Lipid compounds for nucleic acid delivery and related uses and medicaments containing same

Abstract

The present invention relates to lipid compounds for nucleic acid delivery and related uses, and pharmaceuticals containing the same. Specifically, the present invention relates to the use of lipid compounds containing one or more compounds having the following formula (I) in the preparation of products for nucleic acid delivery, pharmaceutical compositions containing the lipid compounds and nucleic acid molecules, and uses of the pharmaceutical compositions. [Case 1] TIFF2025529596000163.tif33165

Description

[Technical Field]

[0001] The present application relates to artificially synthesized lipids that can enhance nucleic acid delivery, as well as specific combinations of the artificially synthesized lipids with nucleic acids that can enhance nucleic acid target cells and target organs. [Background technology]

[0002] Over the past few decades, the concept of using nucleic acid molecules, including RNA molecules, as therapeutic agents has moved from concept to clinical reality. Indeed, nucleic acid molecules possess many properties that make them useful as therapeutic agents. Nucleic acid molecules can fold into complex higher-order structures, which allow them to interact with proteins, small molecules, or other nucleic acids, and some can even form catalytic centers. People commonly refer to siRNA, miRNA, and other non-coding small RNAs interchangeably as small nucleic acids or small RNAs (sRNAs). However, nucleic acids are generally considered poor options for therapeutic agents due to their easy degradation and short in vivo half-life.

[0003] Therefore, how to effectively deliver nucleic acid molecules, including small RNA molecules, to cells and target organs in the body to achieve their biological activity and therapeutic or prophylactic effects is an issue that needs to be considered by those skilled in the art. Summary of the Invention

[0004] The present invention is based in part on the discovery by the inventors of the delivery functionality of a series of sphingosine lipids. The inventors unexpectedly found that a combination of a sphingosine lipid within a specific carbon number range and a nucleic acid, or a combination of a sphingosine lipid within a specific carbon number range and a helper lipid with a nucleic acid, can effectively deliver nucleic acids into cells and into target organs.

[0005] In a first aspect, the present invention provides the use of a lipid composition in the preparation of a product / reagent for delivering a nucleic acid, the lipid composition comprising one or more compounds having the following formula (I): [ka] During the ceremony, A is a linear C 10~34 Alkyl groups and linear C 10~34 alkenyl groups, Q is —OH.

[0006] In certain embodiments, the present invention provides the use of a lipid composition in the preparation of a product / reagent for delivering a nucleic acid, the lipid composition comprising one or more compounds having the following formula (I): [ka] During the ceremony, A is a linear C 10~32 Alkyl groups and linear C 10~32 alkenyl groups, Q is —OH.

[0007] In certain embodiments, the present invention provides the use of a lipid composition in the preparation of a product / reagent for delivering a nucleic acid, the lipid composition comprising one or more compounds having the following formula (I): [ka] During the ceremony, A is a linear C 11~31 Alkyl groups and linear C 11~31 alkenyl groups, Q is —OH.

[0008] In certain embodiments, the present invention provides the use of a lipid composition in the preparation of a product / reagent for delivering a nucleic acid, the lipid composition comprising one or more compounds having the following formula (I): [ka] During the ceremony, A is a linear C 21~34 Alkyl group or linear C 21~34 alkenyl groups, Q is —OH.

[0009] Preferably, A of the present invention is a linear C 21~32 Alkyl groups and linear C 25~32 alkenyl groups, more preferably A is selected from linear C 25~30 Alkyl groups and linear C 25~30 alkenyl groups.

[0010] In certain embodiments, the products / reagents for delivering nucleic acids provided by the present invention deliver nucleic acids into the body of a subject, and preferably, the reagents are used to deliver nucleic acids into the body of a subject via oral, intramuscular, intravenous, subcutaneous, transdermal, intra-arterial, intraperitoneal, intrapulmonary, intracerebrospinal, intra-articular, intrasynovial, intrathecal, intraventricular, and / or inhalation routes.

[0011] In certain embodiments, the products / reagents for nucleic acid delivery provided by the present invention deliver nucleic acids to cells in vitro, preferably by direct contact with cells in vitro.

[0012] In certain embodiments, the lipid compositions provided herein may be used to deliver small RNA, preferably the small RNA is 14-32 nucleotides in length, and preferably the nucleic acid molecule is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides in length.

[0013] In another aspect, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds of formula (I): [ka] During the ceremony, A is a linear C 10~34 Alkyl group or linear C 10~34 alkenyl groups, Q is —OH.

[0014] In certain embodiments, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds of formula (I): [ka] During the ceremony, A is a linear C 10~32 Alkyl group or linear C 10~32 alkenyl groups, Q is —OH.

[0015] In certain embodiments, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds of formula (I): [ka] During the ceremony, A is a linear C 11~31 Alkyl group or linear C 11~31 alkenyl groups, Q is —OH.

[0016] In certain embodiments, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds of formula (I): [ka] During the ceremony, A is a linear C 21~34 Alkyl group or linear C 21~34 alkenyl groups, Q is —OH.

[0017] Preferably, A of the present invention is a linear C 21~32 Alkyl groups and linear C25~32 alkenyl groups, more preferably A is selected from linear C 25~30 Alkyl groups and linear C 25~30 alkenyl groups.

[0018] In certain embodiments, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably the RNA molecule is a small RNA, preferably it is a small RNA having a length of 14 to 32 nucleotides, preferably it is a small RNA having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides.

[0019] In another aspect, the present invention provides a method for preparing the pharmaceutical composition of the present invention as described above, the method comprising the step of mixing a lipid composition with a nucleic acid molecule.

[0020] In another aspect, the present invention provides the use of a pharmaceutical composition described herein in the preparation of a medicament for treating a disease in a subject, preferably wherein the medicament is administered to said subject by oral, intramuscular, intravenous, subcutaneous, transdermal, intraarterial, intraperitoneal, intrapulmonary, intracerebrospinal, intraarticular, intrasynovial, intrathecal, intraventricular, and / or inhalation route.

[0021] In another aspect, the present invention provides a compound according to formula (I): [ka] During the ceremony, A is a linear C 10~34 Alkyl groups and linear C 10~34 alkenyl groups, Q is —OH.

[0022] In certain embodiments, the present invention provides a compound according to formula (I): [ka] During the ceremony, A is a linear C 10~32 Alkyl groups and linear C 10~32 alkenyl groups, Q is —OH.

[0023] In certain embodiments, the present invention provides a compound according to formula (I): [ka] During the ceremony, A is a linear C 11~31 Alkyl groups and linear C 11~31 alkenyl groups, Q is —OH.

[0024] In another aspect, the present invention provides a composition for in vitro cell transfection, comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds of formula (I): [ka] During the ceremony, A is a linear C 10~34 Alkyl group or linear C 10~34 Alkenyl groups, preferably linear C 10~32 Alkyl group or linear C 10~32 alkenyl groups, Q is —OH.

[0025] Preferably, A of the present invention is a linear C 21~32 Alkyl groups and linear C 25~32 alkenyl groups, more preferably A is selected from linear C 25~30 Alkyl groups and linear C 25~30 alkenyl groups.

[0026] Specifically, the lipid composition comprises one or more compounds shown in Table 1.

[0027] In certain embodiments, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably the RNA molecule is a small RNA, preferably it is a small RNA having a length of 14 to 32 nucleotides, preferably it is a small RNA having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides.

[0028] Exemplarily, the small RNA of the present invention is selected from PGY-ssRNA-26 small RNA.

[0029] In certain embodiments, the present invention provides a compound according to formula (I): [ka] During the ceremony, A is a linear C 21~34 Alkyl groups and linear C 21~34 Alkenyl groups, preferably A is selected from linear C 21~32 Alkyl groups and linear C 25~32 alkenyl groups, more preferably A is selected from linear C 25~30 Alkyl groups and linear C 25~30 alkenyl groups, Q is —OH; Preferably, the compound is a compound shown in Table 1.

[0030] In one embodiment of the present invention, the present invention provides a package set comprising a compound represented by formula (I) described herein, or a lipid composition, or a product / reagent for nucleic acid delivery, or a pharmaceutical composition, and a nucleic acid, wherein the compound represented by formula (I), or the lipid composition, or the reagent for nucleic acid delivery, or the pharmaceutical composition, and the nucleic acid are each independently provided in a first container and a second container, and the first container and the second container are the same or different. Preferably, the package set contains any one or more of the above compounds, preferably any one or more of the compounds selected from Table 1.

[0031] In one embodiment of the present invention, the present invention provides a method for nucleic acid delivery, the method comprising administering to a subject a compound of formula (I), or a lipid composition, or a product / reagent for nucleic acid delivery, or a pharmaceutical composition, as described herein.

[0032] In one embodiment of the present invention, the present invention provides a method for treating a disease in a subject, the method comprising administering to the subject a compound of formula (I), or a lipid composition, or a product / reagent for nucleic acid delivery, or a pharmaceutical composition described herein.

[0033] In certain embodiments, the diseases include cancer, inflammation, fibrotic diseases, autoimmune diseases, infectious diseases, congenital and genetic diseases, connective tissue diseases, digestive diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, neurological diseases, and hematological diseases.

[0034] In certain embodiments, the cancer is selected from lung cancer, prostate cancer, breast cancer, head and neck cancer, esophageal cancer, gastric cancer, colon cancer, rectal cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, liver cancer, melanoma, kidney cancer, squamous cell carcinoma, or blood cancer.

[0035] In certain embodiments, the medicament is administered to the subject by oral, intramuscular, intravenous, subcutaneous, transdermal, intraarterial, intraperitoneal, intrapulmonary, intracerebrospinal, intraarticular, intrasynovial, intrathecal, intraventricular, and / or inhalation routes.

[0036] In another aspect, the present invention provides a method for preparing a compound of formula (I), the method being selected from any one of the following: Method a. [ka] Step a1. Reacting a compound represented by formula 1 with an olefin to produce a compound represented by formula 2; Step a2. Converting the compound of formula 2 into a compound of formula (I) (wherein A is a linear alkenyl group); Optional step a3. Reduction of a compound of formula (I) where A is a linear alkenyl group to obtain a compound of formula (I) where A is a linear alkyl group; where n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

[0037] Preferably, n=9, 10, 14, 16, 18, 19, or 24.

[0038] In one embodiment, step a1 is carried out under catalysis by benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium and tricyclohexylphosphine.

[0039] Preferably, the reaction conditions in step a1 are Grubbs 2nd generation, DCM, 40°C.

[0040] In one embodiment, step a2 is carried out in the presence of TFA.

[0041] Preferably, the reaction conditions in step a2 are TFA, ACN, H2O, and 80°C.

[0042] In one embodiment, step a3 is hydrogenation reduction, preferably Pd / C catalyzed hydrogenation reduction.

[0043] Preferably, the reaction conditions in step a3 are Pd / C, H2, MeOH / THF, 50°C.

[0044] Method b. [ka] Step b1. Reacting a compound of formula 1 with an olefin to produce a compound of formula 2; Step b2-1. Reducing the compound represented by formula 2 to obtain a compound represented by formula 3; Step b3. Converting the compound of formula 3 into a compound of formula (I) (wherein A is a linear alkyl group); or Step b2-2. Converting the compound represented by formula 2 into a compound represented by formula (I) (wherein A is a linear alkenyl group); where n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32.

[0045] Preferably, n=20, 21, 22, 23, 25, 26, 27, 28, 29, 30, or 31.

[0046] In one embodiment, step b1 is the same as step a1.

[0047] In one embodiment, step b2-1 is hydrogenation reduction, preferably Pd / C catalyzed hydrogenation reduction.

[0048] Preferably, the reaction conditions for step b2-1 are Pd / C, H2, MeOH / THF, and 50°C.

[0049] In one embodiment, step b3 is carried out in the presence of TFA.

[0050] Preferably, the reaction conditions in step b3 are TFA, ACN, H2O, and 80°C.

[0051] In one embodiment, step 2-2 is carried out in the presence of TFA.

[0052] Preferably, the reaction conditions in step b3 are TFA, ACN, H2O, and 80°C.

[0053] Method c. [ka]

[0054] Preferably, step c further comprises: [ka]

[0055] Preferably, step c further comprises: [ka] [Brief explanation of the drawings]

[0056] [Figure 1] 1 shows the results of small molecule nucleic acid delivery in HPAC cells in vitro. [Figure 2] 1 shows the results of small molecule nucleic acid delivery in H460 cells in vitro. [Figure 3] 1 shows the results of small molecule nucleic acid delivery in 293T cells in vitro. DETAILED DESCRIPTION OF THE INVENTION

[0057] In order to explain the present invention in more detail, this specification provides the following specific embodiments, and illustrates these specific embodiments in conjunction with the accompanying drawings, but the means of the present disclosure are not limited thereto.Those skilled in the art can appropriately modify the methods, uses, and small RNAs of the present invention in combination with the general knowledge in the art.As long as they can achieve the functions described in the present invention, they shall be within the scope of the present invention.

[0058] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0059] In certain embodiments of the invention, the invention provides the use of a lipid composition in the preparation of a reagent for delivering a nucleic acid, the lipid composition comprising one or more compounds having formula (I): [ka] In the formula, A is a linear C 10~32 Alkyl groups and linear C 10~32 alkenyl groups, optionally A is a linear alkyl group containing 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms, or a linear alkenyl group containing 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, or 32 carbon atoms; Q is —OH.

[0060] In certain embodiments, the present invention provides the use of a lipid composition in the preparation of a reagent for delivering a nucleic acid, the lipid composition comprising one or more compounds having formula (I): [ka] During the ceremony, A is a linear C 21~34 Alkyl groups and linear C 21~34optionally A is a linear alkyl group containing 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 carbon atoms, or a linear alkenyl group containing 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 carbon atoms; Q is —OH.

[0061] In certain embodiments, the lipid compositions provided by the present invention may contain one or more compounds of formula (I) provided by the present application or salts, hydrates, or solvates thereof, and may further contain one or more lipid compounds other than the compounds provided by the present application. Other lipid compounds may be, for example, neutral lipids, charged lipids, steroids, and polymer-conjugated lipids. A "neutral lipid" refers to a lipid compound that exists in an uncharged or neutral zwitterionic form at a selected pH value (e.g., physiological pH). A "charged lipid" refers to a lipid compound that exists in either a positively or negatively charged form regardless of pH values ​​within the effective physiological range (e.g., a pH of about 3 to about 9).

[0062] In certain embodiments, the lipid composition may further comprise one or more solvents, which may be mixed with a compound provided by the present application or a salt, hydrate, or solvate thereof to form a homogeneous mixture.

[0063] The lipid composition may further comprise an organic solvent or solvent mixture, such as chloroform, dichloromethane, diethyl ether, cyclohexane, cyclopentane, benzene, toluene, methanol, or other aliphatic alcohols (such as ethanol, propanol, isopropanol, butanol, tert-butanol, isobutanol, pentanol, and hexanol). These solvents may be used alone, in admixture, and / or optionally with a suitable buffer as the solvent in the lipid composition. The choice of solvent may generally be based on the polarity of the solvent, the ease with which the solvent can be removed at a later stage in the formation of the lipid-nucleic acid mixture, and / or pharmaceutically acceptable properties. In certain embodiments, the solvent is non-toxic or pharmaceutically acceptable. Exemplary pharmaceutically acceptable solvents include lower alcohols (1-6 carbon atoms), such as methanol, ethanol, n-propanol, isopropanol, and n-butanol. In certain embodiments, an appropriate amount of solvent may be used to allow the nucleic acid and lipids to form a clear, single-phase mixture.

[0064] In certain embodiments, the lipid compositions provided by the present invention comprise two or more compounds of formula (I).

[0065] In certain embodiments of the invention, the invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds of formula (I): [ka] In the formula, A is a linear C 10~32 Alkyl groups and linear C 10~32alkenyl groups, optionally A is a linear alkyl group containing 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms, or a linear alkenyl group containing 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, or 32 carbon atoms; Q is —OH; Preferably, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably it is a small RNA, preferably it is a small RNA having a length of 14 to 32 nucleotides, preferably it is a small RNA having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides.

[0066] In certain embodiments, the present invention provides a pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more compounds of formula (I): [ka] During the ceremony, A is a linear C 21~34 Alkyl group or linear C 21~34 alkenyl groups, Q is —OH; Preferably, the nucleic acid molecule is an RNA molecule or a DNA molecule, preferably it is a small RNA, preferably it is a small RNA having a length of 14 to 32 nucleotides, preferably it is a small RNA having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides.

[0067] In embodiments of the pharmaceutical compositions provided by the present invention, the mass ratio of lipid composition to nucleic acid molecule is 0.1:1, 0.2:1, 0.3:1, 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, 2.1:1, 2.2:1, 2.3:1, 2.4:1, 2.5:1, 2.6:1, 2.7:1, 2.8:1, 2.9:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, or 10:1, or a range between any of the above ratios.

[0068] In embodiments of the pharmaceutical compositions provided by the present invention, the mass ratio of lipid composition to nucleic acid molecule is 1:100, 1:30, 1:10, 1:3, 1:1, 3:1, 10:1, 30:1, 100:1, or a range between any of the above ratios.

[0069] In certain embodiments, the nucleic acid molecule is a therapeutic RNA molecule or a DNA molecule, preferably the nucleic acid molecule is used to treat a disease by targeting to a specific target, optionally the nucleic acid molecule may be used to treat cancer, inflammation, fibrotic diseases, autoimmune diseases, infectious diseases, congenital and genetic diseases, connective tissue diseases, digestive system diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, nervous system diseases, and blood system diseases.

[0070] In certain embodiments, the cancer is selected from lung cancer, prostate cancer, breast cancer, head and neck cancer, esophageal cancer, gastric cancer, colon cancer, rectal cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, liver cancer, melanoma, kidney cancer, squamous cell carcinoma, or blood cancer.

[0071] In certain embodiments, the present invention provides a method for preparing a pharmaceutical composition of the present invention, the method comprising the step of mixing a lipid composition with a nucleic acid molecule.

[0072] In certain embodiments, a method for preparing a pharmaceutical composition of the invention comprises: 1) mixing a lipid composition with a nucleic acid molecule; and 2) 25℃~150℃ Preferably, at 25°C, 30°C, 35°C, 36°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 110°C, 120°C, 130°C, 140°C, or 150°C, or any range between these points, for at least 5 minutes, e.g., 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 minutes.

[0073] term As used herein, the term "nucleic acid" includes "polynucleotide," "oligonucleotide," and "nucleic acid molecule," and generally refers to a DNA or RNA polymer that can be single-stranded or double-stranded, synthetic, or obtained (e.g., isolated and / or purified) from a natural source, and that can contain natural, non-natural, or modified nucleotides. In some embodiments, a nucleic acid does not contain any insertions, deletions, inversions, and / or substitutions. However, as discussed herein, in some cases it may be appropriate for a nucleic acid to contain one or more insertions, deletions, inversions, and / or substitutions.

