and pG7L promoters were 8-10 times weaker than the pF17R promoter.

[0210] Three promoters of different strengths were selected for further evaluation in the context of recombinant poxvirus: pF17R (SEQ ID NO: 13), pA14L (SEQ ID NO: 11) and pA26L (SEQ ID NO: 12).

[0211] Generation of recombinant poxviruses for comparative evaluation of vaccinia virus promoters Transfer plasmids containing the fusion reporter gene RLuc-GFP under the control of various promoters were constructed. Four early / late promoters were tested: p7.5K (SEQ ID NO: 4), pH5R (SEQ ID NO: 2), p11K7.5 (SEQ ID NO: 3), and pSE / L (SEQ ID NO: 8). Three early promoters were also evaluated: pB2R (SEQ ID NO: 5), pA35R (SEQ ID NO: 7), and pC11R (SEQ ID NO: 6). Three late promoters previously tested in transient infection-transfection (pF17R (SEQ ID NO: 13), pA14L (SEQ ID NO: 11), and pA26L (SEQ ID NO: 12)) were also tested with recombinant VACV. See Tables 4 and 5.

[0212] Ten VACV-RLuc-GFP vectors were generated by homologous recombination in CEF by inserting the RLuc-GFP expression cassette into the J2R locus of the double-deleted vaccinia virus Copenhagen strain under the transcriptional control of different poxvirus promoters, as described herein. All of these viruses are deficient in thymidine kinase (TK, J2R locus) and ribonucleotide reductase (RR, I4L locus) activities.

[0213] Recombinant vaccinia viruses were generated in CEFs by homologous recombination using a transfer plasmid containing the flanking sequences (L and R arms) surrounding the J2R locus and an integrated expression cassette, using COPTG19104 as the starting parent virus. Homologous recombination between the transfer plasmid and the parent vaccinia virus (Copenhagen strain) allowed the generation of recombinant vaccinia viruses that lost the mCherry expression cassette and gained the expression cassette, producing white (non-fluorescent) plaques. More specifically, F175 flasks of CEFs were infected with COPTG19104 at an MOI of 0.05 for 1 hour at room temperature. The virus suspension was then discarded, and infected cells were incubated in MBE + 5% FBS at 37°C + 5% CO2 for 2 hours before being trypsinized and counted. Ten million infected cells were transfected with 2 μg of the I-SceI-restricted transfer plasmid by nucleofection. The transfected cells were then transferred to wells of a 6-well plate and incubated at 37°C for 48 hours before freezing. After sonication, serial dilutions of the transfection mixture were used to infect CEFs for selection of recombinant viruses. Non-fluorescent white plaques were picked and used for a second round of plaque purification. Selected non-fluorescent white plaques were picked and amplified in 6-well plates at 37°C, 5% CO2 for 72 hours. The amplicon was used for PCR, followed by selection of recombinant vaccinia viruses.

[0214] Primary stocks were produced by infecting 100 μL of selected clones into CEFs grown 72 hours prior to infection. Virus amplification was carried out for 72 hours at 37°C and 5% CO2 in MBE supplemented with 5% FBS. Infected cells and medium were subjected to freeze-thaw cycles and then homogenized by sonication. This so-called primary stock was then characterized and stored in aliquots until use. Purified bulk was produced after virus amplification in F500 flasks seeded with CEFs. Infected cells and medium were harvested to generate a crude harvest that was stored at -80°C. Virus was purified according to the procedure described in WO 2007 / 147528, which is incorporated herein by reference in its entirety.

[0215] The recombinant vaccinia viruses are referred to as follows for identification: COPTG19409 (VACV containing promoter pH5R), COPTG19410 (VACV containing promoter p11K7.5), COPTG19411 (VACV containing promoter p7.5K), COPTG19412 (VACV containing promoter pB2R), COPTG19415 (VACV containing promoter pA14L), COPTG19416 (VACV containing promoter pA26L), COPTG19417 (VACV containing promoter pF17R), COPTG19431 (VACV containing promoter pC11R), COPTG19436 (VACV containing promoter pA35R), and COPTG19437 (VACV containing promoter pSE / L).

[0216] Comparative evaluation of vaccinia virus promoters in human tumor cell lines and human PBMCs Human tumor cell lines HeLa, MIA PaCa-2, and HCT116 were infected in 96-well plates with 10 previously obtained recombinant vaccinia viruses at an MOI of 0.1 or 1, as described in the following protocol. After 6 and 24 hours, cells were harvested for quantification of luciferase expression and detection of GFP-expressing cells.

[0217] These human tumor cell lines were seeded in 96-well plates at 1E+05 cells / well / 200 μL the day before infection. Before infection, the medium was removed and replaced with 200 μL of FBS-containing medium containing the virus for infection at an MOI of 0.1 or 1.

[0218] These human PBMCs were seeded the day before in a 96-well plate at 2E+05 cells / well / 125 μL. For infection, 50 μl of virus dilution in FBS-containing medium was added per well to infect at an MOI of 1. Infection was performed in triplicate in two independent plates (one for luciferase measurement and the other for GFP analysis). For luciferase measurement, the supernatant was removed, and the cells were lysed and processed according to the "Renilla Reporter Assay System" (Promega).

[0219] For GFP quantification, the supernatant was removed, and the cells were trypsinized, centrifuged, washed with 100 μL of PBS, stained with 100 μL of 1:100 diluted live / dead IR, and incubated for 15 minutes at room temperature in the dark. The cells were then centrifuged, washed, and resuspended in 100 μL of PBS. GFP detection was then performed by flow cytometry using a MACS Quant 16 instrument (Miltenyi Biotec) and analyzed using Kaluza software (Beckman Coulter). Results were expressed as the percentage of live, GFP-positive cells (infected cells). FACS (fluorescence-activated cell sorting) analysis showed that for all MOIs and cell lines, approximately 70–90% of cells were GFP-positive 24 hours after infection (data not shown). All viruses produced similar results, indicating similar levels of infectivity for all viruses.

[0220] Renilla luciferase was measured 6 and 24 hours after infection, and the results obtained in MIA PaCa-2 cells are shown in Figures 3A and 3B, respectively. Expression was normalized to the weakest promoter, pA26L. At 6 hours postinfection, the late promoters pF17R, pA14L, and pA26L resulted in very low levels of expression. The highest levels of expression were obtained with the early / late promoter pH5R, followed by the early promoters pB2R and pC11R, and the early / late promoters pSE / L and p11K7.5. Similar results were obtained regardless of the MOI of infection and in two other cell lines (Hela and HCT116) (data not shown). At 24 hours postinfection, the early promoters pB2R, pC11R, and pA35R resulted in low levels of expression. Higher expression levels were detected with the promoters of p11K7.5, pSE / L, pF17R, and pH5R (11- to 21-fold higher than pA26L), whereas p7.5K and pA14L resulted in moderate levels of expression (7- to 11-fold higher than pA26L).

[0221] The results obtained after 24 hours of infection of HeLa and HCT-116 cells are shown in Figures 4 and 5, respectively. The results were similar to those obtained with MIA Paca-2 cells. The difference in strength between the promoters was more pronounced at an MOI of 0.1 rather than at an MOI of 1 (up to 14-fold and up to 7-fold relative to pA26L, respectively).

[0222] The results obtained in the three cell lines allowed us to classify the promoters into three strength groups. Weak promoters included the three early promoters (pB2R, pA35R, and pC11R) and the late promoter A26L. Medium promoters were 2-5 times more efficient than the weak promoters. They corresponded to the early / late promoters p7.5K and pH5R and the late promoter pA14L. The strongest promoters were 2-3 times more efficient than the medium promoters. They corresponded to the early / late promoters p11K7.5 and pSE / L and the late promoter pF17R.

[0223] Human PBMCs were then infected in 96-well plates with 10 recombinant vaccinia viruses at an MOI of 1. After 6 and 24 hours, cells were harvested for quantification of luciferase expression and detection of GFP-expressing cells.

[0224] The results of flow cytometry analysis are shown in Figure 6. After 6 hours of infection with viruses containing the early or early / late promoter, approximately 12% of cells were detected as GFP-positive cells. In contrast, after infection with viruses containing the late promoter, very few cells were detected as GFP-positive (less than 4% for pA26L, and less than 1% for pF17R and pA26L). Due to the death of infected cells and lack of replication of the recombinant vaccinia virus, the percentage of GFP-positive cells decreased 24 hours after infection. The percentage of infected cells was then approximately 5% for viruses containing the early and early / late promoters and negligible for viruses containing the late promoter.

[0225] Renilla luciferase was measured after 6 and 24 hours, and the results are shown in Figure 7. Expression was normalized to the weakest promoter, pA26L. Luciferase levels were lower (approximately 100-fold lower) than those detected after infection of human tumor cells. Furthermore, expression decreased between 6 and 24 hours due to death of infected cells. Cells infected with viruses containing late promoters (pF17R, pA14L, and pA26L) expressed very low levels of luciferase, approximately 100- to 300-fold less than that detected with the early or early / late promoters.

[0226] The vaccinia virus used in this study was derived from the Copenhagen strain and contained deletions of both the thymidine kinase gene (J2R) and the ribonucleotide reductase gene (I4L). These two deletions restrict viral replication to highly proliferative cells (containing high concentrations of nucleotides), such as tumor cells. These viruses cannot replicate efficiently in primary human PBMCs, so the late promoter is not activated in these cells.

