Benzimidazole compounds, their preparation and use
Benzimidazole compounds, prepared via catalytic reactions, address the limitations of current heart failure treatments by directly targeting cardiac abnormalities, providing an effective treatment for chronic heart failure.
Patent Information
- Application Number
- JP2025514458
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-09-09
- Filing Date
- 2023-07-19
- Publication Date
- 2025-09-09
- Estimated Expiration
- 2043-07-19
AI Technical Summary
Current drugs for chronic heart failure primarily focus on alleviating symptoms through compensatory mechanisms, failing to halt the progression of the condition, particularly in heart failure with preserved ejection fraction and reduced ejection fraction.
Development of benzimidazole-based compounds with specific structural variations, prepared through catalytic reactions involving brominated compounds and boric acid, which can treat chronic heart failure by targeting underlying cardiac abnormalities.
The benzimidazole compounds effectively treat chronic heart failure by addressing structural and functional cardiac issues, offering a potential halt to the progression of the condition.
Smart Images

Figure 2025529992000001_ABST
Abstract
Description
[Technical Field]
[0001] The present application belongs to the technical field of chemical medicine and relates to benzimidazole compounds, their preparation methods and uses. [Background technology]
[0002] Chronic heart failure is a clinical syndrome whose typical symptoms (e.g., dyspnea, ankle swelling, fatigue) may be accompanied by vital signs due to structural and / or functional cardiac abnormalities (e.g., elevated jugular venous pressure, pulmonary crackles, peripheral edema), resulting in reduced cardiac output and / or elevated intracardiac pressure at rest or during pressure. Chronic heart failure occurs only when symptoms are significant.
[0003] Existing drugs primarily alleviate symptoms by triggering compensatory mechanisms based on the sympathetic adrenergic system during the heart failure process. The sympathetic adrenergic system, the renin-angiotensin-aldosterone (RAA) system, and the release of vasoactive peptides (natriuretic peptides) are stimulated and regulated by myocardial injury, compensating for some myocardial function through increased preload (edema), afterload reperfusion (vasoconstriction), and calcium regulation in cardiomyocytes (hypertrophic cardiomyopathy). In short, first-line treatment protocols still fail to halt the progression of heart failure.
[0004] Therefore, the development of drugs to effectively treat chronic heart failure, including heart failure with preserved ejection fraction and heart failure with reduced ejection fraction, is a focus of research in this field. Summary of the Invention [Problem to be solved by the invention]
[0005] The present application provides benzimidazole-based compounds, their preparation methods and uses. [Means for solving the problem]
[0006] In aspect 1, the present application provides: having the structure shown in Formula A below: [ka] (where R is a hydroxy group or [ka] and R1, R2, R3 and R5 each independently represent hydrogen, halogen, a nitro group, an amino group, a hydroxy group, a cyano group, a carboxyl group, a C1-C4 linear or branched chain alkoxyformyl group, a carbamoyl group, a carbamoyl group substituted at N with a C1-C4 linear or branched chain alkyl group, a C1-C4 linear or branched chain alkyl group, a C1-C4 alkoxy group or a C1-C4 alkylamino group; R4 is fluorine, bromine, a nitro group, a hydroxy group, a cyano group, a carboxyl group, an alkoxyformyl group, a carbamoyl group, an N-substituted carbamoyl group, a C1-C4 linear or branched alkyl group, a non-halogenated C1-C4 alkoxy group, or a C1-C4 alkylamino group; R6 is a C1-C4 linear or branched alkylene group. Benzimidazole compounds are provided.
[0007] The benzimidazole compound having the structure represented by formula A according to the present application has an effect of treating chronic heart failure.
[0008] In some preferred embodiments, the benzimidazole-based compound has a structure shown in Formula I or Formula II: [ka] (However, the limitations of R1, R2, R3, R4, and R5 are the same as those in Formula A.)
[0009] In some preferred embodiments, R1, R2, R3, and R5 are each independently any one of hydrogen, fluorine, chlorine, bromine, amino, hydroxy, cyano, methoxyformyl, ethoxyformyl, dimethylcarbamoyl, diethylcarbamoyl, trifluoromethyl, methyl, ethyl, n-propyl, isopropyl, allyl, cyanomethyl, methoxy, trifluoromethoxy, ethoxy, methylamino, dimethylamino, ethylamino, and diethylamino.
[0010] In some preferred embodiments, R4 is any one of fluorine, bromine, amino, hydroxy, cyano, carboxyl, methoxyformyl, ethoxyformyl, carbamoyl, dimethylcarbamoyl, diethylcarbamoyl, trifluoromethyl, methyl, ethyl, n-propyl, isopropyl, allyl, cyanomethyl, methoxy, ethoxy, methylamino, dimethylamino, ethylamino, or diethylamino.
[0011] In some more preferred embodiments, R1 and R2 are hydrogen or methyl groups.
[0012] In some more preferred embodiments, R3 is a cyano group, fluorine, or hydrogen.
[0013] In some more preferred embodiments, R4 is fluorine, an allyl group, an n-propyl group, a cyanomethyl group, a carboxyl group, a methoxyformyl group, a carbamoyl group, or a dimethylcarbamoyl group.
[0014] In some more preferred embodiments, R5 is hydrogen or a methyl group.
[0015] In the present application, when a group is defined, the number of carbon atoms is defined, for example, a C1-C4 linear or branched alkyl group, a C1-C4 alkoxy group, etc., and the defined number of carbon atoms means all integer values within the defined range, for example, C1-C4 means that the number of carbon atoms may be 1, 2, 3, or 4.
[0016] In some preferred embodiments, the benzimidazole-based compound includes any one of the compounds of the following formulae I-1 to I-47 and II-1 to II-144. [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka]
[0017] In aspect 2, the present application provides: The method includes the steps of catalytically reacting a brominated compound of formula B with a boric acid compound of formula V to obtain a benzimidazole compound of formula A, the reaction scheme of which is as follows: [ka] (However, the limitations of R, R1, R2, R3, R4, and R5 are the same as above, and the explanation will be omitted here.) A method for preparing the above benzimidazole-based compounds is provided.
[0018] Preferably, the molar ratio of the brominated compound of formula B to the boric acid compound of formula V is 1:0.8 to 1:3, for example, 0.8:3, 0.85:3, 0.88:3, 0.9:3, 0.95:3, or 1:3.
[0019] Preferably, the catalyst is any one or a combination of at least two of tetrakis(triphenylphosphine)palladium, 1,1-bis(diphenylphosphine)ferrocenedichloropalladium, or palladium acetate.
[0020] Preferably, the molar ratio of the catalyst to the boric acid compound of formula V is 0.001:1 to 0.5:1, for example, 0.001:1, 0.005:1, 0.008:1, 0.1:1, 0.2:1, 0.3:1, 0.4:1, or 0.5:1.
[0021] Preferably, the Suzuki reaction is carried out in the presence of an alkaline substance.
[0022] Preferably, the alkaline substance is any one or a combination of at least two of potassium fluoride, potassium acetate, sodium carbonate, potassium carbonate, or potassium phosphate.
[0023] Preferably, the Suzuki reaction is carried out in an organic solvent, and the organic solvent is any one or a combination of at least two of DMF, toluene, ethanol, 1,4-dioxane, water, or THF.
[0024] Preferably, the temperature of the Suzuki reaction is 70°C to 150°C (e.g., 70°C, 75°C, 80°C, 90°C, 100°C, 110°C, 120°C, 130°C, 140°C, or 150°C), and the reaction time is 0.25 hours to 48 hours (e.g., 0.25 hours, 0.5 hours, 1 hour, 3 hours, 8 hours, 10 hours, 13 hours, 15 hours, 18 hours, 20 hours, 24 hours, 28 hours, 33 hours, 38 hours, 40 hours, 42 hours, 45 hours, or 48 hours).
[0025] In a third aspect, the present application provides a pharmaceutically acceptable salt of the benzimidazole compound described above.
[0026] In the present application, the pharmaceutically acceptable salt is an organic acid salt or an inorganic acid salt of the benzimidazole compound.
[0027] Preferably, the organic acid salt is any one selected from tartrate, stearate, oxalate, citrate, lactate, sorbate, fumarate, formate, acetate, benzoate, benzenesulfonate, ethanesulfonate, resinate, trifluoroacetate, maleate, malate, L-malate, methanesulfonate, fumarate, amino acid salt, and nicotinate.
[0028] Preferably, the organic acid salt is any one selected from tartrate, acetate, maleate, malate, L-malate, and fumarate.
[0029] Preferably, the inorganic acid salt is any one selected from phosphate, sulfate, nitrate, iodate, bromate, hydroiodide, hydrobromide, and hydrochloride.
[0030] Preferably, the inorganic acid salt is any one selected from phosphate, sulfate, and hydrochloride.
[0031] In a fourth aspect, the present application provides a solvate of the benzimidazole compound described above.
[0032] Preferably, the solvate is a hydrate and / or alcohol solvate of the benzimidazole compound. In the present application, the solvate of the benzimidazole compound corresponds to the benzimidazole compound in terms of function and effect.
[0033] In a fifth aspect, the present application provides prodrugs of the benzimidazole compounds described above.
[0034] In this application, the prodrug refers to a compound obtained by modifying the chemical structure of a drug, which has no or little activity in vitro, and which exerts its medicinal effect by releasing an active drug through enzymatic or non-enzymatic conversion in vivo.
[0035] In the present application, the prodrug of the benzimidazole compound has no or little activity in vitro, and after undergoing metabolic changes in vivo, it releases an active benzimidazole compound and exerts its action.
[0036] In a sixth aspect, the present application provides tautomers or stereochemical isomers of the benzimidazole compounds described above. Common tautomers include, but are not limited to, tautomers due to tautomerism of the double bond in the benzimidazole ring in the structures of Formula I and Formula II.
[0037] In aspect 7, the present application provides containing the benzimidazole-based compound described above, Pharmaceutical compositions are provided.
[0038] Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant.
[0039] Preferably, the pharmaceutically acceptable adjuvant is any one of an excipient, a diluent, a vector, a flavoring agent, a binder, or a filler.
[0040] Preferably, the dosage form of the pharmaceutical composition is an oral formulation, a parenteral administration formulation, or an external formulation.
[0041] For example, in this application, the pharmaceutical compositions can be prepared as solid, semi-solid, liquid, or gaseous preparations, such as tablets, pills, capsules, powders, granules, creams, emulsions, suspensions, suppositories, injections, inhalants, gels, microspheres, and aerosols.
[0042] Typical routes of administration of the compounds of the present application, or pharmaceutically acceptable salts thereof, or pharmaceutical compositions thereof, include, but are not limited to, oral, rectal, topical, inhalation, parenteral, sublingual, intravaginal, intranasal, intraocular, intraperitoneal, intramuscular, subcutaneous, and intravenous administration.
