Antisense oligonucleotides for treating diseases or conditions associated with abnormal processing of APP
Antisense oligonucleotides targeting mutant PSEN1 or PSEN2 alleles in FAD restore normal γ-secretase activity, addressing the inadequacies of current treatments by reducing toxic Aβ peptides and minimizing side effects.
Patent Information
- Application Number
- JP2025504743
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-25
- Filing Date
- 2023-07-19
- Publication Date
- 2025-08-20
AI Technical Summary
Current treatments for familial Alzheimer's disease (FAD) associated with abnormal processing of amyloid precursor protein (APP) are inadequate and often result in severe side effects, necessitating a more effective and specific therapeutic approach.
The use of antisense oligonucleotides that selectively target and degrade mutant alleles of PSEN1 or PSEN2, restoring normal γ-secretase activity and reducing toxic Aβ peptide production without affecting wild-type proteins.
This approach effectively normalizes Aβ42/38 ratios, reduces toxic Aβ peptide production, and is more specific and less harmful than existing treatments, offering a promising therapeutic strategy for FAD.
Smart Images

Figure 2025527208000016 
Figure 2025527208000017 
Figure 2025527208000018
Abstract
Description
[Technical Field]
[0001] The present invention relates to the field of human genetics, and more particularly to the treatment of diseases or conditions associated with abnormal (or altered) processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD). The present invention particularly relates to antisense oligonucleotides (AONs) that can be used in the treatment of such diseases or conditions. [Background technology]
[0002] Neurocognitive disorders include a broad range of degenerative brain diseases characterized by progressive declines in memory, learning, perception, social interaction, cognition, orientation, language, comprehension, and judgment (Non-Patent Document 1). Neurocognitive disorders are manifestations of impaired multiple molecular pathways and cellular functions, leading to synapse loss, cell death, inflammation, gliosis, and disruption of functional networks underlying cognitive, sensory, and motor skills (Non-Patent Document 2). The continued decline in a patient's physical function ultimately leads to loss of autonomy and death. Alzheimer's disease (AD) is the most common neurocognitive and neurodegenerative disorder and the leading cause of dementia (60%-80% of cases). AD is associated with both monogenic and complex inheritance and is characterized by the accumulation of insoluble amyloid-β plaques (also known as Aβ plaques) in extracellular spaces and vascular walls, aggregation of the microtubule protein tau in neurofibrillary tangles, dystrophic neurites, synaptic loss, neurotransmitter changes (acetylcholine deficiency and glutamate excitotoxicity), and microgliosis and astrogliosis. Molecular and cytopathological events begin decades before dementia becomes apparent. The age of onset of AD is over 65 years old and is associated with risk polymorphisms in genes regulating microglial immune activation, lipid metabolism, and endocytosis. (Non-Patent Document 3); (Non-Patent Document 4); (Non-Patent Document 5).
[0003] Familial Alzheimer's disease (FAD) is an early-onset form of Alzheimer's disease (EOAD) (before age 65 years) caused by mutations in the genes involved in Aβ peptide production: APP (OMIM 104760), PSEN1 (OMIM 104311), or PSEN2 (OMIM 1600759) (Non-Patent Document 6). FAD is inherited in an autosomal dominant manner, with a prevalence of 1% of all AD cases. In FAD patients, Aβ plaque deposition has been detected in asymptomatic individuals, and this is most likely the driver of the progression of tau pathology. Symptomatic FAD patients frequently exhibit tau accumulation, and tau pathology has been suggested as an indicator of the development of cognitive impairment (Non-Patent Document 7). In humans, Aβ plaque deposition does not correlate with the degree of cognitive decline, but it has been suggested that it may be necessary for the progression of tau pathology.
[0004] Aβ is produced by the sequential cleavage of β-amyloid precursor protein (APP) by β-secretase and γ-secretase. The β-secretase enzyme (BACE1) cleaves APP at the N-terminus of the Aβ sequence, releasing secreted APP-β and membrane-bound C99 fragments. Following BACE1 cleavage, the γ-secretase complex binds to the N-terminally cleaved APP fragment (C99) and cleaves the ε site within the membrane, releasing C-terminal fragments (CTFs) and Aβ49 or Aβ48. The γ-secretase complex then processes the remaining Aβ along the C-terminus, generating successively shorter peptides, ultimately resulting in the release of Aβ peptides from the complex (typically after the production of peptides 38, 40, and 42 amino acids long). Therefore, the processing capacity of the γ-secretase complex determines the length of the Aβ peptides produced. Aβ peptides tend to aggregate into β-sheet structures and assume the form of higher-order oligomers, protofibrils, and fibrils, which are detectable in AD brains. Longer Aβ peptides (≥Aβ42) are more hydrophobic and exhibit a greater ability to aggregate and form Aβ plaques (Non-Patent Document 8); (Non-Patent Document 5). Importantly, the γ-secretase complex exhibits broad substrate specificity, and in addition to APP, nearly 100 type 1 membrane proteins have been identified as potential substrates (Non-Patent Document 9).
[0005] The γ-secretase complex consists of four protein subunits: presenilin (PSEN), presenilin enhancer 2 (PEN-2), anterior pharyngeal deficiency (APH), and nicastrin. PSEN (PSEN1 or PSEN2) and APH (APH1A or APH1B) have multiple isoforms; therefore, up to four different γ-secretase complexes may exist in a single cell (Non-Patent Document 10). PSEN1 is an aspartyl protease and the catalytic subunit of γ-secretase, PEN-2 is required for γ-secretase maturation, APH stabilizes the complex, and nicastrin is thought to play a role in substrate binding (Non-Patent Document 11), (Non-Patent Document 12), (Non-Patent Document 13); (Non-Patent Document 14); (Non-Patent Document 15); (Non-Patent Document 16).
[0006] Proteins involved in Aβ peptide production form part of a membrane-embedded protease complex called the γ-secretase complex, which is composed of four proteins: nicastrin (NCT), anterior pharyngeal defect 1 (APH1A or APH1B), presenilin enhancer 2 (PEN-2), and presenilin (PSEN-1 or PSEN-2) in a 1:1:1:1 stoichiometric ratio. Presenilin-1 and -2 are catalytic subunits of this complex (Non-Patent Document 10). Presenilin-1 and presenilin-2 are paralogs. The γ-secretase complex exhibits broad substrate specificity, with nearly 100 type 1 membrane proteins listed as potential substrates (Non-Patent Document 9). One of the substrates of the γ-secretase complex is amyloid precursor protein (APP), which is converted to Aβ peptide by the complex (Non-Patent Document 11). APP can be processed through two distinct pathways: the non-amyloidogenic pathway and the amyloidogenic pathway.
[0007] Mutations in APP (OMIM 104760), PSEN1 (OMIM 104311), and PSEN2 (OMIM 1600759) have been found to be the main cause of familial Alzheimer's disease (FAD) (Non-Patent Document 6). Currently, nearly 300 mutations in PSEN1, more than 10 mutations in PSEN2, and more than 18 mutations in APP have been associated with early-onset FAD. PSEN1 mutations are not only significantly more common than PSEN2 or APP, but are also associated with earlier clinical onset and atypical cognitive symptoms, such as motor dysfunction (Non-Patent Document 8); PSEN1 mutations have the following distinct effects: 1. Some reduce or eliminate gamma-secretase activity; 2. Others reduce the processing capacity of γ-secretase activity, thereby shifting γ-secretase activity away from APP and towards the production of longer Aβ peptide species; 3. Others decrease the stability of γ-secretase and Aβ peptides during sequential cleavage, or 4. Reduce PSEN1 maturation.
[0008] Whether presenilin mutations cause Alzheimer's disease through loss or gain of function is hotly debated (Non-Patent Document 17); (Non-Patent Document 18). The most parsimonious explanation is that PSEN1 mutations affect the activity of γ-secretase, leading to an increase in the Aβ42 / 40 ratio, which in turn increases the assembly of neurotoxic oligomers, resulting in synaptic dysfunction and neurodegeneration (Non-Patent Document 19), (Non-Patent Document 20); (Non-Patent Document 21).
[0009] Until 2021, AD patients had access only to symptomatic treatments, primarily including cholinesterase inhibitors and NMDA inhibitors (Non-Patent Document 5). On June 7, 2021, the U.S. Food and Drug Administration (FDA) granted accelerated approval to Aduhelm (aducanumab), the first disease-modifying AD treatment. However, post-approval studies are required to confirm that the drug provides the expected clinical benefit, and continued approval for Aduhelm is required. Adulhelm is a monoclonal antibody that targets extracellular Aβ plaques in the brain. (Non-Patent Document 22). [Prior art documents] [Non-patent literature]
[0010] [Non-Patent Document 1] American Psychiatric Association,2013,5th.Ed.Arlington [Non-patent document 2] Elahi & Miller,2017 Nature Reviews.Neurology,13:457-476 [Non-patent document 3] Masters et al.,2015 Nature Reviews,1:1-18 [Non-patent document 4] Congdon et al 2018,Nature Reviews Neurology,14(7),300-415 [Non-Patent Document 5] Long and Holtzman et al.,2019,Cell 170(2),312-339 [Non-patent document 6] Lanoiselee et al.,2017,PLoS Medicine,14:3 [Non-Patent Document 7] Gordon et al.,Brain.2019 Apr 1;142(4):1063-1076 [Non-patent document 8] L.Chavez-Gutierrez and M.Szaruga,2020,Seminars in Cell and Developmental Biology 105,75-85
Non-licensed literature 9
Non-licensed literature 10
Non-licensed Document 11
Non-licensed Document 12
Non-licensed Document 13
Non-licensed Document 14
Non-licensed Document 15
Non-licensed Document 16
Non-licensed Document 17
Non-licensed Document 18
Non-licensed Document 19
Non-licensed Document 20
[0011] Therefore, there remains a need for new, more effective treatments for diseases or conditions associated with abnormal (or altered) processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD). [Means for solving the problem]
[0012] The present inventors have designed antisense oligonucleotides that may be used in such treatments, which do not appear to have any of the drawbacks of existing treatments. [Brief explanation of the drawings]
[0013] [Figure 1]Analyses showing the effect of AON20 (SEQ ID NO: 118) treatment on Tg / Tg A431E mouse neurons on PSEN1 protein levels (A) and gamma secretase activity (B-D). (A-B) Western blot analysis showing full-length PSEN1 protein levels (A) or CTF APP protein levels normalized by full-length APP (B) after 8 days of treatment with the indicated concentrations of AON20. Data in A and B are shown relative to the untreated condition (0 μM). (C-D) ELISA analysis showing the profiles of soluble Aβ38, Aβ40, and Aβ42 species in the supernatant of mouse Tg / Tg A431E neurons after 8 days of treatment with the indicated concentrations of AON20. Data are shown as Aβ levels (C) and Aβ42 / 38 ratios (D). Each point in the graph corresponds to one cell culture well, and error bars indicate standard deviation (n = 2-3). *p<0.05, **p<0.01 (one-way ANOVA test). CTF = C-terminal fragment. FL = full length. [Figure 2] ELISA analysis showing the profiles of soluble Aβ38, Aβ40, and Aβ42 species in the supernatant of mouse Tg / Wt A431E neurons after 7 days of treatment with the indicated concentrations of AON21 (SEQ ID NO: 120). Data are shown as Aβ levels (A) and Aβ42 / 38 ratios (B). Each point in the graph corresponds to one cell culture well, and error bars indicate standard deviation (n=3). *p<0.05, **p<0.01 (one-way ANOVA test). [Figure 3]Wes analysis showing the efficacy and allele specificity of AONs targeting human A431E PSEN1 transfected into NIH3T3 cells overexpressing Flag-tagged human WT or A431E PSEN1. Data are shown as the ratio of Flag to NPT-II protein levels normalized to that of untreated samples. 10 nM AONs were transfected, and cells were harvested 24 hours post-transfection. (A) Protein levels of WT and A431E PSEN1 after treatment with AONs, in which the sequence and position of the nucleotide opposite the mutation was shifted from the 5' end to the 3' end. (B) Protein levels of WT and A431E PSEN1 after treatment with derivatives of AON4, AON5, and AON6 (SEQ ID NOS: 8, 10, and 12) containing a T (thymine) to U (uracil) substitution at the position opposite the mutation. (C) Backbone modifications used in the AONs listed in Table 4. (D) Protein levels of WT and A431E PSEN1 after treatment with derivatives from AON14 (SEQ ID NO: 28) that incorporate PO and / or PNms binding. NT = untreated. Each point in the graph corresponds to one cell culture well, and error bars indicate standard deviation. [Figure 4] Analysis showing the effect of mutation location within an AON and the effect of a T (thymine) to U (uracil) substitution opposite the mutation location on the potency and allelic selectivity of AONs targeting human A431E (A) or S212Y mutations (B). NIH3T3 cells were transfected with plasmids encoding WT, A431E, or S212Y human PSEN1. After 3 hours, 10 nM of the indicated AON was transfected, and cells were harvested 24 hours post-transfection. (dd) WT and mutant mRNA levels were measured using PCR. Data are presented as the ratio of WT to A431E (A) or S212Y (B) PSEN1 mRNA levels. The AONs used are listed in Table 5. Each point in the graph corresponds to one cell culture well (n = 1 or 2), and error bars indicate standard deviation. [Figure 5](dd) PCR analysis showing WT and A431E PSEN1 mRNA levels in human neurons differentiated from patient-derived iPSCs after treatment with AON14 (SEQ ID NO: 28), AON15 (SEQ ID NO: 30), and AON16 (SEQ ID NO: 33) for 10 days. WT and A431E mRNA copies were quantified by SNP assay and normalized to the mRNA copies of two housekeeping genes (TFRC and GAPDH). Data are shown relative to the untreated condition (NT). n=1 cell culture well. [Figure 6] Analyses showing the effect of AON87 (SEQ ID NO: 202) treatment of Tg / Wt A431E primary mouse neurons on WT and A431E mouse Psen1 mRNA levels (A) and γ-secretase activity (B–D). AON87 specifically targets mouse WT Psen1. (A) RT-qPCR analysis showing A431E and WT mouse Psen1 mRNA levels after 7 days of treatment with the indicated concentrations of AON87. A431E and WT Psen1 mRNA levels were normalized to the levels of two housekeeping genes (actin and Rsp23). Data are shown relative to the untreated condition (0 μM). (B–D) ELISA analysis showing the profiles of soluble Aβ38, Aβ40, and Aβ42 species in the supernatant of Tg / Wt A431E primary mouse neurons after 7 days of treatment with the indicated concentrations of AON87. Data are presented as total Aβ levels (B), relative levels of Aβ38, Aβ40, and Aβ42 compared to untreated conditions (C), and the ratio Aβ42 / 38 (D). mRNA and soluble Aβ levels were measured in the same samples. Each point in the graph corresponds to one cell culture well (n = 9), and error bars indicate standard deviation. ****p<0.0001 (A and C, two-way ANOVA with Dunnett's multiple comparison test; B and D, t-test). [Figure 7]RT-qPCR analysis showing WT and A431E Psen1 mRNA levels in Tg / Tg (A) and Tg / Wt (B) mouse primary neurons after 7 days of treatment with the indicated concentrations of AON20 (SEQ ID NO: 118) and AON88 (SEQ ID NO: 204). Data are shown relative to the untreated condition (0 μM). Each point in the graph corresponds to one cell culture well (n=9), and error bars indicate standard deviation. ***p<0.001, ****p<0.0001 (one-way ANOVA test with Dunnett's multiple comparison test). [Figure 8] ELISA analysis showing the profiles of soluble Aβ38, Aβ40, and Aβ42 species in the supernatants of Tg / Wt primary mouse neurons after 7 days of treatment with AON20 (SEQ ID NO: 118) and AON88 (SEQ ID NO: 204) at 10 μM concentrations. Data are presented as total Aβ levels (A), relative levels of Aβ38, Aβ40, and Aβ42 compared to untreated conditions (B), and the ratio Aβ42 / 38 (C). Each point in the graph corresponds to one cell culture well (n=9), and error bars indicate standard deviation. ***p<0.001, ****p<0.0001 (A and C, one-way ANOVA with Dunnett's multiple comparison test; B, two-way ANOVA with Dunnett's multiple comparison test). NT: untreated. [Figure 9] Analysis demonstrating AON20 (SEQ ID NO: 118) efficacy and allele selectivity in vivo. Psen1 wt / A431E;APPKi mice received a single intracerebroventricular injection of 150 μg AON20. Animals were sacrificed two weeks later, and hippocampal WT and A431E Psen1 mRNA levels were measured by RT-qPCR. Results were normalized to actin and GAPDH levels. Data are presented relative to vehicle condition. Each point in the graph corresponds to one animal (n=7, vehicle; n=4, AON20), and error bars indicate standard deviation. Statistical test: T-test. DETAILED DESCRIPTION OF THE INVENTION
[0014] The present invention targets the true underlying cause of FAD by using the oligonucleotides of the invention, as defined herein, to deplete mutant alleles, thereby restoring normal activity of the catalytic subunit of the γ-secretase complex. Such oligonucleotides preferentially target and destroy alleles carrying mutations in PSEN1 or PSEN2, thereby reducing levels of mutant PSEN1 or PSEN2 and allowing them to be replaced by the corresponding wild-type protein, increasing levels of functional γ-secretase, and ultimately reducing production of toxic forms of Aβ peptides. This strategy differs from attempts to inhibit or downregulate γ-secretase, which can result in severe (Notch) signaling side effects, and is likely to be more effective in treating familial AD than current approaches that focus on more downstream features of the disease, such as tau aggregation, or more general features of the disease, such as inflammation. This strategy is quite unique: the oligonucleotides are selected to exhibit the highest possible efficiency and the highest possible specificity for the mutant allele of PSEN1 or PSEN2, while they are selected to exhibit the lowest possible efficiency and the lowest possible specificity for the wild-type allele of PSEN1 or PSEN2, meaning that they are designed to specifically inactivate, delete, knockdown, or suppress the mutant allele of PSEN1 or PSEN2, while leaving the wild-type allele largely intact.
[0015] antisense oligonucleotides The present inventors have surprisingly discovered antisense oligonucleotides that exhibit attractive therapeutic activity and that can be used to treat diseases or conditions associated with abnormal (or altered) processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD).
[0016] Such antisense oligonucleotides are described in more detail below and will be referred to herein as antisense oligonucleotides of the invention (or antisense oligonucleotides of the invention or oligonucleotides of the invention or oligonucleotides or AONs).
[0017] In a first aspect, there is provided an antisense oligonucleotide that preferentially targets a mutant allele of a protein of the γ-secretase complex when present in a cell containing (preferably expressing) said mutant allele. In a preferred embodiment, the protein of the γ-secretase complex in which the allele is mutated is PSEN1 or PSEN2, preferably PSEN1. In a preferred embodiment, the antisense oligonucleotide is single-stranded.
[0018] In a second aspect, there is provided an antisense oligonucleotide comprising 5-15 contiguous DNA nucleotides flanked on each side by wing regions comprising 1-5 RNA nucleotide analogs and / or a central region of DNA nucleotide analogs of 15-30 or 20-30 nucleotides that preferentially targets a mutant allele of a protein of the y-secretase complex when present in a cell containing, and preferably expressing, a mutant allele of the protein, wherein the mutation present in the mutant allele is targeted by the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, or twelfth nucleotide of the central region of the oligonucleotide. In a preferred embodiment, the protein of the y-secretase complex in which the allele is mutated is PSEN1 or PSEN2, preferably PSEN1. In a preferred embodiment, the antisense oligonucleotide is single-stranded.
[0019] As demonstrated in the Examples section of this application, the antisense oligonucleotides of the second aspect are demonstrated to efficiently target mutant alleles of proteins of the γ-secretase complex, such as PSEN1.
[0020] In one embodiment, an antisense oligonucleotide is provided that, when present in a cell containing, or preferably expressing, a mutant allele of a protein of the y-secretase complex, preferentially targets the mutant allele. The antisense oligonucleotide comprises 15-30 or 20-30 nucleotides, including 5-15 contiguous DNA nucleotides flanked on each side by wing regions containing 1-5 RNA nucleotide analogs and / or a central region of DNA nucleotide analogs, wherein the mutation present in the mutant allele is targeted by the 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, or 18th nucleotide in the 5'-3' oligonucleotide sequence. In a preferred embodiment, the protein of the y-secretase complex in which the allele is mutated is PSEN1 or PSEN2, preferably PSEN1. In a preferred embodiment, the antisense oligonucleotide is single-stranded.