[0227] conclusion This study allowed the identification of two late promoters, pF17R and pA14L, that drive strong or moderate expression in human tumor cells, but little expression was detected in primary human cells. These promoters were therefore chosen to minimize off-target expression of potentially harmful transgenes such as IL-12.

[0228] Example 2: Generation and production of recombinant vaccinia viruses encoding IL-12 by homologous recombination Construction of transfer plasmids pTG19673 and pTG19674 Plasmids pTG19673 and pTG19674 contain the human IL-12 gene under the control of the pF17R and pA14L promoters, respectively.

[0229] Endogenous human IL-12 is unique among cytokines in that it is a disulfide-linked heterodimer of two separately encoded subunits (p35 and p40). A single-chain IL-12 protein was expressed from a vaccinia construct in which the full-length p40 subunit was fused via a G6S linker to a p35 subunit with its leader sequence truncated (i.e., IL-12.p40.deltap35) (see Lieschke et al., 1997, Nat Biotechnol. 1997 Jan;15(1):35-40).

[0230] The primary protein structure of the hIL-12 fusion protein contains IL-12 p40 linked to IL-12 p35 by a 7 amino acid polypeptide linker, as shown in the following sequence (SEQ ID NO: 15). Fusion IL-12.p40.deltap35 (SEQ ID NO: 15): [ka] The underlined sequence is the signal peptide (SEQ ID NO: 16). Sequence in bold, not underlined: IL-12-p40 subunit (SEQ ID NO: 17) Underlined and bolded sequence: linker (SEQ ID NO: 18) Sequence in italics: IL-12 p35 subunit (SEQ ID NO: 19)

[0231] The mature IL-12 fusion protein comprises amino acids 23-532 of SEQ ID NO:15, as shown below in SEQ ID NO:20. Mature fusion IL-12.p40.deltap35 (SEQ ID NO: 20): [ka]

[0232] The nucleotide sequence of the fusion IL-12.p40.deltap35 was optimized for human codon usage and optimal gene expression using Geneart's GeneOptimizer algorithm. The sequence of the expression cassette present in pTG19673 is shown in Figure 8 (SEQ ID NO:21). SEQ ID NO:21 is provided below. [ka]

[0233] The vaccinia virus transfer plasmids pTG19535 and pTG19537 were designed to allow insertion of nucleotide sequences into the J2R locus of the vaccinia virus genome by homologous recombination. They were derived from plasmid pUC18 and cloned with sequences flanking the J2R locus (L and R arms). Plasmid pTG19535 contains the pF17R promoter, while pTG19537 contains the pA14L promoter.

[0234] Fragments containing IL-12 fusions were synthetically generated and inserted into plasmids by Geneart. The corresponding plasmids were restricted with SnaB1, and the resulting fragment "hIL-12" was inserted by homologous recombination into pTG19535 (pF17R promoter) or pTG19537 (pA14L promoter) restricted with PvuII, resulting in pTG19673 (Figure 9) or pTG19674 (Figure 10), respectively. In these plasmids, the expression cassette is inserted between the recombination arms, allowing homologous recombination at the J2R locus of the vaccinia virus genome. Maxi-preparations of both plasmids were produced, and the recombination arms and the expression cassette inserted between them were analyzed by sequencing. Alignment of the analyzed and theoretical sequences showed 100% homology in both plasmids.

[0235] Two different late poxvirus promoters were used. The natural initiation codons of the pA14L and pF17R genes were not used for the expression of IL-12. Therefore, instead of the natural ATG, the sequence ATA was added downstream of the promoter.

[0236] The sequences of these two promoters, pA14L and pF17R, and the downstream ATA are as follows: pA14L (SEQ ID NO: 22) TTTGTTCATTCGGCGATTTAAAATTTTTATTAGTTAAATApF17R (SEQ ID NO: 23) AAAATATAGTAGAATTTCATTTTGTTTTTTTCTATGCTATAAATA

[0237] Generation of recombinant vaccinia viruses by homologous recombination. Recombinant COPTG19673 and COPTG19674 were generated by homologous recombination in CEF using transfer plasmids pTG19673 and pTG19674, encoding hIL-12 under the control of pF17R and pA14L, respectively, with COPTG19104 as the starting parent virus. COPTG19104 contains an expression cassette for mCherry at the J2R locus. Homologous recombination between the transfer plasmid and the parent vaccinia virus can generate recombinant vaccinia viruses (COPTG19673 and COPTG19674) that have lost the mCherry expression cassette and gained the hIL-12 expression cassette (see Example 1 for a method for generating recombinant vaccinia viruses).

[0238] The primary research stock of recombinant virus COPTG19673 obtained by homologous recombination of transfer plasmid pTG19673 and parent COPTG19104 is hereafter referred to as the COPTG19673 primary stock.

[0239] The primary research stock of recombinant virus COPTG19674, obtained by homologous recombination of transfer plasmid pTG19674 and parent COPTG19104, is hereafter referred to as the COPTG19674 primary stock. IL-12 expression in the supernatant of A549 cells infected with COPTG19673 and COPTG19674, as measured by ELISA, is shown in Figure 11.

[0240] These primary research stocks were used for in vitro characterization in Example 3.

[0241] Example 3: In vitro characterization of recombinant oncolytic vaccinia viruses COPTG19673 and COPTG19674 expressing interleukin-12 Vaccinia viruses COPTG19673, COPTG19674, and VVTG18058, described herein in Example 2, were used in the following studies.

[0242] VACVwt (also called COPwt) is a deletion-free wild-type vaccinia virus (Copenhagen strain). VACVwt was produced at CEF. Infectious titer determination in the following assays was performed by plaque assay using Vero cells.

[0243] Viral replication assay Replication in human tumor cell lines Replication of COPTG19673 and COPTG19674 was evaluated in three tumor-producing human cell lines (A549, HT-29, and MIA PaCa-2) and compared to that of the no-arm control VACV VVTG18058 as a benchmark. The A549, HT-29, and MIA PaCa-2 tumor cell lines were inoculated with each virus at an MOI of 10. -3 The infected cells were then plated onto 6-well plates and incubated at 37°C in a 5% CO atmosphere for 24, 48, and 72 hours. The amount of virus produced in each cell line at each time point was determined by plaque assay using Vero cells.

[0244] Figures 12A-C show that replication of COPTG19673, COPTG19674, and VVTG18058 was similar in three human tumor cell lines.

[0245] Replication in manufacturing cells Replication of COPTG19673 and COPTG19674 was evaluated in CEF and a human cell line (HeLa) (as virus-producing cells) and compared with that of the armless control VACV as a benchmark. Seeded HeLa or CEF were infected with each virus at an MOI of 0.05 in 6-well plates. The plates were then incubated at 37°C in a CO atmosphere for 72 hours. Virus production in each cell type was determined by titration with Vero cells using a plaque assay method. Figure 13 shows that replication of COPTG19673, COPTG19674, and VVTG18058 was similar in each of the two cell types (CEF and HeLa) (i.e., less than a 0.7-log difference at 72 hours).

[0246] Oncolytic activity assay The oncolytic activity of COPTG19673 and COPTG19674 was evaluated in three human tumor cell lines (A549, HT-29, and MIA PaCa-2) and compared to that of the no-arm control VACV (VVTG18058). Oncolytic activity was assessed by quantifying cell viability after 5 days of incubation.

[0247] Method for comparing the two viruses: Tumor cell lines were infected with each virus at an MOI of 10 according to the cell line used (i.e., A549 and HT-29: 3.10 -5 ~1, MIA PaCa-2:10 -5 ~3.10 -1 The infected tumor cells were then incubated in 96-well plates at 37°C under a CO atmosphere for 5 days. Cell viability was determined using the Cell Titer Blue cell viability assay according to the protocol provided by the manufacturer.

[0248] Oncolytic activity, expressed as cell viability, represents the lytic activity of the tested virus samples against tumor cells. The oncolytic activity of each sample is expressed as a percentage of mock-infected cell viability. Figures 14A-C show the oncolytic activity of COPTG19673, COPTG19674, and VVTG18058 at different MOIs. From these results, the EC50 value (MOI at which 50% of cells are killed) for each virus in each cell line was calculated. Comparison of EC50 values shows that the oncolytic activity of COPTG19673, COPTG19674, and the no-arm control VACV was very similar in MIA PaCa-2 cells. In A549 and HT-29 cells, COPTG19673 showed a higher EC50 than VVTG18058, but at high MOIs, both VACVs showed similarly strong oncolytic activity, with less than 20% remaining viable cells. The EC50 for both viruses was calculated using GraphPad Prism as follows: For A549: EC50 of COPTG19673 is 6.3.10 -3 COPTG19674's EC50 is 1.9.10 -3 And the EC50 of VVTG18058 is 3.8.10 -3 is. For Mia PaCa-2: EC50 of COPTG19673 is 4.8.10 -3 COPTG19674's EC50 is 2.7.10 -3 And the EC50 of VVTG18058 is 4.4.10 -3 is. For HT29: EC50 of COPTG19673 is 1.2.10 -2 , and EC50 of COPTG19674 is 7.6.10 -3 And the EC50 of VVTG18058 is 4.9.10 -3 is.

[0249] Expression levels of vIL-12 determined by ELISA The levels of expression of the cytokine vhIL-12 were measured in the supernatants of the three tumor cell lines after 3 days of infection at an MOI of 0.01. The terms vIL-12 and vhIL-12 refer to IL-12 expressed by VACV according to the present disclosure.