[0043] In an eighth aspect, the present application provides the use of the benzimidazole compound, a pharmaceutically acceptable salt, solvate, prodrug, tautomer, or stereochemical isomer thereof, or a pharmaceutical composition thereof, as described above, in the preparation of a medicament for treating chronic heart failure.
[0044] In a ninth aspect, the present application provides a use of a substituted benzimidazole compound, or a tautomer thereof, or a pharmaceutically acceptable salt thereof, or a solvate thereof, or a hydrate thereof, or a pharmaceutical composition thereof, in the preparation of a medicament for treating chronic heart failure, wherein the substituted benzimidazole compound has the following structure: [ka] [Effects of the Invention]
[0045] Compared to the prior art, the present invention has the following beneficial effects:
[0046] The benzimidazole compounds of the present application, their pharmaceutically acceptable salts, solvates, prodrugs, tautomers, or stereochemical isomers, or pharmaceutical compositions have the effect of treating chronic heart failure and have broad application prospects. [Brief explanation of the drawings]
[0047] [Figure 1]1 is a nuclear magnetic hydrogen spectrum of the compound of the present invention, Formula I-1. [Figure 2] 1 is a nuclear magnetic hydrogen spectrum of the compound of the present invention, Formula I-24. [Figure 3] 1 is a nuclear magnetic hydrogen spectrum of the compound of the present invention, Formula I-25. DETAILED DESCRIPTION OF THE INVENTION
[0048] The technical solution of the present application will be further described below through specific embodiments. Those skilled in the art should understand that the above examples are only for understanding the present application and should not be considered as specifically limiting the present application.
[0049] Example 1 Synthesis of Compound of Formula I-1 Under the protection of nitrogen gas, 2-bromo-4-fluorophenol (19.1 g, 0.1 mol), (2-methyl-1H-benzimidazol-5-yl)boronic acid (17.6 g, 0.1 mol) were added to 1,4-dioxane (100 ml), and the resulting mixture was diluted with potassium acetate (19.6 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (3.6 g, 5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (2.8 g, 5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 13.4 g of 4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenol was obtained as an off-white powder solid in a 55.3% yield. EI-MS M / Z 243.3 [M + ].
[0050] 1H-NMR (DMSO-d6, 400 MHz): 2.49 (3H, s), 6.86-7.02 (2H, m), 7.10 (1H, dd, J = 9.7, 2.4 Hz), 7.30 (1H, d, J = 8.3 Hz), 7.45 (1H, d, J = 6.3 Hz), 7.63 (1H, s), 9.46 (1H, s), 12.20 (1H, s). For the nuclear magnetic hydrogen spectrum, see Figure 1.
[0051] Note: (2-Methyl-1H-benzimidazol-5-yl)boronic acid was obtained by the standard Miyaura boration reaction of commercially available 5-bromo-1H-benzimidazole. The arylboronic acids in the other examples were obtained using the same preparation method or principle. Other starting materials are generally commercially available or can be obtained by those skilled in the art using standard chemical synthesis methods using commercially available materials.
[0052] Example 2 Synthesis of Compound of Formula I-2 Under the protection of nitrogen gas, 2-bromo-4,6-difluorophenol (2.08 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.54 g of 2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenol was obtained as an off-white powder solid in a 59.2% yield. EI-MS M / Z 261.2 [M + ].
[0053] Example 3 Synthesis of Compound of Formula I-3 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-hydroxybenzonitrile (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.18 g of 5-fluoro-2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 44.2% yield. EI-MS M / Z 268.3 [M + ].
[0054] Example 4 Synthesis of Compound of Formula I-4 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzamide (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.88 g of 4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 32.9% yield. EI-MS M / Z 268.3 [M + ].
[0055] Example 5 Synthesis of Compound of Formula I-5 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzamide (2.34 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.89 g of 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 31.2% yield. EI-MS M / Z 286.3 [M + ].
[0056] Example 6 Synthesis of Compound of Formula I-6 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzamide (2.41 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.81 g of 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 27.6% yield. EI-MS M / Z 293.3 [M + ].
[0057] Example 7 Synthesis of Compound of Formula I-7 Under the protection of nitrogen gas, 3-bromo-4-hydroxy-N,N-dimethylbenzamide (2.16 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.18 g of 4-hydroxy-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 39.9% yield. EI-MS M / Z 296.3 [M + ].
[0058] Example 8 Synthesis of Compound of Formula I-8 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxy-N,N-dimethylbenzamide (2.60 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.19 g of 3-fluoro-4-hydroxy-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 38.0% yield. EI-MS M / Z 314.3 [M + ].
[0059] Example 9 Synthesis of Compound of Formula I-9 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxy-N,N-dimethylbenzamide (2.69 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.15 g of 3-cyano-4-hydroxy-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 35.9% yield. EI-MS M / Z 321.4 [M + ].
[0060] Example 10 Synthesis of Compound of Formula I-48 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzoic acid (2.17 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.78 g of 4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 26.1% yield. EI-MS M / Z 269.3 [M + ].
[0061] Example 11 Synthesis of Compound of Formula I-10 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzoic acid (2.35 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.69 g of 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 24.1%. EI-MS M / Z 287.3 [M + ].
[0062] Example 12 Synthesis of Compound of Formula I-11 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzoic acid (2.42 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.61 g of 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 20.8% yield. EI-MS M / Z 294.3 [M + ].
[0063] Example 13 Synthesis of Compound of Formula I-12 Under the protection of nitrogen gas, methyl 3-bromo-4-hydroxybenzoate (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.58 g of methyl 4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 56.0% yield. EI-MS M / Z 283.3 [M + ].
[0064] Example 14 Synthesis of Compound of Formula I-13 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-hydroxybenzoate (2.49 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.69 g of methyl 3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 56.3% yield. EI-MS M / Z 301.3 [M + ].
[0065] Example 15 Synthesis of Compound of Formula I-14 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-hydroxybenzoate (2.56 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.61 g of methyl 3-cyano-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 43.2% yield. EI-MS M / Z 308.3 [M + ].
[0066] Example 16 Synthesis of Compound of Formula I-15 Under the protection of nitrogen gas, 4-allyl-2-bromophenol (2.13 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.78 g of 4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenol was obtained as a pale white powder solid in a 29.4% yield. EI-MS M / Z 265.3 [M + ].
[0067] Example 17 Synthesis of Compound of Formula I-16 Under the protection of nitrogen gas, 4-allyl-2-bromo-6-fluorophenol (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.69 g of 4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)-6-fluorophenol was obtained as an off-white powder solid in a yield of 24.4%. EI-MS M / Z 283.3 [M + ].
[0068] Example 18 Synthesis of Compound of Formula I-17 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-hydroxybenzonitrile (2.38 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.81 g of 5-allyl-3-(2-methyl-1H-benzimidazol-5-yl)-2-hydroxybenzonitrile was obtained as an off-white powder solid in a yield of 28.0%. EI-MS M / Z 290.3 [M+ ].
[0069] Example 19 Synthesis of Compound of Formula I-18 Under the protection of nitrogen gas, 2-(3-bromo-4-hydroxyphenyl)acetonitrile (2.12 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile (1.28 g, 48.7%) was obtained as a white powder solid. EI-MS M / Z 264.3 [M + ].
[0070] Example 20 Synthesis of Compound of Formula I-19 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-phenol)acetonitrile (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.5 mmol). Add ferrocene (0.28 g, 0.5 mmol), heat to 110 °C, and react for 2 hours. After completion of the reaction, allow the reaction mixture to cool, add water / ethyl acetate, extract, concentrate the organic phase to dryness, and perform column chromatography using ethyl acetate / petroleum ether as an eluent. Obtain 1.19 g of off-white powder solid, 2-(3-fluoro-4-hydroxy-5-(2-methyl-1H-benzimidazol-5-yl))phenyl)acetonitrile, in a yield of 42.3%. EI-MS M / Z 282.3 [M + ].
[0071] Example 21 Synthesis of Compound of Formula I-20 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-hydroxybenzonitrile (2.37 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.01 g of 5-cyanomethyl-2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 35.0% yield. EI-MS M / Z 289.3 [M + ].
[0072] Example 22 Synthesis of Compound of Formula I-21 Under the protection of nitrogen gas, 2-bromo-4-propylphenol (2.15 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.75 g of 2-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenol was obtained as an off-white powder solid in a 65.5% yield. EI-MS M / Z 267.3 [M + ].
[0073] Example 23 Synthesis of Compound of Formula I-22 Under the protection of nitrogen gas, 2-bromo-6-fluoro-4-propylphenol (2.33 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.39 g of 2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenol was obtained as an off-white powder solid in a 48.7% yield. EI-MS M / Z 285.3 [M + ].
[0074] Example 24 Synthesis of Compound of Formula I-23 Under the protection of nitrogen gas, 3-bromo-2-hydroxy-5-propylbenzonitrile (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.11 g of 2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 38.0% yield. EI-MS M / Z 292.4 [M + ].
[0075] Example 25 Synthesis of Compound of Formula I-24 Under nitrogen gas protection, 2-bromo-4-fluorophenol (19.1 g, 0.1 mol) and (1H-benzimidazol-5-yl)boronic acid (16.2 g, 0.1 mol) were added to 1,4-dioxane (100 ml), followed by potassium acetate (19.6 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (3.6 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (2.8 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as an eluent to obtain 14.5 g of 4-fluoro-2-(1H-benzimidazol-5-yl)phenol as an off-white powder solid, with a yield of 63.5%. EI-MS M / Z 229.2[M + ].
[0076] 1H-NMR (DMSO-d6, 400 MHz): 6.91-7.01 (2H, m), 7.12 (1H, dd, J = 9.8, 3.0 Hz), 7.38 (1H, d, J = 8.4 Hz), 7.60 (1H, d, J = 8.3 Hz), 7.77 (1H, s), 8.24 (1H, s), 9.48 (1H, s), 12.47 (1H, s). For the nuclear magnetic hydrogen spectrum, see Figure 2.
[0077] Example 26 Synthesis of Compound of Formula I-25 Under the protection of nitrogen gas, 2-bromo-4,6-difluorophenol (2.08 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.57 g of 2,4-difluoro-6-(1H-benzimidazol-5-yl)phenol was obtained as an off-white powder solid in a 63.8% yield. EI-MS M / Z 247.2 [M + ].
[0078] 1 H-NMR (DMSO-d6, 400 MHz): 7.03-7.06 (1H, m), 7.17-7.23 (1H, m), 7.39 (1H, dd, J = 8.4 Hz), 7.63 (1H, d, J = 8.4 Hz), 7.79 (1H, s), 8.27 (1H, s), 9.44 (1H, s), 12.52 (1H, s). For the nuclear magnetic hydrogen spectrum, see Figure 3.
