Immune cells with co-expressed TGFBR shRNA

Abstract

Provided herein are recombinant nucleic acids that reduce the expression of TGFBR1 and / or TGFBR2, and cells containing such recombinant nucleic acids, as well as methods for making and using such cells.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of and priority to U.S. Provisional Application No. 63 / 375,519, filed September 13, 2022, U.S. Provisional Application No. 63 / 489,840, filed March 13, 2023, U.S. Provisional Application No. 63 / 495,867, filed April 13, 2023, and U.S. Provisional Application No. 63 / 516,484, filed July 28, 2023, the disclosures of each of which are incorporated herein by reference in their entirety for all purposes.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically and is incorporated herein by reference in its entirety. The XML copy was created on XX / 20XX, is named ANB-215_sequencelisting.xml, and is X,XXX,XXX bytes in size. [Background technology]

[0003] background Cancer is a disease characterized by the uncontrolled proliferation of cells. Many approaches to treating cancer have been attempted, including drug and radiation therapy. Recent cancer treatments attempt to use the body's own immune cells to attack cancer cells. One promising approach uses T cells taken from the patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give T cells the new ability to target specific proteins. These receptors are chimeric because they combine antigen-binding and T-cell activation functions into a single receptor.

[0004] Immunotherapy using CAR-T cells is promising because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them. After engineering T cells with a CAR, the resulting CAR-T cells are introduced into patients to attack tumor cells. When CAR-T cells are infused into patients, they come into contact with target antigens on cells. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, the CAR T cells can exponentially proliferate, initiate antitumor cytokine production, and target tumor cell killing.

[0005] However, CAR-T cell-based immunotherapy remains limited. In particular, CAR-T cells may lack peripheral blood survival, have reduced proliferation and effector function, be susceptible to suppression and exhaustion, and may not provide memory T cell persistence. Therefore, additional therapies targeting intrinsic pathways of T cells are needed to address these limitations of CAR-T therapy. Summary of the Invention

[0006] overview In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:2.

[0007] In one aspect, provided herein is one or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to mRNA encoding human TGF-β receptor 1 (TGFBR1) comprising the sequence set forth in SEQ ID NO:1.

[0008] In one aspect, provided herein is one or more recombinant nucleic acids comprising a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:2.

[0009] In one aspect, provided herein is one or more recombinant nucleic acids comprising a first nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 1 (TGFBR1) comprising the sequence set forth in SEQ ID NO:1.

[0010] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0011] In some embodiments, the nucleic acid is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

[0012] In some embodiments, the nucleic acid is an shRNA.

[0013] In some embodiments, the nucleic acid or first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-84.

[0014] In some embodiments, the first and second nucleic acids each comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84.

[0015] In some embodiments, the nucleic acid or first nucleic acid comprises the sequence set forth in SEQ ID NO:81.

[0016] In some embodiments, the nucleic acid or first nucleic acid comprises the sequence set forth in SEQ ID NO: 51 or 53.

[0017] In some embodiments, the nucleic acid, the first nucleic acid, or the second nucleic acid comprises the sequence set forth in SEQ ID NOs: 81 and 51 or 53.

[0018] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 128, 129, 130, 139, 140, or 141.

[0019] In some embodiments, the nucleic acid, first nucleic acid, or second nucleic acid reduces expression of TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

[0020] In some embodiments, the nucleic acid or the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-35.

[0021] In some embodiments, the nucleic acid or the second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28.

[0022] In some embodiments, the nucleic acid or second nucleic acid reduces expression of TGFBR1 in cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

[0023] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:16 or 28.

[0024] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:51.

[0025] In some embodiments, the first and second nucleic acids reduce expression of TGFBR1 and TGFBR2 in cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acids.

[0026] In some embodiments, the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84, and the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-84.

[0027] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:28, 16, 51, or 53.

[0028] In some embodiments, the nucleic acid, the first nucleic acid, and / or the second nucleic acid reduces expression of TFGBR2 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, and the second nucleic acid reduces expression of TGFBR1 and / or TGFBR2 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, respectively, compared to control cells not containing the respective nucleic acid.

[0029] In some embodiments, the one or more nucleic acids further comprise at least a third nucleic acid sequence at least 15 nucleotides in length, wherein the at least third nucleic acid sequence comprises a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3.

[0030] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

[0031] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:92.

[0032] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 130, 139, 129, or 141.

[0033] In some embodiments, the one or more nucleic acids further comprise at least a third nucleic acid sequence at least 15 nucleotides in length, wherein the third nucleic acid sequence comprises one or more of: (1) a nucleic acid sequence complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3; (2) a nucleic acid sequence complementary to nucleotides 518-559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:4; or (3) a nucleic acid sequence complementary to nucleotides 1294-2141 of an mRNA encoding the human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:5.

[0034] In some embodiments, the third nucleic acid comprises a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:3.

[0035] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

[0036] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:92.

[0037] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81, the second nucleic acid comprises the sequence set forth in SEQ ID NO:51, and the third nucleic acid comprises the sequence set forth in SEQ ID NO:92.

[0038] In some embodiments, the one or more recombinant nucleic acids comprise the sequence set forth in SEQ ID NO: 129, 130, 139, or 141.

[0039] In some embodiments, the third nucleic acid comprises a nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), which comprises the sequence set forth in SEQ ID NO:4.

[0040] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 100-112.

[0041] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:110.

[0042] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:129.

[0043] In some embodiments, the third nucleic acid comprises a nucleic acid sequence complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:5.

[0044] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 113-126.

[0045] In some embodiments, the nucleic acid sequence further comprises at least a third and a fourth nucleic acid sequence at least 15 nucleotides in length, wherein the third nucleic acid sequence comprises a nucleic acid sequence that is complementary to nucleotides 1126 to 1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and a fourth nucleic acid sequence that is complementary to nucleotides 518 to 559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:4.

[0046] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

[0047] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:92.

[0048] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 100-112.

[0049] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:110.

[0050] In some embodiments, the third nucleic acid reduces expression of FAS in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% and / or reduces expression of PTPN2 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0051] In some embodiments, the recombinant nucleic acid(s) further comprise at least one of a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds a first antigen and a nucleotide sequence encoding a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds a second antigen, wherein the first antigen and the second antigen are different.

[0052] In some embodiments, the recombinant nucleic acid comprises, in a 5' to 3' direction, a CAR, one or more recombinant nucleic acids disclosed herein, and a priming receptor.

[0053] In some embodiments, the nucleic acid comprises, in a 5' to 3' direction, a priming receptor, one or more recombinant nucleic acids disclosed herein, and a CAR.

[0054] In some embodiments, the recombinant nucleic acid further comprises 5' homology-directed repair arms and / or 3' homology-directed repair arms that are complementary to the insertion site in the host cell chromosome.

[0055] In some embodiments, the recombinant nucleic acid comprises a 5' homology-directed repair arm and a 3' homology-directed repair arm.

[0056] In some embodiments, each of the one or more nucleic acids is encoded on a plurality of different nucleic acid molecules.

[0057] In some embodiments, each of the one or more nucleic acids is encoded on the same nucleic acid molecule.

[0058] In some embodiments, the one or more recombinant nucleic acids are incorporated into one or more expression cassettes or expression vectors.

[0059] In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of one or more of the recombinant nucleic acids.

[0060] In some embodiments, the expression cassette comprises a sequence set forth in any one of SEQ ID NOs: 133-137.

[0061] In some embodiments, the expression vector is a non-viral vector.

[0062] In one aspect, provided herein is an expression vector comprising a recombinant nucleic acid(s) disclosed herein.

[0063] In some embodiments, the expression vector is a non-viral vector.

[0064] In some embodiments, the 5' and 3' ends of the recombinant nucleic acid(s) comprise one or more nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site in the genome of the cell.

[0065] In some embodiments, the insertion site is located at the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0066] In some embodiments, the GSH locus is the GS94 locus.

[0067] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids at least 15 nucleotides in length that are complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:1.

[0068] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids at least 15 nucleotides in length that are complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2.

[0069] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids comprising a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence at least 15 nucleotides in length, wherein the second nucleic acid sequence is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2 or complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:1.

[0070] In some embodiments, the second nucleic acid sequence is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2.

[0071] In some embodiments, the second nucleic acid sequence is complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:1.

[0072] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids comprising a first nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:1.

[0073] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids comprising a first nucleic acid sequence and a second nucleic acid sequence at least 15 nucleotides in length that are complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2.

[0074] In some embodiments, the cell further comprises at least a third nucleic acid sequence at least 15 nucleotides in length, wherein the third nucleic acid sequence is (1) complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:3, (2) complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:4, or (3) complementary to nucleotides 1294-2141 of an mRNA encoding human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:5.

[0075] In some embodiments, the cell further comprises at least a fourth nucleic acid sequence at least 15 nucleotides in length, wherein the fourth nucleic acid sequence is (1) complementary to nucleotides 1126-1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:3, (2) complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:4, or (3) complementary to nucleotides 1294-2141 of an mRNA encoding human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:5.

[0076] In some embodiments, the first, second, third, and fourth nucleic acids are shRNA, siRNA, dsRNA, or antisense oligonucleotides.

[0077] In some embodiments, the first, second, third, and fourth nucleic acids are shRNAs.

[0078] In some embodiments, the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84.

[0079] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81.

[0080] In some embodiments, the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-35.

[0081] In some embodiments, the second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28.

[0082] In some embodiments, the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84, and the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-35.

[0083] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:16 or 28.

[0084] In some embodiments, the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84.

[0085] In some embodiments, the second nucleic acid comprises the sequence set forth in SEQ ID NO:51 or 53.

[0086] In some embodiments, the first nucleic acid and the second nucleic acid comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84.

[0087] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO:51 or 53.

[0088] In some embodiments, the one or more recombinant nucleic acids comprise a sequence set forth in SEQ ID NO: 128, 129, 130, 139, 140, or 141.

[0089] In some embodiments, the first nucleic acid reduces expression of TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not contain the first nucleic acid.

[0090] In some embodiments, expression of TGFBR2 in the cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid.

[0091] In some embodiments, the second nucleic acid reduces expression of TGFBR2 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0092] In some embodiments, expression of TGFBR2 in the cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0093] In some embodiments, the first nucleic acid reduces expression of TGFBR2 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, and the second nucleic acid reduces expression of TGFBR2 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, each compared to control cells that do not contain the respective nucleic acid.

[0094] In some embodiments, the second nucleic acid reduces expression of TGFBR1 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0095] In some embodiments, expression of TGFBR1 in the cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0096] In some embodiments, the first nucleic acid reduces expression of TGFBR2 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, and the second nucleic acid reduces expression of TGFBR1 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, each compared to control cells not containing the respective nucleic acid.

[0097] In some embodiments, the third nucleic acid sequence is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:3.

[0098] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

[0099] In some embodiments, the third nucleic acid comprises the sequence set forth in SEQ ID NO:92.

[0100] In some embodiments, the third nucleic acid reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the third nucleic acid.

[0101] In some embodiments, the fourth nucleic acid sequence is complementary to nucleotides 518-559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:4.

[0102] In some embodiments, the fourth nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 100-112.

[0103] In some embodiments, the fourth nucleic acid comprises the sequence set forth in SEQ ID NO:110.

[0104] In some embodiments, the one or more recombinant nucleic acids comprise the sequence set forth in SEQ ID NO:129.

[0105] In some embodiments, the fourth nucleic acid reduces expression of PTPN2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid.

[0106] In some embodiments, the fourth nucleic acid sequence is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:5.

[0107] In some embodiments, the fourth nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 113-126.

[0108] In some embodiments, expression of TGFBR1, TGFBR2, FAS and / or PTPN2 and / or TOX is determined by a nucleic acid assay or a protein assay.

[0109] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0110] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

[0111] In some embodiments, the cells further comprise a priming receptor comprising a first extracellular antigen-binding domain that specifically binds a first antigen, and a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds a second antigen.

[0112] In some embodiments, the immune cells are primary human immune cells.

[0113] In some embodiments, the primary immune cells are natural killer (NK) cells, natural killer T (NKT) cells, T cells, γδ T cells, CD8+ T cells, CD4+ T cells, primary T cells, T cell progenitors, or induced pluripotent stem cells (iPSCs).

[0114] In some embodiments, the primary immune cells are primary T cells.

[0115] In some embodiments, the primary immune cells are primary human T cells.

[0116] In some embodiments, the immune cells are virus-free.

[0117] In some embodiments, the immune cells are autoimmune cells.

[0118] In some embodiments, the immune cells are allogeneic immune cells.

[0119] In one aspect, provided herein is a primary immune cell comprising at least one recombinant nucleic acid, wherein the at least one recombinant nucleic acid comprises a first nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84 and a second nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 84, wherein the first nucleic acid and the second nucleic acid are inserted into a target region in the genome of the primary immune cell, and the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

[0120] In one aspect, provided herein is a primary immune cell comprising at least one recombinant nucleic acid, wherein the at least one recombinant nucleic acid comprises a first nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84 and a second nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 84, wherein the first nucleic acid and the second nucleic acid are inserted into a target region in the genome of the primary immune cell, and the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.

[0121]

[0010] In one aspect, provided herein is a virus-free viable primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid(s) comprise a first nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84 and a second nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-84, and wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.

[0122]

[0010] In one aspect, provided herein is a virus-free viable primary cell comprising a ribonucleoprotein complex (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, and the recombinant nucleic acid(s) comprise a first nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84 and a second nucleic acid comprising a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-84, and wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences homologous to genomic sequences adjacent to an insertion site in the genome of the primary cell.

[0123] In some embodiments, the cell further comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds a first antigen, and a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds a second antigen, wherein the first antigen and the second antigen are different.

[0124] In one aspect, provided herein is a population of cells comprising a plurality of immune cells disclosed herein.

[0125] In one aspect, provided herein is a pharmaceutical composition comprising an immune cell disclosed herein or a population of cells disclosed herein and a pharmaceutically acceptable excipient.

[0126] In one aspect, provided herein is a pharmaceutical composition comprising one or more recombinant nucleic acids disclosed herein or a vector disclosed herein and a pharmaceutically acceptable excipient.

[0127]

[0013] In one aspect, provided herein is a method of editing an immune cell, the method comprising: providing a ribonucleoprotein (RNP)-recombinant nucleic acid(s) complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid(s) comprise a recombinant nucleic acid(s) disclosed herein, and wherein the 5' and 3' ends of the recombinant nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences adjacent to an insertion site in the genome of the immune cell; non-virally introducing the RNP-recombinant nucleic acid(s) complex into the immune cell, wherein the guide RNA specifically hybridizes to a target region in the genome of the primary immune cell and the nuclease domain cleaves the target region to create an insertion site in the genome of the immune cell; and editing the immune cell via insertion of the recombinant nucleic acid(s) disclosed herein into the insertion site in the genome of the immune cell.

[0128] In some embodiments, the non-viral introducing comprises electroporation.

[0129] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

[0130] In some embodiments, the target region of the cell's genome is the T cell receptor alpha constant (TRAC) locus or the genomic safe harbor (GSH) locus.

[0131] In some embodiments, the recombinant nucleic acid(s) are double-stranded recombinant nucleic acid(s) or single-stranded recombinant nucleic acid(s).

[0132] In some embodiments, the recombinant nucleic acid(s) are linear recombinant nucleic acid(s) or circular recombinant nucleic acid(s), and optionally, the circular recombinant nucleic acid(s) are plasmids.

[0133] In some embodiments, the immune cells are primary human immune cells.

[0134] In some embodiments, the immune cells are autoimmune cells.

[0135] In some embodiments, the immune cells are allogeneic immune cells.

[0136] In some embodiments, the immune cells are natural killer (NK) cells, natural killer T (NKT) cells, T cells, γδ T cells, CD8+ T cells, CD4+ T cells, primary T cells, T cell progenitor cells, or induced pluripotent stem cells (iPSCs).

[0137] In some embodiments, the immune cells are primary T cells.

[0138] In some embodiments, the immune cells are primary human T cells.

[0139] In some embodiments, the immune cells are virus-free or do not contain a viral vector.

[0140] In some embodiments, the method further comprises obtaining immune cells from the patient and introducing the recombinant nucleic acid(s) in vitro.

[0141] In one aspect, provided herein is a method of treating a disease in a subject, the method comprising administering to the subject an immune cell(s) disclosed herein or a pharmaceutical composition disclosed herein.

[0142] In some embodiments, the disease is cancer.

[0143] In some embodiments, the cancer is a solid cancer or a liquid cancer.

[0144] In some embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, pancreatic cancer, kidney cancer, lung cancer, prostate cancer, bladder cancer, breast cancer, brain cancer, leukemia, or lymphoma.

[0145] In some embodiments, administration of the cell(s) enhances the immune response.

[0146] In some embodiments, the enhanced immune response is an adaptive immune response.

[0147] In some embodiments, the enhanced immune response is an innate immune response.

[0148] In one aspect, provided herein is a method of enhancing an immune response in a subject, the method comprising administering to the subject an immune cell(s) disclosed herein or a pharmaceutical composition disclosed herein.

[0149] In some embodiments, the enhanced immune response is an adaptive immune response.

[0150] In some embodiments, the enhanced immune response is an innate immune response.

[0151] In some embodiments, expression of TGFBR2 in immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

[0152] In some embodiments, expression of TGFBR1 in immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

[0153] In some embodiments, expression of FAS in immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

[0154] In some embodiments, expression of PTPN2 in immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

[0155] In some embodiments, expression of TOX in immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

[0156] In some embodiments, expression of TGFBR1, TGFBR2, FAS, PTPN2, and / or TOX in immune cells is determined by a nucleic acid assay or a protein assay.

[0157] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0158] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

[0159] In some embodiments, the method further comprises administering to the subject an immunotherapy, either simultaneously with or after the immune cells. [Brief explanation of the drawings]

[0160] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description and accompanying drawings.