[0250] Supernatant preparation The starting material for measuring the expression level of vIL-12 was supernatant collected from MIA PaCa-2, A549, and HT-29 cells. Tumor cell lines were seeded in 6-well plates at an MOI of 10. -2 and incubated for 72 hours in 3 mL of the appropriate medium without fetal bovine serum. The supernatant was collected and then filtered to remove virus.

[0251] Determination of IL-12 expression in supernatants by ELISA IL-12 concentrations in the supernatants of infected tumor cell lines were determined using the DuoSet® ELISA Development System Human IL-12 (R&D Systems ref. DY1270-05). Three tumor cell lines, A549, HT-29, and MIA PaCa-2, were infected with VVTG18058, COPTG19673, or COPTG19674 at an MOI of 0.01 for 72 hours. IL-12 concentrations in the supernatants of infected cells were then measured by ELISA. Supernatant from VVTG18058-infected cells was used as a negative control. Results are shown in Figure 15 as the mean and standard deviation (SD) of triplicate measurements of three samples. Both the cell line and the promoter controlling transgene transcription affect the level of transgene expression. The highest expression was obtained in A549 cells infected with COPTG19673. However, for both viruses and the three tumor cell lines tested, high-level expression of vIL-12 was obtained at concentrations ranging from 0.3 to 8.3 μg / mL.

[0252] Functional assay of protein vIL-12 in infected tumor cell supernatant The functionality of the virally produced IL-12 during the transgene expression assay of the "supernatant preparations" of this example was assessed using HEK-Blue™ IL-12 reporter cells and by cell proliferation assays using NK-92 cells.

[0253] Biological activity of vIL-12 in HEK Blue IL-12 reporter cells The biological activity of vhIL-12 produced in the supernatants of human tumor cell lines was assayed using HEK-Blue™ IL-12 reporter cells. The biological activity of vIL-12 produced in three human tumor cell lines infected with COPTG19673 and COPTG19674 was measured and compared with that of human recombinant hIL-12 (hereafter referred to as rhIL-12).

[0254] HEK-Blue™ IL-12 cells are designed to detect human and mouse bioactive IL-12 by monitoring activation of the STAT-4 pathway. Upon binding of IL-12 to the IL-12 receptor on the surface of HEK-Blue™ IL-12 cells, a signaling cascade leads to activation of STAT-4 and subsequent production of the secreted alkaline phosphatase (SEAP) marker protein. Detection of SEAP in the supernatant of HEK-Blue™ IL-12 cells can be easily assessed using QUANTI-Blue™.

[0255] Briefly, HEK-Blue™ IL-12 cells were plated at 5E+04 cells / well in 96-well flat-bottom microtiter plates. Different dilutions of culture supernatant and rhIL-12 standard (concentrations ranging from 10 pg / mL to 100 ng / mL) were added to 96-well cell culture microplates. The plates were incubated at 37°C. After 24 hours of incubation, detection of SEAP in the supernatant of HEK-Blue™ IL-12 cells was determined using QUANTI-Blue™ (Invivogen, ref. rep-qbs) according to the supplier's protocol. Supernatants from mock-infected and no-arm control VACV-infected cells were used as negative controls.

[0256] The results shown in Figures 16A–F indicate that all three different samples tested contained biologically active vhIL-12. As controls, medium without rIL-12, supernatant (SN) from mock-infected cells, and SN from a control VACV-infected cell line were added, but these did not show SEAP expression. Comparison of the biological activity of vhIL-12 and rhIL-12 was performed after administering the same ELISA to all samples. At comparable concentrations, vhIL-12 and rhIL-12 produced by the three infected tumor cell lines induced relatively similar levels of absorbance. The results showed that vIL-12 produced from the two VACV-IL-12s activated the HEK-Blue IL-12 cell line with a better EC50 than rhIL-12. These results demonstrated that IL-12 produced by VACV-infected tumor cells retains its cytokine activity.

[0257] Biological activity of vIL-12 on NK-92 cells The biological activity of vIL-12 produced in the supernatants of infected human tumor cell lines was assayed using a cytokine-dependent cell proliferation assay of the NK-92 cell line. NK-92 cell proliferation can be induced by IL-12. The biological activity of vhIL-12 produced by three human tumor cell lines infected with COPTG19673 and COPTG19674 was measured and compared with that of human recombinant hIL-12.

[0258] NK-92 is an interleukin-2-dependent natural killer cell line derived from peripheral blood mononuclear cells. NK-92 cells also depend on IL-12 for proliferation and can then be used to regulate IL-12 functionality.

[0259] Briefly, NK-92 cells were plated at 1E+04 cells / well in 96-well flat-bottom microtiter plates. Different dilutions of culture supernatant and rhIL-12 standard (concentrations ranging from 1 pg / mL to 100 ng / mL) were added to 96-well cell culture microplates. The plates were incubated at 37°C. After 48 hours of incubation, CellTiter-Glo® was added according to the supplier's protocol. Supernatants from mock-infected cells and no-arm control VACV-infected cells were used as negative controls.

[0260] The results shown in Figures 17A–E show that for both viruses, COPTG19673 and COPTG19674, all three different samples tested contained biologically active vhIL-12. As negative controls, SN from mock-infected cells and SN from an empty VACV-infected cell line were added and did not stimulate NK-92 proliferation. Comparison of the biological activity of vhIL-12 and rhIL-12 was performed after administering the same ELISA to all samples. At equivalent concentrations, vhIL-12 from the three tumor cell lines, both viruses, and rhIL-12 induced similar levels of NK-92 proliferation. Similar to the HEK-Blue IL-12 cell line, the EC50 values were lower for vIL-12 than for rhIL-12. These results also demonstrated the functionality and potent efficacy of IL-12 produced from VACV.

[0261] In vitro safety assays Replication rates in normal human hepatocytes To monitor the safety profile of COPTG19673 and COPTG19674, normal human hepatocytes were chosen as these primary cells can be routinely obtained directly from donors.

[0262] Hepatocytes were provided by Biopredic in 6-well plates. Hepatocytes were infected with each virus at an MOI of 10. -3and incubated at 37°C under a CO2 atmosphere for 72 hours. The amount of virus produced during the 72-hour incubation was determined by titrating the virus per well using a plaque assay on Vero cells. Results are expressed as replication yields, which correspond to the ratio of the virus amount input / output. Results are the average of triplicate wells.

[0263] VACVwt spread well, with a replication yield (ratio of input virus to output virus) of 837. In the case of the armless control virus VVTG18058, the replication rate was dramatically reduced to 1 (Figure 18). Similarly, COPTG19673 and COPTG19674 did not replicate in human hepatocytes, with replication rates below 1. These results indicate that the attenuation of replication in normal cells provided by the two deletions (TK and RR) is conserved between the armless control VACV (VVTG18058) and the IL-12-expressing VACVs (COPTG19673 and COPTG19674).

[0264] Viral replication in hPBMCs To evaluate the safety profile of the newly generated VACV, human PBMCs were selected as a second normal primary cell line. Wild-type VACV or armless VACV generally do not replicate in hPBMCs. The presence of cytokines or immunostimulatory molecules expressed by VACV may activate or stimulate immune cells, thereby altering the replication profile of VACV in these cells. Therefore, replication of COPTG19673 and COPTG19674 in these cells (i.e., hPBMCs) was evaluated and compared with benchmark VACVwt and VVTG18058. Virus production was measured by plaque assay in Vero cells at an MOI of 1 postinfection and after 3 days of incubation.

[0265] Viral replication yield was determined as the ratio of total infectious particles detected 72 h post-infection (output) and viral particles used to infect PBMCs (input).

[0266] Figure 19 shows that two IL-12-expressing VACVs, COPTG19673 and COPTG19674, as well as VACVwt and armless control VACVs, did not replicate in hPBMCs. In other words, vectorization of human IL-12 did not alter the replication behavior of VACVs in hPBMCs. Furthermore, Figures 27A-C show that no amplification of COPTG19673 was observed in human PBMCs, and only minimal replication was observed in normal human hepatocytes and skin fibroblasts, indicating that replication is relatively specific to tumor cells.

[0267] Example 4: Efficacy of COPTG19673 ("VACV IL-12") against human tumor cell lines VACV expressing IL-12 COPTG19673 (hereafter referred to as "VACV IL-12") was further evaluated.

[0268] Cultured human tumor cells were grown on tissue culture plastic and incubated with VACV IL-12 at different MOIs ranging from 6.4E-06 to 10 to determine the efficacy of virus-mediated tumor regression. After incubating the cells with virus for 7 days, cell viability in culture was measured using a Cell Titer Blue® cell viability assay. Data were analyzed using GraphPad Prism software version 9.0.0 to determine the MOI (PFU) of virus required for half-maximal cell death (EC50 value) extrapolated from a sigmoidal dose-response curve. In the graph in Figure 20, the y-axis represents the mean and standard deviation of the EC50 values for each cell line determined in independent experiments. The tumor type from which each cell line was derived is indicated below the x-axis. The dashed line represents an arbitrary MOI of 0.1 PFU, which represents the amount of virus required to infect and lyse one-tenth of cynomolgus monkey Vero cells in the plaque-forming assay used to measure PFU. These results, as well as those shown in Figures 29B and 29C, demonstrate that VACV IL-12 is potent across a variety of human tumor cell lines.