[0079] Example 27 Synthesis of Compound of Formula I-26 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-hydroxybenzonitrile (2.16 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.12 g of 5-fluoro-2-hydroxy-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 44.3% yield. EI-MS M / Z 254.2 [M + ].
[0080] Example 28 Synthesis of Compound of Formula I-27 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzamide (2.16 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.86 g of 4-hydroxy-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 34.0% yield. EI-MS M / Z 254.3 [M + ].
[0081] Example 29 Synthesis of Compound of Formula I-28 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzamide (2.34 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was carried out for 2 hours. After the reaction was completed, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.82 g of 3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 30.1% yield. EI-MS M / Z 272.3 [M + ].
[0082] Example 30 Synthesis of Compound of Formula I-29 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzamide (2.41 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.80 g of 3-cyano-4-hydroxy-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 26.9% yield. EI-MS M / Z 279.3 [M + ].
[0083] Example 31 Synthesis of Compound of Formula I-30 Under the protection of nitrogen gas, 3-bromo-4-hydroxy-N,N-dimethylbenzamide (2.16 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110°C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.12 g of 4-hydroxy-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 39.9% yield. EI-MS M / Z 282.3 [M + ].
[0084] Example 32 Synthesis of Compound of Formula I-31 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxy-N,N-dimethylbenzamide (2.60 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.09 g of 3-fluoro-4-hydroxy-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 36.4% yield. EI-MS M / Z 300.3 [M + ].
[0085] Example 33 Synthesis of Compound of Formula I-32 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxy-N,N-dimethylbenzamide (2.69 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.05 g of 3-cyano-4-hydroxy-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 34.3% yield. EI-MS M / Z 307.3 [M + ].
[0086] Example 34 Synthesis of Compound of Formula I-33 Under the protection of nitrogen gas, 3-bromo-4-hydroxybenzoic acid (2.17 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.68 g of 4-hydroxy-3-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 26.8%. EI-MS M / Z 255.3 [M + ].
[0087] Example 35 Synthesis of Compound of Formula I-34 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-hydroxybenzoic acid (2.35 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.52 g of 3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 19.0%. EI-MS M / Z 273.2 [M + ].
[0088] Example 36 Synthesis of Compound of Formula I-35 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-hydroxybenzoic acid (2.42 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.63 g of 3-cyano-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 22.5% yield. EI-MS M / Z 280.3 [M + ].
[0089] Example 37 Synthesis of Compound of Formula I-36 Under the protection of nitrogen gas, methyl 3-bromo-4-hydroxybenzoate (2.31 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.50 g of methyl 4-hydroxy-3-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 56.0% yield. EI-MS M / Z 269.3 [M + ].
[0090] Example 38 Synthesis of Compound of Formula I-37 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-hydroxybenzoate (2.49 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.62 g of methyl 3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 56.6% yield. EI-MS M / Z 287.3 [M + ].
[0091] Example 39 Synthesis of Compound of Formula I-38 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-hydroxybenzoate (2.56 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.60 g of methyl 3-cyano-4-hydroxy-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 54.6% yield. EI-MS M / Z 294.3 [M + ].
[0092] Example 40 Synthesis of Compound of Formula I-39 Under the protection of nitrogen gas, 4-allyl-2-bromophenol (2.13 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.68 g of 4-allyl-2-(1H-benzimidazol-5-yl)phenol was obtained as a white powdery solid in a yield of 27.2%. EI-MS M / Z 251.3 [M + ].
[0093] Example 41 Synthesis of Compound of Formula I-40 Under the protection of nitrogen gas, 4-allyl-2-bromo-6-fluorophenol (2.31 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.65 g of 4-allyl-2-(1H-benzimidazol-5-yl)-6-fluorophenol was obtained as a white powder solid in a yield of 24.2%. EI-MS M / Z 269.3 [M + ].
[0094] Example 42 Synthesis of Compound of Formula I-41 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-hydroxybenzonitrile (2.38 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.80 g of 5-allyl-3-(1H-benzimidazol-5-yl)-2-hydroxybenzonitrile was obtained as an off-white powder solid in a 29.1% yield. EI-MS M / Z 276.3 [M + ].
[0095] Example 43 Synthesis of Compound of Formula I-42 Under the protection of nitrogen gas, 2-(3-bromo-4-hydroxyphenyl)acetonitrile (2.12 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.28 g of 2-(4-hydroxy-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 51.2% yield. EI-MS M / Z 250.3 [M + ].
[0096] Example 44 Synthesis of Compound of Formula I-43 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-phenol)acetonitrile (2.30 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.5 mmol). Add ferrocene (0.28 g, 0.5 mmol), heat to 110 °C, and react for 2 hours. After completion of the reaction, allow the reaction mixture to cool, add water / ethyl acetate, extract, concentrate the organic phase to dryness, and perform column chromatography using ethyl acetate / petroleum ether as an eluent. Obtain 1.12 g of 2-(3-fluoro-4-hydroxy-5-(1H-benzimidazol-5-yl))phenyl)acetonitrile as an off-white powder solid in a 41.9% yield. EI-MS M / Z 268.3 [M + ].
[0097] Example 45 Synthesis of Compound of Formula I-44 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-hydroxybenzonitrile (2.37 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.12 g of 5-cyanomethyl-2-hydroxy-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 40.9% yield. EI-MS M / Z 275.3 [M + ].
[0098] Example 46 Synthesis of Compound of Formula I-45 Under the protection of nitrogen gas, 2-bromo-4-propylphenol (2.15 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.55 g of 2-(1H-benzimidazol-5-yl)-4-propylphenol was obtained as a white powdery solid in a 61.5% yield. EI-MS M / Z 253.3 [M + ].
[0099] Example 47 Synthesis of Compound of Formula I-46 Under the protection of nitrogen gas, 2-bromo-6-fluoro-4-propylphenol (2.33 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.33 g of 2-fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenol was obtained as an off-white powder solid in a 49.2% yield. EI-MS M / Z 271.3 [M + ].
[0100] Example 48 Synthesis of Compound of Formula I-47 Under the protection of nitrogen gas, 3-bromo-2-hydroxy-5-propylbenzonitrile (2.40 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.02 g of 2-hydroxy-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 36.8% yield. EI-MS M / Z 278.3 [M + ].
[0101] Example 49 Synthesis of Compound of Formula II-1 Under the protection of nitrogen gas, 2-(2-bromo-4-fluorophenyl)propan-2-ol (2.31 g, 0.1 mol), (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.24 g of 2-(4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)propan-2-ol was obtained as an off-white powder solid in a 43.7% yield. EI-MS M / Z 285.3 [M + ].
[0102] Example 50 Synthesis of Compound of Formula II-2 Under the protection of nitrogen gas, 2-(2-bromo-4,6-difluorophenyl)propan-2-ol (2.50 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.59 g of 2-(2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)propan-2-ol was obtained as an off-white powder solid in a 52.5% yield. EI-MS M / Z 303.3 [M + ].
[0103] Example 51 Synthesis of Compound of Formula II-3 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(2-hydroxypropan-2-yl)benzonitrile (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.28 g of 5-fluoro-2-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a yield of 41.4%. EI-MS M / Z 310.3 [M + ].
[0104] Example 52 Synthesis of Compound of Formula II-4 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzamide (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.78 g of 4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 25.4% yield. EI-MS M / Z 310.4 [M+ ].
[0105] Example 53 Synthesis of Compound of Formula II-5 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzamide (2.76 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.89 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a yield of 27.1%. EI-MS M / Z 328.4 [M + ].
[0106] Example 54 Synthesis of Compound of Formula II-6 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzamide (2.83 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.71 g of 3-cyano-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 21.2% yield. EI-MS M / Z 335.4 [M + ].
[0107] Example 55 Synthesis of Compound of Formula II-7 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (2.86 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.18 g of 4-(2-hydroxypropan-2-yl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 35.0% yield. EI-MS M / Z 338.4 [M + ].
[0108] Example 56 Synthesis of Compound of Formula II-8 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.04 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.21 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 34.0% yield. EI-MS M / Z 356.4 [M + ].
[0109] Example 57 Synthesis of Compound of Formula II-9 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.11 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.20 g of 3-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 33.1% yield. EI-MS M / Z 363.4 [M + ].
[0110] Example 58 Synthesis of Compound of Formula II-10 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzoic acid (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.79 g of 4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 25.4%. EI-MS M / Z 311.4 [M + ].
[0111] Example 59 Synthesis of Compound of Formula II-11 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoic acid (2.77 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.74 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 22.5% yield. EI-MS M / Z 329.3 [M + ].
[0112] Example 60 Synthesis of Compound of Formula II-12 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoic acid (2.84 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.63 g of 3-cyano-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 19.4%. EI-MS M / Z 336.4 [M + ].
[0113] Example 61 Synthesis of Compound of Formula II-13 Under the protection of nitrogen gas, methyl 3-bromo-4-(2-hydroxypropan-2-yl)benzoate (2.73 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.55 g of methyl 4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 47.8% yield. EI-MS M / Z 325.4 [M + ].
[0114] Example 62 Synthesis of Compound of Formula II-14 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoate (2.91 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.69 g of methyl 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a yield of 49.4%. EI-MS M / Z 343.4 [M + ].
[0115] Example 63 Synthesis of Compound of Formula II-15 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoate (2.98 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.63 g of methyl 3-cyano-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 46.5% yield. EI-MS M / Z 350.4 [M + ].
[0116] Example 64 Synthesis of Compound of Formula II-16 Under the protection of nitrogen gas, 2-(4-allyl-2-bromophenyl)propan-2-ol (2.55 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110°C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.68 g of 2-(4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)propan-2-ol was obtained as an off-white powder solid in a yield of 22.2%. EI-MS M / Z 307.4 [M + ].
[0117] Example 65 Synthesis of Compound of Formula II-17 Under the protection of nitrogen gas, 2-(4-allyl-2-bromo-6-fluorophenyl)propan-2-ol (2.73 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.59 g of 2-(4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)propan-2-ol was obtained as an off-white powder solid in an 18.2% yield. EI-MS M / Z 325.4 [M + ].
[0118] Example 66 Synthesis of Compound of Formula II-18 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(2-hydroxypropan-2-yl)benzonitrile (2.80 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.61 g of 5-allyl-2-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in an 18.4% yield. EI-MS M / Z 332.4 [M + ].
[0119] Example 67 Synthesis of Compound of Formula II-19 Under the protection of nitrogen gas, 2-(3-bromo-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.54 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.08 g of 2-(4-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 35.4% yield. EI-MS M / Z 306.4 [M + ].
[0120] Example 68 Synthesis of Compound of Formula II-20 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.72 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.11 g of 2-(3-fluoro-4-(2-hydroxypropan-2-yl)-5-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 34.3% yield. EI-MS M / Z 324.4 [M + ].