[0074] As used herein, the term "vector" refers to a recombinant expression vector incorporating a nucleic acid described herein. The recombinant expression vector may be any suitable recombinant expression vector and may be used to transform or transfect any suitable host cell, including, but not limited to, plant expression vectors, animal expression vectors, and viral vectors (such as retroviral or lentiviral vectors). These vectors are well known to those skilled in the art and may be purchased commercially.

[0075] As used herein, the term "host cell" refers to any type of cell that can be transfected with a recombinant expression vector of the invention. A host cell can be a eukaryotic cell (such as a plant, animal, fungus, or algae) or a prokaryotic cell (such as a bacterium or protozoan).

[0076] Various transfection techniques are well known in the art, including, but not limited to, calcium phosphate co-precipitation, direct microinjection into cultured cells, electroporation, liposome-mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery using high-velocity microprojectile methods.

[0077] As used herein, "C i~j " represents a range of carbon atoms, where i and j are integers and j is greater than i, and the range of carbon atoms includes the endpoints (i.e., i and j) and each integer point between the endpoints. For example, C 21~34 means a range of 21 to 34 carbon atoms, including 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0078] As used herein, the term "alkyl" refers to a saturated linear or branched hydrocarbyl group.i~j The term "alkyl group" refers to a straight-chain alkyl group having i to j carbon atoms. In some embodiments, the alkyl group contains 21 to 34 carbon atoms. In some embodiments, the alkyl group contains 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0079] In some embodiments, the alkyl group contains 10 to 34 carbon atoms, preferably 10 to 32 carbon atoms. In some embodiments, the alkyl group contains 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0080] As used herein, the term "alkenyl" refers to a linear or branched hydrocarbyl group having at least one carbon-carbon double bond, which may be optionally substituted independently with one or more substituents described herein, including groups having "cis" and "trans" or "E" and "Z" configurations. In some embodiments, an alkenyl group contains 21 to 34 carbon atoms. In some embodiments, an alkenyl group contains 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0081] In some embodiments, the alkenyl group contains 10 to 34 carbon atoms, preferably 10 to 32 carbon atoms. In some embodiments, the alkyl group contains 10 carbon atoms, 11 carbon atoms, 12 carbon atoms, 13 carbon atoms, 14 carbon atoms, 15 carbon atoms, 16 carbon atoms, 17 carbon atoms, 18 carbon atoms, 19 carbon atoms, 20 carbon atoms, 21 carbon atoms, 22 carbon atoms, 23 carbon atoms, 24 carbon atoms, 25 carbon atoms, 26 carbon atoms, 27 carbon atoms, 28 carbon atoms, 29 carbon atoms, 30 carbon atoms, 31 carbon atoms, 32 carbon atoms, 33 carbon atoms, or 34 carbon atoms.

[0082] In some embodiments, an alkenyl group contains two or more carbon-carbon double bonds. When an alkenyl group contains two or more carbon-carbon double bonds, it is understood that the double bonds can be separated or conjugated. In some embodiments, an alkenyl group is an α-alkenyl.

[0083] As used herein, the term "delivery" encompasses both local and systemic delivery. "Local delivery" refers to the delivery of a therapeutic agent (e.g., a nucleic acid) directly to a target site within an organism. For example, a reagent can be delivered locally by direct injection into a target site (e.g., a disease site such as a tumor or an inflammatory site) or a target organ (e.g., the heart, spleen, lungs, kidneys, etc.). "Systemic delivery" refers to delivery that distributes a therapeutic agent (e.g., a nucleic acid) widely throughout the organism, thereby exposing most parts of the body to an effective amount of the therapeutic agent. To achieve widespread biodistribution, a blood lifetime is generally desired so that the therapeutic agent is not rapidly degraded or eliminated before reaching a target site distant from the administration site. Systemic delivery of lipid compositions can be by any suitable means, including, for example, oral, inhalation, gastrointestinal, intravenous, subcutaneous, and intraperitoneal.

[0084] As used herein, the term "lipid" refers to a class of organic compounds, including, but not limited to, esters of fatty acids, that are insoluble in water (e.g., less than about 0.01% by weight in water) but soluble in many organic solvents. Lipids can be, for example, simple lipids (e.g., fats, oils, and waxes), compound lipids (e.g., phospholipids and glycolipids), and derivatized lipids (e.g., steroids).

[0085] As used herein, the term "treating" includes treating a condition in a mammal (particularly a human) and includes (a) inhibiting the condition (i.e., preventing its onset), and / or (b) alleviating the condition (i.e., ameliorating the condition).

[0086] As used herein, the term "subject" refers to any human or non-human organism that may potentially benefit from treatment with a nucleic acid molecule contained in the pharmaceutical composition of the present invention. Exemplary subjects include patients with diseases, particularly those with cancer, inflammation, fibrotic diseases, autoimmune diseases, infectious diseases, congenital and genetic diseases, connective tissue diseases, digestive system diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, nervous system diseases, and blood system diseases. [Example]

[0087] The following examples are merely illustrative of the invention disclosed herein and should not be construed in any way as limiting the scope of protection of the appended claims.

[0088] The following strategies illustrate proposed synthetic routes. Using these strategies, the following guidelines, and the examples, one of ordinary skill in the art will be able to develop similar methods for preparing compounds within the scope of the present invention.

[0089] Example 1. Synthesis and mass spectrometry confirmation of sphingosine Sphingosine (d14:0) Synthesis Route Map: [ka] Synthetic Route: Step 1 tert-Butyl (4S)-4-[(E,1R)-1-hydroxydodecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (400 mg, 1.55 mmol), 1-undecene (311.79 mg, 2.02 mmol), benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium, and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and flushed with nitrogen three times. Under nitrogen protection, the mixture was stirred at 40 °C for 4 h. The mixture was filtered and the filtrate was dried by spin-drying. The crude product is purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to give tert-butyl (4S)-4-[(E,1R)-1-hydroxydodecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (250 mg, 651.78 μmol, 41.93% yield) as a brown oil. 1 H NMR (400 MHz, CDCl3) δ = 5.81 - 5.71 (m, 1H), 5.15 - 4.90 (m, 1H), 2.15 - 2.01 (m, 2H), 1.28 (m, 36H), 0.91 (t, J = 6.8 Hz, 3H).

[0090] Step 2 (E,2S,3R)-2-aminotetradecyl-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (46.05 mg, 403.87 μmol, 30 μL) in water (2 mL) is added to a solution of tert-butyl (4S)-4-[(E,1R)-1-hydroxydodecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (250 mg, 651.78 μmol) in acetonitrile (2 mL). The mixture is stirred at 80 °C for 4 hours. The pH is adjusted to 8 by adding saturated aqueous sodium bicarbonate solution. Extraction is performed three times with ethyl acetate (10 mL). The combined organic phases are washed with saturated brine (5 mL), dried over anhydrous Na2SO4, and filtered. The filtrate is concentrated under reduced pressure to give a colorless solid, (E,2S,3R)-2-aminotetradecyl-4-ene-1,3-diol (150 mg, 616.31 μmol, 94.56% yield). LCMS Rt = 3.756 min in 7 min chromatography, 10-80AB ESI calculated C 14 H 30 NO2[M+H] + 244.3, and measured value 244.1

[0091] Step 3 (2S,3R)-2-aminotetradecane-1,3-diol [ka] Under nitrogen protection, hydrous palladium on carbon (327.94 mg, 308.15 μmol, 10% purity) is added to a solution of (E,2R,3R)-2-aminotetradecyl-4-ene-1,3-diol (150 mg, 616.31 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The mixture is degassed and purged with hydrogen three times. The mixture is stirred at 50°C under a hydrogen atmosphere (50 psi) for 12 hours. Tetrahydrofuran (10 mL) is added to the mixture, and it is filtered. The filter cake is washed three times with tetrahydrofuran (10 mL). After concentrating the filtrate, the crude product is purified by preparative HPLC (chromatographic column: Phenomenex Luna C8 50*40 mm*5 μm, mobile phase: [water (formic acid)-methanol], gradient: 45%-95% B in 20 min) to give a white solid (2S,3R)-2-aminotetradecane-1,3-diol (35.8 mg, 145.88 μmol, yield 23.67%). LCMS Rt = 5.995 min in 7 min chromatography, 10-80AB ESI calculated C 14 H 32 NO2[M+H] + 246.4, and measured value 246.2 1 H NMR (400 MHz, CDCl3) δ = 5.50 - 5.40 (m, 1H), 4.05 - 3.95 (m, 1H), 3.87 - 3.70 (m, 2H), 3.60 - 3.45 (m, 1 H), 2.66 - 2.39 (m, 2H), 1.75 - 1.40 (m, 16H), 1.39 - 1.30 (m, 4H), 0.90 (t, J = 6.4 Hz, 3H).

[0092] Sphingosine (d15:0) Synthesis Route Map: [ka] Synthetic Route: Step 1 tert-Butyl (4S)-4-[(E,1R)-1-hydroxytridecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (400 mg, 1.55 mmol), 1-dodecene (340.14 mg, 2.02 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 8 h. After concentration under reduced pressure, the crude product is purified by silica gel flash column chromatography (eluent: 0–14% ethyl acetate in petroleum ether) to give a yellow oily substance, tert-butyl (4S)-4-[(E,1R)-1-hydroxytridecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (380 mg, 955.76 μmol, 61.49% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.83 - 5.57 (m, 1H), 5.52 - 5.32 (m, 1H), 4.24 - 3.74 (m, 4H), 2.10 - 1.90 (m, 2H), 1.53- 1.43 (m, 15H), 1.40 - 1.14 (m, 16H), 0.90 - 0.84 (m, 3H).

[0093] Step 2 (E,2S,3R)-2-aminopentadecyl-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (544.89 mg, 4.78 mmol, 354.98 μL) in water (2 mL) was added to a solution of (4S)-4-[(E,1R)-1-hydroxytridecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (380 mg, 955.76 μmol) in acetonitrile (2 mL). The mixture was stirred at 80 °C for 4 h. Saturated aqueous sodium bicarbonate was added to adjust the pH to 8. The mixture was filtered, and the filter cake was washed three times with water (10 mL) and dried under reduced pressure to give a brown solid, (E,2S,3R)-2-aminopentadecyl-4-ene-1,3-diol (100 mg, 388.48 μmol, 40.65% yield). The solid did not require further purification and was used directly in the next step. 1 H NMR (400 MHz, CDCl3) δ = 5.82 - 5.69 (m, 1H), 5.51 - 5.41 (m, 1H), 4.85 - 4.41 (m, 2H), 4.13 - 3.95 (m, 1H), 3.77 - 3.55 (m, 2H), 2.97 - 2.77 (m, 1H), 2.12 - 2.00 (m, 2H), 1.40 - 1.35 (m, 2H), 1.28 - 1.24 (m, 14H), 0.88 (t, J = 6.8 Hz, 3H).

[0094] Step 3 (2S,3R)-2-aminopentadecane-1,3-diol [ka] Under nitrogen protection, hydrous palladium on carbon (206.71 mg, 194.24 μmol, 10% purity) is added to a solution of (E,2S,3R)-2-aminopentadecyl-4-ene-1,3-diol (100 mg, 388.48 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (30 psi) at 50°C for 12 hours. Tetrahydrofuran (10 mL) is added to the mixture, which is then filtered. The filter cake is washed three times with tetrahydrofuran (10 mL). After concentrating the filtrate, the crude product is purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40 mm*5 μm, mobile phase: [water (formic acid)-methanol], gradient: 10% to 40% B in 20 min) to obtain a white solid, (2S,3R)-2-aminopentadecane-1,3-diol (10.6 mg, 34.70 μmol, yield 8.93%, formate salt). 1 H NMR (400 MHz, CD3OD) δ = 8.54 (br s, 1H), 3.85 - 3.65 (m, 3H), 3.20 - 3.11 (m, 1H), 1.56 - 1.46 (m, 2H), 1.41 - 1.26 (m, 20H), 0.90 (t, J = 6.8 Hz, 3H). LCMS Rt = 0.830 min in 1.5 min chromatography, 5-95AB_E ESI calculated C 15 H 34 NO2[M+H] + 260.3, and measurement 260.1 HPLC Rt = 0.790 min in an 8 min chromatography, ELSD, purity 98.862%.

[0095] Sphingosine (d19:1) & (d19:0) Synthesis Route Map: [ka] Synthetic Route: Step 1 tert-Butyl (4S)-4-[(E,1R)-1-hydroxyheptadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (400 mg, 1.55 mmol), 1-hexadecene (453.51 mg, 2.02 mmol, 580.68 μL), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 8 h. After concentration under reduced pressure, the crude product is purified by silica gel flash column chromatography (eluent: 0–14% ethyl acetate in petroleum ether) to give a yellow oily substance, tert-butyl (4S)-4-[(E,1R)-1-hydroxyheptadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 661.24 μmol, 42.54% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.76 - 5.67 (m, 1H), 5.58 - 5.36 (m, 1H), 4.13 - 3.79 (m, 4H), 2.04 - 1.96 (m, 2H), 1.70 - 1.30 (m, 23H), 1.27 - 1.24 (m, 16H), 0.93 - 0.83 (m, 3H).

[0096] Step 2 (E,2S,3R)-2-aminononadecyl-4-ene-1,3-diol [ka] Trifluoroacetic acid (753.94 mg, 6.61 mmol, 491.17 μL) is added to a mixture of tert-butyl (4S)-4-[(E,1R)-1-hydroxyheptadecan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 661.24 μmol) in acetonitrile (2 mL) and water (2 mL). The mixture is stirred at 80° C. for 4 hours. Concentration under reduced pressure gives the crude product as a yellow oil (200 mg, 637.92 μmol, 96.47% yield). The resulting mixture (100 mg, 318.96 μmol) was purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40 mm*5 μm, mobile phase: [water (formic acid)-methanol], gradient: 50% to 80% B in 20 min) to give a white solid (E,2S,3R)-2-aminononadecyl-4-ene-1,3-diol (10.9 mg, 25.49 μmol, yield 7.99%, trifluoroacetate salt). 1 H NMR (400 MHz, CD3OD) δ = 8.53 (s, 0.5H), 5.96 - 5.76 (m, 1H), 5.53 - 5.40 (m, 1H), 4.26 (t, J = 6.0 Hz, 1H), 3.82 - 3.75 (m, 1H), 3.70 - 3.62 (m, 1H), 3.20 - 3.14 (m, 2H), 2.15 - 2.05 (m, 2H), 1.47 - 1.40 (m, 2H), 1.29 (s, 22H), 0.90 (t, J = 6.8 Hz, 3H). 19 F NMR (376.5 MHz, CD3OD) δ = -76.926. LCMS Rt = 1.764 min in 7 min chromatography, 50-100AB ESI calculated C 19 H 39 NO2[M+H] + 314.3, and measured value 314.3 HPLC Rt = 2.253 min in an 8 minute chromatography, ELSD, purity 97.530%.

[0097] Step 3 (2S,3R)-2-aminononadecane-1,3-diol [ka] Under nitrogen protection, hydrous palladium on carbon (169.72 mg, 159.48 μmol, 10% purity) is added to a solution of (E,2S,3R)-2-aminononadecyl-4-ene-1,3-diol (100 mg, 318.96 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (30 psi) at 50°C for 12 hours. Tetrahydrofuran (10 mL) is added to the mixture, which is then filtered. The filter cake is washed three times with tetrahydrofuran (10 mL). After concentrating the filtrate, the crude product is purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40mm*5μm, mobile phase: [water (formic acid)-methanol], gradient: 20% to 50% B in 20 min) to obtain a white solid, (2S,3R)-2-aminononadecane-1,3-diol (25.7 mg, 71.08 μmol, yield 22.43%, formate salt). 1 H NMR (400 MHz, CD3OD) δ = 8.54 (br s, 1H), 3.84 - 3.65 (m, 3H), 3.23 - 3.09 (m, 1H), 1.55 - 1.45 (m, 2H), 1.35 - 1.26 (m, 28H), 0.90 (t, J = 6.8 Hz, 3H). LCMS Rt = 0.962 min in 1.5 min chromatography, 5-95AB ESI calculated C 19 H 42 NO2[M+H] + 316.3, and measured value 316.2 HPLC Rt = 2.105 min in an 8 min chromatography, ELSD, purity 99.824%.

[0098] Sphingosine (d21:1) & (d21:0) Synthesis Route Map [ka] Synthetic Route: Step 1 (4S)-4-[(E,1R)-1-hydroxynonadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (800 mg, 3.11 mmol), 1-octadecene (1.02 g, 4.04 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (263.94 mg, 310.89 μmol) in dichloromethane (12 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 4 h. After filtering the reaction solution and concentrating the filtrate under reduced pressure, the crude product is purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain a brown oily substance, (4S)-4-[(E,1R)-1-hydroxynonadecyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (600 mg, 1.25 mmol, 40.06% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.75 - 5.61 (m, 1H), 5.45 - 5.30 (m, 1H), 4.20 - 3.50 (m, 4H), 1.97 - 1.81 (m, 2H), 1.42 (s, 15H), 1.18 (s, 28H), 0.81 (t, J = 6.4 Hz, 3H).

[0099] Step 2 (E,2S,3R)-2-aminoheneicosan-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (1.42 g, 12.45 mmol, 925.13 μL) in water (4 mL) was added to a solution of (4S)-4-[(E,1R)-1-hydroxynonadec-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (600 mg, 1.25 mmol) in acetonitrile (4 mL). The mixture was stirred at 80 °C for 4 h. The reaction solution was purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40 mm*5 μm, mobile phase: [water (formic acid)-methanol], gradient: 27% to 57% B in 20 min) and lyophilized to give a white solid, (E,2S,3R)-2-aminohenicosan-4-ene-1,3-diol (15.6 mg, 34.24 μmol, 2.75% yield, trifluoroacetate salt). LCMS Rt = 3.223 min in 4 min chromatography, 10-80AB ESI calculated C 21 H 44 NO2[M+H] + 342.3, and measured value 342.3 1 H NMR (400 MHz, CD3OD) δ = 5.95 - 5.80 (m, 1H), 5.61 - 5.40 (m, 1H), 4.32 - 4.20 (m, 1H), 3.86 - 3.75 (m, 1H), 3.70 - 3.61 (m, 1H), 3.20 - 3.10 (m, 1H), 2.21 - 2.05 (m, 2H), 1.31 (s, 28H), 0.96 - 0.75 (m, 3H).