[0021] All definitions and / or embodiments described herein relate to both the first and second aspects of the invention unless otherwise indicated.
[0022] In one embodiment, the cell is a cell that endogenously expresses the protein (mutated allele and preferably wild-type allele). In a preferred embodiment, the cell is a mammalian cell, preferably a mouse or human cell. In a more preferred embodiment, the cell is representative of the disease FAD.
[0023] In a first embodiment, the cells representative of the disease FAD are neurons. Preferred neurons are cells of the central nervous system. Preferred cells of the central nervous system may be from or derived from brain regions known to be affected by FAD. Such brain regions include the hippocampus, amygdala, cerebral cortex (e.g., frontal lobe, parietal lobe, temporal lobe, and / or occipital lobe), cerebellum, and thalamus. Thus, in some embodiments, the activity of antisense oligonucleotides is evaluated in such neurons. Evaluation may also be performed in vitro by culturing such cells and contacting them with oligonucleotides.
[0024] In a second embodiment, the cells representative of the disease FAD are human iPSCs (induced pluripotent stem cells), which are induced to differentiate or mature into neurons. As noted in Example 5, the antisense oligonucleotides of the present invention can successfully target a protein of the y-secretase complex (PSEN1), whose allele is mutated in biologically relevant FAD systems, such as iPSC cells. Preferably, the iPSCs are from subjects with altered or diminished PSEN1 or PSEN2 activity, and from subjects who are FAD patients or suspected of becoming FAD patients due to their genetic background. Thus, in one embodiment, the activity of antisense oligonucleotides is evaluated using such neural cells derived from human iPSCs. Evaluation may be performed in vitro by culturing such cells and contacting them with oligonucleotides.
[0025] Alternatively, in another embodiment, the cell is a cell that exogenously expresses the protein (mutant allele or wild-type allele). In a preferred embodiment, the cell is a mammalian cell, preferably a mouse or human cell. In this embodiment, a nucleic acid encoding the mutant protein is introduced into the cell. The cell may be a non-neuronal cell, including but not limited to, a fibroblast, HeLa, or HEK293 cell. The nucleic acid encoding the mutant protein may be introduced by a viral or non-viral vector, more preferably a plasmid that expresses the mutant protein or a fusion derivative thereof.
[0026] Those skilled in the art will know which cells are suitable for evaluating the activity of oligonucleotides depending on the oligonucleotides used. As described above, in one embodiment, the cells are cells that endogenously express the protein. Alternatively, in another embodiment, a nucleic acid encoding the mutant protein is introduced into the cells. Those skilled in the art may also evaluate the activity of oligonucleotides exogenously in cells, followed by endogenous evaluation in cells that express the mutant protein.
[0027] The choice of readout is a key feature of the present invention, as the use of a given readout may lead to the identification of a suboptimal oligonucleotide when subsequently confirmed using a more relevant readout. Here, the inventors have demonstrated that it is crucial to use the effect of this oligonucleotide on the mutant PSEN1 or PSEN2 transcript and / or the lack of effect on the wild-type allele of said transcript, and / or the effect of this oligonucleotide in normalizing, restoring or correcting an abnormal Aβ42 / 38 ratio and / or Aβ43 / 40 ratio and / or Aβ43 / 37 ratio and / or Aβ42 / 40 ratio, preferably the Aβ42 / 38 ratio and / or Aβ43 / 40 ratio, more preferably the Aβ42 / 38 ratio. In particular, the inventors unexpectedly found that the antisense oligonucleotides of the present invention have the greatest impact on Aβ38 peptide levels and the Aβ42 / Aβ38 ratio, while the effects on other Aβ species (such as Aβ40) are less pronounced (Examples 2, 6, and 8). This observation confirms the need to use a holistic readout to assess the therapeutic benefit of antisense oligonucleotides.
[0028] In a preferred embodiment, an antisense oligonucleotide is provided which preferentially targets a mutant allele of a protein of the γ-secretase complex (preferably PSEN1) when present in a cell containing (preferably expressing) said mutant allele. More preferably, the cell is a neuronal cell, even more preferably a human neuronal cell. Preferably, the cell expresses an endogenous mutant allele of a protein of the γ-secretase pathway. In a preferred embodiment, - the oligonucleotide is capable of preferentially silencing, inactivating, disrupting, knocking down, decreasing or reducing the mutant PSEN1 or PSEN2 transcript (preferably the mutant PSEN1 transcript), and even more preferably - the oligonucleotide is not (or is only minimally able to) silence, inactivate, disrupt, knock down, decrease or reduce the wild-type PSEN1 or PSEN2 transcript (preferably the wild-type PSEN1 transcript).
[0029] In a more preferred embodiment, - the oligonucleotide is capable of preferentially silencing, inactivating, disrupting, knocking down, reducing or degrading the mutant PSEN1 or PSEN2 transcript (preferably the mutant PSEN1 transcript), and even more preferably the oligonucleotide is incapable of (or is only minimally capable of) silencing, inactivating, disrupting, knocking down, reducing or degrading the wild-type PSEN1 or PSEN2 transcript (preferably the mutant PSEN1 transcript), and / or - the oligonucleotide is capable of normalizing, restoring or correcting an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio, preferably an Aβ42 / 38 and / or Aβ43 / 40 ratio, more preferably an Aβ42 / 38 ratio.
[0030] In certain embodiments, the oligonucleotide is 1. Preferentially silences or inactivates or destroys mutant PSEN1 transcripts and knocks down or reduces or lowers mutant PSEN1 protein expression, and does not preferentially silence or inactivate or destroy wild-type PSEN1 transcripts and does not knock down or reduce or lower wild-type PSEN1 protein expression; and / or 2. Abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably Aβ42 / 38 and / or Aβ43 / 40 ratios, more preferably Aβ42 / 38 ratios) can be normalized, corrected, or restored.
[0031] In certain embodiments, the oligonucleotide is 1. preferentially silences or inactivates or destroys mutant PSEN1 transcripts and / or does not preferentially silence or inactivate or destroy wild-type PSEN1 transcripts, and / or 2. Abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably Aβ42 / 38 and / or Aβ43 / 40 ratios, more preferably Aβ42 / 38 ratios) can be normalized, corrected, or restored.
[0032] Each of these readouts is broadly defined below.
[0033] In the context of the present invention, the activity elicited or exhibited by the antisense oligonucleotides of the invention is to preferentially target mutant alleles of a protein of the γ-secretase complex when present in a cell containing said mutant allele, which in one embodiment is a human protein and / or PSEN1.
[0034] The targeted mutant allele, and in particular the targeted region or stretch of this mutant allele, may also be referred to as the targeted region of the oligonucleotide.
[0035] The mutant allele of a human protein of the γ-secretase complex can be an allele associated with or causing disease in the patient's cells, in the patient's tissue, and / or in the patient, as described later herein. In certain embodiments, the patient is a mammal. In a preferred embodiment, the patient is human.
[0036] Throughout this application, the terms "bind," "specifically bind," "target," "specifically target," "hybridize," or "specifically hybridize" may be used interchangeably when used in the context of an antisense oligonucleotide that is reverse complementary to a portion of an allele, particularly in the form of a transcript encoding the allele, as identified herein. It follows that the expression "oligonucleotide" is synonymous with the expression "antisense oligonucleotide" in the context of this application.
[0037] Throughout this application, the phrases "preferentially bind," "preferentially target," or "preferentially hybridize" may be used interchangeably when used in the context of the antisense oligonucleotides of the invention that are reverse complementary to a portion of a mutant allele, particularly in the form of a transcript encoding the mutant allele as specified herein. This "preferentially bind / target / hybridize" is defined later in the specification in comparison to "specifically bind / target / hybridize" with the wild-type / control / non-mutant allele.
[0038] The term "transcript" refers to the pre-mRNA or mRNA encoded by an allele. In the context of the present invention, a mutant allele is a gene that encodes a mutated transcript, which encodes a mutant protein of the γ-secretase complex.
[0039] In this regard, the wild-type genomic DNA of mouse PSEN1 comprises SEQ ID NO:145, the corresponding coding RNA comprises SEQ ID NO:146, and the mouse PSEN1 protein comprises SEQ ID NO:147.
[0040] In this regard, the A431E genomic DNA of mouse A431E PSEN1 comprises SEQ ID NO:148, the corresponding coding RNA comprises SEQ ID NO:149, and the mouse A431E PSEN1 protein comprises SEQ ID NO:150.
[0041] In this regard, the wild-type genomic DNA of human PSEN1 comprises SEQ ID NO: 151, the corresponding coding RNA comprises SEQ ID NO: 152 or 169, and the human PSEN1 protein comprises SEQ ID NO: 153 or 159.
[0042] In this regard, the A431E genomic DNA of human A431E PSEN1 comprises SEQ ID NO: 154, the corresponding coding RNA comprises SEQ ID NO: 155 or 170, and the human A431E PSEN1 protein comprises SEQ ID NO: 156 or 161.
[0043] In this regard, the wild-type genomic DNA of human PSEN2 comprises SEQ ID NO: 165, the corresponding coding RNA comprises SEQ ID NO: 171 or 172, and the human PSEN2 protein comprises SEQ ID NO: 166 or 168.
[0044] As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., an antisense compound and its target nucleic acid / target region). While not limited to a particular mechanism, the most common pairing mechanism involves hydrogen bonding (which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleoside or nucleotide bases (nucleobases). For example, the natural base adenine is a nucleobase complementary to the natural nucleobases thymine, 5-methyluracil, and uracil, which pair through the formation of hydrogen bonds. The natural base guanine is a nucleobase complementary to the natural bases cytosine and 5-methylcytosine. Hybridization can occur under a variety of conditions. Specifically, hybridization of an oligonucleotide of the present invention to a target pre-mRNA and / or mRNA can occur under a variety of conditions. Similarly, binding of an oligonucleotide of the present invention to a target pre-mRNA and / or mRNA (i.e., a target region) can occur under a variety of conditions. Preferably, said hybridization or said binding is assessed under physiological conditions in cells, more preferably in human cells. Preferred cells are defined herein above. The oligonucleotides of the present invention are said to be capable of binding to, or capable of binding to, or capable of hybridizing to, or capable of hybridizing to, when said binding or hybridization occurs under physiological conditions in cells, preferably human cells. Preferred cells are defined herein above.
[0045] In the context of the present invention, "hybridize" or "bind" (or "preferentially hybridize" or "preferentially bind" or "preferentially bind" or "preferentially hybridize") is used under physiological conditions in cells, preferably human cells, unless otherwise indicated.
[0046] In one embodiment, an antisense oligonucleotide is said to target a mutant allele encoding a mutant protein of the γ-secretase complex (preferably PSEN1) when the oligonucleotide is reverse complementary to at least 10 or at least 15 consecutive / contiguous bases of the mutant allele or of the mutated transcript encoding the mutant protein. This "at least 10 or at least 15 consecutive / contiguous bases of the mutant allele" may also be referred to as the targeted region or target region of the antisense oligonucleotide. In one embodiment, the length of the reverse complementary portion may be at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35 nucleotides. Within the context of the present invention, an oligonucleotide comprises up to 50 nucleotides and / or nucleotide analogs. The oligonucleotide may be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides and / or nucleotide analogs. The reverse-complementary portion of the oligonucleotide need not itself be 100% reverse-complementary to the mutant allele or transcript of a mutant protein of the γ-secretase complex. In one embodiment, there may be one or two mismatches over a total length of at least 15 nucleotides defining the portion reverse-complementary to the mutant allele or transcript.
[0047] The activity of the oligonucleotide of the present invention is to preferentially target mutant alleles or mutant transcripts encoding mutant proteins of the γ-secretase complex. This activity means silencing, knocking down (or destroying), inactivating, decreasing, or lowering (the level of) the targeted mutant allele (or corresponding transcript). In other words, the level of the mutant transcript is knocked down (or destroyed), decreased, or lowered. In this context, the protein of the γ-secretase complex is PSEN1. In a preferred embodiment, the protein is a human protein. More preferably, it is human PSEN1.
[0048] Therefore, a first method for evaluating the activity of an antisense oligonucleotide of the present invention is to assess whether the oligonucleotide is capable of knocking down (or disrupting) or reducing or lowering (the level of) the mutant transcript (preferably a PSEN1 or PSEN2 mutant allele or transcript). This reduction or lowering of the level of the mutant transcript can be at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to the level of the same transcript at the start of treatment. In a preferred embodiment, the mutant transcript is no longer detectable. The reduction or lowering may be assessed using Northern blotting or (semi-)quantitative RT-qPCR or RT-ddPCR analysis of mutant transcript copy number (preferably as performed in the experimental part) in cells or tissues or subjects treated with the oligonucleotide.
[0049] In a preferred embodiment, for this first method of evaluating the activity of the antisense oligonucleotide of the present invention, the level of a wild-type allele or wild-type transcript that is not targeted (or specifically targeted) by the oligonucleotide is also evaluated. Thus, the wild-type allele or transcript is still detectable, and the level of the wild-type allele or transcript is not less than 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the level of the same allele or transcript at the start of treatment. In a preferred embodiment, the level of the wild-type allele or transcript is the same as that detected at the start of treatment. The presence of the transcript may be evaluated in cells, tissues, or subjects treated with the oligonucleotide by Northern blotting or (semi-)quantitative RT-qPCR or RT-ddPCR analysis of mutant transcript copy number (preferably as performed in the experimental part).
[0050] Thus, in a preferred embodiment, the activity of the antisense oligonucleotides of the invention is assessed as follows: - whether the oligonucleotide is capable of knocking down, decreasing or reducing the level of mutant PSEN1 or PSEN2 transcript; and - Whether the oligonucleotide is unable (or only minimally able) to knock down or reduce or decrease the level of wild-type PSEN1 or PSEN2 transcript.
[0051] This decrease or reduction in the level of the mutant transcript can be at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% decrease or reduction compared to the level of the same transcript at the start of treatment, In a preferred embodiment, the mutant transcript is no longer detectable.
[0052] An oligonucleotide is said to be unable (or only minimally able) to knock down, reduce or lower a wild-type PSEN1 or PSEN2 allele or transcript when the wild-type allele or transcript is still detectable and not below 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of the level of the same allele or transcript at the start of treatment.
[0053] In a more preferred embodiment, the oligonucleotide is capable of knocking down, reducing or lowering the level of mutant PSEN1 or PSEN2 transcript by at least 20, or at least 30, or at least 40, or at least 50, or at least 80, or at least 90 or at least 95% compared to the level of the mutant allele or transcript at the start of treatment, and the level of wild-type PSEN1 or PSEN2 transcript is still at least 50, or at least 80, or at least 90 or at least 95% of the level of the transcript or allele at the start of treatment.
[0054] The presence of mutant or wild-type alleles or transcripts is assessed as previously described herein.
[0055] As explained in the background section, mutations in some PSEN1 or PSEN2 genes can shift γ-secretase complex activity toward the production of abnormal Aβ profiles, from short peptides (Aβ38, Aβ40) to longer peptides (Aβ42, Aβ43, and even longer peptides up to Aβ48 or Aβ49; however, there are no readily available means to measure these species, whereas other species are readily measurable by ELISA assays), as a result of impaired γ-secretase carboxypeptidase-like activity. The underlying mechanism is destabilization of the substrate-enzyme complex; i.e., mutations in the PSEN1 or PSEN2 gene reduce APP substrate interaction with the catalytic presenilin subunit in the γ-secretase complex. This results in the rapid release of longer (less processed) forms of Aβ, i.e., any peptide up to 49 amino acids in length. Longer Aβ peptide species (Aβ49 or longer, Aβ48 or longer, Aβ42 or longer, or Aβ43 or longer) are toxic because they are more hydrophobic and prone to aggregation, forming toxic oligomers and fibrillar species. Aβ processing is progressive, resulting in two production pathways: one that begins with Aβ49>46>43>40>37 and the other that begins with Aβ48>45>42>38 (Takami et al., 2009, J Neurosci 29, 13042-52). In other words, PSEN1 or PSEN2 mutations likely increase the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios in the brain, cerebrospinal fluid (CSF), and / or plasma of FAD patients. In one embodiment, the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) in the plasma and / or CSF and / or brain of a FAD patient is increased by at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to levels in a healthy subject.The Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) may be assessed by techniques known to those skilled in the art.
[0056] In certain embodiments, the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) may be assessed using cell extracts, cell culture media, brain extracts, CSF or plasma of FAD patients harboring PSEN1 or PSEN2 mutations.
[0057] In certain embodiments, the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) may be assessed using cell extracts, cell culture media of cells endogenously or exogenously expressing mutant PSEN1 or PSEN2.
[0058] In one embodiment, this is preferably assessed using ELISA, as performed in the experimental part.
[0059] In the in vivo situation (in transgenic mice), these ratios in CSF, plasma, and / or brain extracts appear to initially increase and then decrease as a result of aggregation of Aβ peptides forming Aβ plaques.
[0060] In the in vivo situation (in FAD patients), these ratios in the CSF and / or plasma appear to initially increase and then decrease as a result of Aβ peptides aggregating to form Aβ plaques.
[0061] This increase is typically observed in FAD patients without detectable Aβ plaques in the brain. FAD patients without detectable Aβ plaques in the brain can be referred to as asymptomatic FAD patients. During the progression of the disease, Aβ plaques form, resulting in a decrease in the ratio in CSF samples. In plasma, these ratios increase throughout the progression of the disease. Therefore, if a patient already has detectable Aβ plaques in their brain, the assay must be performed in their plasma. The ELISA assay only evaluates soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably Aβ42 / 38 ratios), and cannot identify the effect of the aggregation process on the levels of these ratios. The ELISA assay primarily visualizes the initial effect of mutations in γ-secretase complex activity, namely the generation of long-chain Aβ peptide species.
[0062] In one embodiment, asymptomatic FAD subjects or patients are selected or identified taking into account their family history, which includes several FAD patients with PSEN1 or PSEN2 mutations. Diagnosing such subjects while they are still asymptomatic (and therefore as early as possible) is crucial for initiating treatment as soon as possible. Those skilled in the art may use other in vitro assays that can assess the presence of aggregated Aβ peptides in brain extracts from mice.
[0063] Therefore, a second method for evaluating the activity of the oligonucleotides of the present invention is to determine the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably the Aβ42 / 38 ratio) in cell culture medium, tissue, plasma, and / or CSF of treated FAD subjects. In one embodiment, the FAD patient is asymptomatic and has no detectable Aβ plaques in the brain. The oligonucleotides reduce the production of long-chain Aβ species, which is likely to lead to a decrease in soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably the Aβ42 / 38 ratio). When evaluation is performed in a subject, it is preferably performed in the plasma and / or CSF of the subject.
[0064] Normalization, correction, or restoration of an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) may mean a reduction of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% in the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) compared to its level at the start of treatment. The Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio) can be assessed by techniques known to those skilled in the art. In one embodiment, this is preferably assessed using ELISA, as performed in the experimental part.
[0065] When assessment is performed in FAD patients with detectable Aβ plaques in the brain, it is preferably performed in the plasma of said patients and not in the CSF.
[0066] The present invention uniquely utilizes a readout that directly demonstrates the therapeutic effect of oligonucleotides on diseases or conditions associated with abnormal (or altered) APP processing. This readout directly demonstrates the downstream effects of defective γ-secretase complexes present in the cells, tissues, plasma, and / or CSF of FAD patients by assessing the Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratios, more preferably the Aβ42 / 38 ratio). In one embodiment, FAD patients, as defined herein above, are preferably asymptomatic and lack detectable Aβ plaques in the brain. The effect of oligonucleotides on this readout is likely representative of the therapeutic effect for patients with a mutant γ-secretase complex (preferably PSEN1) that will develop FAD. The readout used (i.e., Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio)) is expected to be representative of FAD disease, and therefore normalization, correction, or reversal of the abnormal increase in soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio) is predictive of therapeutic activity of the oligonucleotide. This readout (either soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio), also known as the "long / short" Aβ ratio) is more representative and predictive than a readout limited to a single "long" Aβ peptide (such as soluble Aβ42). The goal of this therapy is to restore the normal enzymatic activity of the γ-secretase complex or to switch the activity of said complex to a more normal activity.Therefore, those skilled in the art will appreciate that the long / short Aβ peptide ratio provides a better representation of the enzymatic activity of the γ-secretase complex than using only one long form of Aβ. In other words, to better understand, visualize, or monitor the activity state of the γ-secretase complex (preferably PSEN1), it is preferable to evaluate the production of Aβ peptide species, not just the production of its long form.