[0121] Example 69 Synthesis of Compound of Formula II-21 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(2-hydroxypropan-2-yl)benzonitrile (2.79 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.93 g of 5-cyanomethyl-2-(2-hydroxypropan-2-yl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a yield of 28.1%. EI-MS M / Z 331.4 [M + ].
[0122] Example 70 Synthesis of Compound of Formula II-22 Under the protection of nitrogen gas, 2-(2-bromo-4-propylphenyl)propan-2-ol (2.57 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110°C, and the reaction was carried out for 2 hours. After the reaction was completed, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.65 g of 2-(2-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)propan-2-ol was obtained as an off-white powder solid in a 53.5% yield. EI-MS M / Z 309.4 [M + ].
[0123] Example 71 Synthesis of Compound of Formula II-23 Under the protection of nitrogen gas, 2-(2-bromo-6-fluoro-4-propylphenyl)propan-2-ol (2.75 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.33 g of 2-(2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)propan-2-ol was obtained as an off-white powder solid in a yield of 40.7%. EI-MS M / Z 327.4 [M + ].
[0124] Example 72 Synthesis of Compound of Formula II-24 Under the protection of nitrogen gas, 3-bromo-2-(2-hydroxypropan-2-yl)-5-propanebenzonitrile (2.82 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). The reaction mixture was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.01 g of 2-hydroxy-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 30.3% yield. EI-MS M / Z 334.4 [M + ].
[0125] Example 73 Synthesis of Compound of Formula II-25 Under the protection of nitrogen gas, 2-(2-bromo-4-fluorophenyl)propan-2-ol (2.31 g, 0.1 mol), (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.21 g of 2-(4-fluoro-2-(1H-benzimidazol-5-yl)phenyl)propan-2-ol was obtained as an off-white powder solid in a yield of 44.8%. EI-MS M / Z 271.3 [M + ].
[0126] Example 74 Synthesis of Compound of Formula II-26 Under the protection of nitrogen gas, 2-(2-bromo-4,6-difluorophenyl)propan-2-ol (2.50 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110°C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.44 g of 2-(2,4-difluoro-6-(1H-benzimidazol-5-yl)phenyl)propan-2-ol was obtained as an off-white powder solid in a yield of 49.9%. EI-MS M / Z 289.3 [M + ].
[0127] Example 75 Synthesis of Compound of Formula II-27 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(2-hydroxypropan-2-yl)benzonitrile (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.08 g of 5-fluoro-2-(2-hydroxypropan-2-yl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 36.6% yield. EI-MS M / Z 296.3 [M + ].
[0128] Example 76 Synthesis of Compound of Formula II-28 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzamide (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.72 g of 4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 24.4% yield. EI-MS M / Z 296.3 [M + ].
[0129] Example 77 Synthesis of Compound of Formula II-29 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzamide (2.76 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.83 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a yield of 26.5%. EI-MS M / Z 314.3 [M + ].
[0130] Example 78 Synthesis of Compound of Formula II-30 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzamide (2.83 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.66 g of 3-cyano-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 20.6% yield. EI-MS M / Z 321.4 [M + ].
[0131] Example 79 Synthesis of Compound of Formula II-31 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (2.86 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.03 g of 4-(2-hydroxypropan-2-yl)-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 31.8% yield. EI-MS M / Z 324.4 [M + ].
[0132] Example 80 Synthesis of Compound of Formula II-32 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.04 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.04 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 30.5% yield. EI-MS M / Z 342.4 [M + ].
[0133] Example 81 Synthesis of Compound of Formula II-33 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethylbenzamide (3.11 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.09 g of 3-cyano-4-(2-hydroxypropan-2-yl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 31.3% yield. EI-MS M / Z 349.4 [M+ ].
[0134] Example 82 Synthesis of Compound of Formula II-34 Under the protection of nitrogen gas, 3-bromo-4-(2-hydroxypropan-2-yl)benzoic acid (2.59 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.77 g of 4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 26.0% yield. EI-MS M / Z 297.3 [M + ].
[0135] Example 83 Synthesis of Compound of Formula II-35 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoic acid (2.77 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.76 g of 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as a white powder solid in a yield of 24.2%. EI-MS M / Z 315.3 [M + ].
[0136] Example 84 Synthesis of Compound of Formula II-36 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoic acid (2.84 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.74 g of 3-cyano-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 23.0% yield. EI-MS M / Z 322.3 [M + ].
[0137] Example 85 Synthesis of Compound of Formula II-37 Under the protection of nitrogen gas, methyl 3-bromo-4-(2-hydroxypropan-2-yl)benzoate (2.73 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.25 g of methyl 4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 40.3% yield. EI-MS M / Z 311.4 [M + ].
[0138] Example 86 Synthesis of Compound of Formula II-38 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)benzoate (2.91 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.89 g of methyl 3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 57.6% yield. EI-MS M / Z 329.3 [M + ].
[0139] Example 87 Synthesis of Compound of Formula II-39 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(2-hydroxypropan-2-yl)benzoate (2.98 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.68 g of methyl 3-cyano-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 50.1% yield. EI-MS M / Z 336.4 [M + ].
[0140] Example 88 Synthesis of Compound of Formula II-40 Under the protection of nitrogen gas, 2-(4-allyl-2-bromophenyl)propan-2-ol (2.55 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-allyl-2-(1H-benzimidazol-5-yl)phenyl)propan-2-ol (0.61 g, 20.9% yield) was obtained as a white powder solid. EI-MS M / Z 293.4 [M + ].
[0141] Example 89 Synthesis of Compound of Formula II-41 Under the protection of nitrogen gas, 2-(4-allyl-2-bromo-6-fluorophenyl)propan-2-ol (2.73 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.50 g of 2-(4-allyl-2-fluoro-6-(1H-benzimidazol-5-yl)phenyl)propan-2-ol was obtained as an off-white powder solid in a yield of 16.1%. EI-MS M / Z 311.4 [M + ].
[0142] Example 90 Synthesis of Compound of Formula II-42 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(2-hydroxypropan-2-yl)benzonitrile (2.80 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.56 g of 5-allyl-2-(2-hydroxypropan-2-yl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a yield of 17.6%. EI-MS M / Z 318.4 [M + ].
[0143] Example 91 Synthesis of Compound of Formula II-43 Under the protection of nitrogen gas, 2-(3-bromo-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.54 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110°C, and the reaction was carried out for 2 hours. After the reaction was completed, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.02 g of 2-(4-(2-hydroxypropan-2-yl)-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 26.1% yield. EI-MS M / Z 292.4 [M+ ].
[0144] Example 92 Synthesis of Compound of Formula II-44 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(2-hydroxypropan-2-yl)phenyl)acetonitrile (2.72 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.31 g of 2-(3-fluoro-4-(2-hydroxypropan-2-yl)-5-(1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 42.3% yield. EI-MS M / Z 310.3 [M + ].
[0145] Example 93 Synthesis of Compound of Formula II-45 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(2-hydroxypropan-2-yl)benzonitrile (2.79 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.03 g of 5-cyanomethyl-2-(2-hydroxypropan-2-yl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 32.6% yield. EI-MS M / Z 317.4 [M + ].
[0146] Example 94 Synthesis of Compound of Formula II-46 Under the protection of nitrogen gas, 2-(2-bromo-4-propylphenyl)propan-2-ol (2.57 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (1H-Benzimidazol-5-yl)-4-propylphenyl)propan-2-ol (1.66 g, 56.4%) was obtained as a white powder solid. EI-MS M / Z 295.4 [M + ].
[0147] Example 95 Synthesis of Compound of Formula II-47 Under the protection of nitrogen gas, 2-(2-bromo-6-fluoro-4-propylphenyl)propan-2-ol (2.75 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2-Fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenyl)propan-2-ol (1.38 g, 44.2% yield) was obtained as a white powder solid. EI-MS M / Z 313.4 [M + ].
[0148] Example 96 Synthesis of Compound of Formula II-48 Under the protection of nitrogen gas, 3-bromo-2-(2-hydroxypropan-2-yl)-5-propanebenzonitrile (2.82 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). The reaction mixture was cooled and extracted with water / ethyl acetate. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.89 g of 2-hydroxy-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 27.9% yield. EI-MS M / Z 320.4 [M + ].
[0149] Example 97 Synthesis of Compound of Formula II-49 Under the protection of nitrogen gas, 1-(2-bromo-4-fluorophenyl)ethan-1-ol (2.19 g, 0.1 mol), (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.04 g of 1-(4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethan-1-ol was obtained as an off-white powder solid in a 38.5% yield. EI-MS M / Z 271.3 [M + ].
[0150] Example 98 Synthesis of Compound of Formula II-50 Under the protection of nitrogen gas, 1-(2-bromo-4,6-difluorophenyl)ethan-1-ol (2.37 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.69 g of 1-(2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethan-1-ol was obtained as an off-white powder solid in a 58.4% yield. EI-MS M / Z 289.3 [M+ ].
[0151] Example 99 Synthesis of Compound of Formula II-51 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(1-hydroxyethyl)benzonitrile (2.44 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.09 g of 5-fluoro-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 36.9% yield. EI-MS M / Z 296.3 [M + ].
[0152] Example 100 Synthesis of Compound of Formula II-52 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzamide (2.42 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.72 g of 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 24.4% yield. EI-MS M / Z 296.3 [M + ].
[0153] Example 101 Synthesis of Compound of Formula II-53 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzamide (2.62 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.86 g of 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a yield of 27.4%. EI-MS M / Z 314.3 [M + ].
[0154] Example 102 Synthesis of Compound of Formula II-54 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzamide (2.69 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.70 g of 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 21.8% yield. EI-MS M / Z 321.4 [M + ].
[0155] Example 103 Synthesis of Compound of Formula II-55 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.72 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.10 g of 4-(1-hydroxyethyl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 34.0% yield. EI-MS M / Z 324.4 [M+ ].
[0156] Example 104 Synthesis of Compound of Formula II-56 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.90 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.25 g of 3-fluoro-4-(1-hydroxyethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 38.9% yield. EI-MS M / Z 342.4 [M + ].
[0157] Example 105 Synthesis of Compound of Formula II-57 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.97 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.33 g of 3-cyano-4-(1-hydroxyethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 38.1% yield. EI-MS M / Z 349.4 [M + ].
[0158] Example 106 Synthesis of Compound of Formula II-58 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzoic acid (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.77 g of 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 26.0% yield. EI-MS M / Z 297.3 [M + ].
[0159] Example 107 Synthesis of Compound of Formula II-59 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoic acid (2.63 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.68 g of 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 21.6%. EI-MS M / Z 315.3 [M + ].