[0100] Step 3 (2S,3R)-2-aminoheneicosane-1,3-diol [ka] Under nitrogen protection, hydrous palladium on carbon (155.78 mg, 146.38 μmol, 10% purity) is added to a solution of (E,2S,3R)-2-aminohenicosan-4-ene-1,3-diol (100 mg, 292.77 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 hours. Tetrahydrofuran (10 mL) is added to the mixture, which is then filtered. The filter cake is washed three times with tetrahydrofuran (10 mL). After concentrating the filtrate, the crude product was purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40mm*5μm, mobile phase: [water (formic acid)-methanol], gradient: 50% to 80% B in 20 min) to obtain a white solid, (2S,3R)-2-aminohenicosane-1,3-diol (13.0 mg, 33.37 μmol, yield 11.39%, formate salt). 1 H NMR (400 MHz, CD3OD) δ = 8.54 (br s, 1H), 3.85 - 3.79 (m, 1H), 3.77 - 3.64 (m, 2H), 3.18 - 3.05 (m, 1H), 1.51 - 1.48 (m, 2H), 1.38 - 1.25 (m, 32H), 0.90 (t, J = 6.4 Hz, 3H). LCMS Rt = 3.082 min in 7 min chromatography, 50-100AB ESI calculated C 21 H 46 NO2[M+H] + 344.4, and measured value 344.3 HPLC Rt = 3.162 min in 8 min chromatography, ELSD, purity 96.003%.

[0101] Sphingosine (d22:0) Synthesis Route Map [ka] Synthetic Route: Step 1 [ka] α-Pinene (1A, 3.0 kg, 22.4 mol, 1.0 eq) is dissolved in acetone (30 L) and water (3 L), and potassium permanganate (6.0 kg, 38.5 mol, 1.7 eq) is added in portions within 2 hours at a temperature ranging from 0 to 5°C. After the addition is complete, the reaction solution is stirred overnight at 0 to 5°C until it turns dark black. When GC shows that the starting material is completely consumed, the reaction solution is filtered to remove the manganese dioxide, and the filtrate is concentrated to obtain the crude product. The crude product was dissolved in ethyl acetate (5 L) and filtered again to remove insoluble material, and the filtrate was washed with water (5 L) and saturated sodium bicarbonate (5 L), dried over anhydrous sodium sulfate, filtered, and concentrated to give a crude oil (1.7 kg), which after distillation (3-4 mmHg, 100-104 °C fraction collected) gave compound 1 (1.2 kg, 32% yield) with a GC purity of >97%.

[0102] Step 2 [ka] Compound 1 (1.0 kg, 5.9 mol, 1.0 eq) was dissolved in toluene (10 L) and glycine hydrochloride ethyl ester (2, 1.7 kg, 11.9 mol, 2.0 eq), triethylamine (1.3 kg, 13.1 mol, 2.2 eq), and boron trifluoride etherate (8.9 g, 59.5 mmol, 0.01 eq) were added. The mixture was heated to reflux under argon protection and reacted for 2-3 hours. LC-MS analysis indicated that approximately 5% of compound 1 remained. The reaction solution was cooled to room temperature, filtered, and the filter cake was rinsed with ethyl acetate (5 L). The filtrate was concentrated to give the crude product as an oil. The crude product is purified by basic silica gel column chromatography (petroleum ether / ethyl acetate = 15 / 1 to ethyl acetate) to give a yellow oily compound 3 (900 g), which is crystallized at low temperature from n-hexane (2.7 L) to give an off-white solid compound 3 (360 g, 24% yield).

[0103] Step 3 [ka] 1-Eicosanol (4A, 1.0 kg, 3.4 mol, 1.0 eq) and pyridine (0.8 kg, 10.1 mol, 3.0 eq) were dissolved in dichloromethane (15 L), cooled to 10 °C, and Dess-Martin reagent (1.7 kg, 4.0 mol, 1.2 eq) was added. The reaction was allowed to proceed at room temperature for 2 h. TLC showed that compound 4A was completely consumed. The reaction solution was quenched with saturated sodium sulfite (10 L), and the aqueous phase was extracted with dichloromethane (5 L). The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and concentrated to give the crude product as an oil. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 200 / 1 to 80 / 1) to give compound 4 (670 g, 67% yield) as an off-white solid. TLC: PE / EA = 20 / 1 (2,4-dinitrophenylhydrazine) R f (Compound 4A) = 0.3 R f (Compound 4) = 0.8

[0104] Step 4 [ka] Compound 3 (0.98 kg, 3.9 mol, 1.0 eq) is dissolved in dichloromethane (4 L). Under argon protection, at 0 °C, a solution of triisopropoxytitanium chloride (1.4 kg, 5.3 mol, 2.5 eq) in dichloromethane (4 L), triethylamine (1.2 L, 3.0 eq), and compound 4 (0.69 kg, 2.3 mol, 1.1 eq) in dichloromethane (4 L) are added in sequence. After 10 min of reaction, TLC indicates that compound 3 is completely consumed. The reaction is quenched by adding saturated brine (3 L). The reaction solution is filtered to remove titanium salts, the filter cake is rinsed with dichloromethane (2 L), and the aqueous phase is extracted with dichloromethane (2 L). The organic phases are combined, dried over anhydrous sodium sulfate, filtered, and concentrated to obtain the crude product. The crude product is dissolved in ethyl acetate (2 L), filtered to remove insoluble material, and concentrated to give compound 5 (2.1 kg, 91% yield) as an orange oil, which is a mixture of ethyl and isopropyl esters. TLC: PE / EA = 3 / 1(I2) R f (Compound 3) = 0.4 R f (Compound 5) = 0.6

[0105] Step 5 [ka] Compound 5 (3 kg, 5.5 mol) was dissolved in tetrahydrofuran (12 L), and prepared 1.0 M dilute hydrochloric acid (32 L) was added. The mixture was stirred at 35° C. for 48-72 hours. When TLC showed that compound 5 was completely consumed, the reaction solution was directly concentrated to give a crude solid product. The crude product was slurried in ethanol / ethyl acetate (2 / 5) (14 L) and then dried to give a pale yellow solid compound 6 (1.7 kg, 71% yield). TLC: PE / EA = 3 / 1 Rf(compound 5) = 0.6 Rf(compound 6) = 0.1

[0106] Step 6 [ka] Compound 6 (0.9 kg, 2.5 mol, 1.0 eq) was dispersed in deionized water (5.4 L) and ethanol (16.2 L), cooled to 0-10 °C, and sodium borohydride (0.6 kg, 20.1 mol, 8.0 eq) was added. The reaction was allowed to proceed at room temperature overnight. LCMS indicated the absence of starting material. The reaction was quenched by the addition of saturated ammonium chloride (5 L) and stirred for 30 min.

[0107] The two reaction solutions are combined and treated as follows: After combining, the reaction solution is filtered, the aqueous phase is extracted with chloroform (10 L), and the combined organic phases are concentrated to give an off-white solid. The solid is combined with the filter cake and then dissolved in deionized water (20 L) and methanol (5 L) at 100°C and stirred for 1 hour. The mixture is allowed to cool to room temperature, stirred overnight, filtered, and the filter cake is dried to give a pale yellow solid (1.8 kg). The solid is dissolved in methanol (30 L) under reflux, cooled to room temperature, filtered, and dried to give a pale yellow solid (1.5 kg). The solid is dissolved in chloroform / methanol = 8 / 1 (100 L) and passed through a filter membrane to remove insoluble materials. The filtrate is then concentrated to give sphingosine (d22:0) (1.2 kg, 77% yield) as an off-white solid. TLC: PE / EA = 1 / 1(I2) Rf(compound 6) = 0.4 Rf (sphingosine (d22:0)) = 0.1 LC-MS: 358.23 [M+1]+ 1 H NMR (400 MHz, methanol-d4) δ 3.73 (dd, J = 8.0, 4.0 Hz, 1H), 3.52-3.45 (m, 2H), 2.77-2.74 (m, 1H), 1.51 (s, 2H), 1.27 (s, 34H), 0.88 (t, J = 6.8 Hz, 3H).

[0108] Sphingosine (d23:1) & (d23:0) Synthesis Route Map [ka] Synthetic Route: Step 1 tert-Butyl (4S)-4-[(E,1R)-1-hydroxyhenicosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (400 mg, 1.55 mmol), 1-eicosene (566.89 mg, 2.02 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (131.97 mg, 155.45 μmol) in dichloromethane (6 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 8 h. After concentrating the reaction solution under reduced pressure, the crude product was purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain a yellow oily substance, tert-butyl (4S)-4-[(E,1R)-1-hydroxyhenicosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 549.23 μmol, 35.33% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.78 - 5.69 (m, 1H), 5.48 - 5.36 (m, 1H), 4.16 - 3.80 (m, 4H), 2.08 - 2.00 (m, 2H), 1.76 - 1.25 (m, 31H), 1.25 - 1.22 (m, 15H), 0.92 - 0.84 (m, 3H).

[0109] Step 2 (E,2S,3R)-2-aminotricosane-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (626.24 mg, 5.49 mmol, 407.97 μL) in water (2 mL) is added to a solution of (4S)-4-[(E,1R)-1-hydroxyhenicosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 549.23 μmol) in acetonitrile (2 mL). The mixture is stirred at 80 °C for 4 h. The crude product obtained after concentrating the reaction solution under reduced pressure was purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40 mm*5 μm, mobile phase: [water (formic acid)-methanol], gradient: 50% to 85% B in 20 min) and lyophilized to give a white solid, (E,2S,3R)-2-aminotricosan-4-ene-1,3-diol (4 mg, 8.27 μmol, yield 0.15%, trifluoroacetate salt). 1 H NMR (400 MHz, CD3OD) δ = 8.54 (br s, 1H), 5.90 - 5.79 (m, 1H), 5.53 - 5.43 (m, 1H), 4.27 (t, J = 5.6 Hz, 1H), 3.82 - 3.75 (m, 1H), 3.69 - 3.61 (m, 1H), 3.23 - 3.14 (m, 1H), 2.10 (q, J = 7.2 Hz, 2H), 1.46 - 1.40 (m, 2H), 1.29 (s, 30H), 0.90 (t, J = 6.8 Hz, 3H). 19 F NMR (376.5 MHz, CD3OD) δ = -76.926. LCMS Rt = 1.107 min in 1.5 min chromatography, 5-95AB ESI calculated C 23 H 48 NO2[M+H] + 370.4, and measured value 370.3 HPLC Rt = 3.661 min in 8 min chromatography, ELSD, purity 100.000%.

[0110] Step 3 (2S,3R)-2-aminotricosane-1,3-diol [ka] Under nitrogen protection, hydrous palladium on carbon (143.96 mg, 135.27 μmol, 10% purity) is added to a solution of (E,2S,3R)-2-aminotricosan-4-ene-1,3-diol (100 mg, 270.55 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (30 psi) at 50° C. for 12 hours. Tetrahydrofuran (10 mL) is added to the mixture, which is then filtered. The filter cake is washed three times with tetrahydrofuran (10 mL). After concentrating the filtrate, the crude product was purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40 mm*5 μm, mobile phase: [water (formic acid)-methanol], gradient: 50% to 85% B in 20 min) to obtain a white solid, (2S,3R)-2-aminotricosane-1,3-diol (5.4 mg, 12.93 μmol, yield 4.80%, formate salt). 1 H NMR (400 MHz, CD3OD) δ = 8.55 (s, 1H), 3.82 - 3.75 (m, 1H), 3.65 - 3.55 (m, 2H), 3.01 - 2.89 (m, 1H), 1.56 - 1.50 (m, 2H), 1.33 - 1.28 (m, 36H), 0.90 (t, J = 6.4 Hz, 3H). LCMS Rt = 1.118 min in 1.5 min chromatography, 5-95AB ESI calculated C 23 H 50 NO2[M+H] + 372.4, and measured value 372.2 HPLC Rt = 3.820 min in an 8 min chromatography, ELSD, purity 94.809%.

[0111] Sphingosine (d24:1) & (d24:0) Synthesis Route Map [ka] Synthetic Route: Step 1 tert-Butyl (4S)-4-(1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate [ka] Vinylmagnesium bromide (1M, 49.07 mL, 1.5 eq) is added dropwise over 30 minutes at −78° C. to a solution of tert-butyl (S)-4-formyl-2,2-dimethyloxazolidine-3-carboxylate (7.5 g, 32.71 mmol, 1 eq) in THF (75 mL). The mixture is stirred at −78° C. for 2 hours, then heated to 25° C. and stirred for an additional 5 hours. The reaction mixture is quenched with saturated aqueous ammonium chloride solution (50 mL), and the aqueous phase is extracted with ethyl acetate (50 mL×3). The combined organic phases are washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to give tert-butyl (4S)-4-(1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate (7 g, 27.20 mmol, 83.1% yield) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ = 5.92 - 5.80 (m, 1H), 5.43 - 5.34 (m, 1H), 5.26 - 5.19 (m, 1H), 4.31 - 4.20 (m, 1H), 4.08 - 3.82 (m, 3H), 1.56 - 1.47 (m, 15H).

[0112] Step 2 (S)-tert-Butyl 4-((R)-1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate [ka] tert-Butyl (4S)-4-(1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate (5 g) was purified by SFC (column: DAICEL CHIRALCEL OX (250 mm × 30 mm, 10 μm), mobile phase: [CO-EtOH (0.1% NHHO)], B%: 10%, isocratic elution mode) to give tert-butyl (S)-4-((R)-1-hydroxyallyl)-2,2-dimethyloxazolidine-3-carboxylate (2.1 g, 8.16 mmol, yield 42.0%, ee 100%) as a colorless oil. 1 H NMR (400 MHz, CDCl3) δ = 5.92 - 5.78 (m, 1H), 5.43 - 5.33 (d, J = 17.2 Hz, 1H), 5.26 - 5.17 (d, J = 10.4 Hz, 1H), 4.33 - 3.86 (m, 4H), 1.58 - 1.45 (m, 15H). SFC Rt = 0.540 min in 3 min. Column: Chiral column OX-3 50x4.6 mm ID, 3 um. Mobile phase: Phase A (CO2), Phase B: (EtOH (0.05% DEA)). Elution gradient: 5% to 40% B in A. Flow rate: 3 mL / min. Detector: PDA. Column temperature: 35 °C. Back pressure: 100 bar.

[0113] Step 3 Eicosanal [ka] Pyridinium chlorochromate (PCC) (6.75 g, 31.32 mmol, 1.1 eq) was added to a DCM solution (400 mL) of 1-eicosanol (8.5 g, 28.47 mmol, 1 eq). The mixture was stirred at 25 °C for 16 h. Silica gel (10 g) was added to the brown suspension. The resulting mixture was stirred for 30 min, and the concentrated crude product was purified by silica gel flash column chromatography (eluent: 0-5% ethyl acetate in petroleum ether) to give eicosanal (6.5 g, 21.04 mmol, 73.9% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 9.77 (t, J = 2.0 Hz, 1H), 2.46 - 2.39 (m, 2H), 1.66 - 1.60 (m, 2H), 1.31 - 1.25 (m, 32H), 0.91 - 0.86 (t, J = 2.8 Hz, 3H).

[0114] Step 4 1-Hen Eikosen [ka] At 0 °C, potassium tert-butoxide (2.27 g, 20.23 mmol, 3 eq) is added to a solution of methyl(triphenyl)phosphonium bromide (7.23 g, 20.23 mmol, 3 eq) in THF (40 mL). The resulting yellow suspension is stirred at 25 °C for 1 h and cooled again to 0 °C. At 0 °C, a solution of eicosanal (2 g, 6.74 mmol, 1 eq) in THF (20 mL) is added dropwise. The mixture is stirred at 25 °C for 16 h. Water (10 mL) is added to the mixture, and it is extracted with ethyl acetate (15 mL × 3). The combined organic phases are washed with saturated brine (5 mL), dried over sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-heneicosene (1.7 g, 5.77 mmol, 85.5% yield) as a colorless solid. 1H NMR (400 MHz, CDCl3) δ = 5.89 - 5.76 (m, 1H), 5.04 - 4.90 (m, 2H), 2.08 - 2.01 (m, 2H), 1.40 - 1.36 (m, 2H), 1.30 - 1.24 (m, 32H), 0.91 - 0.87 (t, J = 5.2 Hz, 3H).

[0115] Step 5 tert-Butyl (4S)-4-[(E,1R)-1-hydroxydocosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium, tricyclohexylphosphine (98.98 mg, 116.58 μmol, 0.1 eq) is added to a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300.00 mg, 1.17 mmol, 1 eq) and 1-heneicosene (446.43 mg, 1.52 mmol, 1.3 eq) in dichloromethane (10 mL). The mixture is stirred at 40 °C for 16 hours. After concentrating the reaction solution under reduced pressure, the resulting crude product was purified by silica gel flash column chromatography (eluent: 0–25% ethyl acetate in petroleum ether) to obtain a yellow solid, tert-butyl (4S)-4-[(E,1R)-1-hydroxydocosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.28 g, 534.53 μmol, 45.8% yield). 1H NMR (400 MHz, CDCl3) δ = 5.81 - 5.69 (m, 1H), 5.50 - 5.40 (m, 1H), 4.22 - 3.83 (m, 4H), 2.09 - 2.01 (m, 2H), 1.56 - 1.48 (m, 15H), 1.31 - 1.22 (m, 34H), 0.91 - 0.86 (t, J = 6.4 Hz, 3H).

[0116] Step 6 (E,2S,3R)-2-aminotetracosan-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (30.70 mg, 269.24 μmol, 0.02 mL, 0.6 eq) in water (2 mL) was added to a solution of (4S)-4-[(E,1R)-1-hydroxydocosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (230.00 mg, 439.07 μmol, 1 eq) in acetonitrile (2 mL). The mixture was stirred at 80 °C for 4 h. The crude product obtained after concentration in vacuo was adjusted to pH 8 with saturated aqueous sodium bicarbonate, filtered, and the filter cake was dried under vacuum to give (E,2S,3R)-2-aminotetracosan-4-ene-1,3-diol (120 mg, 307.78 μmol, 70.1% yield, 98.4% purity) as a white solid. LCMS Rt = 1.786 min in 3 min chromatography, 30-100AB ESI calculated C 24 H 49 NO2[M+1] + 384.6, and measured value 384.4 1H NMR (400 MHz, CDCl3) δ = 5.85 - 5.63 (m, 1H), 5.57 - 5.43 (m, 1H), 4.24 - 3.93 (t, J = 6.0 Hz, 1H), 3.74 - 3.57 (m, 2H), 2.95 - 2.78 (m, 1H), 2.10 - 2.04 (m, 2H), 1.90 - 1.67 (m, 4H), 1.41 - 1.36 (m, 2H), 1.26 (s, 32H), 0.91 - 0.87 (t, J = 2.4 Hz, 3H).