[0067] In certain embodiments, therefore, an antisense oligonucleotide of the invention may be considered active when:
[0068] When the oligonucleotide is capable of normalizing, correcting, or restoring an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio), the evaluation is compared with the level of the same Aβ ratio at the start of treatment (or with the corresponding level of the same Aβ ratio in a healthy subject). The evaluation may be performed in cells, tissues, plasma, or CSF or a subject. When a subject is treated, the ratio is preferably evaluated in the subject's plasma. The subject may be an asymptomatic FAD subject. Alternatively, the subject may be a symptomatic FAD subject. If the subject is a symptomatic FAD subject, the evaluation is preferably performed using plasma. Another method for evaluating the effect of oligonucleotide on Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio) is to use imaging technology to evaluate the accumulation of Aβ plaque in the brain of treated subject.Imaging technology can include PET scan of FAD patients.Imaging technology can also include histology of mouse tissue.
[0069] In preferred embodiments, an antisense oligonucleotide of the invention may be considered active when: - the oligonucleotide is capable of preferentially silencing, inactivating, destroying, knocking down, decreasing, lowering or modifying (the amount or level of) the mutant PSEN1 (or PSEN2) transcript; - when the oligonucleotide is unable (or only minimally able) to silence, inactivate, disrupt, knock down, or reduce, decrease or modify (the amount or level of) the wild-type PSEN1 (or PSEN2) transcript, and When the oligonucleotide is capable of normalizing, correcting, or restoring an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio), preferably the evaluation is compared with the level of the same mutant transcript or the same Aβ ratio at the start of treatment (or with the corresponding level in a healthy subject with the same Aβ ratio). The evaluation may be performed in cells, tissues, plasma, or CSF or a subject. When a subject is treated, the ratio is preferably evaluated in the subject's plasma. The subject may be an asymptomatic FAD subject. Alternatively, the subject may be a symptomatic FAD subject. If the subject is a symptomatic FAD subject, the evaluation is preferably performed using plasma. Another method for evaluating the effect of oligonucleotide on Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio) is to use imaging technology to evaluate the accumulation of Aβ plaque in the brain of treated subject.Imaging technology can include PET scan of FAD patients.Imaging technology can also include histology of mouse tissue.
[0070] In another preferred embodiment, an antisense oligonucleotide of the invention is considered to be active when: - the oligonucleotide is capable of preferentially silencing, inactivating, destroying, knocking down, or decreasing, lowering or modifying (the amount or level of) a mutant PSEN1 (or PSEN2) protein, - the oligonucleotide is unable (or only minimally able) to silence, inactivate, destroy, knock down, or reduce, decrease or modify (the amount or level of) wild-type PSEN1 (or PSEN2) protein, and - when the oligonucleotide is capable of normalizing, correcting, or restoring an abnormal increase in soluble Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably Aβ42 / 38 ratio) (preferably, wherein the evaluation is compared with the level of the same mutant protein or the same Aβ ratio at the start of treatment (or with the corresponding level of the same Aβ ratio in a healthy subject)). The evaluation may be performed in cells, tissues, plasma, or CSF or a subject. The subject may be an asymptomatic FAD subject. Alternatively, the subject may be a symptomatic FAD subject. If the subject is a symptomatic FAD subject, the evaluation is preferably performed using plasma.
[0071] Silencing or inactivation or disruption or reduction or decrease or knockdown of the mutant transcript is likely to induce a similar decrease or decrease in the level of the mutant protein (preferably PSEN1).
[0072] In a more preferred embodiment, an antisense oligonucleotide of the invention may be considered active when: - the oligonucleotide is capable of preferentially silencing, inactivating, disrupting, knocking down, or decreasing, lowering or modifying (the amount or level of) the mutant PSEN1 (or PSEN2) transcript, - the oligonucleotide is unable (or only minimally able) to silence, inactivate, destroy, knock down, or reduce, decrease or modify (the amount or level of) the wild-type PSEN1 (or PSEN2) transcript, - when the oligonucleotide is capable of normalizing, correcting or restoring an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio (preferably the Aβ42 / 38 and / or Aβ42 / 40 ratio, more preferably the Aβ42 / 38 ratio), and - the oligonucleotide is capable of reducing the formation of Aβ plaques (preferably when compared to the level of the same (mutant) transcript or the same Aβ ratio or amount of Aβ plaques at the start of treatment (or to the corresponding level in a healthy subject of the same transcript or Aβ ratio)).
[0073] Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio can be evaluated using ELISA, as preferably carried out in the experimental part.Aβ plaque formation can be evaluated using imaging techniques in the brain of treated subjects.Imaging techniques can include PET scans of FAD patients.Imaging techniques can also include histology of mouse tissue.
[0074] The evaluation can be carried out in cells, tissues, plasma, or CSF or in a subject.When the subject is treated, the ratio is preferably evaluated in the plasma of the subject.The subject can be an asymptomatic FAD subject.Alternatively, the subject can be a symptomatic FAD subject.When the subject is a symptomatic FAD subject, the evaluation is preferably carried out using plasma.
[0075] In one embodiment, the antisense oligonucleotide of the invention, when present in a cell expressing a mutant allele of the protein PSEN1 or PSEN2, preferentially targets the mutant allele (and does not or only minimally targets the WT allele). Preferred cells are defined herein above. In a preferred embodiment, the antisense oligonucleotide of the invention, when present in a cell expressing a mutant allele of the protein PSEN1 of the γ-secretase complex (preferably the human protein PSEN1), preferentially targets the mutant allele (and does not or only minimally targets the WT allele). Preferred cells are defined herein above.
[0076] Preferably, an antisense oligonucleotide of the present invention is said to be active when: -when it is possible to silence, inactivate, knock down, reduce, destroy, correct or decrease (the amount or level of) said mutant allele or transcript, and - The level of the corresponding wild-type allele or transcript does not fall below 50%, 60%, 70%, 80%, 90%, 95%, or 100% of the level of the same allele or transcript at the start of treatment.
[0077] The allele or transcript is preferably from the PSEN1 or PSEN2 gene, more preferably from the PSEN1 gene. In principle, the present invention is not limited to specific mutations found in PSEN1 or PSEN2. There are already hundreds of known mutations in PSEN1 that are associated with FAD. Examples of PSEN1 mutations that may cause FAD and can potentially be targeted by the oligonucleotides of the present invention include: R35Q; E69D; A79V; V82L; I83T; M84V; L85P; P88L; V89L; V89L; C92S; V94M; V96F; V97L; T99A; F105C; F105I; F105L; F105V; R108Q; L113P; L113Q; Y115C; Y115D; Y115H; T116I; T116N; T116R; P117A; P117L;P117R;P117S;E120D;E120D;E120G;E120K;E123K;H131R;S132A;L134R;N135D;N135S;N135Y;A136G;M139I;M139I;M139K;M 139L;M139T;M139V;V142F;I143F;I143M;I143N;I143T;I143V;M146I;M146I;M146I;M146L;M146L;M146V;T147I;T147P;L150P;LI 53 V;Y154C;Y154N;Y156F;R157insIY;R157S;H163P;H163R;H163Y;A164V;W165C;W165C;W165G;L166H;L166P;L166R;L166V;S1 69L;S169P;S170F;S170P;L171P;L173F;L173F;L173W;L174del;L174M;L174R;F175S;F176L;F177L;F177S;S178P;G183V;E1 84D;E184G;V191A;I202F;G206A;G206D;G206S;G206V;G209A;G209E;G209R;G209V;S212Y;I213F;I213L;I213T;H214D;H214 N;H214Y;G217D;G217R;L219F;L219P;L219R;R220P;Q222H;Q222P;Q222R;Q223R;L226F;L226R;I229F;S230I;S230N;S230R;A231P;A231T;A231V;L232P;M233I;M233I;M233L;M233L;M233T;M233V;L235P;L235R;L235V;F237I;F237L ;1238M;K239N;T245P;A246E;A246P;L248P;L248R;L250F;L250S;L250V;Y256S;D257A, A260V;V261F;V261L ;L262F;L262V;C263F;C263R;P264L;G266S;P267A;P267L;P267S;R269G;R269H;L271V;V272A;E273A;E273G ;T274R;A275V;R278I;R278K;R278S;R278T;E280A;E280G;E280K;L282F;L282R;L282V;F283L;P284L;P284S ;A285V;L286P;L286V;T291A;T291P;K311R;E318G;D333G;R352C;R352_S353insR;T354I;R358Q;S365A;S36 5Y;R377M;R377W;G378E;G378V;G378fs;L381F;L381V;G384A;F386I;F386S;F388L;S390I;S390N;V391F;V3 91G;L392P;L392V;G394V;A396T;N405S;I408T;A409T;C410Y;V412I;I416T;G417S;L418F;L420R;L424F;L424H;L424R;L424V;A426P;A431E;A431V;A434C;A434T;L435F;P436Q;P436S;I437V;I439S;I439V;or M457V. ;
[0078] Examples of mutations in PSEN2 that cause FAD and that may be targeted by the oligonucleotides of the invention are: T18M; R29H; G34S; R62C; R62H; P69A; R71W; K82R; A85V; V101M; K115Efs; T122P; T122R; P123L; E126fs; E126K; S130L; V139M; N141I; N141Y; L 143H;V148I;K161R;R163H;H169N;M174V;S175C;G212V;V214L;Q228L;Y231C;1235F;A237V;L238F;L238P;M239I;M239V;A252T;A258T;T301M;K306fs;P334A;P334R;P348L;A377V;V393M;T430M;or D439A.
[0079] In one embodiment, the PSEN1 mutation is selected from the group consisting of the most frequent PSEN1 mutations: P117L, M139T, M139V, M146I, H163R, G206A, P264L, E280A, L392V, and A431E, more preferably selected from the group consisting of E280A and A431E. The most preferred mutation in PSEN1 is A431E. In one embodiment, the PSEN1 mutation is selected from the group consisting of the most frequent PSEN1 mutations: P117L, M139T, M139V, M146I, H163R, G206A, P264L, E280A, L392V, A431E, and S212Y, more preferably selected from the group consisting of E280A and A431E. The most preferred mutation in PSEN1 is A431E.
[0080] In certain embodiments, the PSEN1 mutations are any of the following mutations in the PSEN1 protein: R35Q, V94M, F105I, R108Q, L113Q, T116N, P117T, P117Q, E120K, E123K, M139K, M139I, V142I, M146I, V151M, Y154N, L166H, L174M, I180N, G206S, G206D, G209R, G209E, S212Y, H214N, G217D, S230N, A231T, M233I, F237I, The mutations are selected from the group consisting of mutations caused by a change from guanine, thymine, or cytosine to adenosine in the coding sequence resulting in one of the following: A246E, Y256N, V261I, G266S, R269H, V272D, T274K, R278K, E280K, R358Q, A360T, S365Y, G378E, F386I, F386L, S390N, A396T, A409T, C410Y, G417S, L424H, A431E, A434T, P436Q. The most preferred mutation in PSEN1 is A431E. For all of these mutations, oligonucleotides may be designed as follows: when the base of the nucleotide present in the oligonucleotide and targeting the mutation is thymine, the thymine is replaced with uracil. Examples of oligonucleotides targeting the A431E mutant allele of PSEN1 are provided. Such examples are disclosed in SEQ ID NOs: 26, 28, 30, 33, 35, 37, and 39. Examples of oligonucleotides targeting the S212Y mutant allele of PSEN1 are also provided. Such examples are disclosed in SEQ ID NOs: 188, 190, 192, 194, 198, and 200.
[0081] In preferred oligonucleotides targeting this mutation with thymine, the thymine is replaced with uracil at the first, second, or third central position. In preferred oligonucleotides targeting this mutation with thymine, the thymine is replaced with uracil at the sixth, seventh, or eighth nucleotide in the 5' to 3' oligonucleotide sequence. In other preferred oligonucleotides targeting this mutation with thymine, the thymine is replaced with uracil at the first, second, third, or seventh central position. In preferred oligonucleotides targeting this mutation with thymine, the thymine is replaced with uracil at the sixth, seventh, eighth, or twelfth nucleotide in the 5' to 3' oligonucleotide sequence. This replacement increases mutant allele selectivity, likely due to a slight decrease in melting temperature (Tm) (see Examples 3-4). Indeed, Examples 3 and 4 point out that antisense oligonucleotides with thymine-uracil substitutions at the preferred nucleotide positions described above exhibit increased selectivity for mutant alleles of PSEN1. Examples of oligonucleotides targeting the A431E or S212Y mutant alleles of PSEN1 are provided. Preferred examples are found in SEQ ID NOs: 28, 30, 33, 37, 39, 47, 97, 99, 115, 192, 194, and 198.
[0082] As used herein, the term "core" or "core region" of an antisense oligonucleotide refers to a specific section or interval within the oligonucleotide sequence. The exact definition and boundaries of the core may vary depending on the context of the present invention. In the context of the first aspect of the present invention, the core may be determined based on the nucleotide position relative to the ends of the oligonucleotide. In the context of the second aspect of the present invention, the core refers to a discrete region of a gapmer that exists between two adjacent regions / wings. With respect to both aspects, those skilled in the art will understand that the core is designed to specifically target mutant alleles of proteins of the γ-secretase complex.
[0083] As known to those skilled in the art, oligonucleotides are polymers of nucleotides and / or nucleotide analogs. The expression "nucleotide analog" may be substituted with "derived from nucleotides." Oligonucleotides comprise or consist of repeating monomers. Within the context of the present invention, oligonucleotides comprise up to 50 nucleotides and / or nucleotide analogs. The oligonucleotides may have 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. Such oligonucleotides may also be specified as oligonucleotides having 10 to 50 nucleotides or 12 to 50 nucleotides. Compelling results have been obtained with oligonucleotides having lengths ranging from 15 to 30 nucleotides, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.
[0084] In one embodiment, the antisense oligonucleotides of the present invention comprise nucleotides and / or nucleotide analogs. In another embodiment, the antisense oligonucleotides of the present invention comprise 15-30 nucleotides (and / or DNA nucleotide analogs) that include a central region of DNA nucleotides flanked on each side by wing regions comprising RNA nucleotide analogs. In a preferred embodiment, an antisense oligonucleotide comprising 15-30 nucleotides that include a central region of DNA nucleotides flanked on each side by wing regions comprising RNA nucleotide analogs is related to the antisense oligonucleotides of the second aspect of the present invention. DNA nucleotide analogs may be present in the central region of DNA nucleotides as long as they do not significantly reduce, prevent, or completely eliminate the recruitment of RNase H to the native AON-target RNA duplex and / or do not significantly reduce its on-target activity. In this context, "its activity is not significantly reduced" means that the activity of an oligonucleotide having one or more DNA analog nucleotides in its central region is better, similar, or not less than 50%, 60%, 70%, 80%, or 90% of that of an oligonucleotide having only DNA nucleotides in its central region. Thus, antisense oligonucleotides as defined herein recruit RNase H to silence, inactivate, knock down, destroy, reduce or decrease (the level or expression of) the targeted mutant allele.
[0085] In another embodiment, the antisense oligonucleotide of the present invention comprises 15 to 30 nucleotides comprising a central region of contiguous DNA nucleotides (and / or DNA nucleotide analogues) flanked on each end by wing regions comprising contiguous RNA nucleotide analogues. In another embodiment, the antisense oligonucleotide of the present invention comprises 15 to 30 nucleotides comprising a central region of contiguous DNA nucleotides (and / or DNA nucleotide analogues) flanked on each end by wing regions comprising contiguous RNA nucleotide analogues. In a preferred embodiment, the antisense oligonucleotide of the present invention comprises 15 to 30 nucleotides comprising a central region of 5 to 15 contiguous DNA nucleotides (and / or DNA nucleotide analogues) flanked on each end by wing regions comprising 1 to 5 RNA nucleotide analogues. In a preferred embodiment, the antisense oligonucleotide of the present invention comprises 15 to 30 nucleotides comprising a central region of 5 to 15 contiguous DNA nucleotide analogues flanked on each end by wing regions comprising 1 to 5 RNA nucleotide analogues. In a preferred embodiment, the antisense oligonucleotide of the second aspect of the present invention relates to an antisense oligonucleotide comprising 15 to 30 nucleotides that includes a central region of (contiguous) DNA nucleotides (and / or DNA nucleotide analogues) flanked on each side by wing regions comprising (contiguous) RNA nucleotide analogues. In another preferred embodiment, the antisense oligonucleotide of the second aspect of the present invention relates to an antisense oligonucleotide of 15 to 30 nucleotides that includes a central region of 5 to 15 (contiguous) DNA nucleotides (and / or DNA nucleotide analogues) flanked on each side by wing regions comprising 1 to 5 RNA nucleotide analogues.
[0086] In one embodiment, the central region comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 DNA nucleotides and / or DNA nucleotide analogs. Preferably, the length of the central region is 9, 10, or 11 DNA nucleotides and / or DNA nucleotide analogs. In another embodiment, one of the wing regions comprises 1, 2, 3, 4, or 5 RNA nucleotide analogs. Preferably, the length of one of the wing regions is 2 or 4 RNA nucleotide analogs. In another embodiment, each wing region comprises 1, 2, 3, 4, or 5 RNA nucleotide analogs. Preferably, the length of each wing region is 2 or 5 RNA nucleotide analogs. The present invention also encompasses cases where the lengths and / or chemical species used for the RNA nucleotide analogs in each wing region are not identical.
[0087] In one embodiment, the central region comprises 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 consecutive DNA nucleotides and / or DNA nucleotide analogs. Preferably, the length of the central region is 9, 10, or 11 consecutive DNA nucleotides and / or DNA nucleotide analogs. In another embodiment, one of the wing regions comprises 1, 2, 3, 4, or 5 consecutive RNA nucleotide analogs. Preferably, the length of one of the wing regions is 2 or 5 consecutive RNA nucleotide analogs. In one embodiment, each wing region comprises 1, 2, 3, 4, or 5 consecutive RNA nucleotide analogs. Preferably, the length of each wing region is 2 or 5 consecutive RNA nucleotide analogs. The present invention also encompasses cases where the lengths and / or chemical species used for the RNA nucleotide analogs in each wing region are not identical.
[0088] In one embodiment, the central region is 10 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 5 consecutive RNA nucleotide analogues. In another embodiment, the central region is 10 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 4 consecutive RNA nucleotide analogues. In another embodiment, the central region is 10 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 3 consecutive RNA nucleotide analogues. In another embodiment, the central region is 10 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 2 consecutive RNA nucleotide analogues. In another embodiment, the central region is 10 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 1 consecutive RNA nucleotide analogue.
[0089] In one embodiment, the central region is 11 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 5 consecutive RNA nucleotide analogues. In another embodiment, the central region is 11 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 4 consecutive RNA nucleotide analogues. In another embodiment, the central region is 11 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 3 consecutive RNA nucleotide analogues. In another embodiment, the central region is 11 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 2 consecutive RNA nucleotide analogues. In another embodiment, the central region is 11 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 1 consecutive RNA nucleotide analogue.
[0090] In one embodiment, the central region is 9 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 5 consecutive RNA nucleotide analogues. In another embodiment, the central region is 9 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 4 consecutive RNA nucleotide analogues. In another embodiment, the central region is 9 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 3 consecutive RNA nucleotide analogues. In another embodiment, the central region is 9 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 2 consecutive RNA nucleotide analogues. In another embodiment, the central region is 9 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 1 consecutive RNA nucleotide analogue.