[0269] To further characterize the oncolytic activity of VACV IL-12, we assessed in vitro cell death in 30 human cancer cell lines representing 12 tumor indications. Tumor cells were infected with VACV-LUC or VACV IL-12 at multiple MOIs, and cell death was assessed on day 5 (Figures 29A-B; see also Figure 20). IL-12 receptors are primarily expressed on immune cells, not tumor cells. Therefore, differences in cell death between VACV-LUC and VACV IL-12 using this in vitro model were unexpected. VACV-LUC and VACV IL-12 effectively killed tumor cells at low MOIs and demonstrated similar EC50 values across tumor lines (Pearson's r = 0.89, p < 0.0001), further demonstrating that encoding IL-12 does not interfere with VACV replication (Figure 29C). VACV IL-12-mediated tumor regression was widely observed in tumor cell lines of various cancer types, with 27 / 30 tumor cell lines showing a mean EC50 value of 0.1 MOI or less. Transgene production and viral replication were also assessed in tumor cell lines 5 days post-infection (MOI 0.004) (Figure 29D-E).

[0270] Example 5: Amounts of VACV IL12 virus and human IL-12 recovered from human bladder tumors after intravenous administration to tumor-bearing mice Tumors derived from SW780 human bladder cancer cells were implanted into the flanks of immunodeficient NOD / SCID mice. 5 , 10 6 , or 10 7After a single intravenous administration of PFU of VACV IL-12, tumors were removed and analyzed for viral infiltration (PFU of virus per gram of tumor tissue) by plaque formation assay and for IL-12 transgene production by virus-infected cells (ng of IL-12 per gram of tumor) using a human IL-12-specific ELISA (Figure 21A). In Figure 21B, the X-axis indicates the time point after viral administration. Asterisks indicate time points at which no virus or transgene determinations were made. A zero on the X-axis indicates that no measurable virus or transgene was recovered. The results in Figure 21A demonstrate that the amount of virus isolated from tumors correlates with the amount of IL-12 detected in the tumors (Pearson's correlation coefficient 0.20, p=0.03).

[0271] Additional experiments were performed to evaluate transgene production and replication in SW780 tumor-bearing mice. In treated tumors, viral replication increased in a dose- and time-dependent manner. At 96 hours post-injection, 1 × 10 5 2.5 × 10 from mice treated with PFU 4 ±4.3×10 4 PFU / g recovered, 1 x 10 6 9.5 × 10 from mice treated with PFU 7 ±1.0×10 8 PFU / g recovered, 1 x 10 7 1.3 × 10 from mice treated with PFU 8 ±1.2×10 8 PFU / g were recovered (Figure 30A). Similarly, IL-12 production increased over time within the tumor (Figure 30E), whereas IL-12 was detectable in the periphery, although at lower concentrations (Figure 30F).

[0272] To further determine the antitumor efficacy of VACV IL-12 in NOD / SCID mice bearing subcutaneous tumors from NCI-H292, SW780, or HCT-116 cell lines, mice were treated with VACV-LUC or VACV IL-12 (10 5 , 10 6 , and 10 7In the NCI-H292 and HCT-116 models, mice were treated with a single intravenous dose of 10 PFU (Figures 30A-C). 5 Significant tumor control was observed with a single dose of PFU (p value < 0.001). 10 6 Significant tumor control was observed in the SW780 model following a single administration of PFU of VACV IL-12 (p-value <0.001). Due to the lack of an intact immune system, VACV-LUC and VACV IL-12 demonstrated similar tumor control, indicating that the oncolytic activity of VACV is an important contributor to tumor control.

[0273] Example 6: Activity of VACV muIL-12 against mouse syngeneic tumors The activity of VACV encoding murine IL-12 was assessed after multiple doses and intratumoral administration in C57BL / 6 mice bearing subcutaneous MC38 colon tumors (Fig. 22A). Because human IL-12 does not bind to the murine IL-12 receptor, murine IL-12 was chosen as the cytokine encoded by VACV IL-12 in these experiments. Tumors were approximately 80 mm in median size. 3 After growing to adulthood, they were randomly assigned to treatment groups. 7 PFU of virus was administered twice weekly for 14 days. Blood was collected 4 and 24 hours after the first administration, and tumor burden was recorded thereafter. Tumor growth was assessed in vehicle-treated control mice, mice administered VACV containing no transgene (empty VACV), and mice administered VACV encoding muIL-12 (VACV muIL-12). Tumor growth is shown as individual tumor spider plots in Figures 22B–D, and tumor-bearing mouse survival is shown in Figure 22E as a Kaplan-Meier plot (CR, complete tumor response to therapy with no detectable tumor burden; *, p=0.0024 by log-rank (Mantel-Cox) analysis comparing three or more groups, performed in GraphPad Prism 9). These results demonstrate that VACV muIL-12 is effective against murine syngeneic tumors.

[0274] Example 7: Expression of murine IL-12 and induction of inflammatory cytokines by VACV muIL-12 Expression of murine IL-12 was detected in the peripheral blood of mice 4 and 24 hours after intratumoral administration of VACV muIL-12, but not after administration of empty VACV or vehicle (Figure 23A). Similarly, peripheral blood IFNγ levels (Figure 23B) were significantly higher in VACV muIL-12-treated mice compared with mice administered empty VACV or vehicle. Other proinflammatory cytokines detected in the peripheral blood tended to be higher in VACV muIL-12-treated mice compared with controls, including the IFNγ-inducing cytokine CXCL10 (Figure 23C), as well as the proinflammatory cytokines IL6 (Figure 23D) and TNFα (Figure 23E).

[0275] Example 8: Activity of VACV luc in primary human patient-derived tumor xenografts The antitumor activity of luciferase-expressing VACV (VACV luc) was determined using primary tumors (PDX: patient-derived xenografts) from 47 cancer-bearing patients (Table 6) implanted in immunocompromised NOD / SCID mice (Figure 24A-H). Each tumor tested was either left untreated (open circles, gray line) or injected with 1 x 10 7 pfu VACV luc virus (black squares, black lines) was administered weekly by intravenous (IV) route (protocol shown in Figure 28A), and tumors grew to approximately 200 mm 3 A total of three doses were administered, beginning when the tumor reached a mean volume of 100 μg / ml. Because each patient's primary tumor contained only one untreated and one treated tumor, each open circle and closed square represent a pair, but for simplicity, the graphs are grouped by tumor type. Response rates were determined according to tumor burden relative to untreated controls (complete response (CR): no measurable tumor; partial response (PR): >30% reduction in tumor burden; stable disease (DS): <100% tumor growth; and progressive disease (PD): tumor growth progression). On balance, animals treated with VACV Luc virus demonstrated antitumor activity compared to untreated controls across tumor types (Figure 28B and Table 6).

[0276] To assess VACV replication kinetics, tumor viral replication was assessed 48 hours after the first and third doses. Infectious virus was recovered from all tumor models, demonstrating a significant increase in viral replication after the first and third doses (p-value = 0.0079), indicating that VACV accumulates and replicates in treated tumors (Figure 28C).

[0277] [Table 7]

[0278] Example 9: VACV infection increases IL-12R, NK cells, PDL1, CXCL9 and 10 As shown in Figure 25A-F, we measured mRNA expression levels of IL12RB1, IL12RB2, NKp46, PD-L1, CXCL9, and CXCL10 genes in whole mouse stroma isolated from bladder, head and neck, liver, colon, lung, and ovarian cancer patient-derived xenograft (PDX) models from VACV-luciferase-treated mice at 48 hours and 14 days after day 0. Total RNA was isolated from fresh-frozen PDX tissue, and ribosomal RNA and globin transcripts were removed. RNA-seq libraries were generated and paired-end sequencing was performed.

[0279] Paired-end reads were aligned to the mouse genome reference build mm10 using the STAR aligner, and gene-level read counts were generated using Salmon. Read counts were further normalized for sequencing depth and gene length using tximport to generate TPM (transcripts per kilobase million) values for plots. All plots were generated using R version 4.1. These results demonstrate that VACV infection increases IL-12R, NK cells, PDL1, and CXCL9 / 10, thereby priming the tumor microenvironment (TME) to induce potent antitumor immunity.

[0280] Example 10: VACV-IL-12 efficiently infects human tumors in vitro, resulting in IL-12 and early B8R-dependent blockade of IFN-263. We investigated the efficacy of VACV-IL-12 in vitro infection of human tumors. Specifically, we assessed the efficacy of VACV-IL-12 in whole tumor tissue slice cultures (TSCs) derived from melanoma, bladder cancer, colon cancer, lung cancer, and ovarian cancer, as well as dissociated human tumor cells (DTCs) from patients with melanoma, head and neck squamous cell carcinoma, and ovarian cancer. DTCs of different tumor types were thawed in culture medium supplemented with 1X CTL antiaggregant lavage fluid. 50,000 cells were plated in 96-well U-bottom flasks and cultured with PBS (control), VACV-luciferase (MOI 1), or VACV-IL-12 (MOI 1). Supernatants were collected from cultured DTCs 72 hours after treatment. IL-12 (i.e., IL12p70) concentrations were measured using a custom U-Plex human IL-12p70 assay or a U-PLEX mouse IL-12p70 assay (catalog numbers K151UAK and K152UAK, Meso Scale Diagnostics), respectively, according to the manufacturer's protocol. Human IL-12 expression was detected in the supernatants of tumor tissue slice cultures (TSCs) 3 days after infection with VACV IL-12, but not after infection with VACV-GFP or mock-infected tissues (Figure 26A), as well as in DTCs (Figure 26B). Increased levels of IFNγ mRNA were detected in tissue slice cultures treated with VACV IL-12 compared with slices treated with VACV-GFP or mock infection, but no difference in IFNγ protein expression was detected in supernatants from the same tissues (Figures 26C-D).

