Therapeutic Macrophages

Abstract

The present invention relates to macrophages genetically engineered to overexpress interleukin-10 (IL-10) or IL-10 in combination with matrix metallopeptidase 9 (MMP9). Such macrophages can be used to treat inflammatory conditions in a subject, such as inflammatory organ damage. The inflammatory condition can be acute or chronic and can involve a fibrotic component.

Description

[Technical Field]

[0001] The present invention relates to macrophages genetically engineered to express a combination of interleukin-10 (IL-10) and matrix metallopeptidase 9 (MMP9). The macrophages are preferably engineered with exogenous nucleic acids encoding IL-10 and MMP9, and optionally, these exogenous nucleic acids can be expressed from the same nucleic acid molecule. Such macrophages can be used to treat inflammatory conditions in a subject, such as inflammatory organ damage. The inflammatory condition can be acute or chronic and can involve a fibrotic element. The present invention further relates to populations of such macrophages, compositions comprising such macrophages or populations thereof, and methods of using such macrophages or populations thereof. The present invention further relates to methods of engineering such macrophages, including, for example, transient transfection with a combined IL-10 and MMP9 mRNA construct. [Background technology]

[0002] Fibrosis is the final common pathway of chronic diseases with diverse etiologies, including toxic injury, viral infection, metabolic disorders, genetic disorders, and autoimmune diseases. Acute self-limiting fibrosis likely evolved as a reversible and protective response to injury. The balance between self-limiting and excessive fibrosis is finely regulated by multiple pathways and systems and essentially depends on the duration and repetition of injury. The liver provides a paradigm for the biology of fibrosis development and remodeling. End-stage chronic liver fibrosis, also known as cirrhosis, is a life-threatening condition. 1,2 Mortality attributable to liver disease is the single leading cause of death in the UK, where it has increased steadily every year since the 1970s, and remains a major health burden worldwide. 3Hepatic decompensation (HD) is defined by the acute onset of one or more major complications of cirrhosis (i.e., ascites, encephalopathy, gastrointestinal variceal bleeding, and spontaneous bacterial peritonitis) and represents a progression of the disease during the clinical course of cirrhosis [Trebicka 2020 43 ], the most common cause of hospitalization in patients with cirrhosis [Moreau 2013 46 HD patients are at high risk for short-term mortality [Moreau 2013 46 The initial episode of HD (also referred to herein as the first hepatic decompensation event) often requires hospitalization and marks the transition from compensated to decompensated cirrhosis, which is characterized by recurrent episodes of HD. 42 HD has two distinct clinical manifestations, depending on the presence or absence of other organ failure and the degree of systemic inflammation. The presence of multiple organ failure and severe systemic inflammation is characteristic of acute onset of chronic liver failure (ACLF), a syndrome with a very high 28-day mortality rate. HD with moderate systemic inflammation without additional organ involvement has a low 28-day mortality rate (approximately 2%, but increasing to 10% at 90 days, suggesting heterogeneity in the clinical course of HD patients) [Trebicka 2020]. 43 ] but the outcome remains poor for several years thereafter.

[0003] The only treatments for liver injury are removal of the noxious stimulus (e.g., administration of effective antiviral therapy) and liver transplantation. Treatment of liver failure resulting from acute or chronic injury is limited to supportive care and / or transplantation, the latter of which requires a donor. Currently, there is a shortage of organ donors, and surgery carries significant morbidity and mortality risks. In addition, patients also commit to lifelong immunosuppression. Furthermore, despite the relative success of therapeutic interventions for specific etiologies (e.g., novel antiviral therapies for hepatitis C virus infection and abstinence for alcoholic liver disease), many diseases (e.g., NASH) lack approved treatments, and patients often delay seeking medical care when cirrhosis and related complications have already developed [Starkey 2019]. 44Therefore, there is no specific therapy for treating liver cirrhosis, and therefore there is a significant unmet clinical need to provide effective anti-fibrotic therapy for both chronic and acute liver injury. 4~6 .

[0004] Macrophages (MΦ) play a crucial role in the inflammatory response of injured livers. Two major populations of MΦ exist in the liver: (i) resident macrophages (Kupffer cells, KCs) and (ii) infiltrating macrophages. KCs perform a patrolling function within the hepatic sinusoids to phagocytose microbial debris that reaches the liver via the sinusoids under homeostatic conditions. In the early stages of liver injury, KCs express chemokines such as CCL2 and CCL5, thereby contributing to the recruitment of monocytes from the blood circulation. 2,7 The number of KCs is reduced during fibrosis and then repopulates within the liver during the recovery phase of self-limited fibrosis. 8 Infiltrating monocyte-derived macrophages (MDMs) play a key role in the response to liver injury. Once recruited via the CCR2 / CCL2 axis and entering the liver parenchyma, infiltrating MDMs locate along fibrous septa in the early stages of liver fibrosis and may promote fibrosis by releasing factors such as TGF-β, IL1, PDGF, and CCL2, which activate hepatic stellate cells and exacerbate inflammation. This may suggest a detrimental role for MDMs in progressive fibrosis. However, when MDMs are depleted at the onset of fibrotic remodeling, the remodeling process fails and liver fibrosis persists. It is now widely accepted that macrophages play a dual role in the establishment and resolution of fibrosis. 2,8~11 .

[0005] Given the suggested role of macrophages in healing fibrosis, macrophage cell therapy is considered a potential treatment for chronic liver fibrosis. Murine bone marrow-derived macrophages (BMDMs) have been shown to reduce liver fibrosis when injected into a mouse model of chronic liver fibrosis. 12Similar results have been reproduced using human monocyte-derived macrophages (hMDMs) in an immunodeficient mouse model of chronic liver fibrosis. 13 In addition, GMP-compliant cell culture protocols 14 are currently being used to generate hMDMs for autologous transplantation into patients with cirrhosis in an ongoing Phase II trial (MATCH, Macrophage Therapy for Liver Disease, ISRCTN10368050, EudraCT reference 2015-000963-15). Macrophages are also crucial for the resolution of acute conditions. 38 However, to date, no therapy (macrophage cell therapy or other therapy) has been available that can effectively treat patients suffering from liver cirrhosis by acting through four crucial mechanisms: recruitment of immune system cells to the liver (paracrine effect), conversion of recruited monocytes into pro-restorative macrophages effective in spreading the therapeutic effect (polarization), and phagocytosis and remodeling of fibrotic scars. In particular, to date, no therapy has been available that can effectively act on all of these mechanisms to enable the treatment of patients suffering from decompensated liver cirrhosis and experiencing liver decompensation events. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2019 / 118888A1 [Patent Document 2] International Publication No. 2022 / 047119A1 [Patent Document 3] International Publication No. 2019 / 175595 [Patent Document 4] International Publication No. 2012 / 062930 [Patent Document 5] International Publication No. 2019175595 [Patent Document 6] U.S. Patent No. 8,058,069 [Patent Document 7] U.S. Patent No. 8,492,359