[0161] [Figure 1A] Exemplary insert cassettes encoding logic gates (priming receptor (primeR) and CAR) and shRNA modules are shown. [Figure 1B] Shows knockdown of TGFBR2 and FAS in T cells incubated with the indicated shRNA modules. [Figure 1C] Shown is knockdown of TGFBR2 and FAS in T cells incubated with the indicated shRNA modules and 0 ng / ml or 10 ng / ml TGF-β1. [Figure 1D] Shown is knockdown of TGFBR2 and FAS in T cells incubated with the indicated shRNA modules and 0 ng / ml or 10 ng / ml TGF-β1 after short-term RSA (second stimulation). [Figure 1E] Relative TFGBR2 expression after knockdown with the indicated shRNAs is shown. [Figure 1F] Cumulative T cell proliferation, tumor cell proliferation, and IFNg production in T cells with a single TGFBR2 shRNA stimulated in medium alone or in the presence of TGF-b are shown. [Figure 1G] TFGBR2 expression and pSMAD phosphorylation in T cells after knockdown with the indicated shRNA or FAS-PTPN2-TGFBR2 knockout are shown. [Figure 2A-1] Figure 1 shows that the indicated shRNAs conferred partial resistance to TGF-β-mediated CD103 induction after exposure to tumor and TGF-β1 in short-term RSA. [Figure 2A-2] See legend to Figure 2A-1. [Figure 2B]The indicated shRNAs conferred partial resistance to TGF-β-mediated CD103 induction in RPMI-8226 target cells after exposure to tumor and TGF-β1. [Figure 3] Figure 1 shows that TGFBR2 knockdown by the Quad shRNA module restored TGF-β-mediated inhibition of tumor cell killing by logic gated T cells. [Figure 4] Correlation of CD103 induction with ICT after short-term RSA (2 stimulations) following treatment of cells with the indicated shRNAs is shown. [Figure 5A] Figure 1 shows that selected TGFBR quads partially impaired CD103 induction during RSA. [Figure 5B] We show that selected TGFBR shRNA modules strongly impaired PD1 maintenance during RSA. [Figure 6-1] Figure 1 shows that MULTIseq analysis demonstrates on-target repression of miR shRNA modules. [Figure 6-2] See description of Figure 6-1. [Figure 7] Figure 1 shows that the TGFBR2-TGFBR2 Quad shRNA module exhibited reduced pSMAD2 / 3 induction in response to TGF-β1. [Figure 8] We show that TGFBR2 knockdown by selected quad shRNAs inhibited the suppression of TGF-β-mediated target cell killing by logic gated T cells. [Figure 9A] Figure 1 shows that TGFBR2 knockout in logic-gated T cells enhanced antitumor activity in an H1975 xenograft model. [Figure 9B] 10 shows that FAS-PTPN2 shRNA enhanced the efficacy of logic-gated T cells in the H1975 in vivo model. [Figure 9C] We show that TGFBR2 knockout in logic-gated T cells enhanced antitumor activity in the 786-O xenograft model. [Figure 9D]1 shows the proliferation of TGFBR2 KO T cells on day 14 in the 786-O xenograft model. [Figure 10] Figure 1 shows that TGFBR2 knockout T cells expressing the indicated shRNAs exhibited enhanced TGI in the 786-O model compared to WT T cells and T cells expressing only FAS-PTPN2 shRNA. [Figure 11A] The mean tumor volume after treatment with engineered T cells is shown. [Figure 11B] Individual mouse tumor sizes after treatment with logic gates and control shRNA control groups are shown. [Figure 11C] Individual mouse tumor sizes are shown after treatment with FAS-PTPN2-TGFBR2_23-TGBR2_16 shRNA logic-gated T cells. [Figure 11D] Individual mouse tumor sizes are shown after treatment with FAS-PTPN2 logic-gated T cells. [Figure 11E] Individual mouse tumor sizes are shown after treatment with FAS-PTPN2-TGFBR2_23-TGBR2_37 shRNA logic-gated T cells. [Figure 11F] Individual mouse tumor sizes are shown after treatment with FAS-PTPN2-TGFBR2_23-TGBR1_13 shRNA logic-gated T cells. [Figure 11G] Individual mouse tumor sizes are shown after treatment with FAS-PTPN2-TGFBR2_23-TGBR1_10 shRNA logic-gated T cells. [Figure 11H] Individual mouse tumor sizes are shown after treatment with TGFBR2 knockout T cells. [Figure 12] Logic gates 1-5. Diagrams of various ICT transgene cassettes expressing ICT, shRNA, and optional SPA are provided. [Figure 13] All ICT cells constitutively expressed the PrimeR construct. [Figure 14] Figure 1 shows that ICT cells induced CAR expression when co-cultured with a primeR antigen-expressing cell line. [Figure 15] We show that inclusion of the shRNA module in ICT cells resulted in lower MFI of both FAS and TGFBR2 in ICT cells expressing the primed receptor-CAR logic gate (PrimeR+) normalized to non-edited cells (PrimeR-). [Figure 16] Figure 16A shows cytotoxicity against parental K562 cells that do not express either the CAR or primeR antigen, Figure 16B shows cytotoxicity against K562 cells that express only the CAR antigen, Figure 16C shows cytotoxicity against K562 cells that express only the primeR antigen, and Figure 16D shows cytotoxicity against K562 cells that express both the primeR and CAR antigens. [Figure 17] Shown is IFN-γ production from ICTs expressing logic gates 1–5 only in supernatants harvested from cocultures in which target cells expressed both primeR and CAR antigens. [Figure 18] Figure 18A shows that ICTs expressing logic gates 1-5 demonstrated in vitro cytotoxicity against primeR antigen+ cell lines expressing endogenous CAR antigen. Figure 18B shows the secretion of IFNγ, TNFα, GM-CSF, and IL-2 by ICT cells after co-culture with primeR antigen+ / CAR antigen+ cells. [Figure 19] This shows that co-culture with HUVEC-primeR antigen+ cells induced the expression of CAR protein in ICT cells and the specific killing of CAR antigen+ cells. [Figure 20A] Shown are tumor volumes after tumor implantation in mice treated with ICTs expressing Logic Gates 1–5, RNP, or PBS generated from donor 1. [Figure 20B] The expansion of total T cells and ICTs at day 12 post-inoculation, followed by a decline up to day 21, is shown. [Figure 20C] Total T cells expressing the priming receptor on days 12 and 21 are shown. [Figure 20D] Figure 1 shows tumor volumes after tumor implantation in mice treated with ICT expressing Logic Gates 1-5, RNP, or PBS, generated from donor 2. [Figure 20E] The expansion of total T cells and ICTs at day 12 post-inoculation, followed by a decline up to day 21, is shown. [Figure 20F] Total T cells expressing the priming receptor on days 12 and 21 are shown. [Figure 21] Figure 21A shows tumor growth inhibition (TGI) in the flank of single positive CAR antigen only. Figure 21B shows tumor growth inhibition (TGI) in the flank of double positive primeR antigen / CAR antigen. [Figure 22] We show that TGFBR knockdown protects ICT cells from TGFβ-mediated inhibition. [Figure 23] This shows that ICT+shRNA was more potent than traditional CAR-T benchmarks. [Figure 24] Figure 1 shows in vivo tumor volume in the 786-O xenograft model after injection of the indicated ICTs expressing quad shRNAs. [Figure 25] Figure 1 shows in vivo tumor volume in an A498 xenograft model after injection of ICT expressing quad shRNA compared to FAS-PTPN2 shRNA. [Figure 26-1] 1 shows a schematic diagram of an exemplary dual shRNA expression cassette for expression of shRNAs against FAS and TGFBR2 in 3G-E format. [Figure 26-2] This is a continuation of Figure 26-1. [Figure 26-3] This is a continuation of Figure 26-2. [Figure 27-1] 1 shows a schematic diagram of an exemplary triple shRNA expression cassette for expression of shRNAs against FAS and TGFBR2 in 3G-E-3G format. [Figure 27-2] This is a continuation of Figure 27-1. [Figure 27-3] This is a continuation of Figure 27-2. [Figure 28-1] 1 shows a schematic diagram of an exemplary triple shRNA expression cassette for expression of shRNAs against TGFBR2 and FAS in a 3G-3G-3G format. [Figure 28-2]This is a continuation of Figure 28-1. [Figure 28-3] This is a continuation of Figure 28-2. [Figure 29-1] 1 shows a schematic diagram of an exemplary triple shRNA expression cassette for expression of shRNAs against FAS and TGFBR2 in a 3G-3G-3G format. [Figure 29-2] This is a continuation of Figure 29-1. [Figure 29-3] This is a continuation of Figure 29-2. [Figure 30-1] 1 shows a schematic diagram of an exemplary quadruple shRNA expression cassette for expression of shRNAs against FAS, PTPN2, and TGFBR2 in a 3G-E-3G-3G format. [Figure 30-2] This is a continuation of Figure 30-1. [Figure 30-3] This is a continuation of Figure 30-2. [Figure 30-4] This is a continuation of Figure 30-3. DETAILED DESCRIPTION OF THE INVENTION

[0162] Detailed Description definition Terms used in the claims and specification, unless otherwise specified, are defined as set forth below.

[0163] As used herein, the term "locus" refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0164] The term "safe harbor locus" refers to a locus at which a gene or genetic element may be integrated without disrupting the expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS) or genomic safe harbor (GSH) sites. As used herein, safe harbor locus refers to an "integration site" or "knock-in site" at which a sequence encoding a transgene, as defined herein, may be inserted. In some embodiments, the insertion occurs with replacement of sequences located at the integration site. In some embodiments, the insertion occurs without replacement of sequences at the integration site. Examples of contemplated integration sites are provided in Table D.

[0165] As used herein, the term "insertion" refers to a nucleotide sequence that is integrated (inserted) into a target locus or a safe harbor site. An insertion can be used to refer to a gene or genetic element that is integrated into a target locus or a safe harbor site, for example, using homology-directed repair (HDR), CRISPR / Cas9 genome editing, or other methods for inserting nucleotide sequences into a genomic region known to those skilled in the art.

[0166] The term "insertion" refers to the manipulation of a nucleotide sequence to introduce a non-native sequence. This can be done, for example, by using restriction enzymes and ligases, whereby a DNA sequence of interest, usually encoding a gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with the appropriate restriction enzyme to create compatible overlaps, and then joining the molecules together using ligase. Those skilled in the art will be very familiar with such manipulations, and examples can be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, "Molecular Cloning: A Laboratory Manual", 2nd ed., Cold Spring Harbor Laboratory, 1989), which is incorporated herein by reference in its entirety, including any figures, drawings, and tables.

[0167] The "CRISPR / Cas" system refers to a broad class of bacterial systems for defense against foreign nucleic acids. CRISPR / Cas systems are found in a wide range of fungal and archaeal organisms. CRISPR / Cas systems include type I, type II, and type III subtypes. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, Cas9, in a complex with guide and activator RNAs to recognize and cleave foreign nucleic acids. Guide RNAs with both guide and activator RNA activity are also known in the art. In some cases, such dual-activity guide RNAs are referred to as small guide RNAs (sgRNAs).

[0168] Cas9 homologs are found in a wide variety of fungi, including, but not limited to, bacteria from the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and their homologs are described, for example, in Chylinksi, et al., RNA Biol. 2013 May 1;10(5):726-737; Nat. Rev. Microbiol. 2011 June;9(6):467-477; Hou, et al., Proc Natl Acad Sci US A. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in host cells.

[0169] As used herein, the term "Cas9" refers to an RNA-mediated nuclease (e.g., of bacterial or archaeal origin or derived therefrom). Exemplary RNA-mediated nucleases include the aforementioned Cas9 protein and homologs thereof, including, but not limited to, CPF1 (see, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015). Similarly, as used herein, the term "Cas9 ribonucleoprotein" complex, etc., refers to a complex between a Cas9 protein and a crRNA (e.g., a guide RNA or a small guide RNA), a Cas9 protein and a trans-activating crRNA (tracrRNA), a Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing a Cas9 protein, a tracrRNA, and a crRNA guide RNA).

[0170] As used herein, the phrase "immune cell" includes all cell types that can give rise to immune cells, including hematopoietic cells, such as hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, a macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell precursor, or a dendritic cell. In some embodiments, the cell is an innate immune cell.

[0171] As used herein, the term "primary" in the context of primary cells or primary stem cells refers to cells that have not been transformed or immortalized. Such primary cells can be cultured, subcultured, or passaged a limited number of times (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, primary cells are adapted to in vitro culture conditions. In some cases, primary cells are isolated from organisms, systems, organs, or tissues, optionally sorted, and used directly, for example, without culture or subculture. In some cases, primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN-γ, or a combination thereof.

[0172] As used herein, the terms "T lymphocyte" and "T cell" are used interchangeably and refer to cells that have completed maturation in the thymus and identified a specific foreign antigen in the body. These terms also refer to the major type of white blood cell that has various roles in the immune system, including activating and inactivating other immune cells. T cells can be any T cell, such as cultured T cells, e.g., primary T cells, or T cells from cultured T cell lines, e.g., Jurkat, SupT1, etc., or mammalian-derived T cells. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., not cultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or subpopulations thereof. T cells can be CD3+ cells. T cells can be CD4+ cells. + , CD8 + , or CD4 + and CD8 +T cells can be any type of T cell, CD4+ / CD8+ double-positive T cells, CD4+ helper T cells (e.g., Th1 and Th2 cells), CD8+ T cells (e.g., cytotoxic T cells), peripheral T cells, including, but not limited to, blood mononuclear cells (PBMCs), peripheral blood leukocytes (PBLs), tumor-infiltrating lymphocytes (TILs), memory T cells, naive T cells, regulatory T cells, gamma delta T cells, and the like. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells) and effector memory T cells (Tem cells and Temra cells). T cells can also refer to genetically modified T cells, such as T cells modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem or progenitor cells.

[0173] "CD4+ T cells" refer to a subset of T cells that express CD4 on their surface and are involved in cellular immune responses. CD4+ T cells are characterized by a post-stimulation secretory profile that can include secretion of cytokines such as IFN-γ, TNF-α, IL-2, IL-4, and IL-10. "CD4" is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but has also been found on other cells, including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been suggested as an associative recognition element in MHC (major histocompatibility complex) class II-restricted immune responses. On T lymphocytes, the CD4 antigen defines helper / inducer subsets.

[0174] "CD8+ T cells" refer to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The "CD8" molecule is a differentiation antigen present on thymocytes and on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is the associative recognition element in major histocompatibility complex class I restricted interactions.

[0175] As used herein, the phrase "hematopoietic stem cells" refers to a type of stem cell that can give rise to blood cells. Hematopoietic stem cells can give rise to myeloid or lymphoid cells, or a combination thereof. Hematopoietic stem cells are primarily found in the bone marrow, but they can also be isolated from peripheral blood, or fractions thereof. Various cell surface markers can be used to identify, select, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells express c-kit + and lin - In some cases, human hematopoietic stem cells are identified as CD34 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells are identified as CD34 - , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, human hematopoietic stem cells express CD133 + , CD59 + , Thy1 / CD90 + , CD38 lo / - , C-kit / CD117 + , lin - In some cases, mouse hematopoietic stem cells express CD34 lo / - , SCA-1 + , Thy1 + / lo , CD38+ , C-kit + , lin - In some cases, hematopoietic stem cells express CD150 + CD48 - CD244 - is.

[0176] As used herein, the phrase "hematopoietic cells" refers to cells derived from hematopoietic stem cells. Hematopoietic cells can be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof). Alternatively, hematopoietic cells can be obtained or provided by isolating hematopoietic stem cells and differentiating the stem cells. Hematopoietic cells include cells with limited potential to differentiate into additional cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include lymphoid and myeloid cells, such as lymphocytes, erythrocytes, granulocytes, monocytes, and platelets.

[0177] As used herein, the term "construct" refers to a macromolecule or complex of molecules that includes a polynucleotide.

[0178] As used herein, the term "integration" refers to the process of stably inserting one or more nucleotides of a construct into a cell genome, i.e., covalently linking them to a nucleic acid sequence in the chromosomal DNA of the cell. It can also refer to a nucleotide deletion at the site of integration. If there is a deletion at the insertion site, "integration" can further include the replacement of the deleted endogenous sequence or nucleotides with one or more inserted nucleotides.

[0179] As used herein, the term "exogenous" refers to a molecule or activity that is introduced into a host cell and is not native to that cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material, e.g., by integration into a host chromosome, or as non-chromosomal genetic material such as a plasmid. Thus, when used in connection with expression of an encoding nucleic acid, the term refers to introducing the encoding nucleic acid into a cell in an expressible form. The term "endogenous" refers to a molecule or activity that is present in a host cell under natural, unedited conditions. Similarly, when used in connection with expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid that is contained within the cell and not exogenously introduced.

[0180] The term "heterologous" refers to a nucleic acid or polypeptide sequence or domain that is not native to the flanking sequences, e.g., a heterologous sequence is not found in nature coupled to a nucleic acid or polypeptide sequence that occurs at one or both termini.

[0181] The term "homologous" refers to a nucleic acid or polypeptide sequence or domain that is natural to the adjacent sequence, e.g., a homologous sequence is found in nature coupled to a nucleic acid or polypeptide sequence occurring at one or both termini.

[0182] As used herein, a "polynucleotide donor construct" refers to a nucleotide sequence (e.g., a DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct can include prokaryotic sequences, cDNA derived from eukaryotic mRNA, genomic DNA sequences derived from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, the polynucleotide donor construct can be an miRNA, an shRNA, a native polypeptide (i.e., a naturally occurring polypeptide) or a fragment thereof, or a variant polypeptide (e.g., a naturally occurring polypeptide having less than 100% sequence identity to the native polypeptide) or a fragment thereof.

[0183] As used herein, the terms "complementary" or "complementarity" refer to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are generally A and T (or A and U), and G and C. The guide RNAs described herein can include a DNA target sequence that is fully complementary or substantially complementary (e.g., has 1-4 mismatches) to a sequence, e.g., a genomic sequence in a cell.

[0184] As used herein, the term "transgene" refers to a polynucleotide that has been transferred from one organism to another, either naturally or by any of several genetic engineering techniques. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A "recombinant protein" is a protein that is encoded by a gene (recombinant DNA) and has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system). The recombinant protein can be a therapeutic agent, e.g., a protein that treats a disease or disorder disclosed herein. As used, transgene can refer to a polynucleotide that encodes a polypeptide.

[0185] "Protein," "polypeptide," and "peptide" are used interchangeably herein.

[0186] As used herein, the terms "operably linked" or "operably linked" refer to the association of nucleic acid sequences on a single nucleic acid fragment so that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence or functional RNA if it is capable of affecting the expression of the coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in both sense and antisense orientation.

[0187] As used herein, the term "developmental cell state" refers, for example, to when a cell is inactive, actively developing, differentiating, senescent, etc. A developmental cell state can also refer to a cell in a precursor state (e.g., a T cell precursor).

[0188] As used, the term "encoding" refers to a nucleic acid sequence that encodes a protein or polypeptide of interest. The nucleic acid sequence can be either a DNA or an RNA molecule. In a preferred embodiment, the molecule is a DNA molecule. In another preferred embodiment, the molecule is an RNA molecule. When present as an RNA molecule, it contains a sequence that instructs the host cell's ribosomes to begin translation (e.g., a start codon, ATG) and a sequence that instructs the ribosomes to terminate translation (e.g., a stop codon). Between the start codon and the stop codon is an open reading frame (ORF). Such terms are known to those of skill in the art.

[0189] As used herein, the term "subject" refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs, and sheep. In certain embodiments, the subject is a human. In some embodiments, the subject has a disease or condition that can be treated with the engineered cells or populations thereof provided herein. In some aspects, the disease or condition is cancer.

[0190] As used herein, the term "promoter" refers to a nucleotide sequence (e.g., a DNA sequence) capable of controlling the expression of a coding sequence or functional RNA. A promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter can be derived entirely from a native gene, can be composed of different elements from different promoters found in nature, and / or can include synthetic DNA segments. A promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It will be understood by those skilled in the art that different promoters can induce gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions. As is known in the art, promoters can be selected according to the strength of the promoter and / or the conditions under which the promoter is active, e.g., constitutive promoters, strong promoters, weak promoters, inducible / repressible promoters, tissue-specific or developmentally regulated promoters, cell cycle-dependent promoters, etc.

[0191] The promoter may be an inducible promoter (e.g., a heat shock promoter, a tetracycline-regulated promoter, a steroid-regulated promoter, a metal-regulated promoter, an estrogen receptor-regulated promoter, etc.). The promoter may be a constitutive promoter (e.g., a CMV promoter, a UBC promoter). In some embodiments, the promoter may be a spatially restricted and / or temporally restricted promoter (e.g., a tissue-specific promoter, a cell-type specific promoter, etc.). See, e.g., U.S. Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0192] As contemplated herein, gene editing can involve knocking in or knocking out a gene (or nucleotide sequence). As used herein, the term "knock-in" refers to the addition of a DNA sequence or a fragment thereof to a genome. Such a knocked-in DNA sequence may include an entire gene or multiple genes, and may include regulatory sequences associated with a gene or any portion or fragment thereof. For example, a polynucleotide donor construct encoding a recombinant protein can be inserted into the genome of a cell harboring a mutant gene. In some embodiments, the knock-in strategy involves replacing an existing sequence with a provided sequence, e.g., replacing a mutant allele with a wild-type copy. On the other hand, the term "knock-out" refers to the removal of a gene or the expression of a gene. For example, a gene can be knocked out by either deleting or adding a nucleotide sequence, which leads to a disruption of the reading frame. As another example, a gene can be knocked out by replacing a portion of the gene with an unrelated (e.g., non-coding) sequence.

[0193] As used herein, the term "non-homologous end joining" or NHEJ refers to a cellular process in which broken or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can result in the addition, deletion, substitution, or combination of one or more nucleotides at the repair site.

[0194] As used herein, "homology-directed repair" or HDR refers to the cellular process in which the broken or nick end of a DNA strand is repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the sequence of the template. The homologous template nucleic acid can be provided by a homologous sequence (sister chromatid, homologous chromosome, or repeat region on the same or different chromosome) located elsewhere in the genome. Alternatively, exogenous template nucleic acid can be introduced to obtain specific HDR-induced changes in the sequence at the target site. In this way, specific mutations can be introduced at the break site.

[0195] As used herein, single-stranded DNA template or double-stranded DNA template refers to the DNA oligonucleotide that can be used by cell as template for HDR.Generally, single-stranded DNA template or double-stranded DNA template has at least one region of homology with target site.In some cases, single-stranded DNA template or double-stranded DNA template has two homologous regions adjacent to the region that contains the heterologous sequence that is inserted into target cleavage site.

[0196] The terms "vector" and "plasmid" are used interchangeably and, as used herein, refer to a polynucleotide vehicle useful for introducing genetic material into a cell. A vector can be linear or circular. A vector can integrate into a target genome of a host cell or replicate independently within the host cell. A vector can include, for example, an origin of replication, a multicloning site, and / or a selectable marker. An expression vector typically includes an expression cassette. Vectors and plasmids include, but are not limited to, integrative vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0197] As used herein, the term "introducing" in the context of introducing a nucleic acid or a complex containing a nucleic acid, such as an RNP-DNA template complex, refers to the translocation of the nucleic acid sequence or RNP-DNA template complex from outside the cell to inside the cell. In some cases, introducing refers to the translocation of the nucleic acid or complex from outside the cell to the nucleus of the cell. Various methods of such translocation are contemplated, including, but not limited to, electroporation, contact with nanowires or nanotubes, receptor-mediated internalization, translocation via cell-penetrating peptides, liposome-mediated translocation, etc.

[0198] As used herein, the term "expression cassette" refers to a recombinantly or synthetically produced polynucleotide construct that includes regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequences can facilitate transcription of the selected polynucleotide within the host cell, or transcription and translation of the selected polynucleotide within the host cell. The expression cassette can, for example, be integrated into the genome of the host cell or can be present in an expression vector.

[0199] As used herein, the phrase "subject in need thereof" refers to a subject who exhibits and / or is diagnosed with one or more symptoms or signs of a disease or disorder described herein.

[0200] "Chemotherapeutic agents" refer to chemical compounds useful in the treatment of cancer. Chemotherapeutic agents include "antihormonal agents" or "endocrine therapy agents" that act to regulate, reduce, block, or inhibit the effects of hormones that can promote cancer growth.

[0201] The term "composition" refers to a mixture containing, for example, engineered cells or nucleic acids as contemplated herein. In some embodiments, a composition may contain additional components, such as adjuvants, stabilizers, excipients, etc. The term "composition" or "pharmaceutical composition" refers to a preparation that is in a form that allows the biological activity of the active ingredients contained therein to be effective in treating a subject, and that does not contain additional ingredients that are unacceptably toxic to a subject in the amounts provided in the pharmaceutical composition.

[0202] The term "in situ" refers to processes that occur within living cells grown isolated from an organism, for example, grown in tissue culture.

[0203] The term "in vivo" refers to a process that occurs within a living organism.

[0204] As used herein, the term "ex vivo" generally includes experiments or measurements performed in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal variation from natural conditions.

[0205] As used herein, the term "mammal" includes both humans and non-humans, including, but not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0206] The term percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refers to two or more sequences or subsequences that have a specified percentage of nucleotide or amino acid residues that are identical when compared and aligned for maximum correspondence, as determined using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to those of skill in the art), or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the entire length of the two sequences being compared.

[0207] For sequence comparison, typically, one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated as necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence(s) relative to the reference sequence based on the designated program parameters.

[0208] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, 575 Science Dr., Madison, Wis.)), or by visual inspection (see generally Ausubel et al., infra).

[0209] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0210] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.

[0211] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of the disease.

[0212] The term "ameliorate" refers to any therapeutically beneficial outcome in the treatment of a disease state, for example, a cancer disease state, a reduction in its severity or progression, a remission thereof, or a cure thereof.