[0091] In one embodiment, the central region is 12 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 5 consecutive RNA nucleotide analogues. In another embodiment, the central region is 12 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 4 consecutive RNA nucleotide analogues. In another embodiment, the central region is 12 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 3 consecutive RNA nucleotide analogues. In another embodiment, the central region is 12 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 2 consecutive RNA nucleotide analogues. In another embodiment, the central region is 12 consecutive DNA nucleotides and / or DNA nucleotide analogues, and each wing region is 1 consecutive RNA nucleotide analogue.
[0092] In a preferred embodiment, a mutation in a PSEN1 or PSEN2 allele or transcript is targeted by nucleotides in the oligonucleotide that are present in the center of the oligonucleotide; the center is 5 to 15 nucleotides, and each wing is 1 to 5 nucleotides. In a preferred embodiment, an antisense oligonucleotide comprising nucleotides in the center of the oligonucleotide that target a mutation in a PSEN1 or PSEN2 allele or transcript relates to the antisense oligonucleotide of the second aspect of the present invention. Surprisingly, it has been found that the efficacy and selectivity of an oligonucleotide for a mutant PSEN1 or PSEN2 allele or transcript are optimal when the nucleotide in the oligonucleotide targeting the mutant PSEN1 or PSEN2 nucleotide is located in the center of the oligonucleotide. Specifically, as shown in Examples 3 and 4, antisense oligonucleotides show increased selectivity for mutant PSEN1 alleles when the nucleotide targeting the mutant PSEN1 nucleotide is located within the first five nucleotides from the 5' to the 3' end of the center of the oligonucleotide (i.e., the nucleotide located at the 6th, 7th, 8th, 9th, or 10th position in the 5' to the 3' end of the oligonucleotide sequence).
[0093] In one embodiment, the nucleotide is the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, or twelfth nucleotide in the central portion of the oligonucleotide, beginning from the 5' end and extending to the 3' end. In this embodiment, the nucleotide is the sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, or eighteenth nucleotide in the central portion of the oligonucleotide, beginning from the 5' end and extending to the 3' end. In a preferred embodiment, the nucleotide is the first, second, third, fourth, or fifth nucleotide in the central portion of the oligonucleotide, beginning from the 5' end and extending to the 3' end. Thus, in this preferred embodiment, the nucleotide is the sixth, seventh, eighth, ninth, or tenth nucleotide in the central portion of the oligonucleotide, beginning from the 5' end and extending to the 3' end. In one embodiment, the nucleotide is the first, second, third, or fifth nucleotide in the central portion of the oligonucleotide, beginning from the 5' end and extending to the 3' end. In the preferred embodiment, the nucleotide is the sixth, seventh, eighth, or tenth nucleotide in the 5' to 3' portion of the oligonucleotide sequence. In one embodiment, when the base of the nucleotide present in the oligonucleotide targeting the mutation is thymine, the thymine is replaced with uracil. Examples of oligonucleotides targeting the A431E mutant allele of PSEN1 are provided. Such examples are disclosed in SEQ ID NOs: 26, 28, 30, 33, 35, 37, and 39.
[0094] Examples of oligonucleotides targeting the S212Y mutant allele of PSEN1 are also provided, such as those disclosed in SEQ ID NOs: 188, 190, 192, 194, 198, and 200.
[0095] In preferred oligonucleotides targeting this mutation with thymine, the thymine is replaced with uracil, with the uracil being located at the first, second, or third position in the center. Thus, preferred oligonucleotides targeting this mutation have thymine replaced with uracil at the sixth, seventh, or eighth position in the 5'- to 3'-oligonucleotide sequence. Other preferred oligonucleotides targeting this mutation with thymine have thymine replaced with uracil, with the uracil being located at the first, second, third, or seventh position in the center of the oligonucleotide. These preferred oligonucleotides have thymine replaced with uracil at the sixth, seventh, eighth, or twelfth position in the 5'- to 3'-oligonucleotide sequence. This replacement increases mutant allele selectivity, likely due to a slight decrease in Tm. Preferred examples are found in SEQ ID NOs: 28, 30, 33, 37, 39, 47, 97, 99, 115, 192, 194, and 198.
[0096] Thus, in a preferred embodiment, the oligonucleotide is: - it comprises a central portion of 5 to 15 nucleotides and two wings of 1 to 5 nucleotides each, and - the mutation or transcript present in the mutant allele of PSEN1 or PSEN2 is targeted by the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 9th, 10th, 11th or 12th nucleotide in the center of the oligonucleotide.
[0097] In a preferred embodiment, the oligonucleotide is as follows: - which comprises a central portion of 5 to 15 nucleotides and two wings of 1 to 5 nucleotides each, and - The mutation or transcript present in the mutant allele of PSEN1 or PSEN2 is targeted by the 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, or 18th nucleotide in the oligonucleotide sequence starting from the 5' to the 3'.
[0098] Thus, in a preferred embodiment, the antisense oligonucleotide relates to the antisense oligonucleotide of the second aspect of the invention.
[0099] In another preferred embodiment, the base of the nucleotide of the oligonucleotide targeting a mutation present in a PSEN1 or PSEN2 allele or transcript is an RNA base. In a more preferred embodiment, the RNA base is uracil. More preferably, the target mutation is a C to A mutation, although the target mutation can also be a G or T to A mutation.
[0100] In some embodiments, the antisense oligonucleotides of the present invention comprise nucleotides and nucleotide analogs. Nucleotides may be RNA or DNA nucleotides. The most common naturally occurring nucleotides in RNA are adenosine monophosphate, cytidine monophosphate, guanosine monophosphate, thymidine monophosphate, and uridine monophosphate. These consist of a pentose sugar ribose with a phosphate group linked to the 5' position and a base linked to the 1' position, linked via a phosphate ester. DNA is similar, except that deoxyribose is present instead of ribose. The sugar connects the base and the phosphate bond and is therefore often referred to as the scaffold of the nucleotide. Therefore, modifications to the pentose sugar are often referred to as scaffold modifications. Thus, sugar modifications can be referred to as scaffold modifications. In some modifications, the original pentose sugar may be replaced in its entirety with another moiety that also connects the base and the phosphate. Therefore, while a pentose sugar is often a scaffold, it is understood that a scaffold is not necessarily a pentose sugar.
[0101] Bases, sometimes referred to as nucleobases, are generally adenine, cytosine, guanine, thymine, or uracil, or derivatives thereof. Cytosine, thymine, and uracil are pyrimidine bases, generally linked to the scaffold via their 1-nitrogen. Adenine and guanine are purine bases, generally linked to the scaffold via their 9-nitrogen. The bases present in an oligonucleotide are usually complementary to the target region. If such bases are modified or base analogs are used, the modified bases or base analogs must maintain the same base-pairing specificity as the bases they replace. "Base pairing" refers to the bonding of two bases (or nucleobases) to each other through hydrogen bonds. Specifically, nucleobase analogs replacing cytosine have the ability to base pair with guanine, nucleobase analogs replacing guanine have the ability to base pair with cytosine, nucleobase analogs replacing adenine have the ability to base pair with uracil, and nucleobases replacing uracil have the ability to base pair with adenine.
[0102] Nucleotides are generally linked to adjacent nucleotides through condensation of their 5'-phosphate moiety to the 3'-hydroxyl moiety of the adjacent nucleotide monomer. Similarly, their 3'-hydroxyl moiety is generally linked to the 5'-phosphate moiety of the adjacent nucleotide monomer. This forms a phosphodiester bond. The phosphodiester and scaffold form an alternating copolymer. Bases are grafted onto this copolymer, i.e., onto the scaffold moiety. Because of this feature, the alternating copolymer formed by the linked monomers of an oligonucleotide is often referred to as the backbone of the oligonucleotide. Because the phosphodiester bond connects adjacent monomers together, it is often referred to as the backbone linkage. When the phosphate group is instead modified to a similar moiety, such as phosphorothioate (PS), it is understood that such a moiety is still referred to as the backbone linkage of the monomer. This is referred to as a backbone linkage modification. Generally speaking, the backbone of an oligonucleotide is thus composed of alternating scaffolds and backbone linkages. In some embodiments, the backbone of the oligonucleotide (core and wings) is completely modified, preferably a PS backbone.
[0103] In one embodiment, the antisense oligonucleotide comprises a core comprising DNA nucleotides (or DNA nucleotide analogs) and a modified RNA portion in each wing. In a preferred embodiment, an antisense oligonucleotide comprising a core comprising DNA nucleotides (or DNA nucleotide analogs) and a modified RNA portion in each wing is related to the antisense oligonucleotide of the second aspect of the present invention. The RNA or DNA nucleotide may be modified and therefore may be considered an RNA or DNA nucleotide analog when it comprises a modified base and / or a modified sugar. In addition, the internucleoside bond connecting two adjacent nucleosides may be modified compared to the phosphodiester bond connecting the two nucleosides. The term "modified internucleoside bond" may be substituted for the phrase "backbone bond modification," as explained earlier in this specification.
[0104] In one embodiment, the antisense oligonucleotides of the invention comprise a DNA core (or region) flanked on each end (wing) by modified RNA portions (regions). In another embodiment, the antisense oligonucleotides of the invention comprise a modified DNA core (or region) flanked on each end (wing) by modified RNA portions (regions). In a preferred embodiment, the antisense oligonucleotides of the invention comprising a modified DNA core flanked on each end by modified RNA portions relate to the antisense oligonucleotides of the second aspect of the invention.
[0105] In one embodiment, the oligonucleotide of the present invention, which consists of a 5' wing, a 3' wing, and a central portion (gap), is single-stranded. Such a structure (5' wing, 3' wing, and central portion (gap)) may also be referred to as a gapmer. In a preferred embodiment, a single-stranded antisense oligonucleotide consisting of a 5' wing, a 3' wing, and a central portion relates to the antisense oligonucleotide of the second aspect of the present invention. This structure is attractive because it allows the oligonucleotide to bind to the target mRNA and recruit RNase H. The recruited RNase H exerts at least one of the following effects on the targeted mutant allele: silencing, inactivating, knocking down, destroying, reducing or decreasing its level. In contrast, double-stranded siRNA cannot recruit RNase H and instead relies on Argonaute proteins to silence the target mRNA. Double-stranded siRNA is loaded into the RNA-induced silencing complex (RISC). Upon RISC loading, the thermodynamically less stable 5' end of the siRNA is incorporated, guiding the RISC to the complementary target mRNA. After Argonaute-dependent cleavage, the mRNA target dissociates from the intact siRNA, freeing the RISC to regenerate and cleave additional mRNA targets.
[0106] The presence of wings confers stability and exonuclease-resistant properties to antisense oligonucleotides. Chemical modifications in the gap and / or wings, including base, scaffold, and / or linkage modifications, can improve the safety, biodistribution, stability, cellular uptake, intracellular transport, target binding affinity, duplex stability, and efficacy of the oligonucleotides of the invention compared to oligonucleotides composed of unmodified DNA and / or unmodified RNA analogs. This effect can be attributed, at least, to the presence of modified RNA wings and / or modified DNA core. Fine-tuning the DNA and / or RNA base, scaffold, and / or linkage modifications at specific positions in the oligonucleotide (precision chemistry) can result in oligonucleotides with properties that are most advantageous for clinical applications.
[0107] In some embodiments, the core / region (gap) of the antisense oligonucleotide contains DNA nucleotides or DNA nucleotide analogs. In preferred embodiments, the bases and sugars of this portion of the antisense oligonucleotide are unmodified. However, in more preferred embodiments, the internucleoside linkages (or the entire backbone) of this core are modified. In some embodiments, the modified internucleoside linkages are phosphorothioate or phosphoramidate internucleoside linkages. The nucleotides of the core / region of the antisense oligonucleotide may have at least one internucleoside linkage modification and / or at least one base modification compared to antisense oligonucleotides with a completely unmodified DNA core.
[0108] In some embodiments, the wings of an antisense oligonucleotide comprise modified RNA nucleotides and / or modified internucleoside linkages. In some embodiments, both wings of an antisense oligonucleotide comprise modified RNA nucleotides and / or modified internucleoside linkages. The wings of the antisense oligonucleotide may have at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to unmodified RNA-based antisense oligonucleotides. In some embodiments, the modified internucleoside linkage is a phosphorothioate or phosphoramidate internucleoside linkage.
[0109] Modifications of bases in the core and / or wings of an oligonucleotide include modified versions of natural purine and pyrimidine bases (e.g., adenine, uracil, guanine, cytosine, and thymine), such as hypoxanthine (e.g., inosine), orotic acid, agmatidine, lysidine, pseudouracil, 2-thiopyrimidines (e.g., 2-thiouracil, 2-thiothymine), G-clamps and their derivatives, 5-substituted pyrimidines (e.g., 5-halouracil, 5-propynyluracil, 5-propynylcytosine, 5-aminomethyluracil, 5-hydroxymethyluracil, 5-aminomethylcytosine, 5-hydroxymethylcytosine, super-T), 7-deazaadenine, 2,6-diaminopurine, 7-deazaadenine, 2,6-diaminopurine, 7-amino-2-pyrimidine, 2,6-diaminopurine, 2,6-diamino-2-pyrimidine ... -aza-2,6-diaminopurine, 8-aza-7-deazaadenine, 8-aza-7-deazaadenine, 8-aza-7-deaza-2,6-diaminopurine, Super G, Super A, and N4-ethylcytosine, or derivatives thereof; N2-cyclopentylguanine (cPent-G), N2-cyclopentyl-2-aminopurine (cPent-AP), and N2-propyl-2-aminopurine (Pr-AP), or derivatives thereof; and modified bases such as 2,6-difluorotoluene or universal bases or abasic sites (e.g., 1-deoxyribose, 1,2-dideoxyribose, 1-deoxy-2-O-methylribose; or pyrrolidine derivatives in which the ring oxygen is replaced with a nitrogen (azaribose)). For examples of derivatives of Super A, Super G, and Super T, see U.S. Patent No. 6,683,173 (Epoch Biosciences), which is incorporated herein by reference. cPent-G, cPent-AP, and Pr-AP have been shown to have reduced immunostimulatory effects when incorporated into siRNA (Peacock H. et al.).
[0110] A preferred modified base is 5-methylcytosine.
[0111] Depending on the length of each wing, antisense oligonucleotides of the invention can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 base modifications. The invention also encompasses the introduction of two or more distinct base modifications into the wings of the antisense oligonucleotide.
[0112] Depending on the length of the core, the antisense oligonucleotides of the invention can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 base modifications. The invention also encompasses the introduction of two or more distinct base modifications into the core of the antisense oligonucleotide.
[0113] Depending on the length of the antisense oligonucleotide, the antisense oligonucleotide of the invention can contain at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more base modifications. The invention also encompasses the introduction of two or more distinct base modifications into the antisense oligonucleotide.
[0114] Modified sugars of nucleotides in the wings and / or core of an antisense oligonucleotide are synonymous with oligonucleotide scaffold modifications.
[0115] Scaffold modifications include modified versions of ribosyl moieties, such as 2'-O-modified RNAs, for example, 2'-O-alkyl or 2'-O-(substituted) alkyl, such as 2'-O-methyl, 2'-O-(2-cyanoethyl), 2'-O-(2-methoxy)ethyl (2'-MOE), 2'-O-(2-thiomethyl)ethyl, 2'-O-butyryl, 2'-O-propargyl, 2'-O-acetal esters (e.g., Biscans et al. Bioorg. Med. Chem. 2015, 23, 5360), 2'-O-allyl, 2'-O-(2S-methoxypropyl), 2'-O-(N-(aminoethyl)carbamoyl)methyl) (2'-AECM), 2'-O-(2-carboxyethyl), and carbamoyl derivatives (Yamada et al. al. Org. Biomol. Chem. 2014, 12, 6457), 2'-O-(2-amino)propyl, 2'-O-(2-(dimethylamino)propyl), 2'-O-(2-amino)ethyl, 2'-O-(2-(dimethylamino)ethyl); 2'-deoxy(DNA); 2'-O-(haloalkoxy)methyl (Arai K. et al. Bioorg. Med. Chem. 2011, 21, 6285) for example, 2'-O-(2-chloroethoxy)methyl (MCEM), 2'-O-(2,2-dichloroethoxy)methyl (DCEM); 2'-O-alkoxycarbonyl, for example, 2'-O-[2-(methoxycarbonyl)ethyl] (MOCE), 2'-O-[2-(N-methylcarbamoyl)ethyl] (MCE), 2'-O-[2-(N,N-dimethylcarbamoyl)ethyl] (DCME), 2'-O-[2-(methyl 2'-halo, such as 2'-F, FANA (2'-F arabinosyl nucleic acid); 2',4'-difluoro-2'-deoxy; carba- and aza-sugar modifications; 3'-O-substituted, such as 3'-O-methyl, 3'-O-butyryl, 3'-O-propargyl; 4'-substituted, such as 4'-aminomethyl-2'-O-methyl or 4'-aminomethyl-2'-fluoro; 5'-substituted, such as 5'-methyl or CNA (Ostergaard et al. ACS Chem. Biol. 2014, 22, 6227); and derivatives thereof.
[0116] The scaffold modification can include bicyclic nucleic acid monomers (BNA), which may be bridged nucleic acid monomers. Each occurrence of the BNA can include conformationally restricted nucleotide (CRN) monomers, locked nucleic acid (LNA) monomers, xylo-LNA monomers, α-LNA monomers, α-L-LNA monomers, β-D-LNA monomers, 2'-amino-LNA monomers, 2'-(alkylamino)-LNA monomers, 2'-(acylamino)-LNA monomers, 2'-N-substituted-2'-amino-LNA monomers, 2'-thio-LNA monomers, (2'-O,4'-C) constrained ethyl (cEt) BNA monomers, (2'-O,4'-C) constrained methoxyethyl (cMOE) BNA monomers, 2',4'-BNA NC (NH) monomer, 2',4'-BNA NC (N-Me) monomer, 2',4'-BNA NC Monomers independently selected from the group consisting of (N-Bn) monomers, ethylene-bridged nucleic acid (ENA) monomers, carba LNA (cLNA) monomers, 3,4-dihydro-2H-pyran nucleic acid (DpNA) monomers, 2'-C-bridged bicyclic nucleotide (CBBN) monomers, heterocyclic bridged BNA monomers (such as triazolyl- or tetrazolyl-linked), amide-bridged BNA monomers, urea-bridged BNA monomers, sulfonamide-bridged BNA monomers, bicyclic carbocyclic nucleotide monomers, TriNA monomers, α-L-TriNA monomers, bicyclic DNA (bcDNA) monomers, abcDNA monomers, F-bcDNA monomers, tricyclic DNA (tcDNA) monomers, F-tcDNA monomers, oxetane nucleotide monomers, locked PMO monomers derived from 2'-amino-LNA, guanidine-bridged nucleic acid (GuNA) monomers, spirocyclopropylene-bridged nucleic acid (scpBNA) monomers, and derivatives thereof may be produced.
[0117] Preferred sugar modifications are selected from the following: - 2'-O-modified RNA, more preferably 2'-O-alkyl or 2'-O-(substituted) alkyl, even more preferably 2'-O-methyl (2'-OMe) or 2'-O-(2-methoxy)ethyl (2'-MOE) - (BNA), more preferably (CRN) monomers or locked nucleic acid (LNA) monomers.
[0118] More preferred sugar modifications are 2'-OMe, 2'-MOE, and locked nucleic acid (LNA).
[0119] Depending on the length of each wing, antisense oligonucleotides of the invention can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 sugar modifications. The invention also encompasses the introduction of two or more distinct sugar modifications into the wings of the antisense oligonucleotide.
[0120] Depending on the length of the core, antisense oligonucleotides of the invention can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 sugar modifications. The invention also encompasses the introduction of two or more distinct sugar modifications into the wings of the antisense oligonucleotide.
[0121] Depending on the length of the antisense oligonucleotide, the antisense oligonucleotide of the invention can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more sugar modifications. The invention also encompasses the introduction of two or more distinct sugar modifications into the antisense oligonucleotide.