Patent document 8

Patent document 9

Patent document 10

Patent document 11

Patent document 12

Patent document 13

Patent document 14

Patent document 15

Patent document 16

Non-licensed literature

[0007] [Non-licensed document 1] Roth, IL-10 Is an Autocrine Inhibitor of Human Placental Cytotrophoblast MMP-9 Production and Invasion, Developmental Biology, Volume 205, 1st Edition, 1999, Pages 194~204 [Non-licensed document 2] Krishnamurthy, IL-10 inhibits inflammation and attenuates left ventricular remodeling after myocardial infarction via activation of STAT3 and suppression of HuR, Circ Res., 2009 Jan 30;104(2) [Non-licensed document 3] Balcar et al., United European Gastroenterol J.2021; 9(4): pp. 427-437 [Non-patent document 4] Gharavi, AT et al., “The role of macrophage subtypes and exosomes in immunomodulation”, Cell Mol Biol Lett 27, 83 (2022) [Non-Patent Document 5] Ramachandran et al., Proc Natl Acad Sci USA. November 13, 2012; 109(46): E3186-E3195 [Non-patent document 6] https: / / www.abcam.com / ps / products / 112 / ab112146 / documents / ab112146%20MMP%20Activity%20Assay%20Kit%20Fluorometric%20-%20Green%20v4b%20(website).pdf - ab112146 MMP Activity Assay Kit Fluorometric - Green v4b [Non-Patent Document 7] Campana et al., Nature Reviews Molecular Cell Biology, Vol. 22, pp. 608-624 (2021) Summary of the Invention [Problem to be solved by the invention]

[0008] Introduction to the Invention Typically, human macrophages (hMDMs) derived in vitro from monocytes will express IL-10, but it is not secreted in significant amounts from the macrophages, as shown by the results shown in Figure 1. Here, we have enhanced the anti-fibrotic and anti-inflammatory properties of macrophages by expressing and secreting IL-10 and MMP9 by transient transfection, providing proof of principle how the additional expression of these genes delivers macrophages that secrete IL-10 and active MMPs, promising products to aid in inflammatory conditions, such as the resolution of acute and chronic organ injury.

[0009] IL-10 is known for its anti-inflammatory properties, and some MMPs play a role in supporting the remodeling of fibrosis. However, the effect of the combined expression of IL-10 and MMP9 is currently unknown. In addition, the inventors have demonstrated that macrophages engineered to overexpress IL-10 can be used in effective treatments, particularly for liver cirrhosis. Specifically, without being bound by theory or mechanism, the engineered macrophages described herein (specifically, engineered macrophages expressing both IL-10 and MMP9) exhibit activity and / or improvement in each of the four mechanisms of action believed to underlie the effectiveness of therapeutic macrophages (i.e., 1) remodeling of fibrotic scars, 2) phagocytosis, 3) paracrine effects, and 4) polarization. FIG. 32 illustrates how these mechanisms of action contribute to the therapeutic effect of macrophages, specifically showing how the therapeutic effect can be amplified by the recruitment and polarization of endogenous monocytes into pro-restorative macrophages (this amplification is also referred to as a "virtuous cycle").

[0010] We show that human monocyte-derived macrophages (hMDMs) transfected (Trx) with mRNA expressing IL-10 or IL-10-p2A-MMP9 (referred to herein as IL-10+MMP9) can polarize macrophages toward a pro-restorative phenotype based on expression of CD14, CD206high, 25F9, CD163, CCR2low / neg, CD86low, and HLA class IIlow. Furthermore, in the Examples, the inventors demonstrate that IL-10 Trx and IL-10-MMP9 Trx hMDMs, when tested in a peripheral blood mononuclear cell (PBMC) migration assay, can recruit significantly more monocytes than hMDMs currently used in the MATCH clinical trial (trial registration number: ISRCTN10368050 and EudraCT; reference 2015-000963-15. Study protocol: A multicenter, open-label, parallel-group, phase 2, randomized controlled trial of autologous macrophage therapy for liver cirrhosis). Recruitment can be tested by any suitable method, such as Boyden chamber-based techniques. In the Examples, the inventors tested immune cell migration in a transwell cell migration and invasion assay (Boyden chamber assay). Without wishing to be bound by theory or mechanism, IL-10-Trx macrophages can specifically recruit monocytes without substantially recruiting other immune cell types. Surprisingly, IL-10-MMP9 Trx hMDMs exhibited a superior ability to recruit monocytes compared with MMP9-Trx and IL-10-Trx. The two proteins appear to synergize in this process. Indeed, macrophages transfected with MMP9 alone have been shown to have little or no ability to attract monocytes (Figure 12), and matrix metalloproteinase activity generally increases in such cells (data not shown). Furthermore, IL-10 and MMP9 Trx hMDMs exhibited a superior anti-inflammatory profile and phagocytic capacity.

[0011] Finally, we found that overexpression of IL-10 alone reduced overall matrix metalloproteinase (MMP) activity and the levels of MMP9 secreted into the supernatant of genetically engineered macrophages. Metalloproteinase assays for determining activity levels are described in the Examples. The negative effect of IL-10 on MMP activity is consistent with literature findings (e.g., Roth et al., IL-10 Is an Autocrine Inhibitor of Human Placental Cytotrophoblast MMP-9 Production and Invasion, Developmental Biology, Vol. 205, 1st ed., 1999, pp. 194-204; and Krishnamurthy et al., IL-10 Inhibits Inflammation and Attenuates Left Ventricular Remodeling After Myocardial Infarction via Activation of STAT3 and Suppression of HuR, Circ Res., January 30, 2009; 104(2)).

[0012] Therefore, we also provide macrophages engineered with a sequence encoding a specific MMP, MMP9. Interestingly, when comparing non-Trx hMDMs with IL-10+MMP9 Trx hMDMs, MMP9 expression is not dramatically increased, but overall matrix metalloproteinase activity in IL-10+MMP9 Trx hMDMs is significantly increased.

[0013] Taken together, these data support the use of IL-10+MMP9 Trx hMDM as a therapeutic agent in the treatment and / or prevention of inflammatory conditions (e.g., those associated with organ injury). Although IL-10 is known as an anti-inflammatory cytokine, previous data have shown that IL-4-stimulated macrophages, but not IL-10-stimulated macrophages, are pro-recovery in animal models of acute liver disease. 15This is somewhat surprising. The combination of additional IL-10 and MMP9 expression (e.g., by transfection) may also be envisioned to enhance the antifibrotic (by increasing matrix metalloproteinase activity) and pro-resolving (by increasing monocyte migration) functions of macrophage-based therapeutics. Therefore, recruitment of monocytes to the site of inflammation by such IL-10- and MMP9-expressing macrophages is important, as the macrophages of the present invention recruit monocytes in situ to provide additional therapeutic benefits. Recruited monocytes can be converted into pro-resolving macrophages, thereby enhancing the efficacy of the therapeutic macrophages. The pro-resolving phenotype is broadly described herein.

[0014] Organ damage due to chronic inflammation is often accompanied by fibrosis, such as in chronic liver disease, and therefore pro-restorative therapeutic macrophages with anti-inflammatory and anti-fibrotic functions would be beneficial.

[0015] As described above, the inventors have discovered that macrophages engineered to overexpress IL-10 exhibit reduced overall MMP activity. In contrast, macrophages engineered to additionally express MMP9, for example, by engineering them with a nucleic acid encoding MMP9, exhibit enhanced overall MMP activity, not just MMP9 activity. Here, for the first time, the inventors have demonstrated that combined expression of IL-10 and MMP9 significantly enhanced the overall MMP activity of engineered macrophages beyond what would be expected from data on macrophages transfected with either IL-10 or MMP9 individually. Thus, the inventors have demonstrated a surprising synergistic effect on overall MMP activity by combined expression of IL-10 and MMP9. To this end, macrophages have been engineered to be provided with additional / exogenous coding sequences for IL-10 and MMP9 in addition to those naturally present in the cells. Such a combination is not taught or suggested in the prior art. We show that macrophages transfected with a composite mRNA construct expressing IL-10 and MMP9 can be polarized into macrophages with aspects of a pro-restorative phenotype, as described herein.