[0213] As used herein, the term "effective amount" refers to a sufficient amount of a compound (e.g., a composition described herein, a cell described herein) to produce a beneficial or desired result. An effective amount can be administered in one or more administrations, applications, or dosages, and is not intended to be limited to a particular formulation or route of administration.

[0214] As used herein, the term "treating" includes any effect that results in an improvement of the condition, disease, disorder, etc. or improves the symptoms thereof, e.g., alleviating, reducing, modulating, ameliorating, or eliminating.

[0215] The terms "modulate" and "modulation" refer to decreasing or inhibiting, or alternatively activating or increasing, the recited variable.

[0216] The terms "increase" and "activate" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater increase in the recited variable.

[0217] The terms "reduce" and "inhibit" refer to a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater decrease in the recited variable.

[0218] It must be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0219] Recombinant Nucleic Acid Compositions Transforming growth factor beta receptor 1 (TGFBR1; HGNC:11772, NCBI Entrez Gene:7046, UniProtKB / Swiss-Prot:P36897) is a transmembrane serine / threonine protein kinase that, upon binding to TGF-beta, forms a heterocomplex with TGF-beta receptor type II (TGFRB2) and transduces TGF-beta signals from the cell surface to the cytoplasm.

[0220] Transforming growth factor beta receptor 2 (TGFBR2; HGNC:11773, NCBI Entrez Gene:7048, UniProtKB / Swiss-Prot:P37173) is a transmembrane serine / threonine protein kinase that, upon binding to TGF-beta, forms a heterodimeric complex with TGF-beta receptor type 1 (TGFBR1), resulting in the transduction of TGF-beta signals from the cell surface to the cytoplasm.

[0221] As used herein, a "target gene" refers to a nucleic acid sequence in a cell whose expression can be specifically and effectively regulated using the recombinant nucleic acid molecules and methods described herein. In certain embodiments, the target gene can be involved in the growth (proliferation), maintenance (survival) and / or immune behavior of an individual's immune cells.

[0222] In some embodiments, the target gene is transforming growth factor beta receptor 1 (TGFBR1). In some embodiments, the target gene is transforming growth factor beta receptor 2 (TGFBR2). In some embodiments, two or more recombinant nucleic acid molecules target the TGFBR2 gene.

[0223] In some embodiments, two or more target genes are regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, at least two target genes are regulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, the recombinant nucleic acid molecule(s) is shRNA. In some embodiments, the at least two target genes are at least TGFBR1 and TGFBR2. In some embodiments, the at least two target genes are at least TGFBR1, TGFBR2, FAS, and PTPN2. In some embodiments, the at least two target genes are at least TGFBR1, TGFBR2, FAS, and TOX. In some embodiments, the at least two target genes are at least TGFBR2, FAS, and PTPN2. In some embodiments, the at least two target genes are at least TGFBR2, FAS, and TOX.

[0224] In one aspect, provided herein is a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human transforming growth factor beta receptor 1 (TGFBR1). In one aspect, provided herein is a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human transforming growth factor beta receptor 2 (TGFBR2).

[0225] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1589 to 1610 or 1965 to 1986 of an mRNA encoding human transforming growth factor beta receptor 1 (TGFBR1), comprising the sequence set forth in SEQ ID NO:1.

[0226] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 2215-2236, 4430-4451, or 3761-3782 of an mRNA encoding human transforming growth factor beta receptor 2 (TGFBR2), comprising the sequence set forth in SEQ ID NO:2.

[0227] In some embodiments, the nucleic acid or first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 84. In some embodiments, the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84, and the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 84.

[0228] In some embodiments, the first and second nucleic acids each comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36-84. In some embodiments, the nucleic acid or the first nucleic acid comprises the sequence set forth in SEQ ID NO: 81. In some embodiments, the nucleic acid or the first nucleic acid comprises the sequence set forth in SEQ ID NO: 51 or 53. In some embodiments, the nucleic acid, the first nucleic acid, or the second nucleic acid comprises the sequence set forth in SEQ ID NOs: 81 and 51 or 53.

[0229] In some embodiments, the nucleic acid or second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6-35. In some embodiments, the nucleic acid or second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28. The first nucleic acid comprises the sequence set forth in SEQ ID NO: 81, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28.

[0230] In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:28, 16, 51, or 53. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81, and the second nucleic acid comprises the sequence set forth in SEQ ID NO:51. In some embodiments, the first nucleic acid comprises the sequence set forth in SEQ ID NO:81, the second nucleic acid comprises the sequence set forth in SEQ ID NO:51, and the third nucleic acid comprises the sequence set forth in SEQ ID NO:92.

[0231] In some embodiments, the one or more nucleic acids further comprise at least a third nucleic acid sequence at least 15 nucleotides in length, wherein the at least third nucleic acid sequence comprises a nucleic acid sequence complementary to nucleotides 1126-1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3. In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NO:85-99. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:92. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:130. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NO:128-131, 140, or 141.

[0232] FAS is a member of the apoptosis-inducing TNF receptor superfamily. PTPN2 is a phosphatase that regulates interferon and many other signaling pathways. TOX is a transcription factor that regulates the differentiation of exhausted T cells.

[0233] In one aspect, provided herein is a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human FAS, protein tyrosine phosphatase non-receptor type 2 (PTPN2), or thymocyte selection-associated high-mobility group box (TOX).

[0234] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:3.

[0235] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 518 to 559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO:4.

[0236] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length that is complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:5.

[0237] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 92. In some embodiments, the nucleic acid reduces expression of FAS in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0238] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 100-112. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 110. In some embodiments, the nucleic acid reduces expression of PTPN2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0239] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 113-126. In some embodiments, the nucleic acid reduces expression of TOX in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the nucleic acid.

[0240] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 127-130.

[0241] In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 127-131 or 133-141. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 127-131 and 139-141. In some embodiments, the nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 133-137.

[0242] In some embodiments, the nucleic acid further comprises at least a third nucleic acid sequence at least 15 nucleotides in length, wherein the at least third nucleic acid sequence comprises a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding the human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3.

[0243] In some embodiments, the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

[0244] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO:92.

[0245] In some embodiments, the nucleic acid comprises an shRNA module. In some embodiments, the shRNA module comprises a first strand and a second strand of one or more shRNAs. In some embodiments, the shRNA module comprises two shRNAs. In some embodiments, the shRNA module comprises three shRNA sequences. In some embodiments, the shRNA module comprises four shRNA sequences. In some embodiments, the shRNA module further comprises one or more backbones of one or more miRs. In some embodiments, the one or more backbones comprise a 5' backbone, a loop, and a 3' backbone. In some embodiments, the shRNA module comprises one or more first and second strands of shRNAs within the backbones of one or more miRs. In some embodiments, the first strand of the shRNA is located between the 5' backbone and the loop of the miR, and the second strand of the shRNA is located between the loop and the 3' backbone of the miR.

[0246] In some embodiments, the shRNA module is a dual shRNA module. In some embodiments, the shRNA module comprises, from 5' to 3', (1) the 5' backbone of the first miR (e.g., miR-3G 5' backbone), (2) the first strand of the first shRNA, (3) the loop of the first miR (e.g., miR-3G loop), (4) the second strand of the first shRNA, (5) the 3' backbone of the first miR (e.g., miR-3G 3' backbone), (6) a first spacer, (7) the 5' backbone of the second miR (e.g., miR-E 5' backbone), (8) the first strand of the second shRNA, (9) the loop of the second miR (e.g., miR-E loop), (10) the second strand of the second shRNA, (11) the 3' backbone of the second miR (e.g., miR-E 3' backbone), (12) a second spacer, and (13) a PPT sequence. In some embodiments, the first and second miR are the same. In some embodiments, the first miR is miR-3G and the second miR is miR-E ("3G-E format"). In some embodiments, the first and second miR are different.

[0247] In some embodiments, the shRNA module is a triple shRNA module. In some embodiments, the shRNA module includes, from 5' to 3', (1) the 5' backbone of the first miR (e.g., miR-3G 5' backbone), (2) the first strand of the first shRNA, (3) the loop of the first miR (e.g., miR-3G loop), (4) the second strand of the first shRNA, (5) the 3' backbone of the first miR (e.g., miR-3G 3' backbone), (6) a first spacer, (7) the 5' backbone of the second miR (e.g., miR-E 5' backbone), (8) the first strand of the second shRNA, (9) the loop of the second miR (e.g., miR-E loop), (10) the second strand of the second shRNA, and (11) the 3' backbone of the second miR (e.g., miR-E (11) a 3' backbone of the third miR (e.g., miR-3G 3' backbone), (12) a second spacer, (13) a 5' backbone of the third miR (e.g., miR-3G 5' backbone), (14) a first strand of the third shRNA, (15) a loop of the third miR (e.g., miR-3G loop), (16) a second strand of the third shRNA, (17) a 3' backbone of the third miR (e.g., miR-3G 3' backbone), and (18) a PPT sequence. In some embodiments, the first, second, and third miRs are the same. In some embodiments, the first, second, and third miRs are all different. In some embodiments, the first and second miRs are the same and the third miR is different. In some embodiments, the first and third miRs are the same and the second miR is different. In some embodiments, the second and third miRs are the same and the first miR is different. In some embodiments, the first and third miRs are miR-3G and the second miR is miR-E ("3G-E-3G format"). In some embodiments, the first, second, and third miRs are all miR-3G ("3G-3G-3G format").

[0248] In some embodiments, the shRNA module is a quadruple shRNA module. In some embodiments, the shRNA module includes, from 5' to 3', (1) the 5' backbone of the first miR (e.g., miR-3G 5' backbone), (2) the first strand of the first shRNA, (3) the loop of the first miR (e.g., miR-3G loop), (4) the second strand of the first shRNA, (5) the 3' backbone of the first miR (e.g., miR-3G 3' backbone), (6) a first spacer, (7) the 5' backbone of the second miR (e.g., miR-E 5' backbone), (8) the first strand of the second shRNA, (9) the loop of the second miR (e.g., miR-E loop), (10) the second strand of the second shRNA, and (11) the 3' backbone of the second miR (e.g., miR-E 3' backbone), (12) a second spacer, (13) a 5' backbone of the third miR (e.g., miR-3G 5' backbone), (14) a first strand of the third shRNA, (15) a loop of the third miR (e.g., miR-3G loop), (16) a second strand of the third shRNA, (17) a 3' backbone of the third miR (e.g., miR-3G 3' backbone), (18) a third spacer, (19) a 5' backbone of the fourth miR (e.g., miR-3G 5' backbone), (20) a first strand of the fourth shRNA, (21) a loop of the fourth miR (e.g., miR-3G loop), (22) a second strand of the fourth shRNA, (23) a 3' backbone of the fourth miR (e.g., miR-3G 3' backbone), and (24) a PPT sequence. In some embodiments, the first, second, third, and fourth miRs are identical. In some embodiments, the first, second, third, and fourth miRs are all different. In some embodiments, two miRs in the first group are identical and two miRs in the second group are identical but different from the first group. In some embodiments, two miRs in the first group are identical and the remaining two miRs are each different from the first group and different from each other. In some embodiments, three of the miRs are identical and the last miR is different. In some embodiments, the first, third, and fourth miRs are miR-3G and the second miR is miR-E ("3G-E-3G-3G format").

[0249] In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 130. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 128. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 140. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 129. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 131. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 139. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 141. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 133. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 134. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 135. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 136. In some embodiments, the nucleic acid comprises the sequence set forth in SEQ ID NO: 137.

[0250] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

[0251] In some embodiments, the nucleic acid is an RNA interference (RNAi) molecule.Exemplary RNAi molecules include short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is short hairpin RNA (shRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA) or antisense oligonucleotide.In some embodiments, the nucleic acid is shRNA.

[0252] Single-stranded hairpin ribonucleic acid (shRNA) is a short double-stranded nucleic acid in which the sense and antisense strands are connected by a hairpin loop. They consist of a stem-loop structure, which can be transcribed in cells from an RNA polymerase II or RNA polymerase III promoter on a plasmid construct. When expressed, shRNA is processed into an RNAi species. Expression of shRNA from a plasmid is known to be relatively stable, thereby offering a strong advantage over the use of, for example, synthetic siRNA. shRNA expression units can be incorporated into various plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into target cells. Expression of shRNA from a plasmid can be stably incorporated for constitutive expression. shRNA is synthesized in the cell nucleus, further processed, transported to the cytoplasm, and then incorporated into the RNA-induced silencing complex (RISC) for activity. The shRNA is converted into an active siRNA molecule (capable of binding to and sequestering the mRNA transcript encoded by the target gene and / or preventing its translation).

[0253] The Argonaute family of proteins is a major component of RISC. Within the Argonaute family of proteins, only Ago2 contains endonuclease activity that can cleave and release the passenger strand from the stem portion of the shRNA molecule. The remaining three members of the Argonaute family, Ago1, Ago3, and Ago4, which do not have discernible endonuclease activity, also assemble to form RISC and are thought to function in a cleavage-independent manner. Therefore, RISC can be characterized as having cleavage-dependent and cleavage-independent pathways.

[0254] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) is described in International Publication Nos. 2018232356A1, 2019084552A1, 2019226998A1, 2020014235A1, 2020123871A1, and 2020186219A1, each of which is incorporated by reference herein for all purposes.

[0255] Antisense oligonucleotide structures and chemical modifications are described in International Publication No. WO 20 / 132521, which is incorporated herein by reference.

[0256] dsRNA and shRNA molecules, as well as methods of use and production, are described in US Pat. No. 8,829,264, US Pat. No. 9,556,431, and US Pat. No. 8,252,526, each of which is incorporated herein by reference.

[0257] siRNA molecules, as well as methods of use and production, are described in US Pat. No. 7,361,752 and US Patent Publication No. 20050048647, both of which are incorporated herein by reference.

[0258] Additional methods and compositions for RNA interference, e.g., shRNA, siRNA, dsRNA, and antisense oligonucleotides, are generally known in the art and are further described in U.S. Pat. No. 7,361,752, U.S. Pat. No. 8,829,264, U.S. Pat. No. 9,556,431, U.S. Pat. No. 8,252,526, WO 00 / 44895, WO 01 / 36646, WO 99 / 32619, WO 00 / 01846, WO 01 / 29058, WO 00 / 44914, and WO 04 / 030634, each of which is incorporated herein by reference.

[0259] Nucleic acid sequences (or constructs) that can be used to encode the RNAi molecules, e.g., shRNAs, described herein can include a promoter operably linked (or connected) directly or indirectly to the sequence encoding the RNAi molecule. Such promoters can be selected based on the host cell and the desired effect. Non-limiting examples of suitable promoters include constitutive and inducible promoters, such as inducible RNA polymerase II (pol II)-based promoters. Non-limiting examples of suitable promoters further include tetracycline-inducible or repressible promoters, EF1a, RNA polymerase I or III-based promoters, pol II-dependent viral promoters, e.g., the CMV-IE promoter, and pol III U6 and H1 promoters. The bacteriophage T7 promoter can also be used (it will be understood that in this case, T7 polymerase must also be present). In particular, nucleic acid sequences need not be limited to the use of any single promoter, as they can include two or more shRNAs (i.e., effector combinations), including, but not limited to, integrated shRNA molecules. Each integrated promoter can control one or any combination of the shRNA molecule components.

[0260] In certain embodiments, the promoter may be preferentially active in target cells; for example, it may be desirable to preferentially express at least one recombinant nucleic acid in immune cells using an immune cell-specific promoter. Introduction of such constructs into host cells may be performed under conditions in which two or more recombinant nucleic acids contained within recombinant nucleic acid precursor transcripts initially exist within a single primary transcript, whereby separate RNA molecules (e.g., shRNAs, each containing its own stem-loop structure) are subsequently excised from such precursor transcript by endogenous ribonucleases. The resulting mature recombinant nucleic acids (e.g., shRNAs) can then induce degradation and / or translational repression of target gene mRNA transcripts produced in the cell. Alternatively, each of the precursor stem-loop structures may be produced as part of a separate transcript, in which case each recombinant nucleic acid sequence preferably includes its own promoter and transcription termination sequence. Additionally, multiple recombinant nucleic acid precursor transcripts may exist within a single primary transcript.

[0261] The stem-loop structure of the shRNA recombinant nucleic acids described herein may be about 40-100 nucleotides in length, or preferably about 50-75 nucleotides in length. The stem region may be about 15-45 nucleotides (or more), or about 20-30 nucleotides in length. In some embodiments, the stem region is 22 nucleotides in length. In some embodiments, the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length.

[0262] The stem may contain a fully complementary duplex (but for either 3' tail), but a bulge or internal loop may be present on either arm of the stem. The number of such bulges and asymmetric internal loops is preferably small (e.g., 1, 2, or 3) and about 3 or less nucleotides in size. The terminal loop portion may contain about 4 or more nucleotides, but preferably about 25 or less. The loop portion is preferably 6 to 15 nucleotides in size.

[0263] As described herein, the stem region of shRNA comprises a passenger strand and a guide strand, whereby the guide strand contains a sequence complementary to the target mRNA transcript encoded by the target gene(s).Preferably, the GC content and matching of the guide strand and the passenger strand are carefully designed for thermodynamically favorable strand unwinding activity with or without endonuclease cleavage.Furthermore, the specificity of the guide strand is preferably confirmed through BLAST search (www.ncbi.nim.nih.qov / BLAST).

[0264] The present invention provides that the expression levels of multiple target genes can be regulated using the methods and recombinant nucleic acids described herein. For example, the present invention provides that a first set of recombinant nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a first target gene, and a second set of recombinant nucleic acids can be designed to contain a sequence (guide strand) designed to reduce the expression level of a second target gene. The different sets of recombinant nucleic acids can be expressed and reside within the same or separate pre-transcripts. In certain embodiments, such a multiplex approach, i.e., the use of the recombinant nucleic acids described herein to regulate the expression levels of two or more target genes, can have an enhanced therapeutic effect on patients. For example, when a patient is provided with cells expressing the recombinant nucleic acid molecules described herein to treat, prevent, or ameliorate the effects of cancer, it may be desirable to provide the patient with two or more types of recombinant nucleic acid molecules designed to reduce the expression levels of multiple genes involved in immune cell activation or suppression.

[0265] One or more recombinant nucleic acid molecules described herein may be capable of reducing target gene expression in a cell by at least about 50% compared to control cells that do not contain the recombinant nucleic acid molecule. For example, a recombinant nucleic acid molecule (e.g., shRNA) may be capable of reducing expression of a target gene selected from the group consisting of TGFBR1, TGFBR2, FAS, PTPN2, and / or TOX in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more compared to control cells that do not contain the respective recombinant nucleic acid molecule. The one or more recombinant nucleic acid molecules can be capable of reducing expression of a target gene selected from the group consisting of TGFBR1, TGFBR2, FAS, PTPN2, and / or TOX in a cell by at least about 10-50%, 10-20%, 10-30%, 10-40%, 20-50%, 30-50%, 40-50%, 10-100%, 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or the like, as compared to control cells not containing the respective recombinant nucleic acid molecule. In some embodiments, the one or more recombinant nucleic acid molecules reduce expression of TGFBR1 in cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecules. In some embodiments, the one or more recombinant nucleic acid molecules reduce expression of TGFBR2 in cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecules.In some embodiments, the one or more recombinant nucleic acid molecules reduce expression of FAS in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecules. In some embodiments, the one or more recombinant nucleic acid molecules reduce expression of PTPN2 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecules. In some embodiments, the one or more recombinant nucleic acid molecules reduce expression of TOX in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecules.

[0266] Recombinant nucleic acid molecule(s) can be chemically synthesized or in vitro transcribed and can further include one or more modifications to the sugar phosphate backbone or nucleoside residues.

[0267] Other methods known in the art for introducing nucleic acids into cells can be used, such as lipid-mediated carrier transport and chemical-mediated transport, e.g., calcium phosphate, etc. Thus, the recombinant nucleic acid molecule(s) construct can be introduced with components that perform one or more of the following activities: enhancing RNA uptake by cells, promoting annealing of duplexes for shRNA, stabilizing the annealed shRNA strands, or otherwise increasing inhibition of the target gene.

[0268] In some embodiments, the one or more recombinant nucleic acids further comprise a 5' homology-directed repair arm and / or a 3' homology-directed repair arm, wherein the 5' homology-directed repair arm and / or the 3' homology-directed repair arm are complementary to the insertion site in the host cell chromosome. In some embodiments, the one or more recombinant nucleic acids comprise a 5' homology-directed repair arm and a 3' homology-directed repair arm. In some embodiments, the one or more recombinant nucleic acids are incorporated into an expression cassette or expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the one or more recombinant nucleic acids.

[0269] In some embodiments, the one or more recombinant nucleic acids comprise at least a first nucleic acid and at least a second nucleic acid. In some embodiments, the one or more recombinant nucleic acids further comprise at least a third nucleic acid and at least a fourth nucleic acid. The first, second, third, and / or fourth nucleic acids can be RNAi molecules, e.g., shRNAs. In some embodiments, the first nucleic acid and the second nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the third nucleic acid and the fourth nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the first, second, third, and fourth nucleic acids are incorporated into a single expression cassette or a single expression vector. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the first nucleic acid and / or upstream of the second nucleic acid. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the third nucleic acid and / or upstream of the fourth nucleic acid. In some embodiments, the expression cassette or expression vector further comprises a constitutive promoter upstream of the first nucleic acid, upstream of the second nucleic acid, upstream of the third nucleic acid, and / or upstream of the fourth nucleic acid. In some embodiments, the expression vector is a non-viral vector.