[0160] Example 108 Synthesis of Compound of Formula II-60 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoic acid (2.70 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.71 g of 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 22.0% yield. EI-MS M / Z 322.3 [M+ ].
[0161] Example 109 Synthesis of Compound of Formula II-61 Under the protection of nitrogen gas, methyl 3-bromo-4-(1-hydroxyethyl)benzoate (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.55 g of methyl 4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 47.8% yield. EI-MS M / Z 311.4 [M + ].
[0162] Example 110 Synthesis of Compound of Formula II-62 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoate (2.77 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.74 g of methyl 3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as a white powdery solid in a 53.0% yield. EI-MS M / Z 329.3 [M + ].
[0163] Example 111 Synthesis of Compound of Formula II-63 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoate (2.84 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.60 g of methyl 3-cyano-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 47.7% yield. EI-MS M / Z 336.4 [M + ].
[0164] Example 112 Synthesis of Compound of Formula II-64 Under the protection of nitrogen gas, 1-(4-allyl-2-bromophenyl)ethan-1-ol (2.40 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethan-1-ol (0.72 g, 24.6% yield) was obtained as a white powder solid. EI-MS M / Z 293.4 [M + ].
[0165] Example 113 Synthesis of Compound of Formula II-65 Under the protection of nitrogen gas, 1-(4-allyl-2-bromo-6-fluorophenyl)ethan-1-ol (2.59 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.57 g of 1-(4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)ethan-1-ol was obtained as a white powder solid in an 18.4% yield. EI-MS M / Z 311.4 [M+ ].
[0166] Example 114 Synthesis of Compound of Formula II-66 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(1-hydroxyethyl)benzonitrile (2.66 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.66 g of 5-allyl-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a yield of 20.7%. EI-MS M / Z 318.4 [M + ].
[0167] Example 115 Synthesis of Compound of Formula II-67 Under the protection of nitrogen gas, 2-(3-bromo-(1-hydroxyethyl)phenyl)acetonitrile (2.40 g, 0.01 mol), (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.02 g of 2-(4-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 35.9% yield. EI-MS M / Z 292.4 [M + ].
[0168] Example 116 Synthesis of Compound of Formula II-68 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(1-hydroxyethyl)phenyl)acetonitrile (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110°C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.02 g of 2-(3-fluoro-4-(1-hydroxyethyl)-5-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 33.0% yield. EI-MS M / Z 310.3 [M + ].
[0169] Example 117 Synthesis of Compound of Formula II-69 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(1-hydroxyethyl)benzonitrile (2.65 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.84 g of 5-cyanomethyl-2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a yield of 26.7%. EI-MS M / Z 317.4 [M + ].
[0170] Example 118 Synthesis of Compound of Formula II-70 Under the protection of nitrogen gas, 1-(2-bromo-4-propylphenyl)ethan-1-ol (2.43 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)ethan-1-ol (1.58 g, 53.7% yield) was obtained as a white powder solid. EI-MS M / Z 295.4 [M + ].
[0171] Example 119 Synthesis of Compound of Formula II-71 Under the protection of nitrogen gas, 1-(2-bromo-6-fluoro-4-propylphenyl)ethan-2-ol (2.61 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2-Fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)ethan-1-ol (1.19 g, 38.0% yield) was obtained as a white powder solid. EI-MS M / Z 313.4 [M + ].
[0172] Example 120 Synthesis of Compound of Formula II-72 Under the protection of nitrogen gas, 3-bromo-2-(1-hydroxyethyl)-5-propanebenzonitrile (2.68 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.19 g of 2-(1-hydroxyethyl)-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 37.3% yield. EI-MS M / Z 320.4 [M + ].
[0173] Example 121 Synthesis of Compound of Formula II-73 Under the protection of nitrogen gas, 1-(2-bromo-4-fluorophenyl)ethan-1-ol (2.19 g, 0.1 mol), (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.33 g of 1-(4-fluoro-2-(1H-benzimidazol-5-yl)phenyl)ethan-1-ol was obtained as an off-white powder solid in a 51.9% yield. EI-MS M / Z 257.3 [M + ].
[0174] Example 122 Synthesis of Compound of Formula II-74 Under the protection of nitrogen gas, 1-(2-bromo-4,6-difluorophenyl)ethan-1-ol (2.37 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2,4-Difluoro-6-(1H-benzimidazol-5-yl)phenyl)ethan-1-ol (1.58 g, 57.6%) was obtained as a white powder solid. EI-MS M / Z 275.3 [M + ].
[0175] Example 123 Synthesis of Compound of Formula II-75 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(1-hydroxyethyl)benzonitrile (2.44 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.89 g of 5-fluoro-2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 31.6% yield. EI-MS M / Z 282.3 [M + ].
[0176] Example 124 Synthesis of Compound of Formula II-76 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzamide (2.42 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.71 g of 4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 25.2% yield. EI-MS M / Z 282.3 [M + ].
[0177] Example 125 Synthesis of Compound of Formula II-77 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzamide (2.62 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was carried out for 2 hours. After the reaction was completed, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.81 g of 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 27.1% yield. EI-MS M / Z 300.3 [M + ].
[0178] Example 126 Synthesis of Compound of Formula II-78 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzamide (2.69 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.61 g of 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 19.9% yield. EI-MS M / Z 307.3 [M + ].
[0179] Example 127 Synthesis of Compound of Formula II-79 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.72 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.21 g of 4-(1-hydroxyethyl)-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 39.1% yield. EI-MS M / Z 310.4 [M + ].
[0180] Example 128 Synthesis of Compound of Formula II-80 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.90 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.22 g of 3-fluoro-4-(1-hydroxyethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 37.3% yield. EI-MS M / Z 328.4 [M +].
[0181] Example 129 Synthesis of Compound of Formula II-81 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)-N,N-dimethylbenzamide (2.97 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.22 g of 3-cyano-4-(1-hydroxyethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 36.5% yield. EI-MS M / Z 335.4 [M + ].
[0182] Example 130 Synthesis of Compound of Formula II-82 Under the protection of nitrogen gas, 3-bromo-4-(1-hydroxyethyl)benzoic acid (2.45 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.71 g of 4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 25.2% yield. EI-MS M / Z 283.3 [M + ].
[0183] Example 131 Synthesis of Compound of Formula II-83 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoic acid (2.63 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.60 g of 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as a white powder solid in a 20.0% yield. EI-MS M / Z 301.3 [M + ].
[0184] Example 132 Synthesis of Compound of Formula II-84 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoic acid (2.70 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.62 g of 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 20.2%. EI-MS M / Z 308.3 [M + ].
[0185] Example 133 Synthesis of Compound of Formula II-85 Under the protection of nitrogen gas, methyl 3-bromo-4-(1-hydroxyethyl)benzoate (2.59 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.59 g of methyl 4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 53.6% yield. EI-MS M / Z 297.3 [M + ].
[0186] Example 134 Synthesis of Compound of Formula II-86 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(1-hydroxyethyl)benzoate (2.77 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.54 g of methyl 3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 49.0% yield. EI-MS M / Z 315.3 [M + ].
[0187] Example 135 Synthesis of Compound of Formula II-87 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(1-hydroxyethyl)benzoate (2.84 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.68 g of methyl 3-cyano-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 52.3% yield. EI-MS M / Z 322.3 [M + ].
[0188] Example 136 Synthesis of Compound of Formula II-88 Under the protection of nitrogen gas, 1-(4-allyl-2-bromophenyl)ethan-1-ol (2.40 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-allyl-2-(1H-benzimidazol-5-yl)phenyl)ethan-1-ol (0.77 g, 27.7% yield) was obtained as a white powder solid. EI-MS M / Z 279.4 [M + ].
[0189] Example 137 Synthesis of Compound of Formula II-89 Under the protection of nitrogen gas, 1-(4-allyl-2-bromo-6-fluorophenyl)ethan-1-ol (2.59 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-Allyl-2-fluoro-6-(1H-benzimidazol-5-yl)phenyl)ethan-1-ol (0.51 g, 17.2% yield) was obtained as a white powder solid. EI-MS M / Z 297.4 [M + ].
[0190] Example 138 Synthesis of Compound of Formula II-90 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(1-hydroxyethyl)benzonitrile (2.66 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.69 g of 5-allyl-2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a yield of 22.7%. EI-MS M / Z 304.4 [M + ].
[0191] Example 139 Synthesis of Compound of Formula II-91 Under the protection of nitrogen gas, 2-(3-bromo-(1-hydroxyethyl)phenyl)acetonitrile (2.40 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.85 g of 2-(4-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 30.6% yield. EI-MS M / Z 278.3 [M + ].
[0192] Example 140 Synthesis of Compound of Formula II-92 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(1-hydroxyethyl)phenyl)acetonitrile (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.24 g of 2-(3-fluoro-4-(1-hydroxyethyl)-5-(1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 42.0% yield. EI-MS M / Z 296.3 [M + ].
[0193] Example 141 Synthesis of Compound of Formula II-93 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(1-hydroxyethyl)benzonitrile (2.65 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.89 g of 5-cyanomethyl-2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a yield of 29.4%. EI-MS M / Z 303.3 [M + ].
[0194] Example 142 Synthesis of Compound of Formula II-94 Under the protection of nitrogen gas, 1-(2-bromo-4-propylphenyl)ethan-1-ol (2.43 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2-(1H-benzoimidazol-5-yl)-4-propylphenyl)ethan-1-ol (1.55 g, 55.3%) was obtained as a white powder solid. EI-MS M / Z 281.4 [M + ].
[0195] Example 143 Synthesis of Compound of Formula II-95 Under the protection of nitrogen gas, 1-(2-bromo-6-fluoro-4-propylphenyl)ethan-2-ol (2.61 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.06 g of 1-(2-fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenyl)ethan-1-ol was obtained as an off-white powder solid in a 35.5% yield. EI-MS M / Z 299.4 [M + ].
[0196] Example 144 Synthesis of Compound of Formula II-96 Under the protection of nitrogen gas, 3-bromo-2-(1-hydroxyethyl)-5-propanebenzonitrile (2.68 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.02 g of 2-(1-hydroxyethyl)-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 33.4% yield. EI-MS M / Z 306.4 [M + ].
[0197] Example 145 Synthesis of Compound of Formula II-97 Under the protection of nitrogen gas, (2-bromo-4-fluorophenyl)methanol (2.05 g, 0.1 mol), (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.1 mol) were added to 1,4-dioxane (10 ml), potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine). Ferrocene (0.28 g, 5 mmol) was added, and the mixture was heated to 110°C and reacted for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.11 g of off-white powder solid (4-fluoro-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol was obtained in 43.3% yield. EI-MS M / Z 257.3 [M + ].