[0016] Furthermore, the inventors have demonstrated that IL-10-MMP9-Trx hMDMs localize to the liver in disease models of liver inflammation / fibrosis. Also demonstrated is the ability of the engineered macrophages to recruit significantly more monocytes than the hMDMs (not engineered) currently used in MATCH. Such recruitment studies were performed in vitro using standard assays described herein. Collectively, these data support the use of IL-10 and MMP9-Trx hMDMs as improved therapeutic agents for the treatment and / or prevention of inflammatory conditions (e.g., those associated with organ injury).

[0017] Matrix metalloproteinases (MMPs), also known as matrix metalloproteinases or matrixins, are a family of zinc-dependent polypeptides that collectively degrade various proteins within the extracellular matrix (ECM). MMPs play many roles in vivo, making them extremely complex to understand. While MMPs have been reported to contribute to fibrosis, they are also crucial for the regression of fibrosis due to their ability to remodel the matrix. This dual role in the progression and regression of fibrosis can be understood in part through complex in vivo activities, ranging from cytokine and chemokine activation, immune cell recruitment, and activation to extracellular matrix degradation. Additionally, MMP activation and subsequent activity in vivo are highly regulated, primarily by tissue inhibitors of metalloproteinases (TIMPS), further complicating understanding MMP activity in fibrosis. Experimental models of pulmonary fibrosis have shown increased MMP9 (a type IV collagenase that targets collagen) activity, which has also been associated with disruption of the alveolar epithelial membrane, indicating a putative profibrotic role for MMP9 in lung injury. However, in a bleomycin-induced model of pulmonary fibrosis, MMP9-deficient mice developed lung fibrosis similar to that of their wild-type littermates, although their lungs exhibited limited alveolar bronchiolosis. Overall, the precise role of MMPs in fibrosis is not fully understood. Furthermore, in vitro-derived hMDMs express only negligible levels of MMPs, and their conditioned medium exhibits barely detectable activity.

[0018] Little has been reported to date in the field of MMP genetic manipulation. MMP9 transfection in THP1 cells has been utilized as a research tool to understand the inflammatory response of macrophages in atherosclerosis. Therapeutically, overexpression of MMP9 in iPSCs via lentiviral transduction has been utilized to enhance the repair of damaged myocardium. MMP12 (an elastase that targets soluble and insoluble elastin) has been overexpressed in endothelial progenitor cells for use in melanoma cell therapy. To our knowledge, previous studies performed on MMP transfection of human macrophages have not yielded macrophages with antifibrotic properties. Cabrera et al. demonstrated that overexpression of MMP9 in macrophages from bleomycin-challenged transgenic mice attenuated fibrosis. 45 Differences in the levels of TIMP-1 were also observed between transgenic and wild-type mice, but no differences in the expression levels or activities of other matrix metalloproteinases were reported.

[0019] MMPs have complex biology that is often organ- and disease-specific. For example, MMP9 has significant antifibrotic effects in models of chronic liver and lung disease. However, MMP9 appears to be detrimental in renal fibrosis.

[0020] WO 2019 / 118888A1 (Treatment of Fibrossis with Genetically Engineered Macrophages) describes engineered macrophages for the treatment of fibrosis. For example, the engineered macrophages contain a recombinant extracellular matrix (ECM) targeting protein and / or a recombinant protease. The recombinant protease can be a matrix metalloproteinase (MMP), such as any one of a long list of possible MMPs, including MMP9 and MMP12. However, IL-10 or cytokines are not mentioned in the cell engineering.

[0021] WO 2022 / 047119A1 (MODIFIED IMMUNE CELLS FOR FIBROSIS AND INFLAMMATION) describes modified immune cells comprising one or more nucleic acid sequences encoding (i) at least one exogenous fibrolytic agent and / or (ii) at least one exogenous anti-inflammatory agent. The at least one exogenous fibrolytic agent may include a matrix metallopeptidase (MMP), e.g., one or more from a long list of possible MMPs, such as MMP9 and MMP12. The at least one exogenous anti-inflammatory agent may include, e.g., a cytokine, chemokine, or pentraxin, and the cytokine may include, e.g., IL-10, IL-4, IL-13, and / or TGF-beta. The modified immune cells may include macrophages. However, specific combinations of these possible genes and cell types are not disclosed, and furthermore, the application does not exemplify combinations; only single genes are tested. Furthermore, the applicant has not attempted to determine the effect of, for example, the expression of IL-10 on the expression of other proteins such as MMPs. Furthermore, the data provided in application WO 2022 / 047119 A1 show that IL-10 transfected macrophages produce at least one pro-inflammatory marker on macrophages, CD-80, which is undesirable for the treatment of inflammatory conditions.

[0022] WO 2019 / 175595 describes the use of autologous, isolated, unmanipulated human macrophages in the treatment of liver diseases such as cirrhosis. However, the macrophages in this application are unpolarized and unmanipulated. Therefore, such cells are less useful in the treatment of inflammatory conditions and conditions with fibrotic components.

[0023] WO 2012 / 062930 describes the use of a composition comprising macrophages overexpressing IL-10 from transfected mRNA as a pharmaceutical, but the application does not disclose the combination of IL-10 with MMP9 or the treatment of liver cirrhosis.

[0024] The present inventors are the first to demonstrate the beneficial effects of macrophages engineered to express a specific combination of IL-10 and MMP9 in the treatment of, for example, inflammatory and fibrotic diseases.

[0025] One or more aspects or embodiments of the claimed invention are aimed at solving one or more of the problems set forth above. [Means for solving the problem]

[0026] Statement of the Invention According to a first aspect of the present invention, there is provided an engineered macrophage that has been engineered to overexpress IL-10. In certain embodiments, the macrophage is 4×10 6 When cultured in vitro at a cell concentration of 10,000 pg / ml, they secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. As described herein, engineered macrophages that overexpress only IL-10 exhibit a remarkable ability to recruit monocytes with an anti-inflammatory secretome and to convert non-polarized or pro-inflammatory macrophages to a pro-restorative phenotype. In the Examples, such macrophages are demonstrated to be useful in therapy, particularly for the treatment of liver cirrhosis.

[0027] According to another aspect of the present invention, engineered macrophages are provided that overexpress IL-10 and MMP9, such that the engineered macrophages express higher levels of IL-10 and MMP9 compared to non-transfected macrophages. According to one aspect of the present invention, engineered macrophages are provided that have been engineered to express IL-10 and MMP9, preferably by providing additional or exogenous sequences encoding these proteins. Such IL-10 and MMP9 engineered macrophages may have therapeutic utility, for example, for use in treating inflammatory and / or fibrotic conditions in a subject.

[0028] In other aspects of the present invention, engineered macrophages are provided that have been engineered to overexpress IL-10 and IL-4; IL-10 and MMP12; IL-4, IL-13, and MMP9; or IL-4, IL-13, and MMP12.

[0029] The engineered macrophages according to any aspect of the present invention may have particular structural and advantageous functional properties, as described herein.

[0030] Exemplary structural and functional properties of the engineered macrophages, as compared to the non-polarized, non-transfected cells used in the MATCH studies described in WO2019175595, are set forth in Table 4. In some embodiments, the engineered macrophages of the present invention exhibit any combination of the properties set forth in Table 4.

