Engineered constructs to increase transcription of RNA payloads
Expression cassettes with specific promoter and termination sequences enhance the transcription and expression of small RNA payloads, addressing gene therapy challenges by enabling targeted genetic editing and disease treatment.
Patent Information
- Application Number
- JP2025511604
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-05-15
- Filing Date
- 2023-08-23
- Publication Date
- 2025-08-28
AI Technical Summary
Existing technologies lack effective mechanisms to increase or regulate the expression of RNA payloads for gene therapy applications, particularly in addressing diseases caused by gene mutations, deletions, or altered splicing.
The development of expression cassettes comprising specific promoter, payload, and termination sequences, which include sequences with at least 80% identity to provided SEQ IDs, to enhance the transcription and expression of small RNA payloads, such as engineered guide RNAs, within cells.
These expression cassettes enable efficient transcription and expression of small RNA payloads, facilitating targeted editing of genetic sequences, thereby correcting mutations and treating diseases like Parkinson's disease, Charcot-Marie-Tooth disease, and others by forming guide-target RNA scaffolds and recruiting editing enzymes.
Smart Images

Figure 2025528393000001_ABST
Abstract
Description
[Technical Field]
[0001] cross reference This application is a continuation of U.S. Provisional Patent Application No. 63 / 400,583, entitled "ENGINEERED CONSTRUCTS FOR INCREASED TRANSCRIPTION OF RNA PAYLOADS," filed August 24, 2022; U.S. Provisional Patent Application No. 63 / 419,889, entitled "ENGINEERED CONSTRUCTS FOR INCREASED TRANSCRIPTION OF RNA PAYLOADS," filed October 27, 2022; U.S. Provisional Patent Application No. 63 / 453,584, entitled "ENGINEERED CONSTRUCTS FOR INCREASED TRANSCRIPTION OF RNA PAYLOADS," filed March 21, 2023; and U.S. Provisional Patent Application No. 63 / 453,584, entitled "ENGINEERED CONSTRUCTS FOR INCREASED TRANSCRIPTION OF RNA PAYLOADS," filed May 15, 2023. This application claims the benefit of U.S. Provisional Application No. 63 / 466,625, entitled "PAYLOADS," which is incorporated herein by reference in its entirety.
[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in Extensible Markup Language (XML) format, which is incorporated herein by reference in its entirety. The XML copy, created on August 21, 2023, is named "421688-712021_SL.xml" and is 1.29 megabytes in size. [Background technology]
[0003] A wide variety of diseases and disorders are caused by gene mutations, deletions, altered expression, or altered splicing. RNA can serve as a mechanism for gene therapy, such as by editing mutated RNA sequences associated with disease. Expression cassettes are needed to increase or regulate the expression of RNA payloads. Summary of the Invention
[0004] In various aspects, the disclosure provides expression cassettes comprising a promoter sequence comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NO:1263; a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of: a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265; or b) SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269.
[0005] In various aspects, the disclosure provides expression cassettes comprising: a) a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NO:1263; a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence.
[0006] In various aspects, the disclosure provides an expression cassette comprising a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence (the payload sequence comprising a small RNA payload); and a termination sequence comprising a sequence having at least 80% identity to any one of: a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265; or b) SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269.
[0007] In various aspects, the present disclosure provides an expression cassette comprising a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13-17, 167-707, 1241, 1248-1253, or 1259-1263; a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs:60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289.
[0008] In various aspects, the present disclosure provides an expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263; a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence.
[0009] In various aspects, the disclosure provides an expression cassette comprising: a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence (the payload sequence comprises a small RNA payload); and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:708-1240, SEQ ID NO:1242, SEQ ID NO:1243-1247, SEQ ID NO:1254-1257, SEQ ID NO:1264-1272, SEQ ID NO:1275, or SEQ ID NO:1287-1289.
[0010] In some embodiments, the promoter sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263. In some embodiments, the promoter sequence comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263.
[0011] In some embodiments, the termination sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289. In some embodiments, the termination sequence comprises a sequence having at least 95% sequence identity to any one of SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289.
[0012] In some embodiments, the promoter sequence comprises SEQ ID NO: 17. In some embodiments, the promoter sequence comprises SEQ ID NO: 1262. In some embodiments, the promoter sequence comprises SEQ ID NO: 1250. In some embodiments, the promoter sequence comprises SEQ ID NO: 1251. In some embodiments, the promoter sequence comprises SEQ ID NO: 1252. In some embodiments, the promoter sequence comprises SEQ ID NO: 1253.
[0013] In some embodiments, the termination sequence comprises SEQ ID NO: 1264. In some embodiments, the termination sequence comprises SEQ ID NO: 1265. In some embodiments, the termination sequence comprises SEQ ID NO: 1254. In some embodiments, the termination sequence comprises SEQ ID NO: 1255. In some embodiments, the termination sequence comprises SEQ ID NO: 1257. In some embodiments, the termination sequence comprises SEQ ID NO: 60. In some embodiments, the termination sequence comprises SEQ ID NO: 1242. In some embodiments, the termination sequence comprises SEQ ID NO: 1269. In some embodiments, the termination sequence comprises SEQ ID NO: 1017.
[0014] In some embodiments, the small RNA payload comprises an engineered guide RNA that can hybridize with the target sequence. In some embodiments, the engineered guide RNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to the target sequence. In some embodiments, the engineered guide RNA comprises at least one base pair mismatch with the target sequence. In some embodiments, the target sequence comprises an adenosine residue. In some embodiments, the target sequence is an RNA sequence. In some embodiments, the RNA sequence is mRNA or pre-mRNA.
[0015] In some embodiments, the target sequence comprises a G to A mutation relative to the wild-type sequence. In some embodiments, the target sequence comprises a missense or nonsense mutation relative to the wild-type sequence. In some embodiments, the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl-CpG-binding protein 2 (MECP2).
[0016] In some embodiments, the payload sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 1273, SEQ ID NO: 1274, or SEQ ID NO: 61. In some embodiments, the small RNA payload comprises an antisense oligonucleotide, siRNA, shRNA, miRNA, or tracrRNA. In some embodiments, the small RNA payload is 20 to 500 nucleotide residues in length. In some embodiments, the small RNA payload is 60 to 100 residues in length. In some embodiments, the small RNA payload is 80 to 120 residues in length. In some embodiments, the small RNA payload is 100 to 140 residues in length. In some embodiments, the small RNA payload is 130 to 170 residues in length. In some embodiments, the payload sequence further comprises an Sm binding sequence or a hairpin sequence. In some embodiments, the hairpin sequence comprises a U7 hairpin. In some embodiments, the hairpin sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:52 or SEQ ID NO:54, or the Sm binding sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:56 or SEQ ID NO:58.
[0017] In some embodiments, the expression cassette has a length of 1300 or more nucleotide residues and 2160 or less nucleotide residues. In some embodiments, the expression cassette contains at least 80% sequence identity to the U1 sequence or the U7 sequence. In some embodiments, the U1 sequence is a mouse U1 sequence or a human U1 sequence. In some embodiments, the U7 sequence is a mouse U7 sequence or a human U7 sequence.
[0018] In some embodiments, the promoter sequence comprises a zinc finger 143 motif capable of recruiting the ZNF143 transcription factor. In some embodiments, the promoter sequence comprises an OCT-1 transcription factor binding sequence capable of recruiting the OCT-1 transcription factor. In some embodiments, the promoter sequence comprises a proximal sequence element capable of recruiting SNAPc. In some embodiments, the proximal sequence element is capable of integrator-dependent recruitment of RNA polymerase II.
[0019] In some embodiments, the small RNA payload can form a guide-target RNA scaffold comprising a structural feature upon hybridization of the small RNA payload with the target sequence. In some embodiments, the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or a combination thereof. In some embodiments, the structural feature comprises a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the structural feature comprises a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the structural feature comprises a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, the guide-target RNA scaffold comprises a wobble base pair.
[0020] In various aspects, the present disclosure provides recombinant polynucleotides encoding one or more of the expression cassettes described herein.
[0021] In some embodiments, the recombinant polynucleotide encodes two of the expression cassettes described herein, comprising a first promoter, a second promoter, a first termination sequence, and a second termination sequence. In some embodiments, the first promoter and the second promoter are the same. In some embodiments, the first promoter and the second promoter are different. In some embodiments, the first termination sequence and the second termination sequence are the same. In some embodiments, the first termination sequence and the second termination sequence are different. In some embodiments, the first promoter comprises SEQ ID NO: 17. In some embodiments, the second promoter comprises SEQ ID NO: 1262. In some embodiments, the first termination sequence comprises SEQ ID NO: 1264. In some embodiments, the second termination sequence comprises SEQ ID NO: 1265. In some embodiments, (a) the first promoter sequence comprises SEQ ID NO:17, the first termination sequence comprises SEQ ID NO:1264, the second promoter sequence comprises SEQ ID NO:1262, and the second termination sequence comprises SEQ ID NO:1265; or (b) the first promoter sequence comprises SEQ ID NO:17, the first termination sequence comprises SEQ ID NO:1265, the second promoter sequence comprises SEQ ID NO:1262, and the second termination sequence comprises SEQ ID NO:1264.
[0022] In various aspects, the present disclosure provides viral vectors encapsidating an expression cassette described herein or a recombinant polynucleotide described herein.
[0023] In some embodiments, the viral vector comprises two or more, three or more, or four or more expression cassettes described herein. In some embodiments, the viral vector is an adeno-associated viral vector. In some embodiments, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AA V.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof.
[0024] In various aspects, the present disclosure provides pharmaceutical compositions comprising an expression cassette described herein, a recombinant polynucleotide described herein, or a viral vector described herein, and a pharmaceutically acceptable excipient, carrier, diluent, or combination thereof.
[0025] In various aspects, the disclosure provides methods of expressing a small RNA payload in a cell, the method comprising delivering an expression cassette described herein, a recombinant polynucleotide described herein, a viral vector described herein, or a pharmaceutical composition described herein to a cell, and expressing in the cell the small RNA payload encoded by the expression cassette.
[0026] In various aspects, the disclosure provides methods of editing a target sequence, the method comprising delivering an expression cassette described herein, a recombinant polynucleotide described herein, a viral vector described herein, or a pharmaceutical composition described herein to a cell encoding the target sequence, and expressing a small RNA payload in the cell, wherein the small RNA payload comprises an engineered guide RNA capable of hybridizing to the target sequence; upon hybridization of the small RNA payload to the target sequence, forming a guide-target RNA scaffold, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme.
[0027] In various aspects, the disclosure provides methods for editing a target sequence, the methods comprising delivering an expression cassette to a cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of a) SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or 1263, and a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload, and or b) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269); expressing the small RNA payload in a cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme.
[0028] In various aspects, the disclosure provides methods of editing a target sequence, the method comprising: delivering an expression cassette to a cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of a) SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NO:1263; a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence; expressing the small RNA payload in the cell, and upon hybridization of the small RNA payload with the target sequence, forming a guide-target RNA scaffold; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme.
[0029] In various aspects, the disclosure provides methods of editing a target sequence, the method comprising delivering an expression cassette to a cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence, a payload sequence under transcriptional control of the promoter sequence (the payload sequence comprising a small RNA payload), and a termination sequence comprising a sequence having at least 80% identity to any one of a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265, or b) SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269; expressing the small RNA payload in the cell, forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme.
[0030] In various aspects, the disclosure provides methods for editing a target sequence, the method comprising delivering an expression cassette to a cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263, a payload sequence under transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload, and a sequence comprising a sequence selected from the group consisting of SEQ ID NOs: 60, 708-709, 1259-1263, 1264-1265, 1265-1266, 1266-1267, 1268-1269, 1270-1271, 1272-1273, 1274-1275, 1276-1277, 1278-1279, 1280-1281, 1282-1283, 1284-1285, 1286-1287, 1288-1289, 1290-1291, 1292-1293, 1294-1295, 1300-1301, 1302-1303, 1304-1305, 1306-1307, 1308-1310, 1312-1313, 1314-1315, 1316-1317, 1318-1319, 1320-1321, 1322-1323, 1324-1325, 1326-1327, 1328-1329, and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs: 1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289; expressing the small RNA payload in a cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme.
[0031] In various aspects, the disclosure provides methods of editing a target sequence, the method comprising delivering an expression cassette to a cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263, a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload, and a termination sequence; expressing the small RNA payload in the cell, and upon hybridization of the small RNA payload with the target sequence, forming a guide-target RNA scaffold, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme.
[0032] In various aspects, the disclosure provides methods of editing a target sequence, the method comprising delivering an expression cassette to a cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence, a payload sequence under transcriptional control of the promoter sequence (the payload sequence comprising a small RNA payload), and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:708-1240, SEQ ID NO:1242, SEQ ID NO:1243-1247, SEQ ID NO:1254-1257, SEQ ID NO:1264-1272, SEQ ID NO:1275, or SEQ ID NO:1287-1289; expressing the small RNA payload in the cell, forming a guide-target RNA scaffold upon hybridization of the small RNA payload with the target sequence, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme.
[0033] In some embodiments, the promoter sequence comprises SEQ ID NO: 17. In some embodiments, the promoter sequence comprises SEQ ID NO: 1262. In some embodiments, the promoter sequence comprises SEQ ID NO: 1250. In some embodiments, the promoter sequence comprises SEQ ID NO: 1251. In some embodiments, the promoter sequence comprises SEQ ID NO: 1252. In some embodiments, the promoter sequence comprises SEQ ID NO: 1253.
[0034] In some embodiments, the termination sequence comprises SEQ ID NO: 1264. In some embodiments, the termination sequence comprises SEQ ID NO: 1265. In some embodiments, the termination sequence comprises SEQ ID NO: 1254. In some embodiments, the termination sequence comprises SEQ ID NO: 1255. In some embodiments, the termination sequence comprises SEQ ID NO: 1257. In some embodiments, the termination sequence comprises SEQ ID NO: 60. In some embodiments, the termination sequence comprises SEQ ID NO: 1242. In some embodiments, the termination sequence comprises SEQ ID NO: 1269. In some embodiments, the termination sequence comprises SEQ ID NO: 1017.
[0035] In some embodiments, the target sequence comprises a mutation compared to the wild-type sequence. In some embodiments, editing the target sequence corrects the mutation in the target sequence. In some embodiments, the mutation is a missense mutation. In some embodiments, the mutation is a nonsense mutation. In some embodiments, the mutation is a G to A mutation. In some embodiments, the mutation is associated with a disease. In some embodiments, the disease is a synucleinopathy, Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy due to strain on pressure palsies, Ewan-Harrell-Lupski syndrome, tauopathy, Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn's disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha-1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease.
[0036] In some embodiments, the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl-CpG-binding protein 2 (MECP2).
[0037] In some embodiments, editing the target sequence comprises editing an untranslated region of the target. In some embodiments, the untranslated region is a 5' untranslated region or a 3' untranslated region. In some embodiments, the 3' untranslated region is a polyadenylation sequence. In some embodiments, editing the target sequence comprises editing a translation start site.
[0038] In some embodiments, editing the target sequence alters expression of the target sequence. In some embodiments, editing the target sequence increases expression of the target sequence. In some embodiments, editing the target sequence decreases expression of the target sequence.
[0039] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising administering to the subject a composition comprising an expression cassette described herein, a recombinant polynucleotide described herein, a viral vector described herein, or a pharmaceutical composition described herein; delivering the expression cassette to cells of the subject; and expressing a small RNA payload in the cells, thereby treating the disease.
[0040] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising: combining a promoter sequence comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NO:1263; and a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload. 1017, SEQ ID NO: 1264, or SEQ ID NO: 1265, or a) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO: 60, SEQ ID NO: 771, SEQ ID NO: 930, SEQ ID NO: 1007, SEQ ID NO: 1021, SEQ ID NO: 1242, SEQ ID NO: 1254, SEQ ID NO: 1255, SEQ ID NO: 1257, or SEQ ID NO: 1269; delivering the expression cassette to cells of the subject; and expressing the small RNA payload in the cells, thereby treating the disease.
[0041] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette comprising a promoter sequence comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NO:1263, a payload sequence under the transcriptional control of the promoter sequence (the payload sequence comprises a small RNA payload), and a termination sequence; delivering the expression cassette to a cell of the subject; and expressing the small RNA payload in the cell, thereby treating the disease.
[0042] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising administering to the subject a composition comprising an expression cassette comprising a promoter sequence, a payload sequence under the transcriptional control of the promoter sequence (the payload sequence comprising a small RNA payload), and a termination sequence comprising a sequence having at least 80% identity to any one of: a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265; or b) SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269; delivering the expression cassette to cells of the subject; and expressing the small RNA payload in the cells, thereby treating the disease.
[0043] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising administering to the subject a composition comprising an expression cassette comprising a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263, a payload sequence under the transcriptional control of the promoter sequence (the payload sequence comprises a small RNA payload), and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs: 60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289; delivering the expression cassette to a cell of the subject; and expressing the small RNA payload in the cell, thereby treating the disease.
[0044] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette comprising a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263, a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload, and a termination sequence; delivering the expression cassette to a cell of the subject; and expressing the small RNA payload in the cell, thereby treating the disease.
[0045] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising administering to the subject a composition comprising an expression cassette comprising a promoter sequence, a payload sequence under transcriptional control of the promoter sequence (the payload sequence comprising a small RNA payload), and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:708-1240, SEQ ID NO:1242, SEQ ID NO:1243-1247, SEQ ID NO:1254-1257, SEQ ID NO:1264-1272, SEQ ID NO:1275, or SEQ ID NO:1287-1289; delivering the expression cassette to a cell of the subject; and expressing the small RNA payload in the cell, thereby treating the disease.
[0046] In some embodiments, the promoter sequence comprises SEQ ID NO: 17. In some embodiments, the promoter sequence comprises SEQ ID NO: 1262. In some embodiments, the promoter sequence comprises SEQ ID NO: 1250. In some embodiments, the promoter sequence comprises SEQ ID NO: 1251. In some embodiments, the promoter sequence comprises SEQ ID NO: 1252. In some embodiments, the promoter sequence comprises SEQ ID NO: 1253.
[0047] In some embodiments, the termination sequence comprises SEQ ID NO: 1264. In some embodiments, the termination sequence comprises SEQ ID NO: 1265. In some embodiments, the termination sequence comprises SEQ ID NO: 1254. In some embodiments, the termination sequence comprises SEQ ID NO: 1255. In some embodiments, the termination sequence comprises SEQ ID NO: 1257. In some embodiments, the termination sequence comprises SEQ ID NO: 60. In some embodiments, the termination sequence comprises SEQ ID NO: 1242. In some embodiments, the termination sequence comprises SEQ ID NO: 1269. In some embodiments, the termination sequence comprises SEQ ID NO: 1017.
[0048] In some embodiments, the disease is a synucleinopathy, Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy due to strain on pressure palsies, Ewan-Harrell-Lupski syndrome, tauopathy, Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn's disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha-1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease.
[0049] In some embodiments, the small RNA payload comprises an engineered guide RNA that hybridizes to a target sequence, and the cell encodes the target sequence. In some embodiments, the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl-CpG-binding protein 2 (MECP2).
[0050] In some embodiments, the method further includes forming a guide-target RNA scaffold upon hybridization of the engineered guide RNA with the target sequence, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme. In some embodiments, the target sequence includes a mutation compared to a wild-type sequence. In some embodiments, editing the target sequence corrects the mutation in the target sequence. In some embodiments, the mutation is a missense mutation. In some embodiments, the mutation is a nonsense mutation. In some embodiments, the mutation is a G to A mutation. In some embodiments, the mutation is associated with a disease. In some embodiments, editing the target sequence includes editing an untranslated region of the target. In some embodiments, the untranslated region is a 5' untranslated region or a 3' untranslated region. In some embodiments, the 3' untranslated region is a polyadenylation sequence. In some embodiments, editing the target sequence includes editing a translation start site.
[0051] In some embodiments, editing the target sequence alters expression of the target sequence. In some embodiments, editing the target sequence increases expression of the target sequence. In some embodiments, editing the target sequence decreases expression of the target sequence.
[0052] In some embodiments, the guide-target RNA scaffold comprises a structural feature. In some embodiments, the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or a combination thereof. In some embodiments, the structural feature comprises a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the structural feature comprises a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the structural feature comprises a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, the guide-target RNA scaffold comprises a wobble base pair.
[0053] In some embodiments, the editing enzyme comprises an ADAR, an APOBEC, or a Cas nuclease. In some embodiments, the ADAR comprises ADAR1, ADAR2, ADAR3, or a combination thereof. In some embodiments, the target sequence comprises RNA or DNA. In some embodiments, the target sequence is mRNA or pre-mRNA. In some embodiments, editing the target sequence comprises deamidating nucleotides of the target sequence. In some embodiments, the target sequence is edited with an efficiency of at least 10%, at least 20%, or at least 25%.
[0054] In various aspects, the present disclosure provides an expression cassette comprising a promoter sequence comprising a zinc finger 143 motif, an OCT-1 transcription factor binding sequence, a proximal sequence element, a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload, and a transcription termination sequence; wherein the expression cassette comprises one or more sequence elements selected from the group consisting of: a) the zinc finger 143 motif having at least 80% sequence identity to any one of SEQ ID NOs: 24-26; b) an OCT-1 transcription factor binding sequence having at least 80% sequence identity to any one of SEQ ID NOs: 27-30; c) a proximal sequence element having at least 80% sequence identity to any one of SEQ ID NOs: 31-37; and d) combinations thereof.
[0055] In some embodiments, the zinc finger 143 motif comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs:24-26. In some embodiments, the zinc finger 143 motif comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:20. In some embodiments, the OCT-1 transcription factor binding sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs:27-30. In some embodiments, the proximal sequence element comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs:31-37.
[0056] In some embodiments, the transcription termination sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs:40-42. In some embodiments, the transcription termination sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:60, SEQ ID NOs:1242-1247, or SEQ ID NOs:1254-1257. In some embodiments, the transcription termination sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:1242. In some embodiments, the transcription termination sequence comprises the sequence of SEQ ID NO:1242. In some embodiments, the transcription termination sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:60. In some embodiments, the transcription termination sequence comprises the sequence of SEQ ID NO: 60. In some embodiments, the transcription termination sequence comprises the sequence of SEQ ID NO: 38 or SEQ ID NO: 39.
[0057] In various aspects, the present disclosure provides an expression cassette comprising a promoter sequence comprising a proximal sequence element, wherein the promoter sequence comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, and wherein a proximal sequence element of the promoter sequence is replaced with any one of SEQ ID NOs: 67-120, a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload, and a transcription termination sequence comprising a 3' box sequence element; wherein the transcription termination sequence comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 60, 708-1240, 1242-1247, 1254-1257, and wherein a 3' box sequence element of the termination sequence is replaced with any one of SEQ ID NOs: 121-166.
[0058] In some embodiments, the promoter sequence comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, and the proximal sequence element of the promoter sequence is replaced with any one of SEQ ID NOs: 67-120. In some embodiments, the promoter sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, and the proximal sequence element of the promoter sequence is replaced with any one of SEQ ID NOs: 67-120. In some embodiments, the termination sequence comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 60, 708-1240, 1242-1247, 1254-1257, and the 3' box sequence element of the termination sequence is replaced with any one of SEQ ID NOs: 121-166. In some embodiments, the termination sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 60, 708-1240, 1242-1247, 1254-1257, and the 3' box sequence element of the termination sequence is replaced with any one of SEQ ID NOs: 121-166.
[0059] In various aspects, the present disclosure provides an expression cassette comprising: a promoter sequence comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 16-17, 167-707, 1241, 1248-1253; a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a transcription termination sequence comprising a sequence having at least 75% identity to any one of SEQ ID NOs: 60, 708-1240, 1242-1247, 1254-1257.
[0060] In some embodiments, the promoter sequence comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 16-17, 167-707, 1241, 1248-1253. In some embodiments, the promoter sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 16-17, 167-707, 1241, 1248-1253. In some embodiments, the termination sequence comprises a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 60, 708-1240, 1242-1247, 1254-1257. In some embodiments, the termination sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs: 60, 708-1240, 1242-1247, 1254-1257.
[0061] In some embodiments, the promoter sequence is SEQ ID NO: 376. In some embodiments, the promoter sequence is SEQ ID NO: 1250. In some embodiments, the transcription termination sequence is SEQ ID NO: 917. In some embodiments, the transcription termination sequence is SEQ ID NO: 1254. In some embodiments, the promoter sequence is SEQ ID NO: 168. In some embodiments, the promoter sequence is SEQ ID NO: 1251. In some embodiments, the transcription termination sequence is SEQ ID NO: 709. In some embodiments, the transcription termination sequence is SEQ ID NO: 1255. In some embodiments, the promoter sequence is SEQ ID NO: 1241. In some embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60. In some embodiments, the promoter sequence is SEQ ID NO: 17. In some embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60.
[0062] In some embodiments, the small RNA payload comprises an engineered guide RNA capable of hybridizing to a target sequence.
[0063] In some embodiments, the engineered guide RNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to the target sequence. In some embodiments, the engineered guide RNA contains at least one base pair mismatch with the target sequence. In some embodiments, the target sequence contains an adenosine residue. In some embodiments, the target sequence is an RNA sequence. In some embodiments, the RNA sequence is mRNA or pre-mRNA.
[0064] In some embodiments, the target sequence comprises a G to A mutation relative to the wild-type sequence. In some embodiments, the target sequence comprises a missense or nonsense mutation relative to the wild-type sequence. In some embodiments, the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl-CpG-binding protein 2 (MECP2). In some embodiments, the payload sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:1273, SEQ ID NO:1274, or SEQ ID NO:61.
[0065] In some embodiments, the small RNA payload comprises an antisense oligonucleotide, siRNA, shRNA, miRNA, or tracrRNA. In some embodiments, the small RNA payload is 20 to 500 nucleotide residues in length. In some embodiments, the small RNA payload is 60 to 100 residues in length. In some embodiments, the small RNA payload is 80 to 120 residues in length. In some embodiments, the small RNA payload is 100 to 140 residues in length. In some embodiments, the small RNA payload is 130 to 170 residues in length.
[0066] In some embodiments, the payload sequence further comprises an Sm-binding sequence or a hairpin sequence. In some embodiments, the hairpin sequence comprises a U7 hairpin. In some embodiments, the hairpin sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:52, SEQ ID NO:54, SEQ ID NO:56, or SEQ ID NO:58.