[0198] Example 146 Synthesis of Compound of Formula II-98 Under the protection of nitrogen gas, (2-bromo-4,6-difluorophenyl)methanol (2.23 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2,4-difluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol (1.39 g, 50.7% yield) was obtained as a white powder solid. EI-MS M / Z 275.3 [M +].
[0199] Example 147 Synthesis of Compound of Formula II-99 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(hydroxymethyl)benzonitrile (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.01 g of 5-fluoro-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 35.9% yield. EI-MS M / Z 282.3 [M + ].
[0200] Example 148 Synthesis of Compound of Formula II-100 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzamide (2.30 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110°C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.66 g of 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 23.5% yield. EI-MS M / Z 282.3 [M + ].
[0201] Example 149 Synthesis of Compound of Formula II-101 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzamide (2.48 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.56 g of 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in an 18.7% yield. EI-MS M / Z 300.3 [M + ].
[0202] Example 150 Synthesis of Compound of Formula II-102 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzamide (2.55 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.88 g of 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a yield of 28.7%. EI-MS M / Z 307.3 [M + ].
[0203] Example 151 Synthesis of Compound of Formula II-103 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.58 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.82 g of 4-(hydroxymethyl)-N,N-dimethyl-3-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 58.8% yield. EI-MS M / Z 310.4 [M +].
[0204] Example 152 Synthesis of Compound of Formula II-104 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.76 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.45 g of 3-fluoro-4-(hydroxymethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 44.3% yield. EI-MS M / Z 328.4 [M + ].
[0205] Example 153 Synthesis of Compound of Formula II-105 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.83 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol). Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.16 g of 3-cyano-4-(hydroxymethyl)-N,N-dimethyl-5-(2-methyl-1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 34.7% yield. EI-MS M / Z 335.4 [M + ].
[0206] Example 154 Synthesis of Compound of Formula II-106 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzoic acid (2.31 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.57 g of 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 20.2% yield. EI-MS M / Z 283.3 [M + ].
[0207] Example 155 Synthesis of Compound of Formula II-107 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzoic acid (2.49 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.53 g of 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a yield of 17.6%. EI-MS M / Z 301.3 [M + ].
[0208] Example 156 Synthesis of Compound of Formula II-108 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzoic acid (2.56 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.63 g of 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 20.5% yield. EI-MS M / Z 308.3 [M +].
[0209] Example 157 Synthesis of Compound of Formula II-109 Under the protection of nitrogen gas, methyl 3-bromo-4-(hydroxymethyl)benzoate (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.85 g of methyl 4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 62.4% yield. EI-MS M / Z 297.3 [M + ].
[0210] Example 158 Synthesis of Compound of Formula II-110 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(hydroxymethyl)benzoate (2.63 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.77 g of methyl 3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 56.3% yield. EI-MS M / Z 315.3 [M + ].
[0211] Example 159 Synthesis of Compound of Formula II-111 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(hydroxymethyl)benzoate (2.70 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.69 g of methyl 3-cyano-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 52.6% yield. EI-MS M / Z 322.4 [M + ].
[0212] Example 160 Synthesis of Compound of Formula II-112 Under the protection of nitrogen gas, (4-allyl-2-bromophenyl)methanol (2.27 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-allyl-2-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol (0.42 g, 14.1% yield) was obtained as a white powder solid. EI-MS M / Z 279.4 [M + ].
[0213] Example 161 Synthesis of Compound of Formula II-113 Under the protection of nitrogen gas, (4-allyl-2-bromo-6-fluorophenyl)methanol (2.45 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-allyl-2-fluoro-6-(2-methyl-1H-benzimidazol-5-yl)phenyl)methanol (0.41 g, 13.8% yield) was obtained as a white powder solid. EI-MS M / Z 297.4 [M + ].
[0214] Example 162 Synthesis of Compound of Formula II-114 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(hydroxymethyl)benzonitrile (2.52 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.51 g of 5-allyl-2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)benzonitrile was obtained as a white powder solid in a yield of 16.8%. EI-MS M / Z 304.4 [M + ].
[0215] Example 163 Synthesis of Compound of Formula II-115 Under the protection of nitrogen gas, 2-(3-bromo-4-(hydroxymethyl)phenyl)acetonitrile (2.26 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.88 g of 2-(4-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 31.7% yield. EI-MS M / Z 278.4 [M + ].
[0216] Example 164 Synthesis of Compound of Formula II-116 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(hydroxymethyl)phenyl)acetonitrile (2.44 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.22 g of 2-(3-fluoro-4-(hydroxymethyl)-5-(2-methyl-1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a yield of 41.3%. EI-MS M / Z 296.3 [M + ].
[0217] Example 165 Synthesis of Compound of Formula II-117 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(hydroxymethyl)benzonitrile (2.51 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (1H-Benzimidazol-5-yl)benzonitrile (0.82 g, 27.1%) was obtained as a white powder solid. EI-MS M / Z 303.3 [M + ].
[0218] Example 166 Synthesis of Compound of Formula II-118 Under the protection of nitrogen gas, (2-bromo-4-propylphenyl)methanol (2.29 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2-(2-methyl-1H-benzoimidazol-5-yl)-4-propylphenyl)methanol (1.58 g, 53.7%) was obtained as a white powder solid. EI-MS M / Z 281.4 [M + ].
[0219] Example 167 Synthesis of Compound of Formula II-119 Under the protection of nitrogen gas, (2-bromo-6-fluoro-4-propylphenyl)methanol (2.47 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2-Fluoro-6-(2-methyl-1H-benzimidazol-5-yl)-4-propylphenyl)methanol (1.06 g, 35.5% yield) was obtained as a white powder solid. EI-MS M / Z 299.4 [M + ]. Example 168 Synthesis of Compound of Formula II-120 Under the protection of nitrogen gas, 3-bromo-2-(hydroxymethyl)-5-propanebenzonitrile (2.54 g, 0.01 mol) and (2-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.12 g of 2-(hydroxymethyl)-3-(2-methyl-1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 36.7% yield. EI-MS M / Z 306.4 [M + ].
[0220] Example 169 Synthesis of Compound of Formula II-121 Under nitrogen gas protection, (2-bromo-4-fluorophenyl)methanol (2.05 g, 0.1 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), followed by potassium acetate (1.96 g, 0.2 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 5 mmol), and 1,1'-bis(diphenylphosphine)ferrocene (0.28 g, 5 mmol). The mixture was heated to 110 °C and reacted for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, extracted with water / ethyl acetate, and the organic phase was concentrated to dryness. Column chromatography was performed using ethyl acetate / petroleum ether as an eluent to obtain 1.24 g of off-white powdery solid (4-fluoro-2-(1H-benzimidazol-5-yl)phenyl)methanol in a 51.2% yield. EI-MS M / Z 243.3[M + ].
[0221] Example 170 Synthesis of Compound of Formula II-122 Under the protection of nitrogen gas, (2-bromo-4,6-difluorophenyl)methanol (2.23 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.52 g of off-white powdery solid (2,4-difluoro-6-(1H-benzimidazol-5-yl)phenyl)methanol was obtained in 58.4% yield. EI-MS M / Z 261.2 [M + ].
[0222] Example 171 Synthesis of Compound of Formula II-123 Under the protection of nitrogen gas, 3-bromo-5-fluoro-2-(hydroxymethyl)benzonitrile (2.30 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.1 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.13 g of 5-fluoro-2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 42.3% yield. EI-MS M / Z 268.3 [M + ].
[0223] Example 172 Synthesis of Compound of Formula II-124 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzamide (2.30 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.58 g of 4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 21.7% yield. EI-MS M / Z 268.3 [M + ].
[0224] Example 173 Synthesis of Compound of Formula II-125 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzamide (2.48 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.65 g of 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 22.8% yield. EI-MS M / Z 286.3 [M + ].
[0225] Example 174 Synthesis of Compound of Formula II-126 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzamide (2.55 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.83 g of 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a yield of 28.4%. EI-MS M / Z 293.3 [M + ].
[0226] Example 175 Synthesis of Compound of Formula II-127 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.58 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.12 g of 4-(hydroxymethyl)-N,N-dimethyl-3-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 37.9% yield. EI-MS M / Z 296.3 [M + ].
[0227] Example 176 Synthesis of Compound of Formula II-128 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.76 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.05 g of 3-fluoro-4-(hydroxymethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 33.5% yield. EI-MS M / Z 314.3 [M + ].
[0228] Example 177 Synthesis of Compound of Formula II-129 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)-N,N-dimethylbenzamide (2.83 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.03 g of 3-cyano-4-(hydroxymethyl)-N,N-dimethyl-5-(1H-benzimidazol-5-yl)benzamide was obtained as an off-white powder solid in a 32.1% yield. EI-MS M / Z 321.4 [M + ].
[0229] Example 178 Synthesis of Compound of Formula II-130 Under the protection of nitrogen gas, 3-bromo-4-(hydroxymethyl)benzoic acid (2.31 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.37 g of 4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 13.8% yield. EI-MS M / Z 269.3 [M + ].
[0230] Example 179 Synthesis of Compound of Formula II-131 Under the protection of nitrogen gas, 3-bromo-5-fluoro-4-(hydroxymethyl)benzoic acid (2.49 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.63 g of 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in a 22.0% yield. EI-MS M / Z 287.3 [M + ].
[0231] Example 180 Synthesis of Compound of Formula II-132 Under the protection of nitrogen gas, 3-bromo-5-cyano-4-(hydroxymethyl)benzoic acid (2.56 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.33 g of 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoic acid was obtained as an off-white powder solid in an 11.3% yield. EI-MS M / Z 294.3 [M + ].
[0232] Example 181 Synthesis of Compound of Formula II-133 Under the protection of nitrogen gas, methyl 3-bromo-4-(hydroxymethyl)benzoate (2.45 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.63 g of methyl 4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 57.7% yield. EI-MS M / Z 283.3 [M + ].
[0233] Example 182 Synthesis of Compound of Formula II-134 Under the protection of nitrogen gas, methyl 3-bromo-5-fluoro-4-(hydroxymethyl)benzoate (2.63 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was carried out for 2 hours. After the reaction was completed, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.68 g of methyl 3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 55.9% yield. EI-MS M / Z 301.3 [M + ].
[0234] Example 183 Synthesis of Compound of Formula II-135 Under the protection of nitrogen gas, methyl 3-bromo-5-cyano-4-(hydroxymethyl)benzoate (2.70 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was cooled to 100°C with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.32 g of methyl 3-cyano-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)benzoate was obtained as an off-white powder solid in a 43.0% yield. EI-MS M / Z 308.3 [M + ].
[0235] Example 184 Synthesis of Compound of Formula II-136 Under the protection of nitrogen gas, (4-allyl-2-bromophenyl)methanol (2.27 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-allyl-2-(1H-benzimidazol-5-yl)phenyl)methanol (0.22 g, 8.3% yield) was obtained as a white powder solid. EI-MS M / Z 265.3 [M + ].