[0031] Additional structural and functional properties of the engineered macrophages are set forth in Table 5. In some embodiments, the engineered macrophages of the present invention exhibit any combination of the properties set forth in Table 5. According to some embodiments, the engineered macrophages of the present invention exhibit at least all of the properties set forth in Table 5.

[0032] In preferred embodiments, when exposed to non-engineered macrophages, the engineered macrophages polarize the non-engineered macrophages to a pro-restorative phenotype. When administered to a subject, the engineered macrophages can polarize host macrophages (such as resident monocyte-derived macrophages that migrate to the liver) to a pro-restorative phenotype. In some embodiments, the engineered macrophages can convert non-polarized host macrophages to pro-restorative macrophages. In some embodiments, the engineered macrophages can convert pro-inflammatory host macrophages to pro-restorative macrophages. In some embodiments, conditioned medium from the engineered macrophages can convert non-engineered macrophages to a pro-restorative phenotype. Thus, the engineered macrophages of the present invention can convert non-engineered macrophages to a pro-restorative phenotype in vitro or in vivo. Conversion to a pro-restorative phenotype can increase expression of CD206 and CD163 and decrease expression of CD86 and HLA-DR on the cell surface.

[0033] In some embodiments, the engineered macrophages have at least a 2-fold reduction in CD86 expression compared to unengineered, non-polarized cells. In some embodiments, the engineered macrophages have at least a 2-fold reduction in HLA-DR expression compared to unengineered, non-polarized cells. In some embodiments, the engineered macrophages secrete at least a 1000-fold increase in IL-10 compared to unengineered, non-polarized cells. In some embodiments, the engineered macrophages secrete at least a 10-fold increase in MMP3 compared to unengineered, non-polarized cells. In some embodiments, the engineered macrophages secrete at least a 20-fold increase in MMP10 compared to unengineered, non-polarized cells.

[0034] In some embodiments, the macrophages of the present invention are 4×10 6When cultured in vitro at a cell concentration of 4×10 cells / ml, the macrophages secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. 6 When cultured in vitro at a cell concentration of 1×10 cells / ml, the engineered macrophages secrete MMP9 at a culture supernatant concentration of at least 200 ng / ml. In some embodiments, the engineered macrophages have at least a 5-fold increase in CD206 expression compared to monocytes. In some embodiments, the engineered macrophages have at least a 5-fold increase in 25F9 expression compared to monocytes. In some embodiments, the engineered macrophages have at least a 10-fold decrease in CD80 expression compared to non-engineered cells. In some embodiments, the macrophages of the present invention can be cultured at a cell concentration of 4×10 cells / ml. 6 When cultured in vitro at a cell concentration of 1000 / ml, the engineered macrophages secrete TNF-α at a culture supernatant concentration of at least 40 pg / ml. In some embodiments, the engineered macrophages have the same phagocytic capacity as non-engineered, non-polarized cells.

[0035] In one embodiment, the present invention provides an engineered macrophage comprising one or more exogenous coding sequences for IL-10 and MMPs. The exogenous coding sequences can be any suitable nucleic acid sequence. The exogenous coding sequences can be present in the cytoplasm or nucleus as extrachromosomal nucleic acids, or can be integrated into the macrophage genome. The exogenous coding sequences can encode IL-10 and MMP9, or multiple exogenous coding sequences can encode IL-10 or MMP9, respectively.

[0036] In some embodiments, expression of endogenous IL-10 and / or MMP9 genes can be stimulated by genetic engineering. For example, gene editing techniques such as CRISPR can be used to turn on and off endogenous genes encoding IL-10 and / or MMP9, generating engineered macrophages that express IL-10 and / or MMP9 under conditions that would not otherwise express these proteins. This can be done, for example, by altering the promoter sequence.

[0037] Although natural, unengineered macrophages can express IL-10 and / or MMP9 under relevant physiological conditions, natural macrophages generally do not secrete significant levels of IL-10. However, the present invention does not relate to natural, unengineered macrophages, but instead relates to engineered macrophages, particularly those in which IL-10 expression levels are elevated above physiological levels, thereby improving the anti-inflammatory properties of therapeutic macrophages. As used herein, we refer to this as "overexpression" of IL-10. To overexpress IL-10, macrophages can be engineered to carry additional or exogenous coding sequences for IL-10. In some embodiments, cells are transfected with mRNA encoding IL-10 / MMP9.

[0038] Cells that overexpress IL-10 and / or MMP9 contain coding sequences that express IL-10 and / or MMP9 at elevated levels relative to unengineered cells. As discussed above, overexpression can be achieved by introduction of exogenous nucleic acid encoding IL-10 and / or MMP9, such as mRNA, or by genetic modification that stimulates expression of IL-10 and / or MMP9 from endogenous coding sequences. Engineered macrophages that overexpress IL-10 and / or MMP9 may not necessarily secrete greater amounts of IL-10 and / or MMP9 relative to unengineered macrophages.

[0039] In other embodiments, macrophages can be engineered to activate endogenous genes encoding IL-10 and / or MMP 9. In either case, the macrophages of the present disclosure have been modified by altering the expression levels of IL-10 and / or MMP 9 by any means, and are therefore referred to as engineered macrophages.

[0040] Overexpression of IL-10 reduces the natural activity levels of MMPs, such as MMP9.

[0041] Thus, engineered macrophages are provided with additional or exogenous MMP coding sequences to maintain at least "physiological" levels of MMP9 expression, or slightly above physiological levels. In some embodiments, MMP9 expression is altered to rescue, restore, or return the macrophages to equivalent or elevated MMP9 expression levels compared to macrophages not transfected with IL-10. Thus, despite the fact that the engineered macrophages have been engineered with additional / exogenous MMP9 coding sequences, the engineered macrophages exhibit MMP9 expression levels that are equivalent to or slightly above wild-type / native expression. Slightly above may mean an increase in expression of 1.2- to 1.5-fold above natural expression levels (e.g., 1.2, 1.3, 1.4, or 1.5-fold above natural levels).

[0042] Macrophages can be engineered to express both IL-10 and MMP9. In some embodiments, this expression can be induced from an endogenous gene. In other embodiments, macrophages are engineered to contain exogenous coding sequences for IL-10 and MMP9. It may be preferable for macrophages to overexpress IL-10. It may be preferable for macrophages to overexpress MMP9. Alternatively, macrophages can be engineered to overexpress both IL-10 and MMP-9. The expression levels of IL-10 and / or MMP9 are elevated when compared to non-transfected macrophages. The expression levels of MMP9 are elevated when compared to macrophages transfected with IL-10 alone.

[0043] In some embodiments, the engineered macrophages are human monocyte-derived macrophages. In some embodiments, the macrophages are derived from monocytes by culturing in the presence of MCSF. Suitable culture conditions are discussed further below.

[0044] In some embodiments, baseline macrophages (i.e., pre-engineered or natural) are referred to as non-polarized human monocyte-derived macrophages, also called "resting" macrophages.