[0122] Antisense oligonucleotides according to the invention may contain backbone modifications in their wings and / or in their core. Backbone-linked modifications can be, but are not limited to, modified versions of phosphodiesters present in RNA, such as phosphorothioate (PS), chirally pure phosphorothioates, (R)-phosphorothioate, (S)-phosphorothioate ((S)-phopshorothioate), phosphorodithioate (PS2), phosphonoacetic acid (PACE), phosphonoacetamide (PACA), thiophosphonoacetic acid (thioPACE), thiophosphonoacetamide, phosphorothioate prodrugs, H-phosphonate, methyl phosphonate, methyl phosphonothioate, methyl phosphate, methyl phosphorothioate, ethyl phosphate, ethyl phosphorothioate, boranophosphate, boranophosphorothioate, methyl boranophosphate, methyl boranophosphorothioate, methyl boranophosphonate, methyl boranophosphonothioate, phosphate, phosphate triester, aminoalkyl phosphotriester, and derivatives thereof. Other modifications include phosphorylguanidines, acylphosphoramidates, sulfonylphosphoramidates, phosphoramidate, phosphoramidate, N3'→P5'phosphoramidate, phosphorodiamidate, phosphorothiodiamidate, sulfamate, dimethylene sulfoxide, amide, sulfonate, siloxane, sulfide, sulfone, formacetyl, thioformacetyl, methyleneformacetyl, alkenyl, methylenehydrazino, sulfonamide, amide, triazole, oxalyl, carbamate, methyleneimino (MMI), and thioacetamide nucleic acid (TANA); and derivatives thereof. Examples of chiral pure phosphorothioate bonds are described, for example, in WO2014 / 010250 or WO2017 / 062862 (WaVe Life Sciences). Examples of phosphorylguanidine linkages are described in WO 2016 / 028187 (Noogen). Various salts, mixed salts and free acid forms are also included, along with 3'→3' and 2'→5' linkages.
[0123] Preferred backbone linkage modifications are phosphorothioates and phosphoramidates.
[0124] More preferred backbone linkage modifications are phosphorothioates and phosphoramidates (preferably mesyl phosphoramidate).
[0125] Depending on their length, antisense oligonucleotides of the invention can contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more backbone linkage modifications. The invention also encompasses the introduction of two or more distinct backbone modifications into the antisense oligonucleotide.
[0126] In certain embodiments, the antisense oligonucleotide is such that its central DNA nucleotides are unmodified.
[0127] In another embodiment, the antisense oligonucleotide is such that its core DNA nucleotides are modified and at least a portion of its core backbone (i.e., internucleoside linkages) comprises phosphorothioates and / or phosphoramidates (preferably mesyl phosphoramidates).
[0128] In one embodiment, the antisense oligonucleotide is such that the RNA nucleotide analogues of each of its wings are modified to include a modified internucleoside linkage (preferably phosphorothioate and / or phosphoramidate (preferably mesylphosphoramidate)) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or locked nucleic acid (LNA) monomer) and / or a modified base (preferably 5-methylcytosine).
[0129] In one embodiment, the antisense oligonucleotide is the central DNA nucleotides of which are unmodified, and each RNA nucleotide analogue of its wings is modified to include a modified internucleoside linkage (preferably phosphorothioate or phosphoramidate (more preferably mesylphosphoramidate) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or Locked Nucleic Acid (LNA) monomer) and / or a modified base (preferably 5-methylcytosine).
[0130] In one embodiment, the antisense oligonucleotide is the central DNA nucleotide is modified and the central backbone (i.e., at least one internucleoside linkage) comprises a phosphorothioate or phosphoramidate (more preferably, a mesylphosphoramidate); and each RNA nucleotide analogue of its wings is modified to include a modified internucleoside linkage (preferably phosphorothioate or phosphoramidate (more preferably mesylphosphoramidate) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or Locked Nucleic Acid (LNA) monomer) and / or a modified base (preferably 5-methylcytosine).
[0131] In one embodiment, the antisense oligonucleotide comprises 15-30 or 20-30 nucleotides, including a central region of 5-15 contiguous DNA nucleotides flanked on each side by wing regions containing 1-5 RNA nucleotide analogs. Preferably, the backbone of the oligonucleotide is fully modified (central region and each wing). More preferably, the backbone is phosphorothioate and / or phosphoramidate (more preferably mesyl phosphoramidate).
[0132] In one embodiment, the antisense oligonucleotide is: 1. The DNA nucleotides in its center are unmodified, and each RNA nucleotide analogue in the wing is modified to include a modified internucleoside linkage (preferably a phosphorothioate or phosphoramidate (more preferably a mesylphosphoramidate)) and / or a modified sugar (preferably a 2'-MOE, 2'-OMe and / or a locked nucleic acid (LNA) monomer) and / or a modified base (preferably a 5-methylcytosine); or 1. The core DNA nucleotides are modified and the core backbone (i.e., at least one internucleoside linkage) comprises phosphorothioate and / or phosphoramidate (more preferably mesyl phosphoramidate), and Each RNA nucleotide analogue in the wings is modified to include a modified internucleoside linkage (preferably phosphorothioate or phosphoramidate (more preferably mesylphosphoramidate) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or Locked Nucleic Acid (LNA) monomer) and / or a modified base (preferably 5-methylcytosine).
[0133] In one embodiment, the antisense oligonucleotide is: 1. The DNA nucleotides in its center are unmodified, and each RNA nucleotide analogue in the wing is modified to include a modified internucleoside linkage (preferably phosphorothioate and / or phosphoramidate (more preferably mesylphosphoramidate)) and / or a modified sugar (preferably 2'-MOE) and / or a modified base (preferably 5-methylcytosine); or 2. The core DNA nucleotides are modified and the core backbone (i.e., at least one internucleoside linkage) is modified to include phosphorothioates and / or phosphoramidates (more preferably mesyl phosphoramidates), and Each RNA nucleotide analogue in the wings is modified to include a modified internucleoside linkage (preferably phosphorothioate and / or phosphoramidate (more preferably mesylphosphoramidate)) and / or a modified sugar (preferably 2'-MOE) and / or a modified base (preferably 5-methylcytosine).
[0134] In a preferred embodiment, the antisense oligonucleotide is as follows: the DNA nucleotides in the core are modified and the backbone (i.e., at least one internucleoside linkage) in the core comprises a phosphorothioate linkage, and Each RNA nucleotide analogue in the wing is modified to include a backbone that is a modified phosphorothioate linkage, and preferably at least one modified sugar (preferably 2'-MOE) and / or at least one modified base (preferably 5-methylcytosine).
[0135] In one embodiment, the present invention provides a human antisense oligonucleotide that preferentially targets a mutant allele of a human protein in the γ-secretase pathway, preferably the human protein in the γ-secretase pathway is PSEN 1. In this embodiment, the antisense oligonucleotide targets, hybridizes to, binds to, and / or is reverse complementary to a mutant allele of a human protein in the γ-secretase pathway, preferably PSEN 1.
[0136] In one embodiment, the base sequence of the oligonucleotide is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112 , 114, 116, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277. More preferred oligonucleotides comprising one of these base sequences are disclosed below.
[0137] In one embodiment, the antisense oligonucleotide has the following base sequence: TCTTTCTTGAAAATGGCAAG (AON1) (SEQ ID NO: 1) Includes.
[0138] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 1. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0139] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0140] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 1 is 5-methylcytosine.
[0141] In one embodiment, an oligonucleotide comprising SEQ ID NO: 1 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 1 is fully modified with a PS backbone.
[0142] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 1 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 1 comprise 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0143] The most preferred oligonucleotides containing SEQ ID NO:1 are SEQ ID NO:2: eT s eC* s eT s eT s eT s dC s dT s dT s dG s dA s dA s dA s dA s dT s dG s eG s eC* s eA s eA s eG (SEQ ID NO: 2) is expressed by In the formula, A means adenosine, G means guanine, T means thymine, C means cytosine, C* means 5-methylcytosine, U means uracil, e means 2'-MOE, d means DNA, the subscript s means a PS internucleoside bond, the subscript o means a PO bond, the subscript PNms means a PNms bond, and the subscript PNdmi means a PNdmi bond.
[0144] Unless otherwise indicated, this nomenclature will be used for all oligonucleotides in this application.
[0145] In one embodiment, the antisense oligonucleotide has the following base sequence: ATTCTTTCTTGAAAATGGCA (AON2) (SEQ ID NO: 3) Includes.
[0146] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 3. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0147] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0148] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 3 is 5-methylcytosine.
[0149] In one embodiment, the oligonucleotide comprising SEQ ID NO: 3 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 3 is fully modified with a PS backbone.
[0150] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 3 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 3 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0151] The most preferred oligonucleotide comprising SEQ ID NO:3 is SEQ ID NO:4: eA s eT s eT s eC* s eT s dT s dT s dC s dT s dT s dG s dA s dA s dA s dA s eT s eG s eG s eC* s eA (SEQ ID NO: 4) is expressed by
[0152] In one embodiment, the antisense oligonucleotide has the following base sequence: CAATTCTTTCTTGAAAATGG (AON3) (SEQ ID NO: 5) Includes.
[0153] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 5. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0154] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0155] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 5 is 5-methylcytosine.
[0156] In one embodiment, an oligonucleotide comprising SEQ ID NO: 5 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 5 is fully modified with a PS backbone.
[0157] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 5 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 5 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0158] The most preferred oligonucleotide comprising SEQ ID NO:5 is SEQ ID NO:6: eC* s eA s eA s eT s eT s dC s dT s dT s dT s dC s dT s dT s dG s dA s dA s eA s eA s eT s eG s eG (SEQ ID NO: 6) is expressed by
[0159] In one embodiment, the antisense oligonucleotide has the following base sequence: (AON4) GCAATTCTTTCTTGAAAATG (SEQ ID NO: 7) Includes.
[0160] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 7. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0161] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0162] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 7 is 5-methylcytosine.
[0163] In one embodiment, an oligonucleotide comprising SEQ ID NO: 7 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 7 is fully modified with a PS backbone.
[0164] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 7 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 7 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0165] The most preferred oligonucleotide comprising SEQ ID NO:7 is SEQ ID NO:8: eG s eC* s eA s eA s eT s dT s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA s eA s eA s eT s eG (SEQ ID NO: 8) is expressed by
[0166] In one embodiment, the antisense oligonucleotide has the following base sequence: (AON5)GGCAATTCTTTCTTGAAAAT (SEQ ID NO: 9) Includes.
[0167] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 9. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0168] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0169] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 9 is 5-methylcytosine.
[0170] In one embodiment, an oligonucleotide comprising SEQ ID NO: 9 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 9 is fully modified with a PS backbone.
[0171] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 9 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 9 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0172] The most preferred oligonucleotide comprising SEQ ID NO: 9 is SEQ ID NO: 10: eG s eG s eC* s eA s eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 10) is expressed by
[0173] In one embodiment, the antisense oligonucleotide has the following base sequence: (AON6)TGGCAATTCTTTCTTGAAAA (SEQ ID NO: 11) Includes.
[0174] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 11. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0175] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0176] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 11 is 5-methylcytosine.
[0177] In one embodiment, the oligonucleotide comprising SEQ ID NO: 11 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 11 is fully modified with a PS backbone.
[0178] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 11 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 11 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0179] The most preferred oligonucleotide comprising SEQ ID NO: 11 is SEQ ID NO: 12: eT s eG s eG s eC* s eA s dA s dT s dT s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA s eA s eA (SEQ ID NO: 12) is expressed by
[0180] In one embodiment, the antisense oligonucleotide has the following base sequence: (AON7)CTGGCAATTCTTTCTTGAAA (SEQ ID NO: 13) Includes.
[0181] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 13. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0182] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0183] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 13 is 5-methylcytosine.
[0184] In one embodiment, the oligonucleotide comprising SEQ ID NO: 13 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 13 is fully modified with a PS backbone.
[0185] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 13 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 13 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0186] The most preferred oligonucleotide comprising SEQ ID NO: 13 is SEQ ID NO: 14: eC* s eT s eG s eG s eC* s dA s dA s dT s dT s dC s dT s dT s dT s dC s dT s eT s eG s eA s eA s eA (SEQ ID NO: 14) is expressed by
[0187] In one embodiment, the antisense oligonucleotide has the following base sequence: (AON8)AGCTGGCAATTCTTTCTTGA (SEQ ID NO: 15) Includes.
[0188] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 15. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0189] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0190] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 15 is 5-methylcytosine.
[0191] In one embodiment, the oligonucleotide comprising SEQ ID NO: 15 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 15 is fully modified with a PS backbone.
[0192] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 15 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 15 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0193] The most preferred oligonucleotide comprising SEQ ID NO: 15 is SEQ ID NO: 16: eA s eG s eC* s eT s eG s dG s dC s dA s dA s dT s dT s dC s dT s dT s dT s eC* s eT s eT s eG s eA (SEQ ID NO: 16) is expressed by
[0194] In one embodiment, the antisense oligonucleotide has the following base sequence: (AON9)AGAGCTGGCAATTCTTTCTT (SEQ ID NO: 17) Includes.
[0195] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 17. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0196] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0197] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 17 is 5-methylcytosine.
[0198] In one embodiment, the oligonucleotide comprising SEQ ID NO: 17 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 17 is fully modified with a PS backbone.
[0199] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 17 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 17 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0200] The most preferred oligonucleotide comprising SEQ ID NO: 17 is SEQ ID NO: 18: eA s eG s eA s eG s eC* s dT s dG s dG s dC s dA s dA s dT s dT s dC s dT s eT s eT s eC* s eT s eT (SEQ ID NO: 18) is expressed by
[0201] In one embodiment, the antisense oligonucleotide has the following base sequence: GAAGAGCTGGCAATTCTTTC (AON10) (SEQ ID NO: 19) Includes.
[0202] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 19. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0203] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0204] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 19 is 5-methylcytosine.
[0205] In one embodiment, an oligonucleotide comprising SEQ ID NO: 19 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 19 is fully modified with a PS backbone.
[0206] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 19 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 19 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0207] The most preferred oligonucleotide containing SEQ ID NO: 19 is SEQ ID NO: 20: eG s eA s eA s eG s eA s dG s dC s dT s dG s dG s dC s dA s dA s dT s dT s eC* s eT s eT s eT s eC* (SEQ ID NO: 20).
[0208] In one embodiment, the antisense oligonucleotide has the following base sequence: (AON11)TGGAAGAGCTGGCAATTCTT (SEQ ID NO: 21) Includes.
[0209] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence of SEQ ID NO: 21. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.
[0210] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0211] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 21 is 5-methylcytosine.
[0212] In one embodiment, the oligonucleotide comprising SEQ ID NO: 21 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 21 is fully modified with a PS backbone.
[0213] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 21 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 21 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0214] The most preferred oligonucleotide comprising SEQ ID NO:21 is SEQ ID NO:22: eT s eG s eG s eA s eA s dG s dA s dG s dC s dT s dG s dG s dC s dA s dA s eT s eT s eC* s eT s eT (SEQ ID NO: 22).
[0215] In one embodiment, the antisense oligonucleotide has the following base sequence: ATTGGAAGAGCTGGCAATTC (AON12) (SEQ ID NO: 23) Includes.
[0216] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 23. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0217] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0218] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 23 is 5-methylcytosine.
[0219] In one embodiment, an oligonucleotide comprising SEQ ID NO: 23 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 23 is fully modified with a PS backbone.
[0220] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 23 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 23 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0221] The most preferred oligonucleotide comprising SEQ ID NO:23 is SEQ ID NO:24: eA s eT s eT s eG s eG s dA s dA s dG s dA s dG s dC s dT s dG s dG s dC s eA s eA s eT s eT s eC* (SEQ ID NO: 24) is expressed by
[0222] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON13) (SEQ ID NO: 25) Includes.
[0223] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 25. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0224] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0225] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 25 is 5-methylcytosine.
[0226] In one embodiment, the oligonucleotide comprising SEQ ID NO: 25 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 25 is fully modified with a PS backbone.
[0227] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 25 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 25 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0228] The most preferred oligonucleotide comprising SEQ ID NO:25 is SEQ ID NO:26: eG s eC* s eA s eA s eT s dU s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA s eA s eA s eT s eG (SEQ ID NO: 26) is expressed by
[0229] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON14) (SEQ ID NO: 27) Includes.
[0230] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 27. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0231] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0232] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 27 is 5-methylcytosine.
[0233] In one embodiment, the oligonucleotide comprising SEQ ID NO: 27 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 27 is fully modified with a PS backbone.
[0234] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 27 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 27 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0235] The most preferred oligonucleotide comprising SEQ ID NO:27 is SEQ ID NO:28: eG s eG s eC* s eA s eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 28) is expressed by
[0236] In one embodiment, the antisense oligonucleotide has the following base sequence: TGGCAATUCTTTCTTGAAAA (AON15) (SEQ ID NO: 29) Includes.
[0237] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 29. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0238] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0239] In one embodiment, at least one C, and preferably all Cs, of the oligonucleotide comprising SEQ ID NO: 29 is 5-methylcytosine.
[0240] In one embodiment, the oligonucleotide comprising SEQ ID NO: 29 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 29 is fully modified with a PS backbone.
[0241] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 29 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 29 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0242] The most preferred oligonucleotide comprising SEQ ID NO: 29 is SEQ ID NO: 30: eT s eG s eG s eC* s eA s dA s dT s dU s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA s eA s eA (SEQ ID NO: 30) is expressed by
[0243] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON16) (SEQ ID NO: 32) Includes.
[0244] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 32. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0245] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0246] In one embodiment, at least one C in the oligonucleotide comprising SEQ ID NO: 32 is 5-methylcytosine. In another embodiment, the Cs in the oligonucleotide comprising SEQ ID NO: 32 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 32) are unmethylated. In another embodiment, all Cs in the oligonucleotide comprising SEQ ID NO: 32 are 5-methylcytosine.
[0247] In one embodiment, an oligonucleotide comprising SEQ ID NO: 32 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). In one embodiment, an oligonucleotide comprising SEQ ID NO: 32 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In another embodiment, an oligonucleotide comprising SEQ ID NO: 32 is fully modified with a PS backbone.
[0248] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 32 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In preferred embodiments, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 32 comprises 1, 2, 3, 4, or 5 nucleotides. In more preferred embodiments, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0249] The most preferred oligonucleotide comprising SEQ ID NO: 32 is SEQ ID NO: 33: eG s eG o eC* o eA o eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 33) is expressed by
[0250] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON17) (SEQ ID NO: 34) Includes.
[0251] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 34. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0252] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0253] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 34 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 32 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 34) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 34 are 5-methylcytosine.
[0254] In one embodiment, an oligonucleotide comprising SEQ ID NO: 34 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). In one embodiment, an oligonucleotide comprising SEQ ID NO: 34 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In another embodiment, an oligonucleotide comprising SEQ ID NO: 34 is fully modified with a PS backbone.
[0255] In one embodiment, the oligonucleotide comprising SEQ ID NO: 34 has at least one of its internucleoside linkages, preferably modified as a PNms linkage, preferably at least two of them. In one embodiment, the PNms linkages are present in the central region of the oligonucleotide and not in its wings.
[0256] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 34 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 34 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0257] The most preferred oligonucleotide comprising SEQ ID NO: 34 is SEQ ID NO: 35: eG s eG s eC* s eA s eA s dT s dU PNms dC PNms dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 35) is expressed by
[0258] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON18) (SEQ ID NO: 36) Includes.
[0259] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 36. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0260] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0261] In one embodiment, at least one C in the oligonucleotide comprising SEQ ID NO: 36 is 5-methylcytosine. In another embodiment, the Cs in the oligonucleotide comprising SEQ ID NO: 36 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 36) are unmethylated. In another embodiment, all Cs in the oligonucleotide comprising SEQ ID NO: 36 are 5-methylcytosine.
[0262] In one embodiment, an oligonucleotide comprising SEQ ID NO: 36 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). In one embodiment, an oligonucleotide comprising SEQ ID NO: 36 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In another embodiment, an oligonucleotide comprising SEQ ID NO: 36 is fully modified with a PS backbone.
[0263] In one embodiment, the oligonucleotide comprising SEQ ID NO: 36 has at least one of its internucleoside linkages, preferably modified as a PNms linkage, preferably at least two of them. In one embodiment, the PNms linkages are present in the central region of the oligonucleotide and not in its wings.