[0067] In some embodiments, the expression cassette comprises two or more of the sequence elements. In some embodiments, the expression cassette comprises three or more of the sequence elements. In some embodiments, the expression cassette has a length of 1300 or more nucleotide residues and 2160 or less nucleotide residues. In some embodiments, the expression cassette comprises at least 80% sequence identity to the U1 sequence or the U7 sequence. In some embodiments, the U1 sequence is a mouse U1 sequence or a human U1 sequence. In some embodiments, the U7 sequence is a mouse U7 sequence or a human U7 sequence.
[0068] In some embodiments, the promoter sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs: 13-17, 1241, 1248-1253. In some embodiments, the promoter sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 1241. In some embodiments, the promoter sequence comprises the sequence of SEQ ID NO: 1241. In some embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60. In some embodiments, the promoter sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO: 17. In some embodiments, the promoter sequence comprises the sequence of SEQ ID NO: 17. In some embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60.
[0069] In some embodiments, the expression cassette comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to any one of SEQ ID NOs:1-12 or SEQ ID NO:59. In some embodiments, the zinc finger 143 motif is capable of recruiting ZNF143 transcription factor. In some embodiments, the OCT-1 transcription factor binding sequence is capable of recruiting OCT-1 transcription factor. In some embodiments, the proximal sequence element is capable of recruiting SNAPc. In some embodiments, the proximal sequence element is capable of integrator-dependent recruitment of RNA polymerase II.
[0070] In some embodiments, the small RNA payload can form a guide-target RNA scaffold comprising a structural feature upon hybridization of the small RNA payload with the target sequence. In some embodiments, the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or a combination thereof. In some embodiments, the structural feature comprises a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the structural feature comprises a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the structural feature comprises a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. The guide-target RNA scaffold comprises a wobble base pair.
[0071] In various aspects, the disclosure provides methods of expressing a small RNA payload in a cell, the method comprising delivering an expression cassette described herein to the cell and expressing in the cell the small RNA payload encoded by the expression cassette.
[0072] In various aspects, the disclosure provides methods for editing a target sequence, the method comprising delivering an expression cassette to a cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence comprising a zinc finger 143 motif, an OCT-1 transcription factor binding sequence, and a proximal sequence element, a payload sequence under the transcriptional control of the promoter sequence (the payload sequence comprises a small RNA payload, wherein the small RNA payload comprises an engineered guide RNA sequence capable of hybridizing to the target sequence), and a transcription termination sequence; expressing the small RNA payload in the cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload with the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme.
[0073] In various aspects, the disclosure provides methods for editing a target sequence, the method comprising delivering to a cell an expression cassette encoding the target sequence, wherein the expression cassette comprises a promoter sequence comprising a proximal sequence element, wherein the promoter sequence comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, and wherein the proximal sequence element of the promoter sequence is replaced with any one of SEQ ID NOs: 67-120; a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; The method includes: a transcription termination sequence comprising a 3' box sequence element (the transcription termination sequence comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 60, 708 to 1240, 1242 to 1247, and 1254 to 1257, and wherein the 3' box sequence element of the termination sequence is replaced with any one of SEQ ID NOs: 121 to 166); expressing a small RNA payload in a cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload with the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme.
[0074] In various aspects, the disclosure provides methods for editing a target sequence, the method comprising delivering to a cell an expression cassette encoding the target sequence, the expression cassette comprising: a promoter sequence comprising proximal sequence elements, the promoter sequence comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 16-17, 167-707, 1241, 1248-1253; a payload sequence under transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a 3'-nucleotide sequence encoding a target sequence. a transcription termination sequence comprising a 'box' sequence element (the transcription termination sequence comprising a sequence having at least 75% sequence identity to any one of SEQ ID NO:60, SEQ ID NOs:708 to 1240, SEQ ID NOs:1242 to 1247, and SEQ ID NOs:1254 to 1257); expressing a small RNA payload in a cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme.
[0075] In various embodiments, the promoter sequence is SEQ ID NO: 376. In various embodiments, the promoter sequence is SEQ ID NO: 1250. In various embodiments, the transcription termination sequence is SEQ ID NO: 917. In various embodiments, the transcription termination sequence is SEQ ID NO: 1254. In various embodiments, the promoter sequence is SEQ ID NO: 168. In various embodiments, the promoter sequence is SEQ ID NO: 1251. In various embodiments, the transcription termination sequence is SEQ ID NO: 709. In various embodiments, the transcription termination sequence is SEQ ID NO: 1255. In various embodiments, the promoter sequence is SEQ ID NO: 1241. In various embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60. In various embodiments, the promoter sequence is SEQ ID NO: 17. In various embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60.
[0076] In various aspects, the disclosure provides methods of editing a target sequence, the method comprising delivering an expression cassette described herein to a cell that encodes the target sequence, and expressing a small RNA payload in the cell, wherein the small RNA payload comprises an engineered guide RNA that can hybridize to the target sequence; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; and editing the target sequence with the editing enzyme.
[0077] In some embodiments, the target sequence comprises a mutation compared to the wild-type sequence. In some embodiments, editing the target sequence corrects the mutation in the target sequence. In some embodiments, the mutation is a missense mutation. In some embodiments, the mutation is a nonsense mutation. In some embodiments, the mutation is a G to A mutation. In some embodiments, the mutation is associated with a disease.
[0078] In some embodiments, the disease is a synucleinopathy, Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy due to strain on pressure palsies, Ewan-Harrell-Lupski syndrome, tauopathy, Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn's disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha-1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease. In some embodiments, the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl-CpG-binding protein 2 (MECP2).
[0079] In some embodiments, editing the target sequence comprises editing an untranslated region of the target. In some embodiments, the untranslated region is a 5' untranslated region or a 3' untranslated region. In some embodiments, the 3' untranslated region is a polyadenylation sequence. In some embodiments, editing the target sequence comprises editing a translation start site. In some embodiments, editing the target sequence alters expression of the target sequence. In some embodiments, editing the target sequence increases expression of the target sequence. In some embodiments, editing the target sequence decreases expression of the target sequence.
[0080] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette comprising a promoter sequence comprising a zinc finger 143 motif, an OCT-1 transcription factor binding sequence, and a proximal sequence element, and a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; delivering the expression cassette to a cell of the subject; and expressing the small RNA payload in the cell, thereby treating the disease.
[0081] In various aspects, the disclosure provides a method of treating a disease in a subject, the method comprising: providing a promoter sequence comprising a proximal sequence element, wherein the promoter sequence comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, and wherein the proximal sequence element of the promoter sequence is replaced with any one of SEQ ID NOs: 67-120; a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a 3' administering to a subject a composition comprising an expression cassette comprising a transcription termination sequence comprising a box sequence element (the transcription termination sequence comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 60, 708 to 1240, 1242 to 1247, and 1254 to 1257, wherein the 3' box sequence element of the termination sequence is replaced with any one of SEQ ID NOs: 121 to 166); delivering the expression cassette to a cell of the subject; and expressing a small RNA payload in the cell, thereby treating the disease.
[0082] In various aspects, the disclosure provides methods of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette comprising a promoter sequence comprising a proximal sequence element, wherein the promoter sequence comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 16-17, 167-707, 1241, 1248-1253, a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload, and a transcription termination sequence comprising a 3' box sequence element, wherein the transcription termination sequence comprises a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 60, 708-1240, 1242-1247, 1254-1257;
[0083] In some embodiments, the promoter sequence is SEQ ID NO: 376. In some embodiments, the promoter sequence is SEQ ID NO: 1250. In some embodiments, the transcription termination sequence is SEQ ID NO: 917. In some embodiments, the transcription termination sequence is SEQ ID NO: 1254. In some embodiments, the promoter sequence is SEQ ID NO: 168. In some embodiments, the promoter sequence is SEQ ID NO: 1251. In some embodiments, the transcription termination sequence is SEQ ID NO: 709. In some embodiments, the transcription termination sequence is SEQ ID NO: 1255. In some embodiments, the promoter sequence is SEQ ID NO: 1241. In some embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60. In some embodiments, the promoter sequence is SEQ ID NO: 17. In some embodiments, the transcription termination sequence is SEQ ID NO: 1242 or SEQ ID NO: 60.
[0084] In various aspects, the present disclosure provides methods of treating a disease in a subject, the method comprising administering to the subject a composition comprising an expression cassette described herein, delivering the expression cassette to cells of the subject, and expressing a small RNA payload in the cells, thereby treating the disease.
[0085] In some embodiments, the disease is a synucleinopathy, Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy due to strain on pressure palsies, Ewan-Harrell-Lupski syndrome, tauopathy, Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn's disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha-1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease. In some embodiments, the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl-CpG-binding protein 2 (MECP2). In some embodiments, the small RNA payload comprises an engineered guide RNA that hybridizes to a target sequence, and the cell encodes the target sequence.
[0086] In some embodiments, the method further comprises forming a guide-target RNA scaffold upon hybridization of the engineered guide RNA with the target sequence, recruiting an editing enzyme to the target sequence, and editing the target sequence with the editing enzyme. In some embodiments, the target sequence comprises a mutation compared to a wild-type sequence. In some embodiments, editing the target sequence corrects the mutation in the target sequence. In some embodiments, the mutation is a missense mutation. In some embodiments, the mutation is a nonsense mutation. In some embodiments, the mutation is a G to A mutation. In some embodiments, the mutation is associated with a disease.
[0087] In some embodiments, editing the target sequence comprises editing an untranslated region of the target. In some embodiments, the untranslated region is a 5' untranslated region or a 3' untranslated region. In some embodiments, the 3' untranslated region is a polyadenylation sequence. In some embodiments, editing the target sequence comprises editing a translation start site. In some embodiments, editing the target sequence alters expression of the target sequence. In some embodiments, editing the target sequence increases expression of the target sequence. In some embodiments, editing the target sequence decreases expression of the target sequence.
[0088] In some embodiments, the guide-target RNA scaffold comprises a structural feature. In some embodiments, the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or a combination thereof. In some embodiments, the structural feature comprises a bulge, wherein the bulge is a symmetric bulge. In some embodiments, the structural feature comprises a bulge, wherein the bulge is an asymmetric bulge. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is a symmetric internal loop. In some embodiments, the structural feature comprises an internal loop, wherein the internal loop is an asymmetric internal loop. In some embodiments, the structural feature comprises a hairpin, wherein the hairpin is a recruiting hairpin or a non-recruiting hairpin. In some embodiments, the guide-target RNA scaffold comprises a wobble base pair.
[0089] In some embodiments, the editing enzyme comprises an ADAR, an APOBEC, or a Cas nuclease. In some embodiments, the ADAR comprises ADAR1, ADAR2, ADAR3, or a combination thereof. In some embodiments, the target sequence comprises RNA or DNA. In some embodiments, the target sequence is mRNA or pre-mRNA. In some embodiments, editing the target sequence comprises deamidating nucleotides of the target sequence. In some embodiments, the target sequence is edited with an efficiency of at least 10%, at least 20%, or at least 25%.
[0090] In some embodiments, the expression cassette is delivered to the cell via a viral vector, hi some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector. In some embodiments, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AA V.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof.
[0091] In various aspects, the present disclosure provides viral vectors encapsidating the expression cassettes described herein.
[0092] In some embodiments, the viral vector is an adeno-associated viral vector. In some embodiments, the adeno-associated viral vector is selected from the group consisting of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh43, AAV.Rh74, AAV.v66, AAV.Oligo001, AAV.SCH9, AAV.r3.45, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PhP.eB, AA V.PhP.V1, AAV.PHP.B, AAV.PhB.C1, AAV.PhB.C2, AAV.PhB.C3, AAV.PhB.C6, AAV.cy5, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof.
[0093] In various aspects, the present disclosure provides pharmaceutical compositions comprising an expression cassette described herein, or a viral vector described herein, and a pharmaceutically acceptable excipient, carrier, diluent, or combination thereof. Incorporation by Reference
[0094] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
[0095] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings of which: [Brief explanation of the drawings]
[0096] [Figure 1A] Schematic representation of an exemplary configuration of an engineered guide RNA expression cassette based on the mouse U7 (mU7) promoter. The expression cassette encodes a payload sequence under the transcriptional control of the mU7 promoter. The mU7 promoter contains an SPH element (e.g., a zinc finger 143 motif), an OCT-1 transcription factor binding sequence, and a proximal sequence element (PSE). The payload sequence, beginning with a transcription start site and ending with a termination sequence, contains an engineered guide RNA sequence ("guide") operably linked to an Sm binding sequence (smOPT).
[0097] [Figure 1B] Schematic representation of an exemplary configuration of an engineered guide RNA expression cassette based on the human U7 (hU7) promoter. The expression cassette encodes a payload sequence under the transcriptional control of the hU1 promoter. The hU7 promoter contains an SPH element (e.g., a zinc finger 143 motif), an OCT-1 transcription factor binding sequence, and a proximal sequence element (PSE). The payload sequence, beginning with a transcription start site and ending with a termination sequence, contains an engineered guide RNA sequence ("guide") operably linked to an Sm binding sequence (smOPT).
[0098] [Figure 2A]Schematic diagram of a reporter construct for measuring the expression of engineered guide RNA sequences and the subsequent editing of target RNA sequences. The reporter construct contains a target sequence (e.g., CDS1) that contains an ATG start site that can be edited to ITG by ADAR-catalyzed deamidation and read as GTG. The conversion of ATG to GTG results in increased luciferase (Nanoluc) expression.
[0099] [Figure 2B] 1 shows a bar plot of a luciferase assay demonstrating editing of a reporter construct by an engineered guide RNA construct. The unedited (ATG) construct expresses basal levels of luciferase, resulting in background levels of luciferase activity. The edited (GTG) construct expresses high levels of luciferase, resulting in increased luciferase activity compared to the unedited construct.
[0100] [Figure 3] 3 shows a bar plot of luciferase activity in the presence of unedited (A) or edited (G) reporters of SEQ ID NO: 48 ("fPMP22-cDNA(ATG)"), SEQ ID NO: 49 ("fSNCA-pre(ATG)"), and SEQ ID NO: 50 ("fSNCA-cDNA(ATG)"). For each reporter, the edited constructs expressed higher levels of luciferase compared to the unedited constructs, resulting in increased levels of luciferase activity.
[0101] [Figure 4] This diagram shows a schematic of the workflow for generating and assessing expression of an expression cassette construct. Cells are transfected with a plasmid encoding the engineered guide RNA, and expression of the engineered guide RNA is assessed by luciferase activity. Expression of the engineered guide RNA can be further assessed using mirVANA total RNA isolation, DNase I treatment, ddPCR guide quantification assays, or Sanger editing.
[0102] [Figure 5]A bar plot of a luciferase assay to evaluate the expression of an engineered guide RNA targeting SNCA (SEQ ID NO: 1274) under the control of a mouse U7 promoter containing various OCT-1 transcription factor binding sequences is shown. The original OCT-1 transcription factor binding sequence (SEQ ID NO: 21) in the SNCA-targeting guide RNA expression cassette (SEQ ID NO: 6) was replaced with various OCT-1 transcription factor binding sequences (SEQ ID NO: 27-30), a random sequence (SEQ ID NO: 45), or an overlapping random sequence (SEQ ID NO: 46). A construct encoding only the GFP cassette ("GFP control") was used as a negative control. Higher luciferase activity indicated increased expression of the engineered guide RNA.
[0103] [Figure 6] A bar plot of a luciferase assay to evaluate the expression of an engineered guide RNA targeting SNCA (SEQ ID NO: 1274) under the control of a mouse U7 promoter containing various zinc finger 143 motifs. The original zinc finger 143 motif (SEQ ID NO: 20) in the SNCA-targeting guide RNA expression cassette (SEQ ID NO: 6) was replaced with various zinc finger 143 motifs (SEQ ID NO: 24-SEQ ID NO: 26) or a random sequence (SEQ ID NO: 43). A construct encoding only the GFP cassette ("GFP control") was used as a negative control. Higher luciferase activity indicated increased expression of the engineered guide RNA.
[0104] [Figure 7]A bar plot of luciferase assays was performed to assess the expression of an engineered guide RNA targeting SNCA (SEQ ID NO: 1274) under the control of a mouse U7 promoter containing various proximal sequence elements (PSEs). The original PSE (SEQ ID NO: 22) in the SNCA-targeting guide RNA expression cassette (SEQ ID NO: 6) was replaced with either a mutant PSE from SEQ ID NO: 31 to SEQ ID NO: 37 or a random sequence from SEQ ID NO: 44. A construct encoding only the GFP cassette ("GFP control") was used as a negative control. Higher luciferase activity indicated increased expression of the engineered guide RNA.
[0105] [Figure 8] A bar plot of a luciferase assay to evaluate the expression of an engineered guide RNA targeting SNCA (SEQ ID NO: 1274) under the control of a mouse U7 promoter containing various transcription termination sequences is shown. The original termination sequence (SEQ ID NO: 23) in the SNCA-targeting guide RNA expression cassette (SEQ ID NO: 6) was replaced with either a mutant termination sequence (SEQ ID NO: 40-42) or a random sequence (SEQ ID NO: 47). A construct encoding only the GFP cassette ("GFP control") was used as a negative control. Higher luciferase activity indicated increased expression of the engineered guide RNA.
[0106] [Figure 9A]Figure 1 shows a bar plot of luciferase assays to assess expression of an engineered guide RNA (SEQ ID NO: 1273) targeting PMP22 under the control of a mouse U7 promoter containing various combinations of engineered sequence elements. SEQ ID NO: 2 contained a mutant PSE of SEQ ID NO: 31 compared to SEQ ID NO: 1. SEQ ID NO: 3 contained a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 1. SEQ ID NO: 4 contained a mutant PSE of SEQ ID NO: 31 and a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 1. SEQ ID NO: 5 contained a mutant PSE of SEQ ID NO: 31, a mutant termination sequence of SEQ ID NO: 41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO: 28 compared to SEQ ID NO: 1. Expression was quantified relative to a construct encoding only the GFP cassette ("GFP"). Higher luciferase activity indicated increased guide RNA expression.
[0107] [Figure 9B] Figure 1 shows a bar plot of a luciferase assay to assess the expression of an engineered guide RNA (SEQ ID NO: 1274) targeting SNCA under the control of a mouse U7 promoter containing various combinations of engineered sequence elements. Expression of the guide RNA targeting SNCA was also examined under the control of the human U1 promoter (SEQ ID NO: 13) and the human U7 promoter (SEQ ID NO: 14). SEQ ID NO: 9 contained a mutant PSE of SEQ ID NO: 31 compared to SEQ ID NO: 6. SEQ ID NO: 10 contained a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 6. SEQ ID NO: 11 contained a mutant PSE of SEQ ID NO: 31 and a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 6. SEQ ID NO: 12 contained a mutant PSE of SEQ ID NO: 31, a mutant termination sequence of SEQ ID NO: 41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO: 28 compared to SEQ ID NO: 6. Expression was quantified relative to a construct encoding only the GFP cassette ("GFP"). Higher luciferase activity indicated increased guide RNA expression.
[0108] [Figure 10A]1 shows a bar plot of a guide quantification assay to assess expression of an engineered guide RNA (SEQ ID NO: 1273) targeting PMP22 under the control of a mouse U7 promoter containing various combinations of engineered sequence elements. SEQ ID NO: 2 contained a mutant PSE of SEQ ID NO: 31 compared to SEQ ID NO: 1. SEQ ID NO: 3 contained a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 1. SEQ ID NO: 4 contained a mutant PSE of SEQ ID NO: 31 and a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 1. SEQ ID NO: 5 contained a mutant PSE of SEQ ID NO: 31, a mutant termination sequence of SEQ ID NO: 41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO: 28 compared to SEQ ID NO: 1. Expression was quantified relative to a construct encoding only the GFP cassette ("GFP"). A higher guide to GAPDH ratio indicated increased guide RNA expression.
[0109] [Figure 10B] Figure 1 shows a bar plot of a guide quantification assay to assess expression of an engineered guide RNA (SEQ ID NO: 1274) targeting SNCA under the control of a mouse U7 promoter containing various combinations of engineered sequence elements. Expression of the guide RNA targeting SNCA was also examined under the control of the human U1 promoter (SEQ ID NO: 13) and the human U7 promoter (SEQ ID NO: 14). SEQ ID NO: 9 contained a mutant PSE of SEQ ID NO: 31 compared to SEQ ID NO: 6. SEQ ID NO: 10 contained a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 6. SEQ ID NO: 11 contained a mutant PSE of SEQ ID NO: 31 and a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 6. SEQ ID NO: 12 contained a mutant PSE of SEQ ID NO: 31, a mutant termination sequence of SEQ ID NO: 41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO: 28 compared to SEQ ID NO: 6. Expression was quantified relative to a construct encoding only the GFP cassette ("GFP"). A higher guide to GAPDH ratio indicated increased guide RNA expression.
[0110] [Figure 11A]Figure 1 shows a bar plot of ATG-to-GTG Sanger editing to assess the expression and editing activity of an engineered guide RNA (SEQ ID NO: 1273) targeting PMP22 under the control of a mouse U7 promoter containing various combinations of engineered sequence elements. SEQ ID NO: 2 contained a mutant PSE of SEQ ID NO: 31 compared to SEQ ID NO: 1. SEQ ID NO: 3 contained a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 1. SEQ ID NO: 4 contained a mutant PSE of SEQ ID NO: 31 and a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 1. SEQ ID NO: 5 contained a mutant PSE of SEQ ID NO: 31, a mutant termination sequence of SEQ ID NO: 41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO: 28 compared to SEQ ID NO: 1. A construct encoding only the GFP cassette ("GFP") was used as a negative control. Higher editing rates indicated increased guide RNA expression.
[0111] [Figure 11B] Figure 1 shows a bar plot of Sanger editing of ATG sequences to GTG to assess the expression and editing activity of an engineered guide RNA (SEQ ID NO: 1274) targeting SNCA under the control of a mouse U7 promoter containing various combinations of engineered sequence elements. SEQ ID NO: 9 contained a mutant PSE of SEQ ID NO: 31 compared to SEQ ID NO: 6. SEQ ID NO: 10 contained a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 6. SEQ ID NO: 11 contained a mutant PSE of SEQ ID NO: 31 and a mutant termination sequence of SEQ ID NO: 41 compared to SEQ ID NO: 6. SEQ ID NO: 12 contained a mutant PSE of SEQ ID NO: 31, a mutant termination sequence of SEQ ID NO: 41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO: 28 compared to SEQ ID NO: 6. A construct encoding only the GFP cassette ("GFP") was used as a negative control. Higher editing rates indicated increased guide RNA expression.
[0112] [Figure 12A]Figure 1 shows a bar plot of Sanger editing of residue -3 to assess the expression and editing activity of an engineered guide RNA (SEQ ID NO:1273) targeting PMP22 under the control of a mouse U7 promoter containing various combinations of engineered sequence elements. SEQ ID NO:2 contained a mutant PSE of SEQ ID NO:31 compared to SEQ ID NO:1. SEQ ID NO:3 contained a mutant termination sequence of SEQ ID NO:41 compared to SEQ ID NO:1. SEQ ID NO:4 contained a mutant PSE of SEQ ID NO:31 and a mutant termination sequence of SEQ ID NO:41 compared to SEQ ID NO:1. SEQ ID NO:5 contained a mutant PSE of SEQ ID NO:31, a mutant termination sequence of SEQ ID NO:41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO:28 compared to SEQ ID NO:1. A construct encoding only the GFP cassette ("GFP") was used as a negative control. Higher editing rates indicated increased guide RNA expression.
[0113] [Figure 12B] Figure 1 shows a bar plot of Sanger editing of residue -5 to assess the expression and editing activity of an engineered guide RNA (SEQ ID NO:1274) targeting SNCA under the control of the mouse U7 promoter containing various combinations of engineered sequence elements. SEQ ID NO:9 contained a mutant PSE of SEQ ID NO:31 compared to SEQ ID NO:6. SEQ ID NO:10 contained a mutant termination sequence of SEQ ID NO:41 compared to SEQ ID NO:6. SEQ ID NO:11 contained a mutant PSE of SEQ ID NO:31 and a mutant termination sequence of SEQ ID NO:41 compared to SEQ ID NO:6. SEQ ID NO:12 contained a mutant PSE of SEQ ID NO:31, a mutant termination sequence of SEQ ID NO:41, and a mutant OCT-1 transcription factor binding sequence of SEQ ID NO:28 compared to SEQ ID NO:6. A construct encoding only the GFP cassette ("GFP") was used as a negative control. Higher editing rates indicated increased guide RNA expression.
[0114] [Figure 13A] 10B shows a scatter plot with a linear fit demonstrating the correlation between the results of the guide quantification assay in FIG. 10B and the results of the luciferase assay in FIG. 9B.
[0115] [Figure 13B]11B shows a scatter plot with a linear fit demonstrating the correlation between the results of the Sanger editing assay in FIG. 11B and the results of the luciferase assay in FIG. 9B.
[0116] [Figure 13C] 10B shows a scatter plot with a linear fit demonstrating the correlation between the results of the guide quantification assay in FIG. 10B and the results of the Sanger editing assay in FIG. 11B.
[0117] [Figure 14A] 10A shows a scatter plot with a linear fit demonstrating the correlation between the results of the guide quantification assay in FIG. 10A and the results of the luciferase assay in FIG. 9A.
[0118] [Figure 14B] 12A shows a scatter plot with a linear fit demonstrating the correlation between the results of the Sanger editing assay in FIG. 12A and the results of the luciferase assay in FIG. 9A.
[0119] [Figure 14C] 10A and 11B show scatter plots with linear fits showing the correlation between the results of the guide quantification assay in FIG. 10A and the results of the Sanger editing assay in FIG. 11A.
[0120] [Figure 15-1] A comparison of sequences with a single copy of the promoter variant integrated into the genome of HEK293T cells (left) and copy integration of engineered guide RNAs targeting RAB7A (Figure 15 (continued) top), GAPDH (Figure 15 (continued) middle), and SNCA (Figure 15 (continued) bottom). Figure 15 discloses SEQ ID NO: 1283 and SEQ ID NO: 1284, respectively, in order of appearance. [Figure 15-2] Same as above.
[0121] [Figure 16]
[0014] Figure 16 shows a legend for various exemplary structural features present in the guide-target RNA scaffold formed upon hybridization of a potential guide RNA of the present disclosure with a target RNA. The exemplary structural features shown include an 8 / 7 asymmetric loop (i., 8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (ii., 2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (iii., 1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (iv., 5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24-bp region (v., 24 nucleotides on the target RNA side and 24 nucleotides on the guide RNA side are base-paired), and a 2 / 3 asymmetric bulge (vi., 2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side). Figure 16 discloses SEQ ID NO: 1285 and SEQ ID NO: 1286, respectively, in order of appearance.