[0236] Example 185 Synthesis of Compound of Formula II-137 Under the protection of nitrogen gas, (4-allyl-2-bromo-6-fluorophenyl)methanol (2.45 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (4-allyl-2-fluoro-6-(1H-benzimidazol-5-yl)phenyl)methanol (0.36 g, 12.8% yield) was obtained as a white powder solid. EI-MS M / Z 283.3 [M + ].
[0237] Example 186 Synthesis of Compound of Formula II-138 Under the protection of nitrogen gas, 5-allyl-3-bromo-2-(hydroxymethyl)benzonitrile (2.52 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 0.38 g of 5-allyl-2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as a white powdery solid in a yield of 13.1%. EI-MS M / Z 290.3 [M + ].
[0238] Example 187 Synthesis of Compound of Formula II-139 Under the protection of nitrogen gas, 2-(3-bromo-4-(hydroxymethyl)phenyl)acetonitrile (2.26 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110°C, and the mixture was allowed to react for 2 hours. After the reaction was complete, the mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.15 g of 2-(4-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 43.7% yield. EI-MS M / Z 264.3 [M + ].
[0239] Example 188 Synthesis of Compound of Formula II-140 Under the protection of nitrogen gas, 2-(3-bromo-5-fluoro-4-(hydroxymethyl)phenyl)acetonitrile (2.44 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.06 g of 2-(3-fluoro-4-(hydroxymethyl)-5-(1H-benzimidazol-5-yl)phenyl)acetonitrile was obtained as an off-white powder solid in a 37.7% yield. EI-MS M / Z 282.3 [M + ].
[0240] Example 189 Synthesis of Compound of Formula II-141 Under the protection of nitrogen gas, 3-bromo-5-cyanomethyl-2-(hydroxymethyl)benzonitrile (2.51 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.15 g of 5-cyanomethyl-2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)benzonitrile was obtained as an off-white powder solid in a 39.9% yield. EI-MS M / Z 289.3 [M + ].
[0241] Example 190 Synthesis of Compound of Formula II-142 Under the protection of nitrogen gas, (2-bromo-4-propylphenyl)methanol (2.29 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was carried out for 2 hours. After the reaction was completed, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as an eluent. 1.06 g of (2-(1H-benzimidazol-5-yl)-4-propylphenyl)methanol was obtained as an off-white powder solid in a 39.8% yield. EI-MS M / Z 267.3 [M + ].
[0242] Example 191 Synthesis of Compound of Formula II-143 Under the protection of nitrogen gas, (2-bromo-6-fluoro-4-propylphenyl)methanol (2.47 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the resulting mixture was diluted with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (2-Fluoro-6-(1H-benzimidazol-5-yl)-4-propylphenyl)methanol (1.23 g, 42.3% yield) was obtained as a white powder solid. EI-MS M / Z 285.3 [M + ].
[0243] Example 192 Synthesis of Compound of Formula II-144 Under the protection of nitrogen gas, 3-bromo-2-(hydroxymethyl)-5-propanebenzonitrile (2.54 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the temperature was raised to 110 °C, and the reaction was continued for 2 hours. After the reaction was complete, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.52 g of 2-(hydroxymethyl)-3-(1H-benzimidazol-5-yl)-5-propylbenzonitrile was obtained as an off-white powder solid in a 52.2% yield. EI-MS M / Z 292.4 [M + ].
[0244] Example 193 Synthesis of Formula I-24-A [ka] Under the protection of nitrogen gas, 2-bromo-4-fluoro-1-anisole (2.05 g, 0.01 mol) and (1H-benzimidazol-5-yl)boronic acid (1.62 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) (5-fluoro-2-methoxyphenyl)-1H-benzimidazole (1.55 g, 64.0%) was obtained as a white powder solid. EI-MS M / Z 243.3 [M + ].
[0245] Example 194 Synthesis of Formula I-24-B [ka] Under the protection of nitrogen gas, 2-bromo-4-fluorophenol (1.91 g, 0.01 mol) and (1-methyl-1H-benzimidazol-5-yl)boronic acid (1.76 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.15 g of 4-fluoro-2-(1-methyl-1H-benzimidazol-5-yl)phenol was obtained as an off-white powder solid in a 47.5% yield. EI-MS M / Z 243.3 [M + ].
[0246] Example 195 Synthesis of Formula I-24-C [ka] Under the protection of nitrogen gas, 2-bromophenol (1.73 g, 0.01 mol), (7-fluoro-1H-benzimidazol-5-yl)boronic acid (1.80 g, 0.01 mol) were added to 1,4-dioxane (10 ml), and the mixture was stirred at room temperature with potassium acetate (1.96 g, 0.02 mol), 1,1-bis(diphenylphosphine)ferrocenedichloropalladium (0.36 g, 0.5 mmol), and 1,1'-bis(diphenylphosphine) Ferrocene (0.28 g, 0.5 mmol) was added, the mixture was heated to 110 °C, and the reaction was continued for 2 hours. After completion of the reaction, the reaction mixture was allowed to cool, and water / ethyl acetate was added for extraction. The organic phase was concentrated to dryness and subjected to column chromatography using ethyl acetate / petroleum ether as the eluent. 1.02 g of 2-(7-fluoro-1H-benzimidazol-5-yl)phenol was obtained as an off-white powder solid in a yield of 44.69%. EI-MS M / Z 229.2 [M + ].
[0247] Example 196: Biological activity measurement test of primary cardiac myocytes from suckling rats after injury
[0248] Test Method: Primary cardiomyocytes from suckling rats were isolated and cultured and plated onto cell culture plates. Drug stock solutions were diluted and added to each well to a final concentration of 10 μM. After half an hour of drug action, phenylephrine (PE) stock solution was added to a final PE concentration of 20 μM. After 48 hours of PE action, cell samples were collected and used for real-time quantitative PCR testing or cell area measurement.
[0249] Isolation and plating of rat cardiomyocytes: Depending on the actual cell number needs, a certain number of SPF-level suckling rats were placed on a clean bench, the chest cavity was cut with scissors, the heart was isolated, and the heart was cut into tissue scraps with sterilized surgical scissors. Type II collagenase (Sigma, product number C2-28-100MG) was added to D-HANKS balanced salt buffer to prepare a 5 μg / mL enzymatic digestion solution. Cardiac tissue debris was digested three times in a 37°C water bath. Approximately 2 mL of the enzymatic digestion solution was added in the first digestion, and the cardiomyocytes and tissue debris were digested and centrifuged to precipitate. The supernatant was then discarded. Approximately 4 mL of the enzymatic digestion solution was added in the second and third digestion, and the supernatant was retained each time. An equal volume of DMEM containing 10% FBS was immediately added to the supernatant digestion solution to neutralize the digestive enzyme. The supernatants were combined in the second and third digestions, centrifuged, discarded, and an appropriate amount of DMEM containing 10% FBS was added to resuspend the cardiomyocytes. The cardiomyocytes were then seeded into 100 mm Petri dishes and subjected to differential adhesion in a thermostatic cell incubator for 2 hours. The supernatant was then removed and counted.
[0250] Area detection of rat cardiomyocytes: Take a 24-well plate pre-coated with 1% gelatin and measure 1.0 x 10 3Cells were plated at 100 μL per well and cultured in a 37°C cell incubator with 500 μL of 10% FBS + DMEM medium per well for 24 hours. Different compounds were formulated with DMSO to a 100 mM stock solution and serially diluted with 10% FBS + DMEM medium to prepare a final compound solution of 10 μM containing 0.5% DMSO. The medium in the 24-well plate was discarded and replaced with 500 μL of medium per well containing 10 μM compound. Three duplicate wells were set up for each compound, as well as a negative control well. After 0.5 hours of drug treatment, PE (manufacturer: Meilun Biotechnology, product number: MB1602) was added to each well at a final concentration of 20 μM. Negative control wells were left untreated. After 48 hours of PE treatment, at least five fields per well were randomly selected under an inverted microscope (manufacturer: Nikon, model number: Eclipse TS100). Cell area data were calculated using Image J software. The cell area in the negative control well was set as 1, and the fold increase in cell area in the PE well and each treatment well was calculated, followed by statistical analysis using the One-Way ANOVA method.
[0251] Real-time quantitative PCR Take a 24-well plate pre-coated with 1% gelatin and inoculate 1 x 10 5 Cells were plated at 100 μL per well and cultured in a 37°C cell incubator with 500 μL of 10% FBS + DMEM medium per well for 24 hours. Different compounds were formulated in DMSO to a 100 mM stock solution and serially diluted with 10% FBS + DMEM medium to prepare a final compound solution of 10 μM containing 0.5% DMSO. The medium in the 24-well plate was discarded and replaced with 500 μL of medium containing 10 μM compound per well. Three duplicate wells were set up per compound, as well as a negative control well. After 0.5 hours of drug exposure, PE (manufacturer: Meilun Biotechnology, product number: MB1602) was added to each well at a final concentration of 20 μM. Negative control wells were left untreated with PE for 48 hours before sample detection.
[0252] Gene expression levels related to cardiomyocyte hypertrophy were compared by detecting mRNA levels of atrial natriuretic peptide (ANP) and myosin heavy chain β (β-MHC) using real-time quantitative PCR. The process involved extraction of total cellular RNA, reverse transcription synthesis of cDNA, and real-time quantitative PCR testing.
[0253] The real-time quantitative PCR process was completed according to the following reaction system and reaction program (Note: all relevant primers are commercially available).
[0254] ANP primer: Forward primer: AGAGACGGCAGTGCTCTAGG (SEQ ID NO: 1) Reverse primer: CAATCCTACCCCCGAAGCAG (SEQ ID NO: 2) β-MHC primers: Forward primer: CTCCAGGGGTGATGGACAAC (SEQ ID NO: 3) Reverse primer: CGATACCTCTGCCGGAAGTC (SEQ ID NO: 4) Reaction volume: 20 μL Reaction program: [Table 1]
[0255] Summary and analysis of results: (1) Preliminary modeling study of cardiomyocyte hypertrophy: It is necessary to confirm that PE can induce cardiomyocyte hypertrophy before the study. (2) Results of drug selection Real-time quantitative PCR was used to detect the mRNA levels of ANP in cardiomyocytes to initially screen for drugs with the potential to combat cardiomyocyte hypertrophy. Drugs with potential to combat cardiomyocyte hypertrophy were then examined using the mRNA levels of another hypertrophy gene, β-MHC. One-way ANOVA was used as the statistical method, and GraphPad Prism was used as the statistical software. Significant differences were found (P values were all less than 0.05) between the representative compounds in Formulas I-1 to I-48 and II-1 to II-144 and the PE group.