[0270] In some embodiments, the expression cassette is a dual shRNA expression cassette. In some embodiments, the dual expression cassette includes, from 5' to 3', (1) a promoter (e.g., an EF1a promoter, e.g., SEQ ID NO: 132), (2) a 5' backbone of a first miR (e.g., a miR-3G 5' backbone), (3) a first strand of a first shRNA, (4) a loop of a first miR (e.g., a miR-3G loop), (5) a second strand of a first shRNA, (6) a 3' backbone of a first miR (e.g., a miR-3G 3' backbone), (7) a first spacer, (8) a 5' backbone of a second miR (e.g., a miR-E 5' backbone), (9) a first strand of a second shRNA, (10) a loop of a second miR (e.g., a miR-E loop), (11) a second strand of a second shRNA, and (12) a 3' backbone of a second miR (e.g., a miR-E (13) a second spacer, (14) a PPT sequence, (15) a 5' untranslated region (UTR), (16) an optional transgene (e.g., encoding a chimeric antigen receptor), and (17) a polyadenylation (polyA) sequence (e.g., a human growth hormone (GH1) polyA sequence, e.g., SEQ ID NO: 138). In some embodiments, the first and second miRs are identical. In some embodiments, the first miR is miR-3G and the second miR is miR-E ("3G-E format"). In some embodiments, the first and second miRs are different. In some embodiments, the dual expression cassette comprises a nucleic acid sequence set forth in SEQ ID NO: 133, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. An exemplary dual shRNA expression cassette is shown in Figure 26.

[0271] In some embodiments, the expression cassette is a triple shRNA expression cassette. In some embodiments, the triple expression cassette includes, from 5' to 3', (1) a promoter (e.g., an EF1a promoter, e.g., SEQ ID NO: 132), (2) a 5' backbone of a first miR (e.g., a miR-3G 5' backbone), (3) a first strand of a first shRNA, (4) a loop of a first miR (e.g., a miR-3G loop), (5) a second strand of a first shRNA, (6) a 3' backbone of a first miR (e.g., a miR-3G 3' backbone), (7) a first spacer, (8) a 5' backbone of a second miR (e.g., a miR-E 5' backbone), (9) a first strand of a second shRNA, (10) a loop of a second miR (e.g., a miR-E loop), (11) a second strand of a second shRNA, and (12) a 3' backbone of a second miR (e.g., a miR-E 3' backbone), (13) a second spacer, (14) a 5' backbone of the third miR (e.g., miR-3G 5' backbone), (15) a first strand of the third shRNA, (16) a loop of the third miR (e.g., miR-3G loop), (17) a second strand of the third shRNA, (18) a 3' backbone of the third miR (e.g., miR-3G 3' backbone), (19) a PPT sequence, (20) a 5' untranslated region (UTR), (21) an optional transgene (e.g., encoding a chimeric antigen receptor), and (22) a polyadenylation (polyA) sequence (e.g., a human growth hormone (GH1) polyA sequence, e.g., SEQ ID NO: 138). In some embodiments, the first, second, and third miRs are identical. In some embodiments, the first, second, and third miRs are all different. In some embodiments, the first and second miRs are identical and the third miR is different. In some embodiments, the first and third miRs are identical and the second miR is different. In some embodiments, the second and third miRs are identical and the first miR is different. In some embodiments, the first and third miRs are miR-3G and the second miR is miR-E ("3G-E-3G format"). In some embodiments, the first, second, and third miRs are all miR-3G ("3G-3G-3G format").In some embodiments, the triple expression cassette comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 134-136, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. In some embodiments, the triple expression cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 134, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. In some embodiments, the triple expression cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 135, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. In some embodiments, the triple expression cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 136, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. Exemplary triple shRNA expression cassettes are shown in Figures 27-29.

[0272] In some embodiments, the expression cassette is a quadruple shRNA expression cassette. In some embodiments, the quadruple expression cassette includes, from 5' to 3', (1) a promoter (e.g., an EF1a promoter, e.g., SEQ ID NO: 132), (2) a 5' backbone of a first miR (e.g., a miR-3G 5' backbone), (3) a first strand of a first shRNA, (4) a loop of a first miR (e.g., a miR-3G loop), (5) a second strand of a first shRNA, (6) a 3' backbone of a first miR (e.g., a miR-3G 3' backbone), (7) a first spacer, (8) a 5' backbone of a second miR (e.g., a miR-E 5' backbone), (9) a first strand of a second shRNA, (10) a loop of a second miR (e.g., a miR-E loop), (11) a second strand of a second shRNA, and (12) a 3' backbone of a second miR (e.g., a miR-E 3' backbone), (13) a second spacer, (14) a 5' backbone of the third miR (e.g., miR-3G 5' backbone), (15) a first strand of the third shRNA, (16) a loop of the third miR (e.g., miR-3G loop), (17) a second strand of the third shRNA, (18) a 3' backbone of the third miR (e.g., miR-3G 3' backbone), (19) a third spacer, (20) a 5' backbone of the fourth miR (e.g., miR-3G 5' backbone), (21) a first strand of the fourth shRNA, (22) a loop of the fourth miR (e.g., miR-3G loop), (23) a second strand of the fourth shRNA, (24) a 3' backbone of the fourth miR (e.g., miR-3G (25) a 3' backbone), (26) a PPT sequence, (27) a 5' untranslated region (UTR), (27) an optional transgene (e.g., a chimeric antigen receptor), and (28) a polyadenylation (polyA) sequence (e.g., a human growth hormone (GH1) polyA sequence, e.g., SEQ ID NO: 138). In some embodiments, the first, second, third, and fourth miRs are identical. In some embodiments, the first, second, third, and fourth miRs are all different. In some embodiments, two miRs in the first group are identical and two miRs in the second group are identical but different from the first group. In some embodiments, two miRs in the first group are identical and the remaining two miRs are each different from the first group and different from each other.In some embodiments, three of the miRs are identical and the final miR is different. In some embodiments, the first, third, and fourth miRs are miR-3G, and the second miR is miR-E ("3G-E-3G-3G format"). In some embodiments, the quadruple expression cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 137, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. An exemplary quadruple shRNA expression cassette is shown in Figure 30.

[0273] Recombinant cells Also provided herein are recombinant cells, such as primary cells or immune cells, that comprise at least one recombinant nucleic acid non-virally inserted into a target region of the genome of the cell.

[0274] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids at least 15 nucleotides in length that are complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:1.

[0275] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids at least 15 nucleotides in length that are complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2.

[0276] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids comprising a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence at least 15 nucleotides in length, wherein the second nucleic acid sequence is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2 or complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:1.

[0277] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids comprising a first nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:1.

[0278] In one aspect, provided herein is an immune cell comprising one or more recombinant nucleic acids comprising a first nucleic acid sequence and a second nucleic acid sequence at least 15 nucleotides in length that are complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2.

[0279] In some embodiments, the cells are primary immune cells. In some embodiments, the cells are viable virus-free primary cells.

[0280] In some embodiments, expression of a gene (e.g., TGFBR1, TGFBR2, FAS, PTPN2, and / or TOX) targeted by a recombinant nucleic acid molecule(s) is reduced or decreased in the target cell. Target gene expression may be reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more. Target gene expression may be reduced by about 10-50%, 10-20%, 10-30%, 10-40%, 20-50%, 30-50%, 40-50%, 10-100%, 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or the like, as compared to control cells that do not contain the recombinant nucleic acid molecule(s).

[0281] Cells containing recombinant nucleic acid molecule(s) insertions at the target locus or safe harbor site described in this disclosure may be referred to as engineered cells. In some embodiments, the engineered cells are immune cells. In some embodiments, the immune cells are any cells that can give rise to pluripotent immune cells. In some embodiments, the immune cells may be induced pluripotent stem cells (iPSCs) or human pluripotent stem cells (HSPCs). In some embodiments, the immune cells comprise primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, natural killer (NK) cells, T cells, CD8+ cells, CD4+ cells, or T cell precursors. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD8+ cells. + In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD4 + CD8 + T cells.

[0282] In some embodiments, the engineered cells are stem cells, human cells, primary cells, hematopoietic cells, adaptive immune cells, innate immune cells, T cells, or T cell precursor cells. Non-limiting examples of immune cells contemplated by the present disclosure include T cells, B cells, natural killer (NK) cells, NKT / iNKT cells, macrophages, myeloid cells, and dendritic cells. Non-limiting examples of stem cells contemplated by the present disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells (ntES; nuclear transfer ES), male germ cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem / progenitor stem cells (HSPCs), somatic cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells, and other stem cells, including bone cells, chondrocytes, myocytes, cardiomyocytes, neurons, tenocytes, adipocytes, pancreatic cells, hepatocytes, kidney cells, and follicular cells. In some embodiments, the engineered cells are T cells, NK cells, iPSCs, and HSPCs. In some embodiments, the engineered cells used in the present disclosure are human cell lines (e.g., intentionally immortalized cell lines, cancer cell lines, etc.) grown in vitro.

[0283] In some embodiments, the immune cells are autologous immune cells. In some embodiments, the immune cells are allogeneic immune cells.

[0284] Also provided herein are populations of cells comprising a plurality of engineered cells. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise at least one recombinant nucleic acid molecule. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise at least two shRNA molecules. In some embodiments, at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or more of the genomes of the cells comprise at least 3, 4, 5, 6, 7, 8, 9, 10 or more recombinant nucleic acid molecules.

[0285] Also provided herein are populations of cells comprising the recombinant nucleic acid(s).

[0286] The cells may further comprise a chimeric protein such as a chimeric antigen receptor (CAR) or a priming receptor. In some embodiments, the cells comprise at least one chimeric antigen receptor. In some embodiments, the cells comprise at least one priming receptor. In some embodiments, the cells comprise at least one chimeric antigen receptor and at least one priming receptor. At least one recombinant nucleic acid molecule encoding at least one RNAi molecule can be encoded on the same DNA template or nucleic acid fragment as the at least one RNAi molecule, or on a different DNA template or nucleic acid fragment from the RNAi molecule. When the CAR, priming receptor, and RNAi recombinant nucleic acid molecule are encoded on the same DNA template or nucleic acid fragment, the various components can be arranged on the DNA template in any order. For example, the DNA template can comprise, from 5' to 3', a CAR, at least one RNAi recombinant nucleic acid, and a priming receptor. Alternatively, the DNA template may comprise, from 5' to 3', i) a priming receptor, at least one RNAi recombinant nucleic acid, and a CAR; ii) at least one RNAi recombinant nucleic acid, a priming receptor, and a CAR; iii) at least one RNAi recombinant nucleic acid, a CAR, and a priming receptor; iv) a priming receptor, a CAR, and at least one RNAi recombinant nucleic acid; v) a CAR, a priming receptor, and at least one RNAi recombinant nucleic acid; vi) at least one RNAi recombinant nucleic acid, a priming receptor, and a CAR; or vii) at least one RNAi recombinant nucleic acid, a CAR, and a priming receptor. In some embodiments, the at least one RNAi recombinant nucleic acid comprises two recombinant nucleic acids. In some embodiments, the recombinant nucleic acid comprises a nucleic acid complementary to TGFBR1. In some embodiments, the recombinant nucleic acid comprises a nucleic acid complementary to TGFBR2. In some embodiments, the recombinant nucleic acid comprises a nucleic acid complementary to FAS. In some embodiments, the recombinant nucleic acid comprises a nucleic acid complementary to PTPN2. In some embodiments, the recombinant nucleic acid comprises a nucleic acid complementary to TOX.

[0287] In some embodiments, the priming receptor comprises a first extracellular antigen-binding domain that specifically binds a first antigen, and the chimeric antigen receptor (CAR) comprises a second extracellular antigen-binding domain that specifically binds a second antigen.

[0288] Methods for reducing gene expression Another aspect of the present invention provides a method for attenuating expression of a target gene in a mammalian cell, comprising introducing into the mammalian cell a recombinant nucleic acid complementary to the target gene mRNA, such as a single-stranded hairpin ribonucleic acid (shRNA), siRNA, dsRNA, or antisense oligonucleotide. In some embodiments, the recombinant nucleic acid complementary to the target gene mRNA is an shRNA. In some embodiments, the shRNA comprises a self-complementary sequence of 19 to 100 nucleotides that forms a duplex region, which hybridizes to the target gene mRNA transcript under intracellular conditions. In some embodiments, the shRNA comprises a 22-nt self-complementary sequence. In some embodiments, the shRNA (i) is a substrate for cleavage by RNase III enzyme to produce a double-stranded RNA product, (ii) does not result in general sequence-independent killing of mammalian cells, and (iii) reduces expression of the target gene in a manner dependent on the sequence of the complementary region.

[0289] In some embodiments, the target gene is TGFBR1. In some embodiments, the target gene is TGFBR2. In some embodiments, the target gene is human TGFBR1. In some embodiments, the target gene is human TGFBR2. In some embodiments, the target gene is FAS. In some embodiments, the target gene is human FAS. In some embodiments, the target gene is PTPN2. In some embodiments, the target gene is human PTPN2. In some embodiments, the target gene is TOX. In some embodiments, the target gene is human TOX.

[0290] Cells containing the recombinant nucleic acid can have reduced or diminished expression of a target gene selected from TGFBR1 and / or TGFBR2. In some embodiments, the cells have expression of TGFBR1 and / or TGFBR2 that is reduced by about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, or 50-55% compared to control cells that do not contain the respective recombinant nucleic acid molecule(s). In some embodiments, the cells have TGFBR1 expression in the cells that is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not comprise the recombinant nucleic acid molecule(s). In some embodiments, the cells have TGFBR2 expression in the cells that is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not comprise the recombinant nucleic acid molecule(s). In some embodiments, the cells have expression of TGFBR1 and TGFBR2 in immune cells that is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, respectively, compared to control cells that do not contain the respective recombinant nucleic acid molecule(s).

[0291] In some embodiments, expression of TGFBR2 in the cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid. In some embodiments, the second nucleic acid reduces expression of TGFBR1 in the cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid. In some embodiments, expression of TGFBR2 and TGFBR1 in the cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first or second nucleic acid.

[0292] Cells containing the recombinant nucleic acid can also have reduced or diminished expression of a target gene selected from the group consisting of FAS, PTPN2, and TOX. In some embodiments, the cells have expression of FAS, PTPN2, and / or TOX that is reduced by about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, or 50-55% compared to control cells that do not contain the recombinant nucleic acid molecule(s). In some embodiments, the cells have FAS expression in the cells that is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the recombinant nucleic acid molecule(s). In some embodiments, the cells have PTPN2 expression in the cells that is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not comprise the recombinant nucleic acid molecule(s). In some embodiments, the cells have TOX expression in immune cells that is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not comprise the recombinant nucleic acid molecule(s).

[0293] In some embodiments, expression of FAS in immune cells is reduced by at least 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the first nucleic acid. In some embodiments, the second nucleic acid reduces expression of PTPN2 in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid. In some embodiments, expression of PTPN2 in the cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0294] In some embodiments, the second nucleic acid reduces expression of TOX in immune cells by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid. In some embodiments, expression of TOX in cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the second nucleic acid.

[0295] In some embodiments, the expression of TGFBR1, TGFBR2, FAS, PTPN2, and / or TOX is determined by a nucleic acid assay or a protein assay, in some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0296] How to Treat Cancer In another aspect, the present invention provides a method for treating an immune-related condition or disease (e.g., cancer) in an individual, comprising administering to the individual an effective amount of a composition comprising cells containing at least one recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to a target selected from the group consisting of TGFBR1 and / or TGFRB2.

[0297] In some embodiments, the recombinant nucleic acid is an shRNA molecule. In some embodiments, the shRNA is a TGFBR1 shRNA molecule or a TGFBR2 shRNA. In some embodiments, the cell comprises at least a TGFBR2 shRNA molecule. In some embodiments, the cell comprises at least a TGFBR2 shRNA molecule. In some embodiments, the cell comprises at least two TGFBR2 shRNA molecules. In some embodiments, the cell comprises at least a TGFBR2 shRNA molecule and a TGFBR2 shRNA molecule.

[0298] In another aspect, the present invention provides a method for enhancing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising cells comprising at least one shRNA molecule, wherein the shRNA molecule is selected from the group consisting of a TGFBR2 shRNA molecule or a TGFBR1 shRNA molecule.

[0299] In some embodiments, the method of treating an individual or enhancing an immune response of an individual further comprises administering to the individual an effective amount of a composition comprising cells comprising at least one recombinant nucleic acid comprising a nucleic acid sequence of at least 15 nucleotides in length that is complementary to a target selected from the group consisting of TGFBR1 and / or TGFRB2.

[0300] In some embodiments, the recombinant nucleic acid is an shRNA molecule.

[0301] In some embodiments, the shRNA is selected from the group consisting of a FAS shRNA molecule, a PTPN2 shRNA molecule, and a TOX shRNA molecule. In some embodiments, a cell comprises at least a FAS shRNA molecule. In some embodiments, a cell comprises at least a PTPN2 shRNA molecule. In some embodiments, a cell comprises at least a TOX shRNA molecule. In some embodiments, a cell comprises at least a FAS shRNA molecule and a PTPN2 shRNA molecule. In some embodiments, a cell comprises at least a FAS shRNA molecule and a TOX shRNA molecule. In some embodiments, a cell comprises at least a PTPN2 shRNA molecule and a TOX shRNA molecule. In another aspect, the invention provides a method of enhancing an immune response in an individual, the method comprising administering to the individual an effective amount of a composition comprising cells comprising at least one shRNA molecule, wherein the shRNA molecule is selected from the group consisting of a FAS shRNA molecule, a PTPN2 shRNA molecule, and a TOX shRNA molecule. In some embodiments, the cells comprise at least a TGFBR2 shRNA molecule, a TGFBR2 shRNA molecule, a FAS shRNA molecule, a PTPN2 shRNA molecule, and / or a TOX shRNA molecule.

[0302] In some embodiments, the methods provided herein are useful for treating an immune-related condition in an individual. In certain embodiments, the individual is a human.

[0303] In some embodiments, the methods provided herein (e.g., methods of enhancing an immune response) are useful for treating cancer, and thus, an individual who receives a system described herein has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immune-evasive. In some embodiments, the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, pancreatic cancer, kidney cancer, lung cancer, prostate cancer, bladder cancer, breast cancer, brain cancer, leukemia, or lymphoma. In some embodiments, the cancer is ovarian cancer, kidney cancer, lung cancer, breast cancer, or prostate cancer.

[0304] In some embodiments, the treatment results in a decrease in cancer volume or size. In some embodiments, the treatment is effective in reducing cancer volume compared to the cancer volume before administration of the recombinant nucleic acid or recombinant cells. In some embodiments, the treatment results in a decrease in cancer growth rate. In some embodiments, the treatment is effective in reducing cancer growth rate compared to the cancer growth rate before administration of the recombinant cells. In some embodiments, the treatment is effective in eliminating the cancer.

[0305] Immunomodulatory methods The method of administering cells containing a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2 can result in modulation of the immune response. The modulation can be an increase or a decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.

[0306] The method of administering cells containing a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to FAS, PTPN2, and / or TOX can result in modulation of the immune response. The modulation can be an increase or a decrease in the immune response. In some embodiments, the modulation is an increase in the immune response.

[0307] In one aspect, administration of cells containing a system comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS, PTPN2, and / or TOX described herein can result in the induction of pro-inflammatory molecules, such as cytokines or chemokines. In some embodiments, the cytokine is IFNg. Generally, the induced pro-inflammatory molecules are present at levels greater than those achieved with an isotype control. Such pro-inflammatory molecules then lead to the activation of anti-tumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation. Thus, administration of a system comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS, PTPN2, and / or TOX can induce multiple anti-tumor immune mechanisms that result in tumor destruction.

[0308] In another aspect, provided herein are methods of increasing an immune response in an individual, the methods comprising administering to the individual an effective amount of cells comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2. In some embodiments, the method of increasing an immune response in a subject comprises administering to the subject cells comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2.

[0309] In another aspect, provided herein are methods of increasing an immune response in an individual, the methods comprising administering to the individual an effective amount of cells comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to FAS, PTPN2, and / or TOX. In some embodiments, the methods of increasing an immune response in a subject comprise administering to the subject cells comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to FAS, PTPN2, and / or TOX.

[0310] In some embodiments, the cells are present in a pharmaceutical composition that further comprises a pharmaceutically acceptable excipient.

[0311] In any aspect of increasing an immune response described herein, the increase, decrease, or alteration of any aspect of characteristic(s) or function(s) is compared to a cell that does not contain a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2.

[0312] Increasing an immune response can be both enhancing an immune response or inducing an immune response. For example, increasing an immune response includes both initiating or initiating an immune response or increasing or amplifying an ongoing or existing immune response. In some embodiments, the treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, the treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, the immune response is started or initiated by administration of a recombinant nucleic acid cell comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2. In some embodiments, the immune response is enhanced by administration of cells comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2.

[0313] In another aspect, the application provides a method of gene editing a cell with a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2, wherein the gene editing results in modulation of the immune function of the cell. The modulation can be an increased immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function results in activation of the cell comprising the recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to TGFBR1 and / or TGFBR2.

[0314] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell precursor.

[0315] In some embodiments, modulating the function of a cell comprising a recombinant nucleic acid(s) described herein results in an increase in the ability of the cell to stimulate both naive and activated T cells, for example, by increasing cytokine or chemokine secretion by the cell expressing the recombinant nucleic acid(s). In some embodiments, modulating the function enhances or increases the ability of the cell to produce a cytokine, chemokine, CAR, or costimulatory or activating receptor. In some embodiments, modulating increases a T cell stimulatory function of the cell expressing the recombinant nucleic acid(s), where T cell stimulatory function includes, for example, the ability of the cell to induce T cell receptor (TCR) signaling, T cell proliferation, or T cell cytokine production.

[0316] In some embodiments, the increased immune response is secretion of cytokines and chemokines, hi some embodiments, the recombinant nucleic acid(s) induce increased expression of at least one cytokine or chemokine in the cells compared to isotype control cells.

[0317] In some embodiments, the enhanced immune response is anti-tumor immune cell recruitment and activation.