[0122] [Figure 17A]1 shows bar graphs quantifying the expression of a guide RNA targeting SNCA (SEQ ID NO: 1274, left) or a guide RNA targeting PMP22 (SEQ ID NO: 1273, right) in ARPE-19 cells. Expression of a guide RNA targeting SNCA (left) in ARPE-19 cells was compared for an expression cassette under the control of a wild-type mouse U7 promoter (SEQ ID NO: 6) or an expression cassette under the control of an engineered mouse U7 promoter (SEQ ID NO: 12). Expression of a guide RNA targeting PMP22 (right) in ARPE-19 cells was compared for an expression cassette under the control of a wild-type mouse U7 promoter (SEQ ID NO: 1) or an expression cassette under the control of an engineered mouse U7 promoter (SEQ ID NO: 5). The engineered expression cassettes of SEQ ID NO: 12 and SEQ ID NO: 5 contained an engineered promoter of SEQ ID NO: 17, which contains an OCT-1 transcription factor binding sequence of SEQ ID NO: 28 and a PSE of SEQ ID NO: 31, and an engineered termination sequence of SEQ ID NO: 60, which contains a termination sequence motif of SEQ ID NO: 41. Expression was quantified relative to a construct encoding only the GFP cassette ("GFP"). A higher ratio of guide to GAPDH indicated increased guide RNA expression.
[0123] [Figure 17B] 1 shows a bar graph quantifying the expression of a guide RNA targeting SERPINA1 (SEQ ID NO: 61) in HepG2 cells. Expression of a guide RNA targeting SERPINA1 in HepG2 cells was compared for an expression cassette under the control of a wild-type mouse U7 promoter (mU7-WT") or an expression cassette under the control of an engineered mouse U7 promoter (SEQ ID NO: 59). The engineered expression cassette of SEQ ID NO: 59 contained an engineered promoter of SEQ ID NO: 16, containing a PSE of SEQ ID NO: 31, and an engineered termination sequence of SEQ ID NO: 60, containing a termination sequence motif of SEQ ID NO: 41. Expression was quantified relative to a construct encoding only the GFP cassette ("GFP"). A higher ratio of guide to GAPDH indicated increased guide RNA expression.
[0124] [Figure 18]Figure 1 shows an exemplary novel promoter of the present disclosure that was tested on antisense oligonucleotides for clinically relevant Duchenne muscular dystrophy (DMD) exon skipping in differentiated muscle cells. Engineered guide RNA expression constructs were randomly integrated into the genome and evaluated after 10 days of muscle cell differentiation.
[0125] [Figure 19A] 1 shows exemplary combinations of promoters, promoter variants, 3' box termination sequences, and truncated 3' box termination sequences of the present disclosure to drive guide RNA expression.
[0126] [Figure 19B] 1 shows exemplary combinations of promoters, promoter variants, 3' box termination sequences, and truncated 3' box termination sequences of the present disclosure to drive guide RNA expression.
[0127] [Figure 20A] 1 shows a bar graph quantifying expression of a guide RNA targeting PMP22 in HEK293 cells using a luciferase reporter (reporter 1). Expression of a guide RNA targeting PMP22 in HEK293 cells using engineered guide RNA constructs targeting PMP22, including the engineered promoter elements contained in SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:5, had a higher fold expression compared to the control mU7 wild-type guide RNA construct (SEQ ID NO:1).
[0128] [Figure 20B] 1 shows a bar graph quantifying expression of guide RNAs targeting SNCA by a luciferase reporter (Reporter 2) in HEK293 cells. Expression of Reporter 2 guide RNA in HEK293 cells with engineered guide RNA constructs targeting SNCA containing engineered promoter elements contained in SEQ ID NO:9, SEQ ID NO:10, and SEQ ID NO:12 had higher fold expression compared to the control mU7 wild-type guide RNA construct (SEQ ID NO:6).
[0129] [Figure 21A] The left panel shows a bar graph quantifying expression of a guide RNA targeting PMP22 in HEK293T cells via a luciferase reporter (Reporter 1). Expression of Reporter 1 guide RNA in HEK293T cells with an engineered guide RNA construct targeting PMP22 containing the engineered promoter element contained in SEQ ID NO:5 had a higher fold expression compared to the control mU7 wild-type guide RNA construct (SEQ ID NO:1), as well as increased expression when compared to a control PMP22-targeting guide RNA under the control of the wild-type human U1 promoter (SEQ ID NO:13). Expression of a negative control was also quantified with a construct encoding only the GFP cassette ("GFP Ctrl"). The right panel of Figure 21A shows a bar graph quantifying expression of a guide RNA targeting SNCA in HEK293T cells via a luciferase reporter (Reporter 2). Expression of reporter 2 guide RNA in HEK293T cells with an engineered guide RNA construct targeting SNCA containing the engineered promoter element contained in SEQ ID NO: 12 had a higher fold expression compared to the control mU7 wild-type guide RNA construct (SEQ ID NO: 6). Expression of a negative control was also quantified with a construct encoding only the GFP cassette ("GFP Ctrl").
[0130] [Figure 21B]The left panel shows a bar graph quantifying the expression of a guide RNA targeting PMP22 in HEK293T cells using a luciferase reporter (reporter 1). Expression of reporter 1 guide RNA in HEK293T cells using an engineered PMP22-targeting guide RNA under the control of an engineered hU1 promoter (SEQ ID NO: 1241) had a higher fold expression than the control PMP22-targeting guide RNA under the control of the wild-type human U1 promoter (SEQ ID NO: 13). Expression of a negative control was also quantified using a construct encoding only the GFP cassette ("GFP"). The right panel of Figure 21B shows a bar graph quantifying the expression of a guide RNA targeting SNCA in HEK293T cells using a luciferase reporter (reporter 2). Expression of reporter 2 guide RNA in HEK293T cells with an engineered SNCA-targeting guide RNA under the control of an engineered hU1 promoter (SEQ ID NO: 1241) had a higher fold expression compared to the control hU1 wild-type guide RNA construct (SEQ ID NO: 7). Expression of a negative control was also quantified with a construct encoding only the GFP cassette ("GFP").
[0131] [Figure 22A] Figure 1 shows a bar graph quantifying SNCA guide RNA expression for constructs containing promoter sequences containing the full-length WT mU7 promoter sequence (SEQ ID NO: 15), a variant of the WT mU7 promoter sequence with a 100-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1248), an engineered mU7 promoter sequence (SEQ ID NO: 17), or a variant of the engineered mU7 promoter sequence with a 100-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1249). Guide RNA expression was quantified by ddPCR and normalized to a housekeeping gene (GAPDH). A higher ratio of guide RNA expression to GAPDH expression (gRNA / GAPDH) indicated increased guide RNA expression.
[0132] [Figure 22B]
[0039] Figure 1 shows a bar graph quantifying PMP22 guide RNA expression for expression cassette constructs containing promoter sequences including the full-length WT mU7 promoter sequence (SEQ ID NO: 15), a variant of the WT mU7 promoter sequence with a 100-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1248), an engineered mU7 promoter sequence (SEQ ID NO: 17), or a variant of the engineered mU7 promoter sequence with a 100-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1249). Guide RNA expression was quantified by ddPCR and normalized to the housekeeping gene (GAPDH). A higher ratio of guide RNA expression to GAPDH expression (gRNA / GAPDH) indicated increased guide RNA expression.
[0133] [Figure 23] 1 shows a bar graph quantifying Rab7a editing in expression cassette constructs comprising promoter sequences including the full-length WTmU7 promoter sequence (SEQ ID NO: 15), a variant of the WTmU7 promoter sequence with a 50-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1258), a variant of the WTmU7 promoter sequence with a 75-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1259), a variant of the WTmU7 promoter sequence with a 100-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1248), a variant of the WTmU7 promoter sequence with a 126-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1260), and a variant of the WTmU7 promoter sequence with a 135-base deletion between the DSE and PSE promoter elements (SEQ ID NO: 1261).
[0134] [Figure 24]A bar graph quantifies GFP expression from an expression construct containing the herpesvirus saimiri U-RNA element (HSUR). The HSUR element was extracted from NCBI NC_001350 and integrated downstream of a gRNA cassette containing the RNU5B1 promoter (SEQ ID NO: 1250) and a GFP gRNA targeting the GFP-G67R reporter, where deamination of the AGA codon to GGA correlates with recovery of fluorescence. The expression construct was introduced as a single copy using Bxbl integrase and enriched for 14 days with puromycin. GFP expression was quantified by flow cytometry using the geometric mean fluorescence intensity (GFP gMFI). Cells were gated for mCherry fluorescence upstream, allowing graphing of only cells positive for the cassette. GFP expression was quantified for an expression construct containing the termination sequence SEQ ID NO: 1266-SEQ ID NO: 1272 and compared to GFP expression from an expression construct containing the termination sequence SEQ ID NO: 1254.
[0135] [Figure 25A] Figure 1 shows a bar graph quantifying GFP guide RNA expression for expression cassette constructs containing the promoter sequence of SEQ ID NO: 17 and the termination sequence of SEQ ID NO: 60 (SEQ ID NO: 17 / SEQ ID NO: 60), the promoter sequence of SEQ ID NO: 15 and the termination sequence of SEQ ID NO: 1243 (SEQ ID NO: 15 / SEQ ID NO: 1243), the promoter sequence of SEQ ID NO: 1250 and the termination sequence of SEQ ID NO: 1254 (SEQ ID NO: 1250 / SEQ ID NO: 1254), the promoter sequence of SEQ ID NO: 1252 and the termination sequence of SEQ ID NO: 1256 (SEQ ID NO: 1252 / SEQ ID NO: 1256), the promoter sequence of SEQ ID NO: 1251 and the termination sequence of SEQ ID NO: 1255 (SEQ ID NO: 1251 / SEQ ID NO: 1255), or the promoter sequence of SEQ ID NO: 1253 and the termination sequence of SEQ ID NO: 1257 (SEQ ID NO: 1253 / SEQ ID NO: 1257). Guide RNA expression was quantified by ddPCR and normalized to the housekeeping gene (GAPDH). A higher ratio of guide RNA expression to GAPDH expression (gRNA / GAPDH) indicated increased guide RNA expression.
[0136] [Figure 25B]1 shows a bar graph quantifying SNCA guide RNA expression for expression cassette constructs containing the promoter sequence of SEQ ID NO:17 and the termination sequence of SEQ ID NO:60 (SEQ ID NO:17 / SEQ ID NO:60), the promoter sequence of SEQ ID NO:15 and the termination sequence of SEQ ID NO:1243 (SEQ ID NO:15 / SEQ ID NO:1243), the promoter sequence of SEQ ID NO:1250 and the termination sequence of SEQ ID NO:1254 (SEQ ID NO:1250 / SEQ ID NO:1254), the promoter sequence of SEQ ID NO:1252 and the termination sequence of SEQ ID NO:1256 (SEQ ID NO:1252 / SEQ ID NO:1256), the promoter sequence of SEQ ID NO:1251 and the termination sequence of SEQ ID NO:1255 (SEQ ID NO:1251 / SEQ ID NO:1255), or the promoter sequence of SEQ ID NO:1253 and the termination sequence of SEQ ID NO:1257 (SEQ ID NO:1253 / SEQ ID NO:1257). Guide RNA expression was quantified by ddPCR and normalized to the housekeeping gene (GAPDH). A high ratio of guide RNA expression to GAPDH expression (gRNA / GAPDH) indicated increased guide RNA expression.
[0137] [Figure 26] A schematic diagram of the flow-seq pipeline for screening promoter or termination sequences is shown. Screening begins with a pool of HEK293 cells containing a single attp1 sequence. The next intermediate cell line contains two cassettes: one containing the GFP-G67R ORF, which is non-fluorescent but carries BFP for enrichment. The second cassette contains blasticidin resistance and Bxbl integrase. The promoter or termination sequence library is cloned into a plasmid containing mCherry and puromycin resistance. The pooled promoter or termination sequence plasmid preparation can be transfected into intermediate cells, which can be enriched for integration by puromycin resistance using mCherry as an enrichment marker.
[0138] [Figure 27]Results from the flowseq analysis described in Figure 26 are shown with points representing the normalized performance of each termination sequence pooled from each of the three promoter sequences. Data points indicated by arrows indicate superior termination sequences that were taken forward for single copy evaluation, including SEQ ID NO: 1254 and SEQ ID NO: 1255, which showed similar expression compared to the WT mU7 termination sequence (SEQ ID NO: 1243).
[0139] [Figure 28] 27 shows a bar graph quantifying GFP expression by expression constructs containing termination sequences identified in the flowseq evaluation as described in Figure 27. GFP expression was quantified by geometric mean fluorescence intensity (geometric MFI) by flow cytometry. GFP expression was quantified for expression cassettes containing termination sequences of SEQ ID NO:712, SEQ ID NO:868, SEQ ID NO:1021, SEQ ID NO:930, SEQ ID NO:1017, SEQ ID NO:1254, SEQ ID NO:771, SEQ ID NO:906, SEQ ID NO:1007, and SEQ ID NO:1002, and compared to the engineered mU7 termination sequence of SEQ ID NO:60. DETAILED DESCRIPTION OF THE INVENTION
[0140] The present disclosure provides expression cassettes for expressing RNA payloads. The expression cassettes described herein may be engineered to increase expression of the encoded RNA payload sequence. In some embodiments, specific elements of the expression cassette, such as an enhancer sequence, a core promoter sequence, or a transcription termination sequence, may be engineered to enhance payload expression. These sequence elements may be engineered from various endogenous promoters, such as the U1, U6, or U7 promoter, to increase payload expression. Individual sequence elements of the expression cassette may be engineered to enhance expression of the encoded RNA payload.
[0141] Promoter and termination sequences The expression cassette of the present disclosure may include a promoter sequence, an RNA payload coding sequence, and a termination sequence. The promoter may recruit transcription factors, polymerases (e.g., RNA polymerase II or RNA polymerase III), or other transcriptional machinery to promote transcription of the RNA payload. For example, the expression cassette may promote transcription of a guide RNA for RNA editing, a guide RNA for DNA editing, a tracrRNA, an siRNA, an shRNA, or an miRNA, or an antisense oligonucleotide. In some embodiments, the promoter may be engineered to increase expression of an RNA payload under the transcriptional control of the promoter. The termination sequence may enhance transcription termination and promote transcription turnover, increasing transcription of the payload. In some embodiments, the termination sequence may be engineered to enhance expression of the RNA payload. Sequence elements within the promoter or termination sequence (e.g., transcription factor binding sequences, transcription initiation sequences, termination sequences, or combinations thereof) may be engineered to enhance payload expression. Sequence elements may be interchangeable with sequence elements from endogenous RNA promoters, such as U1, U6, or U7 promoters.
[0142] An expression cassette may be engineered from an endogenous sequence. For example, an expression cassette may be engineered from an endogenous U1, U2, U3, U4, U5, U6, or U7 sequence. The endogenous sequence may be derived from any organism, including human, mouse, or other mammals. In some embodiments, an expression cassette may include a promoter engineered from an endogenous promoter, such as an endogenous U1, U2, U3, U4, U5, U6, or U7 promoter. In some embodiments, an expression cassette may include a transcription termination sequence engineered from an endogenous transcription termination sequence, such as an endogenous U1, U2, U3, U4, U5, U6, or U7 transcription termination sequence.
[0143] The present disclosure provides regulatory elements that are useful for enhancing optimal expression of small RNA payloads, such as engineered guide RNAs. Regulatory elements can refer to several different regions in the native human genome, but as disclosed herein, large-format assays have been screened to identify combinations of regulatory elements that provide enhanced guide RNA expression. The expression cassettes of the present disclosure include both a regulatory element and a payload. For example, an expression cassette may include a regulatory element that includes a portion of a promoter region from the native human genome or the native mouse genome. In some embodiments, an expression cassette may include a regulatory element that includes a herpesvirus saimiri U-RNA (HSUR) element. In some embodiments, an expression cassette may include a regulatory element that includes a mutated version of a native human genome promoter region or a mutated version of a native mouse genome promoter region. In some embodiments, the vectors of the present disclosure provide two expression cassettes, one with a native promoter region and one with a mutated promoter region. The expression cassettes of the present disclosure are engineered so that the promoter region is located 5' or upstream of the therapeutic payload (e.g., a small RNA sequence, such as an engineered guide RNA).
[0144] Furthermore, the regulatory element may comprise a portion of the native human genome termination region, the native mouse genome termination sequence, or the herpesvirus Saimiri U-RNA (HSUR) termination sequence. The regulatory element may also comprise a portion of a mutated human genome termination region or a mutated mouse genome termination sequence. In some embodiments, the vectors of the present disclosure provide two expression cassettes, one with a native termination region and one with a mutated termination region. The expression cassettes of the present disclosure are engineered so that the termination region is located 3', or downstream, of the therapeutic payload.
[0145] The promoter region of the present disclosure can be broken down into multiple elements, including a distal sequence element (DSE) and a proximal sequence element (PSE) (5' to 3'). These different elements can play different roles in the rate and efficiency of transcription of downstream payloads. In some embodiments, the PSE is part of the core promoter region. The PSE may be bound by the snRNA-activating protein complex (SNAPc). SNAPc is a transcription factor important for transcription initiation and may facilitate the binding or recruitment of additional transcription factors (e.g., TBP, TFIIA, TFIIB, TFIIE, and TFIIF). In some embodiments, the DSE is part of an enhancer region. The DSE may bind to transcription factors and factors that help stabilize the transcription machinery on the PSE. In some embodiments, the DSE includes an SPH element that recruits STAF transcription factors (e.g., ZNF143 transcription factor). STAF transcription factors (e.g., ZNF143 transcription factors) are zinc finger proteins that contain an activation domain that can activate RNA polymerase promoters (e.g., mRNA-type RNA polymerase II promoters, type 3 RNA polymerase III promoters, and RNA polymerase II snRNA promoters). SPH elements may also contain a ZNF143 motif that can recruit zinc finger 143 (ZNF143) transcription factors. In some embodiments, the DSE comprises an OCT-1 element containing an octameric sequence that recruits the OCT-1 transcription factor. The rate and efficiency of transcription of downstream payloads can be improved by modifying either one of the DSE and PSE regions or other portions of the promoter region, or by selecting different DSE and PSE regions in combination. The distance between the DSE and PSE can be varied. In some embodiments, the distance between the DSE and PSE is shortened compared to the native promoter sequence. In some embodiments, the distance between the DSE and PSE is lengthened compared to the native promoter sequence. In some embodiments, the present disclosure provides promoters derived from the native human genome that are adapted for use in heterologous systems where transcription of a therapeutic payload is desired.In some embodiments, the present disclosure provides promoters with modifications in their DSEs relative to the native human or mouse genomic DSEs that are part of the promoter's enhancer region. Regions of the DSE that are important for operation include an SPH element (recruiting the transcription factor STAF) and an OCT-1 transcription factor (TF) binding sequence. In some embodiments, the SPH element includes a zinc finger 143 (ZNF143) motif (recruiting zinc fingers). In some embodiments, the SPH element is a ZNF143 element (e.g., a zinc finger 143 (ZNF143) motif (recruiting zinc fingers)). These SPH regions (e.g., ZNF143 motifs) and OCT-1 TF binding regions may also be referred to as regulators. Promoter sequences disclosed herein with optimal elements within the DSE can result in enhanced transcription of downstream small RNA payloads. In some embodiments, promoter sequences of the present disclosure have within them one or more regions corresponding to an SPH element (eg, a ZNF143 motif) and an OCT-1 TF binding sequence.
[0146] Array elements Engineering an expression cassette may include incorporating engineered sequence elements into an expression construct or replacing engineered sequence elements. In some embodiments, elements present in the DSE or PSE within a promoter may be incorporated with or replaced by engineered elements. In some embodiments, sequence elements present in a termination sequence may be incorporated with or replaced by engineered elements. For example, an endogenous transcription factor binding sequence present in a DSE (e.g., an endogenous SPH element such as a ZNF143-binding sequence, an endogenous OCT-1-binding sequence, or an endogenous GABP-binding sequence) may be replaced with an engineered transcription factor binding sequence (e.g., an engineered SPH element such as a ZNF143-binding sequence, an engineered OCT-1-binding sequence, or an engineered GABP-binding sequence). Alternatively, or in addition, an endogenous core promoter sequence element (e.g., an endogenous proximal sequence element or an endogenous TATA box) may be replaced with an engineered core promoter sequence (e.g., an engineered proximal sequence element or an engineered TATA box). Alternatively, or in addition, an endogenous termination sequence element (e.g., an endogenous 3' box sequence element) may be replaced with an engineered termination sequence element (e.g., an engineered 3' box sequence element). Examples of engineered sequence elements that may be inserted into or replaced in an expression cassette are shown in Table 1. [Table 1]
[0147] In some embodiments, the expression cassette may comprise one or more of the engineered sequence elements presented in Table 1. For example, the expression cassette may comprise a DSE comprising an engineered SPH element (ZNF143 element) containing a zinc finger 143 motif of any of SEQ ID NOs: 24-26 that binds to ZNF143 transcription factor, a DSE comprising an engineered OCT-1 transcription factor binding site of any of SEQ ID NOs: 27-30 that binds to OCT-1 transcription factor, an engineered proximal sequence element (PSE) of any of SEQ ID NOs: 31-37 that recruits SNAPc and phosphorylated RNA polymerase II transcription machinery, an engineered transcription termination sequence element (e.g., a 3' box sequence element) of any of SEQ ID NOs: 38-42 that promotes termination of transcription, or a combination thereof.
[0148] An engineered SPH element containing a zinc finger 143 motif may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to any of SEQ ID NOs: 24 through 26. In some embodiments, an SPH element containing an engineered zinc finger 143 motif may replace an endogenous SPH element containing the zinc finger 143 motif of SEQ ID NO: 20.
[0149] The engineered OCT-1 transcription factor binding site may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to any of SEQ ID NOs: 27 through 30. In some embodiments, the engineered OCT-1 transcription factor binding site may replace the endogenous OCT-1 transcription factor binding site of SEQ ID NO: 21 in the distal sequence element (DSE).
[0150] Additional exemplary PSE sequences of the present disclosure are shown in Table 2. [Table 2-1] [Table 2-2]
[0151] The PSE may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to any of SEQ ID NOs:31-37 or SEQ ID NOs:67-120. In some embodiments, the PSE may replace the endogenous PSE of SEQ ID NO:22. In some embodiments, the PSE that may be included in an engineered promoter sequence may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to any of SEQ ID NOs:67-120. In some embodiments, the promoter sequence may comprise a PSE sequence of SEQ ID NO:31-37 or SEQ ID NO:67-120. In some embodiments, the PSE is selected from SEQ ID NOs:31-37 or SEQ ID NOs:67-120. The PSE may be selected from or engineered from a PSE of an endogenous gene. For example, the PSE may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to a PSE from a gene selected from U1, U2, U4, U5, U6, U7, U3, SNORD13, SNORD118, RPPH1, TRNAU1, 7SK, RNY3, or RNY4. In some embodiments, an engineered promoter may comprise a PSE (e.g., any of SEQ ID NOs:31-37 or SEQ ID NOs:67-120). In some embodiments, the engineered promoter may include a PSE (eg, any of SEQ ID NOs:31-37 or SEQ ID NOs:67-120) in place of the PSE of SEQ ID NO:22.
[0152] In some embodiments, an engineered promoter may include overlapping sequence elements (e.g., overlapping transcription factor binding sites) to enhance payload expression. For example, an engineered promoter may include a DSE containing two or more SPH elements containing a zinc finger 143 motif (e.g., SEQ ID NO:20 or two or more of SEQ ID NOs:24-26, or a combination thereof). In another example, an engineered promoter may include a DSE containing two or more OCT-1 transcription factor binding sites (e.g., SEQ ID NO:21 or two or more of SEQ ID NOs:27-30, or a combination thereof). In another example, an engineered promoter may include two or more proximal sequence elements (PSEs) (e.g., SEQ ID NO:22, two or more of SEQ ID NOs:31-37, SEQ ID NO:67-120, or a combination thereof). The overlapping sequences may be separated by a spacer sequence.
[0153] In some embodiments, an engineered promoter may include multiple promoter elements (e.g., an SPH element containing a zinc finger 143 motif, an OCT-1 transcription factor binding site, or a proximal sequence element). In some embodiments, an engineered promoter may include one or more SPH elements containing an engineered zinc finger 143 motif of any of SEQ ID NOs: 24-26 that bind to the ZNF143 transcription factor, one or more engineered OCT-1 transcription factor binding sites of any of SEQ ID NOs: 27-30 that bind to the OCT-1 transcription factor, or one or more engineered proximal sequence elements (PSEs) of any of SEQ ID NOs: 31-37, SEQ ID NOs: 67-120. An engineered promoter may also include an endogenous SPH element containing a zinc finger 143 motif of SEQ ID NO: 20, an endogenous OCT-1 transcription factor binding site of SEQ ID NO: 21, or an endogenous proximal sequence element (PSE) of SEQ ID NO: 22.
[0154] The engineered transcription termination sequence may comprise a 3' box sequence element. The 3' box element may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to any of SEQ ID NOs: 40 through 42. In some embodiments, the 3' box sequence element is GTTYN. 0-3 In some embodiments, the 3' box element may comprise the sequence AARRYAGA (SEQ ID NO: 38), wherein each N is independently A, T, C, or G, each R is independently A or G, and each Y is independently C or T. In some embodiments, the 3' box element is GTTTN 1-4 It may comprise the sequence AANARNAGA (SEQ ID NO:39), where each N is independently A, T, C, or G, and each R is independently A or G. In some embodiments, the engineered transcription termination sequence may replace the endogenous 3' box sequence element of SEQ ID NO:23.