[0256] [Table 2]
[0257] [Table 3]
[0258] [Table 4]
[0259] Verification was carried out by directly measuring the area of cardiomyocytes and comparing the differences between groups. After intervention with both PE and drugs, cardiomyocytes were placed under a microscope for direct observation and image capture, and the cell area data was calculated using Image J software. The results are shown in Table 4. The results show that the cardiomyocyte area of the groups intervened with two structurally typical drugs, Formula I and Formula II, was significantly lower than that of the PE group, and Formula I-24-A, Formula I-24-B, and Formula I-24-C had no obvious improving effect.
[0260] [Table 5]
[0261] Example 197 Efficacy test of a mouse pressure overload heart failure model
[0262] 1. Materials and Methods 1.1 Animals: Healthy C57BL / 6 mice 1.2 Drugs and Dosing Regimen [Table 6] 1.3 Method modeling: Modeling of thoracic aortic ligation surgery: To exclude mice with abnormal cardiac function, cardiac ultrasound was performed before surgery. Mice with normal cardiac function were anesthetized, and once anesthetized, they were transferred to a small animal operating table and immobilized. A respiratory passage was established via tracheal intubation, and anesthesia was maintained. Centering on the second rib, the epidermis was incised along the sternum toward the first and third ribs, exposing the junction between the second rib and the sternum. The second rib was incised to expose the thoracic aorta. The aortic arch was freed, and a thin thread was passed underneath, placed parallel to the aortic arch with a thin needle, and both were ligated. After ligation, the thin needle was removed and the condition of the mouse was observed. Once stable, the ligation was performed layer by layer. The mouse was placed on a heating mat to keep warm, and after awakening, it was returned to its cage based on its behavior and kept for daily care.
[0263] Experimental grouping and dosing regimen: After 5 weeks of modeling, the mice were monitored by cardiac ultrasound to determine their cardiac ejection fraction. When the ejection fraction decreased by about 50%, the experimental requirements were met and the administration experiment began. According to the ultrasound data, the animals were randomly divided into groups and administered. The mice were monitored by cardiac ultrasound every 2 weeks until the 9th week, at which point pathological section analysis was performed.
[0264] Statistical analysis: The results are expressed as mean ± standard error. Data analysis was performed using GraphPad Prism statistical software. Comparisons were performed using t-test analysis. A statistically significant difference was determined if P<0.05, and no significant difference was determined otherwise.
[0265] 2 Results 2.1 Effect of test drugs on disease progression in mice The results, as shown in Tables 5 and 6, showed that after 4 weeks of administration (i.e., 9 weeks after modeling), the typical drugs of formula I and formula II all had obvious improving effects on cardiac contractile function, while formula I-24-A, formula I-24-B and formula I-24-C had no obvious improving effects.
[0266] [Table 7]
[0267] [Table 8]
[0268] Four weeks after administration (i.e., 9 weeks after modeling), tissue sampling was performed on the mouse hearts, and the pathological results showed that after modeling treatment, cardiac fibrosis significantly increased, and after each group was treated with the typical test drugs of Formula I and Formula II (as listed in Tables 5 and 6), the degree of fibrosis was significantly reduced in both groups.
[0269] To summarize the above examples of the present application, the benzimidazole compounds of the present application have a simple and short synthesis process, are easy to control the synthesis process, have myocardial protective effects, and can be used to treat chronic heart failure diseases, with broad application prospects.
[0270] The present application has described the compounds of the present application, their preparation methods and uses through the above examples, but the applicant declares that the present application is not limited to the above examples, that is, it does not mean that the present application must be carried out depending on the above examples. Those skilled in the art should understand that any improvements to the present application, equivalent substitution of raw materials used in the present application, addition of auxiliary components, selection of specific forms, etc. are all within the scope of protection and disclosure of the present application.
Claims
1. A benzimidazole compound having the structure shown in formula A below. 【Chemical 1】 (wherein R is a hydroxy group or 【Chemistry 2】 and R 1 , R 2 , R 3 and R 5 are each independently hydrogen, halogen, a nitro group, an amino group, a hydroxy group, a cyano group, a carboxyl group, a C1 to C4 linear or branched alkoxyformyl group, a carbamoyl group, a carbamoyl group in which N is substituted with a C1 to C4 linear or branched alkyl group, a C1 to C4 linear or branched alkyl group, a C1 to C4 alkoxy group, or a C1 to C4 alkylamino group; R 4 is a fluorine atom, a bromine atom, a nitro group, a hydroxy group, a cyano group, a carboxyl group, a C1-C4 linear or branched alkoxyformyl group, a carbamoyl group, a carbamoyl group in which N is substituted with a C1-C4 linear or branched alkyl group, a C1-C4 linear or branched alkyl group, a non-halogenated C1-C4 alkoxy group, or a C1-C4 alkylamino group; R 6 is a C1-C4 linear or branched alkylene group, R 4 is a carboxyl group, and R 3 is hydrogen and R is a hydroxy group, R 5 is not a methyl group.)
2. The benzimidazole compound of claim 1 having a structure represented by Formula I or Formula II: 【Chemistry 3】 (However, R 1 , R 2 , R 3 , R 4 and R 5 The limitations are the same as those in Formula A.
3. R 1 , R 2 , R 3 and R 5 each independently represents one of hydrogen, fluorine, chlorine, bromine, an amino group, a hydroxy group, a cyano group, a methoxyformyl group, an ethoxyformyl group, a dimethylcarbamoyl group, a diethylcarbamoyl group, a trifluoromethyl group, a methyl group, an ethyl group, an n-propyl group, an isopropyl group, an allyl group, a cyanomethyl group, a methoxy group, a trifluoromethoxy group, an ethoxy group, a methylamino group, a dimethylamino group, an ethylamino group, and a diethylamino group; Preferably, R 4 represents any one of fluorine, bromine, amino, hydroxy, cyano, carboxyl, methoxyformyl, ethoxyformyl, carbamoyl, dimethylcarbamoyl, diethylcarbamoyl, trifluoromethyl, methyl, ethyl, n-propyl, isopropyl, allyl, cyanomethyl, methoxy, ethoxy, methylamino, dimethylamino, ethylamino, and diethylamino groups; Preferably, R 1 , R 2 is hydrogen or a methyl group, Preferably, R 3 is a cyano group, fluorine, or hydrogen, Preferably, R 4 is fluorine, an allyl group, an n-propyl group, a cyanomethyl group, a carboxyl group, a methoxyformyl group, a carbamoyl group, or a dimethylcarbamoyl group, Preferably, R 5 is hydrogen or a methyl group; The benzimidazole compound according to claim 1 or 2.
4. The benzimidazole compound according to any one of claims 1 to 3, comprising any one of the compounds of the following formulae I-1 to I-47 and II-1 to II-144. 【Chemistry 4】 【Chemistry 5】 【Chemistry 6】 【Chemistry 7】 【Chemistry 8】 【Chemistry 9】 【Chemistry 10】 【Chemistry 11】
5. The method includes a step of subjecting a brominated compound of formula B and a boric acid compound of formula V to a Suzuki reaction under the influence of a catalyst to obtain a benzimidazole compound of formula A, the reaction scheme of which is as follows: 【Chemistry 12】 Preferably, the molar ratio of the brominated compound of formula B to the boric acid compound of formula V is 1:0.8 to 1:3; Preferably, the catalyst is any one or a combination of at least two of tetrakis(triphenylphosphine)palladium, 1,1-bis(diphenylphosphine)ferrocenedichloropalladium, or palladium acetate; Preferably, the molar ratio of the catalyst to the boric acid compound of formula V is from 0.001:1 to 0.5:1; Preferably, the Suzuki reaction is carried out in the presence of an alkaline substance; Preferably, the alkaline substance is any one or a combination of at least two of potassium fluoride, potassium acetate, sodium carbonate, potassium carbonate, or potassium phosphate; Preferably, the Suzuki reaction is carried out in an organic solvent, and the organic solvent is any one or a combination of at least two of DMF, toluene, ethanol, 1,4-dioxane, water, or THF; Preferably, the temperature of the Suzuki reaction is 70 to 150°C, and the time is 0.25 to 48 hours. A method for preparing the benzimidazole compound according to any one of claims 1 to 4.
6. A pharmaceutically acceptable salt of the benzimidazole compound according to any one of claims 1 to 4, Preferably, the pharmaceutically acceptable salt is an organic acid salt or an inorganic acid salt of the benzimidazole compound; Preferably, the organic acid salt is any one selected from tartrate, stearate, oxalate, citrate, lactate, sorbate, fumarate, formate, acetate, benzoate, benzenesulfonate, ethanesulfonate, resinate, trifluoroacetate, maleate, malate, L-malate, methanesulfonate, fumarate, amino acid salt, and nicotinate; Preferably, the organic acid salt is any one selected from tartrate, acetate, maleate, malate, L-malate, and fumarate; Preferably, the inorganic acid salt is any one selected from phosphate, sulfate, nitrate, iodate, bromate, hydroiodide, hydrobromide, and hydrochloride; Preferably, the inorganic acid salt is any one selected from phosphate, sulfate, and hydrochloride. Pharmaceutically acceptable salts.
7. A solvate, prodrug, tautomer, or stereochemical isomer of a benzimidazole compound according to any one of claims 1 to 4, Preferably, the solvate is a hydrate and / or alcohol solvate of the benzimidazole compound. Solvates, prodrugs, tautomers, or stereochemical isomers.
8. 1. A pharmaceutical composition comprising: The benzimidazole compound according to any one of claims 1 to 4, Preferably, the pharmaceutical composition further comprises a pharmaceutically acceptable adjuvant, Preferably, the pharmaceutically acceptable adjuvant is any one of an excipient, a diluent, a vector, a flavoring agent, a binder, or a filler; Preferably, the dosage form of the pharmaceutical composition is an oral formulation, a parenteral administration formulation, or an external formulation. Pharmaceutical compositions.
9. Use of a benzimidazole compound according to any one of claims 1 to 4 and / or a pharmaceutically acceptable salt according to claim 6, or a solvate, prodrug, tautomer, or stereochemical isomer according to claim 7, or a pharmaceutical composition according to claim 8, in the preparation of a medicament for treating chronic heart failure.
10. 1. Use of a substituted benzimidazole compound, or a tautomer thereof, or a pharmaceutically acceptable salt thereof, or a solvate thereof, or a hydrate thereof, or a pharmaceutical composition thereof in the preparation of a medicament for treating chronic heart failure, comprising: The substituted benzimidazole compound has the following structure: 【Chemistry 13】
Citation Information
Patent Citations
Angiotensin ii antagonist
JP1994080666A
System and method for registering network information strings
JP2014522588A
Biaryl ether sulfonamides and their use as therapeutic agents
JP2014534213A
Substituted benzimdazole derivatives useful as TRPM8 receptor modulators
WO2012109100A1