[0318] In some embodiments, cells expressing the recombinant nucleic acid(s) induce a memory immune response compared to isotype control cells. Generally, a memory immune response is a protective immune response upon subsequent exposure to a pathogen or antigen previously encountered by the immune system. Exemplary memory immune responses include immune responses following infection or vaccination with an antigen. Generally, memory immune responses are mediated by lymphocytes, e.g., T cells or B cells. In some embodiments, a memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, a memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.

[0319] How to edit cells The term "gene editing" or "genome editing," as used herein, refers to a type of genetic manipulation in which DNA is inserted into, replaced, or removed from a genome using engineered nucleases or "molecular scissors." This is a useful tool for elucidating the function and effects of sequence-specific genes or proteins or for modifying cellular behavior (e.g., for therapeutic purposes).

[0320] Currently available genome editing tools include zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) for integrating genes into safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). The DICE (dual integrase cassette exchange) system, which utilizes phiC31 integrase and Bxb1 integrase, is a tool for targeted integration. Additionally, clustered regularly interspaced short palindromic repeats / Cas9 (CRISPR / Cas9) technology can be used for targeted gene insertion.

[0321] Site-specific gene editing approaches can include homology-dependent or homology-independent mechanisms.

[0322] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein for inserting constructs into gene target or safe harbor loci.

[0323] Provided herein is a method for inserting one or more recombinant RNAi nucleic acids without the presence of a viral vector.In some embodiments, one or more recombinant nucleic acids can be inserted into the genome of primary immune cells without the presence of a viral vector.

[0324] Described herein are methods and compositions for achieving integration of nucleotide sequences encoding one or more recombinant nucleic acids into the genome of a cell, some of which improve integration efficiency, reduce off-target effects, and / or reduce loss of cell viability.

[0325] A plasmid encoding one or more recombinant nucleic acids is introduced into immune cells using a nuclease, such as a CRISPR-associated system (Cas). The nuclease can be introduced in a ribonucleoprotein format by a guide RNA (gRNA) that targets a specific site on the genome of the immune cell. The nuclease cuts the genomic DNA at this specific site. The specific site can be a portion of the genome that encodes an endogenous immune cell receptor. Therefore, by cutting the genome at this site, the immune cell no longer expresses the endogenous immune cell receptor.

[0326] The plasmid may contain 5' and 3' homology-directed repair arms that are complementary to sequences at specific sites on the genome of immune cells. The complementary sequences are on either side of the site cleaved by the nuclease, allowing the plasmid to be integrated into the designated insertion site on the genome of immune cells. Once the plasmid is integrated, the cells express the shRNA.

[0327] First, immune cells such as T cells are activated. The immune cells can be obtained from a patient. Thus, the present disclosure provides a method in which immune cells such as T cells are harvested from a patient. Then, a plasmid encoding one or more recombinant nucleic acids is introduced into the T cells. Advantageously, the plasmids of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, a nuclease can also be introduced. By using electroporation, the method of the present disclosure avoids the use of viral vectors to introduce transgenes, which is a known bottleneck in immune cell engineering. The immune cells are then expanded and co-cultured to generate a sufficient amount of engineered immune cells for use as a therapeutic treatment.

[0328] A method for editing the genome of a cell can include: a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex comprising: (i) an RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the 5' and 3' ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences adjacent to the insertion site, and wherein the molar ratio of RNP to DNA template in the complex is from about 3:1 to about 100:1; and b) introducing the RNP-DNA template complex into the cell.

[0329] In some embodiments, the methods described herein provide an efficiency of delivery of RNP-DNA template complexes of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the efficiency is determined in terms of cells that are viable after introducing the RNP-DNA template into cells. In some cases, the efficiency is determined in terms of the total number of cells (viable or nonviable) into which the RNP-DNA template is introduced.

[0330] As another example, delivery efficiency can be determined by quantifying the number of genome-edited cells within a population of cells (compared to the total cells or total viable cells obtained after the introduction step). Various methods for quantifying genome editing are available. These methods include, but are not limited to, the use of mismatch-specific nucleases such as T7 endonuclease I, sequencing of one or more target loci (e.g., by Sanger sequencing of cloned target locus amplified fragments), and high-throughput large-scale sequencing.

[0331] In some embodiments, the loss of cell viability is reduced compared to the loss of cell viability after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these. In some embodiments, the off-target effects of integration are reduced compared to off-target integration after naked DNA is introduced into cells or after DNA is introduced into cells using a viral vector. The reduction can be at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or any percentage between these.

[0332] In some cases, the methods described herein provide high cell viability of cells into which the RNP-DNA template has been introduced, in some cases, the viability of cells into which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or more. In some cases, the viability of cells into which the RNP-DNA template has been introduced is about 20% to about 99%, about 30% to about 90%, about 35% to about 85% or 90% or more, about 40% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 50% to about 85% or 90% or more, about 60% to about 85% or 90% or more, or about 70% to about 85% or 90% or more.

[0333] In the methods provided herein, the molar ratio of RNP to DNA template can be from about 3:1 to about 100:1. For example, the molar ratio can be from about 5:1 to about 10:1, from about 5:1 to about 15:1, from 5:1 to about 20:1, from 5:1 to about 25:1, from about 8:1 to about 12:1, from about 8:1 to about 15:1, from about 8:1 to about 20:1, or from about 8:1 to about 25:1.

[0334] In some embodiments, the DNA template has a concentration of about 2.5 pM to about 25 pM. For example, the DNA template concentration can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM, or any concentration therebetween.

[0335] In some embodiments, the amount of DNA template can be about 1 μg to about 10 μg. For example, the amount of DNA template can be about 1 μg to about 2 μg, about 1 μg to about 3 μg, about 1 μg to about 4 μg, about 1 μg to about 5 μg, about 1 μg to about 6 μg, about 1 μg to about 7 μg, about 1 μg to about 8 μg, about 1 μg to about 9 μg, or about 1 μg to about 10 μg. In some embodiments, the amount of DNA template is about 2 μg to about 3 μg, about 2 μg to about 4 μg, about 2 μg to about 5 μg, about 2 μg to about 6 μg, about 2 μg to about 7 μg, about 2 μg to about 8 μg, about 2 μg to about 9 μg, or 2 μg to about 10 μg. In some embodiments, the amount of DNA template is about 3 μg to about 4 μg, about 3 μg to about 5 μg, about 3 μg to about 6 μg, about 3 μg to about 7 μg, about 3 μg to about 8 μg, about 3 μg to about 9 μg, or about 3 μg to about 10 μg. In some embodiments, the amount of DNA template is about 4 μg to about 5 μg, about 4 μg to about 6 μg, about 4 μg to about 7 μg, about 4 μg to about 8 μg, about 4 μg to about 9 μg, or about 4 μg to about 10 μg. In some embodiments, the amount of DNA template is about 5 μg to about 6 μg, about 5 μg to about 7 μg, about 5 μg to about 8 μg, about 5 μg to about 9 μg, or about 5 μg to about 10 μg. In some embodiments, the amount of DNA template is about 6 μg to about 7 μg, about 6 μg to about 8 μg, about 6 μg to about 9 μg, or about 6 μg to about 10 μg. In some embodiments, the amount of DNA template is about 7 μg to about 8 μg, about 7 μg to about 9 μg, or about 7 μg to about 10 μg. In some embodiments, the amount of DNA template is about 8 μg to about 9 μg, or about 8 μg to about 10 μg. In some embodiments, the amount of DNA template is about 9 μg to about 10 μg.

[0336] In some embodiments, the DNA template encodes an shRNA molecule or a fragment thereof. In some embodiments, the DNA template encodes at least one shRNA molecule. In some embodiments, the DNA template encodes at least two shRNA molecules. In some embodiments, the DNA template encodes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more shRNA molecules.

[0337] In some embodiments, the DNA template comprises regulatory sequences, such as promoter and / or enhancer sequences, for regulating expression of the heterologous protein or fragment thereof after insertion into the genome of the cell.

[0338] In some cases, the DNA template is a linear DNA template. In some cases, the DNA template is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, "pure single-stranded DNA" refers to single-stranded DNA that is substantially devoid of other strands or opposite strands of DNA. "Substantially devoid" means that the pure single-stranded DNA is devoid of one DNA strand at least 100 times more than another DNA strand.

[0339] In some cases, the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about 1 minute to about 30 minutes at a temperature of about 20° C. to about 25° C. For example, the RNP can be incubated with the DNA template at a temperature of about 20° C., 21° C., 22° C., 23° C., 24° C., or 25° C. for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes, 30 minutes, or any amount of time therebetween. In another example, the RNP can be incubated with the DNA template at a temperature of about 20° C. to about 25° C. for about less than 1 minute to about 1 minute, about less than 1 minute to about 5 minutes, about less than 1 minute to about 10 minutes, about 5 to 10 minutes, about 5 to 15 minutes, about 10 to about 15 minutes, about 10 to about 20 minutes, or about 10 to about 30 minutes. In some embodiments, the RNP-DNA template complex and cells are mixed before introducing the RNP-DNA template complex into the cells.

[0340] In some embodiments, introducing the RNP-DNA template complex comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in the Examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in WO / 2006 / 001614 or Kim, JA et al. Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce the RNP-DNA template complex can include those described in U.S. Patent Application Publication Nos. 2006 / 0094095, 2005 / 0064596, or 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Li, L. Het al. Cancer Res. Treat. 1, 341-350 (2002), U.S. Patent Nos. 6,773,669, 7,186,559, 7,771,984, 7,991,559, 6485961, 7029916, and U.S. Patent Application Publication Nos. 2014 / 0017213 and 2012 / 0088842, all of which are incorporated herein by reference. Additional or alternative methods, compositions, and devices for electroporating cells to introduce RNP-DNA template complexes can include those described in Geng, T. et al., J. Control Release 144, 91-100 (2010), and Wang, J., et al. Lab. Chip 10, 2057-2061 (2010), all of which are incorporated herein by reference.

[0341] In some embodiments, the Cas9 protein can be in an active endonuclease form so that when it binds to a target nucleic acid as part of a complex with a guide RNA or a DNA template, a double-strand break is introduced into the target nucleic acid. The double-strand break can be repaired by NHEJ to introduce random mutations, or by HDR to introduce specific mutations. Various Cas9 nucleases can be used in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3' of the region targeted by the guide RNA can be used. Such a Cas9 nuclease can target any region of the genome that contains an NGG sequence. As another example, a Cas9 protein with an orthogonal PAM motif requirement can be used to target a sequence that does not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificity include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015 (both of which are incorporated herein by reference).

[0342] In some cases, Cas9 protein is a nickase, so that when it binds to target nucleic acid as part of a complex with guide RNA, it introduces single-strand breaks or nicks into target nucleic acid.A pair of Cas9 nickases, each of which is bound to structurally different guide RNAs, can target two adjacent sites in the target genome region, and thus introduce a pair of adjacent single-strand breaks into the target genome region.Nickase pairs can increase specificity because off-target effects are more likely to result in a single nick, which is generally repaired without lesions by base excision repair mechanisms.Exemplary Cas9 nickases include Cas9 nucleases with D10A or H840A mutations.

[0343] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP-DNA template complex comprises at least two structurally distinct RNP complexes. In some embodiments, the at least two structurally distinct RNP complexes contain structurally distinct Cas9 nuclease domains. In some embodiments, the at least two structurally distinct RNP complexes contain structurally distinct guide RNAs. In some embodiments, where the at least two structurally distinct RNP complexes contain structurally distinct guide RNAs, each of the structurally distinct RNP complexes comprises a Cas9 nickase, and the structurally distinct guide RNAs hybridize to opposite strands of the target region.

[0344] In some cases, multiple RNP-DNA templates containing structurally distinct ribonucleoprotein complexes are introduced into cells. For example, a Cas9 protein can be complexed with multiple (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) structurally distinct guide RNAs to target insertion of the DNA templates at multiple structurally distinct target genomic regions.

[0345] In the methods and compositions provided herein, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells, etc. Optionally, the cells are mammalian cells, e.g., human cells. The cells can be in vitro, ex vivo, or in vivo. The cells can also be primary cells, germ cells, stem cells, or progenitor cells. Progenitor cells can be, for example, pluripotent stem cells or hematopoietic stem cells. In some embodiments, the cells are primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, the primary hematopoietic cells are immune cells. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD4 + In some embodiments, the T cells are CD8 + In some embodiments, the T cells are CD4 + CD8 + In some embodiments, the T cells are CD4 - CD8 - The modified cells are T cells. Also provided are any populations of cells modified by any of the methods described herein. In some embodiments, the method further comprises expanding the population of modified cells.

[0346] In some cases, cells are removed from a subject, modified using any of the methods described herein, and administered to the patient. In other cases, any of the constructs described herein are delivered to the patient in vivo. See, e.g., U.S. Patent No. 9,737,604 and Zhang et al., "Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy," NPG Asia Materials Volume 9, page e441 (2017) (both incorporated herein by reference).

[0347] In some embodiments, the RNP-DNA template complex is about 1×10 5 ~Approx. 2×10 6 For example, the RNP-DNA template complex is introduced into cells at approximately 1 × 10 5 ~Approx. 5×10 5 cells, approximately 1 x 10 5 ~Approx. 1×10 6 , 1×10 5 ~Approx. 1.5×10 6 , 1×10 5 ~Approx. 2×10 6 , about 1×10 6 ~Approx. 1.5×10 6 cells or approximately 1 x 10 6 ~Approx. 2×10 6 can be introduced into

[0348] In some cases, the methods and compositions described herein can be used to generate, modify, use, or control recombinant immune cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, infectious disease, or autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked into T cells to express a heterologous protein (e.g., a chimeric antigen receptor (CAR) or a priming receptor).

[0349] Insertion site Methods for editing the genome of an immune cell include methods for editing the genome of a human T cell, comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-α subunit (TRAC) in a human immune cell. In some embodiments, the target region is in exon 1 of the constant domain of the TRAC gene. In other embodiments, the target region is in exon 1, exon 2, or exon 3, prior to the start of the sequence encoding the TCR-α transmembrane domain.

[0350] The method for editing the genome of an immune cell also includes a method for editing the genome of a human immune cell, comprising inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-β subunit (TRBC) in a human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.

[0351] Methods for editing the genome of immune cells specifically include methods for editing the genome of human immune cells, comprising inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0352] Methods for editing the genome of a T cell also include methods of editing the genome of a human T cell comprising inserting a nucleic acid sequence or construct into the GS94 target region (locus chr11:128340000-128350000).

[0353] In some embodiments, the target region is the GS94 locus.

[0354] Gene editing therapies include, for example, vector integration and site-specific integration. Site-specific integration is a promising alternative to random integration of viral vectors because it reduces the risk of insertional mutagenesis or insertional carcinogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus et al. Nat Biotechnol. 2005 23:967-973; Paques et al. Curr Gen Ther. 2007 7:49-66). However, site-specific integration continues to face challenges, such as low knock-in efficiency, risk of insertional carcinogenesis, unstable and / or abnormal expression of adjacent genes or transgenes, and low accessibility (e.g., within 20 kB of adjacent genes). These challenges can be addressed, in part, by identifying and using safe harbor loci or safe harbor sites (SHSs), which are sites where genes or genetic elements can be integrated without disrupting the expression or regulation of adjacent genes.

[0355] The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was originally identified as a site for recurrent adeno-associated virus insertion. Other potential SHSs have been identified based on homology to sites originally identified in other species (e.g., the human homolog of the permissive mouse Rosa26 locus) or in an increasing number of human genes that appear non-essential under some circumstances. One putative SHS of this type is the CCR5 chemokine receptor gene, whose disruption confers resistance to human immunodeficiency virus infection. Additional potential genomic SHSs have been identified in humans and other cell types based on viral integration site mapping or gene trap analysis, similar to the original mouse Rosa26 locus. The top three SHSs, AAVS1, CCR5, and Rosa26, are located near many protein-coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbors for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosure of which is incorporated herein by reference in its entirety.)

[0356] AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g., DNA transgenes) with expected functions. It is located at position 19q13.42. It has an open chromatin structure and is transcriptionally competent. The canonical SHS locus for AAVS1 is chr19:55, 625, 241 to 55, 629, 351. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference). Exemplary AAVS1-targeting gRNAs and target sequences are provided below. AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT ●AAVS1 target sequence: ggggccactagggacaggat

[0357] CCR5, located on chromosome 3 at position 3p21.31, encodes the primary co-receptor for HIV-1. Disruption of this site in the CCR5 gene is beneficial in HIV / AIDS treatment and has prompted the development of zinc finger nucleases targeting its third exon. The canonical SHS locus for CCR5 is chr3:46, 414, 443 to 46, 414, 942. See Pellenz et al., "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion," Human Gene Therapy, Vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference).

[0358] The mouse Rosa26 locus is particularly useful for genetic modification because it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 (“Identification and targeting of the ROSA26 locus in human embryonic stem cells.” Nature biotechnology 25.12(2007):1477-1482, the relevant disclosure of which is incorporated herein by reference, identified the human homolog, human ROSA26, on chromosome 3 (position 3p25.3). The canonical SHS locus for human Rosa26 (hRosa26) is chr3:9,415,082-9,414,043. See Pellenz et al. “New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7(2019):814-828, the relevant disclosure of which is incorporated herein by reference.

[0359] Additional examples of safe harbor sites are provided in Pellenz et al. "New Human Chromosomal Sites with 'Safe Harbor' Potential for Targeted Transgene Insertion." Human gene therapy vol. 30, 7 (2019): 814-828 (the relevant disclosure of which is incorporated herein by reference). Additional examples of integration sites are provided in Table 1.

[0360] In some embodiments, safe harbor sites allow for high transgene expression (sufficient to enable transgene functionality or treatment of the disease of interest) and stable expression of the transgene over days, weeks, or months. In some embodiments, knockout of the gene at the safe harbor locus confers a benefit to cellular function, or the gene at the safe harbor locus has no known function in the cell. In some embodiments, the safe harbor locus results in stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage compared to other loci detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and is located outside of cancer-associated genes.

[0361] When used, "neighboring genes" can refer to genes that are within about 100 kB, about 125 kB, about 150 kB, about 175 kB, about 200 kB, about 225 kB, about 250 kB, about 275 kB, about 300 kB, about 325 kB, about 350 kB, about 375 kB, about 400 kB, about 425 kB, about 450 kB, about 475 kB, about 500 kB, about 525 kB, or about 550 kB of the safe harbor locus (integration site).

[0362] In some embodiments, the present disclosure contemplates nucleic acid inserts containing one or more recombinant RNAi nucleic acids, such as at least one shRNA molecule. The incorporation of one or more recombinant RNAi nucleic acids can result in, for example, improved therapeutic properties. These enhanced therapeutic properties, as used herein, refer to enhanced therapeutic properties of cells compared to typical immune cells of the same normal cell type. For example, NK cells with "enhanced therapeutic properties" have enhanced, improved, and / or increased therapeutic outcomes compared to typical, unmodified, and / or naturally occurring NK cells. Therapeutic properties of immune cells may include, but are not limited to, cell engraftment, trafficking, homing, viability, self-renewal, persistence, immune response control and modulation, survival, and cytotoxicity. Therapeutic properties of immune cells may also be manifested by the expression of antigen-targeting receptors, HLA presentation or lack thereof, tolerance to the tumor microenvironment, induction and immunomodulation of bystander immune cells, improved target specificity through reduction, and resistance to treatments such as chemotherapy.

[0363] As used herein, "insert size" refers to the length of the nucleotide sequence to be integrated (inserted) into the target locus or safe harbor site.

[0364] An insert, as used herein, refers to a nucleic acid molecule or polynucleotide inserted into a target locus or safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises smaller fragments of DNA, such as plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, fosmid, cosmid, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC), and / or any other subgenomic segment of DNA. Nucleotides in the insert are contemplated as naturally occurring nucleotides, non-naturally occurring nucleotides, and modified nucleotides. Nucleotides may be chemically or biochemically modified or contain non-natural or derivatized nucleotide bases, as will be readily understood by those skilled in the art. Such modifications include, for example, labeling, methylation, substitution of one or more naturally occurring nucleotides with an analog, and internucleotide modifications. Polynucleotides can be in any topological conformation, including single-stranded, double-stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimensional conformations contemplated in the art.

[0365] The insert can have coding and / or non-coding regions. The insert can include non-coding sequences (e.g., regulatory elements, e.g., promoter sequences). In some embodiments, the insert encodes one or more recombinant RNAi nucleic acids.

[0366] In some embodiments, nucleic acid sequences are inserted into the genome of immune cells via non-viral delivery.In non-viral delivery methods, nucleic acids can be naked DNA or can be in non-viral plasmids or vectors.Non-viral delivery techniques can be site-specific integration techniques described herein or known to those skilled in the art.Examples of site-specific techniques for integration into safe harbor loci include, but are not limited to, homology-dependent manipulation using nucleases and homology-independent targeted insertion using Cas9 or other CRISPR endonucleases.

[0367] In some embodiments, an insert is integrated into a safe harbor site by introducing into the engineered cell (a) a targeting nuclease that cleaves a target region of the safe harbor site to create an insertion site, and (b) a nucleic acid sequence (the insert), where the insert is integrated into the insertion site, for example, by HDR. Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in U.S. Application Nos. 16 / 568,116 and 16 / 622,843, the relevant disclosures of which are incorporated herein by reference in their entireties.

[0368] Examples of contemplated integration sites are provided in Table D. [Table D] TIFF2025530328000003.tif132165TIFF2025530328000004.tif132165TIFF2025530328000005.tif130165TIFF20255303280 00006.tif153165TIFF2025530328000007.tif192165TIFF2025530328000008.tif177165TIFF2025530328000009.tif200165

[0369] CRISPR-Cas editing One effective example of gene editing is the CRISPR-Cas approach (e.g., CRISPR-Cas9), which incorporates the use of a guide polynucleotide (e.g., a guide ribonucleic acid or gRNA) and a Cas endonuclease (e.g., Cas9 endonuclease).