[0045] In some embodiments, the engineered macrophages are derived from iPSCs. Various methods for deriving macrophages from iPSCs are known in the art. At baseline, they will also be unpolarized or quiescent. Thus, in certain embodiments, the engineered macrophages are derived from pluripotent stem cells cultured in vitro. Preferably, such pluripotent stem cell- or iPSC-derived macrophages are hypoimmunogenic due to the knockout or knockdown of at least one gene associated with either HLA class I and / or HLA class II cell surface molecules. For example, the HLA class I-associated gene can be an HLA-A, HLA-B, HLA-C gene, or a B2M gene. The HLA class II-associated gene can be HLA-DP, DM, DO, DQ, and DR, or CIITA. While this knockout or knockdown is evident in macrophages, it can be introduced into any progenitor cells as macrophages differentiate from stem cells. In an exemplary method, the engineered macrophages of the invention may be produced by providing stem cells, such as induced pluripotent stem cells, optionally knocking out or down expression of at least one sequence encoding a unit within an HLA I or HLA II complex, differentiating the stem cells into embryoid bodies, optionally using BMP4, SCF, VEGF, and / or Rock inhibitor (Y-27632), differentiating the embryoid bodies into macrophage progenitor cells, optionally using M-CSF and IL-3, and maturing the macrophage progenitor cells into functional macrophages, optionally using M-CSF.

[0046] As used herein, overexpression relates to the artificial expression of an increased amount of a gene.

[0047] Where used in the examples, protein expression levels were quantified 16-24 hours after transfection. The expression levels listed herein are within the range of 4 x 10 6 pieces / ml(1cm 2 2 x 10 6Secreted protein concentrations are obtained for macrophage populations at a concentration of 1000 μg / mL (equivalent to 1000 μg / mL of cells). In the examples, macrophages were transfected, isolated by centrifugation, resuspended in TexMACs buffer supplemented with IL-3 and IL-14, and incubated at 37°C under 5% CO2. Those skilled in the art will be aware of equivalent conditions suitable for determining secreted protein concentrations.

[0048] In some embodiments, macrophages are engineered to overexpress IL-10 and secreted IL-10 protein levels are greater than about 300 pg / ml. Preferably, secreted IL-10 protein is greater than about 300 pg / ml, or 400 pg / ml, or 500 pg / ml, or 600 pg / ml, or 700 pg / ml, or 800 pg / ml, or 900 pg / ml, or 1,000 pg / ml, or 2,000 pg / ml, or 3,000 pg / ml, or 4,000 pg / ml, or 5,000 pg / ml, or 6,000 pg / ml, or 7,000 pg / ml, or 8,000 pg / ml, or 9,000 pg / ml, or 10,000 pg / ml, or 11,000 pg / ml. Preferably, these IL-10 protein levels are measured by culturing macrophages as described above, with the concentration of macrophages in the culture medium being 4×10 6 cells / ml (2 x 10 6 cells / cm 2 In a preferred embodiment, the macrophages are cultured at a concentration of 4×10 6When cultured in vitro at a cell concentration of 10,000 pg / ml, 15,000 pg / ml, or 20,000 pg / ml of IL-10 are secreted at a culture supernatant concentration of at least 10,000 pg / ml, 15,000 pg / ml, or 20,000 pg / ml. In particularly preferred embodiments, IL-10 is secreted at a culture supernatant concentration of 49,000 pg / ml or greater. In some embodiments, the engineered macrophages may secrete IL-10 at levels 1000-fold higher than unengineered, non-polarized hMDMs. Unengineered, non-polarized hMDMs have been described in the art, for example, in WO2019175595.

[0049] In some embodiments, macrophages are engineered to overexpress MMP9, and secreted MMP9 protein levels exceed about 200 ng / ml. Preferably, the secreted MMP9 protein is greater than about 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, or 1,000 ng / ml. Preferably, the secreted MMP9 protein level is between about 200 ng / ml and 2,000 ng / ml. In a preferred embodiment, the secreted MMP9 protein level exceeds 200 ng / ml. In one embodiment, the secreted MMP9 protein level exceeds 1,500 ng / ml. Preferably, the engineered macrophages (containing IL-10 and MMP9) have higher secreted MMP9 protein levels compared to the average secreted MMP9 protein level in macrophages engineered with IL-10 alone. In some embodiments, the engineered macrophages (comprising IL-10 and MMP9) have secreted MMP9 protein levels at least equal to the average level of secreted MMP9 protein in unpolarized, non-transfected macrophages. Preferably, the overall MMP activity of the engineered macrophages of the present invention is also increased compared to the overall MMP activity of macrophages engineered with IL-10 alone. In other embodiments, the overall MMP activity of the engineered macrophages is greater than the MMP activity of non-transfected macrophages. In preferred embodiments, the MMP activity of the engineered macrophages is at least 1.5-fold greater than the MMP activity of non-transfected macrophages. Preferably, these IL-10 and MMP9 protein levels are measured by culturing the macrophages as described above, wherein the concentration of macrophages in the culture medium is greater than 4×10 6 cells / ml (2 x 10 6 cells / cm 2The amount of engineered macrophages may be measured by culturing the cells with a polarized macrophage protein (corresponding to a 10-fold increase in the amount of MMP3) and measuring the concentration of the protein in the culture medium. In some embodiments, the engineered macrophages may secrete greater amounts of other matrix metalloproteinases. In certain embodiments, the engineered macrophages may secrete 10-fold greater amounts of matrix metalloproteinase-3 (MMP3) than non-engineered, non-polarized cells. In certain embodiments, the engineered macrophages may secrete 10-fold greater amounts of matrix metalloproteinase-10 (MMP10) than non-engineered, non-polarized cells.

[0050] The macrophages of the present invention may be used in treatment (particularly cell therapy) for a subject in need thereof. The subject may have a condition, disease, or disorder that would benefit from administration of the macrophages of the present invention. Such a condition, disease, or disorder may have an inflammatory and / or fibrotic component. Such a condition, disease, or disorder may be acute or chronic, or may be an acute exacerbation. Such a condition, disease, or disorder may cause organ damage. The organ may be any suitable organ, such as the liver, lung, or kidney.

[0051] In some embodiments, the condition, disease, or disorder in the subject is a chronic inflammatory condition with a fibrotic component. In some embodiments, the condition is chronic organ damage associated with chronic inflammation. In some embodiments, the condition is an acute inflammatory condition. In some embodiments, the condition is an acute exacerbation of a chronic inflammatory condition.

[0052] In some embodiments, the condition is associated with the kidney, liver, or lung. For example, the condition can be liver damage, kidney damage, or lung damage.

[0053] In some embodiments, the condition may be acute-on-chronic liver failure (ACLF). ACLF is a syndrome characterized by acute decompensation of chronic liver disease accompanied by organ failure and high short-term mortality. Excessive systemic inflammatory response is thought to play an important role in the development of ACLF.

[0054] In some embodiments, the condition may be liver injury. In a preferred embodiment, the liver injury is chronic liver injury, optionally inflammatory liver injury. In a preferred embodiment, the inflammatory liver injury has a fibrotic component. In a preferred embodiment, the condition is chronic inflammatory liver injury with a fibrotic component, preferably cirrhosis.

[0055] Liver cirrhosis represents the final stage of chronic liver injury and progressive fibrosis (scarring), regardless of underlying etiology. Liver cirrhosis is characterized by severe liver fibrosis, which causes liver structure collapse, hepatocyte dysfunction, and portal hypertension. Various etiologies can lead to liver cirrhosis. Liver disorders with fibrotic components that can lead to fibrosis include, but are not limited to, non-alcoholic fatty liver disease (NAFL) (for example, non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH)) or alcoholic liver disease (for example, alcoholic fatty liver disease (AFLD) or alcoholic steatohepatitis (ASH)).

[0056] The etiology that causes fibrosis may include, but is not limited to, fatty liver disease (SLD), such as metabolic dysfunction-associated fatty liver disease (MASLD), metabolic-associated steatohepatitis (MASH), or Met-ALD. In some cases, the cause of fatty liver disease is unknown, and may be referred to as idiopathic SLD.