[0117] Step 7 (2S,3R)-2-aminotetracosane-1,3-diol [ka] Under nitrogen protection, hydrous palladium on carbon (40 mg, 37.59 μmol, 10% purity) was added to a methanol solution (6 mL) of (E,2S,3R)-2-aminotetracosan-4-ene-1,3-diol (200 mg, 521.31 μmol, 1 eq). The mixture was stirred at 25 °C for 6 h under a hydrogen atmosphere. The mixture was filtered. After concentration of the filtrate, the crude product was purified by preparative HPLC (chromatography column: Phenomenex Luna C18 150 x 25 mm, 10 μm column; mobile phase: [water (formic acid)-methanol]; gradient: 60% to 90% B in 8 min) to give (2S,3R)-2-aminotetracosane-1,3-diol (7 mg, 18.13 μmol, 3.4% yield, 99.9% purity) as a white solid. LCMS Rt = 1.86 min in 3 min chromatography, 30-100AB ESI calculated C 24 H 51 NO2[M+1] + 386.6, and measured value 386.4 1H NMR (400 MHz, CDCl3) δ = 3.75 - 3.67 (s, 2H), 3.65 - 3.58 (s, 1H), 2.91 - 2.81 (s, 1H), 2.00 (br s, 4H), 1.51 - 1.48 (s, 2H), 1.28 - 1.25 (s, 38H), 0.90 - 0.87 (t, J = 5.6 Hz, 3H).

[0118] Sphingosine (d25:0) & (d25:1) Synthesis Route Map [ka] Synthetic Route: Step 1 (4S)-4-[(E,1R)-1-hydroxytricosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (1 g, 3.89 mmol), 1-docosene (1.56 g, 5.05 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (329.92 mg, 388.61 μmol) in dichloromethane (15 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 4 h. After filtering the reaction solution and concentrating the filtrate, the crude product is purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain a brown oily substance, (4S)-4-[(E,1R)-1-hydroxytricosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (910 mg, 1.69 mmol, 43.54% yield). 1H NMR (400 MHz, CDCl3) δ = 5.80 - 5.70 (m, 1H), 5.50 - 5.40 (m, 1H), 4.24 - 3.85 (m, 4H), 2.10 - 2.00 (m, 2H), 1.51 (s, 15H), 1.28 (s, 36H), 0.90 (t, J = 6.4 Hz, 3H).

[0119] Step 2 (4S)-4-[(1R)-1-Hydroxytricosyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, Pd / C (722.19 mg, 678.62 μmol, purity 10%) is added to a mixed solution of (4S)-4-[(E,1R)-1-hydroxytricosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (730 mg, 1.36 mmol) in methanol (4 mL) and tetrahydrofuran (4 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (50 psi) at 50°C for 16 hours. Tetrahydrofuran (10 mL) is added to the mixture, and it is filtered. The filter cake is washed three times with tetrahydrofuran (10 mL). The crude product obtained by concentrating the filtrate is purified by flash silica gel column chromatography (eluent: 20% ethyl acetate in petroleum ether) to give the compound (4S)-4-[(1R)-1-hydroxytricosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (560 mg, 1.04 mmol, yield 76.43%) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 4.20 - 3.75 (m, 4H), 1.65 - 1.55 (m, 15H), 1.27 (s, 42H), 0.95 - 0.85 (m, 3H).

[0120] Step 3 (2S,3R)-2-aminopentacosane-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (591.36 mg, 5.19 mmol, 385.25 μL) was added to a solution (3 mL) of (4S)-4-[(1R)-1-hydroxytricosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (560 mg, 1.04 mmol) in acetonitrile. The mixture was stirred at 80°C for 4 hours. The pH was adjusted to 8 by adding saturated aqueous sodium bicarbonate and then filtered. The filter cake was stirred at room temperature in HCl / dioxane (2 M, 10 mL) and filtered. After slurrying with methanol (10 mL) and lyophilization, a white solid (2S,3R)-2-aminopentacosane-1,3-diol (241 mg, 552.56 μmol, 53.27% yield, hydrochloride salt) was obtained. MS Rt = 1.92 - 2.14 min in 4 min chromatography, 50-100AB ESI calculated C 25 H 54 NO2[M+H] + 400.4, and measured value 400.4 1 H NMR (400 MHz, DMSO-d 6 ) δ = 7.90 - 7.70 (m, 3H), 5.10 - 4.85 (m, 2H), 3.75 - 3.65 (m, 2H), 3.60 - 3.50 (m, 1H), 3.10 - 3.00(m, 1H), 1.50 - 1.35 (m, 2H), 1.27 (s, 40H), 0.88 (t, J = 6.8 Hz, 3H).

[0121] Step 4 (E,2S,3R)-2-aminopentacosan-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (169.59 mg, 1.49 mmol, 110.48 μL) in water (1 mL) is added to a solution of (4S)-4-[(E,1R)-1-hydroxytricosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (80 mg, 148.74 μmol) in acetonitrile (1 mL). The mixture is stirred at 80° C. for 16 hours. After concentrating the reaction solution, the crude product was purified by preparative HPLC (chromatography column: Phenomenex Luna C8 50*40mm*5μm, mobile phase: [water (formic acid)-methanol], gradient: 30% to 60% B in 20 min) to obtain a white solid, (E,2S,3R)-2-aminopentacosan-4-ene-1,3-diol (9.7 mg, 21.86 μmol, yield 14.70%, formate salt). LCMS Rt = 1.140 min in 1.5 min chromatography, 5-95AB ESI calculated C 25 H 52 NO2[M+H] + 398.4, and measured value 398.3. 1 H NMR (400 MHz, CD3OD) δ = 8.57 (s, 1H), 5.94 - 5.80 (m, 1H), 5.55 - 5.45 (m, 1H), 4.25 - 4.21 (m, 1H), 3.81 - 3.75 (m, 1H), 3.72 - 3.61 (m, 1H), 3.16 - 3.05 (m, 1H), 2.23 - 2.15 (m, 2H), 1.51 - 1.41 (m, 2H), 1.31 (s, 34H), 0.92 (t, J = 6.8 Hz, 3H).

[0122] Sphingosine (d26:0) & (d26:1) Synthesis Route Map [ka] Synthetic Route: Step 1 Docosanal [ka] Pyridinium chlorochromate (PCC) (7.92 g, 36.74 mmol, 1.2 eq) was added to a DCM solution (400 mL) of 1-docosanol (10 g, 30.62 mmol, 1 eq). The mixture was stirred at 30 °C for 16 h. Silica gel (20 g) was added to the brown suspension. The resulting mixture was stirred for 30 min, and the concentrated crude product was purified by silica gel flash column chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to give docosanal (7.3 g, 22.49 mmol, 73.4% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 9.78 - 9.76 (t, J =2.0 Hz, 1H), 2.48 - 2.38 (m, 2H), 1.67 - 1.59 (m, 2H), 1.26 (s, 36H), 0.93 - 0.83 (t, J = 6.4 Hz, 3H).

[0123] Step 2 1-tricosene [ka] At 0°C, potassium tert-butoxide (4.15 g, 36.97 mmol, 3 eq) is added to a solution of methyl(triphenyl)phosphonium bromide (13.21 g, 36.97 mmol, 3 eq) in THF (40 mL). The resulting yellow suspension is stirred at 25°C for 1 hour and cooled to 0°C again. At 0°C, a solution of docosanal (4 g, 12.32 mmol, 1 eq) in THF (40 mL) is added dropwise. The mixture is stirred at 25°C for 16 hours. Water (30 mL) is added to the mixture, and it is extracted with ethyl acetate (40 mL x 3). The combined organic phase is washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-tricosene (3.4 g, 10.54 mmol, 85.5% yield) as a white solid. 1H NMR (400 MHz, CDCl3) δ = 5.88 - 5.77 (m, 1H), 5.03 - 4.97 (m, 1H), 4.96 - 4.91 (m, 1H), 2.08 - 2.02 (m, 2H), 1.41 - 1.36 (m, 2H), 1.29 - 1.25 (m, 36H), 0.91 - 0.87 (t, J = 6.8 Hz, 3H).

[0124] Step 3 (4S)-4-[(E,1R)-1-hydroxytetracosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium, tricyclohexylphosphine (188.64 mg, 222.20 μmol, 0.1 eq) is added to tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (571.78 mg, 2.22 mmol, 1 eq) and 1-tricosene (2 g, 6.20 mmol, 2.79 eq) in dichloromethane (20 mL). The mixture is stirred at 40 °C for 16 hours. After concentrating the reaction solution, the crude product is purified by silica gel flash column chromatography (eluent: 0–25% ethyl acetate in petroleum ether) to obtain a brown solid, (4S)-4-[(E,1R)-1-hydroxytetracosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.6 g, 1.09 mmol, 48.9% yield). 1 HNMR (400 MHz, CDCl3) δ = 5.79 - 5.71 (m, 1H), 5.48 (m, 1H), 4.19 - 3.87 (m, 4H), 2.08 - 2.02 (m, 2H), 1.54 - 1.49 (m, 15H), 1.26 (s, 38H), 0.91 - 0.86 (t, J = 6.0 Hz, 3H).

[0125] Step 4 (4S)-4-[(1R)-1-Hydroxytetracosyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, Pd / C (40 mg, 37.59 μmol, 10% purity) is added to a methanol solution (6 mL) of (4S)-4-[(E,1R)-1-hydroxytetracosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 543.59 μmol, 1 eq). The mixture is stirred under a hydrogen atmosphere at 25°C for 6 hours. After filtration, the filtrate is concentrated to give the compound (4S)-4-[(1R)-1-hydroxytetracosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.28 g, 505.51 μmol, 93.0% yield) as a white solid. 1 H NMR δ = 4.07 - 3.77 (m, 4H), 3.60 - 3.46 (s, 1H), 1.60 - 1.58 (s, 2H), 1.54 - 1.49 (m, 15H), 1.26 (s, 42H), 0.91 - 0.87 (t, J = 6.4 Hz, 3H).

[0126] Step 5 (2S,3R)-2-aminohexacosane-1,3-diol [ka] A solution of (4S)-4-[(1R)-1-hydroxytetracosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (260 mg, 469.40 μmol, 1 eq) in acetonitrile (3 mL) is added to a solution of trifluoroacetic acid (92.10 mg, 807.73 μmol, 1.72 eq) in water (3 mL). The mixture is stirred at 85 °C for 16 hours. The reaction solution is concentrated, and the resulting crude product is added to saturated aqueous sodium bicarbonate solution to adjust the pH to 8. After filtration, the filtrate is purified by preparative HPLC (chromatographic column: Welch Xtimate C1 100x30 mm, 5 μm, mobile phase: [water (formic acid)-methanol], gradient: 65%-95% B in 8 min) to give a white solid, (2S,3R)-2-aminohexacosane-1,3-diol (10 mg, 23.42 μmol, yield 5.0%, purity 96.88%). LCMS Rt = 1.989 min in 3 min chromatography, 30-100AB ESI calculated C 26 H 55 NO2[M+1] + 414.7, and measured value 414.4 1 H NMR (400 MHz, CD3OD) δ = 8.56 - 8.50 (s, 1H), 3.86 - 3.80 (dd, J = 4.0, 11.2 Hz, 1H), 3.79 - 3.74 (m, 1H), 3.73 - 3.66 (dd, J = 8.8, 11.6 Hz, 1H), 3.21 - 3.14 (m, 1H), 1.51 - 1.45 (m, 2H), 1.35 - 1.28 (m, 42H), 0.92 - 0.88 (t, J = 6.4 Hz, 3H). Step 6 (E,2S,3R)-2-aminohexacosan-4-ene-1,3-diol [ka] A solution of (4S)-4-[(E,1R)-1-hydroxytetracosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 543.59 μmol, 1 eq) in acetonitrile (3 mL) is added to a solution of trifluoroacetic acid (92.10 mg, 807.73 μmol, 1.49 eq) in water (3 mL). The mixture is stirred at 85 °C for 6 hours. The reaction solution is concentrated, and the resulting crude product is added to saturated aqueous sodium bicarbonate solution to adjust the pH to 8. After filtration, the filtrate is purified by preparative HPLC (chromatographic column: Welch Xtimate C1 100x30 mm, 5 μm, mobile phase: [water (formic acid)-methanol], gradient: 65%-95% B in 20 min) and lyophilized to give (E,2S,3R)-2-aminohexacosan-4-ene-1,3-diol (12.7 mg, 30.82 μmol, 5.6% yield, 99.9% purity) as a white solid. LCMS Rt = 1.839 min in 3 min chromatography, 30-100AB ESI calculated C 26 H 53 NO2[M+1] + 412.7, and measured value 412.4 1 H NMR (400 MHz, CD3OD) δ = 8.59 - 8.50 (s, 1H), 5.83 - 5.72 (m, 1H), 5.53 - 5.44 (m, 1H), 4.12 - 4.06 (m, 1H), 3.76 - 3.68 (m, 1H), 3.60 - 3.51 (m, 1H), 2.97 - 2.88 (m, 1H), 2.12 - 2.06 (m, 2H), 1.44 - 1.40 (m, 2H), 1.33 - 1.27 (m, 36H), 0.93 - 0.87 (t, J = 5.2 Hz, 3H).

[0127] Sphingosine (d27:1) & (d27:0) Synthesis Route Map [ka] Synthetic Route: Step 1 Tetracosane-1-bromide [ka] Triphenylphosphine (4.44 g, 16.92 mmol) is added to a solution of 1-tetracosanol (5 g, 14.10 mmol) in DCM (50 mL). N-Bromosuccinimide (3.01 g, 16.92 mmol) is then added to the mixture at 0 °C. The mixture is stirred at 25 °C for 1 hour. Saturated Na2SO3 solution (50 mL) is added, and the aqueous phase is extracted with DCM (50 mL x 3). The combined organic phase is washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give tetracosane-1-bromide (3.8 g, 9.10 mmol, 64.55% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 3.41 (t, J = 6.8 Hz, 2H), 1.92 - 1.82 (m, 2H), 1.48 - 1.39 (m, 2H), 1.36 - 1.13 (m, 40H), 0.89 (t, J = 6.8 Hz, 3H).

[0128] Step 2 1-Tetracosene [ka] At 25°C, potassium tert-butoxide (2.45 g, 21.84 mmol) is added to a cyclohexane solution (40 mL) of tetracosane-1-bromide (3.8 g, 9.10 mmol) and 18-crown-6 (577.32 mg, 2.18 mmol). The mixture is stirred at 80°C for 0.5 h. The mixture is added to water (50 mL), and the aqueous layer is extracted with EtOAc (50 mL x 3). The combined organic phases are washed with saturated brine (100 mL), dried over anhydrous NaSO, filtered, and concentrated under reduced pressure. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-tetracosene (2.1 g, 6.24 mmol, 68.55% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 5.98 - 5.73 (m, 1H), 5.05 - 4.92 (m, 2H), 2.10 - 2.00 (m, 2H), 1.41 - 1.37 (m, 2H), 1.30 - 1.28 (m, 38H), 0.89 (t, J = 6.8 Hz, 3H).

[0129] Step 3 (4S)-4-[(E,1R)-1-hydroxypentacosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (504.51 mg, 1.96 mmol), 1-tetracosene (600 mg, 1.78 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (151.32 mg, 178.23 μmol) in dichloromethane (6 mL) was degassed and flushed with nitrogen three times. Under nitrogen protection, the mixture was stirred at 40 °C for 8 hours. This reaction solution was combined with another batch of reaction solution prepared from 1-tetracosene (600 mg). After concentration, the crude product is purified by silica gel flash column chromatography (eluent: 0–14% ethyl acetate in petroleum ether) to give a brown oily substance, (4S)-4-[(E,1R)-1-hydroxypentacosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (880 mg, 1.56 mmol, 43.62% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.82 - 5.68 (m, 1H), 5.47 - 5.38 (m, 1H), 4.15 - 3.74 (m, 4H), 1.49 - 1.25 (m, 57H), 0.89 - 0.85 (m, 3H).

[0130] Step 4 (E,2S,3R)-2-aminoheptacosan-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (1.77 g, 15.55 mmol, 1.16 mL) in water (3 mL) is added to a solution of (4S)-4-[(E,1R)-1-hydroxypentacosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (880 mg, 1.56 mmol) in acetonitrile (3 mL). The mixture is stirred at 80 °C for 4 hours. The reaction solution is concentrated to give (E,2S,3R)-2-aminoheptacosan-4-ene-1,3-diol (660 mg, 1.55 mmol, 99.70% yield). The resulting mixture (330 mg, 775.14 μmol) was purified by preparative HPLC (chromatographic column: Welch Xl timate C4 100x30x10 μm, mobile phase: [water (formic acid)-methanol], gradient: 70% to 55% B in 20 min) to give (E,2S,3R)-2-aminoheptacosan-4-ene-1,3-diol (10.8 mg, 20.01 μmol, 2.57% yield, trifluoroacetate salt) as a white solid. 1 H NMR (400 MHz, CD3OD) δ = 8.52 (br s, 1H), 5.96 - 5.74 (m, 1H), 5.58 - 5.43 (m, 1H), 4.34 - 4.26 (m, 1H), 3.80 - 3.60 (m, 2H), 3.21 - 3.14 (m, 1H), 2.15 - 2.05 (m, 2H), 1.43 - 1.39 (m, 2H), 1.34 - 1.26 (m, 38H), 0.93 - 0.85 (m, 3H). 19 F NMR (376.5 MHz, CD3OD) δ = -76.907. LCMS Rt = 1.191 min in 1.5 min chromatography, 5-95AB ESI calculated C 27 H 56 NO2[M+H] + 426.4, and measured value 426.3 HPLC Rt = 4.980 min in an 8 min chromatography, ELSD, purity 98.085%.

[0131] Step 5 (4S)-4-[(1R)-1-Hydroxypentacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, Pd / C (188.05 mg, 176.71 μmol, purity 10%) is added to a mixed solution of (4S)-4-[(E,1R)-1-hydroxypentacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (1 g, 1.77 mmol) in methanol (5 mL) and tetrahydrofuran (5 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (30 psi) at 50°C for 12 hours. Tetrahydrofuran (50 mL) is added to the mixture, and it is filtered. The filter cake is washed three times with tetrahydrofuran (30 mL). The crude product obtained by concentrating the filtrate is purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain the compound (4S)-4-[(1R)-1-hydroxypentacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (600 mg, 1.06 mmol, yield 59.79%) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ = 4.26 - 3.75 (m, 4H), 3.72 - 3.36 (m, 1H), 1.58 (s, 9H), 1.49 (s, 6H), 1.45- 1.19 (m, 46H), 0.88 (t, J = 6.8 Hz, 3H).