[0155] Additional exemplary 3' box sequence elements that may be included in the engineered termination sequences of the present disclosure are shown in Table 3. [Table 3-1] [Table 3-2]
[0156] The engineered 3' box sequence element may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to any of SEQ ID NOs:40-42 or 121-166. In some embodiments, the engineered transcription termination sequence may replace the endogenous 3' box sequence element of SEQ ID NO:23. In some embodiments, the 3' box sequence element that may be included in the engineered promoter sequence may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to any of SEQ ID NOs:121-166. In some embodiments, the termination sequence comprises a 3' box sequence element sequence of SEQ ID NO:40-42 or SEQ ID NO:121-166. In some embodiments, the 3' box sequence element is selected from SEQ ID NO:40-42 or SEQ ID NO:121-166. The 3' box sequence element may be selected or engineered from a 3' box sequence element of an endogenous gene. For example, the 3' box sequence element may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 93%, at least about 95%, at least about 97%, or about 100% sequence identity to a 3' box sequence element from a U1, U2, U4, U5, U6, U7, U3, SNORD13, SNORD118, RPPH1, TRNAU1, 7SK, RNY3, or RNY4 gene. In some embodiments, the engineered termination sequence may include a 3' box sequence element (eg, any of SEQ ID NOs: 40-42 or 121-166).In some embodiments, the engineered termination sequence may include a 3' box sequence element (e.g., any of SEQ ID NOs:40-42 or 121-166) in place of the 3' box sequence element of SEQ ID NO:23. promoter
[0157] The expression cassette may include a promoter. The promoter may be an endogenous promoter. The promoter may be an engineered promoter that is engineered to increase expression of the RNA payload sequence under the transcriptional control of the promoter. Endogenous promoters (e.g., SEQ ID NOs: 13-15), engineered promoters (e.g., examples of SEQ ID NOs: 16, 17, 1241, 1248, 1249, 1252, 1253, and 1258-1261), and additional promoters (e.g., SEQ ID NOs: 1250, 1251, 1262, and 1263) are provided in Table 4. [Table 4-1] [Table 4-2] [Table 4-3]
[0158] In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NOs: 13-17, 1241, 1248-1253, or 1259-1263. In some embodiments, the promoter engineered for enhanced expression of an RNA payload may be a mutant version of a promoter (e.g., a mutant version of any one of SEQ ID NOs: 13-15, 1250, 1251, 1262, and 1263). In some embodiments, the engineered promoter may comprise a variant of any of SEQ ID NOs:13-15, SEQ ID NO:1250, SEQ ID NO:1251, SEQ ID NO:1262, and SEQ ID NO:1263 having at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NOs:13-15, SEQ ID NO:1250, SEQ ID NO:1251, SEQ ID NO:1262, and SEQ ID NO:1263, as well as at least one nucleotide substitution relative to any of SEQ ID NOs:13-15, SEQ ID NO:1250, SEQ ID NO:1251, SEQ ID NO:1262, and SEQ ID NO:1263.
[0159] In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:13. In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:15. In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:17. In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1241.In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1250. In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1251. In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1252. In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1253.In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1262. In some embodiments, a promoter for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1263.
[0160] The engineered promoter may enhance expression of an RNA payload under the control of the engineered promoter compared to an endogenous promoter (e.g., an endogenous U1 promoter, an endogenous U6 promoter, or an endogenous U7 promoter). In some embodiments, the engineered promoter (e.g., a promoter comprising any one of SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:1241, SEQ ID NO:1248, SEQ ID NO:1249, SEQ ID NO:1249, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NOs:1258-1261) may increase expression of an RNA payload by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, or at least about 50% compared to an endogenous promoter (e.g., an endogenous U1 promoter, an endogenous U6 promoter, or an endogenous U7 promoter). In some embodiments, an engineered promoter (e.g., a promoter comprising any one of SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 1241, SEQ ID NO: 1248, SEQ ID NO: 1249, SEQ ID NO: 1252, SEQ ID NO: 1253, and SEQ ID NOs: 1258 to 1261) inhibits expression of an RNA payload by about 5% to about 50%, about 10% to about 50%, or about 15% to about 50%, compared to an endogenous promoter (e.g., an endogenous U1 promoter, an endogenous U6 promoter, or an endogenous U7 promoter). It may be increased by about 15% to about 50%, about 20% to about 50%, about 25% to about 50%, about 30% to about 50%, about 35% to about 50%, about 40% to about 50%, about 45% to about 50%, about 5% to about 40%, about 10% to about 40%, about 15% to about 40%, about 20% to about 40%, about 25% to about 40%, about 30% to about 40%, about 35% to about 40%, about 5% to about 30%, about 10% to about 30%, about 15% to about 30%, about 20% to about 30%, about 5% to about 30%, about 10% to about 20%, or about 15% to about 20%.
[0161] In some embodiments, the promoter sequence may enhance transcription of the RNA payload. The promoter sequence may be located upstream of the payload sequence. Additional exemplary promoter sequences of the present disclosure are provided in Table 5.
Table 5-1
Table 5-2
Table 5-3
Table 5-4
Table 5-5
Table 5-6
Table 5-7
Table 5-8
Table 5-9
Table 5-10
Table 5-11
Table 5-12
Table 5-13
Table 5-14
Table 5-15
Table 5-16
Table 5-17
Table 5-18
Table 5-19
Table 5-20
Table 5-21
Table 5-22
Table 5-23
Table 5-24
Table 5-25
Table 5-26
Table 5-27
Table 5-28
Table 5-29
Table 5-30
Table 5-31
Table 5-32
Table 5-33
Table 5-34
Table 5-35
Table 5-36
Table 5-37
Table 5-38
Table 5-39
Table 5-40
Table 5-41
Table 5-42
Table 5-43
Table 5-44
Table 5-45
Table 5-46
Table 5-47
Table 5-48
Table 5-49
Table 5-50
Table 5-51
Table 5-52
Table 5-53
Table 5-54
Table 5-55
Table 5-56
Table 5-57
Table 5-58
Table 5-59
Table 5-60
Table 5-61
Table 5-62
Table 5-63
Table 5-64
Table 5-65
Table 5-66
Table 5-67
Table 5-68
Table 5-69
Table 5-70
Table 5-71
Table 5-72
Table 5-73
Table 5-74
Table 5-75
Table 5-76
Table 5-77
Table 5-78
Table 5-79
Table 5-80
Table 5-81
Table 5-82
Table 5-83
Table 5-84
Table 5-85
Table 5-86
Table 5-87
Table 5-88
Table 5-89
Table 5-90
Table 5-91
[0162] In some embodiments, the promoter sequence may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263. In some embodiments, the promoter sequence comprises the sequence of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263. In some aspects, the promoter sequence is selected from SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263. In some embodiments, a PSE of a promoter sequence of any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263 is replaced with a PSE of any of SEQ ID NOs: 31-37 or 67-120. In some embodiments, a PSE of any of SEQ ID NOs: 31-37 or 67-120 is inserted or substituted into a promoter sequence of any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263.In some embodiments, the PSE sequence is extracted from any of SEQ ID NOs: 13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263 and inserted into a different promoter (e.g., any of SEQ ID NOs: 13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263). In some embodiments, the PSE of any of the promoters of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263 is replaced with a PSE extracted from a different promoter (e.g., any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263).
[0163] Promoters of the present disclosure may have nucleotide insertions or deletions on either side of the promoter. Nucleotide bases may be inserted or deleted between the promoter and the 5' ITR or between the promoter and the payload. In some embodiments, promoter sequences of the present disclosure (e.g., any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263) may be truncated by 1-2, 1-3, 1-5, 1-10, or 1-20 nucleotide bases from the 5' end, the 3' end, or both the 5' and 3' ends. In some embodiments, a promoter (e.g., any of SEQ ID NOs: 13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263) may be truncated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides from the 5' end, the 3' end, or both the 5' and 3' ends. In some embodiments, 1 to 2, 1 to 3, 1 to 5, 1 to 10, or 1 to 20 nucleotide bases may be added to the 5' end, the 3' end, or both the 5' and 3' ends of a promoter sequence of the present disclosure (e.g., any of SEQ ID NOs: 13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263). In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be added to the 5' end, 3' end, or both the 5' end and 3' end of a promoter (e.g., any of SEQ ID NOs: 13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263). The nucleotides added to the 5' end or 3' end of the promoter may be selected from any nucleotide (e.g., A, T, C, or G).For example, SEQ ID NO: 1250 comprises a truncation of 18 nucleotide bases at the 5' end of SEQ ID NO: 376. In another example, SEQ ID NO: 1251 comprises a truncation of 2 nucleotide bases at the 5' end and an addition of 2 nucleotide bases to the 3' end of SEQ ID NO: 168.
[0164] A promoter (e.g., any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263) may have additional nucleotides added to the 5' end to extend the expression cassette. In some embodiments, a promoter (e.g., any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263) may have additional nucleotides added to the 5' end to extend the promoter to a full length of 200, 300, 400, or 500 nucleotides. For example, SEQ ID NO: 1262 is an extended version of SEQ ID NO: 1250 with an additional 118 nucleotides added to the 5' end to extend it to a full length of 400 nucleotides. For example, SEQ ID NO: 1263 is an extended version of SEQ ID NO: 1251 with an additional 100 nucleotides added to the 5' end to extend the total length to 400 nucleotides.
[0165] Termination sequence The expression cassette may include a termination sequence (also called a terminator). The termination sequence may be an endogenous termination sequence. The termination sequence may be an engineered termination sequence engineered to increase expression of the RNA payload. Examples of endogenous termination sequences (e.g., SEQ ID NO: 1243), engineered termination sequences (e.g., SEQ ID NO: 60, SEQ ID NO: 1242, SEQ ID NO: 1256, SEQ ID NO: 1257, SEQ ID NO: 1275, or SEQ ID NOs: 1287-1289), and additional termination sequences (e.g., SEQ ID NO: 771, SEQ ID NO: 930, SEQ ID NO: 1002, SEQ ID NO: 1007, SEQ ID NO: 1017, SEQ ID NO: 1021, SEQ ID NOs: 1244-1247, SEQ ID NO: 1254, SEQ ID NO: 1255, or SEQ ID NOs: 1264-1272) are provided in Table 6. [Table 6-1] [Table 6-2] [Table 6-3]
[0166] In some embodiments, the expression cassette comprises an engineered termination sequence (e.g., SEQ ID NO: 60, SEQ ID NO: 1242, SEQ ID NO: 1256, SEQ ID NO: 1257, SEQ ID NO: 1275, or SEQ ID NOs: 1287-1289). The engineered termination sequence may enhance expression of a payload (e.g., a small RNA payload) encoded by the expression cassette. In some embodiments, the engineered termination sequence may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:60, SEQ ID NO:1242, SEQ ID NO:1256, SEQ ID NO:1257, SEQ ID NO:1275, or SEQ ID NOs:1287-1289.
[0167] In some embodiments, the expression cassette comprises a termination sequence that may enhance expression of a payload (e.g., a small RNA payload) encoded by the expression cassette. In some embodiments, the termination sequence may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1002, SEQ ID NO:1007, SEQ ID NO:1017, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NOs:1243-1247, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1256, SEQ ID NO:1257, SEQ ID NOs:1264-1272, SEQ ID NO:1275, or SEQ ID NOs:1287-1289.
[0168] In some embodiments, the 3' box sequence element that may be included in the engineered termination sequence may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:40-42, or SEQ ID NO:121-166. In some embodiments, the termination sequence comprises the sequence of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1002, SEQ ID NO:1007, SEQ ID NO:1017, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NOs:1243-1247, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1256, SEQ ID NO:1257, SEQ ID NOs:1264-1272, SEQ ID NO:1275, or SEQ ID NOs:1287-1289. In some embodiments, the termination sequence is selected from SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1002, SEQ ID NO:1007, SEQ ID NO:1017, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1243-1247, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1256, SEQ ID NO:1257, SEQ ID NOs:1264-1272, SEQ ID NO:1275, or SEQ ID NOs:1287-1289.
[0169] In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:60. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:771. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:930. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1002.In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1007. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1017. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1021. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1242.In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1254. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1255. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1257. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1264.In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1265. In some embodiments, a termination sequence for enhancing expression of an RNA payload may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO:1269.
[0170] In some embodiments, a termination sequence, also called a terminator, may enhance transcription of the RNA payload. The termination sequence may be located downstream of the payload sequence. Additional exemplary termination sequences of the present disclosure are shown in Table 7. [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4] [Table 7-5] [Table 7-6] [Table 7-7]
Table 7-8
Table 7-9
Table 7-10
Table 7-11
Table 7-12
Table 7-13
Table 7-14
Table 7-15
Table 7-16
Table 7-17
Table 7-18
Table 7-19
Table 7-20
Table 7-21
Table 7-22
Table 7-23
Table 7-24
Table 7-25
Table 7-26
Table 7-27
Table 7-28
Table 7-29
Table 7-30
Table 7-31
Table 7-32
Table 7-33
Table 7-34
Table 7-35
Table 7-36
Table 7-37
Table 7-38
Table 7-39
[0171] In some embodiments, the termination sequence may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NOs: 60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289. In some embodiments, the termination sequence comprises the sequence of SEQ ID NO: 60, SEQ ID NO: 708 to SEQ ID NO: 1240, SEQ ID NO: 1242, SEQ ID NO: 1243 to SEQ ID NO: 1247, SEQ ID NO: 1254 to SEQ ID NO: 1257, SEQ ID NO: 1264 to SEQ ID NO: 1272, SEQ ID NO: 1275, or SEQ ID NO: 1287 to SEQ ID NO: 1289. In some embodiments, the termination sequence is selected from SEQ ID NO: 60, SEQ ID NO: 708 to SEQ ID NO: 1240, SEQ ID NO: 1242, SEQ ID NO: 1243 to SEQ ID NO: 1247, SEQ ID NO: 1254 to SEQ ID NO: 1257, SEQ ID NO: 1264 to SEQ ID NO: 1272, SEQ ID NO: 1275, or SEQ ID NO: 1287 to SEQ ID NO: 1289. In some embodiments, the 3' box sequence element of any of the termination sequences of SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289 is replaced with a 3' box sequence element of any of SEQ ID NO:40 to SEQ ID NO:42 or SEQ ID NO:121 to SEQ ID NO:166.In some embodiments, the 3' box sequence element of any of SEQ ID NOs:40-42 or 121-166 is inserted into or substituted for the termination sequence of any of SEQ ID NOs:60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289. In some embodiments, a 3' box sequence element extracted from any of SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289 is inserted into a different termination sequence (e.g., any of SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289). In some embodiments, the 3' box sequence element of any of the termination sequences set forth in SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289 is replaced with a 3' box sequence element extracted from a different termination sequence (e.g., SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289), or is replaced with a 3' box sequence element of any of SEQ ID NO:40 to SEQ ID NO:42 or SEQ ID NO:121 to SEQ ID NO:166.
[0172] Termination sequences of the present disclosure may have nucleotide insertions or deletions on either side of the termination sequence. Nucleotide bases may be inserted or deleted at the 3' end of the termination sequence to extend the length of the cassette. In some embodiments, termination sequences of the present disclosure (e.g., SEQ ID NOs: 60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289) may be truncated by 1-2, 1-3, 1-5, 1-10, or 1-20 nucleotide bases from the 5' end, the 3' end, or both the 5' and 3' ends. In some embodiments, the termination sequence (e.g., SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289) may be truncated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides from the 5' end, the 3' end, or both the 5' and 3' ends. In some embodiments, 1 to 2, 1 to 3, 1 to 5, 1 to 10, or 1 to 20 nucleotide bases may be added to the 5' end, 3' end, or both the 5' end and the 3' end of a termination sequence (e.g., SEQ ID NO: 60, SEQ ID NOs: 708 to 1240, SEQ ID NO: 1242, SEQ ID NOs: 1243 to 1247, SEQ ID NOs: 1254 to 1257, SEQ ID NOs: 1264 to 1272, SEQ ID NO: 1275, or SEQ ID NOs: 1287 to 1289). In some embodiments, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides may be added to the 5' end, the 3' end, or both the 5' end and the 3' end of a termination sequence (e.g., SEQ ID NO:60, SEQ ID NO:708 to SEQ ID NO:1240, SEQ ID NO:1242, SEQ ID NO:1243 to SEQ ID NO:1247, SEQ ID NO:1254 to SEQ ID NO:1257, SEQ ID NO:1264 to SEQ ID NO:1272, SEQ ID NO:1275, or SEQ ID NO:1287 to SEQ ID NO:1289).Nucleotides added to the 5' or 3' end of the termination sequence may be selected from any nucleotide (e.g., A, T, C, or G). For example, SEQ ID NO: 1254 contains a deletion of one nucleotide base at the 5' end and two nucleotide bases at the 3' end of SEQ ID NO: 917. In another example, SEQ ID NO: 1255 contains a deletion of one nucleotide base at the 5' end and an addition of one nucleotide base at the 3' end of SEQ ID NO: 709. For example, SEQ ID NO: 1287 contains a deletion of two nucleotide bases at the 5' end of SEQ ID NO: 60. For example, SEQ ID NO: 1288 contains a deletion of four nucleotide bases at the 5' end of SEQ ID NO: 60. For example, SEQ ID NO: 1289 contains a deletion of six nucleotide bases at the 5' end of SEQ ID NO: 60.
[0173] Termination sequences (e.g., SEQ ID NO:60, SEQ ID NO:708-1240, SEQ ID NO:1242, SEQ ID NO:1243-1247, SEQ ID NO:1254-1257, SEQ ID NO:1264-1272, SEQ ID NO:1275, or SEQ ID NO:1287-1289) may have nucleotide additions at the 3' end to extend the length of the expression cassette. In some embodiments, termination sequences (e.g., any of SEQ ID NO:60, SEQ ID NO:708-1240, SEQ ID NO:1242, SEQ ID NO:1243-1247, SEQ ID NO:1254-1257, SEQ ID NO:1264-1272, SEQ ID NO:1275, or SEQ ID NO:1287-1289) may have additional nucleotides added to the 3' end to extend the termination sequence to a full length of 100, 150, 200, or 300 nucleotides. For example, SEQ ID NO: 1264 is an extended version of SEQ ID NO: 1002 with an additional 100 nucleotides added to the 3' end to extend it to a total length of 200 nucleotides. For example, SEQ ID NO: 1265 is an extended version of SEQ ID NO: 1071 with an additional 100 nucleotides added to the 3' end to extend it to a total length of 200 nucleotides.
[0174] Small non-coding RNAs (snRNAs) undergo post-transcriptional cap conversion, in which a monomethylguanosine (MMG) cap is converted to a trimethylguanosine (TMG) cap by the TGSI enzyme. Efficient cap conversion is important for the formation of mature snRNAs and their subsequent transport to the nucleus by snurportin 1. A double purine (adenine or guanine) sequence on the 5' end of the guide RNA may aid in efficient cap conversion. The present disclosure provides expression cassettes in which the expressed gRNA has two additional bases at the 5' end, both of which are purines (adenine or guanine). Thus, in some embodiments, the present disclosure provides expression cassettes having gRNAs that start with AA, GG, GA, or AG. For example, an SNCA guide RNA (SEQ ID NO: 1290) may have an additional G at the 5' end, resulting in the SNCA guide RNA sequence of SEQ ID NO: 1274, which contains a GA at the 5' end.
[0175] Pairing of promoter and termination sequences The expression cassette of the present disclosure may include a promoter sequence (e.g., any one of SEQ ID NOs: 13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263), a payload sequence under the transcriptional control of the promoter sequence, and a termination sequence (e.g., any one of SEQ ID NOs: 60, 708 to 1240, 1242, 1243 to 1247, 1254 to 1257, 1264 to 1272, 1275, or 1287 to 1289).
[0176] In some embodiments, the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NO:1263; a payload sequence under transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of: a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265, or b) SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269. In some embodiments, the expression cassette comprises: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO:17, SEQ ID NO:1250, or SEQ ID NO:1262; b) SEQ ID NO:13 or SEQ ID NO:15; or c) SEQ ID NO:1241, SEQ ID NO:1251, SEQ ID NO:1252, SEQ ID NO:1253, or SEQ ID NO:1263; a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence. In some embodiments, the expression cassette comprises a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of: a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265; or b) SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269.
[0177] In some embodiments, the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13-17, 167-707, 1241, 1248-1253, or 1259-1263, a payload sequence under the transcriptional control of the promoter sequence comprising a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs:60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289. In some embodiments, the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263, a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload, and a termination sequence. In some embodiments, the expression cassette comprises a promoter sequence, a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload, and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs: 60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289.
[0178] In embodiments, the expression cassette comprises: (i) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1264; (ii) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1265; (iii) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1254; (iv) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1255; (v) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1257; (vi) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 60; (vii) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1242; (viii) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1264; (ix) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1265; (x) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1254; (xi) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1255; (xii) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1257; (xiii); the promoter sequence of sequence number 1262 and the termination sequence of sequence number 60; (xiv) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1242; (xv) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1264; (xvi) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1265; (xvii) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1254; (xviii) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1255; (xix) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1257; (xx) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 60; (xxi) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1242; (xxii) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1264; (xxiii) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1265; (xxiv) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1254; (xxv) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1255; (xxvi) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1257; (xxvii) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 60; (xxviii) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1242; (xxix) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 1264; (xxx) promoter sequence of SEQ ID NO: 1252 and termination sequence of SEQ ID NO: 1265; (xxxi) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 1254; (xxxii) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 1255; (xxxiii) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 1257; (xxxiv) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 60; (xxxv) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 1242; (xxxvi) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 1264; (xxxvii) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 1265; (xxxviii) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 1254; (xxxix) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 1255; (xl) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 1257; (xli) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 60; (xlii) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 1242; (xliii) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1269; (xliv) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1269; (xlv) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1269; (xlvi) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1269; (xlvii) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 1269; (xlviii) a promoter sequence of SEQ ID NO: 1253 and a termination sequence of SEQ ID NO: 1269; (xlix) a promoter sequence of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1017; (l) a promoter sequence of SEQ ID NO: 1262 and a termination sequence of SEQ ID NO: 1017; (li) a promoter sequence of SEQ ID NO: 1250 and a termination sequence of SEQ ID NO: 1017; (lii) a promoter sequence of SEQ ID NO: 1251 and a termination sequence of SEQ ID NO: 1017; (liii) a promoter sequence of SEQ ID NO: 1252 and a termination sequence of SEQ ID NO: 1017; or (liv) comprising the promoter of SEQ ID NO: 1253 and the termination sequence of SEQ ID NO: 1017.
[0179] Additional promoter / termination sequence pairing In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 17 and the termination sequence of SEQ ID NO: 1264. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 1262 and the termination sequence of SEQ ID NO: 1265. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 1250 and the termination sequence of SEQ ID NO: 1254. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 1251 and the termination sequence of SEQ ID NO: 1255. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 1252 and the termination sequence of SEQ ID NO: 1255. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 1253 and the termination sequence of SEQ ID NO: 1255. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 17 and the termination sequence of SEQ ID NO: 60. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 17 and the termination sequence of SEQ ID NO: 1242. In embodiments, the expression cassette comprises the promoter of SEQ ID NO: 1262 and the termination sequence of SEQ ID NO: 1269. In embodiments, the expression cassette comprises a promoter of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1265. In embodiments, the expression cassette comprises a promoter of SEQ ID NO: 17 and a termination sequence of SEQ ID NO: 1017.
[0180] payload The expression cassettes of the present disclosure may encode an RNA payload under the transcriptional control of a promoter (e.g., an engineered promoter). In some embodiments, the RNA payload may encode a small RNA payload such as a guide sequence (e.g., for RNA or DNA editing), a tracrRNA, an siRNA, an shRNA, or an miRNA, an antisense oligonucleotide (e.g., for expression knockdown), a structural element (e.g., an RNA hairpin), or a combination thereof. Provided herein are engineered RNA payloads and polynucleotides encoding them, as well as compositions comprising the engineered RNA payloads or polynucleotides. As used herein, the term "engineered," with reference to an RNA payload or a polynucleotide encoding it, refers to a non-naturally occurring RNA or polynucleotide encoding it. For example, the present disclosure provides an engineered polynucleotide encoding an engineered guide RNA. In some embodiments, the engineered guide comprises RNA. In some aspects, the engineered guide comprises DNA. In some examples, the engineered guide comprises modified RNA bases or unmodified RNA bases. In some embodiments, the engineered guide comprises modified DNA bases or unmodified DNA bases. In some examples, the engineered guide comprises both DNA and RNA bases.
[0181] Guide RNA payloads for RNA editing For site-specific, selective editing of a target RNA via an RNA editing entity or a biologically active fragment thereof, the expression cassettes described herein may be used to enhance expression of an engineered guide RNA and an engineered polynucleotide encoding the same. The engineered guide RNAs of the present disclosure can comprise a cryptic structure such that when the engineered guide RNA hybridizes with a target RNA to form a guide-target RNA scaffold, at least a portion of the cryptic structure is manifested as at least a portion of the structural feature as described herein.
[0182] The engineered guide RNA as described herein may comprise a targeting domain that is complementary to the target RNA described herein. Thus, the guide RNA can be engineered to site-specifically / selectively target and hybridize with a specific target RNA, facilitating the editing of a specific nucleotide in the target RNA via an RNA editing entity or a biologically active fragment thereof. The targeting domain may comprise a nucleotide that, when the guide RNA hybridizes with the target RNA, faces the base that is edited by the RNA editing entity or a biologically active fragment thereof, and is positioned so that it does not base-pair with the edited base or does not completely base-pair with the edited base. This mismatch can help restrict the editing of the RNA editing entity to the desired base in the target RNA. However, sometimes, in addition to the desired editing, some off-target editing may occur, and in some cases, significant off-target editing may occur.
[0183] Hybridization of the target RNA with the targeting domain of the guide RNA may generate specific secondary structures in the guide-target RNA scaffold that emerge upon hybridization, referred to herein as "cryptic structures." When present, cryptic structures may be structural features described herein, including mismatches, bulges, internal loops, and hairpins. Without wishing to be bound by theory, the presence of structural features described herein that emerge upon hybridization of the guide RNA with the target RNA configures the guide RNA to promote specific or selective targeted editing of the target RNA via an RNA editing entity or a biologically active fragment thereof. Furthermore, structural features in combination with the mismatches described above generally promote increased editing of target residues (e.g., adenosine residues), decreased off-target editing, or both, compared to constructs containing only mismatches or constructs with perfect complementarity to the target RNA. Thus, rationally designing cryptic structures in the engineered guide RNAs of the present disclosure to generate specific structural features in the guide-target RNA scaffold can be a powerful means of promoting target RNA editing with high specificity, selectivity, and robust activity.
[0184] In some examples, the engineered guides provided herein include engineered guides that can be configured, upon hybridization with a target RNA molecule, to at least partially form a guide-target RNA scaffold with at least a portion of the target RNA molecule, wherein the guide-target RNA scaffold comprises at least one structural feature, and wherein the guide-target RNA scaffold recruits an RNA editing entity and facilitates chemical modification of nucleotide bases in the target RNA molecule by the RNA editing entity.