[0057] Metabolic dysfunction-related fatty liver disease refers to non-alcoholic fatty liver disease, and therefore may also be known as NAFLD.Metabolic-related steatohepatitis refers to a more severe form of MASLD, and may also be known as NASH. "Met-ALD" refers to individuals who suffer from fatty liver disease and also drink alcohol. "Idiopathic SLD" refers to SLD of unknown cause, such as individuals who do not have any known metabolic risk factors for SLD.

[0058] Fibrotic diseases, disorders, and conditions may include mechanical trauma, biliary obstruction, autoimmune hepatitis, iron overload, hepatitis B infection (HBV), and / or hepatitis C infection (HCV). However, the engineered macrophages of the present invention are capable of treating cirrhosis regardless of the underlying etiology.

[0059] Cirrhosis can be either compensated cirrhosis or decompensated cirrhosis (also referred to herein as liver decompensation or HD). Decompensated cirrhosis is defined as a rapid decline in liver function in cirrhotic patients, and is characterized by symptoms including but not limited to jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, gastrointestinal bleeding, and any combination thereof. In other embodiments, the liver disease is decompensated cirrhosis. In some embodiments, the liver disease is compensated cirrhosis. In some embodiments, the patient has compensated cirrhosis and has at least one event (or exactly one event) of decompensated cirrhosis.

[0060] In a preferred embodiment, the patient has a MELD score of 10-18, more preferably 10-16 or 12-18.

[0061] In some embodiments, the liver disease is one in which cirrhosis is caused by hepatocyte damage, such as diseases of viral origin (including treated (sustained viral response) hepatitis C (HCV), hepatitis B), alcoholism damage (alcohol-related liver disease (ALD)), or non-alcoholic fatty liver disease (NAFLD) (including non-alcoholic steatohepatitis (NASH) (including NASH caused by diabetes or obesity), cryptogenic cirrhosis, hemochromatosis, or alpha-1-antitrypsin deficiency). In some embodiments, the underlying etiology has been eliminated (e.g., a patient suffering from alcoholism damage is no longer drinking, or a patient suffering from HCV damage no longer has HCV, etc.). In some embodiments, the patient with liver disease is at risk of end-stage renal disease.

[0062] In some embodiments, the liver disease is fatty liver disease (SLD). In some embodiments, the fatty liver disease is metabolic dysfunction-associated fatty liver disease (MASLD), Met-ALD, or idiopathic SLD. In some embodiments, the metabolic dysfunction-associated fatty liver disease (MASLD) is metabolic-associated steatohepatitis (MASH).

[0063] Cirrhosis can lead to acute-on-chronic liver failure (ACLF). In some embodiments, the liver disease is ACLF. ACLF is a condition distinct from liver decompensation, which is characterized by the development of ascites, hepatic encephalopathy, gastrointestinal bleeding, or any combination of these conditions in patients with cirrhosis. In contrast, ACLF is associated with organ failure and is associated with a high short-term mortality rate of over 15% at 28 days. Three main characteristics characterize this syndrome: ACLF occurs in the setting of intense systemic inflammation; ACLF frequently occurs in close temporal association with an inflammation-induced exacerbating event (e.g., infection or alcoholic hepatitis); and ACLF is associated with single or multiple organ failure. In some embodiments, engineered macrophages are used in the treatment of cirrhosis in subjects with ACLF.

[0064] Affected patients suitable for treatment or use according to any aspect or embodiment of the present invention may be patients with the relevant disease and severity.

[0065] In some embodiments, the subject has experienced a first liver decompensation event. In a preferred embodiment, the subject has been hospitalized after the first liver decompensation event. The subject may exhibit one or more clinical signs of liver decompensation selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding. The cells, compositions, and methods of the present invention are expected to be particularly effective in treating patients hospitalized after a first liver decompensation event. Furthermore, the data provided in the examples demonstrate that the cells, compositions, and methods of the present invention are suitable for treating these specific patients with severe, difficult-to-treat diseases.

[0066] Hospitalization after a liver decompensation event is a measure of disease severity and is indicative of a particular clinical situation. Certain symptoms of liver decompensation are similar to those of less severe liver cirrhosis, but if a patient is hospitalized after a first liver decompensation event, this indicates that the disease is sufficiently severe to particularly benefit from the present invention.

[0067] Thus, in certain embodiments, the present invention provides cells and compositions for use in methods of treating a patient exhibiting one or more clinical signs of liver decompensation selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding, wherein the one or more clinical signs require hospitalization.

[0068] Hospitalization refers to admission to a hospital for treatment. As such, hospitalization usually requires the patient to stay in the hospital for at least 24 hours. Since symptoms cannot be managed outside of the hospital, hospitalization is a measure of disease severity. Hospitalization is a recognized measure of disease severity and patient status in cirrhosis. 42 (See also, e.g., Balcar et al., United European Gastroenterol J. 2021; 9(4): 427-437).

[0069] In a preferred embodiment, the subject is treated with the cells, compositions, or cell populations of the present invention once the subject has recovered (recompensated) from the initial liver decompensation event, and optionally the subject has been hospitalized after the initial liver decompensation event. In some embodiments, the subject is treated with the cells, compositions, or cell populations of the present invention after being discharged from the hospital. According to some embodiments, recovery (recompensation) from the liver decompensation event is defined by a physician's clinical assessment and / or the absence of a significant increase in MELD score between discharge and treatment. In some embodiments, the subject is showing and / or recovering from one or more clinical signs of liver decompensation selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding.

[0070] According to a preferred embodiment, a subject is treated after recovery from an initial liver decompensation event requiring hospitalization and before experiencing additional liver decompensation events. As is known in the art, the severity and mortality of decompensated cirrhosis increases if a subject experiences multiple decompensation events. 42 Therefore, without being bound by theory or mechanism, it is preferable to treat a subject with the cells, compositions, and cell populations of the present invention after recovery from the initial liver decompensation event to increase the likelihood that the subject will survive without experiencing additional liver decompensation events and without requiring a liver transplant. In some embodiments, macrophages engineered to express human IL-10 and human MMP9 may be used in the treatment of liver cirrhosis.

[0071] In some embodiments, macrophages engineered to express human IL-10 and human MMP9 may be used to treat ACLF.

[0072] In some embodiments, the macrophages have a pro-restorative phenotype and are anti-inflammatory and anti-fibrotic, such phenotypes being further defined herein.

[0073] Macrophages engineered to express IL-10 and MMP9 can be genetically engineered in any suitable manner, for example, using viral or non-viral vectors, DNA or RNA constructs, or gene editing using any suitable technique. Thus, in some embodiments, macrophages can be engineered with one or more exogenous coding sequences. These exogenous coding sequences can encode IL-10 and / or MMP9 and / or can encode gene-editing proteins, such as CRISPR, nickase, etc., that can alter the cell's genome to increase expression of endogenous IL-10 and / or MMP9. This can be achieved, for example, by editing promoter or enhancer sequences.

[0074] Known viral vectors for transfecting macrophages include lentiviruses, adenoviruses, and adeno-associated viruses (AAV).

[0075] As used herein, "encoding" refers to the ability of a sequence of nucleotides, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of a macromolecule in a biological process, such as a defined amino acid sequence. Thus, a coding sequence can be any suitable nucleic acid sequence that provides instructions for synthesizing the relevant entity (e.g., IL-10 or MMP9). The coding sequences can be contained within the same vector / construct or can be contained in different vectors / constructs.