[0370] As used herein, a polypeptide referred to as a "Cas endonuclease" or having "Cas endonuclease activity" refers to a CRISPR-associated (Cas) polypeptide encoded by a Cas gene, which is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., U.S. Patent No. 8,697,359). This definition also includes variants of Cas endonucleases that retain guide polynucleotide-dependent endonuclease activity. The Cas endonucleases used in the donor DNA insertion methods detailed herein are endonucleases that introduce double-strand breaks in DNA at target sites (e.g., within a target locus or at a safe harbor site).

[0371] As used herein, the term "guide polynucleotide" refers to a polynucleotide sequence that can complex with a Cas endonuclease and enable the Cas endonuclease to recognize and cleave a DNA target site. A guide polynucleotide can be a single molecule or a double molecule. A guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). A guide polynucleotide that contains only ribonucleic acid is also referred to as a "guide RNA." In some embodiments, a polynucleotide donor construct is inserted into a safe harbor locus using a guide RNA (gRNA) in combination with a Cas endonuclease (e.g., Cas9 endonuclease).

[0372] The guide polynucleotide comprises a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide sequence that interacts with a Cas endonuclease polypeptide. The guide polynucleotide may be a duplex molecule (also referred to as a double-stranded guide polynucleotide) that comprises a sequence domain (also referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this duplex guide polynucleotide comprises two separate molecules that hybridize along complementary regions. The two separate molecules may be RNA sequences, DNA sequences, and / or RNA-DNA combination sequences.

[0373] Genome editing using the CRISPR-Cas approach relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by RNA-guided Cas endonucleases (e.g., Cas9 endonuclease). Homology-directed repair (HDR) of these DSBs allows for precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions. Conventional HDR-based CRISPR / Cas9 genome editing involves transfecting cells with Cas9, gRNA, and donor DNA containing homologous arms matching the locus of interest.

[0374] HITI (homology-independent targeted insertion) uses a homology-independent strategy based on non-homologous end joining (NHEJ), which can be more efficient than HDR. A guide RNA (gRNA) targets the insertion site. For HITI, the donor plasmid lacks homology arms, and DSB repair does not occur via the HDR pathway. The donor polynucleotide construct can be engineered to contain Cas9 cleavage site(s) adjacent to the gene or sequence to be inserted. This results in Cas9 cleavage in both the donor plasmid and the genomic target sequence. Both the target and donor have blunt ends, and the linearized donor DNA plasmid is used by the NHEJ pathway, which leads to integration into the genomic DSB site. (See, e.g., Suzuki, K., et al. (2016). In vivo genome editing via CRISPR / Cas9 mediated homology-independent targeted integration. Nature, 540(7631), 144-149, the relevant disclosure of which is incorporated herein in its entirety.)

[0375] Methods for gene editing using CRISPR-Cas approaches are known to those skilled in the art. (See, e.g., U.S. Application Nos. US16 / 312,676, US15 / 303,722, and US15 / 628,533, the disclosures of which are incorporated herein by reference in their entireties.) Additionally, the use of endonucleases to insert transgenes into safe harbor loci is described, for example, in U.S. Application No. 13 / 036,343, the disclosure of which is incorporated herein by reference in its entirety.

[0376] The guide RNA and / or mRNA (or DNA) encoding the endonuclease can be chemically conjugated to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Non-limiting examples of such moieties include cholesterol moieties, cholic acid, thioethers, thiocholesterol, aliphatic chains (e.g., dodecanediol or undecyl residues), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-3-H-phosphonate, polyamine or polyethylene glycol chains, adamantane acetic acid, palmityl moieties, and lipid moieties such as octadecylamine or hexylamino-carbonyl-t-oxycholesterol moieties. See, e.g., U.S. Patent Publication No. 20180127786, the disclosure of which is incorporated herein by reference in its entirety.

[0377] therapeutic use For therapeutic applications, the engineered cells, populations thereof, or compositions thereof are administered to a subject, generally a mammal, generally a human, in an effective amount.

[0378] The engineered cells can be administered to a subject by infusion (eg, continuous infusion over a period of time) or other modes of administration known to those of skill in the art.

[0379] The engineered cells provided herein find use in gene therapy as well as non-pharmaceutical uses, such as, for example, the production of animal models and the production of recombinant cell lines expressing a recombinant nucleic acid of interest.

[0380] The engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell, that has been modified by incorporating a transgene into a safe harbor locus as described herein. Exemplary cells are provided in the recombinant cell section.

[0381] The engineered cells, compositions, and methods of the present disclosure are useful for therapeutic applications in immunotherapy or T cell therapy. In some embodiments, insertion of a sequence encoding an shRNA molecule within a safe harbor locus maintains TCR expression relative to the absence of the insertion, allowing transgene expression while maintaining TCR function.

[0382] In some embodiments, the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein. In some embodiments, administration of the engineered cell composition results in a desired pharmacological and / or physiological effect. This effect can be a partial or complete cure of the disease and / or adverse effects resulting from the disease. In some embodiments, treatment includes any treatment of a disease in a subject (e.g., a mammal, e.g., a human). Additionally, treatment can stabilize or reduce undesirable clinical symptoms in a subject (e.g., a patient). The cells, populations thereof, or compositions thereof provided herein can be administered during or after the onset of a disease.

[0383] In certain embodiments, a subject has a disease, condition, and / or injury that can be treated and / or ameliorated by cell therapy. In some embodiments, a subject in need of cell therapy is a subject with an injury, disease, or condition that triggers cell therapy (e.g., therapy in which cellular material is administered to the subject). However, it is contemplated that the severity of at least one symptom associated with the injury, disease, or condition can be treated, ameliorated, and / or reduced.

[0384] Method of administration An effective amount of the immune cells comprising the system can be administered for the treatment of cancer. The appropriate dosage of the immune cells comprising the system can be determined based on the type of cancer being treated, the type of immune cells comprising the system, the severity and course of the cancer, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0385] Pharmaceutical Compositions The engineered recombinant cells or recombinant nucleic acids provided herein can be administered as part of a pharmaceutical composition. These compositions can contain, in addition to one or more of the recombinant cells, pharmaceutically acceptable excipients, carriers, buffers, stabilizers, or other materials known to those of skill in the art. Such materials should be non-toxic and not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material may depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, or intraperitoneal. Pharmaceutical compositions can contain one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and those of skill in the art can select a suitable pharmaceutical excipient. Therefore, the pharmaceutical excipients provided below are intended to be exemplary and not limiting. Additional pharmaceutical excipients include, for example, those described in Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6th Ed. (2009), incorporated by reference in its entirety.

[0386] Various modes of administering the additional therapeutic agent are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration.

[0387] The compositions can be administered alone or in combination with other treatments, either simultaneously or sequentially, depending on the condition to be treated.

[0388] Kits and Products The present application provides kits comprising any one or more of the recombinant nucleic acid or cell compositions described herein and instructions for use. The instructions may be present in the kit as a package insert, on a label on the container of the kit or its components, or in digital form (e.g., on a CD-ROM or via an internet link). The kit may include one or more of a genome-targeting nucleic acid, a polynucleotide encoding the genome-targeting nucleic acid, a site-directed polypeptide, and / or a polynucleotide encoding the site-directed polypeptide. Additional components in the kit, such as buffers (reconstitution buffer, stabilization buffer, dilution buffer, etc.), and / or one or more control vectors, are also contemplated.

[0389] In some embodiments, the kit further contains a component selected from any of a secondary antibody, a reagent for immunohistochemistry, a pharmaceutically acceptable excipient, and instructions, and any combination thereof. In a specific embodiment, the kit includes a pharmaceutical composition comprising any one or more of the recombinant nucleic acid or cell compositions described herein and one or more pharmaceutically acceptable excipients.

[0390] The present application also provides an article of manufacture comprising any one of the recombinant nucleic acid or cell compositions or kits described herein. An example of an article of manufacture is a vial (including a sealed vial). [Example]

[0391] Below are examples of specific embodiments for carrying out the present invention. The examples are provided for illustrative purposes only and are not intended to limit the scope of the present disclosure in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0392] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques, and pharmacology, within the skill of the art. Such techniques are fully explained in the literature, e.g., T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3 rd Ed. (Plenum Press) Vols A and B (1992).

[0393] Example 1: Characterization of TGFRB1 and TGFRB2 shRNAs in vitro material T cell generation: Engineered T cells were generated using CITE non-viral gene delivery. Briefly, pan-T cells were isolated from healthy human donors using the Miltenyi StraightFrom® Leukopak® CD4 / CD8 MicroBead Kit. Isolated T cells were stimulated with anti-CD3 / anti-CD28 beads. Two days after stimulation, cells were resuspended in a solution containing S. pyogenes Cas9 complexed with the GS94 guide RNA and a donor DNA template encoding the transgene of interest. Cells were then electroporated using a Lonza 4-D Nucleofector and harvested in fresh medium supplemented with IL-7 and IL-15. Cells were counted, and fresh medium was added every 2–3 days after electroporation. All constructs tested encoded a logic gate expressing the PrimeR receptor for ALPG and a CAR targeting MSLN. An exemplary construct format is shown in Figure 1A. The shRNA cassette encoded in the cassette was variable between constructs. T cells expressing the ALPG / MSLN logic gate and shRNA cassette are referred to as integrated circuit T cells (ICTs). The shRNAs used in the cassette targeted TGFBR1, TGFBR2, FAS, and / or PTPN2. Thirty-seven single candidate shRNAs targeting TGFBR2 were screened for their ability to reduce TGFBR2 surface expression. Dual shRNA cassettes contained an shRNA targeting TGFBR1 and an shRNA targeting TGFBR2 or two shRNAs targeting TGFBR2. "Quad" shRNA cassettes were created by combining TGFBR1 / TGFBR2 or TGFBR2 / TGFBR2 shRNAs in combination with shRNAs targeting FAS and PTPN2. "Triple" shRNA cassettes were created by combining a TGFBR2 shRNA in combination with shRNAs targeting FAS and PTPN2.

[0394] Repeated stimulation assay and flow cytometry using K562 tumor cells: Five days after electroporation, edited cells were enriched for Myc+ cells via positive selection using beads (the Myc tag was expressed on the priming receptor). T cells were co-cultured with K562 tumor cells engineered to express ALPG and MSLN at a 2:1 effector:target ratio in plain medium or medium containing 10 ng / mL TGFβ1 for 6 days. Three days after the first stimulation, T cells and tumors were quantified by flow cytometry, and T cells were normalized to a defined concentration and restimulated at a 2:1 E:T ratio with or without added TGFβ1. On day 6, cells were harvested and flow cytometry was performed to assess FAS, CD103 expression, and the number of viable tumor cells (Figures 1C, 2A, and 2B).

[0395] Longitudinal repeated stimulation assay and flow cytometry using K562 tumor cells Four days after electroporation, edited cells were enriched through positive selection for Myc+ cells using beads. T cells were co-cultured with K562 tumor cells engineered to express ALPG and MSLN at a 2:1 effector:target ratio in plain medium or medium containing 10 ng / mL TGFβ1. T cells and tumors were quantified by flow cytometry every 2–3 days. At each time point, T cells were normalized to a defined concentration and restimulated at a 2:1 E:T ratio with or without added TGFβ1. A total of six stimulations were performed over 14 days. The frequency of CD103+ T cells (Figure 5A) and PD-1+ T cells (Figure 5B) in the +TGFβ1 condition was quantified longitudinally by flow cytometry.

[0396] Co-culture with RPMI-8226 tumor cells and flow cytometry: The cells isolated as described above were co-cultured with RPMI-8226 tumor cells at an E:T ratio of 1:2.5 in the presence or absence of 10 ng / mL of exogenous TGFb1 for 6 days. On day 6, cells were harvested and flow cytometry was performed to assess CD103 expression.

[0397] Edited logic-gated T cells were co-cultured with K562 target cells in the absence or presence of TGF-β1 for 14 days. Surface expression of CD103 and PD1 was measured by flow cytometry. AUC / ΔAUC (10 ng / mL TGF-β1 vs. 0) was calculated for CD103 and PD1 at stimulations 2–6.

[0398] Validation of shRNA target knockdown by MULTI-Seq: At the end of a 14-day repeated stimulation assay (RSA) performed in the presence or absence of TGFβ, cells were harvested and processed for MULTISEQ.

[0399] Cultured cells were counted in an Attune and normalized to a minimum T cell number of approximately 85,000 cells per well. 100 μL of normalized cells in media were transferred to a 96-well round-bottom plate.

[0400] Cells in the 96-well plate were washed twice and resuspended in 180 μL of 1x PBS to form a cell suspension. For anchor labeling, 22 μL of a 2 μM anchor-barcode mixture (equimolar amounts of anchor LMO and sample barcode oligonucleotide in 1x PBS) was mixed with each cell sample and incubated on ice for 5 minutes. 22 μL of co-anchor solution (2 μM co-anchor LMO in 1x PBS) was added to the anchor-barcoded sample and incubated on ice for an additional 5 minutes. After co-anchor labeling, cells were spun down at 400 × g for 10 minutes at 4 °C. The supernatant was removed, followed by two consecutive washes in cold 1x PBS buffer containing 1% BSA. The cells were then resuspended in cold 1x PBS containing 1% BSA, pooled into a single tube, filtered, and sorted for live T cells. The sorted cells were counted using a hemocytometer and loaded onto a 10x microfluidic chip targeting 40,000 cells per lane. Library preparation was performed as described in the Chromium Next GEM Single Cell 5' Reagent Kit v2 protocol by adding MULTI-Seq primers (approximately 25 nM final concentration) to the cDNA amplification reaction.

[0401] Following the 10x cDNA amplification cleanup protocol, 0.6x SPRIselect reagent was added to the sample. The sample was mixed, incubated, and placed on a 10x magnet until the solution was clear. 80 μL of the supernatant was transferred to a new 1.5 mL tube, which contained the MULTI-seq barcode sequencing fraction. 260 μL of SPRIselect and 180 μL of 100% isopropanol were added to the MULTI-seq barcode fraction. The sample was mixed thoroughly, incubated, and placed on a 10x magnet. The supernatant was discarded, and the beads were washed twice with 80% ethanol. The beads were air-dried and resuspended in Qiagen elution buffer. Samples were quantified using a Qubit fluorometer.

[0402] For index PCR, samples were normalized to 3.5 ng in a total sample volume of 18.75 μL. To multiplex samples for sequencing, universal i5 primers were paired with unique i7 index primers. After index PCR, samples were subjected to a 1.6x SPRIselect cleanup. Final samples were then quantified using Qubit and Tapestation. The molar concentrations from the Tapestation were calculated as 100-1000 bp. MULTI-seq barcoded samples were pooled to target 2,000 reads per cell. Samples were sequenced on the Illumina Novaseq platform as described in the Chromium Next GEM Single Cell 5' Reagent Kit v2 protocol.

[0403] Log2(CPKM+1) was plotted for the relevant target genes (FAS, PTPN2, TGFBR1, TGFBR2).

[0404] Phospho-Smad2 / 3 assessment by flow cytometry: 2 x 10 per donor 5Myc-enriched cells were resuspended in serum-free, cytokine-free medium and left overnight. The following day, cells were treated with 10 ng / ml TGF-β1 for 2 hours and stained for surface Myc expression and live / dead staining. Cells were fixed and permeabilized using BE Perm Buffer III according to the manufacturer's protocol. Cells were stained for pSMAD2 / 3 using clone 072-670 (BD). Samples were washed and acquired on an Attune Nxt cytometer. MFI of pSMAD2 / 3 was quantified relative to control cells lacking TGFBR shRNA.

[0405] result To ensure that the shRNA miR Quad (fas-ptpn2-tgfbr2-tfgrb2 or fas-ptpn2-tgfbr2-tgfrb1 shRNA) acts across all targets, knockdown of both TGFBR2 and FAS was assessed after transfection of cells with the Quad shRNA construct. Quad shRNAs conferred enhanced knockdown of TGFBR2 and maintained knockdown of the endogenous target FAS in T cells (Figures 1B and 1C). TGFBR2 knockdown was enhanced by incorporating multiple TGFBR2 shRNAs. Furthermore, FAS knockdown was conserved across all TGFBR shRNA constructs in the "Quad" shRNA-miR module and was comparable across all TGFBR shRNA constructs. Targeting TGFBR2 with two shRNAs can improve knockdown at the protein level.

[0406] TGFBR2 knockdown also partially inhibited TGF-β-mediated suppression of target cell killing in a short-term repeated stimulation assay ( Fig. 1 D ).

[0407] Four lead TGFBR2 shRNA candidates achieved greater than 50% knockdown of TGFBR2 surface expression in T cells (Figure 1E). Single TGFBR2 knockdown T cells were also evaluated in repeated stimulation assays using soluble TGF-b. Figure 1F shows cumulative T cell proliferation, tumor cell proliferation, and IFNg production in T cells stimulated in medium alone or in the presence of TGF-b. Single shRNA-mediated TGFBR2 knockdown did not improve ICT function in the presence of TGF-b. However, ICT with TGFBR2 knockout (TGFBR2 sgRNA) demonstrated functional recovery in all metrics (increased T cell proliferation, reduced target cell proliferation, and increased IFNg production). Thus, the dual TGFBR2 shRNA construct demonstrated improved T cell function compared to single TGFBR2 shRNA-mediated knockdown.

[0408] The "triplet" shRNA cassette also reduced TGFBR2 expression and pSMAD phosphorylation compared to FAS-PTPN2 shRNA alone (FIG. 1G).

[0409] To assess the resistance of TGFRB-targeting shRNA Quad (to downstream effects of TGF-β signaling), edited logic gate T cells were co-cultured with Prime-Cell Lysis+K562 in the absence or presence of TGF-β. As shown in Figure 2A, Quad shRNA conferred partial resistance to TGF-β-mediated CD103 induction after exposure to tumor and TGF-β1 in short-term RSA. Thus, TGFBR1 and TGFBR2 knockout protected logic gate T cells from TGF-β-mediated CD103 induction. TGFBR knockdown resulted in a partial reduction in CD103 induction by TGF-β.

[0410] The assay was repeated using RPMI-8226 target cells. As shown in Figure 2B, Quad shRNA conferred partial resistance to TGF-β-mediated CD103 induction in RPMI-8226 target cells after exposure to tumor and TGF-β1.

[0411] TGFBR2 knockdown restored TGF-β-mediated inhibition of tumor cell killing by logic gate T cells (Figure 3). Thus, TGFBR shRNA restored the antitumor activity of logic gate T cells in the presence of TGF-β1.

[0412] PD1 surface expression was also used to evaluate the activity of TGFBR shRNA Quad. A bivariate plot of PD1 versus CD103 expression shows that inhibition of TGFBR signaling resulted in attenuation of PD-1 expression (data not shown). A correlation between PD1 and CD103 induction was also observed after knockdown with the Quad shRNA module (Figures 2A, 2B, and 4). A strong correlation was also observed between CD103 induction in integrated circuit T cells (ICT) after short-term RSA (two stimulations) and CSA (Figure 4). Thus, resistance to CD103 correlates with PD1 induction. Without wishing to be bound by theory, PD1 induction may be a useful metric for ranking TGFBR shRNA modules.

[0413] Selected quad shRNA modules were chosen for further characterization. As shown in Figure 5A, the selected TGFBR quads partially impaired CD103 induction during RSA. TGFBR2 knockout longitudinally protected logic-gated T cells from TGF-β-mediated CD103 induction. TGFBR knockdown resulted in a partial reduction of CD103 induction by TGF-β1. The selected quad TGFBR shRNA modules strongly impaired PD1 maintenance during RSA (Figure 5B).

[0414] MULTIseq revealed on-target repression of the Quad miR shRNA module (Figure 6). KD of FAS and PTPN2 was maintained in the Quad construct. KD of TGFBR2 was also consistent across the Quad.

[0415] The TGFBR2-TGFBR2 Quad exhibited stronger temporal inhibition of TGF-β signaling based on pSMAD2 / 3 phosphorylation. As shown in Figure 7, the TGFBR2-TGFBR2 Quad shRNA module (left panel) demonstrated reduced pSMAD2 / 3 induction in response to TGF-β1. Thus, the R2-R2 shRNA Quad (left panel) exhibited greater inhibition of TGF-β1-induced signaling than the R2-R1 Quad (right panel). This demonstrates that including multiple shRNAs targeting TGFBRs enhances target knockdown and provides superior resistance to inhibitory TGFBRs.

[0416] TGFBR2 knockdown by selected quad shRNAs inhibited the suppression of TGF-β-mediated target cell killing by logic gate T cells (Figure 8). TGFBR knockdown resulted in a significant rescue from TGF-β-mediated suppression of target cell killing by logic gate T cells.

[0417] Example 2: Characterization of TGFRB1 and TGFRB2 knockouts in vivo material H1975 mouse model H1975 cells were engineered to co-express ALPG and MSLN for targeting by logic-gated CAR T cells. Briefly, pan-T cells were stimulated with aCD3 / aCD28 and electroporated with Cas9 RNP containing GS94 guide RNA, donor DNA template, and sgRNA targeting TGFBR2 (if applicable) to generate ICT cells with TGFBR2 knockout (KO). Cells were grown in IL-7 and IL-15 for 7 days and cryopreserved before use. Mice were transfected with H1975 cells. ALPG / MSLN After randomization, when the xenografts reached 160 mm3, 5 × 10 T cells harboring TGFBR2 knockout and expressing the ALPG / MSLN logic gate (ALPG priming receptor and MSLN CAR) were inoculated subcutaneously. 5 , 2 × 10 6 or 4×106 T cells were injected with 1000 ng / ml of TGFBR2 knockout T cells. WT T cells without TGFBR2 knockout or ALPG / MSLN logic gate were used as control. N = 7 mice / group, 1 donor.