[0281] Vaccinia virus encodes several immunomodulatory genes that suppress immune cell activation, such as B8R, which sequesters and neutralizes IFNγ. VACV-IL-12 infection of TSCs resulted in expression of B8R, which has been shown to sequester IFNγ in the supernatant. Significantly higher B8R levels were detected in TSCs infected with either VACV-GFP or VACV-IL-12 compared to mock-infected tissue (Figure 26E). In Figure 26E, each dot represents one slice and one to four replicates per condition. Data were analyzed using GraphPad Prism software version 9.0.0. A schematic diagram of VACV infection, transgene production, and tumor cell lysis is shown in Figure 26F.

[0282] VACV IL-12 (COPTG1673) infection resulted in the production of IL-12p70 in 19 / 19 DTC samples tested (17,984 pg / mL ± SD 49,523). In contrast, IL-12 concentrations in supernatants from mock-infected (6.15 pg / mL ± SD 9.13) or VACV GFP-treated (4.99 pg / mL ± SD 6.36) DTCs (Figures 31A-D) were negligible. IFNγ RNA transcripts were significantly increased after VACV IL-12 infection compared to mock infection (1.5-fold, p<0.001) and VACV GFP in TSCs (1.4-fold, p<0.001), but assessment of both DTC and TSC supernatants demonstrated that IFNγ protein was not produced after VACV IL-12 treatment (Figures 26B, 26D, and 31A-D).

[0283] Example 11: VACV encoding murine IL-12 overcomes the inhibitory effect of B8R and leads to IFN-γ induction in an in vivo rat model Because IFNγ signaling is important for IL-12 efficacy, we evaluated the effect of B8R on downstream IL-12 and IFNγ activation. While VACV-encoded B8R does not bind mouse IFNγ, B8R binds and neutralizes human and rat IFNγ. To confirm B8R binding to rat IFNγ, a competitive ELISA was performed. Recombinant B8R protein or filtered supernatant from VACV-infected HeLa cells (MOI 1) was incubated with recombinant IFNγ at 37°C for 1 hour. An ELISA was then performed to measure available rat IFNγ. Incubation with rB8R resulted in greater than 50% neutralization, whereas supernatant from infected cells was able to inhibit IFNγ detection in a dose-dependent manner, confirming that B8R binds to rat IFNγ (Figure 32A).

[0284] Based on the ability of B8R to bind rat IFNγ, we utilized a syngeneic rat tumor model to evaluate VACV IL-12 (COPTG1673) in an immunocompetent model. Because muIL12 has been shown to cross-react in rats, we used the alternative VACV-muIL12 virus. Furthermore, VACV-muIL12 replicated and produced the muIL-12 transgene more efficiently in rat tumor cells compared to mouse tumor cells (Figure 32B-C). Similarly, VACV-muIL12 mediated potent tumor regression of rat tumor cell lines but exhibited low cell death activity against mouse tumor cell lines (Figure 32D-F). Rats were implanted with F98 tumor cells and intravenously administered VACV-LUC (1 x 10) on days 0, 4, and 7. 7 PFU) or VACV-muIL12 (1 × 10 5 , 1×10 6 , 1×10 7 Plasma cytokine analysis confirmed the production of IL12p70, with a 1 × 10 5 and 1 x 10 6A modest increase was observed between rats treated with VACV-muIL12 and those treated with VACV-LUC (Figure 32G). Furthermore, IFN-γ was detectable in the plasma of rats treated with VACV-muIL12 but not in the VACV-LUC control group (Figure 32H). These results indicate that VACV-encoded IL12 induces peripheral IFN-γ production, which is not inhibited by B8R.

[0285] Interferon-γ competitive ELISA Recombinant rat IFN-γ (1 ng / ml) (R&D) was incubated with PBS, recombinant B8R (50 ng / ml) (Vendor), or 0.2 μm filtered supernatants of HeLa cells infected with VACV IL-12 (MOI 1). The mixtures were incubated at 37°C for 1 hour. Because B8R binds to IFN-γ and prevents antibody binding and detection by ELISA, ELISA was performed to determine IFN-γ recovery, as described below. Recovery was calculated relative to IFN-γ alone.

[0286] ELISA Rat interferon-γ was measured in the plasma of rats treated with VACV at the indicated time points. Plasma was diluted and measured using the Rat IFN-γ DuoSet Elisa according to the manufacturer's protocol (R&D Systems). This demonstrates that recombinant poxvirus can increase interferon (IFN)-γ.

[0287] Example 12: IL12-expressing VACV improves therapeutic efficacy in a mouse syngeneic tumor model To evaluate the immunomodulatory effects of IL-12, we tested the murine surrogate VACV-muIL12 virus in mouse tumor cell lines and tumor models. VACV-muIL12 demonstrates replication, tumor regression, and transgene bioactivity similar to VACV IL-12 in human and mouse tumor cell lines (Figures 33A–E and 34A–F). Mice bearing subcutaneous CT26 tumors were treated with five intratumoral (it) doses (10 PFU) of either vehicle control, VACV-LUC, or surrogate VACV-muIL12 (Figures 35A–D). Treatment with VACV-LUC did not result in control of CT26 tumors (0 / 10 complete responses), similar to the vehicle group (Figures 35B–D). However, treatment with VACV-muIL12 resulted in regression of CT26 tumors, with 6 / 10 complete responses (Figure 35E).

[0288] VACV-LUC and VACV-muIL12 demonstrated similar oncolytic activity and replication in mouse tumor cells (Figure 34A-F). Therefore, it was hypothesized that the observed differences in tumor control were due to the immunomodulatory effects of muIL12. Therefore, animals were treated according to the protocol shown in Figure 35A. Evidence of IL-12 production in serum was detected 4 hours post-injection (Figure 35F). IFNγ induction, a key feature of IL-12 signaling, was detected 4 and 24 hours post-injection in VACV-muIL12-treated mice (Figure 35G). Similar results were observed in the MC38 syngeneic tumor model (Figures 22A-E, 23A-B, 23E). Overall, these results suggest that VACV encoding IL-12 participates in the adaptive immune response to control tumor growth, but the oncolytic activity of VACV-LUC alone is insufficient to control tumor burden.

[0289] Example 13: In vivo and ex vivo testing methods In vivo testing Xenografts derived from cell lines were implanted in the right flank of 8- to 12-week-old animals with 5 × 10 cells suspended in PBS. 6 Tumors were established by subcutaneous (sc) injection of 200 μL of cells. Tumors were 150–250 mm before randomization.3 Animals were weighed twice weekly for 4 weeks and then weekly thereafter, and weight loss was monitored for protection purposes.

[0290] To establish the MC38 mouse syngeneic tumor model, cells were removed from tissue culture plastic using Accutase solution. Collected cells were stored on ice for a period of time between collection and implantation (not exceeding 3 hours). The implantation site of each animal was shaved at least 24 hours before cell injection. Seven to nine-week-old C57BL / 6J female animals were implanted with 5 x 10 cells suspended in 100 μL of phosphate-buffered saline (PBS) into the right flank. 5 Syngeneic tumors were established by subcutaneous injection of 100 cells. Tumor volumes were 200 mm 3 Mice were randomized when they reached 1. The weight of the mice was monitored throughout the study.

[0291] To establish CT26 tumors, cells were removed from T-150 flasks using trypsin solution before implantation, and the trypsin was neutralized by adding RPMI + 10% FBS. The harvested cells were stored on ice from harvest until implantation (not exceeding 3 hours). The implantation site of each animal was shaved at least 24 hours before cell injection. 5 × 10 cells suspended in 200 μL of PBS were injected into the right flank of 9-12 week-old Balb / c female animals. 5 Syngeneic tumors were established by subcutaneous injection of 100 cells. Tumor volumes ranged from 150 to 250 mm. 3 Mice were randomized when they reached 1. The weight of the mice was monitored throughout the study.

[0292] To establish 47 PDX models, cryovials containing tumor cells were thawed and prepared for injection into mice. Thawed cells were washed with RPMI medium, counted, and resuspended in cold RPMI at a concentration of 50,000–100,000 viable cells / 50 μL. The cell suspension was mixed with an equal volume of CULTUREX™ extracellular matrix (ECM) and kept on ice during transport to the animal care room. Cells were drawn into a chilled 1 mL slip-tip syringe and prepared for injection. The filled syringe was kept on ice to prevent solidification of the ECM. Animals were shaved prior to injection. One mouse was immobilized at a time, and the injection site was disinfected with an alcohol swab. 100 mL of cell suspension (50,000–100,000 cells) in ECM was injected subcutaneously into the hind flank of 9–29 week-old NOD-SCID mice. 100 ml of cell suspension was injected per syringe into up to five animals.

[0293] To inoculate tumor masses, frozen tumor pieces were thawed and cut into tumor masses approximately 2-3 mm in diameter. Each mouse received a single injection of buprenorphine 30 minutes before tumor mass implantation. One tumor mass was loaded into a trocar needle and injected into the right front flank of the mouse for tumor development. Mice were ear-tagged and left for up to 7 days before tumor growth was observed. When tumors reached approximately 130-230 mm 3 After reaching a ≥100% CI, patients were assigned to a treatment group. The anti-cancer effect of VACV Luc was determined by comparing the growth curve of each treated tumor with that of a size-matched untreated tumor. In this way, the best overall response of the treated tumor compared to the untreated tumor was designated as complete response (CR), partial response (PR), stable disease (DS), or progressive disease (PD). Tumors that did not fit this classification were considered not evaluable (NE).