[0076] As used herein, "exogenous" refers to any material (especially genetic material) introduced from or produced outside of a particular cell. As used herein, in some embodiments, the exogenous coding sequence or engineered macrophage encodes / expresses IL-10 or MMP9. In some embodiments, the IL-10 and / or MMP9 are human. One of skill in the art will understand that variations in the sequence of these genes / coding sequences are also encompassed by the present invention. Ideally, the gene / coding sequence is human. The gene / coding sequence may be codon-optimized. The gene / coding sequence may be adjusted, and if the reference sequence is RNA, different nucleotides may be present in the DNA vector.

[0077] Preferably, the sequence of the IL-10 coding sequence provided is at least 80% similar or homologous to NCBI reference sequence: NM_000572.3 (human IL10 mRNA sequence), and preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% similar to the native sequence.

[0078] Preferably, the sequence of the MMP9 coding sequence provided is at least 80% similar or homologous to the NCBI reference sequence: NM_004994.3 (human matrix metallopeptidase 9 (MMP9), mRNA), and preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% similar to the native sequence.

[0079] Preferably, the expressed IL-10 protein is preferably at least 80% similar or homologous to the sequence presented as SEQ ID NO:4, preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% similar to SEQ ID NO:4.

[0080] Preferably, the expressed MMP9 protein is preferably at least 80% similar or homologous to the sequence presented as SEQ ID NO:6, preferably at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% similar to SEQ ID NO:6.

[0081] In some embodiments, the macrophages are non-virally engineered and engineered with a nucleic acid vector. In some embodiments, the macrophages are transfected with a DNA vector (e.g., a naked DNA vector). Preferably, the DNA vector may encode both IL-10 and MMP9 on a single vector. In some embodiments, the nucleic acid vector is not derived from a viral genome. In some embodiments, the macrophages are transfected with one or more free nucleic acids or vectors. In some embodiments, the macrophages are transfected with an RNA vector. In some embodiments, the macrophages are transfected with mRNA. Preferably, the macrophages are transfected with a single mRNA construct expressing IL-10 and MMP9.

[0082] In some embodiments, IL-10 and MMP9 are provided to macrophages as mRNA. Therefore, the engineered cells are provided with exogenous mRNA molecules. MMP9 and IL-10 can be present on the same mRNA molecule or on separate mRNA molecules. Preferably, MMP9 and IL-10 are present on the same mRNA molecule. More preferably, the mRNA is a bicistronic vector encoding both MMP9 and IL-10. Suitably, the mRNA molecule comprises a sequence set forth in any one of SEQ ID NOs: 1-3, 10, 13, or 14.

[0083] In some embodiments, the mRNA comprises a sequence encoding IL-10. In some embodiments, the mRNA comprises a sequence at least 80% identical to SEQ ID NO: 13. In some embodiments, the mRNA comprises a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13. In a preferred embodiment, the mRNA comprises the sequence set forth in SEQ ID NO: 13.

[0084] In some embodiments, the mRNA comprises a sequence encoding MMP9. In some embodiments, the mRNA comprises a sequence at least 80% identical to SEQ ID NO: 14. In some embodiments, the mRNA comprises a sequence at least 85%, at least 90%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 14. In preferred embodiments, the mRNA comprises the sequence set forth in SEQ ID NO: 14.

[0085] In some embodiments, macrophages are engineered with mRNA encoding both IL-10 and MMP9. In some embodiments, macrophages are engineered with mRNA comprising both the sequence set forth in SEQ ID NO: 13 and the sequence set forth in SEQ ID NO: 14. In some embodiments, the sequences set forth in SEQ ID NO: 13 and SEQ ID NO: 14 are present on the same mRNA molecule. In some embodiments, the sequences set forth in SEQ ID NO: 13 and SEQ ID NO: 14 are present on separate molecules. In a preferred embodiment, the mRNA comprises the sequences set forth in SEQ ID NO: 13 and SEQ ID NO: 14 on the same mRNA molecule separated by an mRNA encoding a self-cleaving linker. In a preferred embodiment, the self-cleaving linker has the amino acid sequence set forth in SEQ ID NO: 9. In a preferred embodiment, the mRNA encoding the self-cleaving linker has the sequence set forth in SEQ ID NO: 15.

[0086] In some embodiments, the mRNA construct expresses IL-10 fused to MMP9 via a cleavable linker. In some embodiments, the linker is p2A. p2A can have the amino acid sequence set forth in SEQ ID NO:9, which can be encoded by the mRNA sequence set forth in SEQ ID NO:8 or 15. In a preferred embodiment, p2A is encoded by the mRNA sequence set forth in SEQ ID NO:15. p2A is part of a larger family of 2A self-cleaving peptides or 2A peptides. This class of peptides is 18-22 amino acids long and can induce ribosomal skipping during protein translation in cells. These peptides share the DxExNPGP core sequence motif. This allows IL-10 and MMP9 to be expressed as separate proteins despite being present in the same mRNA molecule.

[0087] In preferred embodiments, both IL-10 and MMP9 are expressed from an mRNA molecule. In some embodiments, the mRNA molecule comprises a sequence at least 80% identical to SEQ ID NO: 10. In some embodiments, the mRNA molecule comprises a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10. In preferred embodiments, the mRNA comprises the sequence set forth in SEQ ID NO: 10. In particularly preferred embodiments, the mRNA comprises the sequence set forth in SEQ ID NO: 10, optionally further comprising a poly-A tail of 65-250 residues in length, preferably 90-120 residues in length, preferably about 90 residues in length, and / or a 5' cap. In particularly preferred embodiments, the mRNA comprises the sequence set forth in SEQ ID NO: 10, optionally further comprising a poly-A tail of 65-250 residues in length, preferably 90-120 residues in length, e.g., 90 residues in length, and a 5' cap. In preferred embodiments, the exogenous mRNA sequence comprises a sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 16. In particularly preferred embodiments, the exogenous mRNA sequence comprises the sequence set forth in SEQ ID NO: 16, preferably further comprising a 5' cap.

[0088] In some embodiments, the exogenous mRNA sequence comprises a 5' untranslated region sequence (5'UTR) that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 19. In preferred embodiments, the exogenous mRNA sequence comprises a 5' untranslated region sequence (5'UTR) that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 17. In preferred embodiments, the exogenous mRNA sequence comprises a 5'UTR sequence set forth in SEQ ID NO: 17.

[0089] In some embodiments, the exogenous mRNA sequence comprises a 3' untranslated region sequence (3'UTR) that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 20. In preferred embodiments, the exogenous mRNA sequence comprises a 3' untranslated region sequence (3'UTR) that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 18. In preferred embodiments, the exogenous mRNA sequence comprises the 3'UTR sequence set forth in SEQ ID NO: 18. In preferred embodiments, the exogenous mRNA comprises both the 5'UTR sequence set forth in SEQ ID NO: 17 and the 3'UTR sequence set forth in SEQ ID NO: 18.

[0090] Alternatively, or in addition, an IRES site may be inserted between the coding sequences, which, as one skilled in the art will understand, will disrupt expression to form two separate proteins.

[0091] In some embodiments, the mRNA molecule comprises a poly-A tail, which is a long chain of adenine nucleotides added to an mRNA molecule during RNA processing to increase the stability of the molecule. Suitable poly-A tails are 65-250 residues in length, preferably 90-120 residues in length. The poly-A tail makes the RNA molecule more stable and prevents its degradation.