[0418] 786-O Mouse Model A TGF-B-secreting model of human renal cell carcinoma (RCC) was generated in NSG MHC I / II double knockout mice. 2e6 768-O cells engineered to express ALPG and MSLN proteins were injected into the flank, and tumors grew to 300 mm. 3 Mice were staged when they reached a tumor size of 1000. ICT cells with CRISPR-mediated TGFBR2 knockout and expressing an exemplary ALPG / MSLN logic gate (ALPG priming receptor and MSLN CAR) were administered via tail vein injection at a "stress dose" level of 3e5 cells / mouse. Control T cells used were RNP-only cells and edited T cells expressing the logic gate and a non-coding control (NTC) sgRNA. Peripheral blood was collected on day 14 for PK analysis of edited T cells. Tumor volume was measured for 40 days after ICT injection and for a total of 68 days after tumor cell injection. N = 7 mice / group.

[0419] result H1975 mouse model TGFBR2 knockout in logic-gated T cells resulted in anti-tumor activity in the H1975 xenograft model (Figure 9A). TGFBR2 knockout (KO) logic-gated T cells induced tumor growth inhibition (TGI). 5 × 10 5 At the engineered cell dose, TGI split between TGFBR2 KO and WT logic gated cells at the same cell dose, indicating that TGFBR2 KO increased the efficacy of T cells against target cells.

[0420] TGFBR2 KO enhanced logic-gated T cell efficacy (ICT) in the H1975 model comparable to shRNA knockdown of FAS-PTPN2 ( Fig. 9B ).

[0421] 786-O Mouse Model While non-edited cells (RNP only) showed no antitumor effect, T cells with only the logic gate showed some tumor control. In contrast, T cells with the logic gate and TGFBR2 knockout (TGFBR2 sgRNA) showed significantly enhanced tumor control (Figure 9C). Edited ICT cells in peripheral blood were measured by flow cytometry of buccal blood samples isolated 14 days after ICT injection and compared between experimental groups. ICT cells with TGFBR2 knockout showed significantly higher levels of ICT proliferation in the blood (Figure 9D). Student's t-test; p<0.05. Thus, TGFBR2 knockout improved the efficacy of ICT in an RCC model with TGF-B secretion.

[0422] Example 3: In vivo characterization of TGFRB1 and TGFRB2 shRNAs in combination with FAS and PTPN2 shRNAs Materials and Methods 786-O Mouse Model Briefly, pan-T cells were stimulated with aCD3 / aCD28 and electroporated with Cas9 RNP containing the GS94 guide RNA and a donor DNA template encoding the ALPG / MSLN logic gate and the indicated shRNA cassette to generate ICT cells. TGFBR2 KO samples were also treated with sgRNA targeting TGFBR2. Cells were grown in IL-7 and IL-15 for 7 days and cryopreserved before use.

[0423] 786-O on Mouse ALPG / MSLN After randomization, xenografts were 300 mm 3 ICT was injected when tumor volume reached 1000 mg / kg. N = 7 mice / group, 1 donor. Tumor volume was measured longitudinally with a caliper.

[0424] H1975 mouse model ICT cells were generated as described above.

[0425] H1975 in mice ALPG / MSLNAfter randomization, the xenografts were 145 mm 3 Engineered T cells were injected when the ALPG / MSLN logic gate was reached. T cells were engineered to express the ALPG / MSLN logic gate alone with a control shRNA or in combination with FAS-PTPN2 shRNA, or FAS-PTPN2-TGFBR2_23-TGBR1_10 shRNA, FAS-PTPN2-TGFBR2_23-TGBR1_13 shRNA, FAS-PTPN2-TGFBR2_23-TGBR2_16 shRNA, or FAS-PTPN2-TGFBR2_23-TGBR2_37 shRNA. TGFBR2 knockout T cells were used as a positive control. N = 7 mice / group, 1 donor, 2 doses.

[0426] result TGFBR2 knockout T cells expressing FAS-PTPN2-TGFBR2_23-TGBR1_10 shRNA, FAS-PTPN2-TGFBR2_23-TGBR1_13 shRNA, FAS-PTPN2-TGFBR2_23-TGBR2_16 shRNA, or FAS-PTPN2-TGFBR2_23-TGBR2_37 shRNA showed enhanced TGI in the 786-O model compared with WT T cells and T cells expressing FAS-PTPN2 shRNA alone (Figure 10).

[0427] TGFBR2 knockout T cells expressing FAS-PTPN2-TGFBR2_23-TGBR1_10 shRNA, FAS-PTPN2-TGFBR2_23-TGBR1_13 shRNA, FAS-PTPN2-TGFBR2_23-TGBR2_16 shRNA, or FAS-PTPN2-TGFBR2_23-TGBR2_37 shRNA showed enhanced TGI in the H1975 in vivo model compared with WT T cells and T cells expressing only FAS-PTPN2 shRNA. Figure 11A shows the mean tumor volume after treatment with engineered T cells. Figure 11B shows the tumor size of individual mice after treatment with logic gate and control shRNA control groups. Figure 11C shows the tumor size of individual mice after treatment with FAS-PTPN2-TGFBR2_23-TGBR2_16 shRNA logic gate T cells. Figure 11D shows individual mouse tumor sizes after treatment with FAS-PTPN2 logic gated T cells. Figure 11E shows individual mouse tumor sizes after treatment with FAS-PTPN2-TGFBR2_23-TGBR2_37 shRNA logic gated T cells. Figure 11F shows individual mouse tumor sizes after treatment with FAS-PTPN2-TGFBR2_23-TGBR1_13 shRNA logic gated T cells. Figure 11G shows individual mouse tumor sizes after treatment with FAS-PTPN2-TGFBR2_23-TGBR1_10 shRNA logic gated T cells. Figure 11H shows individual mouse tumor sizes after treatment with TGFBR2 knockout T cells.

[0428] Example 4: In vitro characterization of a second logic gate in combination with FAS and TGFBR2 shRNA Materials and Methods Expression of PrimeR / CAR ICT constructs in T cells Integrated circuit T (ICT) cells targeting a second exemplary primeR antigen (priming receptor) and a second exemplary CAR antigen were generated by site-specific CRISPR-mediated knock-in (KI). T cells were activated for two days using CD3-CD28 beads. On day 2, the beads were removed, and then the ICT transgene was delivered to the GS94 site in the T cell genome. Transgene integration was achieved using a CRISPR-based process and electroporation step, combining activated T cells, CRISPR / Cas9 RNPs targeting the GS94 non-coding autosomal integration site, and plasmid DNA constituting a repair template to drive insertion of the transgene cassette via cellular DNA repair mechanisms.

[0429] The GS94 CRISPR / Cas9 RNP used was generated by complexing a single guide RNA (sgRNA) with recombinant Streptococcus pyogenes Cas9 (SpCas9). The sgRNA contained a protospacer sequence that directed the CRISPR / Cas9 RNP to the GS94 transgene integration site. The plasmid DNA repair template contained an ICT transgene cassette flanked by 450 base pairs (bp) of sequence homology to regions flanking the integration site to effect repair-mediated insertion.

[0430] A diagram of the various ICT transgene cassettes generated is provided in Figure 12. ICT constructs 1, 2, 3, and 4 contained a constitutively expressed priming receptor, an inducible CAR (forming a logic gate or "LG"), constitutively expressed shRNAs targeting FAS (one shRNA) and TGFBR2 (two shRNAs), and a synthetic pathway activator (SPA). One ICT also contained shRNAs targeting PTPN2 in addition to FAS and TGFBR2, and LNGFR instead of SPA (LG 5 IC). The FAS and dual TGFBR2 shRNA cassette (triple shRNA) is provided in SEQ ID NO: 130, and the sequence of the FAS / PTPN2 / double TGFBR2 shRNA cassette (quadruple shRNA) is provided in SEQ ID NO: 131. A complete transgene cassette containing a logic gate with shRNA and optional SPA is referred to as a Logic Gate 1 Integrated Circuit ("IC" or LG 1 IC), Logic Gate 2 IC (LG 2 IC), Logic Gate 3 IC (LG 3 IC), Logic Gate 4 IC (LG 4 IC), or Logic Gate 5 IC (LG 5 IC).

[0431] After electroporation, cells were harvested and grown in T cell medium for 7 days. Optionally, negative control T cells were generated using a mock electroporation process to edit T cells with ribonucleoprotein (RNP) in the absence of donor plasmid, referred to as "RNP control."

[0432] ICT cells were evaluated for expression of the transgene KI and PrimeR and CAR using flow-based staining. The constructs contained a signal peptide followed by the tags myc and flag on the distal extracellular portion of PrimeR and CAR, respectively. ICT cells 7 days after activation were stained with myc, flag, and CD3 antibodies for 30 minutes at 4°C. After activation, cells were washed in FAC buffer and run by flow cytometry. After gating each sample on live CD3+ cells, ICTs were analyzed for PrimeR and CAR expression.

[0433] ICT CAR induction ICTs were generated as described above from T cells from two donors. 11 days after activation, ICTs were measured for CAR and PrimeR expression by Flag and Myc staining. KI% was quantified by summing the % of T cells in a sample that were PrimeR+ or CAR+. Prior to co-culture setup, ICTs were normalized to the same KI% using the addition of donor-matched RNP-only cells. 1 x 10 7 ICT, 1 x 10 7 The cells were co-cultured with target cells or medium for 72 hours and stained using flag staining to calculate the % of CAR+ cells. Basal CAR expression was measured during the assay setup.

[0434] shRNA knockdown ICT cells contain constitutive shRNA modules targeting knockdown of FAS and TGFBR2, whereas cells without the transgene (PrimeR-negative cells) have normal expression of FAS and TGFBR2 and can be used as an internal control. Multicolor flow cytometry was performed on four ICT cell populations to characterize transgene expression and evaluate shRNA-miR knockdown of FAS and TGFBR2. Antibodies against CD4, CD8, CD95 (FAS), and TGFBR2 were used for flow cytometry. The panel also included rh-primeR antigen for primeR detection, rhCAR antigen for CAR detection, and Zombi NIR for live vs. dead cell staining.

[0435] Surface protein knockdown of FAS and TGFBR2 in ICT cells was determined using flow cytometry. Cells were stained with anti-FAS and anti-TGFBR2 antibodies, and geometric mean fluorescence intensity (gMFI) was measured for both PrimeR-positive and PrimeR-negative ICT cell subsets. Data are representative of four donors. The formula used to calculate KD% (percent knockdown) was 100% (1-(MFI PrimeR+) / (MFI PrimeR-)).

[0436] Synthetic pathway activators Synthetic pathway activators (SPAs) constitutively induce STAT signaling without the need for exogenous cytokine input. Through rational design, SPAs can be engineered to harness the activity of multiple STAT family transcription factors at variable levels. Exemplary class I SPAs primarily increase pSTAT3 activity, while exemplary class II SPAs primarily increase pSTAT5 activity.

[0437] To demonstrate the ability of the SPA module to induce constitutive STAT3 phosphorylation, ICTs expressing the SPA module under unstimulated conditions were fixed, permeabilized, and stained for pSTAT3 and the myc epitope tag to distinguish edited from nonedited cells (data not shown).

[0438] Cytotoxic, engineered K562 cells ICT cells expressing integrated circuits containing shRNA and, optionally, SPA-containing logic gate 1 IC, logic gate 2 IC, logic gate 3 IC, logic gate 4 IC, or logic gate 5 IC were co-cultured with K562_EFG, K562_EFG_CAR antigen, K562_EFG_primeR antigen, or K562_EFG_CAR antigen_primeR antigen at various E:T ratios for 72 hours at 37°C. After incubation, cytotoxicity was measured using a luciferase reporter assay. Data are shown as the mean ± standard deviation of four donors.

[0439] Cytokine secretion To further evaluate the specificity and function of IC cells expressing logic gates 1-5, supernatants were collected from K562-target cytotoxic co-cultures (1:1 effector:target ratio, 72 h co-culture). After incubation, supernatants were collected at the endpoint, and cytokine release levels were measured using a Luminex assay. Data from four donors are shown.

[0440] Cytotoxicity in endogenous / engineered cells LG1-5 IC-expressing ICT cells were co-cultured with CAR antigen-primeR antigen cells (cells endogenously expressing the CAR antigen and engineered to express the primeR antigen) at various E:T ratios for 72 hours at 37°C. After incubation, cytotoxicity was measured using a luciferase reporter assay. Data are shown as the mean ± standard deviation of four donors. Supernatants were collected at the endpoint before the luciferase readout, and the cytokines (B) IFN-γ, (C) TNFα, (D) GM-CSF, and (E) IL-2 were measured using a Luminex assay. Data from four donors are shown.

[0441] Cytotoxicity of mixed co-cultures ICT cells expressing logic gates 1-5 were co-cultured with primeR antigen+ / CAR antigen- HUVEC cells and luciferase-expressing primeR antigen- / CAR antigen+ cells (K562-EFG-CAR antigen) at various E:T ratios for 72 hours at 37°C. After incubation, cytotoxicity was measured using a luciferase reporter assay. Data are from one normal donor. ICT-mediated killing of CAR antigen+ target cells was assessed using a luciferase reporter assay against a negative control electroporated with RNP.

[0442] result All ICT cells constitutively expressed the PrimeR construct, as indicated by myc expression (Figure 13). Inducible CAR was not expressed basally in ICT cells, as indicated by the lack of FLAG expression (Figure 13), indicating that the priming receptor did not induce CAR expression.

[0443] As shown in Figure 14, ICT cells induced CAR expression when co-cultured with a primeR antigen-expressing cell line. The numbers shown in Figure 14 are calculated as (CAR%) / (KI% normalized to the start of the assay). *100. Thus, the logic gate circuit functioned correctly by preventing CAR expression in the absence of binding of primeR to its cognate antigen (FIG. 13) and inducing CAR expression upon binding of primeR to its cognate ligand on target cells (FIG. 14).

[0444] Inclusion of the shRNA module in ICT cells showed lower MFI for both FAS and TGFBR2 in primed receptor-CAR logic gate (PrimeR+)-expressing ICT cells normalized to non-edited cells (PrimeR-), indicating knockdown of both FAS and TGFBR2 in ICT PrimeR+ cells (Figure 15).

[0445] ICT expressing LG1-5 IC showed cytotoxicity only against cells expressing dual CAR and primeR antigens, compared to unedited control cells (RNP). Figure 16A shows cytotoxicity against parental K562 cells expressing neither CAR nor primeR antigens. Figure 16B shows cytotoxicity against K562 cells expressing only CAR antigens. Figure 16C shows cytotoxicity against K562 cells expressing only primeR antigens. Figure 16D shows cytotoxicity against K562 cells expressing both primeR and CAR antigens. As shown in Figure 16D, ICT showed cytotoxicity only against cells expressing both primeR and CAR antigens, compared to unedited control cells (RNP).

[0446] IFN-γ production from ICTs expressing LG1-5 ICTs was observed only in supernatants harvested from cocultures in which target cells expressed both the primeR and CAR antigens (Figure 17). The cytokine analysis results were consistent with the cytotoxicity data. Collectively, these data further demonstrate that ICT activity is induced by coexpression of the primeR and CAR antigens.

[0447] ICTs expressing LG1-5 ICs demonstrated in vitro cytotoxicity against primeR antigen-med cell lines expressing endogenous CAR antigen (Figure 18A). ICTs also secrete cytokines after coculture. Figure 18B shows the secretion of IFNγ, TNFα, GM-CSF, and IL-2 by ICT cells after coculture with primeR antigen+ / CAR antigen+ cells. Thus, ICTs expressing LG1-5 ICs secreted cytokines and killed ccRCC cell lines expressing endogenous CAR antigen in the presence of primeR antigen.

[0448] Co-culture of HUVECs with primeR antigen induced CAR protein expression in ICT cells, confirming specific killing of CAR antigen+ cells (Figure 19). Therefore, ICTs expressing LG1-5 ICTs were able to induce CAR expression through interaction with primeR antigen+ endothelial cells and subsequently bind specifically to and kill CAR antigen+ tumor cells. Therefore, without wishing to be bound by theory, ICTs may be primed by binding to endothelial cells expressing primeR antigen to express CAR and subsequently kill CAR antigen+ target tumor cells.

[0449] Therefore, we developed a logically gated ICT cell line that exploits the presence of two antigens to induce tumor cell killing and thereby enhance tumor specificity in order to improve the therapeutic index of CAR T cells. CAR induction was gated on the expression of the primeR antigen, which was found in the tumor neovascular network of ccRCC. In this example, the PrimeR antigen and CAR antigen were not previously known to be co-expressed in normal tissues. When the priming receptor (PrimeR) binds to its cognate antigen, PrimeR binding triggers the proteolytic release of a transcription factor that induces CAR expression. The feasibility of vascular priming was confirmed using a transwell assay in which ICT cells were primed by a primeR antigen-expressing endothelial cell line, then migrated through the transwell membrane and killed CAR antigen-expressing RCC cells.

[0450] To further enhance the potency and persistence of ICT cells, we inserted shRNA cassettes targeting both FAS and TGFBR2, a receptor used in TGFβ signaling in T cells, into the ICT. The addition of FAS / TGFBR2 shRNA enhanced the antitumor activity of T cells expressing the primeR antigen × CAR antigen logic gate during an in vitro chronic stimulation assay performed in the presence of exogenous TGFβ (data not shown). Furthermore, ICT-containing FAS / TGFBR shRNA demonstrated enhanced antitumor activity in multiple xenograft RCC models (Example 5, Figure 22). Collectively, these results demonstrate that primeR antigen-CAR antigen ICT cells (i) can selectively target antigens that generally cannot be safely targeted by conventional CARs and (ii) can overcome multiple suppressive mechanisms in the tumor microenvironment.

[0451] Example 5: In vivo efficacy of primeR and CAR logic-gated T cells expressing FAS and TGFBR2 shRNAs Materials and Methods A498 RCC Efficacy Model Human ccRCC cells express endogenous levels of the CAR antigen and were engineered to express physiological levels of the primeR antigen. 6 PrimeR antigen + / CAR antigen + cells were inoculated into the right dorsal flank of 5-6 week-old female NSG MHC I / II DKO mice. 35 days after tumor inoculation, the average tumor volume was 150 mm. 3 The tumor-bearing animals were randomized into various treatment groups so that the mean tumor volume per group was within 10% of the overall mean. Seven mice per group received 0.15 x 10 PrimeR+ICT cells expressing one of the five LG ICTs (LG 1 IC, LG 2 IC, LG 3 IC, LG 4 IC, or LG 5 IC) described in Example 4, RNP, or PBS. 6 The test was repeated using ICT generated from two different normal donors. Tumor volume and body weight were recorded every two weeks. Tumor volume was calculated using the formula 1 / 2 * L * W2 The calculation was performed according to the formula: where L is the tumor length and W is the tumor width.

[0452] Blood pharmacokinetics showed proliferation of ICT on day 14 after T cell injection, followed by a complete decline by day 42 after injection. PrimeR+ ICT was quantified in the blood of mice using flow cytometry with counting bright beads for T cell quantification / volume, and ICT proliferation was tracked. Mean and SEM were plotted.

[0453] Double flank model Human ccRCC 786-O cells were engineered to express either CAR and primeR antigen or CAR alone. 2 × 10 6 786-O-CAR+ cells and 786-O-CAR+-primeR antigen+ cells were inoculated into the left and right dorsal flanks, respectively, of 5- to 6-week-old female NSG MHC I / II DKO mice. At 35 days post-tumor inoculation, the mean tumor volume in each flank was 150-200 mm. 3 The tumor-bearing animals were randomized into various treatment groups so that the mean tumor volume per group on the right flank was within 10% of the overall mean. Seven mice per group received 0.25 x 10 PrimeR+ICT cells, constitutive CAR T cells, RNP, or PBS control. 6 or 1×10 6 The tumor volume and body weight were recorded every two weeks. The tumor volume was calculated using the formula 1 / 2 * L * W 2 (where L is tumor length and W is tumor width). (B) Tumor volume in the 786-O CAR antigen-only flank (left) and (C) tumor volume in the 786-O-CAR+ / primeR antigen+ flank (right). Data represent a single-donor study with 7 mice per group, and the mean and SEM are plotted.

[0454] result A498 RCC Efficacy Model ICTs expressing LG1-5 ICTs demonstrated tumor elimination in a ccRCC model. Figures 20A and 20D show tumor volume after tumor implantation in mice treated with ICTs expressing Logic Gates 1-5, RNP, or PBS generated from T cells from either Donor 1 (Figures 20A-C) or Donor 2 (Figures 20D-F). Figures 20B and 20E show the proliferation of total T cells and ICTs on day 12 post-inoculation, followed by a decline by day 21. Figures 20C and 20F show the total T cells expressing the priming receptors on days 12 and 21. In both replicates, ICT cells demonstrated significant tumor growth suppression in mice (P<0.05).

[0455] Double flank model The ICT expressing the LG1-5 IC demonstrated specificity in the double-flank model (Figures 21A and B). Greater tumor growth inhibition (TGI) was observed in the double-positive primeR antigen + / CAR antigen + flank (Figure 21B) than in the single-positive CAR-only flank (Figure 21A). Thus, the double-flank xenograft model demonstrates that the logic gated circuit (ICT) more selectively killed tumors expressing both the CAR antigen and the primeR antigen, rather than tumors expressing the CAR antigen alone.

[0456] Example 6: Synthesis and characterization of primeR and CAR logic-gated T cells with TGFBR knockdown or synthetic pathway activators T cells expressing primeR and CAR logic gates (also called integrated circuit T cells (ICT)) and synthetic pathway activators and FAS and TGFBR shRNAs or FAS, TGFBR2, and PTPN2 shRNAs were constructed and characterized. The results are presented in Figures 22 and 23. Figure 22 shows that TGFBR knockdown protected ICT cells from TGFβ-mediated inhibition in vitro. Figure 23 shows that ICT cells are a potent and specific cell therapy in an in vivo renal cell carcinoma model. ICT cells expressing CAR and primeR logic gates demonstrated significant and specific tumor reduction against tumor cells expressing both CAR and primeR antigens in the double-flank model described in Example 5. ICT cells were also more potent than conventional CAR T cells used as a benchmark.