[0294] To establish F98 tumors in rats, cells were removed from a 10-stack flask using trypsin solution and neutralized by adding DMEM + 10% FBS. The harvested cells were stored on ice from harvest until implantation (not exceeding 3 hours). F98 cell line was cultured at 5.0 × 10 cells suspended in 0.2 mL of PBS.6 Cells were implanted by subcutaneous (SC) injection into the right flank of 7- to 9-week-old animals. Tumors were approximately 300–350 mm before randomization. 3 was left until it reached

[0295] Ex vivo analysis To assess viral replication in tumors, mice were euthanized, blood was collected, and tumor and normal tissues were excised and snap-frozen. The frozen tumor and normal tissues were weighed and suspended in ice-cold homogenization buffer (PBS supplemented with 1x antibiotic-antimycotic and 1x HALT™ protease-phosphatase inhibitor). The tissues containing the homogenization buffer were transferred to Matrix A tubes and homogenized at 4 m / s for 20 seconds using a Fast-prep-24 lysis system. The tissue homogenates were then subjected to two freeze-thaw cycles, aliquoted, and stored at -80°C. Two additional aliquots that were not subjected to freeze-thawing were prepared for DNA isolation or cytokine analysis by MSD.

[0296] Cytokine analysis Aliquots of tumor and spleen homogenates were centrifuged at 1,500 RPM for 5 minutes at 4°C. Supernatants were collected and stored at -80°C for cytokine measurements. Blood was collected from mice at the indicated time points and centrifuged at 13,000 RPM for 10 minutes at 4°C. Plasma was collected and stored at -80°C. Plasma, tumor, and spleen lysates were diluted and measured using the Mouse and Human IL12p70 U-Plex Assay (Meso Scale Diagnostics) or a custom U-Plex mouse cytokine panel according to the manufacturer's protocol.

[0297] statistical analysis Differences in tumor burden size at the indicated times during the experiment were assessed using one-way analysis of variance (ANOVA) with Tukey's correction for multiple comparisons using GraphPad Prism software (San Diego, California, USA). Statistical differences in calculated tumor growth rates were assessed using a two-tailed Mann-Whitney U-test (also known as the Wilcoxon rank-sum test). Mean growth rates and growth rate inhibition statistics are reported along with the Mann-Whitney U-test p-values. Differences in virus recovery from tumors (PFU), human IL-12 transgene detected in tumors (pg / mL), and IL-12 transgene detected in mouse plasma (pg / mL) were determined using ANOVA with Tukey's correction for multiple comparisons. Significant p-values obtained from the ANOVA analysis.

[0298] Example 14: Therapeutic combination with VACV-muIL12 and immune checkpoint inhibitors As demonstrated in the examples above, VACV-muIL12 results in significant tumor control. However, it was hypothesized that combining the murine VACV-muIL12 surrogate with a PD-L1 inhibitor could enhance antitumor T cell immunity. To test this, mice were implanted with CT26 tumor cells and treated with vehicle, VACV-LUC, or VACV-muIL12. Each treatment group also received vehicle, an isotype control, or a commercially available anti-muPD-L1 blocking antibody that prevents murine PD-L1 from binding to PD-1. Because tumors were well controlled after VACV-muIL12 therapy, no significant enhancement in tumor control was observed when delivered in combination with an anti-PD-L1 antibody (Figures 36A-C). However, significant antitumor immune responses were observed.

[0299] The antitumor immune response was further characterized by an ex vivo splenocyte restimulation assay. Splenocytes were harvested 7 days after VACV administration and stimulated with either a tumor-associated peptide antigen (AH-1) or a VACV-specific peptide (A52L). Combining VACV-muIL12 with anti-PD-L1 resulted in a significant increase in the number of IFN-gamma-secreting cells upon AH-1 peptide stimulation (p-value 0.041) (Figure 37A). In comparison, VACV-luc alone or in combination did not result in a significant increase in IFN-gamma-secreting cells compared to other treatment groups. Furthermore, the VACV-specific immune response was not affected by IL-12 or anti-PD-L1 (Figure 37B). This example demonstrates that VACV-muIL12 enhances tumor-specific immune responses when combined with a PD-L1 inhibitor in a tumor model resistant to anti-PD-L1 therapy. These results also indicate that VACV-muIL12 in combination with anti-PD-L1 blocking antibodies engages the immune system to induce T cell-specific immune responses against tumor cells.

Claims

1. A therapeutic combination comprising: (a) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12); and (b) a programmed death protein 1 (PD-1) inhibitor or a programmed death ligand 1 (PD-L1) inhibitor.

2. 10. The therapeutic combination of claim 1, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter.

3. 3. The therapeutic combination of claim 1 or 2, wherein the poxvirus belongs to the genus Orthopoxvirus.

4. 4. The therapeutic combination of claim 3, wherein the poxvirus belonging to the genus Orthopoxvirus is an oncolytic vaccinia virus.

5. 5. The therapeutic combination of claim 4, wherein the oncolytic vaccinia virus is selected from the group consisting of Copenhagen (Cop), Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, and LIVP virus strains.

6. 6. The therapeutic combination of any one of claims 1 to 5, wherein the genome comprises at least 150 kb, at least about 175 kb, at least about 180 kb, at least about 185 kb, at least about 190 kb, at least about 192 kb, or at least about 194 kb.

7. The therapeutic combination of any one of claims 1 to 6, wherein the poxvirus is attenuated.

8. The therapeutic combination of any one of claims 1 to 7, wherein the poxvirus is not NYVAC.

9. 9. The therapeutic combination of any one of claims 1 to 8, wherein the late promoter is selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R.

10. 10. The therapeutic combination of claim 9, wherein the late promoter is selected from pA14L, pA26L, and pF17R.

11. 11. The therapeutic combination of claim 10, wherein the late promoter is pA14L.

12. 11. The therapeutic combination of claim 10, wherein the late promoter is pF17R.

13. 13. The therapeutic combination of any one of claims 1 to 12, wherein the late promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23.

14. 14. The therapeutic combination of any one of claims 1 to 13, wherein the late promoter comprises the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23.

15. 9. The therapeutic combination of any one of claims 1 to 8, wherein the intermediate promoter is selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L.

16. 16. The therapeutic combination of claim 15, wherein the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of any one of SEQ ID NOs:25-31.

17. The therapeutic combination of any one of claims 1 to 16, wherein said IL-12 is human IL-12.

18. The therapeutic combination of any one of claims 1 to 17, wherein the IL-12 is a fusion protein comprising the IL-12 p40 subunit and the IL-12 p35 subunit.

19. 19. The therapeutic combination of claim 18, wherein the IL-12 p40 subunit is N-terminal to the IL-12 p35 subunit.

20. 20. The therapeutic combination of claim 18 or 19, wherein the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO:17, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:

17.

21. 21. The therapeutic combination of any one of claims 18 to 20, wherein the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO:19, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO:

19.

22. 22. The therapeutic combination of any one of claims 18 to 21, wherein the IL-12 p40 subunit and the IL-12 p35 subunit are fused into a single polypeptide via an amino acid linker.

23. 23. The therapeutic combination of claim 22, wherein said amino acid linker is about 5 to about 10 amino acids in length.

24. 24. The therapeutic combination of claim 22 or 23, wherein the amino acid linker is 7 amino acids in length.

25. 25. The therapeutic combination of any one of claims 22 to 24, wherein the amino acid linker is a glycine-serine linker.

26. 26. The therapeutic combination of any one of claims 22 to 25, wherein the amino acid linker comprises the amino acid sequence of SEQ ID NO:

18.

27. 27. The therapeutic combination of any one of claims 1 to 26, wherein said IL-12 comprises the amino acid sequence of SEQ ID NO:20, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO:

20.

28. The therapeutic combination of any one of claims 18 to 21, wherein the IL-12 p40 subunit and the IL-12 p35 subunit are directly fused into a single polypeptide.

29. 29. The therapeutic combination of any one of claims 1 to 28, wherein the heterologous nucleic acid sequence encoding the IL-12 comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO:

21.

30. 30. The therapeutic combination of claim 29, wherein the heterologous nucleic acid sequence encoding the IL-12 comprises the nucleotide sequence of SEQ ID NO:

21.

31. 31. The therapeutic combination of any one of claims 1 to 30, wherein the poxvirus is deficient in thymidine kinase (TK) activity.

32. 32. The therapeutic combination of any one of claims 1 to 31, wherein the poxvirus lacks a functional J2R gene.

33. 33. The therapeutic combination of any one of claims 1 to 32, wherein the poxvirus is deficient in ribonucleotide reductase (RR) activity.

34. 34. The therapeutic combination of any one of claims 1 to 33, wherein the poxvirus lacks a functional I4L gene.

35. 35. The therapeutic combination of any one of claims 1 to 34, wherein said poxvirus lacks a functional F4L gene.

36. 36. The therapeutic combination of any one of claims 1 to 35, wherein the heterologous nucleic acid sequence encoding IL-12 is inserted within the J2R locus of the poxvirus genome.

37. 37. The therapeutic combination of claim 36, wherein said insertion renders said J2R gene non-functional, and optionally said J2R locus is completely deleted by said insertion.