[0264] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 36 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 36 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0265] The most preferred oligonucleotide comprising SEQ ID NO: 36 is SEQ ID NO: 37: eG s eG s eC* s eA s eA s dT s dU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 37) is expressed by
[0266] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON19) (SEQ ID NO: 38) Includes.
[0267] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 38. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0268] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0269] In one embodiment, at least one C in the oligonucleotide comprising SEQ ID NO: 38 is 5-methylcytosine. In another embodiment, the Cs in the oligonucleotide comprising SEQ ID NO: 38 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 38) are unmethylated. In another embodiment, all Cs in the oligonucleotide comprising SEQ ID NO: 38 are 5-methylcytosine.
[0270] In one embodiment, an oligonucleotide comprising SEQ ID NO: 38 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 38 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 38 is fully modified with a PS backbone.
[0271] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0272] In one embodiment, the oligonucleotide comprising SEQ ID NO: 38 has at least one of its internucleoside linkages, preferably modified as a PNms linkage, preferably at least two of them. In one embodiment, the PNms linkages are present in the central region of the oligonucleotide and not in its wings.
[0273] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 38 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 38 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0274] The most preferred oligonucleotide comprising SEQ ID NO: 38 is SEQ ID NO: 39: eG s eG o eC* o eA o eA s dT s dU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA oeA o eA o eA s eT (SEQ ID NO: 39) is expressed by
[0275] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAAATCTTTCTTGAAAAT (AON22) (SEQ ID NO: 40) Includes.
[0276] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 40. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0277] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0278] In one embodiment, at least one C in the oligonucleotide comprising SEQ ID NO: 40 is 5-methylcytosine. In another embodiment, the Cs in the oligonucleotide comprising SEQ ID NO: 40 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 40) are unmethylated. In another embodiment, all Cs in the oligonucleotide comprising SEQ ID NO: 40 are 5-methylcytosine.
[0279] In one embodiment, an oligonucleotide comprising SEQ ID NO: 40 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 40 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 40 is fully modified with a PS backbone.
[0280] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 40 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 40 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0281] The most preferred oligonucleotide comprising SEQ ID NO: 40 is SEQ ID NO: 41: eG s eG s eC* s eA s eA s dA s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 41) is expressed by
[0282] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTGTTTCTTGAAAAT (AON23) (SEQ ID NO: 42) Includes.
[0283] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 42. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0284] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0285] In one embodiment, at least one C in the oligonucleotide comprising SEQ ID NO: 42 is 5-methylcytosine. In another embodiment, the C in the oligonucleotide comprising SEQ ID NO: 42 present in the gap of the oligonucleotide (the C at position 12 of SEQ ID NO: 42) is unmethylated. In another embodiment, all Cs in the oligonucleotide comprising SEQ ID NO: 42 are 5-methylcytosine.
[0286] In one embodiment, an oligonucleotide comprising SEQ ID NO: 42 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 42 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 42 is fully modified with a PS backbone.
[0287] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 42 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 42 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0288] The most preferred oligonucleotide comprising SEQ ID NO: 42 is SEQ ID NO: 43: eG s eG s eC* s eA s eA s dT s dT s dG s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 43) is expressed by
[0289] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTGATTCTTGAAAAT (AON24) (SEQ ID NO: 44) Includes.
[0290] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 44. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0291] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0292] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 44 is 5-methylcytosine. In another embodiment, a C in an oligonucleotide comprising SEQ ID NO: 44 that is present in the gap of the oligonucleotide (the C at position 12 of SEQ ID NO: 44) is unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 44 are 5-methylcytosine.
[0293] In one embodiment, an oligonucleotide comprising SEQ ID NO: 44 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 44 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 44 is fully modified with a PS backbone.
[0294] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 44 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 44 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0295] The most preferred oligonucleotide comprising SEQ ID NO:44 is SEQ ID NO:45: eG s eG s eC* s eA s eA s dT s dT s dG s dA s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 45) is expressed by
[0296] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON25) (SEQ ID NO: 46) Includes.
[0297] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 46. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0298] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0299] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 46 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 46 present in the gap of the oligonucleotide (the C at position 7 and the C at position 11 of SEQ ID NO: 46) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 46 are 5-methylcytosine.
[0300] In one embodiment, an oligonucleotide comprising SEQ ID NO: 46 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 46 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 46 is fully modified with a PS backbone.
[0301] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 46 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In preferred embodiments, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 46 comprises 1, 2, 3, 4, or 5 nucleotides. In more preferred embodiments, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0302] The most preferred oligonucleotide comprising SEQ ID NO: 46 is SEQ ID NO: 47: eG s eC* o eA o eA o eT s dU s dC s dT s dT s dT s dCs dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 47) is expressed by
[0303] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTCTAACTTGAAAAT (AON26) (SEQ ID NO: 48) Includes.
[0304] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 48. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0305] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0306] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 48 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 48 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 48) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 48 are 5-methylcytosine.
[0307] In one embodiment, an oligonucleotide comprising SEQ ID NO: 48 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 48 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 48 is fully modified with a PS backbone.
[0308] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 48 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 48 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0309] The most preferred oligonucleotide comprising SEQ ID NO:48 is SEQ ID NO:49: eG s eG s eC* s eA s eA s dT s dT s dC s dT s dA s dA s dC s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 49) is expressed by
[0310] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTCTTAGTTGAAAAT (AON27) (SEQ ID NO: 50) Includes.
[0311] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 50. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0312] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0313] In one embodiment, at least one C of the oligonucleotide comprising SEQ ID NO: 50 is 5-methylcytosine. In another embodiment, the C of the oligonucleotide comprising SEQ ID NO: 50 present in the gap of the oligonucleotide (the C at position 8 of SEQ ID NO: 50) is unmethylated. In another embodiment, all Cs of the oligonucleotide comprising SEQ ID NO: 50 are 5-methylcytosine.
[0314] In one embodiment, an oligonucleotide comprising SEQ ID NO: 50 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 50 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 50 is fully modified with a PS backbone.
[0315] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 50 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 50 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0316] The most preferred oligonucleotide comprising SEQ ID NO:50 is SEQ ID NO:51: eG s eG s eC* s eA s eA s dT s dT s dC s dT s dT s dA s dG s dT s dT s dG s eA s eA s eA s eA s eT (SEQ ID NO: 51) is expressed by
[0317] In one embodiment, the antisense oligonucleotide has the following base sequence: CAATTCTTTCTTGAAAAT (AON28) (SEQ ID NO: 52) Includes.
[0318] In this embodiment, the antisense oligonucleotide has a length of 18 to 50 nucleotides and comprises the base sequence SEQ ID NO: 52. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0319] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0320] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 52 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 52 present in the gap of the oligonucleotide (the Cs at positions 6 and 10 of SEQ ID NO: 52) are unmethylated. In another embodiment, and preferably, all Cs in an oligonucleotide comprising SEQ ID NO: 52 are 5-methylcytosine.
[0321] In one embodiment, an oligonucleotide comprising SEQ ID NO: 52 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 52 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 52 is fully modified with a PS backbone.
[0322] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 52 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 52 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOEs.
[0323] The most preferred oligonucleotide comprising SEQ ID NO: 52 is SEQ ID NO: 53: eC* s eA s eA s eT s dT s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA s eA s eA s eT (SEQ ID NO: 53) is expressed by
[0324] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATTCTTTCTTGAAAA (AON29) (SEQ ID NO: 54) Includes.
[0325] In this embodiment, the antisense oligonucleotide has a length of 18 to 50 nucleotides and comprises the base sequence SEQ ID NO: 54. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0326] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0327] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 54 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 54 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 54) are unmethylated. In another embodiment, and preferably, all Cs in an oligonucleotide comprising SEQ ID NO: 54 are 5-methylcytosine.
[0328] In one embodiment, an oligonucleotide comprising SEQ ID NO: 54 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 54 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 54 is fully modified with a PS backbone.
[0329] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 54 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 54 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOEs.
[0330] The most preferred oligonucleotide comprising SEQ ID NO: 54 is SEQ ID NO: 55: eG s eC* s eA s eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA s eA (SEQ ID NO: 55) is expressed by
[0331] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTCTTTCTTGAAA (AON30) (SEQ ID NO: 56) Includes.
[0332] In this embodiment, the antisense oligonucleotide has a length of 18 to 50 nucleotides and comprises the base sequence SEQ ID NO: 56. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0333] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0334] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 56 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 56 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 56) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 56 are 5-methylcytosine.
[0335] In one embodiment, an oligonucleotide comprising SEQ ID NO: 56 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 56 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 56 is fully modified with a PS backbone.
[0336] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 56 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 56 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOEs.
[0337] The most preferred oligonucleotide comprising SEQ ID NO: 56 is SEQ ID NO: 57: eG s eG s eC* s eA s dA s dT s dT s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA s eA (SEQ ID NO: 57) is expressed by
[0338] In one embodiment, the antisense oligonucleotide has the following base sequence: AATTCTTTCTTGAAAA (AON31) (SEQ ID NO: 58) Includes.
[0339] In this embodiment, the antisense oligonucleotide has a length of 16 to 50 nucleotides and comprises the base sequence SEQ ID NO: 58. The length can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0340] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0341] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 58 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 58 present in the gap of the oligonucleotide (the Cs at positions 5 and 9 of SEQ ID NO: 58) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 58 are 5-methylcytosine.
[0342] In one embodiment, an oligonucleotide comprising SEQ ID NO: 58 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 58 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 58 is fully modified with a PS backbone.
[0343] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 58 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 58 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0344] The most preferred oligonucleotide comprising SEQ ID NO:58 is SEQ ID NO:59: eA s eA s eT s dT s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA s eA s eA (SEQ ID NO: 59) is expressed by
[0345] In one embodiment, the antisense oligonucleotide has the following base sequence: CAATTCTTTCTTGAAA (AON32) (SEQ ID NO: 60) Includes.
[0346] In this embodiment, the antisense oligonucleotide has a length of 16 to 50 nucleotides and comprises the base sequence SEQ ID NO: 60. The length can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0347] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0348] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 60 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 60 that are present in the gap of the oligonucleotide (the Cs at positions 6 and 10 of SEQ ID NO: 60) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 60 are 5-methylcytosine.
[0349] In one embodiment, an oligonucleotide comprising SEQ ID NO: 60 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 60 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 60 is fully modified with a PS backbone.
[0350] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 60 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 60 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 3 nucleotides. Most preferably, both wings comprise 3 nucleotides and are MOEs.
[0351] The most preferred oligonucleotide comprising SEQ ID NO: 60 is SEQ ID NO: 61: eC* s eA s eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA s eA s eA (SEQ ID NO: 61) is expressed by
[0352] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATTCTTTCTTGAA (AON33) (SEQ ID NO: 62) Includes.
[0353] In this embodiment, the antisense oligonucleotide has a length of 16 to 50 nucleotides and comprises the base sequence SEQ ID NO: 62. The length can be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides.
[0354] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0355] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 62 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 62 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 62) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 62 are 5-methylcytosine.
[0356] In one embodiment, an oligonucleotide comprising SEQ ID NO: 62 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 62 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 62 is fully modified with a PS backbone.
[0357] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 62 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 62 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 3 nucleotides. Most preferably, both wings comprise 3 nucleotides and are MOEs.
[0358] The most preferred oligonucleotide comprising SEQ ID NO: 62 is SEQ ID NO: 63: eG s eC* s eA s dA s dT s dT s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA (SEQ ID NO: 63) is expressed by
[0359] In one embodiment, the antisense oligonucleotide has the following base sequence: ATTCTTTCTTGAAAATGGCA (AON34) (SEQ ID NO: 64) Includes.
[0360] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 64. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0361] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0362] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 64 is 5-methylcytosine. In another embodiment, the C in an oligonucleotide comprising SEQ ID NO: 64 that is present in the gap of the oligonucleotide (the C at position 8 of SEQ ID NO: 64) is unmethylated. In another embodiment, and preferably, all Cs in an oligonucleotide comprising SEQ ID NO: 64 are 5-methylcytosine.
[0363] In one embodiment, an oligonucleotide comprising SEQ ID NO: 64 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 64 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 64 is fully modified with a PS backbone.
[0364] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0365] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 64 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 64 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0366] The most preferred oligonucleotide comprising SEQ ID NO:64 is SEQ ID NO:65: eA s eT o eT o eC* o eT s dT s dT s dC sdT s dT s dG s dA s dA s dA s dA s eT o eG o eG o eC* s eA (SEQ ID NO: 65) is expressed by
[0367] In one embodiment, the antisense oligonucleotide has the following base sequence: ATTCTTTCTTGAAAATGGCA (AON35) (SEQ ID NO: 66) Includes.
[0368] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 66. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0369] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0370] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 66 is 5-methylcytosine. In another embodiment, a C in an oligonucleotide comprising SEQ ID NO: 66 that is present in a gap of the oligonucleotide (the C at position 8 of SEQ ID NO: 66) is unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 66 are 5-methylcytosine.
[0371] In one embodiment, an oligonucleotide comprising SEQ ID NO: 66 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 66 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 66 is fully modified with a PS backbone.
[0372] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 66 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 66 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0373] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 66 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 66 comprises 1, 2, 3, 4, or 5 PNdmi bonds, more preferably 2, 3, or 4, and most preferably 3 PNdmi bonds.
[0374] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 66 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0375] In certain embodiments, the oligonucleotide has two distinct internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.
[0376] The most preferred oligonucleotide comprising SEQ ID NO:66 is SEQ ID NO:67: eA s eT PNdmi eT PNdmi eC* PNdmi eT s dT s dT s dC s dT s dT s dG s dA s dA s dA s dA s eT PNdmi eG PNdmi eG PNdmi eC* s eA (SEQ ID NO: 67) is expressed by
[0377] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTCTTTCTTGAAAAT (AON36) (SEQ ID NO: 68) Includes.
[0378] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 68. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0379] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0380] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 68 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 68 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 68) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 68 are 5-methylcytosine.
[0381] In one embodiment, an oligonucleotide comprising SEQ ID NO: 68 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 68 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 68 is fully modified with a PS backbone.
[0382] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0383] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 68 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 68 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0384] The most preferred oligonucleotide comprising SEQ ID NO:68 is SEQ ID NO:69: eG s eG o eC* o eA o eA s dT s dT s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 69) is expressed by
[0385] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTCTTTCTTGAAAAT (AON37) (SEQ ID NO: 70) Includes.
[0386] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 70. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0387] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0388] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 70 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 70 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 70) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 70 are 5-methylcytosine.
[0389] In one embodiment, an oligonucleotide comprising SEQ ID NO: 70 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 70 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 70 is fully modified with a PS backbone.
[0390] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 70 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 70 contains 1 or 2 or 3 or 4 or 5 PNdmi bonds, more preferably 2 or 3 or 4, and most preferably 3 PNdmi bonds.
[0391] In one embodiment, one or preferably each wing of an oligonucleotide comprising SEQ ID NO: 70 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0392] In certain embodiments, the oligonucleotide has two distinct internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.
[0393] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 70 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 70 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0394] The most preferred oligonucleotide comprising SEQ ID NO: 70 is SEQ ID NO: 71: eG s eG PNdmi eC* PNdmi eA PNdmi eA s dT s dT s dCs dT s dT s dT s dC s dT s dT s dG s eA PNdmi eA PNdmi eA PNdmi eA s eT (SEQ ID NO: 71) is expressed by
[0395] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATTCTTTCTTGAAAAT (AON38) (SEQ ID NO: 72) Includes.
[0396] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 72. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0397] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0398] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 72 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 72 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 72) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 72 are 5-methylcytosine.
[0399] In one embodiment, an oligonucleotide comprising SEQ ID NO: 72 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 72 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 72 is fully modified with a PS backbone.
[0400] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 72 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 72 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0401] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0402] The most preferred oligonucleotide comprising SEQ ID NO: 72 is SEQ ID NO: 73: eG s eG o eC* s eA o eA s dT s dT s dC sdT s dT s dT s dC s dT s dT s dG s eA o eA s eA o eA s eT (SEQ ID NO: 73) is expressed by
[0403] In one embodiment, the antisense oligonucleotide has the following base sequence: AGCTGGCAATTCTTTCTTGA (AON39) (SEQ ID NO: 74) Includes.
[0404] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 74. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0405] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0406] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 74 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 74 present in the gap of said oligonucleotide (the Cs at positions 7 and 12 of SEQ ID NO: 74) are unmethylated. In another embodiment, and preferably, all Cs of an oligonucleotide comprising SEQ ID NO: 74 are 5-methylcytosine.
[0407] In one embodiment, an oligonucleotide comprising SEQ ID NO: 74 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 74 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 74 is fully modified with a PS backbone.
[0408] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 74 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 74 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0409] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0410] The most preferred oligonucleotide comprising SEQ ID NO: 74 is SEQ ID NO: 75: eA s eG o eC* o eT o eG s dG s dC s dA sdA s dT s dT s dC s dT s dT s dT s eC* o eT o eT o eG s eA (SEQ ID NO: 75) is expressed by
[0411] In one embodiment, the antisense oligonucleotide has the following base sequence: AGCTGGCAATTCTTTCTTGA (AON40) (SEQ ID NO: 76) Includes.
[0412] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 76. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0413] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0414] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 76 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 76 present in the gap of the oligonucleotide (the Cs at positions 7 and 12 of SEQ ID NO: 76) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 76 are 5-methylcytosine.
[0415] In one embodiment, an oligonucleotide comprising SEQ ID NO: 76 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 76 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 76 is fully modified with a PS backbone.
[0416] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 76 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 76 comprises 1, 2, 3, 4, or 5 PNdmi bonds, more preferably 2, 3, or 4, and most preferably 3 PNdmi bonds.
[0417] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 76 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0418] In certain embodiments, the oligonucleotide has two distinct internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.
[0419] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 76 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 76 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0420] The most preferred oligonucleotide comprising SEQ ID NO: 76 is SEQ ID NO: 77: eA s eG PNdmi eC* PNdmi eT PNdmi eG s dG s dC s dA s dA s dT s dT s dC s dT s dT s dT s eC* PNdmi eT PNdmi eT PNdmi eG s eA (SEQ ID NO: 77) is expressed by
[0421] In one embodiment, the antisense oligonucleotide has the following base sequence: AGCTGGCAATTCTTTCTTGA (AON41) (SEQ ID NO: 78) Includes.
[0422] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 78. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0423] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0424] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 78 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 78 present in the gap of the oligonucleotide (the Cs at positions 7 and 12 of SEQ ID NO: 78) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 78 are 5-methylcytosine.
[0425] In one embodiment, an oligonucleotide comprising SEQ ID NO: 78 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 78 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 78 is fully modified with a PS backbone.
[0426] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 78 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 78 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0427] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0428] The most preferred oligonucleotide comprising SEQ ID NO: 78 is SEQ ID NO: 79: eA s eG o eC* s eT o eG s dG s dC s dA s dA s dT s dT s dC s dT s dT s dT s eC* o eT s eT o eG s eA (SEQ ID NO: 79) is expressed by
[0429] In one embodiment, the antisense oligonucleotide has the following base sequence: GAAGAGCTGGCAATTCTTTC (AON42) (SEQ ID NO: 80) Includes.
[0430] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 80. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0431] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0432] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 80 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 80 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 80) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 80 are 5-methylcytosine.
[0433] In one embodiment, an oligonucleotide comprising SEQ ID NO: 80 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 80 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 80 is fully modified with a PS backbone.
[0434] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 80 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 80 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0435] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0436] The most preferred oligonucleotide comprising SEQ ID NO:80 is SEQ ID NO:81: eG s eA o eA o eG o eA s dG s dC s dT s dG s dG s dC s dA s dA s dT s dT s eC* o eT o eT o eT s eC* (SEQ ID NO: 81) is expressed by
[0437] In one embodiment, the antisense oligonucleotide has the following base sequence: GAAGAGCTGGCAATTCTTTC (AON43) (SEQ ID NO: 82) Includes.
[0438] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 82. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0439] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0440] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 82 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 82 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 82) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 82 are 5-methylcytosine.