[0185] In some examples, the target RNA of the engineered guide RNA of the present disclosure can be pre-mRNA or mRNA. In some embodiments, the engineered guide RNA of the present disclosure hybridizes with the sequence of the target RNA. In some embodiments, a portion of the engineered guide RNA (e.g., the targeting domain) hybridizes with the sequence of the target RNA. The portion of the engineered guide RNA that hybridizes with the target RNA is sufficiently complementary to the sequence of the target RNA for hybridization to occur.
[0186] Targeting domain. The engineered guide RNA disclosed herein can be engineered in any manner suitable for RNA editing. In some examples, the engineered guide RNA generally comprises at least a targeting sequence that allows it to hybridize with a region of a target RNA molecule. The targeting sequence can also be referred to as "targeting domain" or "targeting region".
[0187] As used herein, the term "targeting sequence" can be used interchangeably with "targeting domain" or "targeting region" and refers to a polynucleotide sequence within an engineered guide RNA sequence that is at least partially complementary to a target polynucleotide. A target polynucleotide (e.g., a target RNA or a target DNA) may be a region of a polynucleotide of interest, such as a gene or messenger RNA. As used herein, a "complementary" sequence refers to a sequence that is a reverse complement compared to a second sequence.
[0188] The targeting sequence of the engineered guide RNA allows the engineered guide RNA to hybridize with a target polynucleotide (e.g., a target RNA) through base pairing, such as Watson-Crick base pairing. The targeting sequence can be located at either the N-terminus or C-terminus of the engineered guide RNA, or both, or the targeting sequence can be internal to the engineered guide RNA. The targeting sequence can be of any length sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 16 14, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or up to about 200 nucleotides in length.In embodiments, the engineered polynucleotides are about 25-200, 50-150, 75-100, 80-110, 90-120, 95-115, 60-200, 60-180, 60-160, 60-140, 70-200, 70-180, 70-160, 70-140, 80-200, 80-190, 80-170, 80-160 0, 80-150, 80-140, 80-130, 80-120, 90-200, 90-190, 90-180, 90-170, 90-160, 90-150, 90-140, 90-130, 90-120, 100-200, 100-190, 100-180, 100-170, 100-160, 100-150, 100-140, 1 00-130, 100-120, 110-200, 110-190, 110-180, 110-170, 110-160, 110-150, 110-140, 110-120, 120-200, 120-190, 120-180, 120-170, 120-160, 120-150, 120-140, 130-200, 130-19 and a targeting sequence that is 0, 130-180, 130-170, 130-160, 130-150, 140-200, 140-190, 140-180, 140-170, 140-160, 150-200, 150-190, 150-180, 150-170, 160-200, 160-190, or 160-180 nucleotides.
[0189] The targeting sequence comprises at least partial sequence complementarity to the target polynucleotide. The targeting sequence may have a degree of sequence complementarity to the target polynucleotide sufficient to hybridize with the target polynucleotide. In some cases, the targeting sequence comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target polynucleotide. In some cases, the targeting sequence comprises less than 100% complementarity to the target polynucleotide sequence. For example, the targeting sequence may have a single base mismatch with the target polynucleotide when bound to the target polynucleotide. In other cases, the targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 20, 30, 40, or up to about 50 base mismatches with the target polynucleotide when bound to the target polynucleotide. In some embodiments, the nucleotide mismatch can be associated with the structural features provided herein. In some embodiments, a targeting sequence comprises at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or up to about 15 nucleotides that differ in complementarity from the wild-type polynucleotide of the subject target polynucleotide.
[0190] A targeting sequence comprises nucleotide residues having complementarity to a target polynucleotide. A targeting sequence may have a number of residues that are complementary to a target polynucleotide sufficient to hybridize with the target polynucleotide. The complementary residues may be contiguous or non-contiguous. In some cases, a targeting sequence comprises at least 50 nucleotides having complementarity to a target polynucleotide. In some cases, a targeting sequence comprises 50-150 nucleotides having complementarity to a target polynucleotide. In some cases, a targeting sequence comprises 50-200 nucleotides having complementarity to a target polynucleotide. In some cases, a targeting sequence comprises 50-250 nucleotides having complementarity to a target polynucleotide. In some cases, a targeting sequence comprises 50-300 nucleotides having complementarity to a target polynucleotide.In some cases, the targeting sequence has complementarity to a target polynucleotide. 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172 , 173, 174, 175, 176, 177, 178, 179, 180, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, or 300 nucleotides.In some cases, the targeting sequence comprises more than 50 total nucleotides and has at least 50 nucleotides that are complementary to the target polynucleotide. In some cases, the targeting sequence comprises between 50 and 400 total nucleotides and has between 50 and 150 nucleotides that are complementary to the target polynucleotide. In some cases, the targeting sequence comprises between 50 and 400 total nucleotides and has between 50 and 200 nucleotides that are complementary to the target polynucleotide. In some cases, the targeting sequence comprises between 50 and 400 total nucleotides and has between 50 and 250 nucleotides that are complementary to the target polynucleotide. In some cases, the targeting sequence comprises between 50 and 400 total nucleotides and has between 50 and 300 nucleotides that are complementary to the target polynucleotide. In some cases, the at least 50 nucleotides that are complementary to the target polynucleotide are separated by one or more mismatches, one or more bulges, one or more loops, one or more hairpins, or any combination thereof. In some cases, 50-150 nucleotides complementary to the target polynucleotide are separated by one or more mismatches, one or more bulges, one or more loops, or any combination thereof. In some cases, 50-200 nucleotides complementary to the target polynucleotide are separated by one or more mismatches, one or more bulges, one or more loops, or any combination thereof. In some cases, 50-250 nucleotides complementary to the target polynucleotide are separated by one or more mismatches, one or more bulges, one or more loops, or any combination thereof. In some cases, 50-300 nucleotides complementary to the target polynucleotide are separated by one or more mismatches, one or more bulges, one or more loops, or any combination thereof. For example, the targeting sequence may comprise a total of 54 nucleotides, where, contiguous, 25 nucleotides are complementary to the target polynucleotide, 4 nucleotides form a bulge, and 25 nucleotides are complementary to the target polynucleotide.As another example, the targeting sequence comprises a total of 118 nucleotides, contiguous with 25 nucleotides complementary to the target polynucleotide, 4 nucleotides forming a bulge, 25 nucleotides complementary to the target polynucleotide, 14 nucleotides forming a loop, and 50 nucleotides complementary to the target polynucleotide.
[0191] In some cases, the targeting domain comprises 95%, 96%, 97%, 98%, 99%, or 100% sequence complementarity to the target RNA. In some cases, the targeting sequence comprises less than 100% complementarity to the target RNA sequence. For example, the targeting sequence and the region of the target RNA that can be bound by the targeting sequence can have a single base mismatch.
[0192] The targeting sequence can have sufficient complementarity to the target RNA to allow hybridization of the targeting sequence to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 50 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 60 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 70 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 80 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 90 nucleotides or more to the target RNA. In some embodiments, the targeting sequence has a minimum antisense complementarity of about 100 nucleotides or more to the target RNA. In some embodiments, antisense complementarity refers to a non-contiguous section of sequence. In some embodiments, antisense complementarity refers to a continuous section of sequence.
[0193] In some embodiments, hybridization of the targeting sequence with the target RNA to form the guide-target RNA scaffold may reveal potential structural features. For example, the potential structural features may include symmetric bulges, asymmetric bulges, symmetric internal loops, asymmetric internal loops, or combinations thereof. In some embodiments, the potential structural features may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 unpaired nucleotides on the target RNA side. In some embodiments, the potential structural features may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 unpaired nucleotides on the guide RNA side.
[0194] In some embodiments, engineered guide RNAs for RNA editing may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to SEQ ID NO: 1273, SEQ ID NO: 1274, SEQ ID NO: 61, or SEQ ID NO: 1290. For example, an engineered guide RNA of SEQ ID NO: 1273 may be used to target PMP22. In another example, an engineered guide RNA of SEQ ID NO: 1274 may be used to target SNCA. In another example, an engineered guide RNA of SEQ ID NO: 1290 may be used to target SNCA. In another example, an engineered guide RNA of SEQ ID NO: 61 may be used to target SERPINA1. Examples of engineered guide RNAs are shown in Table 8. [Table 8]
[0195] Engineered guide RNAs with recruitment domains. In some examples, the subject engineered guide RNAs include a recruitment domain that recruits an RNA editing entity (e.g., an ADAR), where in some cases, the recruitment domain is formed and exists in the absence of binding to the target RNA. A "recruitment domain" may also be referred to herein as a "recruitment sequence" or "recruitment region." In some examples, the subject engineered guides can facilitate editing of nucleotide bases in a target sequence of a target RNA, which ultimately regulates the expression of a polypeptide encoded by the target RNA. In some cases, the regulation can increase or decrease the expression of the polypeptide. In some cases, the engineered guides can be configured to promote editing of nucleotides in a region of an RNA or polynucleotide bases by an RNA editing entity (e.g., an ADAR or an APOBEC). To promote editing, the engineered polynucleotides of the present disclosure can recruit an RNA editing entity (e.g., an ADAR or an APOBEC). Various RNA editing entity recruitment domains can be utilized. In some examples, the recruitment domain includes: ionotropic glutamate receptor AMPA-type subunit 2 (GluR2), an Alu sequence, or, if recruiting an APOBEC, an APOBEC recruitment domain.
[0196] In some examples, two or more recruitment domains can be included in the engineered guide of the present disclosure. In examples where a recruitment domain is present, the recruitment domain can be used to position the RNA editing entity to effectively react with the subject target RNA after the targeting sequence hybridizes with the target sequence of the target RNA. In some examples, the recruitment domain can allow the RNA editing entity to bind transiently to the engineered guide. In some examples, the recruitment domain can allow the RNA editing entity to bind persistently to the engineered guide. The recruitment domain can be of any length. In some cases, the recruitment domain can be from about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75 nucleotides up to about 80 nucleotides in length. In some cases, the recruitment domain can be about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 80 nucleotides in length or less. In some cases, the recruitment domain can be about 45 nucleotides in length. In some cases, at least a portion of the recruitment domain comprises at least 1 to about 75 nucleotides. In some cases, at least a portion of the recruitment domain comprises about 45 nucleotides to about 60 nucleotides.
[0197] In some aspects, the recruitment domain comprises a GluR2 sequence or a functional fragment thereof. In some cases, the GluR2 sequence can be recognized by an RNA editing entity, such as an ADAR, or a biologically active fragment thereof. In some aspects, the GluR2 sequence can be a non-natural sequence. In some cases, the GluR2 sequence can be modified, for example, to enhance recruitment. In some embodiments, the GluR2 sequence can include portions of naturally occurring GluR2 sequences and synthetic sequences.
[0198] In some examples, the recruitment domain comprises a GluR2 sequence or sequences having at least about 70%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% identity to GUGGAAUAGUAUAACAAUAUGCUAAAUGUUGUUAUAGUAUCCCAC (SEQ ID NO: 51). In some cases, the recruitment domain can comprise at least about 80% sequence homology to at least about 10, 15, 20, 25, or 30 nucleotides of SEQ ID NO: 51. In some examples, the recruitment domain can comprise at least about 90%, 95%, 96%, 97%, 98%, or 99% sequence homology and / or length to SEQ ID NO: 51.
[0199] Additional RNA editing entity recruitment domains are also contemplated. In embodiments, the recruitment domain comprises an apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like (APOBEc) domain. In some instances, the APOBEC domain can comprise a non-naturally occurring sequence or a naturally occurring sequence. In some embodiments, the sequence encoding the APOBEC domain can comprise a modified portion. In some cases, the sequence encoding the APOBEC domain can comprise a portion of the sequence encoding a naturally occurring APOBEC domain. In another embodiment, the recruitment domain can be derived from an Alu domain.
[0200] Any number of recruitment domains can be found in the engineered guides of the present disclosure. In some instances, at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to about 10 recruitment domains can be included in an engineered guide. The recruitment domain can be located anywhere in the engineered guide RNA. In some cases, the recruitment domain can be located at the N-terminus, middle, or C-terminus of the engineered guide RNA. The recruitment domain can be located upstream or downstream of the targeting sequence. In some cases, the recruitment domain is adjacent to the targeting sequence of the subject guide. The recruitment sequence can contain all ribonucleotides or deoxyribonucleotides, although in some cases, recruitment domains containing both ribonucleotides and deoxyribonucleotides may not be excluded.
[0201] Engineered Guide RNAs with Cryptic Structures In some examples, the engineered guides disclosed herein useful for promoting target RNA editing by an RNA editing entity can be engineered cryptic guide RNAs. "Engineered cryptic guide RNAs" refer to engineered guide RNAs containing cryptic structures. "Cryptic structures" refer to structural features that are substantially formed only upon hybridization of the guide RNA with the target RNA. For example, the sequence of the guide RNA provides one or more structural features, but these structural features are substantially formed only upon hybridization with the target RNA, so that one or more cryptic structural features appear as structural features upon hybridization with the target RNA. Upon hybridization of the guide RNA with the target RNA, the structural features are formed, thus revealing the cryptic structure provided by the guide RNA. The formation and structure of the cryptic structural features upon binding to the target RNA depend on the guide RNA sequence. For example, the formation and structure of the cryptic structural features may depend on the pattern of complementary and mismatched residues in the guide RNA sequence relative to the target RNA. The guide RNA sequence may be engineered to have a cryptic structural feature that is formed upon binding to the target RNA.
[0202] A double-stranded RNA (dsRNA) substrate may be formed upon hybridization of an engineered guide RNA of the present disclosure with a target RNA. The resulting dsRNA substrate is also referred to herein as a "guide-target RNA scaffold."
[0203] 16 shows a legend for various exemplary structural features present in the guide-target RNA scaffold formed upon hybridization of a potential guide RNA of the present disclosure with a target RNA. Exemplary structural features shown include an 8 / 7 asymmetric loop (i. 8 nucleotides on the target RNA side and 7 nucleotides on the guide RNA side), a 2 / 2 symmetric bulge (ii. 2 nucleotides on the target RNA side and 2 nucleotides on the guide RNA side), a 1 / 1 mismatch (iii. 1 nucleotide on the target RNA side and 1 nucleotide on the guide RNA side), a 5 / 5 symmetric internal loop (iv. 5 nucleotides on the target RNA side and 5 nucleotides on the guide RNA side), a 24 bp region (v. 24 nucleotides on the target RNA side base-paired with 24 nucleotides on the guide RNA side), and a 2 / 3 asymmetric bulge (vi. 2 nucleotides on the target RNA side and 3 nucleotides on the guide RNA side).
[0204] Unless otherwise noted, the number of nucleotides involved in a given structural feature is shown as the nucleotide on the target RNA side relative to the nucleotide on the guide RNA side. This legend also provides positional annotation cues for each figure. For example, the target nucleotide to be edited is represented as position 0. Each nucleotide downstream (3') of the target nucleotide to be edited is counted by +1. Each nucleotide upstream (5') of the target nucleotide to be edited is counted by -1. Thus, an exemplary 2 / 2 symmetric bulge in this legend occurs at positions +12 to +13 of the guide-target RNA scaffold. Similarly, an exemplary 2 / 3 asymmetric bulge in this legend occurs at positions -36 to -37 of the guide-target RNA scaffold. As used herein, positional annotations are provided relative to the target nucleotide to be edited and on the target RNA side of the guide-target RNA scaffold. As used herein, when a single position is annotated, the structural feature extends from that position away from position 0 (the target nucleotide to be edited). For example, if a potential guide RNA is annotated herein as forming a 2 / 3 asymmetric bulge at position -36, the 2 / 3 asymmetric bulge will be formed from positions -36 to -37 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA scaffold. As another example, if a potential guide RNA is annotated herein as forming a 2 / 2 symmetric bulge at position +12, the 2 / 2 symmetric bulge will be formed from positions +12 to +13 relative to the edited target nucleotide (position 0) on the target RNA side of the guide-target RNA scaffold.
[0205] In some instances, the engineered guides disclosed herein lack a recruitment region, and recruitment of the RNA editing entity can be achieved by structural features of the guide-target RNA scaffold formed by hybridization of the engineered guide RNA and the target RNA. In some instances, the engineered guide does not contain structural features that recruit RNA editing entities (e.g., ADARs or APOBECs) when present in aqueous solution and not bound to a target RNA molecule. Upon hybridization with the target RNA, the engineered guide RNA forms one or more structural features with the target RNA molecule that recruit RNA editing entities (e.g., ADARs or APOBECs).
[0206] In the absence of a recruitment sequence, the engineered guide RNA can still associate with a subject RNA editing entity (e.g., an ADAR or APOBEC) to facilitate editing of the target RNA and / or regulate expression of a polypeptide encoded by the subject target RNA. This can be achieved through structural features formed in the guide-target RNA scaffold formed upon hybridization of the engineered guide RNA with the target RNA. The structural features can include any one of a mismatch, a symmetric bulge, an asymmetric bulge, a symmetric internal loop, an asymmetric internal loop, a hairpin, a wobble base pair, or any combination thereof.
[0207] Structural features that may be present in the guide-target RNA scaffolds of the present disclosure are described herein. Examples of features include mismatches, bulges (symmetric or asymmetric), internal loops (symmetric or asymmetric internal loops), or hairpins (mobilizing or non-mobilizing hairpins). The engineered guide RNAs of the present disclosure may have 1 to 50 features. The engineered guide RNAs of the present disclosure may have 1 to 5, 5 to 10, 10 to 15, 15 to 20, 20 to 25, 25 to 30, 30 to 35, 35 to 40, 40 to 45, 45 to 50, 5 to 20, 1 to 3, 4 to 5, 2 to 10, 20 to 40, 10 to 40, 20 to 50, 30 to 50, 4 to 7, or 8 to 10 features. In some aspects, structural features (e.g., mismatches, bulges, internal loops) can be formed from the latent structure of the engineered potential guide RNA upon hybridization of the engineered potential guide RNA to the target RNA, and thus upon formation of the guide-target RNA scaffold. In some embodiments, the structural feature is not formed from the latent structure, but instead is formed from a preformed structure (e.g., a GluR2-recruiting hairpin or a hairpin derived from U7 snRNA).
[0208] A guide-target RNA scaffold may be formed upon hybridization of an engineered guide RNA of the present disclosure with a target RNA. As disclosed herein, a mismatch refers to a single nucleotide in the guide RNA that is not paired with an opposing single nucleotide in the target RNA within the guide-target RNA scaffold. A mismatch may include any two single nucleotides that do not form a base pair. If the number of involved nucleotides on the guide RNA and target RNA sides exceeds one, the resulting structure is no longer considered a mismatch, but rather a "bulge" or "internal loop," depending on the size of the structural feature. In some embodiments, the mismatch is an A / C mismatch. An A / C mismatch may include a C of an engineered guide RNA of the present disclosure opposite an A of the target RNA. An A / C mismatch may include an A of an engineered guide RNA of the present disclosure opposite a C of the target RNA. A G / G mismatch may include a G of an engineered guide RNA of the present disclosure opposite a G of the target RNA.
[0209] In some embodiments, a mismatch located 5' of the editing site can facilitate base flipping of the edited target A. Mismatches can also serve to confer sequence specificity. Thus, mismatches can be structural features formed from the potential structures provided by engineered potential guide RNAs.
[0210] In another embodiment, the structural feature comprises a wobble base. A wobble base pair refers to two bases that weakly base pair. For example, a wobble base pair in the present disclosure may refer to a G paired with a U. Thus, a wobble base pair may be a structural feature formed from a potential structure provided by an engineered potential guide RNA.
[0211] In some cases, the structural feature can be a hairpin. As disclosed herein, a hairpin comprises an RNA duplex in which portions of a single-stranded RNA fold back on themselves to form an RNA duplex. The portions of the single-stranded RNA fold back due to nucleotide sequences that base-pair with each other, separated by an intervening sequence that does not base-pair with itself, thereby forming a base-paired portion and an intervening loop portion that does not base-pair with itself. The hairpin can have an overall duplex length of 10 to 500 nucleotides. The loop portion of the hairpin can be 3 to 15 nucleotides long. A hairpin can be present in any of the engineered guide RNAs disclosed herein. The engineered guide RNAs disclosed herein can have 1 to 10 hairpins. In some embodiments, the engineered guide RNAs disclosed herein have one hairpin. In some embodiments, the engineered guide RNAs disclosed herein have two hairpins. As disclosed herein, hairpin can be a recruiting hairpin or a non-recruiting hairpin.Hairpin can be present anywhere in the engineered guide RNA of the present disclosure.In some embodiments, one or more hairpins can be present at the 3'-end proximal or 3'-end of the engineered guide RNA of the present disclosure, at the 5'-end proximal or 5'-end of the engineered guide RNA of the present disclosure, at the targeting domain proximal or in the targeting domain of the engineered guide RNA of the present disclosure, or any combination thereof.
[0212] In some embodiments, the structural feature comprises a non-recruiting hairpin. As disclosed herein, the non-recruiting hairpin does not have the primary function of recruiting an RNA editing entity. Sometimes, the non-recruiting hairpin does not recruit an RNA editing entity. In some instances, the non-recruiting hairpin has a binding dissociation constant for the RNA editing entity that is insufficient for binding under physiological conditions. For example, the non-recruiting hairpin has a binding dissociation constant for the RNA editing entity at 25°C of greater than about 1 mM, 10 mM, 100 mM, or 1 M, as measured in an in vitro assay. The non-recruiting hairpin can exhibit functionality that improves the localization of the engineered guide RNA to the target RNA. In some embodiments, the non-recruiting hairpin improves intranuclear tethering. In some embodiments, the non-recruiting hairpin comprises a hairpin derived from U7 snRNA. Thus, non-recruiting hairpins, such as those derived from U7 snRNA, are preformed structural features that may be present in constructs containing engineered guide RNA constructs, rather than structural features formed by potential structures introduced into engineered potential guide RNAs.
[0213] Hairpins of the present disclosure can be of any length, hi some embodiments, hairpins can be from about 10 to 500 nucleotides or more. In some cases, the hairpin may be about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 3, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188 46, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263,264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 4, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, or more nucleotides. In other cases, hairpins are 10-20, 10-30, 10-40,10~50, 10~60, 10~70, 10~80, 10~90, 10~100, 10~110, 10~120, 10~130, 10~140, 10~150, 10~160, 10~170, 10~180, 10~190, 10~200, 10~210, 10~220, 10~230, 10~240, 10~250, 10~260, 10~270, 10~280, 10~ It may contain 290, 10 to 300, 10 to 310, 10 to 320, 10 to 330, 10 to 340, 10 to 350, 10 to 360, 10 to 370, 10 to 380, 10 to 390, 10 to 400, 10 to 410, 10 to 420, 10 to 430, 10 to 440, 10 to 450, 10 to 460, 10 to 470, 10 to 480, 10 to 490, or 10 to 500 nucleotides.
[0214] The guide-target RNA scaffold is formed upon hybridization of the engineered guide RNA of the present disclosure to the target RNA. As disclosed herein, a bulge refers to a structure that is formed substantially only upon formation of the guide-target RNA scaffold, in which consecutive nucleotides in either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposing strand. The bulge can alter the secondary or tertiary structure of the guide-target RNA scaffold. The bulge can independently have 0 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the target RNA side of the guide-target RNA scaffold, or the bulge can independently have 0 to 4 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 to 4 consecutive nucleotides on the guide RNA side of the guide-target RNA scaffold. However, as used herein, the term "bulge" does not refer to a structure in which a single nucleotide involved in an engineered guide RNA and a single nucleotide involved in a target RNA do not base-pair; a single nucleotide involved in an engineered guide RNA and a single nucleotide involved in a target RNA that do not base-pair is referred to herein as a "mismatch." Furthermore, if the number of involved nucleotides on either the guide RNA side or the target RNA side exceeds four, the resulting structure is no longer considered a bulge, but rather an internal loop. In some embodiments, the guide-target RNA scaffold of the present disclosure has two bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has three bulges. In some embodiments, the guide-target RNA scaffold of the present disclosure has four bulges. Thus, a bulge can be a structural feature formed from a potential structure resulting from an engineered potential guide RNA.
[0215] In some embodiments, the presence of a bulge in the guide-target RNA scaffold can position or help position ADAR so as to selectively edit target A in the target RNA and reduce off-target editing of non-target A(s) in the target RNA. In some embodiments, the presence of a bulge in the guide-target RNA scaffold can recruit or help recruit additional amounts of ADAR. The bulge in the guide-target RNA scaffold disclosed herein can recruit other proteins, such as other RNA editing entities. In some embodiments, the bulge located 5' of the editing site can promote base flipping of the target A to be edited. The bulge can also help to impart sequence specificity to the A of the target RNA to be edited compared to other A(s) present in the target RNA. For example, the bulge can help direct ADAR editing by constraining it to a direction that results in selective editing of target A.
[0216] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge may be symmetric or asymmetric. A symmetric bulge is formed when the same number of nucleotides are present on both bulges. For example, a symmetric bulge of a guide-target RNA scaffold of the present disclosure may have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and two nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure may be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and three nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric bulge of the present disclosure may be formed by four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and four nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetric bulge may be a structural feature formed from a potential structure resulting from an engineered potential guide RNA.
[0217] A guide-target RNA scaffold is formed upon hybridization of an engineered guide RNA of the present disclosure to a target RNA. The bulge can be a symmetric bulge or an asymmetric bulge. An asymmetric bulge is formed when a different number of nucleotides are present on either side of the bulge. For example, an asymmetric bulge of a guide-target RNA scaffold of the present disclosure can have a different number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 1 nucleotide on the target RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the target RNA side of the guide-target RNA scaffold and 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold. An asymmetric bulge of the present disclosure can be formed by 0 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the target RNA side of the guide-target RNA scaffold and 2 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 3 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the target RNA side of the guide-target RNA scaffold and 3 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 4 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 0 nucleotide on the target RNA side of the guide-target RNA scaffold and 4 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by 1 nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and 2 nucleotides on the target RNA side of the guide-target RNA scaffold.The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by one nucleotide on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure may be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and three nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by two nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by three nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and four nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric bulge of the present disclosure can be formed by three nucleotides on the target RNA side of the guide-target RNA scaffold and four nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric bulge can be a structural feature formed from a potential structure resulting from an engineered potential guide RNA.