38. 36. The therapeutic combination of any one of claims 1 to 35, wherein the heterologous nucleic acid sequence encoding IL-12 is inserted within the I4L locus of the poxvirus genome.

39. 39. The therapeutic combination of claim 38, wherein said insertion renders said I4L gene non-functional, and optionally, said insertion does not fully delete the I4L locus.

40. 36. The therapeutic combination of any one of claims 1 to 35, wherein the heterologous nucleic acid sequence encoding the IL-12 is inserted within the F4L locus of the poxvirus genome.

41. 41. The therapeutic combination of claim 40, wherein said insertion renders said F4L gene non-functional, and optionally, said insertion does not fully delete the F4L locus.

42. 42. The therapeutic combination of any one of claims 1 to 41, wherein said poxvirus further comprises one or more therapeutic genes in its genome.

43. 43. The therapeutic combination of claim 42, wherein said one or more therapeutic genes are selected from the group consisting of suicide genes, immunomodulatory genes, anti-angiogenic genes, immune checkpoint inhibitor genes, antibody encoding genes, extracellular matrix degradation or regulating genes, and combinations thereof.

44. 44. The therapeutic combination of any one of claims 1 to 43, capable of lysing one or more cancer cell types.

45. 45. The therapeutic combination of claim 44, wherein the recombinant poxvirus is capable of expressing at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL, or about 8.3 μg / mL of the IL-12 in cancer cells 72 hours post-infection at a multiplicity of infection (MOI) of 10.

46. 46. The therapeutic combination of claim 44 or 45, wherein the cancer cells are renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, bile duct cancer, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma cells.

47. 47. The therapeutic combination of any one of claims 44-46, wherein the cancer cells are A549, HT29, MIA PaCa-2, A375, RPMI7591, Sk-Mel-5, OVCAR3, OVCAR4, NCI-H292, NCI-H460, SW780, TCCSUP, T24, Huh7, Hep3B, Panc1, Hup-T3, DAN-G, MDA-MB-435, HCC38, BT20, SW1417, WiDr, HCT-116, SNU5, NCI-N87, Kato III, A CHN, A 498, PC-3, or MM.1R cells.

48. 48. The therapeutic combination of any one of claims 1 to 47, wherein the virus is produced in chicken embryo fibroblasts (CEF), HeLa cells, EB66® cells, Vero cells, HEK293 cells, PerC6 cells, BHK21 cells, or MRC5 cells.

49. 49. The therapeutic combination of any one of claims 1 to 48, wherein the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or an antigen-binding fragment thereof, or an anti-PD-L1 antibody or an antigen-binding fragment thereof.

50. 50. The therapeutic combination of claim 49, wherein the anti-PD-1 antibody or antigen-binding fragment thereof or the anti-PD-L1 antibody or antigen-binding fragment thereof is produced in Chinese hamster ovary (CHO) cells.

51. 49. The therapeutic combination of any one of claims 1 to 48, wherein the PD-1 inhibitor or the PD-L1 inhibitor is a small molecule.

52. 52. The therapeutic combination of any one of claims 1 to 51, wherein (b) is a PD-1 inhibitor.

53. 52. The therapeutic combination of any one of claims 1 to 51, wherein (b) is a PD-L1 inhibitor.

54. 54. The therapeutic combination of any one of claims 1 to 53, wherein the PD-1 inhibitor or PD-L1 inhibitor is selected from the group consisting of durvalumab, nivolumab, pembrolizumab, lambrolizumab, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, pidilizumab, GLS-010, STI-1110, AGEN2034, MGA012, IBI308, AMP-224, BMS-936559, atezolizumab, MPDL3280A, RG7446, avelumab, STI-1014, CX-072, KN035, and CK-301.

55. 55. The therapeutic combination of any one of claims 1 to 51 and 53 to 54, wherein the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or antigen-binding fragment thereof comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 32, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 34, a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 35, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 36, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:

37.

56. 56. The therapeutic combination of claim 55, wherein the anti-PD-L1 antibody, or antigen-binding fragment thereof, comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:

39.

57. 57. The therapeutic combination of claim 55 or 56, wherein the anti-PD-Ll antibody, or antigen-binding fragment thereof, further comprises an Fc variant, wherein the Fc variant comprises at least one amino acid substitution selected from the group consisting of 234F, 235F, and 331S, as numbered according to the EU index as set forth in Kabat.

58. 58. The therapeutic combination of any one of claims 1 to 51 and 53 to 57, wherein the PD-1 inhibitor or PD-L1 inhibitor is durvalumab.

59. A therapeutic combination comprising: (a) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), wherein said heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter; and (b) durvalumab.

60. 60. The therapeutic combination of any one of claims 1 to 59, wherein the therapeutic combination is for (i) treating cancer in a subject, (ii) inhibiting the growth of cancer, or (iii) enhancing a tumor-specific immune response.

61. 61. The therapeutic combination of any one of claims 1 to 60, wherein said therapeutic combination is a kit of parts comprising: (a) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12); and (b) said programmed death protein 1 (PD-1) inhibitor or programmed death-ligand 1 (PD-L1) inhibitor.

62. 1. A method of treating cancer in a subject, comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), and (ii) a programmed death protein 1 (PD-1) inhibitor or a programmed death ligand 1 (PD-L1) inhibitor.

63. 1. A method of inhibiting the growth of cancer in a subject, comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), and (ii) a PD-1 inhibitor or a PD-L1 inhibitor.

64. A method of enhancing a tumor-specific immune response in a subject with cancer, comprising administering to the subject effective amounts of (i) a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), and (ii) a PD-1 inhibitor or a PD-L1 inhibitor.

65. 65. The method of any one of claims 62 to 64, wherein the heterologous nucleic acid sequence encoding IL-12 is operably linked to a late promoter or an intermediate promoter.

66. 66. The method of any one of claims 62 to 65, wherein the poxvirus belongs to the genus Orthopoxvirus.

67. 67. The method of claim 66, wherein the poxvirus belonging to the genus Orthopoxvirus is an oncolytic vaccinia virus.

68. 68. The method of claim 67, wherein the oncolytic vaccinia virus is selected from the group consisting of Copenhagen (Cop), Western Reserve (WR), Elstree, Wyeth, Lister, Tian Tan, and LIVP virus strains.

69. 69. The method of any one of claims 62-68, wherein the genome comprises at least 150 kb, at least about 175 kb, at least about 180 kb, at least about 185 kb, at least about 190 kb, at least about 192 kb, or at least about 194 kb.

70. 70. The method of any one of claims 62 to 69, wherein the poxvirus is attenuated.

71. 71. The method of any one of claims 62 to 70, wherein the poxvirus is not NYVAC.

72. 72. The method of any one of claims 62 to 71, wherein the late promoter is selected from pA10L, pA11R, pA13L, pA14L, pA26L, pG7L, and pF17R.

73. 73. The method of claim 72, wherein the late promoter is selected from pA14L, pA26L, and pF17R.

74. 74. The method of claim 73, wherein the late promoter is pA14L.

75. 74. The method of claim 73, wherein the late promoter is pF17R.

76. 76. The method of any one of claims 62 to 75, wherein the late promoter comprises a nucleotide sequence at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23.

77. 77. The method of any one of claims 62 to 76, wherein the late promoter comprises the nucleotide sequence of SEQ ID NO: 11, 13, 22, or 23.

78. 72. The method of any one of claims 62 to 71, wherein the intermediate promoter is selected from pI1L, pA12L, pA19L, pA42R, pD13L, pA3L, or pA27L.

79. 79. The method of claim 78, wherein the intermediate promoter comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or 100% identical to the nucleotide sequence of any one of SEQ ID NOs:25-31.

80. 80. The method of any one of claims 62 to 79, wherein the IL-12 is human IL-12.

81. 81. The method of any one of claims 62 to 80, wherein the IL-12 is a fusion protein comprising the IL-12 p40 subunit and the IL-12 p35 subunit.

82. 82. The method of claim 81, wherein the IL-12 is a fusion protein comprising the IL-12 p40 subunit and the IL-12 p35 subunit.

83. 83. The method of claim 81 or 82, wherein the IL-12 p40 subunit comprises the amino acid sequence of SEQ ID NO:17, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:

17.

84. 84. The method of any one of claims 81-83, wherein the IL-12 p35 subunit comprises the amino acid sequence of SEQ ID NO:19, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the amino acid sequence of SEQ ID NO:

19.

85. 85. The method of any one of claims 81 to 84, wherein the IL-12 p40 subunit and the IL-12 p35 subunit are fused into a single polypeptide via an amino acid linker.

86. 86. The method of claim 85, wherein the amino acid linker is about 5 to about 10 amino acids in length, optionally, the amino acid linker is 7 amino acids in length.

87. 87. The method of claim 85 or 86, wherein the amino acid linker is a glycine-serine linker.

88. 88. The method of any one of claims 85 to 87, wherein the amino acid linker comprises the amino acid sequence of SEQ ID NO:

18.

89. 89. The method of any one of claims 62 to 88, wherein the IL-12 comprises the amino acid sequence of SEQ ID NO:20, or an amino acid sequence that is at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identical to the amino acid sequence of SEQ ID NO:

20.

90. 90. The method of any one of claims 65 to 89, wherein the IL-12 p40 subunit and the IL-12 p35 subunit are directly fused into a single polypeptide.