[0132] Step 6 (2S,3R)-2-aminoheptacosane-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (602.30 mg, 5.28 mmol, 392.38 μL) is added to a solution (3 mL) of (4S)-4-[(E,1R)-1-hydroxypentacosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (600 mg, 1.06 mmol) in acetonitrile. The mixture is stirred at 80° C. for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to adjust the pH to 8. Filter and dry the filter cake under reduced pressure. At room temperature, the filter cake is placed in hydrochloric acid / dioxane (2 M, 10 mL), stirred, and concentrated. The crude product is slurried with methanol (10 mL) and filtered. The filter cake is lyophilized to obtain the compound (2S,3R)-2-aminoheptacosanyl-1,3-diol (105 mg, 215.07 μmol, 20.36% yield, 95.082% purity, hydrochloride salt) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ = 8.04 (br s, 3H), 5.03 (br s, 2H), 3.78 - 3.55 (m, 3H), 3.06 - 2.94 (m, 1H), 1.46 - 1.39 (m, 2H), 1.37 - 1.15 (m, 44H), 0.86 (t, J = 6.8 Hz, 3H). LCMS Rt = 5.664 min in 7 min chromatography, 50-100AB ESI calculated C 27 H 58 NO2[M+H] + 428.4, and measured value 428.4 HPLC Rt = 5.630 min in an 8 min chromatography, ELSD, purity 95.082%.

[0133] Sphingosine (d28:1) & (d28:0) Synthesis Route Map [ka] Synthetic Route: Step 1 Tetracosanal [ka] Pyridinium chlorochromate (PCC) (7.29 g, 33.84 mmol, 1.5 eq) was added to a DCM solution (400 mL) of 1-tetracosanol (8 g, 22.56 mmol, 1 eq). The mixture was stirred at 30 °C for 16 h. Silica gel (20 g) was added to the brown suspension. The resulting mixture was stirred for 30 min, and the concentrated crude product was purified by silica gel flash column chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to give tetracosanal (5.65 g, 16.03 mmol, 71.0% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 9.78 - 9.76 (t, J =2.0 Hz, 1H), 2.48 - 2.38 (m, 2H), 1.67 - 1.59 (m, 2H), 1.26 (s, 40H), 0.90 - 0.86 (t, J = 6.8 Hz, 3H).

[0134] Step 2 1-Pentacosene [ka] At 0 °C, potassium tert-butoxide (6.36 g, 56.72 mmol, 5 eq) is added to a solution of methyl(triphenyl)phosphonium bromide (20.26 g, 56.72, 5 eq) in THF (15 mL). The resulting yellow suspension is stirred at 25 °C for 1 h and cooled again to 0 °C. At 0 °C, a solution of tetracosanal (4 g, 11.34 mmol, 1 eq) in THF (40 mL) is added dropwise. The mixture is stirred at 25 °C for 16 h. Water (30 mL) is added to the mixture and extracted with ethyl acetate (40 mL × 3). The combined organic phase is washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-pentacosene (3.20 g, 9.13 mmol, 80.4% yield) as a pale yellow solid. 1H NMR (400 MHz, CDCl3) δ = 5.88 - 5.77 (m, 1H), 5.03 - 4.91 (m, 2H), 2.06 - 2.03 (m, 2H), 1.29 - 1.25 (m, 42H), 0.91 - 0.86 (t, J = 6.4 Hz, 3H).

[0135] Step 3 (4S)-4-[(E,1R)-1-Hydroxyhexacosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium, tricyclohexylphosphine (183.44 mg, 216.07 μmol, 0.1 eq) is added to tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (556 mg, 2.16 mmol, 1 eq) and 1-pentacosene (2.11 g, 6.03 mmol, 2.79 eq) in dichloromethane (20 mL). The mixture is stirred at 40 °C for 16 h. After concentrating the reaction solution, the crude product is purified by silica gel flash column chromatography (eluent: 0-25% ethyl acetate in petroleum ether) to obtain a yellow solid, (4S)-4-[(E,1R)-1-hydroxyhexacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (438 mg, 755.26 μmol, 34.9% yield). 1 HNMR (400 MHz, CDCl3) δ = 5.76 - 5.71 (m, 1H), 5.48 (m, 1H), 4.19 - 3.87 (m, 4H), 2.08 - 2.02 (m, 2H), 1.54 - 1.49 (m, 15H), 1.26 (s, 44H), 0.91 - 0.86 (t, J = 6.4 Hz, 3H).

[0136] Step 4 (4S)-4-[(1R)-1-Hydroxyhexacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, Pd / C (30 mg, 28.19 μmol, 10% purity) is added to a methanol solution (3 mL) of (4S)-4-[(E,1R)-1-hydroxyhexacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 517.30 μmol, 1 eq). The mixture is stirred under a hydrogen atmosphere at 25°C for 6 hours. The mixture is filtered. The filtrate is concentrated to give the compound (4S)-4-[(1R)-1-hydroxyhexacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (231 mg, 396.94 μmol, 76.7% yield) as a white solid. 1 H NMR δ = 4.07 - 3.77 (m, 4H), 3.60 - 3.46 (s, 1H), 1.60 - 1.58 (s, 2H), 1.54 - 1.49 (m, 15H), 1.26 (s, 48H), 0.91 - 0.87 (t, J = 6.4 Hz, 3H).

[0137] Step 5 (2S,3R)-2-aminooctacosan-1,3-diol [ka] A solution of trifluoroacetic acid (92.10 mg, 807.75 μmol, 60 μL, 2.03 eq) in water (3 mL) is added to a solution of (4S)-4-[(1R)-1-hydroxyhexacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (231 mg, 396.94 μmol, 1 eq) in acetonitrile (3 mL). The mixture is stirred at 80 °C for 6 h. The reaction solution is concentrated, the pH is adjusted to 8 by adding saturated aqueous sodium bicarbonate solution, and filtered. The filtrate is purified by preparative HPLC (chromatography column: Welch Xl timate C1 100x30 mm, 5 μm, mobile phase: [water (formic acid)-methanol], gradient: 65% to 95% B in 8 min) to give a white solid, (2S,3R)-2-aminooctacosane-1,3-diol (9 mg, 20.37 μmol, 5.1% yield, 100% purity). LCMS Rt = 2.854 min in 3 min chromatography, 30-100AB ESI calculated C 28 H 59 NO2[M+1] + 442.7, and measured value 442.4 1 H NMR (400 MHz, CD3OD) δ = 8.54 (s, 1H), 3.86 - 3.80 (dd, J = 7.2, 11.2 Hz, 1H), 3.77 - 3.74 (m, 1H), 3.73 - 3.66 (dd, J = 8.8, 11.6 Hz, 1H), 3.16 - 3.13 (m, 1H), 1.52 - 1.45 (m, 2H), 1.35 - 1.28 (m, 46H), 0.92 - 0.88 (t, J = 6.0 Hz, 3H).

[0138] Step 6 (E,2S,3R)-2-aminooctacosan-4-ene-1,3-diol [ka] A solution of (4S)-4-[(E,1R)-1-hydroxyhexacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (360 mg, 620.76 μmol, 1 eq) in acetonitrile (4 mL) is added to a solution of trifluoroacetic acid (110.52 mg, 969.30 μmol, 72.00 μL, 1.56 eq) in water (7 mL). The mixture is stirred at 80 °C for 4 h. The reaction solution is concentrated, the pH is adjusted to 8 by adding saturated aqueous sodium bicarbonate solution, and filtered. The filtrate is purified by preparative HPLC (chromatography column: Welch Xtimate C1 100x30 mm, 5 μm, mobile phase: [water (formic acid)-methanol], gradient: 60% to 90% B in 8 min) to give a white solid, (E,2S,3R)-2-aminooctacosan-4-ene-1,3-diol (6.99 mg, 15.90 μmol, yield 2.3%, purity 100%). LCMS Rt = 0.478 min in 0.8 min chromatography, 30-100AB ESI calculated C 28 H 57 NO2[M+1] + 440.7, and measured value 440.4 1 H NMR (400 MHz, CDCl3) δ = 5.85 - 5.63 (m, 1H), 5.57 - 5.43 (m, 1H), 4.24 - 3.93 (m, 1H), 3.74 - 3.57 (m, 2H), 2.95 - 2.78 (m, 1H), 2.45 - 2.10 (m, 4H), 2.10 - 1.90 (m, 2H), 1..6 - 1.41 (m, 2H), 1.4 - 1.0 (s, 40H), 0.91 - 0.70 (m, 3H).

[0139] Sphingosine (d29:1) & (d29:0) Synthesis Route Map [ka] Synthetic Route: Step 1 (4S)-4-[(E,1R)-1-hydroxyheptacosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (500 mg, 1.94 mmol), 1-hexacosene (921.20 mg, 2.53 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (164.96 mg, 194.31 μmol) in dichloromethane (6 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 8 h. After concentrating the reaction solution, the crude product is purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain a yellow oily substance, (4S)-4-[(E,1R)-1-hydroxyheptacosane-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 471.41 μmol, 24.26% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.81 - 5.67 (m, 1H), 5.50 - 5.38 (m, 1H), 4.20 - 3.84 (m, 4H), 2.06 - 2.00 (m, 2H), 1.60 - 1.26 (m, 44H), 1.25 - 1.24 (m, 15H), 0.88 (t, J = 6.4 Hz, 3H).

[0140] Step 2 (E,2S,3R)-2-aminononacosan-4-ene-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (537.50 mg, 4.71 mmol, 350.16 μL) is added to a solution (3 mL) of (4S)-4-[(E,1R)-1-hydroxyheptacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 471.41 μmol) in acetonitrile. The mixture is stirred at 80 °C for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to the reaction solution to adjust the pH to 8. The mixture is filtered and the filter cake is washed three times with water (10 mL). The filter cake is dried to obtain a brown solid, (E,2S,3R)-2-aminononacosan-4-ene-1,3-diol (200 mg, 440.74 μmol, 93.49% yield). This (70 mg, 154.26 μmol) was purified twice by preparative HPLC (chromatographic column: Welch Xltimate C4 100x30x10 μm, mobile phase: [water (formic acid)-methanol], gradient: 70% to 85% B in 20 min) to give a white solid, (E,2S,3R)-2-aminononacosan-4-ene-1,3-diol (4.3 mg, 8.25 μmol, yield 0.05%, purity 95.870%, formate salt). 1 H NMR (400 MHz, DMSO-d6) δ = 8.43 (br s, 3H), 5.77 - 5.18 (m, 2H), 3.89 - 3.77 (m, 1H), 3.63 - 3.35 (m, 1H), 3.22 - 3.20 (m, 1H), 2.74 - 2.58 (m, 1H), 2.04 - 1.98 (m, 2H), 1.40 -1.16 (m, 44H), 0.90 - 0.83 (m,3H). LCMS Rt = 5.960 min in 7 min chromatography, 50-100AB ESI calculated C 29 H 60 NO2[M+H] + 454.5, and measured value 454.5 HPLC Rt = 5.996 min in 15 min chromatography, ELSD, purity 95.870%.

[0141] Step 3 (2S,3R)-2-aminononacosane-1,3-diol [ka] Under nitrogen protection, Pd / C (152.44 mg, 143.24 μmol, 10% purity) is added to a mixed solution of (E,2S,3R)-2-aminononacosan-4-ene-1,3-diol (130 mg, 286.48 μmol) in methanol (2 mL) and tetrahydrofuran (2 mL). The reaction solution is degassed and purged with hydrogen three times. The mixture is stirred at 50°C under a hydrogen atmosphere (30 psi) for 12 hours. Tetrahydrofuran (10 mL) is added to the reaction solution. The filter cake is washed three times with tetrahydrofuran (10 mL). The filtrate was concentrated and purified by preparative HPLC (chromatography column: Welch Xltimate C4 100x30x10 μm, mobile phase: [water (formic acid)-methanol], gradient: 70% to 85% B in 20 min) to obtain the compound (2S,3R)-2-aminononacosane-1,3-diol (6.4 mg, 12.54 μmol, yield 4.38%, purity 98.296%, formate salt) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ = 8.37 (s, 3H), 3.64 - 3.45 (m, 1H), 3.28 - 3.27 (m, 2H), 2.71 - 2.60 (m, 1H), 1.45 - 1.23 (m, 50H), 0.88 - 0.82 (m, 3H). LCMS Rt = 6.199 min in 7 min chromatography, 50-100AB ESI calculated C 29 H 62 NO2[M+H] + 456.5, and measured value 456.5. HPLC Rt = 6.735 min in a 15 min chromatography, ELSD, purity 98.296%.

[0142] Sphingosine (d30:0) Synthesis Route Map: [ka] Synthetic Route: Step 1 tert-Butyl (4S)-4-[(E,1R)-1-hydroxyoctacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium, tricyclohexylphosphine (224.17 mg, 264.05 μmol) was added to a dichloromethane solution (10 mL) of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (500 mg, 1.94 mmol) and 1-hexacosene (1.30 g, 3.43 mmol). The mixture was degassed and purged with hydrogen three times. Under nitrogen protection, the mixture was stirred at 40 °C for 8 h. After concentrating the reaction solution, the crude product is purified by silica gel flash column chromatography (eluent: 0–10% ethyl acetate in petroleum ether) to obtain a brown solid, tert-butyl (4S)-4-[(E,1R)-1-hydroxyoctacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 460.54 μmol, 17.44% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.81 - 5.67 (m, 1H), 5.50 - 5.35 (m, 1H), 4.25 - 3.77 (m, 4H), 2.10 - 1.91 (m, 2H), 1.58 - 1.45 (m, 15H), 1.40 - 1.08 (m, 46H), 0.88 (t, J = 6.8 Hz, 3H).

[0143] Step 2 (4S)-4-[(1R)-1-hydroxyoctacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate tert-butyl ester [ka] Under nitrogen protection, Pd / C (50 mg, 10% purity) is added to a mixed solution of tert-butyl (4S)-4-[(E,1R)-1-hydroxyoctacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 460 μmol) in tetrahydrofuran (10 mL) and methanol (5 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (50 psi) at 50° C. for 16 hours. Filter, and the filter cake is washed three times with tetrahydrofuran (30 mL). The crude product obtained by concentrating the filtrate is purified by silica gel plate chromatography (dispersant: petroleum ether: ethyl acetate 4:1) to obtain the compound (4S)-4-[(1R)-1-hydroxyoctacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate tert-butyl (160 mg, 262.29 μmol, yield 56.95%) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 4.15-3.43 (m, 4H), 1.58 (s, 6H), 1.49 (s, 9H), 1.45 - 1.10 (m, 52H), 0.88 (t, J = 7.2 Hz, 3H).

[0144] Step 3 (2S,3R)-2-aminotriacontan-1,3-diol [ka] Trifluoroacetic acid (307 mg, 2.69 mmol, 0.2 mL) is added to a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyoctacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (160 mg, 262 μmol) in acetonitrile (1.5 mL) and water (1.5 mL). Under a nitrogen atmosphere, the mixture is stirred at 80°C for 4 hours. Saturated aqueous sodium bicarbonate is added to the reaction solution to adjust the pH to 8. Filter in portions and rinse the filter cake with methanol (5 mL). Disperse the filter cake in hydrochloric acid / dioxane (2 M, 5 mL) and stir for 20 minutes. Slurry the crude product in methanol (3 mL) and filter. The filter cake is lyophilized to obtain the compound (2S,3R)-2-aminotriacontan-1,3-diol (53.8 mg, 92.15 μmol, 35.13% yield, trifluoroacetate salt) as a white solid. MS Rt = 0.464 min in a 0.8 min chromatography, 30-100 AB, ESI calculated for C30H64NO2 [M+H]+ 470.5, and found 470.4. 1 H NMR (400 MHz, DMSO-d6) δ = 7.71 (br s, 3H), 4.95 - 4.82 (m, 2H), 3.74 - 3.64 (m, 2H), 3.62 - 3.53 (m, 1H), 3.10 -3.01 (m, 1H), 1.32 - 1.25 (m, 52H), 0.87 (t, J = 6.8 Hz, 3H). 19 F NMR (282 MHz, DMSO-d6) δ = -73.413.

[0145] Step 4 Hexacosanal [ka] Silica gel (5 g) and pyridinium chlorochromate (PCC) (5.63 g, 26.12 mmol) are added to a solution of 1-hexacosanol (5 g, 13.06 mmol) in DCM (350 mL). The mixture is stirred at 25 °C for 20 h. The reaction solution is filtered through diatomaceous earth, and the filtrate is concentrated to give hexacosanal (4.97 g, 13.06 mmol) as a white solid that does not require further purification. 1 H NMR (400 MHz, CDCl3) δ = 9.76 (s, 1H), 2.45 - 2.34 (m, 2H), 1.70 - 1.57 (m, 2H), 1.34 - 1.20 (m, 44H), 0.88 (t, J = 6.8 Hz, 3H).

[0146] Step 5 1-Heptacosene [ka] At 0°C, potassium tert-butoxide (4.39 g, 39.17 mmol) is added to a THF solution (120 mL) of methyl(triphenyl)phosphonium bromide (13.99 g, 39.17 mmol). The resulting suspension is stirred at 25°C for 1 hour and cooled to 0°C again. At 0°C, a THF solution (60 mL) of hexacosanal (4.97 g, 13.06 mmol) is added dropwise. The mixture is stirred at 25°C for 16 hours. Water (100 mL) is added to the mixture, and it is extracted with ethyl acetate (100 mL x 3). The combined organic phase is washed with saturated brine (200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-heptacosene (3.85 g, 10.17 mmol, 77.87% yield) as a white solid. 1H NMR (400 MHz, CDCl3) δ = 5.88 - 5.75 (m, 1H), 5.04 - 4.88 (m, 2H), 2.04 (q, J = 7.2 Hz, 2H), 1.45 - 1.32 (m, 2H), 1.40 - 1.15 (m, 44H), 0.88 (t, J = 6.8 Hz, 3H).

[0147] Sphingosine (d30:1) Synthesis Route Map [ka] Synthetic Route: Step 1 Hexacosanal [ka] Pyridinium chlorochromate (PCC) (1.61 g, 7.38 mmol, 1.5 eq) was added to a DCM solution (85 mL) of 1-hexacosanol (1.9 g, 4.96 mmol, 1 eq). The mixture was stirred at 40 °C for 16 h. Silica gel (3.5 g) was added to the brown suspension. The resulting mixture was stirred for 30 min, and the concentrated crude product was purified by silica gel flash column chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to give hexacosanal (690 mg, 1.81 mmol, 36.5% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 9.80 - 9.75 (t, J = 2.0 Hz, 1H), 2.48 - 2.38 (m, 2H), 1.60 (br s, 2H), 1.29 - 1.25 (m, 44H), 0.91 - 0.87 (t, J = 6.8Hz, 3H).

[0148] Step 2 1-Heptacosene [ka] At 0 °C, potassium tert-butoxide (530.57 mg, 4.73 mmol, 3 eq) is added to a THF solution (5 mL) of methyl(triphenyl)phosphonium bromide (1.69 g, 4.73 mmol, 3 eq). The resulting yellow suspension is stirred at 25 °C for 1 h and cooled again to 0 °C. At 0 °C, a THF solution (5 mL) of hexacosanal (0.6 g, 1.58 mmol, 1 eq) is added dropwise. The mixture is stirred at 25 °C for 12 h. Water (10 mL) is added to the mixture, and it is extracted with ethyl acetate (15 mL × 3). The combined organic phase is washed with saturated brine (5 mL), dried over sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-heptacosene (0.31 g, 0.87 mmol, 45.0% yield) as a colorless solid. 1 H NMR (400 MHz, CDCl3) δ = 5.89 - 5.75 (m, 1H), 5.04 - 4.97 (d, J = 17.2 Hz, 1H), 4.97 - 4.90 (d, J = 10.0 Hz, 1H), 2.08 - 2.02 (m, 2H), 1.40 - 1.36 (m, 2H), 1.27 (s, 44H), 0.91 - 0.87 (t, J = 6.4 Hz, 3H).