[0218] In some cases, the structural feature may be an internal loop. As disclosed herein, the internal loop refers to a structure that is substantially formed only during the formation of the guide-target RNA scaffold, in which the nucleotides of either the engineered guide RNA or the target RNA are not complementary to their corresponding positions in the opposite strand, and one side of the internal loop on either the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold has 5 or more nucleotides. If the number of nucleotides involved on both the guide RNA side and the target RNA side is reduced to less than 5, the resulting structure is no longer considered an internal loop, but rather a bulge or mismatch, depending on the size of the structural feature. The internal loop may be a symmetric internal loop or an asymmetric internal loop. An internal loop present near the editing site may be useful for base flipping of target A of the target RNA to be edited.
[0219] The internal loop on either the target RNA side or the engineered guide RNA side of the guide-target RNA scaffold can be formed by 5 to 150 nucleotides, and can be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 120, 135, 140, 145, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, or 1000 nucleotides, or any number of nucleotides in between. One side of the internal loop may be formed by 5 nucleotides. One side of the internal loop may be formed by 10 nucleotides. One side of the internal loop may be formed by 15 nucleotides. One side of the internal loop may be formed by 20 nucleotides. One side of the internal loop may be formed by 25 nucleotides. One side of the internal loop may be formed by 30 nucleotides. One side of the internal loop may be formed by 35 nucleotides. One side of the internal loop may be formed by 40 nucleotides. One side of the internal loop may be formed by 45 nucleotides. One side of the internal loop may be formed by 50 nucleotides. One side of the internal loop may be formed by 55 nucleotides. One side of the internal loop may be formed by 60 nucleotides. One side of the internal loop may be formed by 65 nucleotides. One side of the internal loop may be formed by 70 nucleotides. One side of the internal loop may be formed by 75 nucleotides. One side of the internal loop may be formed by 80 nucleotides. One side of the internal loop may be formed by 85 nucleotides. One side of the internal loop may be formed by 90 nucleotides. One side of the internal loop may be formed by 95 nucleotides. One side of the internal loop may be formed by 100 nucleotides. One side of the internal loop may be formed by 110 nucleotides. One side of the internal loop may be formed by 120 nucleotides. One side of the internal loop may be formed by 130 nucleotides. One side of the internal loop may be formed by 140 nucleotides.One side of the internal loop may be formed by 150 nucleotides. One side of the internal loop may be formed by 200 nucleotides. One side of the internal loop may be formed by 250 nucleotides. One side of the internal loop may be formed by 300 nucleotides. One side of the internal loop may be formed by 350 nucleotides. One side of the internal loop may be formed by 400 nucleotides. One side of the internal loop may be formed by 450 nucleotides. One side of the internal loop may be formed by 500 nucleotides. One side of the internal loop may be formed by 600 nucleotides. One side of the internal loop may be formed by 700 nucleotides. One side of the internal loop may be formed by 800 nucleotides. One side of the internal loop may be formed by 900 nucleotides. One side of the internal loop may be formed by 1000 nucleotides. Thus, an internal loop may be a structural feature formed from a potential structure provided by an engineered potential guide RNA.
[0220] The internal loop may be a symmetric internal loop or an asymmetric internal loop. A symmetric internal loop is formed when the same number of nucleotides are present on both sides of the internal loop. For example, a symmetric internal loop of a guide-target RNA scaffold of the present disclosure may have the same number of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 5 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure may be formed by 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 8 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 9 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 10 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 15 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 15 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 20 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 20 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 30 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 30 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 40 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 40 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 50 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 60 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 60 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 70 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 70 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 80 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 80 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 90 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 90 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 100 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 110 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 110 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 120 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 120 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 130 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 130 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 140 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 140 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 150 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 200 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 250 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 250 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 300 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 350 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 350 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 400 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 450 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 450 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 500 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 600 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 600 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 700 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 700 nucleotides on the target RNA side of the guide-target RNA scaffold. The symmetric internal loop of the present disclosure can be formed by 800 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 800 nucleotides on the target RNA side of the guide-target RNA scaffold.A symmetric internal loop of the present disclosure can be formed by 900 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 900 nucleotides on the target RNA side of the guide-target RNA scaffold. A symmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold target and 1000 nucleotides on the target RNA side of the guide-target RNA scaffold. Thus, a symmetric internal loop can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.
[0221] An asymmetric internal loop is formed when there are different numbers of nucleotides on either side of the internal loop. For example, an asymmetric internal loop in a guide-target RNA scaffold of the present disclosure can have different numbers of nucleotides on the engineered guide RNA side and the target RNA side of the guide-target RNA scaffold.
[0222] The asymmetric internal loop of the present disclosure can be formed by 5 to 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 to 150 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered side of the target of the guide-target RNA scaffold is different from the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 to 1,000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 5 to 1,000 nucleotides on the target RNA side of the guide-target RNA scaffold, where the number of nucleotides on the engineered side of the target of the guide-target RNA scaffold is different from the number of nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 6 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and 7 nucleotides on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 7 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 8 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 9 nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 9 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold and a 10 nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 6 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and an 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and an 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 7-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and an 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 9-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by an 8-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by a 9-nucleotide internal loop on the engineered guide RNA side of the guide-target RNA scaffold and a 10-nucleotide internal loop on the target RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 9 nucleotides on the target RNA side of the guide-target RNA scaffold and 10 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 5 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 50 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 50 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 100 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 100 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 150 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 5 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 150 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 200 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 200 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 300 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure may be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 300 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 400 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 400 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold.The asymmetric internal loop of the present disclosure can be formed by 500 nucleotides on the target RNA side of the guide-target RNA scaffold and 1000 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. The asymmetric internal loop of the present disclosure can be formed by 1000 nucleotides on the target RNA side of the guide-target RNA scaffold and 500 nucleotides on the engineered guide RNA side of the guide-target RNA scaffold. Thus, the asymmetric internal loop can be a structural feature formed from a potential structure provided by a potential engineered guide RNA.
[0223] As described herein, a "microfootprint" sequence refers to a sequence with a cryptic structure that, when revealed, promotes adenosine editing of target RNA via adenosine deaminase enzyme. Macrofootprints can serve to guide or focus RNA editing entities (e.g., ADARs) and direct their activity toward the microfootprint. In some embodiments, the microfootprint sequence contains a nucleotide positioned opposite the adenosine edited by the ADAR enzyme when the guide RNA hybridizes to the target RNA, such that it does not base-pair with the edited adenosine. This nucleotide, referred to herein as a "mismatched position" or "mismatch," can be a cytosine. The microfootprint sequences described herein possess at least one structural feature selected from the group consisting of a bulge, an internal loop, a mismatch, a hairpin, and any combination thereof, upon hybridization of the engineered guide RNA with the target RNA. Engineered guide RNAs with excellent microfootprint sequences can be selected based on their ability to facilitate editing of a specific target RNA. Engineered guide RNAs selected for their ability to facilitate editing of specific targets can adopt a variety of microfootprint potential structures that can vary on a target-by-target basis.
[0224] The guide RNA of the present disclosure may further comprise a macrofootprint. In some embodiments, the macrofootprint comprises a barbell macrofootprint. The microfootprint can serve to guide or focus an RNA editing enzyme, directing its activity toward the target adenosine to be edited. As described herein, "barbell" refers to the potential structural feature of a pair of internal loops that are revealed upon hybridization of a guide RNA with a target RNA. In some embodiments, each internal loop is located at the 5' or 3' end of the guide-target RNA scaffold formed upon hybridization of the guide RNA with the target RNA. In some aspects, each internal loop is adjacent to opposite sides of a microfootprint sequence. Upon hybridization of the guide RNA with the target RNA, insertion of barbell macrofootprint sequences adjacent to opposite sides of the microfootprint sequence results in the formation of barbell internal loops on opposite sides of the microfootprint, which then contain at least one structural feature that facilitates editing of a specific target RNA.
[0225] In some embodiments, the presence of a barbell adjacent to a microfootprint can improve one or more aspects of editing. For example, the presence of a barbell macrofootprint in addition to a microfootprint can result in greater amounts of on-target adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. Additionally and / or alternatively, the presence of a barbell macrofootprint in addition to a microfootprint can result in less localized off-target adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. Furthermore, while the effects of various microfootprint structural features can vary on a target-by-target basis based on selection in high-throughput screens, the enhancement of one or more aspects of editing provided by a barbell macrofootprint structure can be independent of the specific target RNA. Thus, the inclusion of a barbell structure can provide a convenient method for improving editing of a pre-selected guide RNA to promote editing of a target RNA of interest. For example, the macrofootprint (e.g., a barbell macrofootprint) and the microfootprint can increase the amount of targeted adenosine editing compared to an otherwise equivalent guide RNA lacking the barbell. In other embodiments, the presence of barbell macrofootprints in addition to microfootprints can result in even smaller amounts of localized off-target adenosine editing upon hybridization of a guide RNA and a target RNA to form a guide-target RNA scaffold lacking the barbell, compared to an otherwise equivalent guide RNA.
[0226] As disclosed herein, a "macrofootprint" sequence can be positioned such that it is adjacent to a microfootprint sequence. Additionally, while a macrofootprint sequence can be adjacent to a microfootprint sequence, it can also incorporate additional cryptic structures adjacent to either end of the macrofootprint. In some aspects, such additional cryptic structures are included as part of the macrofootprint. In some aspects, such additional cryptic structures are separate from, distinct from, or both the macrofootprint. In some embodiments, a macrofootprint sequence can comprise a barbell macrofootprint sequence that includes cryptic structures that, when revealed, generate a first internal loop and a second internal loop.
[0227] In some embodiments, the barbell first internal loop or the barbell second internal loop is positioned at least about 5 bases (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 bases) away from the A / C mismatch relative to the base of the first internal loop or the second internal loop that is closest to the A / C mismatch. In some embodiments, the barbell first internal loop or the barbell second internal loop is positioned up to about 50 bases (e.g., 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5 bases) away from the A / C mismatch with respect to the base of the first internal loop or the second internal loop closest to the A / C mismatch.
[0228] In some embodiments, the first internal loop or the second internal loop, independently, is at least about 5 bases or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or less (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5-150, 6-145, 7-140, 8-135, 9-130, 10-125, 11-120, 12-115, 13-110, 14-105, 15-100, 16-95, 17-90, 18-85, 19-80, 20-75, 21-70, 22-65, 23-60, 24-55, 25-5 0) and engineered guide RNAs of at least about 5 bases or more (e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150); about 150 bases or less (e.g., 145, 135, 125, 115, 95, 85, 75, 65, 55, 45, 35, 25, 19, 18, 17, 16, 15, 14, 13 , 12, 11, 10, 9, 8, 7, 6, 5); or at least about 5 bases to at least about 150 bases (e.g., 5 to 150, 6 to 145, 7 to 140, 8 to 135, 9 to 130, 10 to 125, 11 to 120, 12 to 115, 13 to 110, 14 to 105, 15 to 100, 16 to 95, 17 to 90, 18 to 85, 19 to 80, 20 to 75, 21 to 70, 22 to 65, 23 to 60, 24 to 55, 25 to 50).
[0229] As disclosed herein, a "base-paired (bp) region" refers to a region of a guide-target RNA scaffold in which a base of the guide RNA pairs with an opposing base of the target RNA. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near the other end of the guide-target RNA scaffold. A base-paired region can extend between two structural features. A base-paired region can extend from at or near one end of the guide-target RNA scaffold to at or near a structural feature. A base-paired region can extend from a structural feature to the other end of the guide-target RNA scaffold. In some embodiments, the base-paired region is from 1 bp to 100 bp, from 1 bp to 90 bp, from 1 bp to 80 bp, from 1 bp to 70 bp, from 1 bp to 60 bp, from 1 bp to 50 bp, from 1 bp to 45 bp, from 1 bp to 40 bp, from 1 bp to 35 bp, from 1 bp to 30 bp, from 1 bp to 25 bp, from 1 bp to 20 bp, from 1 bp to 15 bp, from 1 bp to 10 bp, from 1 bp to 5 bp, from 5 bp to 10 bp, from 5 bp to 20 bp, from 10 bp to 20 bp, from 10 bp to 50 bp, from 5 bp to 50 bp, at least 1 bp, at least 2 bp, at least 3 bp , at least 4 bp, at least 5 bp, at least 6 bp, at least 7 bp, at least 8 bp, at least 9 bp, at least 10 bp, at least 12 bp, at least 14 bp, at least 16 bp, at least 18 bp, at least 20 bp, at least 25 bp, at least 30 bp, at least 35 bp, at least 40 bp, at least 45 bp, at least 50 bp, at least 60 bp, at least 70 bp, at least 80 bp, at least 90 bp, at least 100 bp.
[0230] Guide RNA expression cassette. The guide RNA expression cassette may include a promoter (e.g., any of SEQ ID NOs: 13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263), a guide RNA sequence, structural elements, and a termination sequence (e.g., any of SEQ ID NOs: 60, 708 to 1240, 1242, 1243 to 1247, 1254 to 1257, 1264 to 1272, 1275, or 1287 to 1289). The guide RNA sequence may target a target RNA. In some embodiments, the target RNA encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-induced kinase 1 (PINK1), or methyl-CpG-binding protein 2 (MECP2). Examples of engineered guide RNA expression cassettes containing promoters, guide RNA sequences, structural elements, and termination sequences are provided in Table 9. [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5]
[0231] In some embodiments, the expression cassette of the engineered guide RNA may have at least about 70%, at least about 75%, at least about 80%, at least about 83%, at least about 85%, at least about 87%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to any of SEQ ID NOs:1-12, or SEQ ID NO:59.
[0232] The expression cassette for the engineered guide RNA may include a promoter (e.g., any of SEQ ID NOs: 13-17, 167-707, 1241, 1248-1253, or 1259-1263), a guide RNA sequence, structural elements, and a termination sequence (e.g., any of SEQ ID NOs: 60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289).
[0233] For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 1 comprises a promoter of SEQ ID NO: 15, a PMP22 guide RNA sequence of SEQ ID NO: 1273, and a termination sequence of SEQ ID NO: 1243. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 2 comprises a promoter of SEQ ID NO: 16, a PMP22 guide RNA sequence of SEQ ID NO: 1273, and a termination sequence of SEQ ID NO: 1243. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 3 comprises a promoter of SEQ ID NO: 15, a PMP22 guide RNA sequence of SEQ ID NO: 1273, and a termination sequence of SEQ ID NO: 1275. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 4 comprises a promoter of SEQ ID NO: 16, a PMP22 guide RNA sequence of SEQ ID NO: 1273, and a termination sequence of SEQ ID NO: 60. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 5 comprises a promoter of SEQ ID NO: 17, a PMP22 guide RNA sequence of SEQ ID NO: 1273, and a termination sequence of SEQ ID NO: 60.
[0234] For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 6 comprises a promoter of SEQ ID NO: 15, an SNCA guide RNA sequence of SEQ ID NO: 1274, and a termination sequence of SEQ ID NO: 1243. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 7 comprises a promoter of SEQ ID NO: 13, an SNCA guide RNA sequence of SEQ ID NO: 1290, and a termination sequence of SEQ ID NO: 1243. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 8 comprises a promoter of SEQ ID NO: 14, an SNCA guide RNA sequence of SEQ ID NO: 1274, and a termination sequence of SEQ ID NO: 1243. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 9 comprises a promoter of SEQ ID NO: 16, an SNCA guide RNA sequence of SEQ ID NO: 1274, and a termination sequence of SEQ ID NO: 1243. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 10 comprises a promoter of SEQ ID NO: 15, an SNCA guide RNA sequence of SEQ ID NO: 1274, and a termination sequence of SEQ ID NO: 1275. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 11 comprises a promoter of SEQ ID NO: 16, an SNCA guide RNA sequence of SEQ ID NO: 1274, and a termination sequence of SEQ ID NO: 60. For example, an expression cassette for an engineered guide RNA of SEQ ID NO: 12 comprises a promoter of SEQ ID NO: 17, an SNCA guide RNA sequence of SEQ ID NO: 1274, and a termination sequence of SEQ ID NO: 60.
[0235] For example, the expression cassette for the engineered guide RNA of SEQ ID NO: 59 comprises the promoter of SEQ ID NO: 16, the SERPINA1 guide RNA sequence of SEQ ID NO: 61, and the termination sequence of SEQ ID NO: 60.
[0236] Additional engineered guide RNA components The present disclosure provides engineered guide RNAs with additional structural features and components.For example, the engineered guide RNAs described herein can be circular.In another example, the engineered guide RNAs described herein can include a U7 sequence, a smOPT sequence, or a combination of both sequences.
[0237] In some cases, the engineered guide RNAs can be circularized. In some cases, the engineered guide RNAs provided herein can be circularized or can be in a circular structure. In some embodiments, the at least partially circular guide RNA lacks a 5' hydroxyl or a 3' hydroxyl.
[0238] In some examples, the engineered guide RNA can comprise a backbone comprising multiple sugar and phosphate moieties covalently linked to one another, hi some examples, the backbone of the engineered guide RNA can comprise a phosphodiester bond linkage between the first hydroxyl group of the phosphate group on the 5' carbon of the deoxyribose of DNA or the ribose of RNA and the second hydroxyl group on the 3' carbon of the deoxyribose of DNA or the ribose of RNA.
[0239] In some embodiments, the backbone of the engineered guide RNA can lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to solvent. In some embodiments, the backbone of the engineered guide can lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to nucleases. In some embodiments, the backbone of the engineered guide can lack a 5' reduced hydroxyl, a 3' reduced hydroxyl, or both that can be exposed to hydrolases. Sometimes, the backbone of the engineered guide can be represented as a polynucleotide sequence in a circular two-dimensional format, where one nucleotide follows another. Sometimes, the backbone of the engineered guide can be represented as a polynucleotide sequence in a looped circular two-dimensional format, where one nucleotide follows another. In some cases, the 5' hydroxyl, the 3' hydroxyl, or both can be linked by a phosphorus-oxygen bond. In some cases, the 5' hydroxyl, the 3' hydroxyl, or both can be modified to a phosphoester by a phosphorus-containing moiety.
[0240] As described herein, an engineered guide can comprise a circular structure. An engineered polynucleotide can be circularized from an engineered precursor polynucleotide. Such an engineered precursor polynucleotide can be an engineered linear precursor polynucleotide. In some cases, the engineered linear polynucleotide precursor can be a precursor for an engineered circular guide RNA. For example, the engineered linear polynucleotide precursor can be a linear mRNA transcribed from a plasmid that can be configured to circularize in a cell using the techniques described herein. The engineered linear precursor polynucleotide can be constructed with domains such as a ribozyme domain and a ligation domain that enable circularization when inserted into a cell. The ribozyme domain can include a domain that can cleave the linear precursor RNA at a specific site (e.g., adjacent to the ligation domain). The engineered linear precursor polynucleotide can comprise, from 5' to 3', a 5' ribozyme domain, a 5' ligation domain, a region to be circularized, a 3' ligation domain, and a 3' ribozyme domain. In some cases, the circularization region can comprise a guide RNA as described herein. In some cases, the precursor polynucleotide can be specifically processed at both sites by 5' and 3' ribozymes to free exposed ends on the 5' and 3' ligation domains, respectively. The free exposed ends can be ligation elements so that the ends can ligate to form a mature circularized structure. For example, the free ends can include a 5'-OH and a 2',3'-cyclic phosphate ligated via RNA ligation in cells. A linear polynucleotide containing a ligation domain and a ribozyme domain can be transfected into a cell, where it can be circularized via endogenous cellular enzymes. In some cases, the polynucleotide can encode an engineered guide RNA containing a ribozyme domain and a ligation domain described herein, which can be circularized in cells.For example, PCT / US2021 / 034301 provides a description of circular guide RNAs and their structures, sequences of circular guide RNAs, and methods for engineering circularized polynucleotide domains, each of which descriptions in PCT / US2021 / 034301 is incorporated herein by reference.
[0241] An engineered polynucleotide (e.g., a circularized guide RNA) as described herein can include a spacer domain. As described herein, a spacer domain can refer to a domain that provides space between other domains. A spacer domain can be used between the region to be circularized and the adjacent ligation sequence to increase the overall size of the mature circularized guide RNA. When the region to be circularized includes a targeting domain as described herein configured to bind to a target sequence, the addition of a spacer can provide improvements (e.g., increased specificity, enhanced editing efficiency, etc.) for the engineered polynucleotide relative to the target polynucleotide compared to a comparable engineered polynucleotide lacking the spacer domain. Sometimes, the spacer domain is configured so that it does not hybridize to the target RNA. In some embodiments, an engineered polynucleotide precursor or engineered circular guide may include, in 5' to 3' order: a first ribozyme domain; a first ligation domain; a first spacer domain; a targeting domain that may be at least partially complementary to the target RNA, a second spacer domain, a second ligation domain, and a second ribozyme domain. In some cases, the first spacer domain, the second spacer domain, or both are configured such that when the targeting domain binds to the target RNA, the first spacer domain, the second spacer domain, or both do not bind to the target RNA.
[0242] The disclosed compositions and methods provide engineered polynucleotides encoding guide RNAs operably linked to portions of small nuclear ribonucleic acid (snRNA) sequences. The engineered polynucleotides can include at least a portion of the small nuclear ribonucleic acid (snRNA) sequence. The U7 and U1 small nuclear RNAs, whose primary role is in spliceosomal processing of pre-mRNAs, have been engineered for decades to alter splicing at desired disease targets. Replacing a portion of the U7 snRNA that naturally hybridizes to the histone-pre-mRNA spacer element (e.g., the first 18 nucleotides of the U7 snRNA) with a short targeting (or antisense) sequence for a disease gene can redirect the splicing machinery and alter splicing around the target site. Furthermore, converting the wild-type U7 Sm-domain binding site to an optimized consensus Sm-binding sequence (smOPT) can increase the expression level, activity, and subcellular localization of artificial antisense-engineered U7 snRNAs. Many subsequent groups have adapted this modified U7 smOPT snRNA chassis bearing antisense sequences of other genes to recruit spliceosomal elements and modify RNA splicing for additional disease targets.
[0243] snRNAs are a type of small RNA molecule found in the nucleus of eukaryotic cells. They are involved in various important processes, such as RNA splicing (removal of introns from pre-mRNA), regulation of transcription factors (7SK RNA) or RNA polymerase II (B2 RNA), and maintenance of telomeres. They are always associated with specific proteins, and the resulting RNA-protein complexes are called small nuclear ribonucleoproteins (snRNPs), or sometimes snurps. There are numerous snRNAs, designated U1, U2, U3, U4, U5, U6, U7, U8, U9, and U10.
[0244] U7-type snRNAs are typically involved in the maturation of histone mRNAs and have been identified in numerous eukaryotic species (56 so far), and the U7 snRNAs of each of these species should be considered equally advantageous for the present disclosure.
[0245] The wild-type U7 snRNA contains a stem-loop structure, a U7-specific Sm sequence, and an antisense sequence to the 3' end of the histone pre-mRNA.
[0246] In addition to the smOPT domain, U7 contains an antisense sequence to the 3' end of histone pre-mRNA. When this sequence is replaced by a targeting sequence that is antisense to another target pre-mRNA, U7 is redirected to the new target pre-mRNA. Thus, stable expression of a modified U7 snRNA containing the smOPT domain and a target antisense sequence resulted in specific changes in mRNA splicing. An AAV-2 / 1-based vector expressing an appropriately modified murine U7 gene in conjunction with its native promoter and 3' elements enabled highly efficient gene transfer into skeletal muscle and complete dystrophin restoration by covering and skipping mouse DMD exon 23. The engineered polynucleotides described herein (whether administered directly or, for example, via an AAV vector) can facilitate editing of target RNA by deaminase.
[0247] The engineered polynucleotide may comprise, at least in part, a snRNA sequence. The snRNA sequence can be a U1, U2, U3, U4, U5, U6, U7, U8, U9, or U10 snRNA sequence.
[0248] In some cases, engineered polynucleotides comprising at least a portion of an snRNA sequence (e.g., an snRNA promoter, an snRNA hairpin, etc.) can have superior properties for treating or preventing a disease or condition compared to equivalent polynucleotides lacking such characteristics. For example, as described herein, engineered polynucleotides comprising at least a portion of an snRNA sequence can facilitate exon skipping of exons with greater efficiency than equivalent polynucleotides lacking such characteristics. Furthermore, as described herein, engineered polynucleotides comprising at least a portion of an snRNA sequence can facilitate base editing of nucleotides in a target RNA (e.g., a pre-mRNA or a mature RNA) with even greater efficiency than equivalent polynucleotides lacking such characteristics. Promoter and snRNA components are described in PCT / US2021 / 028618 and PCT / US2022 / 078801, each of which is incorporated herein by reference.
[0249] Disclosed herein is an engineered RNA comprising (a) an engineered guide RNA as described herein, and (b) a U7 snRNA hairpin sequence, a smOPT sequence, or a combination thereof. In some embodiments, the U7 hairpin comprises a human U7 hairpin sequence or a mouse U7 hairpin sequence. In some embodiments, the human U7 hairpin sequence comprises TAGGCTTTCTGGCTTTTTACCGGAAAGCCCCT (SEQ ID NO: 52) or RNA:UAGGCUUUCUGGCUUUUUACCGGAAAGCCCCU (SEQ ID NO: 53). In some embodiments, the mouse U7 hairpin sequence comprises CAGGTTTTCTGACTTCGGTCGGAAAACCCCT (SEQ ID NO: 54) or RNA:CAGGUUUUCUGACUUCGGUCGGAAAACCCCU (SEQ ID NO: 55). In some embodiments, the smOPT sequence has a sequence of AATTTTTGGAG (SEQ ID NO: 56 or RNA:AAUUUUUGGAG (SEQ ID NO: 57). In some embodiments, the RNA payload may comprise a guide RNA, a U7 hairpin sequence (e.g., a human or mouse U7 hairpin sequence), an SmOPT sequence, or a combination thereof. For example, the RNA payload may comprise a sequence of AATTTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTG (SEQ ID NO: 58). In some embodiments, the combination of the U7 hairpin sequence and the smOPT sequence can comprise a smOPT U7 hairpin sequence in which the smOPT sequence is linked to the U7 sequence. In some embodiments, the U7 hairpin sequence, the smOPT sequence, or a combination thereof is downstream (e.g., 3') of an engineered guide RNA disclosed herein.