91. 91. The method of any one of claims 62-90, wherein the heterologous nucleic acid sequence encoding the IL-12 comprises a nucleotide sequence that is at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, or at least 99% identical to the nucleotide sequence of SEQ ID NO:21, optionally wherein the heterologous nucleic acid sequence encoding the IL-12 comprises the nucleotide sequence of SEQ ID NO:

21.

92. 92. The method of any one of claims 62 to 91, wherein the recombinant poxvirus is deficient in thymidine kinase (TK) activity.

93. 93. The method of any one of claims 62 to 92, wherein the recombinant poxvirus lacks a functional J2R gene.

94. 94. The method of any one of claims 62 to 93, wherein the recombinant poxvirus is deficient in ribonucleotide reductase (RR) activity.

95. 95. The method of any one of claims 62 to 94, wherein the recombinant poxvirus lacks a functional I4L gene.

96. 96. The method of any one of claims 62 to 95, wherein the recombinant poxvirus lacks a functional F4L gene.

97. 97. The method of any one of claims 62 to 96, wherein the heterologous nucleic acid sequence encoding IL-12 is inserted within the J2R locus of the poxvirus genome.

98. 98. The method of claim 97, wherein the insertion renders the J2R gene non-functional, and optionally, the J2R locus is completely deleted by the insertion.

99. 99. The method of any one of claims 62 to 98, wherein the recombinant poxvirus is capable of lysing one or more cancer cells.

100. 100. The method of any one of claims 62 to 99, wherein the recombinant poxvirus is capable of expressing at least 50 ng / mL, at least 100 ng / mL, at least 300 ng / mL, at least 500 ng / mL, at least 1.0 μg / mL, at least 2.0 μg / mL, at least 3.0 μg / mL, at least 4.0 μg / mL, at least 5.0 μg / mL, at least 6.0 μg / mL, at least 7.0 μg / mL, at least 8.0 μg / mL, or about 8.3 μg / mL of the IL-12 in cancer cells 72 hours post-infection at a multiplicity of infection (MOI) of 10-2.

101. The method of any one of claims 62 to 100, wherein the recombinant poxvirus is capable of increasing interferon (IFN)-γ.

102. The method of any one of claims 62 to 101, wherein the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or an antigen-binding fragment thereof, or an anti-PD-L1 antibody or an antigen-binding fragment thereof.

103. The method of claim 102, wherein the anti-PD-1 antibody or antigen-binding fragment thereof, or the anti-PD-L1 antibody or antigen-binding fragment thereof is produced in Chinese hamster ovary (CHO) cells.

104. 104. The method of any one of claims 62 to 103, wherein the PD-1 inhibitor or the PD-L1 inhibitor is a small molecule.

105. The method of any one of claims 62 to 104, wherein (ii) is a PD-1 inhibitor.

106. The method of any one of claims 62 to 105, wherein (ii) is a PD-L1 inhibitor.

107. The method of any one of claims 62 to 106, wherein the PD-1 inhibitor or PD-L1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, lambrolizumab, MEDI-0680, cemiplimab, JS001, BGB-A317, INCSHR1210, TSR-042, pidilizumab, GLS-010, STI-1110, AGEN2034, MGA012, IBI308, AMP-224, BMS-936559, atezolizumab, MPDL3280A, RG7446, durvalumab, avelumab, STI-1014, CX-072, KN035, and CK-301.

108. The method of any one of claims 1 to 103 and 107, wherein the PD-1 inhibitor or PD-L1 inhibitor is an anti-PD-1 antibody or antigen-binding fragment thereof comprising a heavy chain CDR1 comprising the amino acid sequence of SEQ ID NO: 32, a heavy chain CDR2 comprising the amino acid sequence of SEQ ID NO: 33, a heavy chain CDR3 comprising the amino acid sequence of SEQ ID NO: 34, a light chain CDR1 comprising the amino acid sequence of SEQ ID NO: 35, a light chain CDR2 comprising the amino acid sequence of SEQ ID NO: 36, and a light chain CDR3 comprising the amino acid sequence of SEQ ID NO:

37.

109. The method of claim 108, wherein the anti-PD-L1 antibody or antigen-binding fragment thereof comprises a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable region comprising the amino acid sequence of SEQ ID NO:

39.

110. 110. The method of claim 108 or 109, wherein the anti-PD-L1 antibody, or antigen-binding fragment thereof, further comprises an Fc variant, wherein the Fc variant comprises at least one amino acid substitution selected from the group consisting of 234F, 235F, and 331S, as numbered according to the EU index as set forth in Kabat.

111. 111. The method of claim 110, wherein the PD-1 inhibitor or PD-L1 inhibitor is durvalumab.

112. 112. The method of any one of claims 62 to 111, wherein the cancer is renal cancer, prostate cancer, breast cancer, bladder cancer, colorectal cancer, lung cancer, liver cancer, gastric cancer, bile duct cancer, endometrial cancer, pancreatic cancer, ovarian cancer, head and neck cancer, melanoma, glioblastoma, multiple myeloma, or malignant glioma.

113. 113. The therapeutic combination of claim 60 or the method of any one of claims 62 to 112, wherein the cancer is resistant to immune checkpoint inhibitor therapy.

114. 114. The therapeutic combination of claim 60 or 113, or the method of any one of claims 62 to 113, wherein the cancer is resistant to a PD1 inhibitor.

115. 115. The therapeutic combination of claim 60, 113, or 114, or the method of any one of claims 62 to 114, wherein the cancer is resistant to a PD-L1 inhibitor.

116. The effective amount for each dose of the recombinant poxvirus is 1 x 10 3 pfu ~ 1 x 10 12 pfu, optionally 1 x 10 4 pfu ~ 1 x 10 11 pfu, optionally 1 x 10 5 pfu ~ 1 x 10 10 pfu, optionally 5 x 10 7 pfu ~ 4 x 10 9 116. The method of any one of claims 62 to 115, comprising pfu.

117. 117. The method of any one of claims 62 to 116, wherein the PD-1 inhibitor or PD-L1 inhibitor is durvalumab, and the durvalumab is administered at a dose of 10 mg / kg every 2 weeks, 1500 mg every 4 weeks, or 1500 mg every 3 weeks.

118. 118. The method of any one of claims 62-117, wherein said administering results in an enhanced therapeutic effect compared to treatment with the recombinant poxvirus alone or treatment with the PD-1 inhibitor or PD-L1 inhibitor alone.

119. The method of any one of claims 62 to 118, wherein the subject is a human.

120. 120. The method of any one of claims 62 to 119, wherein the administration is intratumoral.

121. 121. The method of any one of claims 62 to 120, wherein the administration is intravenous.

122. 122. The method of claim 121, wherein the intravenous administration is via intravenous infusion.

123. 123. The method of claim 122, wherein the administration is at a dose of 10 mg / kg every two weeks.

124. 124. The method of any one of claims 62 to 123, wherein the recombinant poxvirus and / or the PD-1 inhibitor or PD-L1 inhibitor is administered two or more times.

125. 125. The method of any one of claims 62 to 124, wherein the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient prior to administration of the recombinant poxvirus.

126. The method of any one of claims 62 to 124, wherein the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient simultaneously with the recombinant poxvirus.

127. 127. The method of any one of claims 62 to 126, wherein the PD-1 inhibitor or PD-L1 inhibitor and the recombinant poxvirus are administered in separate pharmaceutical compositions.

128. 127. The method of any one of claims 62-124 or 126, wherein the PD-1 inhibitor or PD-L1 inhibitor and the recombinant poxvirus are administered in the same pharmaceutical composition.

129. 125. The method of any one of claims 62 to 124, wherein the PD-1 inhibitor or PD-L1 inhibitor is administered to the patient after administration of the recombinant poxvirus.

130. 130. A composition comprising a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding IL-12, for use in treating cancer in a subject in need thereof, for administration in combination with a PD-1 inhibitor or a PD-L1 inhibitor, optionally wherein said treatment comprises the method of any one of claims 62 to 129.

131. 130. A composition comprising a PD-1 inhibitor or a PD-L1 inhibitor for use in treating cancer in a subject in need thereof, for administration in combination with a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding IL-12, optionally wherein said treatment comprises the method of any one of claims 62 to 129.

132. 130. A pharmaceutical composition comprising a recombinant poxvirus comprising in its genome (i) a heterologous nucleic acid sequence encoding IL-12, and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, optionally wherein said recombinant poxvirus is the recombinant poxvirus used in the method of any one of claims 62 to 129, and / or said PD-1 inhibitor or PD-L1 inhibitor is the PD-1 inhibitor or PD-L1 inhibitor used in the method of any one of claims 62 to 129.

133. 133. The composition for use according to any one of claims 130 to 132, wherein the PD-1 inhibitor or PD-L1 inhibitor is durvalumab.

134. 128. A kit comprising unit dosage forms of (i) a pharmaceutical composition comprising a recombinant poxvirus comprising in its genome a heterologous nucleic acid sequence encoding interleukin-12 (IL-12), and (ii) a PD-1 inhibitor or a PD-L1 inhibitor, optionally wherein the recombinant poxvirus is the recombinant poxvirus used in the method of any one of claims 62 to 127, and / or the PD-1 inhibitor or PD-L1 inhibitor is the PD-1 inhibitor or PD-L1 inhibitor used in the method of any one of claims 62 to 127.

135. The kit of claim 132, wherein the PD-1 inhibitor or PD-L1 inhibitor is durvalumab.