[0149] Step 3 (4S)-4-[(E,1R)-1-hydroxyoctacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium, tricyclohexylphosphine (24.10 mg, 28.39 μmol, 0.1 eq) is added to tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (146.12 mg, 567.85 μmol, 2 eq) and 1-heptacosene (300 mg, 792.15 μmol, 2.79 eq) in dichloromethane (15 mL). The mixture is stirred at 40° C. for 16 hours. After concentrating the reaction solution, the crude product is purified by silica gel flash column chromatography (eluent: 0–25% ethyl acetate in petroleum ether) to obtain a gray solid, (4S)-4-[(E,1R)-1-hydroxyoctacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (55 mg, 90.46 μmol, 31.9% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.79 - 5.71 (m, 1H), 5.48 (br s, 1H), 4.19 - 3.87 (m, 4H), 2.08 - 2.02 (m, 2H), 1.54 - 1.49 (m, 15H), 1.26 (m, 46H), 0.91 - 0.86 (t, J = 6.4 Hz, 3H).

[0150] Step 4 (E,2S,3R)-2-aminotriacontyl-4-ene-1,3-diol [ka] A solution of (4S)-4-[(E,1R)-1-hydroxyoctacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (45 mg, 74.01 μmol, 1 eq) in acetonitrile (1 mL) is added to a solution of trifluoroacetic acid (30.70 mg, 269.24 μmol, 0.02 mL, 3.64 eq) in water (1 mL). The mixture is stirred at 85 °C for 16 hours. Saturated aqueous sodium bicarbonate is added to the concentrated reaction solution to adjust the pH to 8. Filtration and drying of the filter cake give a white solid, (E,2S,3R)-2-aminotriacontyl-4-ene-1,3-diol (9 mg, 18.57 μmol, 25.1% yield, 96.5% purity). LCMS Rt = 2.066 min in 3 min chromatogram, 30-100 ESI calculated C 30 H 61 NO2[M+1] + 468.8, and measured value 468.5. 1 H NMR (400 MHz, CDCl3) δ = 5.83 - 5.70 (m, 1H), 5.55 - 5.42 (m, 1H), 4.15 - 4.00 (m, 1H), 3.77 - 3.59 (m, 2H), 2.98 - 2.83 (m, 1H), 2.10 - 2.04 (m, 2H), 1.82 - 1.73 (m, 4H), 1.43 - 1.39 (m, 2H), 1.26 (br s, 44H), 0.91 - 0.87 (t, J = 6.4 Hz, 3H).

[0151] Sphingosine (d31:1) & (d31:0) Synthesis Route Map [ka] Synthetic Route: Step 1 Octacosane-1-bromide [ka] PPh3 (3.83 g, 14.61 mmol) was added to a solution of 1-octacosanol (5 g, 12.17 mmol) in DCM (50 mL). N-Bromosuccinimide (2.60 g, 14.61 mmol) was then added to the mixture at 0 °C. The mixture was stirred at 25 °C for 1 h. Saturated Na2SO3 solution (50 mL) was added, and the aqueous phase was extracted with DCM (50 mL x 3). The combined organic phase was washed with saturated brine (100 mL), dried over anhydrous Na2SO4, filtered, and concentrated under reduced pressure. The crude product was purified by silica gel flash column chromatography (eluent: petroleum ether) to give octacosan-1-bromide (5.77 g, 12.18 mmol, 100.00% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 3.42 (t, J = 7.6 Hz, 2H), 1.95 - 1.80 (m, 2H), 1.44 (s, 2H), 1.30 - 1.24 (m, 48H), 0.89 (t, J = 6.8 Hz, 3H).

[0152] Step 2 1-Octacosene [ka] At 25°C, potassium tert-butoxide (2.71 g, 24.17 mmol) is added to a cyclohexane solution (5 mL) of octacosane-1-bromide (4.77 g, 10.07 mmol) and 18-crown-6 (638.85 mg, 2.42 mmol). The mixture is stirred at 80°C for 0.5 h. The mixture is added to water (50 mL), and the aqueous phase is extracted with EtOAc (50 mL x 3). The combined organic phase is washed with saturated brine (100 mL), dried over anhydrous NaSO, filtered, and concentrated under reduced pressure. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-octacosene (3.15 g, 8.02 mmol, 79.64% yield) as a white solid. 1H NMR (400 MHz, CDCl3) δ = 5.87 - 5.70 (m, 1H), 5.07 - 4.85 (m, 2H), 1.25 - 1.24 (m, 50H), 0.86 (t, J = 6.8 Hz, 3H).

[0153] Step 3 (4S)-4-[(E,1R)-1-hydroxynonacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (800 mg, 3.11 mmol), 1-octacosene (1.59 g, 4.04 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (263.94 mg, 310.89 μmol) in dichloromethane (12 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 8 h. After concentrating the reaction solution, the crude product is purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain a yellow oily substance, (4S)-4-[(E,1R)-1-hydroxynonacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (450 mg, 723.46 μmol, yield 23.27%). 1 H NMR (400 MHz, CDCl3) δ = 5.78 - 5.70 (m, 1H), 5.50 - 5.38 (m, 1H), 4.08 - 3.69 (m, 4H), 2.09 - 2.00 (m, 2H), 1.79 - 1.29 (m, 48H), 1.25 - 1.24 (m, 15H), 0.89 - 0.86 (m, 3H).

[0154] Step 4 (E,2S,3R)-2-aminohentriacontyl-4-ene-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (824.88 mg, 7.23 mmol, 537.38 μL) is added to a solution (3 mL) of (4S)-4-[(E,1R)-1-hydroxynonacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (450 mg, 723.46 μmol) in acetonitrile. The mixture is stirred at 80 °C for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to the reaction solution to adjust the pH to 8. After filtration, the filter cake is washed three times with water (10 mL) and dried under reduced pressure to obtain a brown solid, (E,2S,3R)-2-aminohentriacontyl-4-ene-1,3-diol (340 mg, 705.64 μmol, 97.54% yield). The resulting mixture (170 mg, 352.82 μmol) was purified twice by preparative HPLC (chromatographic column: Welch Xltimate C4 100x30x10 μm, mobile phase: [water (formic acid)-methanol], gradient: 70% to 90% B in 20 min) to obtain the compound (E,2S,3R)-2-aminohentriacontyl-4-ene-1,3-diol (2 mg, 3.64 μmol, yield 1.03%, purity 96.127%, formate salt) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ = 8.21 (br s, 2H), 5.60 - 5.25 (m, 2H), 3.65 - 3.46 (m, 2H), 3.40 - 3.37 (m, 1H), 2.69 - 2.66 (m, 1H), 2.03 - 1.97 (m, 2H), 1.52 - 1.46 (m, 2H), 1.30 - 1.23 (m, 46H), 0.88 - 0.85 (m, 3H). LCMS Rt = 6.247 min in the 7 min chromatogram, 50-100AB ESI calculated C 31 H 64 NO2[M+H] + 482.5, and measured value 482.5. HPLC Rt = 7.018 min in 15 min chromatography, ELSD, purity 96.127%.

[0155] Step 5 (4S)-4-[(1R)-1-hydroxynonacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, Pd / C (171.09 mg, 160.77 μmol, 10% purity) is added to a mixed solution of (4S)-4-[(E,1R)-1-hydroxynonacosan-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (1 g, 1.61 mmol) in methanol (5 mL) and tetrahydrofuran (5 mL). The mixture is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (30 psi) at 50°C for 12 hours. Tetrahydrofuran (50 mL) is added to the reaction solution. The mixture is filtered, and the filter cake is washed three times with tetrahydrofuran (30 mL). After concentration of the filtrate, the crude product is purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain the compound (4S)-4-[(1R)-1-hydroxynonacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 448.70 μmol, yield 27.91%) as a yellow solid. 1 H NMR (400 MHz, CDCl3) δ = 4.18 - 3.72 (m, 4H), 3.67 - 3.31 (m, 1H), 1.57 (s, 9H), 1.49 (s, 6H), 1.48 - 1.13 (m, 54H), 0.88 (t, J =6.8 Hz,3H).

[0156] Step 6 (2S,3R)-2-aminohentriacontan-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (255.80 mg, 2.24 mmol, 166.65 μL) is added to a solution (3 mL) of (4S)-4-[(1R)-1-hydroxynonacosyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 448.70 μmol) in acetonitrile. The mixture is stirred at 80° C. for 4 hours. Saturated aqueous sodium bicarbonate is added to the reaction solution to adjust the pH to 8 and filtered. The filter cake is dried under reduced pressure. At room temperature, the filter cake is placed in hydrochloric acid / dioxane (2 M, 10 mL), stirred, and concentrated. The crude product is slurried with methanol (10 mL) and filtered. The filter cake is lyophilized to obtain the compound (2S,3R)-2-aminohentriacontane-1,3-diol (51 mg, 88.33 μmol, 19.69% yield, 90.112% purity, hydrochloride salt) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ = 7.83 (br s, 1.5H), 5.04 - 4.89 (m, 1H), 3.78 - 3.38 (m, 3H), 3.04 - 2.99 (m, 1H), 1.46 - 1.42 (m, 2H), 1.32 - 1.24 (m, 52H), 0.86 (t, J = 7.6 Hz, 3H). LCMS Rt = 6.614 min in the 7 min chromatogram, 50-100AB ESI calculated C 31 H 66 NO2[M+H] + 484.5, and measured value 484.5. HPLC Rt = 6.672 min in an 8 minute chromatography, ELSD, purity 90.112%.

[0157] Sphingosine (d32:1) & (d32:0) Synthesis Route Map [ka] Synthetic Route: Step 1 Octacosanal [ka] Pyridinium chlorochromate (PCC) (6.30 g, 29.21 mmol, 1.2 eq) was added to a solution of 1-octacosanol (10 g, 24.35 mmol, 1 eq) in DCM (400 mL). The mixture was stirred at 30 °C for 16 h. Silica gel (15 g) was added to the brown suspension. The resulting mixture was stirred for 30 min, and the concentrated crude product was purified by silica gel flash column chromatography (eluent: 0-10% ethyl acetate in petroleum ether) to give octacosanal (4.5 g, 11.01 mmol, 45.2% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 9.79 - 9.76 (s, 1H), 2.46 - 2.39 (m, 2H), 1.67 - 1.61 (m, 2H), 1.31 - 1.25 (m, 48H), 0.91 - 0.87 (t, J = 6.4 Hz, 3H).

[0158] Step 2 1-nonacosene [ka] At 0 °C, potassium tert-butoxide (3.71 g, 33.03 mmol, 3 eq) is added to a solution of methyl(triphenyl)phosphonium bromide (11.80 g, 33.03 mmol, 3 eq) in THF (40 mL). The resulting yellow suspension is stirred at 25 °C for 1 h and cooled to 0 °C again. At 0 °C, a solution of octacosanal (4.5 g, 11.01 mmol, 1 eq) in THF (50 mL) is added dropwise. The mixture is stirred at 25 °C for 16 h. Water (30 mL) is added to the mixture, and it is extracted with ethyl acetate (40 mL × 3). The combined organic phase is washed with saturated brine (15 mL), dried over sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-nonacosene (3.4 g, 8.36 mmol, 75.9% yield) as a white solid. 1H NMR (400 MHz, CDCl3) δ = 5.91 - 5.75 (m, 1H), 5.07 - 4.88 (m, 2H), 2.08 - 2.01 (m, 2H), 1.40 - 1.36 (m, 2H), 1.28 - 1.25 (m, 48H), 0.91 - 0.87 (t, J = 6.4 Hz, 3H).

[0159] Step 3 (4S)-4-[(E,1R)-1-hydroxytriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium, tricyclohexylphosphine (149.61 mg, 176.23 μmol, 0.1 eq) is added to tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (453.48 mg, 1.76 mmol, 1 eq) and 1-nonacosene (2 g, 4.92 mmol, 2.79 eq) in dichloromethane (20 mL). The mixture is stirred at 40 °C for 16 hours. After concentrating the reaction solution under reduced pressure, the crude product is purified by silica gel flash column chromatography (eluent: 0–25% ethyl acetate in petroleum ether) to obtain a brown solid, (4S)-4-[(E,1R)-1-hydroxytriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.3 g, 471.67 μmol, 26.8% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.79 - 5.68 (m, 1H), 5.48 - 5.41 (m, 1H), 4.10 - 3.76 (m, 4H), 2.05 - 2.01 (m, 2H), 1.54 - 1.49 (m, 15H), 1.28 - 1.24 (m, 50H), 0.91 - 0.86 (t, J = 6.4 Hz, 3H).

[0160] Step 4 (E,2S,3R)-2-aminodotriacontyl-4-ene-1,3-diol [ka] A solution of (4S)-4-[(E,1R)-1-hydroxytriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (0.3 g, 471.67 μmol, 1 eq) in acetonitrile (3 mL) is added to a solution of trifluoroacetic acid (92.10 mg, 807.73 μmol, 60.00 μL, 1.71 eq) in water (3 mL). The mixture is stirred at 85 °C for 16 hours. Saturated aqueous sodium bicarbonate is added to the concentrated reaction solution to adjust the pH to 8. Filtration and drying of the filter cake under reduced pressure give a white solid (E,2S,3R)-2-aminodotriacontyl-4-ene-1,3-diol (110 mg, 216.29 μmol, 45.9% yield, 97.5% purity). LCMS Rt = 2.137 min in 3 min chromatogram, 30-100AB ESI calculated C 32 H 65 NO2[M+1] + 496.8, and measured value 496.5. 1 H NMR (400 MHz, CDCl3) δ = 5.82 - 5.70 (m, 1H), 5.53 - 5.42 (m, 1H), 4.14 - 3.97 (s, 1H), 3.74 - 3.58 (m, 2H), 2.96 - 2.82 (s, 1H), 2.10 - 2.03 (m, 2H), 1.91 - 1.70 (m, 4H), 1.41 - 1.36 (m, 2H), 1.29 - 1.24 (m, 48H), 0.91 - 0.86 (m, 3H).

[0161] Step 5 (4S)-4-[(1R)-1-hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate tert-butyl ester [ka] Under nitrogen protection, Pd / C (50 mg, 10% purity) was added to a mixture of tert-butyl (4S)-4-[(E,1R)-1-hydroxytriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (300 mg, 471.67 μmol) in tetrahydrofuran (5 mL) and methanol (5 mL). The suspension was degassed and purged with hydrogen three times, then stirred under a hydrogen atmosphere (50 psi) at 50°C for 16 hours. The mixture was filtered, and the filter cake was washed three times with tetrahydrofuran (50 mL). The filtrate was concentrated to give tert-butyl (4S)-4-[(1R)-1-hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (250 mg, 391.81 μmol) as a brown solid. 1 H NMR (400 MHz, CDCl3) δ = 4.15-3.67 (m, 4H), 1.56 (s, 6H), 1.43 (s, 9H), 1.38 - 1.15 (m, 56H), 0.88 (t, J = 6.8 Hz, 3H).

[0162] Step 6 (2S,3R)-2-aminodotriacontan-1,3-diol [ka] Trifluoroacetic acid (307.00 mg, 2.69 mmol, 0.2 mL) is added to a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxytriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (250 mg, 391.81 μmol) in acetonitrile (2 mL) and water (2 mL). The mixture is stirred at 80° C. for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to the reaction solution to adjust the pH to 8. The mixture is filtered in portions, and the filter cake is rinsed with methanol (5 mL). The filter cake is dispersed in hydrochloric acid / dioxane (2 M, 5 mL), stirred, and then concentrated. The crude product is slurried in methanol (10 mL) and filtered. The filter cake is freeze-dried to obtain the compound (2S,3R)-2-aminodotriacontan-1,3-diol (44.7 mg, 83.65 umol, yield 21.35%, hydrochloride salt) in the form of a white solid. MS Rt = 0.497 min in the 0.8 min chromatogram, 30-100 AB, ESI calculated C 32 H 68 NO2[M+H] + 498.5, and measured value 498.6. 1 H NMR (400 MHz, DMSO-d6) δ = 7.76 (s, 3H), 4.90 (s, 2H), 3.74 - 3.64 (m, 2H), 3.63 - 3.53 (m, 1H), 3.10 -3.00 (m, 1H), 1.48 - 1.35 (m, 2H), 1.41 - 1.15 (m, 54H), 0.87 (t, J = 6.8 Hz, 3H).

[0163] Sphingosine (d33:1) & (d33:0) Synthesis Route Map [ka] Synthetic Route: Step 1 Triacontane-1-bromide [ka] Triphenylphosphine (2.15 g, 8.20 mmol) is added to a DCM solution (50 mL) of 1-triacontanol (3 g, 6.84 mmol). N-Bromosuccinimide (1.46 g, 8.20 mmol) is then added to the mixture at 0 °C. The mixture is stirred at 25 °C for 1 hour. Saturated NaSO solution (50 mL) is added, and the aqueous phase is extracted with DCM (50 mL x 3). The combined organic phase is washed with saturated brine (100 mL), dried over anhydrous NaSO, filtered, and concentrated under reduced pressure. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give a white solid, triacontan-1-bromide (3.43 g, 6.84 mmol, 100.00% yield). 1 H NMR (400 MHz, CDCl3) δ = 3.42 (t, J = 6.8 Hz, 2H), 1.86 (q, J = 7.2 Hz, 2H), 1.47 - 1.15 (m, 54H), 0.89 (t, J = 6.8 Hz, 3H).

[0164] Step 2 1-Triaconten [ka] At 25°C, potassium tert-butoxide (1.30 g, 11.62 mmol) is added to a cyclohexane solution (5 mL) of triacontane-1-bromide (2.43 g, 4.84 mmol) and 18-crown-6 (307.25 mg, 1.16 mmol). The mixture is stirred at 80°C for 0.5 h. The mixture is added to water (50 mL), and the aqueous phase is extracted with EtOAc (50 mL x 3). The combined organic phase is washed with saturated brine (100 mL), dried over anhydrous NaSO, filtered, and concentrated under reduced pressure. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-triacontene (1.35 g, 3.21 mmol, 66.24% yield) as a white solid. 1H NMR (400 MHz, CDCl3) δ = 5.95 - 5.68 (m, 1H), 5.02 - 4.83 (m, 2H), 1.26 - 1.24 (m, 54H), 0.86 (t, J = 6.8 Hz, 3H).