[0250] Guide RNA payloads for DNA editing The expression cassettes described herein may be used to enhance expression of RNA components for site-specific, selective editing of target DNA via a DNA editing entity or a biologically active fragment thereof. The RNA components for site-specific DNA editing may include a guide RNA, a trans-activating CRISPR RNA (tracrRNA), a single guide RNA, or an engineered polynucleotide encoding the same. The engineered guide RNA described herein may include a sequence complementary to a target DNA described herein. Thus, the guide RNA can be engineered to site-specifically / selectively target and hybridize to a specific target DNA, facilitating editing of specific nucleotides in the target DNA via the DNA editing entity or a biologically active fragment thereof. DNA editing may be facilitated by a nuclease, such as a Cas nuclease. In some embodiments, the Cas nuclease may be Cas9, Cas12, or Cas14.
[0251] In some embodiments, the engineered guide RNA hybridizes to a sequence in the target DNA. In some embodiments, a portion of the engineered guide RNA hybridizes to a sequence in the target DNA. The portion of the engineered guide RNA that hybridizes to the target DNA is sufficiently complementary to the sequence in the target DNA for hybridization to occur. In some embodiments, the guide RNA may comprise a sequence having at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the target DNA. The guide RNA encoded by the expression cassettes of the present disclosure may comprise a length of about 15 to about 70 nucleotides, about 40 to about 70 nucleotides, or about 70 to about 100 nucleotides. In some embodiments, the region of the guide RNA that hybridizes to the target may comprise a length of about 18 to about 44 nucleotides.
[0252] In some instances, the engineered guide RNA can facilitate editing of nucleotide bases in a target sequence of a target DNA, thereby regulating the expression of a gene encoded by the target DNA. Sometimes, the regulation can increase or decrease gene expression. In some cases, the engineered guide can be configured to facilitate editing of nucleotides or polynucleotide bases in a DNA region by a DNA editing entity (e.g., Cas nuclease).
[0253] In some embodiments, the expression cassettes described herein may be used to enhance expression of a trans-activating crRNA (tracrRNA) and an engineered polynucleotide encoding it for editing of target DNA via a DNA editing entity or a biologically active fragment thereof. The tracrRNA may bind to and activate a DNA editing enzyme (e.g., a Cas nuclease). The tracrRNA encoded by the expression cassettes of the present disclosure may comprise a length of about 75 to about 100 nucleotides.
[0254] In some embodiments, the expression cassettes described herein may be used to enhance expression of single guide RNAs and engineered polynucleotides encoding them for editing target DNA via a DNA editing entity or a biologically active fragment thereof. The single guide RNA may include a region that binds to and activates a DNA editing enzyme (e.g., a Cas nuclease) and a region that hybridizes to a sequence in the target DNA. The portion of the single guide RNA that hybridizes to the target DNA is sufficiently complementary to the sequence in the target DNA for hybridization to occur. In some embodiments, the single guide RNA may include a sequence that has at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the target DNA. The single guide RNA encoded by the expression cassettes of the present disclosure may comprise a length of about 80 to about 120 nucleotides. In some embodiments, the region of the single guide RNA that hybridizes to the target may comprise a length of about 18 to about 44 nucleotides.
[0255] Other RNA-targeting oligonucleotides The expression cassettes described herein may be used to enhance expression of other engineered RNA-targeting oligonucleotides, including antisense oligonucleotides, siRNAs, shRNAs, and miRNAs, as well as engineered polynucleotides that hybridize to and encode a target RNA (e.g., a target mRNA or a target pre-mRNA). Engineered oligonucleotides such as those described herein may contain a targeting domain that is complementary to a target RNA described herein. Thus, oligonucleotides can be engineered to target and hybridize to a specific target RNA, thereby altering expression of the polypeptide encoded by the target RNA.
[0256] In some embodiments, an engineered oligonucleotide (e.g., an antisense oligonucleotide, siRNA, shRNA, or miRNA) of the present disclosure hybridizes to a sequence of a target RNA. In some embodiments, a portion of the engineered oligonucleotide (e.g., a targeting domain) hybridizes to a sequence of the target RNA. The portion of the engineered oligonucleotide that hybridizes to the target RNA is sufficiently complementary to the sequence of the target RNA for hybridization to occur. The targeting sequence can also be referred to as a "targeting domain" or "targeting region." In some embodiments, binding of the engineered oligonucleotide to the target RNA may recruit additional components, such as RISC components.
[0257] Therapeutic applications The expression cassette of the present disclosure, encoding an RNA payload under the transcriptional control of an engineered promoter, may have various therapeutic applications. The engineered promoters described herein may facilitate therapeutic use by increasing the expression of the payload and enhancing the therapeutic effect provided by the payload. For example, increasing the expression of a guide RNA payload may enhance the editing efficiency of target DNA or target RNA. In another example, increasing the expression of an antisense oligonucleotide may enhance the efficiency of target knockdown.
[0258] RNA editing RNA editing can refer to a process in which RNA can be enzymatically modified after synthesis at specific nucleosides. RNA editing can include any one of the insertion, deletion, or substitution of nucleotide(s). Examples of RNA editing include chemical modifications such as pseudouridylation (isomerization of uridine residues) and deamination (removal of an amine group from cytidine to uridine, or C→U editing; adenosine to inosine, or A→I editing). RNA editing can be used to correct mutations (e.g., correcting missense mutations) to restore protein expression, or to introduce mutations or edit coding or non-coding regions of RNA to inhibit RNA translation and achieve protein knockdown. The expression cassettes of the present disclosure can be used to express engineered guide RNAs and facilitate RNA editing by RNA entities (e.g., adenosine deaminase acting on RNA (ADAR)) or biologically active fragments thereof.
[0259] Described herein are engineered guide RNAs that facilitate RNA editing by an RNA editing entity (e.g., RNA adenosine deaminase (ADAR)) or a biologically active fragment thereof. In some examples, ADARs can be enzymes that catalyze the chemical conversion of adenosine to inosine in RNA. Because the properties of inosine are similar to those of guanosine (e.g., inosine forms two hydrogen bonds with cytosine), inosine can be recognized as guanosine by the cellular translation machinery. "Adenosine-to-inosine (A→i) RNA editing" therefore effectively changes the primary sequence of the RNA target. Generally, ADAR enzymes share a common domain structure, including a variable number of amino-terminal dsRNA-binding domains (dsRBDs) and a single carboxy-terminal deaminase catalytic domain. Human ADARs have two or three dsRBDs. Evidence suggests that ADARs can form homodimers and heterodimers with other ADARs when bound to double-stranded RNA, although it is currently uncertain whether dimerization is required for editing to occur. The engineered guide RNAs disclosed herein can promote RNA editing through any of the three identified human ADAR genes (ADAR1-3) or any combination thereof. ADARs have a typical modular domain organization, containing at least two copies of a dsRNA-binding domain (dsRBD; ADAR1 has three dsRBDs; ADAR2 and ADAR3 each have two dsRBDs) in their N-terminal region, followed by a C-terminal deaminase domain.
[0260] The engineered guide RNA of the present disclosure facilitates RNA editing by endogenous ADAR enzyme.In some embodiments, exogenous ADAR can be delivered together with the engineered guide RNA disclosed herein to facilitate RNA editing.In some embodiments, ADAR is human ADAR1.In some embodiments, ADAR is human ADAR2.In some embodiments, ADAR is human ADAR3.In some embodiments, ADAR is human ADAR1, human ADAR2, human ADAR2, or any combination thereof.
[0261] In some embodiments, the present disclosure provides engineered guide RNAs that promote editing at specific regions of a target RNA (e.g., mRNA or pre-mRNA). For example, the engineered guide RNAs disclosed herein can target the coding or non-coding sequence of an RNA. For example, the target region in the coding sequence of an RNA can be the translation initiation site (TIS). In some embodiments, the target region in the non-coding sequence of an RNA can be a polyadenylation (polyA) signal sequence.
[0262] Missense mutations. In some embodiments, the engineered guide RNAs of the present disclosure may target missense mutations in a target RNA sequence. The engineered guide RNA may facilitate ADAR-mediated RNA editing of the target adenosine (A) to convert it to inosine (I), which may be read as guanosine (G). The conversion of A to I via ADAR-mediated RNA editing may correct a missense mutation of G to A. For example, ADAR-mediated editing may correct a valine-to-isoleucine or valine-to-methionine mutation by converting an isoleucine codon (AUU, AUC, or AUA) or a methionine codon (AUG) to a valine codon (AUA, GUC, GUU, or GUG). In another example, ADAR-mediated editing may correct a cysteine-to-tyrosine mutation by converting a tyrosine codon (AUA or UAC) to a cysteine codon (UGU or UGC). Alternatively, or in addition, the engineered guide RNA may facilitate APOBEC-mediated RNA editing of a targeted cytosine (C) to convert it to uracil (U). The C to U conversion via APOBEC-mediated RNA editing may correct a U to C missense mutation. The engineered guide RNAs of the present disclosure can target one or any combination of missense mutations in a target sequence (e.g., SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2).
[0263] Nonsense mutation. In some embodiments, the engineered guide RNA of the present disclosure may target a nonsense mutation in a target RNA sequence. The engineered guide RNA may facilitate ADAR-mediated RNA editing of the target adenosine (A) to convert it to inosine (I), which may be read as guanosine (G). The conversion of A to I via ADAR-mediated RNA editing may correct the G to A nonsense mutation. For example, ADAR-mediated editing may correct a tryptophan by converting a UAG stop codon to a tryptophan codon (UGG), thereby correcting the tryptophan and stopping the nonsense mutation. In another example, ADAR-mediated editing may correct a UGA stop codon to a tryptophan codon (UGG), thereby correcting the tryptophan and stopping the nonsense mutation. Correction of the nonsense mutation via ADAR-mediated editing may increase expression of the target sequence. The engineered guide RNAs of the present disclosure can target one or any combination of missense mutations in a target sequence (e.g., SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2).
[0264] TIS. In some embodiments, the engineered guide RNA of the present disclosure targets the adenosine of the translation start site (TIS). The engineered guide RNA may facilitate ADAR-mediated RNA editing of the TIS (AUG) to GUG. This results in the inhibition of RNA translation, thereby resulting in protein knockdown. Protein knockdown can also be referred to as reduced expression of wild-type protein. The engineered guide RNA of the present disclosure can target one or any combination of TIS of a target sequence (e.g., SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2).
[0265] 3'UTR. In some embodiments, the engineered guide RNA of the present disclosure targets one or more adenosines in the 3' untranslated region (3'UTR). In some embodiments, the engineered guide RNA facilitates ADAR-mediated RNA editing of one or more adenosines in the 3'UTR, thereby reducing mRNA export from the nucleus and inhibiting translation, thereby resulting in protein knockdown. In some embodiments, the target sequence may be SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.
[0266] PolyA signal sequence. In some embodiments, an engineered guide RNA of the present disclosure targets one or more adenosines in a polyA signal sequence. In some embodiments, the engineered guide RNA facilitates ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence, thereby interfering with RNA processing and resulting in degradation of the target mRNA, thereby resulting in protein knockdown. In some embodiments, the target can have one or more polyA signal sequences. In these cases, one or more engineered guide RNAs of the present disclosure, each with a different sequence, can be multiplexed to target one or more adenosines in the polyA signal sequence. In both cases, the engineered guide RNA of the present disclosure facilitates ADAR-mediated RNA editing of the adenosines in the polyA signal sequence to inosines (which are read as guanosines by the cellular machinery), resulting in protein knockdown. In some embodiments, the target sequence may be SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.
[0267] DNA editing DNA editing can refer to the process by which DNA can be enzymatically modified (e.g., by an RNA-guided endonuclease). DNA editing can include any one of the insertion, deletion, or substitution of a nucleotide(s). DNA editing can be used to correct a mutation (e.g., correct a missense mutation) to restore protein expression, or to introduce a mutation or edit a coding or non-coding region of DNA to inhibit DNA transcription and achieve protein knockdown. The expression cassettes of the present disclosure can be used to express engineered guide RNAs to facilitate DNA editing by a DNA entity (e.g., a CRISPR / Cas endonuclease) or a biologically active fragment thereof. Described herein are engineered guide RNAs that facilitate DNA editing by an RNA editing entity (e.g., a CRISPR / Cas endonuclease) or a biologically active fragment thereof.
[0268] The engineered guide RNAs of the present disclosure may facilitate DNA editing by endogenous Cas enzymes. In some embodiments, exogenous Cas enzymes can be delivered together with the engineered guide RNAs disclosed herein to facilitate DNA editing. In some embodiments, the Cas nuclease is Cas9. In some embodiments, the Cas nuclease is Cas12. In some embodiments, the Cas nuclease is Cas14.
[0269] In some embodiments, the present disclosure provides engineered guide RNAs that facilitate editing of specific regions of target DNA. For example, the engineered guide RNAs disclosed herein can target coding or non-coding sequences of DNA.
[0270] The engineered guide RNAs of the present disclosure may recruit CRISPR / Cas endonucleases (e.g., Cas9 nucleases) to form ribonucleoprotein (RNP) complexes that are directed to specific sites in a target polynucleotide (e.g., target DNA) through base pairing between the guide RNA and a target region within the target polynucleotide (e.g., target DNA). The engineered guide RNA may include a targeting sequence that is complementary to the target site of the target polynucleotide. Thus, the engineered guide RNA forms a complex with the Cas nuclease, and the guide RNA provides sequence specificity to the RNP complex via the targeting sequence. Upon recruitment to the target polynucleotide, the Cas nuclease may site-specifically edit the target polynucleotide (e.g., target DNA). In some embodiments, the target polynucleotide may encode SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.
[0271] Expression knockdown The expression cassettes of the present disclosure may be used to express engineered RNA-targeting oligonucleotides (e.g., antisense oligonucleotides, siRNAs, shRNAs, or miRNAs) to facilitate knockdown expression of the target RNA. In some embodiments, binding of the RNA-targeting oligonucleotide to the target RNA may recruit additional components (e.g., RISC complex components) to the target RNA, which may reduce expression of the peptide encoded by the target RNA. For example, binding of an siRNA may recruit RISC and facilitate cleavage of the target RNA. In another example, binding of an miRNA or shRNA may recruit RISC and inhibit translation of the target RNA. In some embodiments, the target RNA may encode SNCA, PMP22, DUX4, LRRK2, MAPT, GRN, ABCA4, APP, SERPINA1, HEXA, CFTR, LIPA, GBA, PINK1, or MECP2.
[0272] Targets and Treatment Methods Small RNA payloads, such as engineered guide RNAs of the present disclosure, can be used in methods of treating a disorder in a subject in need of treatment. The disorder can be a disease, condition, genotype, phenotype, or any condition associated with an adverse effect. In some embodiments, treating a disorder can include preventing the disorder, slowing its progression, reversing it, or alleviating its symptoms. A method of treating a disorder can include delivering an engineered polynucleotide encoding the engineered guide RNA to cells of a subject in need of treatment for the disorder and expressing the engineered guide RNA in the cells. In some embodiments, the engineered guide RNAs of the present disclosure can be used to treat genetic disorders (e.g., tauopathies such as AD, FTD, and Parkinson's disease). In some embodiments, the engineered guide RNAs of the present disclosure can be used to treat conditions associated with one or more mutations.
[0273] The present disclosure provides compositions of expression cassettes encoding engineered payloads (e.g., engineered guide RNAs) and methods of use thereof, such as therapeutic methods. In some embodiments, the expression cassettes of the present disclosure encode guide RNAs that target a coding sequence of an RNA (e.g., an RNA encoding alpha-synuclein, PMP22, DUX4, LRRK2, tau, progranulin, ABCA4, amyloid precursor protein, or an RNA encoding alpha-1 antitrypsin). In some embodiments, the engineered polynucleotides of the present disclosure encode guide RNAs that target a non-coding sequence of an RNA (e.g., a polyA sequence). In some embodiments, the present disclosure provides compositions of one or more engineered polynucleotides that encode more than one engineered guide RNA that target a TIS, a polyA sequence, or any other portion of a coding or non-coding sequence. The engineered guide RNAs disclosed herein facilitate ADAR-mediated RNA editing of adenosines in a TIS, a polyA sequence, any portion of a coding sequence of an RNA, any portion of a non-coding sequence of an RNA, or any combination thereof.
[0274] Examples of target genes that may be targeted by the engineered RNA payloads encoded by the expression cassettes of the present disclosure are shown in Table 10. The target gene may be a wild-type gene, or the target gene may be a mutated gene. By targeting the gene using an engineered RNA payload, a condition associated with the target gene may be treated. [Table 10]
[0275] The expression cassettes of the present disclosure may express payloads to target, modify, and / or express any sequence of interest. Selected targets of interest that may be targeted by the payloads described herein for the treatment of associated conditions are discussed below by way of example.
[0276] MAPT The present disclosure provides an expression cassette encoding an engineered guide RNA that facilitates RNA editing of MAPT to knock down tau protein expression. Tau pathology can be an important factor in a wide range of neurodegenerative diseases collectively known as tauopathies. For example, diseases in which tau may play a major role include, but are not limited to, Alzheimer's disease (AD), frontotemporal dementia (FTD), Parkinson's disease, progressive supranuclear palsy (PSP), corticobasal degeneration (CBD), and chronic traumatic encephalopathy. Tauopathies are characterized by the intracellular accumulation of neurofibrillary tangles (NFTs) composed of aggregated, misfolded tau (MAPT gene). Therefore, the engineered guide RNA of the present disclosure that targets MAPT RNA for ADAR-mediated editing to knock down tau protein may be able to prevent or ameliorate disease progression in numerous diseases, including, but not limited to, AD, FTD, autism, traumatic brain injury, Parkinson's disease, and Dravet syndrome.
[0277] Thus, the engineered guide RNAs of the present disclosure can target MAPT for RNA editing, thereby causing a reduction in tau protein expression. In some embodiments, tau protein expression is reduced in human neurons. In some embodiments, the present disclosure provides compositions of engineered guide RNAs that target MAPT and facilitate ADAR-mediated RNA editing of MAPT to reduce the pathogenic level of tau by targeting the adenosine present in the translation initiation site (TIS), which is important for deamination. In some embodiments, the engineered guide RNAs of the present disclosure target a coding sequence in MAPT. For example, the coding sequence can be the translation initiation site (TIS) (AUG) of MAPT, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of AUG to GUG. The engineered guide RNAs of the present disclosure can target one or more TISs in MAPT to reduce or completely inhibit tau protein expression.
[0278] For example, in some embodiments, an engineered guide RNA targets an AUG at the 18th nucleotide of exon 1 (c.1, Nm_005910.5; GRCh37 / Hg19; coding nucleotide 1 is also referred to as "c.1"), referred to as the conventional TIS. In some embodiments, an engineered guide RNA targets an AUG at the 48th nucleotide (c.31) in exon 1. In some embodiments, an engineered guide RNA targets an AUG at the 48th nucleotide (c.379) in exon 5. With reference to the 2N4R tau isoform (Np_005901, GRCh37 / Hg19), which contains 441 amino acids, these three TISs correspond to methionine (Met) 1, 11, and 127, respectively. In some embodiments, an engineered guide RNA targets an AUG at the 108th nucleotide (c.91) in exon 1. In some embodiments, one or more engineered guide RNAs of the present disclosure target any one or any combination of the four TISs. For example, a single engineered guide RNA of the present disclosure can be designed to target more than one of the four TISs. In some embodiments, multiple engineered guide RNAs are designed to independently target more than one of the four TISs. In some embodiments, an engineered guide RNA of the present disclosure can target any one or any combination of the TISs in exon 1 (c.1, c.31, and c.91). Targeting these sites in MAPT facilitates editing that results in translation inhibition and reduced tau protein expression. In some embodiments, the ratio of 3R to 4R isoforms of tau can be measured by protein analysis (e.g., using ELISA or flow cytometry) to assess the effectiveness of RNA editing, with a 1:1 ratio representing the ratio in a healthy adult brain. In some embodiments, any of the engineered guide RNAs disclosed herein is packaged into an AAV vector and delivered virally.
[0279] In some aspects, the engineered guide RNA targets a non-coding sequence in MAPT. The non-coding sequence can be a polyA signal sequence, and the engineered guide RNA can facilitate ADAR-mediated RNA editing of one or more adenosines in the polyA signal sequence of MAPT. In some embodiments, the engineered guide RNA of the present disclosure can be multiplexed to target multiple polyA signal sequences of MAPT. In some embodiments, the engineered guide RNA of the present disclosure can be multiplexed to target the TIS and one or more polyA signal sequences of MAPT. In some embodiments, the engineered guide RNA can be multiplexed to target non-coding and coding sequences of MAPT. The engineered guide RNA of the present disclosure facilitates ADAR-mediated RNA editing of MAPT, thereby achieving protein knockdown.
[0280] In some embodiments, engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of 1-100% of target adenosines. Engineered guide RNAs of the present disclosure can facilitate editing of 40-90% of target adenosines. In some embodiments, engineered guide RNAs of the present disclosure can facilitate RNA editing of at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100%, 5-20%, 20-40%, 40-60%, 60-80%, 80-100%, 60-80%, 70-90%, or up to 90% or more of the target adenosines. Optionally, engineered guide RNAs of the present disclosure can further facilitate these levels of on-target RNA editing while maintaining editing of less than 10% of off-target adenosines. Optionally, further, the engineered guide RNAs of the present disclosure can facilitate these levels of on-target RNA editing while maintaining less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 9%, less than 8%, less than 7%, less than 6%, less than 5%, less than 4%, less than 3%, less than 2%, less than 1%, or 0% off-target adenosine editing.
[0281] In some embodiments, the engineered guide RNAs of the present disclosure facilitate ADAR-mediated RNA editing of MAPT, resulting in protein level knockdown. Protein level knockdown is quantified as a reduction in tau protein expression. The engineered guide RNAs of the present disclosure can facilitate 1% to 100% tau protein knockdown. The engineered guide RNAs of the present disclosure can facilitate knockdown of tau protein by 1% to 10%, 10% to 20%, 20% to 30%, 30% to 40%, 40% to 50%, 50% to 60%, 60% to 70%, 70% to 80%, 80% to 90%, 90% to 100%, 20% to 40%, 30% to 50%, 40% to 60%, 50% to 70%, 60% to 80%, 20% to 50%, 30% to 60%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%. In some embodiments, the engineered guide RNAs of the present disclosure facilitate 30% to 60% knockdown of tau protein, which can be measured by an assay comparing samples or subjects treated with the engineered guide RNA to a control sample or subject not treated with the engineered guide RNA.
[0282] α-synuclein The alpha-synuclein gene consists of five exons and encodes a 140-amino acid protein with a predicted molecular weight of approximately 14.5 kDa. The encoded product is an intrinsically disordered protein with unknown function. Normally, alpha-synuclein is a monomer. Under certain stress conditions or other unknown causes, alpha-synuclein self-aggregates into oligomers. Lewy-related pathologies (LRPs), primarily composed of alpha-synuclein, are found in over 50% of brains of autopsy-confirmed Alzheimer's disease patients. Although the molecular mechanism by which alpha-synuclein influences the pathogenesis of Alzheimer's disease is unknown, experimental evidence indicates that alpha-synuclein interacts with tau-p and can seed the intracellular aggregation of tau-p. Furthermore, alpha-synuclein can regulate the activity of GSK3β, which can mediate tau hyperphosphorylation. Alpha-synuclein can also self-assemble into pathogenic aggregates (Lewy bodies). Both tau and α-synuclein can be released into the extracellular space and spread to other cells. Vascular abnormalities impair the supply of nutrients and the removal of metabolic by-products, leading to microinfarctions and promoting glial cell activation. Therefore, a multi-pronged strategy to substantially reduce tau formation, α-synuclein formation, or their combination could be important for effectively treating neurodegenerative diseases.
[0283] The domain structure of alpha-synuclein includes an N-terminal A2 lipid-binding alpha-helical domain, a non-amyloid beta component (NAC) domain, and a C-terminal acidic domain. Molecularly, alpha-synuclein has been suggested to play a role in neuronal transmission and DNA repair. In some cases, regions of alpha-synuclein can be targeted using the compositions provided herein. In some cases, regions of alpha-synuclein mRNA can be targeted with engineered polynucleotides disclosed herein for knockdown. In some cases, exon or intron regions of alpha-synuclein mRNA can be targeted. In some embodiments, regions of the non-coding sequence of alpha-synuclein mRNA, such as the 5'UTR and 3'UTR, can be targeted. In other cases, regions of the coding sequence of alpha-synuclein mRNA can be targeted. Suitable regions include, but are not limited to, the N-terminal A2 lipid-binding alpha-helical domain, the non-amyloid beta component (NAC) domain, or the C-terminal acidic domain.
[0284] In some embodiments, the alpha-synuclein mRNA sequence is targeted. In some cases, any one of the 3,177 residues of the sequence may be targeted using the compositions and methods provided herein. In some cases, the target residues are residues 1-100, 99-200, 199-300, 299-400, 399-500, 499-600, 599-700, 699-800, 799-900, 899-1000, 999-1100, 1099-1200, 1199-1300, 1299-1400, 1399-1500, 1499-1600, 1599-1700, 1699-1800, 1700-1800, 1900-2000, 2100-2100, 2200-2300, 2300-2400, 2400-2500, 2500-2600, 2600-2700, 2700-2800, 2800-2900, 2900-3000, 3000-3100, 3100-3200, 3200-3300, 3300-3400, 3400-3500, 3500-3600, 3600-3700, 3700-3800, 3800-3900, 3900-4000, 4100-4200, 4200-4300, 4300-4400, 4400-4500, 45 It may be positioned between 0, 1799-1900, 1899-2000, 1999-2100, 2099-2200, 2199-2300, 2299-2400, 2399-2500, 2499-2600, 2599-2700, 2699-2800, 2799-2900, 2899-3000, 2999-3100, 3099-3177, or any combination thereof.
[0285] In some embodiments, the present disclosure provides an expression cassette encoding an engineered guide RNA that targets SNCA. The engineered guide RNA may target SNCA to modify or alter SNCA expression. In some embodiments, targeting SNCA with an engineered guide RNA of the present disclosure may treat a disease associated with SNCA, such as synucleinopathy, Parkinson's disease, dementia with Lewy b...
Claims
1. An expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO: 17, SEQ ID NO: 1250, or SEQ ID NO: 1262; b) SEQ ID NO: 13 or SEQ ID NO: 15; or c) SEQ ID NO: 1241, SEQ ID NO: 1251, SEQ ID NO: 1252, SEQ ID NO: 1253, or SEQ ID NO: 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265; or b) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269.