[0441] In one embodiment, an oligonucleotide comprising SEQ ID NO: 82 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 82 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 82 is fully modified with a PS backbone.
[0442] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 82 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 82 comprises 1, 2, 3, 4, or 5 PNdmi bonds, more preferably 2, 3, or 4, and most preferably 3 PNdmi bonds.
[0443] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 82 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0444] In certain embodiments, the oligonucleotide has two distinct internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.
[0445] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 82 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 82 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0446] The most preferred oligonucleotide comprising SEQ ID NO: 82 is SEQ ID NO: 83: eG s eA PNdmi eA PNdmi eG PNdmi eA s dG s dC s dT sdG s dG s dC s dA s dA s dT s dT s eC* PNdmi eT PNdmi eT PNdmi eT s eC* (SEQ ID NO: 83) is expressed by
[0447] In one embodiment, the antisense oligonucleotide has the following base sequence: TGGCAATUCTTTCTTGAAAA (AON44) (SEQ ID NO: 84) Includes.
[0448] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 84. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0449] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0450] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 84 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 84 present in the gap of the oligonucleotide (the Cs at positions 9 and 13 of SEQ ID NO: 84) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 84 are 5-methylcytosine.
[0451] In one embodiment, an oligonucleotide comprising SEQ ID NO: 84 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 84 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 84 is fully modified with a PS backbone.
[0452] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 84 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 84 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0453] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0454] The most preferred oligonucleotide comprising SEQ ID NO:84 is SEQ ID NO:85: eT s eG o eG o eC* o eA s dA s dT s dU sdC s dT s dT s dT s dC s dT s dT s eG o eA o eA o eA s eA (SEQ ID NO: 85) is expressed by
[0455] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON45) (SEQ ID NO: 86) Includes.
[0456] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 86. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0457] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0458] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 86 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 86 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 86) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 86 are 5-methylcytosine.
[0459] In one embodiment, an oligonucleotide comprising SEQ ID NO: 86 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 86 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 86 is fully modified with a PS backbone.
[0460] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 86 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 86 comprises 1 or 2 or 3 or 4 or 5 PNdmi bonds, more preferably 2 or 3 or 4, and most preferably 3 PNdmi bonds.
[0461] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 86 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0462] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate, and phosphorothioate.
[0463] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 86 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 86 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0464] The most preferred oligonucleotide comprising SEQ ID NO:86 is SEQ ID NO:87: eG s eC* PNdmi eA o eA PNdmi eT s dU s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 87) is expressed by
[0465] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON46) (SEQ ID NO: 88) Includes.
[0466] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 88. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0467] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0468] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 88 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 88 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 88) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 88 are 5-methylcytosine.
[0469] In one embodiment, an oligonucleotide comprising SEQ ID NO: 88 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 88 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 88 is fully modified with a PS backbone.
[0470] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 88 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 88 comprises 1 or 2 or 3 or 4 or 5 PNdmi bonds, more preferably 2 or 3 or 4, and most preferably 3 PNdmi bonds.
[0471] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0472] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 88 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0473] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate, and phosphorothioate.
[0474] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 88 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 88 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0475] The most preferred oligonucleotide comprising SEQ ID NO:88 is SEQ ID NO:89: eG s eG PNdmi eC* o eA PNdmi eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA PNdmi eT (SEQ ID NO: 89) is expressed by
[0476] In one embodiment, the antisense oligonucleotide has the following base sequence: TGGCAATUCTTTCTTGAAAA (AON47) (SEQ ID NO: 90) Includes.
[0477] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 90. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0478] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0479] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 90 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 90 present in the gap of the oligonucleotide (the Cs at positions 9 and 13 of SEQ ID NO: 90) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 90 are 5-methylcytosine.
[0480] In one embodiment, an oligonucleotide comprising SEQ ID NO: 90 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 90 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 90 is fully modified with a PS backbone.
[0481] In one embodiment, one internucleoside linkage modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 90 is a dmi-phosphoramidate (PNdmi) linkage. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 90 comprises 1 or 2 or 3 or 4 or 5 PNdmi linkages, more preferably 2 or 3 or 4, and most preferably 3 PNdmi linkages.
[0482] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0483] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 90 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0484] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate, and phosphorothioate.
[0485] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 90 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 90 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0486] The most preferred oligonucleotide comprising SEQ ID NO:90 is SEQ ID NO:91: eT s eG PNdmi eG o eC* PNdmi eA s dA s dT s dU s dC s dT s dT s dT s dC s dT s dT s eG o eA o eA o eA PNdmi eA (SEQ ID NO: 91) is expressed by
[0487] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAA (AON48) (SEQ ID NO: 92) Includes.
[0488] In this embodiment, the antisense oligonucleotide has a length of 18 to 50 nucleotides and comprises the base sequence SEQ ID NO: 92. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0489] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0490] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 92 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 92 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 92) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 92 are 5-methylcytosine.
[0491] In one embodiment, an oligonucleotide comprising SEQ ID NO: 92 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 92 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 92 is fully modified with a PS backbone.
[0492] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 92 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 92 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOEs.
[0493] The most preferred oligonucleotide comprising SEQ ID NO:92 is SEQ ID NO:93: eG s eG s eC* s eA s dA s dT s dU s dC s dT s dT s dT s dC s dT s dT s eG s eA s eA s eA (SEQ ID NO: 93) is expressed by
[0494] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAA (AON49) (SEQ ID NO: 94) Includes.
[0495] In this embodiment, the antisense oligonucleotide has a length of 18 to 50 nucleotides and comprises the base sequence SEQ ID NO: 94. The length can be 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0496] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0497] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 94 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 94 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 94) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 94 are 5-methylcytosine.
[0498] In one embodiment, an oligonucleotide comprising SEQ ID NO: 94 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 94 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 94 is fully modified with a PS backbone.
[0499] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 94 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 94 contains 1, 2, 3, 4, or 5 PNdmi bonds, more preferably 1, 2, or 3, and most preferably 1 PNdmi bond.
[0500] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 94 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0501] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate, and in some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate, and phosphorothioate.
[0502] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 94 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 94 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 4 nucleotides. Most preferably, both wings comprise 4 nucleotides and are MOEs.
[0503] The most preferred oligonucleotide comprising SEQ ID NO:94 is SEQ ID NO:95: eG s eG PNdmi eC* o eA s dA s dT s dU s dC s dT s dT s dT s dC s dT s dT s eG o eA o eA PNdmi eA (SEQ ID NO: 95) is expressed by
[0504] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON50) (SEQ ID NO: 96) Includes.
[0505] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 96. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0506] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0507] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 96 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 96 present in the gap of said oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 96) are unmethylated. In another embodiment, and preferably, all Cs of an oligonucleotide comprising SEQ ID NO: 96 are 5-methylcytosine.
[0508] In one embodiment, an oligonucleotide comprising SEQ ID NO: 96 has at least one of its internucleoside linkages modified, preferably as a PNms linkage, and preferably as at least two of them. In one embodiment, the PNms linkage is present in the central region of the oligonucleotide and not in its wings. In one embodiment, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0509] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0510] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 96 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 96 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0511] The most preferred oligonucleotide comprising SEQ ID NO:96 is SEQ ID NO:97: eG s eC* o eA o eA o eT s dU PNms dC PNms dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 97) is expressed by
[0512] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON51) (SEQ ID NO: 98) Includes.
[0513] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 98. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0514] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0515] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 98 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 98 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 98) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 98 are 5-methylcytosine.
[0516] In one embodiment, the oligonucleotide comprising SEQ ID NO: 98 has at least one of its internucleoside linkages, preferably modified as a PNms linkage, preferably at least two of them. In one embodiment, the PNms linkages are present in the central region of the oligonucleotide and not in its wings.
[0517] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0518] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 98 comprises one modified internucleoside linkage, preferably phosphorothioate.
[0519] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0520] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 98 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 98 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0521] The most preferred oligonucleotide comprising SEQ ID NO:98 is SEQ ID NO:99: eG s eC* o eA o eA o eT s dU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 99) is expressed by
[0522] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON52) (SEQ ID NO: 100) Includes.
[0523] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 100. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0524] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0525] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 100 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 100 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 100) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 100 are 5-methylcytosine.
[0526] In one embodiment, an oligonucleotide comprising SEQ ID NO: 100 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 100 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 100 is fully modified with a PS backbone.
[0527] In one embodiment, one internucleoside bond modification in one wing, or preferably in each wing, or in the core of an oligonucleotide comprising SEQ ID NO: 100 is a mesyl phosphoramidate (PNms) bond. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 100 contains 1 or 2 or 3 or 4 or 5 PNms bond(s), more preferably 2 or 3 or 4, and most preferably 2 PNms bond(s). Preferably, the core of an oligonucleotide comprising SEQ ID NO: 100 contains 1 or 2 or 3 or 4 or 5 PNms bond(s), more preferably 2 or 3 or 4, and most preferably 2 PNms bond(s).
[0528] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 100 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0529] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 100, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0530] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0531] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0532] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 100 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 100 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0533] The most preferred oligonucleotide comprising SEQ ID NO: 100 is SEQ ID NO: 101: eG s eC* PNms eA PNms eA o eT s dU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT seG (SEQ ID NO: 101) is expressed by
[0534] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON53) (SEQ ID NO: 102) Includes.
[0535] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 102. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0536] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0537] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 102 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 102 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 102) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 102 are 5-methylcytosine.
[0538] In one embodiment, an oligonucleotide comprising SEQ ID NO: 102 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 102 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 102 is fully modified with a PS backbone.
[0539] In one embodiment, the oligonucleotide comprising SEQ ID NO: 102 has at least one of its internucleoside linkages, preferably modified as a PNms linkage, preferably at least two of them. In one embodiment, the PNms linkages are present in the central region of the oligonucleotide and not present in one wing (or both wings).
[0540] In one embodiment, an oligonucleotide comprising SEQ ID NO: 102 has at least one internucleoside linkage in one wing (or in both wings) that is unmodified and thus is a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0541] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0542] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 102 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 102 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0543] The most preferred oligonucleotide comprising SEQ ID NO: 102 is SEQ ID NO: 103: eG s eC* o eA o eA o eT s dU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA s eA s eA s eT s eG (SEQ ID NO: 103) is expressed by
[0544] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON54) (SEQ ID NO: 104) Includes.
[0545] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 104. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0546] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0547] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 104 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 104 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 104) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 104 are 5-methylcytosine.
[0548] In one embodiment, an oligonucleotide comprising SEQ ID NO: 104 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 104 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 104 is fully modified with a PS backbone.
[0549] In one embodiment, the oligonucleotide comprising SEQ ID NO: 104 has at least one of its internucleoside linkages preferably modified as a PNms linkage, preferably at least 2, 3, 4, or 5 of them. In one embodiment, the PNms linkages are present in the central region of the oligonucleotide and not in its wings.
[0550] In one embodiment, an oligonucleotide comprising SEQ ID NO: 104 has at least one internucleoside linkage in one wing (or in both wings) that is unmodified and thus is a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0551] In certain embodiments, oligonucleotides have distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0552] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 104 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 104 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0553] The most preferred oligonucleotide comprising SEQ ID NO: 104 is SEQ ID NO: 105: eG s eC* s eA s eA s eT s dUs dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 105) is expressed by
[0554] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON55) (SEQ ID NO: 106) Includes.
[0555] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 106. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0556] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0557] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 106 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 106 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 106) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 106 are 5-methylcytosine.
[0558] In one embodiment, an oligonucleotide comprising SEQ ID NO: 106 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 106 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 106 is fully modified with a PS backbone.
[0559] In one embodiment, the oligonucleotide comprising SEQ ID NO: 106 has at least one of its internucleoside linkages preferably modified as a PNms linkage, preferably at least 2, 3, 4, or 5 of them. In one embodiment, the PNms linkage is present in the central region of the oligonucleotide and is absent from one of its wings (or from both wings).
[0560] In one embodiment, an oligonucleotide comprising SEQ ID NO: 106 has at least one internucleoside linkage in one wing (or in both wings) that is unmodified and thus is a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0561] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0562] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 106 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 106 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0563] The most preferred oligonucleotide comprising SEQ ID NO: 106 is SEQ ID NO: 107: eG s eG o eC* o eA o eA s dT s dU PNms dC PNms dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 107) is expressed by
[0564] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON56) (SEQ ID NO: 108) Includes.
[0565] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 108. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0566] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0567] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 108 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 108 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 108) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 108 are 5-methylcytosine.
[0568] In one embodiment, an oligonucleotide comprising SEQ ID NO: 108 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 108 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 108 is fully modified with a PS backbone.
[0569] In one embodiment, one internucleoside linkage modification in one wing, or preferably in each wing, or in the core of an oligonucleotide comprising SEQ ID NO: 108 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing or each wing of an oligonucleotide comprising SEQ ID NO: 108 contains one, two, three, four, or five PNms linkages, more preferably two, three, or four, and most preferably two PNms linkages. Preferably, the core of an oligonucleotide comprising SEQ ID NO: 108 contains one, two, three, four, or five PNms linkages, more preferably two, three, or four, and most preferably two PNms linkages. In one embodiment, one wing or preferably each wing of an oligonucleotide comprising SEQ ID NO: 108 contains two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0570] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 108, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0571] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0572] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 108 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 108 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0573] The most preferred oligonucleotide comprising SEQ ID NO: 108 is SEQ ID NO: 109: eG s eG PNms eC* PNms eA o eA s dT s dU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 109) is expressed by
[0574] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON57) (SEQ ID NO: 110) Includes.
[0575] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 110. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0576] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0577] In one embodiment, at least one C of the oligonucleotide comprising SEQ ID NO: 110 is 5-methylcytosine. In another embodiment, the Cs of the oligonucleotide comprising SEQ ID NO: 110 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 110) are unmethylated. In another embodiment, all Cs of the oligonucleotide comprising SEQ ID NO: 110 are 5-methylcytosine.
[0578] In one embodiment, an oligonucleotide comprising SEQ ID NO: 110 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 110 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 110 is fully modified with a PS backbone.
[0579] In one embodiment, one internucleoside linkage modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 110 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 110 comprises 1 or 2 or 3 or 4 or 5 PNms linkages, more preferably 2 or 3 or 4, and most preferably 2 PNms linkages.
[0580] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO:110 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0581] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 110, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0582] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0583] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0584] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 110 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 110 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0585] The most preferred oligonucleotide comprising SEQ ID NO: 110 is SEQ ID NO: 111: eG s eG PNms eC* PNms eA o eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 111) is expressed by
[0586] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON58) (SEQ ID NO: 112) Includes.
[0587] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 112. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0588] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0589] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 112 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 112 present in the gap of said oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 112) are unmethylated. In another embodiment, and preferably, all Cs of an oligonucleotide comprising SEQ ID NO: 112 are 5-methylcytosine.
[0590] In one embodiment, an oligonucleotide comprising SEQ ID NO: 112 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 112 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 112 is fully modified with a PS backbone.
[0591] In one embodiment, one internucleoside linkage modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 112 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing, or each wing, of an oligonucleotide comprising SEQ ID NO: 112 comprises 1, 2, 3, 4, or 5 PNms linkages, more preferably 2, 3, or 4, and most preferably 2 PNms linkages.
[0592] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 112 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0593] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 112, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters, mesyl phosphoramidate, and phosphorothioate.
[0594] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0595] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 112 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 112 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0596] The most preferred oligonucleotide comprising SEQ ID NO: 112 is SEQ ID NO: 113: eG s eG o eC* PNms eA PNms eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 113) is expressed by
[0597] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON59) (SEQ ID NO: 114) Includes.
[0598] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 114. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0599] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0600] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 114 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 114 present in the gap of said oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 114) are unmethylated. In another embodiment, and preferably, all Cs of an oligonucleotide comprising SEQ ID NO: 114 are 5-methylcytosine.
[0601] In one embodiment, an oligonucleotide comprising SEQ ID NO: 114 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 114 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 114 is fully modified with a PS backbone.
[0602] In one embodiment, one internucleoside linkage modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 114 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing, or each wing, of an oligonucleotide comprising SEQ ID NO: 114 comprises 1, 2, 3, 4, or 5 PNms linkages, more preferably 2, 3, or 4, and most preferably 2 PNms linkages.
[0603] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 114 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0604] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 114, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0605] In certain embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate.
[0606] In certain embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0607] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 114 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 114 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprise 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0608] The most preferred oligonucleotide comprising SEQ ID NO: 114 is SEQ ID NO: 115: eG s eG o eC* o eA o eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA PNms eA PNms eT (SEQ ID NO: 115) is expressed by
[0609] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON60) (SEQ ID NO: 116) Includes.
[0610] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 116. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0611] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0612] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 116 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 116 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 116) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 116 are 5-methylcytosine.
[0613] In one embodiment, an oligonucleotide comprising SEQ ID NO: 116 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 116 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 116 is fully modified with a PS backbone.
[0614] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 116 is a mesyl phosphoramidate (PNms) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 116 comprises 1, 2, 3, 4, or 5 PNms bond(s), more preferably 2, 3, or 4, and most preferably 2 PNms bond(s).
[0615] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 116 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0616] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 116, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0617] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0618] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 116 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 116 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0619] The most preferred oligonucleotide comprising SEQ ID NO: 116 is SEQ ID NO: 117: eG s eG o eC* o eA o eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA PNms eA PNms eA o eT (SEQ ID NO: 117) is expressed by
[0620] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON61) (SEQ ID NO: 121) Includes.
[0621] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 121. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0622] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0623] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 121 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 121 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 121) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 121 are 5-methylcytosine.
[0624] In one embodiment, an oligonucleotide comprising SEQ ID NO: 121 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 121 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 121 is fully modified with a PS backbone.
[0625] In one embodiment, at least one sugar modification is present in the gap of an oligonucleotide comprising SEQ ID NO: 121, preferably at least one 2-O methyl sugar modification is present in the gap of said oligonucleotide, most preferably at position 7 of SEQ ID NO: 121.
[0626] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 121 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 121 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0627] The most preferred oligonucleotide comprising SEQ ID NO: 121 is SEQ ID NO: 122: eG s eC* o eA o eA o eT s dU s mC s dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 122) is expressed by
[0628] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON62) (SEQ ID NO: 123) Includes.
[0629] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 123. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0630] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0631] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 123 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 123 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 123) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 123 are 5-methylcytosine.
[0632] In one embodiment, an oligonucleotide comprising SEQ ID NO: 123 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 123 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 123 is fully modified with a PS backbone.
[0633] In one embodiment, at least one sugar modification is present in the gap of an oligonucleotide comprising SEQ ID NO: 123, preferably at least one 2-O methyl sugar modification is present in the gap of said oligonucleotide, most preferably at position 7 of SEQ ID NO: 123.
[0634] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 123 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 123 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0635] The most preferred oligonucleotide comprising SEQ ID NO: 123 is SEQ ID NO: 124: eG s eG o eC* o eA o eA s dT s mU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 124) is expressed by
[0636] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON63) (SEQ ID NO: 125) Includes.
[0637] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 125. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0638] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0639] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 125 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 125 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 125) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 125 are 5-methylcytosine.
[0640] In one embodiment, an oligonucleotide comprising SEQ ID NO: 125 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 125 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 125 is fully modified with a PS backbone.
[0641] In one embodiment, one internucleoside linkage modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 125 is a dmi-phosphoramidate (PNdmi) linkage. Preferably, one wing, or each wing, of an oligonucleotide comprising SEQ ID NO: 125 contains 1 or 2 or 3 or 4 or 5 PNdmi linkages, more preferably 1 or 2 or 3, and most preferably 1 PNdmi linkage.
[0642] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 125 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0643] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate, and phosphorothioate.
[0644] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 125 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 125 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0645] The most preferred oligonucleotide comprising SEQ ID NO: 125 is SEQ ID NO: 126: eG s eC* o eA o eA o eT s dU s dC s dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 126) is expressed by
[0646] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON64) (SEQ ID NO: 127) Includes.
[0647] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 127. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0648] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0649] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 127 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 127) is unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 127 are 5-methylcytosine.