[0165] Step 3 (4S)-4-[(E,1R)-1-Hydroxyhentriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (800 mg, 3.11 mmol), 1-triacontene (1.70 g, 4.04 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (263.94 mg, 310.89 μmol) in dichloromethane (12 mL) was degassed and flushed with nitrogen three times. The mixture was stirred under nitrogen protection at 40 °C for 8 h. After concentrating the reaction solution, the crude product is purified by silica gel flash column chromatography (eluent: 0–14% ethyl acetate in petroleum ether) to obtain a yellow liquid, (4S)-4-[(E,1R)-1-hydroxyhentriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (260 mg, 399.96 μmol, 12.86% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.78 - 5.55 (m, 1H), 5.47 - 5.23 (m, 1H), 4.09 - 3.75 (m, 4H), 2.02 - 1.87 (m, 2H), 1.75 - 1.20 (m, 52H), 1.18 - 1.17 (m, 15H), 0.83 - 0.79 (m, 3H).

[0166] Step 4 (E,2S,3R)-2-aminotritriacontyl-4-ene-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (420.95 mg, 3.69 mmol, 274.24 μL) is added to a solution (3 mL) of (4S)-4-[(E,1R)-1-hydroxyhentriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (240 mg, 369.19 μmol) in acetonitrile. The mixture is stirred at 80 °C for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to the reaction solution to adjust the pH to 8. After filtration, the filter cake is washed three times with water (10 mL) and dried under reduced pressure to obtain (E,2S,3R)-2-aminotritriacontyl-4-ene-1,3-diol (180 mg, 353.02 μmol, 95.62% yield). The resulting mixture (90 mg, 176.51 μmol) was purified by preparative HPLC (chromatographic column: Welch Xltimate C4 100x30x10 μm, mobile phase: [water (formic acid)-methanol], gradient: 70% to 90% B in 20 min) to give the compound (E,2S,3R)-2-aminotritriacontyl-4-ene-1,3-diol (7.8 mg, 14.03 μmol, yield 7.95%, formate salt) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ = 8.27 (br s, 1H), 5.66 - 5.55 (m, 1H), 5.50 - 5.40 (m, 1H), 3.93 - 3.85 (m, 1H), 3.48 - 3.47 (m, 2H), 2.71 - 2.65 (m, 1H), 2.04 - 1.95 (m, 2H), 1.36 - 1.31 (m, 2H), 1.30 - 1.21 (m, 50H), 0.89 - 0.83 (m, 3H). LCMS Rt = 1.336 min in the 1.5 min chromatogram, 5-95AB ESI calculated C 33 H 68 NO2[M+H] + 510.5, and measurement 510.4. HPLC Rt = 7.948 min in 15 min chromatography, ELSD, purity 98.751%.

[0167] Step 5 (4S)-4-[(1R)-1-Hydroxyhentriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, Pd / C (45.84 mg, 43.07 μmol, purity 10%) is added to a mixed solution of (4S)-4-[(E,1R)-1-hydroxyhentriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (280 mg, 430.72 μmol) in methanol (5 mL) and tetrahydrofuran (5 mL). The mixture is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (30 psi) at 50°C for 12 hours. Tetrahydrofuran (50 mL) is added to the reaction solution. The mixture is filtered, and the filter cake is washed three times with tetrahydrofuran (30 mL). After concentration of the filtrate, the crude product is purified by silica gel flash column chromatography (eluent: 0-14% ethyl acetate in petroleum ether) to obtain the compound (4S)-4-[(1R)-1-hydroxyhentriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (240 mg, 368.05 μmol, yield 85.45%) as a yellow oil. 1 H NMR (400 MHz, CDCl3) δ = 4.06 - 3.85 (m, 4H), 3.74 - 3.49 (m, 1H), 1.59 (s, 6H), 1.49 (s, 9H), 1.48 - 1.13 (m, 58H), 0.88 (t, J =6.8 Hz,3H).

[0168] Step 6 (2S,3R)-2-aminotritriacontan-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (209.83 mg, 1.84 mmol, 136.69 μL) is added to a solution (3 mL) of (4S)-4-[(1R)-1-hydroxyhentriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (240 mg, 368.05 μmol) in acetonitrile. The mixture is stirred at 80° C. for 4 hours. Saturated aqueous sodium bicarbonate is added to the reaction solution to adjust the pH to 8 and filtered. The filter cake is dried under reduced pressure. At room temperature, the filter cake is placed in hydrochloric acid / dioxane (4 M, 10 mL), stirred, and concentrated. The crude product is slurried with methanol (10 mL) and filtered. The filter cake is lyophilized to obtain the compound (2S,3R)-2-aminotritriacontan-1,3-diol (226.3 mg, 349.87 μmol, 95.06% yield, 84.780% purity, hydrochloride salt) as a white solid. 1 H NMR (400 MHz, DMSO-d6) δ = 7.89 (br s, 2H), 4.98 (br s, 1H), 3.73 - 3.56 (m, 2H), 3.54 - 3.40 (m, 1H), 3.04 - 2.99 (m, 1H), 1.45 - 1.41 (m, 2H), 1.34 - 1.21 (m, 56H), 0.87 (t, J = 6.4 Hz, 3H). HPLC Rt = 7.079 min in an 8 minute chromatography, ELSD, purity 84.780%. MS Rt = 2.97-3.14 min in a 4-minute chromatogram, 50-100AB ESI calculated C 33 H 70 NO2[M+H] + 512.5328, and measurement 512.5456.

[0169] Sphingosine (d34:0) & (d34:1) Synthesis Route Map [ka] Synthetic Route: Step 1 (4S)-4-[(E,1R)-1-hydroxydotriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] A mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (800 mg, 3.11 mmol), 1-hentriacontene (1.2 g, 2.76 mmol), and benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidin-2-ylidene]-dichloro-ruthenium and tricyclohexylphosphine (234.30 mg, 275.98 μmol) in dichloromethane (12 mL) was degassed and flushed with nitrogen three times. The mixture was stirred at 40 °C for 4 h. After filtering the reaction solution and concentrating the filtrate, the crude product is purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain a brown oily substance, (4S)-4-[(E,1R)-1-hydroxydotriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (1 g, 1.51 mmol, 54.56% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.80 - 5.70 (m, 1H), 5.55 - 5.40 (m, 1H), 4.10-3.75 (m, 4H), 2.07 (s, 2H), 1.51 (s, 15H), 1.27 (s, 54H), 0.95 - 0.85 (m, 3H).

[0170] Step 2 (4S)-4-[(1R)-1-hydroxydotriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under nitrogen protection, Pd / C (800 mg, 751.40 μmol, purity 10%) is added to a mixed solution of (4S)-4-[(E,1R)-1-hydroxydotriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (1 g, 1.51 mmol) in methanol (10 mL) and tetrahydrofuran (10 mL). The mixture is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (50 psi) at 50°C for 16 hours. Tetrahydrofuran (10 mL) is added to the reaction solution. The mixture is filtered, and the filter cake is washed three times with tetrahydrofuran (10 mL). After concentration of the filtrate, the crude product is purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain the compound (4S)-4-[(1R)-1-hydroxydotriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (460 mg, 690.58 μmol, yield 45.86%) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 4.05-3.82 (m, 4H), 1.67 (s, 15H), 1.28 (s, 60H), 0.95-0.84 (m, 3H).

[0171] Step 3 (2S,3R)-2-aminotetratriacontan-1,3-diol [ka] An aqueous solution (3 mL) of trifluoroacetic acid (393.70 mg, 3.45 mmol, 256.48 μL) is added to a solution (3 mL) of (4S)-4-[(1R)-1-hydroxydotriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (460 mg, 690.58 μmol) in acetonitrile. The mixture is stirred at 80° C. for 4 hours. Saturated aqueous sodium bicarbonate is added to the reaction solution to adjust the pH to 8 and filtered. The filter cake is dried under reduced pressure. At room temperature, the filter cake is placed in hydrochloric acid / dioxane (2 M, 10 mL), stirred for 10 minutes, and concentrated. The crude product is slurried with methanol (10 mL) and filtered. The filter cake is lyophilized to obtain the compound (2S,3R)-2-aminotetratriacontan-1,3-diol (377.4 mg, 671.06 μmol, 97.17% yield, hydrochloride salt) as a white solid. MS Rt = 1.06-1.43 min in a 4 min chromatography, 80-100 AB, ESI calculated C 34 H 72 NO2[M+H] + 526.5, and measurement 526.6 1 H NMR (400 MHz, DMSO-d 6 ) δ = 8.10 - 7.90 (m, 3H), 5.10 - 4.85 (m, 1H), 3.75 - 3.65 (m, 2H), 3.65 - 3.55 (m, 1H), 3.04 -3.00 (m, 1H), 1.45 - 1.35 (m, 2H), 1.27 (s, 60H), 0.90 -0.80 (m, 3H).

[0172] Step 4 (E,2S,3R)-2-aminotetratriacontyl-4-ene-1,3-diol [ka] A solution of trifluoroacetic acid (824.12 mg, 7.23 mmol, 536.89 μL) in water (4 mL) is added to a solution of (4S)-4-[(E,1R)-1-hydroxydotriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (480 mg, 722.79 μL) in acetonitrile (4 mL). The mixture is stirred at 80 °C for 4 hours. Saturated aqueous sodium bicarbonate is added to the reaction solution to adjust the pH to 8, and the mixture is filtered. The filter cake is dried under reduced pressure to give (E,2S,3R)-2-aminotetratriacontyl-4-ene-1,3-diol (300 mg, 572.61 μmol, 79.22% yield). The crude solution is purified by preparative HPLC (chromatographic column: Welch Xltimate C4 100x30x10 μm, mobile phase: [water (formic acid)-methanol], gradient: 70% to 90% B in 20 min) to obtain the compound (E,2S,3R)-2-aminotetratriacontyl-4-ene-1,3-diol (8.2 mg, 14.39 μmol, yield 1.99%, formate salt) as a white solid. LCMS Rt = 1.342 min in the 1.5 min chromatogram, 5-95AB ESI calculated C 34 H 70 NO2[M+H] + 524.5, and measured value 525.4. 1 H NMR (400 MHz, DMSO-d 6 ) δ = 8.35 (s, 2H), 5.65 - 5.40 (m, 3H), 5.40 - 5.30 (m, 1H), 3.90 - 3.87 (m, 1H), 3.50 - 3.46 (m, 1H), 3.35 - 3.25 (m, 1H), 2.70 - 2.66 (m, 1H), 2.05 - 1.95 (m, 2H), 1.27 (s, 54H), 0.90-0.80 (m, 3H).

[0173] Step 5 Triacontanal [ka] Pyridinium chlorochromate (PCC) (1.08 g, 5.01 mmol) and silica gel (3.00 g, 49.93 mmol) were added to a solution of 1-triacontanol (2 g, 4.56 mmol) in DCM (100 mL). The mixture was stirred at 25 °C for 16 h. The mixture was filtered, and the filtrate was concentrated. The crude product was purified by silica gel flash chromatography (eluent: 0-30% ethyl acetate in petroleum ether) to give triacontanal (1 g, 2.29 mmol, 50.23% yield) as a brown solid. 1 H NMR (400 MHz, CDCl3) δ = 9.85 - 9.75 (m, 1H), 2.50 - 2.35 (m, 2H), 1.70 - 1.60 (m, 2H), 1.30 - 1.20 (m, 52H), 0.95 - 0.85 (m, 3H).

[0174] Step 6 1-Hentriaconten [ka] At 0°C, potassium tert-butoxide (1.85 g, 16.48 mmol) is added to a solution of methyl(triphenyl)phosphonium bromide (5.89 g, 16.48 mmol) in THF (50 mL). The resulting yellow suspension is stirred at 25°C for 1 hour and cooled to 0°C again. At 0°C, a solution of triacontanal (2.4 g, 5.49 mmol) in THF (25 mL) is added dropwise. The mixture is stirred at 25°C for 16 hours. The reaction solution is combined with another batch prepared from triacontanal (1 g). Water (50 mL) is added to the mixture and extracted with ethyl acetate (50 mL x 3). The combined organic phase is washed with saturated brine (10 mL), dried over sodium sulfate, filtered and concentrated. The crude product is purified by flash silica gel chromatography (eluent: petroleum ether) to give 1-hentriacontene (1.1 g, 2.53 mmol, 32.42% yield) as a colorless oil. 1H NMR (400 MHz, CDCl3) δ = 5.90 - 5.80 (m, 1H), 5.05 - 4.93 (m, 2H), 2.09 - 2.02 (m, 2H), 1.28 (s, 54H), 0.91 (t, J = 6.8 Hz, 3H).

[0175] Sphingosine (d35:1) & (d35:0) Synthesis Route Map: [ka] Synthetic Route: Step 1 tert-Butyl (4S)-4-[(E,1R)-1-hydroxytritriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Grubbs' second generation catalyst, benzyl-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-acyl]-dichlororuthenium-tricyclohexylphosphine (164.96 mg, 194.31 umol) was added to a mixture of tert-butyl (4S)-4-[(1R)-1-hydroxyalkenyl]-2,2-dimethyl-oxazolidine-3-carboxylate (500 mg, 1.94 mmol) and 1-dotriacontene (1.13 g, 2.53 mmol) in dichloromethane (7.5 mL), and the mixture was degassed and flushed with nitrogen three times, then stirred under a nitrogen atmosphere at 40° C. for 8 hours. After concentrating the reaction solution, the crude product was purified by silica gel flash column chromatography (eluent: 0-15% ethyl acetate in petroleum ether) to obtain a white solid, tert-butyl (4S)-4-[(E,1R)-1-hydroxytritriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (90.0 mg, 132.72 μmol, 6.83% yield). 1H NMR (400 MHz, CDCl3) δ = 5.78 - 5.68 (m, 1H), 5.48 - 5.35 (m, 1H), 4.24 - 3.76 (m, 4H), 2.07 - 1.98 (m, 2H), 1.55 - 1.47 (m, 15H), 1.40 - 1.11 (m, 56H), 0.88 (t, J = 6.8 Hz, 3H).

[0176] Step 2 (E,2S,3R)-2-aminopentatriacontyl-4-ene-1,3-diol [ka] Trifluoroacetic acid (307 mg, 2.69 mmol, 0.2 mL) is added to a mixture of tert-butyl (4S)-4-[(E,1R)-1-hydroxytritriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (90.0 mg, 132.7 μmol) in acetonitrile (1.5 mL) and water (1.5 mL), and the mixture is stirred at 80° C. for 6 hours. Saturated aqueous sodium bicarbonate solution is added to the reaction solution to adjust the pH to 8. Filter in portions and rinse the filter cake with methanol (5 mL). Disperse the filter cake in hydrochloric acid / dioxane (2 M, 5 mL) and stir for 20 minutes. Slurry the concentrated crude product in methanol (3 mL) and filter. The filter cake is lyophilized to obtain the compound (E,2S,3R)-2-aminopentatriacontyl-4-ene-1,3-diol (15.0 mg, 26.11 umol, 19.68% yield, hydrochloride salt) as a white solid. MS Rt = 0.519 min in 0.8 min chromatogram, 30-100 AB, ESI calculated C 35 H 72 NO2[M+H] + 538.5, and measured value 538.5. 1H NMR (400 MHz, DMSO-d6) δ = 7.81 - 7.39 (m, 3H), 5.79 - 5.66 (m, 1H), 5.51 - 5.41 (m, 1H), 5.24 - 5.14 (m, 1H), 4.93 - 4.81 (m, 1H), 4.26 - 4.16 (m, 1H), 3.69 - 3.59 (m, 1H), 3.58 - 3.47 (m, 1H), 3.58 - 3.47 (m, 1H), 3.18 - 3.07 (m, 1H), 2.07 - 1.99 (m, 2H), 1.42 - 1.32 (m, 2H), 1.40 - 1.15 (m, 56H), 0.87 (t, J = 6.8 Hz, 3H).

[0177] Step 3 (4S)-4-[(1R)-1-hydroxytritriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate tert-butyl ester [ka] Under nitrogen protection, Pd / C (117.70 mg, 110.60 μmol, 10% purity) was added to a mixture of tert-butyl (4S)-4-[(E,1R)-1-hydroxytritriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-3-carboxylate (150 mg, 221.20 μmol) in tetrahydrofuran (2 mL) and methanol (2 mL). The suspension was degassed and flushed with hydrogen three times, then stirred under a hydrogen atmosphere (50 psi) at 50°C for 16 hours. Tetrahydrofuran (10 mL) was added. The mixture was filtered, and the filter cake was washed three times with tetrahydrofuran (10 mL). After concentration of the filtrate, the crude product is purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to give a white solid, tert-butyl (4S)-4-[(1R)-1-hydroxytritriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (110 mg, 161.73 μmol, 73.12% yield). 1H NMR (400 MHz, CDCl3) δ = 4.14 - 3.67 (m, 4H), 1.64 - 1.58 (m, 15H), 1.36 - 1.12 (m, 62H), 0.88 (t, J = 6.8 Hz, 3H).

[0178] Step 4 (2S,3R)-2-aminopentatriacontan-1,3-diol [ka] An aqueous solution (2 mL) of trifluoroacetic acid (92.20 mg, 808.66 μmol, 60.07 μL) is added to a solution (2 mL) of tert-butyl (4S)-4-[(1R)-1-hydroxytritriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (110 mg, 161.73 μmol) in acetonitrile. The mixture is stirred at 80° C. for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to the reaction solution to adjust the pH to 8. The mixture is filtered in portions, and the filter cake is concentrated under reduced pressure. The filter cake is dispersed in hydrochloric acid / dioxane (2 M, 10 mL) at room temperature and then concentrated. The crude product is slurried with methanol (10 mL) and filtered. The filter cake is lyophilized to obtain the compound (2S,3R)-2-aminopentatriacontan-1,3-diol (35.4 mg, 61.41 μmol, 37.97% yield, hydrochloride salt) as a white solid. MS Rt = 2.158 min in 3 min chromatography, ESI calculated C 35 H 74 NO2[M+H] + 540.6, and measured value 540.6. 1H NMR (400 MHz, DMSO-d6) δ = 7.23 - 6.74 (m, 3H), 4.39 - 4.19 (m, 2H), 3.16 - 3.06 (m, 2H), 2.95 - 2.88 (m, 1H), 2.70 - 2.64 (m, 1H), 0.86 - 0.77 (m, 4H), 0.69 - 0.66 (m, 58H), 0.30 - 0.24 (m, 3H).