[0457] Example 7: In vivo efficacy of primeR and CAR logic-gated T cells expressing FAS and TGFBR2 shRNA in an RCC model Materials and Methods 786-O ccRCC model 2e6 768-O cells engineered to express ALPG and MSLN proteins were injected into the flank of mice, and tumors grew to 300 mm 3 Mice were staged when they reached a 90-day post-tumor stage. ICTs expressing the exemplary corresponding primeR+CAR logic gate and one of four selected quad shRNAs (FAS / PTPN2 / TGFBR2 / TGFBR2 shRNA, see Example 3 and Figure 10) were administered via tail vein injection at a stress dose of 3e5 cells / mouse 28 days after tumor inoculation. Blood was collected on day 42 after tumor inoculation for PK analysis (data not shown). Tumor volume was measured for 62 days after T cell injection on day 28, for a total of 90 days. Control T cells used were unedited (RNP) or ICTs expressing the logic gate with luciferase (dual luc), FAS / PTPN2 shRNA module, or CRISPR-mediated FAS / PTPN2 / TFGBR2 knockout. N=7.

[0458] A498 ccRCC model To evaluate the efficacy of ICT with TGFBR2 shRNA, an additional in vivo model of RCC was created. A498 ccRCC cells express endogenous levels of a second exemplary CAR antigen and were engineered to express physiological levels of a second exemplary primeR antigen. Engineered A498 cells were injected into the flank of mice, and tumors grew to 150 mm. 3 Mice were staged when they reached 100%. ICT expressing the primeR+CAR logic gate and quadruple shRNA (FAS / PTPN2 / TGFBR2 / TGFBR2 shRNA, SEQ ID NO: 131) and the exemplary SPA described in Example 4 was administered via tail vein injection at a stress dose of 3e5 cells / mouse 25 days after tumor inoculation. Blood was collected on day 39 after tumor inoculation for PK analysis (data not shown). Tumor volume was measured for 28 days after T cell injection, for a total of 54 days. Control T cells used were either unedited T cells (RNP) or ICT expressing the logic gate together with the FAS / PTPN2 shRNA module and SPA. N=7.

[0459] result 786-O ccRCC model ICTs carrying either of the quadruple shRNA cassettes showed significantly improved tumor elimination compared to control T cells in the 786-O ccRCC model (Figure 24). ICTs expressing only the FAS / PTPN2 shRNA showed a moderate level of tumor elimination compared to control cells and ICTs expressing the quadruple shRNA. Thus, inclusion of TGFBR2 shRNA in ICTs resulted in increased tumor elimination compared to ICTs containing only the FAS / PTPN2 shRNA. ICTs expressing only the logic gates did not show antitumor effects in the 786-O RCC model at the stress dose of 3e5 used in the study. Non-edited T cells did not show antitumor effects in the 786-O RCC model.

[0460] A498 ccRCC model ICTs carrying either of the quadruple shRNA cassettes demonstrated significantly improved tumor clearance and potent antitumor responses compared to control T cells in the A498 ccRCC model (Figure 25). ICTs expressing only the FAS / PTPN2 shRNA demonstrated improved tumor clearance compared to control cells, but did not demonstrate as significant tumor reduction as cells expressing the quadruple shRNA. Thus, inclusion of the TGFBR2 shRNA in the ICT resulted in increased tumor clearance compared to ICTs containing only the FAS / PTPN2 shRNA. Non-edited T cells did not demonstrate antitumor effects in the 786-O RCC model.

[0461] Thus, the data demonstrate enhanced antitumor efficacy by shRNA knockdown of TFGBR2 in two different RCC xenograft models that secrete TGF-B.

[0462] While the present invention has been particularly shown and described with reference to preferred and various alternative embodiments, it will be understood by those skilled in the relevant art that various changes in form and detail can be made therein without departing from the spirit and scope of the invention.

[0463] All references, issued patents, and patent applications cited within the body of this specification are hereby incorporated by reference in their entirety for all purposes.

[0464] TIFF2025530328000010.tif232165TIFF2025530328000011.tif237165TIFF2025530328000012.tif237165TIFF2025530328000013.tif237165TIFF2025530328000014.tif237165TIFF2025530328000015.tif237165TIFF2025530328000016.tif237165TIFF2025530328000017.tif237165TIFF2025530328000018.tif237165TIFF2025530328000019.tif237165TIFF2025530328000020.tif237165TIFF2025530328000021.tif237165TIFF2025530328000022.tif237165TIFF2025530328000023.tif237165TIFF2025530328000024.tif223165TIFF2025530328000025.tif221165TIFF2025530328000026.tif226165TIFF2025530328000027.tif203165TIFF2025530328000028.tif209165TIFF2025530328000029.tif209165TIFF2025530328000030.tif209165TIFF2025530328000031.tif208165TIFF2025530328000032.tif208165TIFF2025530328000033.tif208165TIFF2025530328000034.tif208165TIFF2025530328000035.tif207165TIFF2025530328000036.tif214165TIFF2025530328000037.tif155165

Claims

1. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:

2.

2. One or more recombinant nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 1 (TGFBR1) comprising the sequence set forth in SEQ ID NO:

1.

3. a. a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:2; b. a second nucleic acid sequence of at least 15 nucleotides in length complementary to the mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:2; and One or more recombinant nucleic acids comprising:

4. a. a first nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human TGF-β receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO:2; b. a second nucleic acid sequence of at least 15 nucleotides in length that is complementary to the mRNA encoding human TGF-β receptor 1 (TGFBR1) comprising the sequence set forth in SEQ ID NO:1; and One or more recombinant nucleic acids comprising:

5. 5. The one or more recombinant nucleic acids of any one of claims 1 to 4, wherein the nucleic acid sequences are at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length.

6. 6. The one or more recombinant nucleic acids of any one of claims 1 to 5, wherein the nucleic acid is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double-stranded RNA (dsRNA), or an antisense oligonucleotide.

7. The one or more recombinant nucleic acids of claim 6, wherein the nucleic acid is an shRNA.

8. 8. The one or more recombinant nucleic acids of any one of claims 1 or 3 to 7, wherein the nucleic acid or the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 84.

9. 9. The one or more recombinant nucleic acids of any one of claims 3 to 8, wherein the first and second nucleic acids each comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84.

10. 10. The one or more recombinant nucleic acids of claim 8 or 9, wherein the nucleic acid or the first nucleic acid comprises the sequence set forth in SEQ ID NO:

81.

11. 11. The one or more recombinant nucleic acids of claim 8, 9, or 10, wherein the nucleic acid or the first nucleic acid comprises the sequence set forth in SEQ ID NO: 51 or 53.

12. 12. The one or more recombinant nucleic acids of any one of claims 8 to 11, wherein the nucleic acid, the first nucleic acid, or the second nucleic acid comprises a sequence set forth in SEQ ID NO: 81 and 51 or 53.

13. 12. The one or more recombinant nucleic acids of any one of claims 8 to 11, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO: 128, 129, 130, 139, 140, or 141.

14. 14. The one or more recombinant nucleic acids of any one of claims 1 or 3-13, wherein the nucleic acid, the first nucleic acid, or the second nucleic acid reduces expression of TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not contain the respective nucleic acid.

15. 9. The one or more recombinant nucleic acids of any one of claims 2, or 4 to 8, wherein the nucleic acid or the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 35.

16. 16. The one or more recombinant nucleic acids of claim 15, wherein the nucleic acid or the second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28.

17. 17. The one or more recombinant nucleic acids of any one of claims 2, 4-8, 15, or 16, wherein the nucleic acid or the second nucleic acid reduces expression of TGFBR1 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

18. 18. The one or more recombinant nucleic acids of any one of claims 4-14 or 16-17, wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO: 81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28.

19. 19. The one or more recombinant nucleic acids of any one of claims 3, 5-8, or 15-18, wherein the first and second nucleic acids reduce expression of TGFBR1 and TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acids.

20. 8. The one or more recombinant nucleic acids of any one of claims 4 to 7, wherein the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84, and the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 84.

21. 21. The one or more recombinant nucleic acids of claim 20, wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO: 81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 28, 16, 51, or 53.

22. 22. The one or more recombinant nucleic acids of any one of claims 1 to 21, wherein the nucleic acid, the first nucleic acid, and / or the second nucleic acid reduces expression of TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, and the second nucleic acid reduces expression of TGFBR1 and / or TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, respectively, compared to a control cell not containing the respective nucleic acid.

23. further comprising at least a third nucleic acid sequence at least 15 nucleotides in length; the at least third nucleic acid sequence comprises a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding the human Fas cell surface death receptor (FAS), comprising the sequence set forth in SEQ ID NO:3; One or more recombinant nucleic acids according to any one of claims 1 to 22.

24. 24. The one or more recombinant nucleic acids of claim 23, wherein the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

25. 25. One or more recombinant nucleic acids according to claim 23 or 24, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO:

92.

26. 26. The one or more recombinant nucleic acids of any one of claims 23 to 25, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO: 130, 139, 129, or 141.

27. further comprising at least a third nucleic acid sequence at least 15 nucleotides in length; the third nucleic acid sequence is (1) a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding the human Fas cell surface death receptor (FAS), comprising the sequence set forth in SEQ ID NO:3; (2) a nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding the human protein tyrosine phosphatase non-receptor type 2 (PTPN2), comprising the sequence set forth in SEQ ID NO:4; or (3) a nucleic acid sequence complementary to nucleotides 1294 to 2141 of an mRNA encoding the human thymocyte selection-associated high mobility group box (TOX), comprising the sequence set forth in SEQ ID NO:

5. including one or more of: One or more recombinant nucleic acids according to any one of claims 1 to 22.

28. 28. The one or more recombinant nucleic acids of claim 27, wherein the third nucleic acid comprises a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

29. 29. The one or more recombinant nucleic acids of claim 27 or 28, wherein the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

30. 30. The one or more recombinant nucleic acids according to any one of claims 27 to 29, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO:

92.

31. 28. The one or more recombinant nucleic acids of Claim 27, wherein the third nucleic acid comprises a nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2), which comprises the sequence set forth in SEQ ID NO:

4.

32. 32. The one or more recombinant nucleic acids of claim 27 or 31, wherein the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 100-112.

33. 33. The one or more recombinant nucleic acids of any one of claims 27, 31, or 32, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO:

110.

34. 34. The one or more recombinant nucleic acids of any one of claims 27 to 33, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO:

129.

35. 28. The one or more recombinant nucleic acids of claim 27, wherein the third nucleic acid comprises a nucleic acid sequence complementary to nucleotides 1294 to 2141 of an mRNA encoding a human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:

5.

36. 36. The one or more recombinant nucleic acids of claim 27 or 35, wherein the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 113-126.

37. further comprising at least a third and a fourth nucleic acid sequence at least 15 nucleotides in length; the third nucleic acid sequence comprises a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human Fas cell surface death receptor (FAS) comprising the sequence set forth in SEQ ID NO:3, and the fourth nucleic acid sequence complementary to nucleotides 518 to 559 of an mRNA encoding human protein tyrosine phosphatase non-receptor type 2 (PTPN2) comprising the sequence set forth in SEQ ID NO:4; One or more recombinant nucleic acids according to any one of claims 1 to 27.

38. 29. The one or more recombinant nucleic acids of claim 27 or 28, wherein the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

39. 30. The one or more recombinant nucleic acids according to any one of claims 27 to 29, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO:

92.

40. 32. The one or more recombinant nucleic acids of claim 27 or 31, wherein the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 100-112.

41. 33. The one or more recombinant nucleic acids of any one of claims 27, 31, or 32, wherein the nucleic acid comprises the sequence set forth in SEQ ID NO:

110.

42. 42. The one or more recombinant nucleic acids of any one of claims 27-41, wherein the third nucleic acid reduces expression of FAS in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% and / or reduces expression of PTPN2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the nucleic acid.

43. 43. The one or more recombinant nucleic acids of any one of claims 1 to 42, wherein each of said one or more nucleic acids is encoded on a plurality of different nucleic acid molecules.

44. 43. The one or more recombinant nucleic acids of any one of claims 1 to 42, wherein each of said one or more nucleic acids is encoded on the same nucleic acid molecule.

45. 45. One or more recombinant nucleic acids according to any one of claims 1 to 44 incorporated into one or more expression cassettes or expression vectors.

46. 46. ​​The one or more recombinant nucleic acids of claim 45, wherein the expression cassette or the expression vector further comprises a constitutive promoter upstream of the one or more recombinant nucleic acids.

47. 47. The one or more recombinant nucleic acids of claim 45 or 46, wherein the expression cassette comprises a sequence set forth in any one of SEQ ID NOs: 133-137.

48. An expression vector comprising the recombinant nucleic acid of any one of claims 1 to 47.

49. An immune cell comprising one or more recombinant nucleic acids at least 15 nucleotides in length that are complementary to mRNA encoding human TGFBR1, the mRNA comprising the sequence set forth in SEQ ID NO:

1.

50. An immune cell comprising one or more recombinant nucleic acids at least 15 nucleotides in length that are complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:

2.

51. One or more recombinant nucleic acids comprising a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence at least 15 nucleotides in length. An immune cell comprising: the second nucleic acid sequence is a. is complementary to the mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2; or b. is complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO: 1; The immune cells.

52. 52. The immune cell of claim 51, wherein the second nucleic acid sequence is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:

2.

53. 52. The immune cell of claim 51, wherein the second nucleic acid sequence is complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:

1.

54. One or more recombinant nucleic acids comprising a first nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence of at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR1 comprising the sequence set forth in SEQ ID NO:

1. including immune cells.

55. One or more recombinant nucleic acids comprising a first nucleic acid sequence at least 15 nucleotides in length that is complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO:2, and a second nucleic acid sequence. including immune cells.

56. 56. The immune cell of any one of claims 49 to 55, wherein the cell further comprises at least a third nucleic acid sequence at least 15 nucleotides in length, the third nucleic acid sequence being complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

57. 56. The immune cell of any one of claims 49 to 55, wherein the cell further comprises at least a third nucleic acid sequence at least 15 nucleotides in length, the third nucleic acid sequence being (1) complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:3, (2) complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:4, or (3) complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:

5.

58. 58. The immune cell of any one of claims 49 to 57, wherein the cell further comprises at least a fourth nucleic acid sequence at least 15 nucleotides in length, the fourth nucleic acid sequence being (1) complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:3, (2) complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:4, or (3) complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte-selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:

5.

59. The immune cell of any one of claims 49 to 58, wherein the first, second, third, and fourth nucleic acids are shRNA, siRNA, dsRNA, or antisense oligonucleotides.

60. 60. The immune cell of claim 59, wherein the first, second, third, and fourth nucleic acids are shRNAs.

61. The immune cell of any one of claims 51 to 60, wherein the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84.

62. 62. The immune cell of claim 61 , wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO:

81.

63. The immune cell of any one of claims 51 to 62, wherein the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 35.

64. 64. The immune cell of claim 63, wherein the second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28.

65. 65. The immune cell of any one of claims 51 to 64, wherein the first nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84, and the second nucleic acid sequence comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 6 to 35.

66. 66. The immune cell of any one of claims 51 to 65, wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO: 81, and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 16 or 28.

67. The immune cell of any one of claims 51 to 62, wherein the second nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84.

68. 68. The immune cell of claim 67, wherein the second nucleic acid comprises the sequence set forth in SEQ ID NO: 51 or 53.

69. 69. The immune cell of any one of claims 51 to 62 or 67 to 68, wherein the first nucleic acid and the second nucleic acid comprise a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 36 to 84.

70. 70. The immune cell of any one of claims 51 to 62 or 67 to 69, wherein the first nucleic acid comprises the sequence set forth in SEQ ID NO: 81 and the second nucleic acid comprises the sequence set forth in SEQ ID NO: 51 or 53.

71. 71. The immune cell of any one of claims 51-62 or 67-70, wherein the one or more recombinant nucleic acids comprise a sequence set forth in SEQ ID NO: 128, 129, 130, 139, 140, or 141.

72. 72. The immune cell of any one of claims 51-71, wherein the first nucleic acid reduces expression of TGFBR2 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not contain the first nucleic acid.

73. 73. The immune cell of claim 72, wherein expression of TGFBR2 in the cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not contain the first nucleic acid.

74. 67. The immune cell of any one of claims 51 to 66, wherein the second nucleic acid reduces expression of TGFBR1 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell that does not contain the second nucleic acid.

75. The immune cell of claim 74, wherein expression of TGFBR1 in the cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells not containing the second nucleic acid.

76. 76. The immune cell of any one of claims 51 to 75, wherein the first nucleic acid reduces expression of TGFBR2 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, and the second nucleic acid reduces expression of TGFBR1 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, respectively, compared to control cells not containing the respective nucleic acid.

77. The immune cell of any one of claims 56 to 76, wherein the third nucleic acid sequence is complementary to nucleotides 1126 to 1364 of an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO:

3.

78. 78. The immune cell of claim 77, wherein the third nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 85-99.

79. 79. The immune cell of claim 78, wherein the third nucleic acid comprises the sequence set forth in SEQ ID NO:

92.

80. 80. The immune cell of any one of claims 56 to 79, wherein the one or more recombinant nucleic acids comprise a sequence set forth in SEQ ID NO: 129, 130, 139, or 141.

81. 81. The immune cell of any one of claims 56 to 80, wherein the third nucleic acid reduces expression of FAS in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the third nucleic acid.

82. The immune cell of any one of claims 58 to 78, wherein the fourth nucleic acid sequence is complementary to nucleotides 518 to 559 of an mRNA encoding human PTPN2 comprising the sequence set forth in SEQ ID NO:

4.

83. 78. The immune cell of claim 77, wherein the fourth nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 100-112.

84. 84. The immune cell of claim 83, wherein the fourth nucleic acid comprises the sequence set forth in SEQ ID NO:

110.

85. 85. The immune cell of any one of claims 58 to 84, wherein the one or more recombinant nucleic acids comprise the sequence set forth in SEQ ID NO:

129.

86. 86. The immune cell of any one of claims 57 to 85, wherein the fourth nucleic acid reduces expression of PTPN2 in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to a control cell not containing the first nucleic acid.

87. 79. The immune cell of any one of claims 58 to 78, wherein the fourth nucleic acid sequence is complementary to nucleotides 1294 to 2141 of an mRNA encoding human thymocyte selection-associated high-mobility group box (TOX) comprising the sequence set forth in SEQ ID NO:

5.

88. 88. The immune cell of claim 87, wherein the fourth nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 113-126.

89. The immune cell of any one of claims 49 to 88, wherein the expression of TGFBR1, TGFBR2, FAS and / or PTPN2 and / or TOX is determined by a nucleic acid assay or a protein assay.

90. 90. The immune cell of claim 89, wherein the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

91. 90. The immune cell of claim 89, wherein the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

92. The immune cell of any one of claims 49 to 91, which is a primary human immune cell.

93. The immune cell of any one of claims 49 to 92, wherein the primary immune cell is a natural killer (NK) cell, a natural killer T (NKT) cell, a T cell, a γδ T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, a T cell progenitor cell, or an induced pluripotent stem cell (iPSC).

94. The immune cell of any one of claims 49 to 93, wherein the primary immune cell is a primary T cell.

95. The immune cell of any one of claims 49 to 94, wherein the primary immune cell is a primary human T cell.

96. The immune cell according to any one of claims 49 to 95, which is an autoimmune cell.

97. The immune cell according to any one of claims 49 to 95, which is an allogeneic immune cell.

98. A population of cells comprising a plurality of immune cells according to any one of claims 49 to 97.

99. A pharmaceutical composition comprising an immune cell according to any one of claims 49 to 97 or a population of cells according to claim 98, and a pharmaceutically acceptable excipient.

100. A pharmaceutical composition comprising one or more recombinant nucleic acids according to any one of claims 1 to 47 or a vector according to claim 48, and a pharmaceutically acceptable excipient.

101. 100. A method of treating a disease in a subject, comprising administering to the subject an immune cell according to any one of claims 51 to 98 or a pharmaceutical composition according to claim 99 or 100.

102. 102. The method of claim 101, wherein the disease is cancer.

103. 103. The method of claim 102, wherein the cancer is a solid cancer or a liquid cancer.

104. 104. The method of claim 102 or 103, wherein the cancer is ovarian cancer, fallopian tube cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, pancreatic cancer, kidney cancer, lung cancer, prostate cancer, bladder cancer, breast cancer, brain cancer, leukemia, or lymphoma.

105. 105. The method of any one of claims 101 to 104, wherein said administration of said cells enhances an immune response.

106. 106. The method of claim 105, wherein the enhanced immune response is an adaptive immune response.

107. 106. The method of claim 105, wherein the enhanced immune response is an innate immune response.

108. 102. A method of enhancing an immune response in a subject, comprising administering to the subject an immune cell according to any one of claims 51 to 98 or a pharmaceutical composition according to claim 99 or 100.

109. 109. The method of claim 108, wherein the enhanced immune response is an adaptive immune response.

110. 110. The method of claim 109, wherein the enhanced immune response is an innate immune response.

111. 113. The method of any one of claims 101 to 112, wherein expression of TGFBR2 in the immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

112. 111. The method of any one of claims 101 to 110, wherein expression of TGFBR1 in the immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

113. 113. The method of any one of claims 101 to 112, wherein expression of FAS in the immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

114. 113. The method of any one of claims 101-112, wherein expression of PTPN2 in the immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

115. 113. The method of any one of claims 101-112, wherein expression of TOX in the immune cells is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% compared to control cells that do not contain the respective nucleic acid.

116. 116. The method of any one of claims 112 to 115, wherein the expression of TGFBR1, TGFBR2, FAS, PTPN2, and / or TOX in the immune cells is determined by a nucleic acid assay or a protein assay.

117. 117. The method of claim 116, wherein the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

118. 117. The method of claim 116, wherein the protein assay comprises at least one of immunoblotting, fluorescence-activated cell sorting, flow cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

Images