2. An expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of: a) SEQ ID NO: 17, SEQ ID NO: 1250, or SEQ ID NO: 1262, b) SEQ ID NO: 13 or SEQ ID NO: 15, or c) SEQ ID NO: 1241, SEQ ID NO: 1251, SEQ ID NO: 1252, SEQ ID NO: 1253, or SEQ ID NO: 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a termination sequence.
3. An expression cassette comprising: a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a) SEQ ID NO: 1002, SEQ ID NO: 1017, SEQ ID NO: 1264, or SEQ ID NO: 1265, or b) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269.
4. An expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs:60, 708 to 1240, 1242, 1243 to 1247, 1254 to 1257, 1264 to 1272, 1275, or 1287 to 1289.
5. An expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a termination sequence.
6. An expression cassette comprising: a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs:60, 708 to 1240, 1242, 1243 to 1247, 1254 to 1257, 1264 to 1272, 1275, or 1287 to 1289.
7. 7. The expression cassette of any one of claims 4 to 6, wherein the promoter sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs:13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263.
8. 7. The expression cassette of any one of claims 4 to 6, wherein the promoter sequence comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs:13 to 17, 167 to 707, 1241, 1248 to 1253, or 1259 to 1263.
9. 9. The expression cassette of any one of claims 4 to 8, wherein the termination sequence comprises a sequence having at least 90% sequence identity to any one of SEQ ID NOs:60, 708 to 1240, 1242, 1243 to 1247, 1254 to 1257, 1264 to 1272, 1275, or 1287 to 1289.
10. 9. The expression cassette of any one of claims 4 to 8, wherein the termination sequence comprises a sequence having at least 95% sequence identity to any one of SEQ ID NOs:60, 708 to 1240, 1242, 1243 to 1247, 1254 to 1257, 1264 to 1272, 1275, or 1287 to 1289.
11. The expression cassette of any one of claims 1 to 10, wherein the promoter sequence comprises SEQ ID NO:
17.
12. 11. The expression cassette of any one of claims 1 to 10, wherein the promoter sequence comprises SEQ ID NO: 1262.
13. 11. The expression cassette of any one of claims 1 to 10, wherein the promoter sequence comprises SEQ ID NO: 1250.
14. 11. The expression cassette of any one of claims 1 to 10, wherein the promoter sequence comprises SEQ ID NO: 1251.
15. 11. The expression cassette of any one of claims 1 to 10, wherein the promoter sequence comprises SEQ ID NO: 1252.
16. 11. The expression cassette of any one of claims 1 to 10, wherein the promoter sequence comprises SEQ ID NO: 1253.
17. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1264.
18. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1265.
19. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1254.
20. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1255.
21. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1257.
22. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO:
60.
23. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1242.
24. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1269.
25. 17. The expression cassette of any one of claims 1 to 16, wherein the termination sequence comprises SEQ ID NO: 1017.
26. 26. The expression cassette of any one of claims 1 to 25, wherein the small RNA payload comprises an engineered guide RNA capable of hybridizing to a target sequence.
27. 27. The expression cassette of Claim 26, wherein the engineered guide RNA is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% reverse complementary to the target sequence.
28. 28. The expression cassette of Claim 26 or 27, wherein the engineered guide RNA comprises at least one base pair mismatch to the target sequence.
29. 29. The expression cassette of any one of claims 26 to 28, wherein the target sequence comprises an adenosine residue.
30. 30. The expression cassette of any one of claims 26 to 29, wherein the target sequence is an RNA sequence.
31. 31. The expression cassette of claim 30, wherein the RNA sequence is mRNA or pre-mRNA.
32. 32. The expression cassette of any one of claims 26 to 31, wherein the target sequence comprises a G to A mutation compared to the wild-type sequence.
33. 33. The expression cassette of any one of claims 26 to 32, wherein the target sequence comprises a missense or nonsense mutation compared to the wild-type sequence.
34. 34. The expression cassette of any one of claims 26 to 33, wherein the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-inducible kinase 1 (PINK1), or methyl-CpG binding protein 2 (MECP2).
35. 35. The expression cassette of any one of claims 26-34, wherein the payload sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:1273, SEQ ID NO:1274, or SEQ ID NO:
61.
36. 36. The expression cassette of any one of claims 1 to 35, wherein the small RNA payload comprises an antisense oligonucleotide, siRNA, shRNA, miRNA, or tracrRNA.
37. 37. The expression cassette of any one of claims 1 to 36, wherein the small RNA payload is at least 20 nucleotide residues and at most 500 nucleotide residues in length.
38. 38. The expression cassette of any one of claims 1 to 37, wherein the small RNA payload is at least 60 residues and at most 100 residues in length.
39. 38. The expression cassette of any one of claims 1 to 37, wherein the small RNA payload is at least 80 residues and at most 120 residues in length.
40. 38. The expression cassette of any one of claims 1 to 37, wherein the small RNA payload is at least 100 residues and at most 140 residues in length.
41. 38. The expression cassette of any one of claims 1 to 37, wherein the small RNA payload is at least 130 residues and at most 170 residues in length.
42. 42. The expression cassette of any one of claims 1 to 41, wherein the payload sequence further comprises an Sm binding sequence or a hairpin sequence.
43. 43. The expression cassette of claim 42, wherein the hairpin sequence comprises a U7 hairpin.
44. 44. The expression cassette of claim 42 or 43, wherein the hairpin sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:52 or SEQ ID NO:54, or the Sm binding sequence comprises at least 80%, at least 85%, at least 90%, at least 95%, or 100% sequence identity to SEQ ID NO:56 or SEQ ID NO:
58.
45. 45. The expression cassette of any one of claims 1 to 44, wherein the expression cassette has a length of at least 1300 nucleotide residues and at most 2160 nucleotide residues.
46. 46. The expression cassette of any one of claims 1 to 45, wherein the expression cassette comprises at least 80% sequence identity to the U1 or U7 sequence.
47. 47. The expression cassette of claim 46, wherein the U1 sequence is a mouse U1 sequence or a human U1 sequence.
48. 47. The expression cassette of claim 46, wherein the U7 sequence is a mouse U7 sequence or a human U7 sequence.
49. 49. The expression cassette of any one of claims 1 to 48, wherein the promoter sequence comprises a zinc finger 143 motif capable of recruiting the ZNF143 transcription factor.
50. 50. The expression cassette of any one of claims 1 to 49, wherein the promoter sequence comprises an OCT-1 transcription factor binding sequence capable of recruiting an OCT-1 transcription factor.
51. 51. An expression cassette according to any one of claims 1 to 50, wherein the promoter sequence comprises proximal sequence elements capable of recruiting SNAPc.
52. 52. The expression cassette of claim 51, wherein the proximal sequence elements are capable of integrator-dependent recruitment of RNA polymerase II.
53. 53. The expression cassette of any one of claims 1 to 52, wherein the small RNA payload is capable of forming a guide-target RNA scaffold comprising structural features upon hybridization of the small RNA payload to a target sequence.
54. 54. The expression cassette of claim 53, wherein the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or a combination thereof.
55. 55. The expression cassette of claim 54, wherein the structural feature comprises the bulge, and the bulge is a symmetric bulge.
56. 55. The expression cassette of claim 54, wherein the structural feature comprises the bulge, and the bulge is an asymmetric bulge.
57. 55. The expression cassette of claim 54, wherein the structural feature comprises the internal loop, and the internal loop is a symmetric internal loop.
58. 55. The expression cassette of claim 54, wherein the structural feature comprises the internal loop, and the internal loop is an asymmetric internal loop.
59. 55. The expression cassette of claim 54, wherein the structural feature comprises the hairpin, and the hairpin is a recruiting hairpin or a non-recruiting hairpin.
60. 60. The expression cassette of any one of claims 43 to 59, wherein the guide-target RNA scaffold comprises a wobble base pair.
61. A recombinant polynucleotide encoding one or more of the expression cassettes of any one of claims 1 to 60.
62. 62. The recombinant polynucleotide of claim 61, encoding two of the expression cassettes of any one of claims 1 to 60, comprising a first promoter, a second promoter, a first termination sequence, and a second termination sequence.
63. 63. The recombinant polynucleotide of claim 62, wherein the first promoter and the second promoter are the same.
64. 63. The recombinant polynucleotide of claim 62, wherein the first promoter and the second promoter are different.
65. 65. The recombinant polynucleotide of any one of claims 62 to 64, wherein the first termination sequence and the second termination sequence are the same.
66. 65. The recombinant polynucleotide of any one of claims 62 to 64, wherein the first termination sequence and the second termination sequence are different.
67. 67. The recombinant polynucleotide of any one of claims 62 to 66, wherein the first promoter comprises SEQ ID NO:
17.
68. 68. The recombinant polynucleotide of claim 62 or any one of claims 64 to 67, wherein the second promoter comprises SEQ ID NO: 1262.
69. 69. The recombinant polynucleotide of any one of claims 62 to 68, wherein the first termination sequence comprises SEQ ID NO:1264.
70. 70. The recombinant polynucleotide of any one of claims 62-64 or 66-69, wherein the second termination sequence comprises SEQ ID NO:1265.
71. 63. The recombinant polynucleotide of Claim 62, wherein: (a) the first promoter sequence comprises SEQ ID NO: 17, the first termination sequence comprises SEQ ID NO: 1264, the second promoter sequence comprises SEQ ID NO: 1262, and the second termination sequence comprises SEQ ID NO: 1265; or (b) the first promoter sequence comprises SEQ ID NO: 17, the first termination sequence comprises SEQ ID NO: 1265, the second promoter sequence comprises SEQ ID NO: 1262, and the second termination sequence comprises SEQ ID NO: 1264.
72. A viral vector encapsidated with an expression cassette according to any one of claims 1 to 60 or a recombinant polynucleotide according to any one of claims 61 to 71.
73. 73. The viral vector of claim 72, wherein the viral vector comprises two or more, three or more, or four or more expression cassettes of any one of claims 1 to 60.
74. 74. The viral vector of claim 72 or 73, wherein the viral vector is an adeno-associated viral vector.
75. The adeno-associated virus vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AA V11, AAV12, AAV13, AAV14, AAV15, AAV16, AAV-DJ, AAV-DJ / 8, AAV-DJ / 9, AAV1 / 2, AAV. rh8, AAV. rh10, AAV. rh20, AAV. rh39, AAV. Rh43, AAV. Rh74, AAV. v66, AAV. Oligo001, AAV. SCH9, AAV. r3.45, AAV. RHM4-1, AAV. hu37, AAV. Anc80, AAV. Anc80L65, AAV. 7m8, AAV. PhP. eB, AAV. PhP. V1, AAV. PHP. B. AAV. PhB. C1, AAV. PhB. C2, AAV. PhB. C3, AAV. PhB. C6, AAV. cy5, AAV2.5, AAV2tYF, AAV3B, AAV. LK03, AAV. HSC1, AAV. HSC2, AAV. HSC3, AAV. HSC4, AAV. HSC5, AAV. HSC6, AAV.
75. The viral vector of claim 74, wherein the viral vector is selected from the group consisting of AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15, AAV.HSC16, AAV.HSC17, AAVhu68, chimeras thereof, and combinations thereof.
76. 76. A pharmaceutical composition comprising the expression cassette of any one of claims 1 to 60, the recombinant polynucleotide of any one of claims 61 to 71, or the viral vector of any one of claims 72 to 75, and a pharmaceutically acceptable excipient, carrier, diluent, or a combination thereof.
77. 10. A method of expressing a small RNA payload in a cell, the method comprising delivering an expression cassette of any one of claims 1-60, a recombinant polynucleotide of any one of claims 61-71, a viral vector of any one of claims 72-75, or a pharmaceutical composition of claim 76 to a cell, and expressing the small RNA payload encoded by the expression cassette in the cell.
78. 1. A method for editing a target sequence, said method comprising: delivering to a cell encoding said target sequence an expression cassette according to any one of claims 1 to 60, a recombinant polynucleotide according to any one of claims 61 to 71, a viral vector according to any one of claims 72 to 75, or a pharmaceutical composition according to claim 76; expressing the small RNA payload in the cell, the small RNA payload comprising an engineered guide RNA capable of hybridizing to a target sequence; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; editing the target sequence with the editing enzyme.
79. 1. A method for editing a target sequence, said method comprising: delivering an expression cassette to the cell encoding the target sequence, the expression cassette comprising: a) SEQ ID NO: 17, SEQ ID NO: 1250, or SEQ ID NO: 1262; b) SEQ ID NO: 13 or SEQ ID NO: 15, or c) a sequence having at least 80% sequence identity to any one of SEQ ID NO: 1241, SEQ ID NO: 1251, SEQ ID NO: 1252, SEQ ID NO: 1253, or SEQ ID NO: 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265, or b) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269; expressing the small RNA payload in the cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; editing the target sequence with the editing enzyme.
80. 1. A method for editing a target sequence, said method comprising: delivering an expression cassette to the cell encoding the target sequence, the expression cassette comprising: a) SEQ ID NO: 17, SEQ ID NO: 1250, or SEQ ID NO: 1262; b) SEQ ID NO: 13 or SEQ ID NO: 15, or c) a sequence having at least 80% sequence identity to any one of SEQ ID NO: 1241, SEQ ID NO: 1251, SEQ ID NO: 1252, SEQ ID NO: 1253, or SEQ ID NO: 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a termination sequence; expressing the small RNA payload in the cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; editing the target sequence with the editing enzyme.
81. 1. A method for editing a target sequence, said method comprising: delivering an expression cassette to the cell encoding the target sequence, the expression cassette comprising a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265, or b) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269; expressing the small RNA payload in the cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; editing the target sequence with the editing enzyme.
82. 1. A method for editing a target sequence, said method comprising: delivering an expression cassette to the cell encoding the target sequence, wherein the expression cassette comprises a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13-17, 167-707, 1241, 1248-1253, or 1259-1263; and a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NOs:708 to 1240, SEQ ID NO:1242, SEQ ID NOs:1243 to 1247, SEQ ID NOs:1254 to 1257, SEQ ID NOs:1264 to 1272, SEQ ID NO:1275, or SEQ ID NOs:1287 to 1289; expressing the small RNA payload in the cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; editing the target sequence with the editing enzyme.
83. 1. A method for editing a target sequence, said method comprising: delivering an expression cassette to a cell encoding the target sequence, the expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13-17, 167-707, 1241, 1248-1253, or 1259-1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a termination sequence; expressing the small RNA payload in the cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; editing the target sequence with the editing enzyme.
84. 1. A method for editing a target sequence, said method comprising: delivering an expression cassette to a cell encoding the target sequence, the expression cassette comprising: a promoter sequence; a payload sequence under transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs:60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289; expressing the small RNA payload in the cell; forming a guide-target RNA scaffold upon hybridization of the small RNA payload to the target sequence; recruiting an editing enzyme to the target sequence; editing the target sequence with the editing enzyme.
85. 85. The method of any one of claims 77 to 84, wherein the promoter sequence comprises SEQ ID NO:
17.
86. 85. The method of any one of claims 77 to 84, wherein the promoter sequence comprises SEQ ID NO: 1262.
87. 85. The method of any one of claims 77 to 84, wherein the promoter sequence comprises SEQ ID NO: 1250.
88. 85. The method of any one of claims 77 to 84, wherein the promoter sequence comprises SEQ ID NO: 1251.
89. 85. The method of any one of claims 77 to 84, wherein the promoter sequence comprises SEQ ID NO: 1252.
90. 85. The method of any one of claims 77 to 84, wherein the promoter sequence comprises SEQ ID NO: 1253.
91. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1264.
92. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1265.
93. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1254.
94. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1255.
95. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1257.
96. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO:
60.
97. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1242.
98. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1269.
99. 91. The method of any one of claims 77 to 90, wherein the termination sequence comprises SEQ ID NO: 1017.
100. 99. The method of any one of claims 78 to 99, wherein the target sequence comprises a mutation compared to the wild-type sequence.
101. 101. The method of claim 100, wherein the mutation in the target sequence is corrected by editing the target sequence.
102. 102. The method of claim 100 or 101, wherein the mutation is a missense mutation.
103. 102. The method of claim 100 or 101, wherein the mutation is a nonsense mutation.
104. 104. The method of any one of claims 100 to 103, wherein the mutation is a G to A mutation.
105. 105. The method of any one of claims 100 to 104, wherein the mutation is associated with a disease.
106. 106. The method of claim 105, wherein the disease is a synucleinopathy, Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy due to strain on pressure palsies, Ewan-Harrell-Lupski syndrome, tauopathy, Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn's disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha-1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease.
107. 107. The method of any one of claims 78 to 106, wherein the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-inducible kinase 1 (PINK1), or methyl-CpG binding protein 2 (MECP2).
108. 108. The method of claims 78-107, wherein editing the target sequence comprises editing an untranslated region of the target sequence.
109. 109. The method of claim 108, wherein the untranslated region is a 5' untranslated region or a 3' untranslated region.
110. 110. The method of claim 109, wherein the 3' untranslated region is a polyadenylation sequence.
111. 111. The method of any one of claims 78 to 110, wherein editing the target sequence comprises editing a translation start site.
112. 112. The method of any one of claims 78 to 111, wherein editing the target sequence alters expression of the target sequence.
113. 113. The method of Claim 112, wherein editing the target sequence increases expression of the target sequence.
114. 113. The method of claim 112, wherein editing the target sequence reduces expression of the target sequence.
115. 1. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising the expression cassette of any one of claims 1 to 60, the recombinant polynucleotide of any one of claims 61 to 71, the viral vector of any one of claims 72 to 75, or the pharmaceutical composition of claim 76; delivering the expression cassette to cells of the subject; expressing the small RNA payload in the cell, thereby treating the disease.
116. 1. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette, the expression cassette comprising: a) SEQ ID NO: 17, SEQ ID NO: 1250, or SEQ ID NO: 1262; b) SEQ ID NO: 13 or SEQ ID NO: 15, or c) a sequence having at least 80% sequence identity to any one of SEQ ID NO: 1241, SEQ ID NO: 1251, SEQ ID NO: 1252, SEQ ID NO: 1253, or SEQ ID NO: 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265, or b) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269; delivering the expression cassette to cells of the subject; expressing the small RNA payload in the cell, thereby treating the disease.
117. 1. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette, the expression cassette comprising: a) SEQ ID NO: 17, SEQ ID NO: 1250, or SEQ ID NO: 1262; b) SEQ ID NO: 13 or SEQ ID NO: 15, or c) a sequence having at least 80% sequence identity to any one of SEQ ID NO: 1241, SEQ ID NO: 1251, SEQ ID NO: 1252, SEQ ID NO: 1253, or SEQ ID NO: 1263; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a termination sequence; delivering the expression cassette to cells of the subject; expressing the small RNA payload in the cell, thereby treating the disease.
118. 1. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette, the expression cassette comprising: a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; a) SEQ ID NO:1002, SEQ ID NO:1017, SEQ ID NO:1264, or SEQ ID NO:1265, or b) a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NO:771, SEQ ID NO:930, SEQ ID NO:1007, SEQ ID NO:1021, SEQ ID NO:1242, SEQ ID NO:1254, SEQ ID NO:1255, SEQ ID NO:1257, or SEQ ID NO:1269; delivering the expression cassette to cells of the subject; expressing the small RNA payload in the cell, thereby treating the disease.
119. 1. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette, the expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13-17, 167-707, 1241, 1248-1253, or 1259-1263; and a payload sequence under the transcriptional control of the promoter sequence, wherein the payload sequence comprises a small RNA payload; a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NO:60, SEQ ID NOs:708 to 1240, SEQ ID NO:1242, SEQ ID NOs:1243 to 1247, SEQ ID NOs:1254 to 1257, SEQ ID NOs:1264 to 1272, SEQ ID NO:1275, or SEQ ID NOs:1287 to 1289; delivering the expression cassette to cells of the subject; expressing the small RNA payload in the cell, thereby treating the disease.
120. 1. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette, the expression cassette comprising: a promoter sequence comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs:13-17, 167-707, 1241, 1248-1253, or 1259-1263; a payload sequence under the transcriptional control of said promoter sequence, said payload sequence comprising a small RNA payload; and a termination sequence; delivering the expression cassette to cells of the subject; expressing the small RNA payload in the cell, thereby treating the disease.
121. 1. A method of treating a disease in a subject, the method comprising: administering to the subject a composition comprising an expression cassette, the expression cassette comprising: a promoter sequence; a payload sequence under the transcriptional control of the promoter sequence, the payload sequence comprising a small RNA payload; and a termination sequence comprising a sequence having at least 80% identity to any one of SEQ ID NOs:60, 708-1240, 1242, 1243-1247, 1254-1257, 1264-1272, 1275, or 1287-1289; delivering the expression cassette to cells of the subject; expressing the small RNA payload in the cell, thereby treating the disease.
122. 122. The method of any one of claims 115 to 121, wherein the promoter sequence comprises SEQ ID NO:
17.
123. 122. The method of any one of claims 115 to 121, wherein the promoter sequence comprises SEQ ID NO: 1262.
124. 122. The method of any one of claims 115 to 121, wherein the promoter sequence comprises SEQ ID NO: 1250.
125. 122. The method of any one of claims 115 to 121, wherein the promoter sequence comprises SEQ ID NO: 1251.
126. 122. The method of any one of claims 115 to 121, wherein the promoter sequence comprises SEQ ID NO: 1252.
127. 122. The method of any one of claims 115 to 121, wherein the promoter sequence comprises SEQ ID NO: 1253.
128. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1264.
129. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1265.
130. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1254.
131. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1255.
132. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1257.
133. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO:
60.
134. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1242.
135. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1269.
136. 128. The method of any one of claims 115 to 127, wherein the termination sequence comprises SEQ ID NO: 1017.
137. 137. The method of any one of claims 115 to 136, wherein the disease is a synucleinopathy, Parkinson's disease, dementia with Lewy bodies, multiple system atrophy, Charcot-Marie-Tooth disease, hereditary neuropathy due to strain on pressure palsies, Ewan-Harrell-Lupski syndrome, tauopathy, Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal degeneration, chronic traumatic encephalopathy, autism, traumatic brain injury, Dravet syndrome, Crohn's disease, muscular dystrophy, B-cell leukemia, Dejerine-Sottas disease, Stargardt disease, alpha-1 antitrypsin deficiency, Tay-Sachs disease, cystic fibrosis, liposomal acid lipase deficiency, or Gaucher disease.
138. 138. The method of any one of claims 115-137, wherein the small RNA payload comprises an engineered guide RNA that hybridizes to a target sequence, and wherein the cell encodes the target sequence.
139. 139. The method of claim 138, wherein the target sequence encodes alpha-synuclein (SNCA), peripheral myelin protein 22 (PMP22), double homeobox 4 (DUX4), leucine-rich repeat kinase 2 (LRRK2), tau (MAPT), progranulin (GRN), the PMP22 duplication associated with Charcot-Marie-Tooth disease type 1A (CMT1A), ATP-binding cassette subfamily A member 4 (ABCA4), amyloid precursor protein (APP), alpha-1 antitrypsin (SERPINA1), hexosaminidase A (HEXA), cystic fibrosis transmembrane conductance regulator (CFTR), lipase A (LIPA), glucosylceramidase beta (GBA), PTEN-inducible kinase 1 (PINK1), or methyl-CpG binding protein 2 (MECP2).
140. 140. The method of Claim 138 or 139, further comprising forming a guide-target RNA scaffold upon hybridization of the engineered guide RNA to the target sequence, recruiting an editing enzyme to the target sequence, and editing the target sequence by the editing enzyme.
141. 141. The method of any one of claims 138 to 140, wherein the target sequence comprises a mutation compared to the wild-type sequence.
142. 142. The method of Claim 141, wherein the mutation in the target sequence is corrected by editing the target sequence.
143. 143. The method of claim 141 or 142, wherein the mutation is a missense mutation.
144. 143. The method of claim 141 or 142, wherein the mutation is a nonsense mutation.
145. 145. The method of any one of claims 141 to 144, wherein the mutation is a G to A mutation.
146. 146. The method of any one of claims 141 to 145, wherein the mutation is associated with the disease.
147. 147. The method of any one of claims 140 to 146, wherein editing the target sequence comprises editing an untranslated region of the target sequence.
148. 148. The method of claim 147, wherein the untranslated region is a 5' untranslated region or a 3' untranslated region.
149. 149. The method of claim 148, wherein the 3' untranslated region is a polyadenylation sequence.
150. 150. The method of any one of claims 140-149, wherein editing the target sequence comprises editing a translation start site.
151. 151. The method of any one of claims 140 to 150, wherein expression of the target sequence is altered by editing the target sequence.
152. 152. The method of claim 151, wherein editing the target sequence increases expression of the target sequence.
153. 152. The method of claim 151, wherein editing the target sequence reduces expression of the target sequence.
154. 154. The method of any one of Claims 78-114 or 140-153, wherein the guide-target RNA scaffold comprises a structural feature.
155. 155. The method of claim 154, wherein the structural feature is a bulge, a mismatch, an internal loop, a hairpin, or a combination thereof.
156. 156. The method of claim 155, wherein the structural feature comprises the bulge, and the bulge is a symmetrical bulge.
157. 156. The method of claim 155, wherein the structural feature comprises the bulge, and the bulge is an asymmetric bulge.
158. 158. The method of any one of claims 155 to 157, wherein the structural feature comprises the inner loop, and the inner loop is a symmetric inner loop.
159. 158. The method of any one of claims 155 to 157, wherein the structural feature comprises the internal loop, and the internal loop is an asymmetric internal loop.
160. 160. The method of any one of claims 155-159, wherein the structural feature comprises the hairpin, and the hairpin is a recruiting hairpin or a non-recruiting hairpin.
161. 161. The method of any one of Claims 78-114 or 140-160, wherein the guide-target RNA scaffold comprises a wobble base pair.
162. 162. The method of any one of claims 78-114 or 140-161, wherein the editing enzyme comprises ADAR, APOBEC, or a Cas nuclease.
163. 163. The method of claim 162, wherein the ADAR comprises ADAR1, ADAR2, ADAR3, or a combination thereof.
164. 164. The method of any one of claims 78-114 or 140-163, wherein the target sequence comprises RNA or DNA.
165. 165. The method of any one of claims 78-114 or 140-164, wherein the target sequence is mRNA or pre-mRNA.
166. 166. The method of any one of claims 78-114 or 140-165, wherein editing the target sequence comprises deamidating nucleotides of the target sequence.
167. 167. The method of any one of claims 78-114 or 140-166, wherein the target sequence is edited with an efficiency of at least 10%, at least 20%, or at least 25%.