[0179] Sphingosine (d36:1) & (d36:0) Synthesis Route Map: [ka] Synthetic Route: Step 1 Dotriacontanal [ka] Pyridinium chlorochromate (PCC) (10.16 g, 47.12 mmol) and silica gel (20.00 g, 332.87 mmol) are added to a DCM solution (1 L) of dotriacontan-1-ol (20 g, 42.84 mmol). The mixture is stirred at 25° C. for 1 hour. The reaction solution is combined with another batch of reaction solution (prepared from 20 g of 1A). After filtration, the filtrate is concentrated to give dotriacontanal (14 g, 30.12 mmol, 35.15% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 9.79 (s, 1H), 2.45 - 2.38 (m, 2H), 2.03 - 1.96 (m, 2H), 1.27 - 1.30 (m, 56H), 0.88 (t, J = 6.8 Hz, 3H).

[0180] Step 2 1-Dotriaconten [ka] At 0°C, potassium tert-butoxide (2.17 g, 19.36 mmol) is added to a THF solution (50 mL) of methyl(triphenyl)phosphonium bromide (6.92 g, 19.36 mmol). The resulting yellow suspension is stirred at 25°C for 1 hour and cooled to 0°C again. At 0°C, a THF solution (25 mL) of dotriacontanal (3 g, 6.45 mmol) is added dropwise. The mixture is stirred at 25°C for 16 hours. Water (50 mL) is added to the mixture, and it is extracted with ethyl acetate (50 mL x 3). The combined organic phases are washed with saturated brine (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated. The crude product is purified by silica gel flash column chromatography (eluent: petroleum ether) to give 1-dotriacontene (880 mg, 1.90 mmol, 29.46% yield) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 5.85 - 5.77 (m, 1H), 5.04 - 4.92 (m, 1H), 4.90 - 4.86 (m, 1H), 2.09 - 1.95 (m, 2H), 1.31 - 1.25 (m, 58H), 0.88 (t, J = 6.8 Hz, 3H).

[0181] Step 3 tert-Butyl (4S)-4-[(E,1R)-1-hydroxytetratriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate [ka] Under a nitrogen atmosphere, benzal-[1,3-bis(2,4,6-trimethylphenyl)imidazolidine-2-methylene]-dichloro-ruthenium, tricyclohexylphosphine (159.57 mg, 187.96 μmol) was added to a dichloromethane solution (12 mL) of tert-butyl (4S)-4-[(1R)-1-hydroxyallyl]-2,2-dimethyl-oxazolidine-3-carboxylate (532.02 mg, 2.07 mmol) and 1-tritriacontene (870 mg, 1.88 mmol). Under nitrogen protection, the mixture was stirred at 40° C. for 4 hours. The reaction solution was filtered, and the filtrate was concentrated. The crude product is purified by silica gel flash column chromatography (eluent: 0–25% ethyl acetate in petroleum ether) to give a white solid, tert-butyl (4S)-4-[(E,1R)-1-hydroxytetratriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (70 mg, 101.13 μmol, 5.38% yield). 1 H NMR (400 MHz, CDCl3) δ = 5.80 - 5.70 (m, 1H), 5.48 - 5.40 (m, 1H), 4.17 - 3.95 (m, 4H), 2.09 - 1.98 (m, 2H), 1.61 - 1.55 (m, 15H), 1.31 - 1.24 (m, 58H), 0.88 (t, J = 6.8 Hz, 3H).

[0182] Step 4 (E,2S,3R)-2-aminohexatriacontyl-4-ene-1,3-diol [ka] An aqueous solution (1 mL) of trifluoroacetic acid (57.66 mg, 505.67 μmol, 37.56 μL) is added to a solution (1 mL) of tert-butyl (4S)-4-[(E,1R)-1-hydroxytetratriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (70 mg, 101.13 μmol) in acetonitrile. The mixture is stirred at 80°C for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to the reaction solution to adjust the pH to 8. Filter in portions and dry the filter cake under reduced pressure. Disperse the filter cake in hydrochloric acid / dioxane (2 M, 10 mL) and concentrate. Slurry in methanol (10 mL) and freeze-dry to obtain the compound (E,2S,3R)-2-aminohexatriacontyl-4-ene-1,3-diol (32 mg, 54.38 μmol, 53.77% yield, hydrochloride salt) as a white solid. MS Rt = 1.348 min in the 1.5 min chromatogram, 5-95 AB, ESI calculated C 36 H 74 NO2[M+H] + 552.6, and measured value 552.5. 1 H NMR (400 MHz, DMSO-d 6 ) δ = 7.82-7.58 (m, 2H), 5.84 - 5.68 (m, 1H), 5.50 -5.43 (m, 1H), 5.28 - 5.19 (m, 1H), 5.00 - 4.89 (m, 1H), 4.30 - 4.19 (m, 1H), 3.71 - 3.62 (m, 1H), 3.58 - 3.52 (m, 1H), 3.35-3.32(m, 1H), 2.08-2.00 (m, 2H), 1.31 - 1.25 (m, 58H), 0.88 (t, J = 6.8 Hz, 3H).

[0183] Step 5 (4S)-4-[(1R)-1-hydroxytetratriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate tert-butyl ester [ka] Under nitrogen protection, Pd / C (130.69 mg, 122.81 μmol, purity 10%) is added to a mixed solution of tert-butyl (4S)-4-[(E,1R)-1-hydroxytetratriacontyl-2-enyl]-2,2-dimethyl-oxazolidine-3-carboxylate (170 mg, 245.61 μmol) in tetrahydrofuran (2 mL) and methanol (2 mL). The suspension is degassed and purged with hydrogen three times. The mixture is stirred under a hydrogen atmosphere (50 psi) at 50°C for 16 hours. Tetrahydrofuran (10 mL) is added and filtered. The filter cake is washed three times with tetrahydrofuran (10 mL). The crude product obtained by concentrating the filtrate is purified by silica gel flash column chromatography (eluent: 20% ethyl acetate in petroleum ether) to obtain the compound (4S)-4-[(1R)-1-hydroxytetratriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (70 mg, 100.84 μmol, yield 41.06%) as a white solid. 1 H NMR (400 MHz, CDCl3) δ = 4.13 - 3.77 (m, 4H), 1.81 - 1.52 (m, 15H), 1.44 - 1.42 (m, 2H), 1.35 - 1.10 (m, 62H), 0.88 (t, J = 6.8 Hz, 3H).

[0184] Step 6 (2S,3R)-2-aminohexatriacontan-1,3-diol [ka] An aqueous solution (2 mL) of trifluoroacetic acid (57.49 mg, 504.20 μmol, 37.45 μL) is added to a solution (2 mL) of tert-butyl (4S)-4-[(1R)-1-hydroxytetratriacontyl]-2,2-dimethyl-oxazolidine-3-carboxylate (70 mg, 100.84 μmol) in acetonitrile. The mixture is stirred at 80° C. for 4 hours. A saturated aqueous solution of sodium bicarbonate is added to the reaction solution to adjust the pH to 8. Filter in portions and dry the filter cake under reduced pressure. Disperse the filter cake in hydrochloric acid / dioxane (2 M, 10 mL) and stir at room temperature. The crude product is slurried in methanol (10 mL) and lyophilized to give the compound (2S,3R)-2-aminohexatriacontan-1,3-diol (15.2 mg, 25.74 μmol, 25.53% yield, hydrochloride salt) as a white solid. MS Rt = 1.586 min in 3 min chromatography, ESI calculated C 36 H 76 NO2[M+H] + 554.6, and measured value 554.5. 1 H NMR (400 MHz, DMSO-d 6 ) δ = 7.70 - 7.55 (m, 3H), 5.10 - 4.63 (m, 2H), 3.70 -3.62 (m, 2H), 3.58 - 3.51 (m, 1H), 3.18 - 3.10 (m, 1H), 1.40 - 1.38 (m, 2H), 1.28 - 1.25 (m, 62H), 0.88 (t, J = 6.8 Hz, 3H).

[0185] The lipids used in the examples of the present invention are sphingosines as shown in Table 1 below. [Table 1] TIFF2025529596000141.tif230165TIFF2025529596000142.tif239165TIFF2025529596000143.tif236165 TIFF2025529596000144.tif237165TIFF2025529596000145.tif237165TIFF2025529596000146.tif233165

[0186] Example 2. Studies on in vitro delivery of small nucleic acids using lipid-nucleic acid complexes 1.Cell culture The human pancreatic acinar epithelial carcinoma cell line HPAC, the human large cell lung carcinoma cell line H460, and the human embryonic kidney cell line HEK293T (purchased from the Cell Resource Center, Institute of Basic Medicine, Chinese Academy of Medical Sciences) used in the experiment were cultured in a 37°C, 5% CO2 incubator. HPAC cells were cultured in DMEM / F12 medium, H460 cells in RPMI-1640 medium, and 293T cells in DMEM medium containing 10% fetal bovine serum and 1% antibiotics (penicillin 100 U / mL and streptomycin 100 mg / mL). The cell density was 6 x 10 5 The cells are cultured in 1 mL medium / well until they reach the logarithmic growth phase, split into 12-well plates (1 mL medium / well), and incubated at 37° C. overnight (12 hours) before subsequent experiments.

[0187] 2. Preparation of Lipid-RNA Mixture 5 μL of nucleic acid and 95 μL of DEPC-treated water are added to a 2 mL glass tube and mixed uniformly, a certain amount of lipid monomer is added, mixed thoroughly, heated in a water bath at 90°C for 15 minutes, and then allowed to cool naturally to obtain a mixture of nucleic acid and lipid.

[0188] Exemplarily, the RNA PGY-ssRNA-26 used in this example has the sequence UCCGGAAUGAUUGGGCGUAAAGCGU (SEQ ID NO: 1).

[0189] 3. Detection of cellular uptake of nucleic acids delivered inside cells by lipids by flow cytometry (CFlow)

[0190] 1) Main experimental equipment and devices: 10 cm cell culture dish, 12-well cell culture plate, pipette, transfer tube, optical microscope, flow cytometer CytoFLEX instrument (purchased from Beckman, USA)

[0191] 2) Main experimental reagents: Model establishment and transfection: artificially synthesized lipid monomers and nucleic acids as shown in the table

[0192] 3) Human pancreatic acinar epithelial carcinoma cell line HPAC cells, human large cell lung carcinoma cell line H460 cells, and human embryonic kidney cell line HEK293T cells used in the experiment were cultured until the logarithmic growth phase, and then they were grown at a cell density of 6 × 10 5 1 mL culture medium / well into a 12-well plate, and the 12-well plate is incubated at 37° C. overnight (12 hours) before subsequent experiments.

[0193] 4) The experimental groups are as follows: a) Blank group: refers to untreated cells, this group serves as a blank control group. b) Free uptake group: 5 μL of a solution of fluorescently labeled nucleic acid (stock concentration 20 μM) was directly added to this group, which served as a negative control group. c) Lipid-nucleic acid mixture treatment group: The mixture of lipids and fluorescently labeled nucleic acids prepared in step 2 was added to the cells and mixed uniformly. The final concentration of nucleic acid was 100 nM.

[0194] 5) After 9 hours of incubation with the cells, wash the cells with PBS three times, resuspend the cells in PBS (self-prepared), and use a flow cytometer CytoFLEX instrument (purchased from Beckman, USA) to detect the fluorescence intensity of the cells in the sample wells.

[0195] The results of in vitro small molecule nucleic acid delivery in this example are shown in the following Tables 2 to 4 and Figures 1 to 3.

[0196] In Tables 2 to 4, the small nucleic acid used is PGY-ssRNA-26. [Table 2] TIFF2025529596000148.tif208165TIFF2025529596000149.tif155165 [Table 3] TIFF2025529596000151.tif226165TIFF2025529596000152.tif137165 [Table 4] TIFF2025529596000154.tif226165TIFF2025529596000155.tif137165

[0197] The results show that the fluorescence offset in the experimental group is increased compared to the negative control group, indicating that cells take up more fluorescently labeled RNA, i.e., that the amount of RNA delivered into cells by lipids is greater, reflecting higher delivery efficiency. From the results in Tables 2-4 above, it can be seen that after sphingosine lipids deliver 0.1 nmol of nucleic acid at a concentration of 1.25 μg / mL, the fluorescence value of the experimental group shifts significantly compared to the free uptake group. This indicates that various sphingosine monomers can all efficiently deliver sRNA into cells. Sphingosine lipid monomers, especially sphingosines of the present invention with a carbon chain length of more than 21, are effective for nucleic acid delivery.

Claims

1. 1. Use of a lipid composition in the preparation of a product for delivering a nucleic acid, said lipid composition comprising a lipid molecule of the following formula (I): 【Chemical 1】 During the ceremony, A is a linear C １０～３４ Alkyl groups and linear C １０～３４ Alkenyl groups, preferably linear C １０～３２ Alkyl groups and linear C １０～３２ alkenyl groups, Q is —OH; and preferably, the lipid composition comprises one or more compounds shown in Table 1.

2. The use according to claim 1, wherein the lipid composition comprises two or more compounds of formula (I), and optionally the lipid composition further comprises a lipid other than the compound of formula (I).

3. 3. The use according to claim 1 or 2, wherein the product is used for delivering nucleic acids into the body of a subject, preferably the reagent is used for delivering nucleic acids into the body of a subject via oral, intramuscular, intravenous, subcutaneous, transdermal, intra-arterial, intraperitoneal, intrapulmonary, intracerebrospinal, intra-articular, intrasynovial, intrathecal, intraventricular and / or inhalation routes.

4. 3. The use according to claim 1 or 2, wherein the product is used for delivering nucleic acids to cells in vitro, preferably by direct contact with cells in vitro, preferably wherein the cells are tumor cells.

5. The nucleic acid is an RNA molecule or a DNA molecule, preferably 5. The use according to any one of claims 1 to 4, wherein the RNA molecule is a small RNA, preferably the RNA molecule is a small RNA having a length of 14 to 32 nucleotides, preferably the nucleic acid molecule is a small RNA having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides.

6. 1. A pharmaceutical composition comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more nucleic acid molecules of formula (I): 【Chemistry 2】 During the ceremony, A is a linear C １０～３４ Alkyl group or linear C １０～３４ Alkenyl groups, preferably linear C １０～３２ Alkyl groups and linear C １０～３２ alkenyl groups, Q is —OH; and preferably, the lipid composition comprises one or more compounds shown in Table 1.

7. The nucleic acid molecule is an RNA molecule or a DNA molecule, preferably 7. The pharmaceutical composition of claim 6, wherein the nucleic acid molecule is a small RNA, preferably the nucleic acid molecule is a small RNA having a length of 14 to 32 nucleotides, preferably the nucleic acid molecule is a small RNA having a length of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32 nucleotides.

8. The pharmaceutical composition according to any one of claims 6 to 7, wherein the mass ratio of the lipid composition to the nucleic acid molecule is 1:100 to 100:

1.

9. 9. The pharmaceutical composition of claim 8, wherein the mass ratio of the lipid composition to the nucleic acid molecule is 1:100, 1:30, 1:10, 1:3, 1:1, 3:1, 10:1, 30:1, 100:1, or a range between any of the above ratios.

10. The pharmaceutical composition according to any one of claims 6 to 9, further comprising a pharmaceutically acceptable carrier or excipient.

11. The pharmaceutical composition according to any one of claims 6 to 10, wherein the nucleic acid molecule is a therapeutic RNA molecule or a DNA molecule, preferably the nucleic acid molecule is used to treat a disease by targeting to a specific target.

12. Steps below: 1) mixing the lipid composition with the nucleic acid molecule, 12. A method for preparing a pharmaceutical composition according to any one of claims 6 to 11, comprising the mixture, wherein the lipid composition is as defined in any one of claims 6 and 8, and the nucleic acid molecule is as defined in any one of claims 7, 8, and 9.

13. Steps below: 2) 25°C to 150°C, Preferably at 25°C, 30°C, 35°C, 36°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C, 65°C, 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 110°C, 120°C, 130°C, 140°C, or 150°C, or any range of temperatures between these points, Heating the mixture obtained in step 1) of claim 12 for at least 5 minutes; 13. The method of claim 12, further comprising heating, preferably for 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 minutes.

14. 14. Use of the pharmaceutical composition of any one of claims 6 to 11 or the pharmaceutical composition prepared by the method of any one of claims 12 to 13 in the preparation of a medicament for treating a disease in a subject, wherein preferably the medicament is administered to the subject by oral, intramuscular, intravenous, subcutaneous, transdermal, intraarterial, intraperitoneal, intrapulmonary, intracerebrospinal, intraarticular, intrasynovial, intrathecal, intraventricular and / or inhalation route.

15. 15. The use according to claim 14, wherein the disease is selected from cancer, inflammation, fibrotic diseases, autoimmune diseases, infectious diseases, congenital and genetic diseases, connective tissue diseases, digestive system diseases, endocrine diseases, eye diseases, reproductive diseases, cardiovascular diseases, renal and urinary diseases, respiratory diseases, metabolic disorders, musculoskeletal diseases, nervous system diseases, and blood system diseases.

16. 16. The use of claim 15, wherein the cancer is selected from lung cancer, prostate cancer, breast cancer, head and neck cancer, esophageal cancer, gastric cancer, colon cancer, rectal cancer, bladder cancer, cervical cancer, uterine cancer, ovarian cancer, liver cancer, melanoma, kidney cancer, squamous cell carcinoma, or blood system cancer.

17. 1. A composition for in vitro cell transfection comprising a lipid composition and a nucleic acid molecule, wherein the lipid composition comprises one or more nucleic acid molecules of formula (I): 【Chemistry 3】 During the ceremony, A is a linear C １０～３４ Alkyl group or linear C １０～３４ Alkenyl groups, preferably linear C １０～３２ Alkyl groups and linear C １０～３２ alkenyl groups, Q is —OH; wherein the nucleic acid molecule is a small RNA.

18. Formula (I): 【Chemistry 4】 During the ceremony, A is a linear C １０～３４ Alkyl groups and linear C １０～３４ Alkenyl groups, preferably linear C １０～３２ Alkyl groups and linear C １０～３２ alkenyl groups, Q is —OH; and preferably a compound shown in Table 1.

19. A method for preparing a compound of formula (I) according to claim 18, comprising the following methods a to c: Method a. 【Chemistry 5】 Step a1. Reacting a compound of formula 1 with an olefin to produce a compound of formula 2; Step a2: Converting the compound represented by formula 2 into a compound represented by formula (I) in which A is a linear alkenyl group; Optional step a3. Reducing the compound of formula (I) wherein A is a linear alkenyl group to obtain the compound of formula (I) wherein A is a linear alkyl group; Including, wherein n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32; Method b. 【Chemistry 6】 Step b1. Reacting a compound of formula 1 with an olefin to produce a compound of formula 2; Step b2-1: reducing the compound represented by formula 2 to obtain a compound represented by formula 3; Step b3: Converting the compound represented by formula 3 into a compound represented by formula (I) in which A is a linear alkyl group; or Step b2-2: Converting the compound represented by formula 2 into a compound represented by formula (I) in which A is a linear alkenyl group; Including, Method b, wherein n=9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, or 32; Method c. 【Chemistry 7】 The method is selected from any one of the following:

Images