[0650] In one embodiment, an oligonucleotide comprising SEQ ID NO: 127 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 127 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 127 is fully modified with a PS backbone.
[0651] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 127 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 127 contains 1, 2, 3, 4, or 5 PNdmi bonds, more preferably 1, 2, or 3, and most preferably 1 PNdmi bond.
[0652] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 127 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0653] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, dmi-phosphoramidate, and phosphorothioate.
[0654] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 127 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 127 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0655] The most preferred oligonucleotide comprising SEQ ID NO: 127 is SEQ ID NO: 128: eG s eG o eC* o eA o eA s dT s dU s dC s dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA PNdmi eT (SEQ ID NO: 128) is expressed by
[0656] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON65) (SEQ ID NO: 129) Includes.
[0657] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 129. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0658] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0659] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 129 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 129) is unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 129 are 5-methylcytosine.
[0660] In one embodiment, an oligonucleotide comprising SEQ ID NO: 129 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 129 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 129 is fully modified with a PS backbone.
[0661] In one embodiment, one internucleoside linkage modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 129 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing, or each wing, of an oligonucleotide comprising SEQ ID NO: 129 comprises 1, 2, 3, 4, or 5 PNms linkages, more preferably 2, 3, or 4, and most preferably 2 PNms linkages.
[0662] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 129 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0663] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 129, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters, mesyl phosphoramidate, and phosphorothioate.
[0664] In one embodiment, at least one sugar modification is present in the gap of an oligonucleotide comprising SEQ ID NO: 129, preferably at least one 2-O methyl sugar modification is present in the gap of said oligonucleotide, most preferably at position 7 of SEQ ID NO: 129.
[0665] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0666] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 129 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 129 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0667] The most preferred oligonucleotide comprising SEQ ID NO: 129 is SEQ ID NO: 130: eG s eC* o eA o eA o eT s dU PNms mC PNms dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 130) is expressed by
[0668] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON66) (SEQ ID NO: 131) Includes.
[0669] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 131. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0670] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0671] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 131 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 131) is unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 131 are 5-methylcytosine.
[0672] In one embodiment, an oligonucleotide comprising SEQ ID NO: 131 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 131 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 131 is fully modified with a PS backbone.
[0673] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 131 is a mesyl phosphoramidate (PNms) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 131 comprises 1, 2, 3, 4, or 5 PNms bond(s), more preferably 2, 3, or 4, and most preferably 2 PNms bond(s).
[0674] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 131 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0675] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 131, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters, mesyl phosphoramidate, and phosphorothioate.
[0676] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0677] In one embodiment, at least one sugar modification is present in the gap of an oligonucleotide comprising SEQ ID NO: 131, preferably at least one 2-O methyl sugar modification is present in the gap of said oligonucleotide, most preferably at position 7 of SEQ ID NO: 131.
[0678] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 131 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 131 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0679] The most preferred oligonucleotide comprising SEQ ID NO: 131 is SEQ ID NO: 132: eG s eC* o eA o eA o eT s dU s mC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT s eG (SEQ ID NO: 132) is expressed by
[0680] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON67) (SEQ ID NO: 133) Includes.
[0681] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 133. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0682] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0683] In one embodiment, at least one C in an oligonucleotide comprising SEQ ID NO: 133 is 5-methylcytosine. In another embodiment, the Cs in an oligonucleotide comprising SEQ ID NO: 133 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 133) are unmethylated. In another embodiment, all Cs in an oligonucleotide comprising SEQ ID NO: 133 are 5-methylcytosine.
[0684] In one embodiment, the oligonucleotide comprising SEQ ID NO: 133 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, the oligonucleotide comprising SEQ ID NO: 133 is fully modified with a PS backbone.
[0685] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 133 is a mesyl phosphoramidate (PNms) bond. Preferably, one wing, or each of the wings of an oligonucleotide comprising SEQ ID NO: 133, comprises 1, 2, 3, 4, or 5 PNms bond(s), more preferably 2, 3, or 4, and most preferably 2 PNms bond(s).
[0686] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 133 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0687] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 133, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0688] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0689] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 133 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 133 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0690] The most preferred oligonucleotide comprising SEQ ID NO: 133 is SEQ ID NO: 134: eG s eG o eC* o eA o eA s dT s mU PNms dC PNms dT s dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 134) is expressed by
[0691] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON68) (SEQ ID NO: 135) Includes.
[0692] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 135. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0693] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0694] In one embodiment, at least one C of the oligonucleotide comprising SEQ ID NO: 135 is 5-methylcytosine. In another embodiment, the Cs of the oligonucleotide comprising SEQ ID NO: 135 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 135) are unmethylated. In another embodiment, all Cs of the oligonucleotide comprising SEQ ID NO: 135 are 5-methylcytosine.
[0695] In one embodiment, an oligonucleotide comprising SEQ ID NO: 135 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 135 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 135 is fully modified with a PS backbone.
[0696] In one embodiment, one internucleoside linkage modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 135 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing, or each wing, of an oligonucleotide comprising SEQ ID NO: 135 comprises 1, 2, 3, 4, or 5 PNms linkages, more preferably 2, 3, or 4, and most preferably 2 PNms linkages.
[0697] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 135 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0698] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 135, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0699] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0700] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 135 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 135 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0701] In one embodiment, at least one sugar modification is present in the gap of an oligonucleotide comprising SEQ ID NO: 135, preferably at least one 2-O methyl sugar modification is present in the gap of said oligonucleotide, most preferably at position 7 of SEQ ID NO: 135.
[0702] The most preferred oligonucleotide comprising SEQ ID NO: 135 is SEQ ID NO: 136: eG s eG o eC* o eA o eA s dT s mU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s eA o eA o eA o eA s eT (SEQ ID NO: 136) is expressed by
[0703] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON69) (SEQ ID NO: 137) Includes.
[0704] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 137. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0705] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0706] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 137 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 137 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 137) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 137 are 5-methylcytosine.
[0707] In one embodiment, an oligonucleotide comprising SEQ ID NO: 137 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 137 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 137 is fully modified with a PS backbone.
[0708] In one embodiment, one internucleoside linkage modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 137 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing, or each wing, of an oligonucleotide comprising SEQ ID NO: 137 comprises 1, 2, 3, 4, or 5 PNms linkages, more preferably 2, 3, or 4, and most preferably 2 PNms linkages.
[0709] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 137 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0710] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 137, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters, mesyl phosphoramidate, and phosphorothioate.
[0711] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 137 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 137 contains 1, 2, 3, 4, or 5 PNdmi bonds, more preferably 1, 2, or 3, and most preferably 1 PNdmi bond.
[0712] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 137 comprises two distinct modified internucleoside linkages, preferably dmi-phosphoramidate and phosphorothioate.
[0713] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0714] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 137 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 137 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0715] The most preferred oligonucleotide comprising SEQ ID NO: 137 is SEQ ID NO: 138: eG s eC* o eA o eA o eT s dU PNms dC PNms dT s dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 138) is expressed by
[0716] In one embodiment, the antisense oligonucleotide has the following base sequence: GCAATUCTTTCTTGAAAATG (AON70) (SEQ ID NO: 139) Includes.
[0717] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 139. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0718] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0719] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 139 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 139 present in the gap of the oligonucleotide (the Cs at positions 7 and 11 of SEQ ID NO: 139) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 139 are 5-methylcytosine.
[0720] In one embodiment, an oligonucleotide comprising SEQ ID NO: 139 has at least one of its internucleoside linkages modified, preferably as a phosphorothioate or phosphoramidate (preferably mesyl phosphoramidate). More preferably, an oligonucleotide comprising SEQ ID NO: 139 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 139 has one, two, or three phosphodiester linkages in each of its wings, preferably three phosphodiester linkages in each of its wings. In one embodiment, an oligonucleotide comprising SEQ ID NO: 139 is fully modified with a PS backbone.
[0721] In one embodiment, one internucleoside linkage modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 139 is a mesyl phosphoramidate (PNms) linkage. Preferably, one wing, or each wing, of an oligonucleotide comprising SEQ ID NO: 139 comprises 1, 2, 3, 4, or 5 PNms linkages, more preferably 2, 3, or 4, and most preferably 2 PNms linkages.
[0722] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 139 comprises two distinct modified internucleoside linkages, preferably mesyl phosphoramidate and phosphorothioate.
[0723] In one embodiment, 1, 2, 3, 4, or 5 PNms linkages are present in the core of an oligonucleotide comprising SEQ ID NO: 139, and no PNms linkages are present in the wings of the oligonucleotide. In this embodiment, the internucleoside linkages in the wings of the oligonucleotide are selected from phosphodiesters linkages, mesyl phosphoramidate, and phosphorothioate.
[0724] In some embodiments, at least one internucleoside linkage in one wing (or in both wings) is unmodified and is therefore a phosphodiester internucleoside linkage. A preferred internucleoside linkage modification in one wing (or in both wings) is phosphorothioate. In some embodiments, the oligonucleotide has three distinct internucleoside linkages, preferably phosphodiester, mesyl phosphoramidate, and phosphorothioate.
[0725] In one embodiment, one internucleoside bond modification of one wing, or preferably each of the wings, of an oligonucleotide comprising SEQ ID NO: 139 is a dmi-phosphoramidate (PNdmi) bond. Preferably, one wing, or each of the wings, of an oligonucleotide comprising SEQ ID NO: 139 comprises 1, 2, 3, 4, or 5 PNdmi bonds, more preferably 1, 2, or 3, and most preferably 1 PNdmi bond.
[0726] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 139 comprises two distinct modified internucleoside linkages, preferably a dmi-phosphoramidate and a phosphorothioate.
[0727] In one embodiment, one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 139 has at least one internucleoside linkage modification and / or at least one sugar modification and / or at least one base modification compared to an RNA-based antisense oligonucleotide. In a preferred embodiment, one wing, or more preferably both wings, of an oligonucleotide comprising SEQ ID NO: 139 comprises 1, 2, 3, 4, or 5 nucleotides. In a more preferred embodiment, one wing, or even more preferably both wings, comprises 5 nucleotides. Most preferably, both wings comprise 5 nucleotides and are MOEs.
[0728] The most preferred oligonucleotide comprising SEQ ID NO: 139 is SEQ ID NO: 140: eG s eC* o eA o eA o eT s dU s dC PNms dT PNms dT s dT s dC s dT s dT s dG s dA s eA o eA o eA o eT PNdmi eG (SEQ ID NO: 140) is expressed by
[0729] In one embodiment, the antisense oligonucleotide has the following base sequence: GGCAATUCTTTCTTGAAAAT (AON71) (SEQ ID NO: 141) Includes.
[0730] In this embodiment, the antisense oligonucleotide has a length of 20 to 50 nucleotides and comprises the base sequence SEQ ID NO: 141. The length can be 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 nucleotides.
[0731] Each nucleotide may be a nucleotide analog as specified herein above. When a base is modified or a base analog is used, the modified base or base analog must maintain the same base pairing specificity as the base it replaces.
[0732] In one embodiment, at least one C of an oligonucleotide comprising SEQ ID NO: 141 is 5-methylcytosine. In another embodiment, the Cs of an oligonucleotide comprising SEQ ID NO: 141 present in the gap of the oligonucleotide (the Cs at positions 8 and 12 of SEQ ID NO: 141) are unmethylated. In another embodiment, all Cs of an oligonucleotide comprising SEQ ID NO: 141 are 5-methylcytosine.
[0733] In one embodiment, one internucleoside bond modification of one wing, or preferably each wing, of an oligonucleotide comprising SEQ ID NO: 141 is a mesyl phosphoramidate (PNms) bond. Preferably, one wing, or each wing, o...
Claims
1. An antisense oligonucleotide that preferentially targets a mutant allele of a protein of the γ-secretase complex when present in a cell containing, and preferably expressing, said mutant allele.
2. The antisense oligonucleotide according to claim 1, wherein the protein of the γ-secretase complex in which the allele is mutated is PSEN1 or PSEN2, preferably PSEN1.
3. 3. The antisense oligonucleotide of claim 1 or 2, - capable of preferentially silencing, inactivating, disrupting, knocking down, reducing or decreasing the mutant PSEN1 or PSEN2 transcript (preferably the mutant PSEN1 transcript); and - it is not possible (or is only minimally possible) to silence, inactivate, disrupt, knock down, reduce or decrease the wild-type PSEN1 or PSEN2 transcript (preferably the wild-type PSEN1 transcript), Antisense oligonucleotides.
4. The antisense oligonucleotide according to any one of claims 1 to 3, which is capable of normalizing, restoring or correcting abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratios, preferably said Aβ42 / 38 and / or Aβ43 / 40 ratios, more preferably said Aβ42 / 38 ratio.
5. The antisense oligonucleotide of any one of claims 1 to 4, wherein the protein of the γ-secretase complex is endogenously expressed by the cell.
6. The antisense oligonucleotide according to any one of claims 1 to 5, wherein the cell is a neuron.
7. 7. The antisense oligonucleotide of claim 1, wherein the human PSEN1 mutation is selected from the group consisting of the most frequent PSEN1 mutations: P117L, M139T, M139V, M146I, H163R, G206A, P264L, E280A, L392V, A431E, and S121Y, more preferably E280A and A431E.
8. The mutation in human PSEN1 is selected from the group consisting of mutations caused by substitution of guanine, thymine, or cytosine with adenosine in the coding sequence, and the PSEN1 protein contains one of the following mutations: R35Q, V94M, F105I, R108Q, L113Q, T116N, P117T, P117Q, E120K, E123K, M139K, M139I, V142I, M146I, V151M, Y154N, L166H, L174M, I180N, G206S, G206D, G209R, G209E, S 8. The antisense oligonucleotide of any one of claims 1 to 7, which gives rise to 212Y, H214N, G217D, S230N, A231T, M233I, F237I, A246E, Y256N, V261I, G266S, R269H, V272D, T274K, R278K, E280K, R358Q, A360T, S365Y, G378E, F386I, F386L, S390N, A396T, A409T, C410Y, G417S, L424H, A431E, A434T, P436Q, preferably A431E.
9. 9. The antisense oligonucleotide of any one of claims 1 to 8, which is capable of recruiting RNase H to silence, inactivate, knockdown, disrupt, reduce or decrease the level or expression of the targeted mutant allele.
10. 10. The antisense oligonucleotide of any one of claims 1 to 9, comprising 15 to 30 or 20 to 30 nucleotides, including a central region of DNA nucleotide analogues and / or 5 to 15 contiguous DNA nucleotides flanking each end of wing regions comprising 1 to 5 RNA nucleotide analogues.
11. The antisense oligonucleotide of claim 10, wherein the mutation present in a mutant allele or transcript of PSEN1 or PSEN2 is targeted by the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh or twelfth nucleotide of the central region of the oligonucleotide.
12. 1) its core DNA nucleotides are unmodified and each of its wings' RNA nucleotides are modified to include modified internucleoside linkages, preferably phosphorothioates and / or phosphoramidates (more preferably mesylphosphoramidates) and / or modified sugars (preferably 2'-MOE, 2'-OMe and / or Locked Nucleic Acid (LNA) monomers) and / or modified bases (preferably 5-methylcytosine); or 2) its central DNA nucleotides are modified such that the backbone (i.e., at least one internucleoside linkage) comprises a phosphorothioate and / or phosphoramidate (preferably mesyl phosphoramidate), and each of its wings' RNA nucleotides is modified to comprise a modified internucleoside linkage, preferably a phosphorothioate and / or phosphoramidate (more preferably mesyl phosphoramidate) and / or a modified sugar (preferably 2'-MOE, 2'-OMe and / or Locked Nucleic Acid (LNA) monomer) and / or a modified base (preferably 5-methylcytosine); The antisense oligonucleotide according to claim 10 or 11.
13. SEQ ID NOs: 2, 4, 6, 8, 7, 8, 9, 10, 11, 12, 14, 16, 18, 20, 22, 24, 25, 26, 27, 28, 29, 30, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, preferably SEQ ID NOs: 7, 8, 9, 10, 11, 12, 25, 26, 27, 28, 29, 30, 33, 34, 35, 36, 37, 38, 39, 47, 97, 99, 115, more preferably SEQ ID NOs: 8, 10, 12, 26, 28, 30, 33, 35, 37, 39, 47, 97, 99, 115, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249 251, 253, 255, 257, 259, 261, 263, 265, 267, 269, 271, 273, 275, 277, and most preferably SEQ ID NOs: 28, 30, 33, 37, 39, 47, 85, 97, 99, 115, 221, or 223.
14. A composition comprising the antisense oligonucleotide of any one of claims 1 to 13, wherein the composition comprises a pharmaceutically acceptable excipient.
15. The antisense oligonucleotide according to any one of claims 1 to 13 or the composition according to claim 14 for use as a medicament.
16. 16. The antisense oligonucleotide or composition of claim 15 for use as a medicament for treating and / or delaying and / or curing and / or preventing and / or ameliorating a disease or condition associated with abnormal processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD).
17. The antisense oligonucleotide elicits at least one of the following: - said oligonucleotide is capable of preferentially silencing, inactivating, disrupting, knocking down, reducing or degrading a mutant PSEN1 or PSEN2 transcript (preferably a mutant PSEN1 transcript), and said oligonucleotide is not (or is only minimally capable of) silencing, inactivating, disrupting, knocking down, reducing or degrading a wild-type PSEN1 or PSEN2 transcript (preferably a wild-type PSEN1 transcript); - said oligonucleotide is capable of normalizing, restoring or correcting an abnormal Aβ42 / 38 and / or Aβ43 / 40 and / or Aβ43 / 37 and / or Aβ42 / 40 ratio, preferably said Aβ42 / 38 and / or Aβ43 / 40 ratio, more preferably said Aβ42 / 38 ratio; and - the oligonucleotide is capable of alleviating one or more symptoms and / or characteristics and / or improving parameters associated with or related to a disease or condition associated with abnormal processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD), 17. An antisense oligonucleotide or composition for use according to claim 15 or 16.
18. 20. A method for treating and / or delaying a disease or condition associated with abnormal processing of amyloid precursor protein (APP), preferably familial Alzheimer's disease (FAD), using an antisense oligonucleotide or composition according to any one of claims 1 to 17.
19. an antisense oligonucleotide comprising 15-30 or 20-30 nucleotides containing 5-15 contiguous DNA nucleotides flanked on each side by wing regions comprising 1-5 RNA nucleotide analogues and / or a central region of DNA nucleotide analogues, which preferentially targets a mutant allele of a protein of the y-secretase complex when present in a cell containing, and preferably expressing, said mutant allele; An antisense oligonucleotide wherein the mutation present in the mutant allele is targeted by the first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, or twelfth nucleotide of the central region of the oligonucleotide.
20. an antisense oligonucleotide comprising 15-30 or 20-30 nucleotides containing 5-15 contiguous DNA nucleotides flanked on each side by wing regions comprising 1-5 RNA nucleotide analogues and / or a central region of DNA nucleotide analogues, which preferentially targets a mutant allele of a protein of the y-secretase complex when present in a cell containing, and preferably expressing, said mutant allele, An antisense oligonucleotide wherein the mutation present in the mutant allele is targeted by the 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, or 18th nucleotide in the oligonucleotide sequence starting from 5' to 3'.
21. The antisense oligonucleotide of claim 10, wherein the mutation present in the mutant allele or transcript of PSEN1 or PSEN2 is targeted by the 6th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, or 18th nucleotide of the oligonucleotide sequence starting from 5' to 3'.
22. 13. The antisense oligonucleotide of any one of claims 1 to 12, comprising SEQ ID NOs: 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, preferably SEQ ID NOs: 178, 180, 182, 192, 194, 196, 198, more preferably SEQ ID NOs: 192, 194, 196.
23. The antisense oligonucleotide of claim 10, wherein the mutation present in the mutant allele or transcript of PSEN1 or PSEN2 is targeted by the first, second, third, fourth, or fifth nucleotide of the central region of the oligonucleotide.
24. The antisense oligonucleotide of claim 10, wherein the mutation present in the mutant allele or transcript of PSEN1 or PSEN2 is targeted by the sixth, seventh, eighth, ninth, or tenth nucleotide of the oligonucleotide sequence starting from 5' to 3'.