[0092] In some embodiments, an mRNA molecule contains at least one cap. The 5' cap is characteristic of eukaryotic mRNA. Chemically, the 5' cap consists of an inverted 7-methylguanosine connected to the rest of the eukaryotic mRNA via a 5'-5' triphosphate bridge. This so-called "cap0" contributes, among other things, to eukaryotic mRNA stabilization, translation initiation, and mRNA degradation. Artificial cap structures have been designed to enhance the success of in vitro translation. Synthetic anti-inverted cap analogs include the trinucleotide CleanCap® AG, which is methylated at the first adenosine with additional methylation. At least one cap can be a synthetic cap analog, preferably CleanCap®.

[0093] In some embodiments, the mRNA is modified RNA. In some embodiments, the mRNA modification comprises a chemical modification of uridine and / or a chemical modification of cytidine. In some embodiments, the mRNA modification comprises pseudouridine, N1-methylpseudouridine, 5-methoxy-uridine, 5-methyl-cytidine, preferably 5-methoxy-uridine.

[0094] In certain embodiments, the mRNA is modified with 5-methoxyuridine and contains at least one CleanCap®.

[0095] In some embodiments, the mRNA construct comprises the sequence of SEQ ID NO:2 or a sequence that is at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% similar or homologous to SEQ ID NO:2.

[0096] In some embodiments, macrophages are engineered using nucleic acid vectors. In some embodiments, macrophages are transfected via electroporation. Other suitable transfection methods include nucleofection.

[0097] In some embodiments, the mRNA is delivered to macrophages via nanoparticles, which in some embodiments are lipid nanoparticles, such as those described in U.S. Patent Nos. 8,058,069, 8,492,359, 8,822,668, 9,364,435, 9,504,651, and 11,141,378.

[0098] In some embodiments, the macrophages are autologous or allogeneic to the subject, hi some embodiments, the macrophages are derived from progenitor cells such as iPSCs, hematopoietic stem cells, or monocytes.

[0099] In some embodiments, macrophages are derived from monocytes by culturing the monocytes under suitable conditions. Such conditions may suitably include: 1. An in vitro method for producing macrophages, comprising: (a) culturing monocytes in a medium for 3 to 5 days to produce macrophages, the medium containing one or more growth factors to stimulate macrophage production; A method in which step (a) is all carried out in the same medium.

[0100] Preferably, the medium is suitable for generating macrophages from monocytes. Preferably, the medium is a T cell medium. Preferably, the medium can be selected from X-Vivo 10, X-Vivo 15, TexMACS, AIMv, RPMI, DMEM, and DMEM / F12. Preferably, the medium is TexMACS (Miltenyi).

[0101] Preferably, the medium is serum-free. Preferably, the medium is xenoprotein-free. Preferably, the medium is GMP compliant.

[0102] Preferably, the medium may contain one or more factors. Suitable factors include growth factors, polysaccharides, cytokines, and chemokines. Suitable factors may include MCSF and GM-CSF. Thus, preferably, the factors are growth factors. Preferably, the one or more factors are GMP-compliant. In one embodiment, the medium may contain one or more growth factors, which may include MCSF or GM-CSF. Monocytes are most commonly cultured with either MCSF or GM-CSF. Culturing monocytes with GM-CSF biases them toward an "inflammatory" phenotype, while culturing monocytes with MCSF biases them toward a "pro-restorative" phenotype. In other embodiments, the one or more growth factors do not include a combination of MCSF and GM-CSF. Thus, in any of the methods of the present invention, if M-CSF is used as a growth factor to generate macrophages, it may be preferable not to also use GM-CSF to generate macrophages from monocytes. This is true for culturing monocytes until macrophages are generated.

[0103] According to a second aspect of the present invention there is provided a population of engineered macrophages as described herein, which may be suitable for use in the treatments described above.

[0104] According to a third aspect of the present invention, there is provided a composition comprising engineered macrophages. In some embodiments, the engineered macrophage composition is for use in the treatments described above, or is a population of engineered macrophages for use in the treatments described above. The composition may also include other pharmaceutically acceptable components (e.g., suitable cell culture medium, excipients, etc.).

[0105] According to any aspect of the present invention, the use preferably comprises administering to a subject an effective amount of the engineered macrophages.

[0106] According to any aspect of the invention, the use may include delivering the engineered macrophages to a subject by systemic administration, preferably by systemic injection. In some embodiments, administration is by local injection, for example, to the kidneys and lungs. In some embodiments, administration is to the lungs by nebulizer. Peripheral intravenous injection is preferred for liver conditions to avoid invasive procedures, for example, in patients with cirrhosis. Local injection, such as into the renal artery, for kidney conditions may be better tolerated.

[0107] Preferably, the macrophages used in therapy are engineered ex vivo and delivered to the patient.

[0108] However, in some embodiments, macrophages may be engineered in vivo. In some embodiments, macrophages are engineered in vivo by administering to a subject a preparation of exogenous coding sequences for IL-10 and MMP9 suitable for macrophage transfection. The preparation may include any of the exogenous coding sequences discussed herein. Delivery vehicles suitable for in vivo manipulation may include targeting molecules for macrophages that utilize macrophage cell surface markers. When in vivo transfection of macrophages is envisioned, local application of the preparation, such as local injection of the preparation into the liver or kidney, or spraying into the lungs, may be more effective. Such treatments may be prepared as nanoparticles to assist in macrophage targeting.

[0109] According to a fourth aspect of the present invention there is provided a method of improving monocyte migration to a site of inflammation, the method comprising the use of an engineered macrophage according to the first aspect of the invention, a population of engineered macrophages according to the second aspect of the invention or a composition according to the third aspect of the invention.

[0110] In some embodiments, the method polarizes host monocytes / macrophages toward a pro-restorative phenotype. In some embodiments, the method polarizes non-polarized host macrophages toward an anti-inflammatory and / or pro-restorative phenotype. In some embodiments, the method polarizes inflammatory host macrophages toward an anti-inflammatory and / or pro-restorative phenotype.

[0111] In some embodiments, the pro-restorative phenotype may be described using one or more of the following markers: increased CD206 and / or CD163, decreased inflammatory markers such as CD86 and / or MHC class II (HLA-DR). These increases / decreases are relative to non-polarized (resting) or pro-inflammatory macrophages. In terms of secretory profile, these macrophages are expected to not express TNFα, IFNg, and IL1b, which are typically associated with pro-inflammatory and pro-fibrotic profiles. In preferred embodiments, the engineered macrophages express CD206 at a five-fold higher level than non-engineered non-polarized cells, such as those described in WO 2019 / 17559.

[0112] In some embodiments, the engineered macrophages do not secrete TNFα, IFNg, IL1b, IL-12p70, and / or IL-2. In preferred embodiments, the engineered macrophages secrete less than 40 pg / ml of TNFα. In some embodiments, the engineered macrophages secrete the same or similar levels of TNFα, IFNg, IL1b, IL-12p70, and / or IL-2 as non-engineered, non-polarized cells.

[0113] The engineered macrophages secrete IL-10 and / or MMP9. In a preferred embodiment, the engineered macrophages secrete at least 10,000 pg / ml of IL-10. In a preferred embodiment, the engineered macrophages secrete at least 200 ng / ml of MMP9. In some embodiments, the engineered macrophages exhibit enhanced MMP activity. In a preferred embodiment, the engineered macrophages exhibit 1.5-fold greater MMP activity than non-engineered, non-polarized cells. In some embodiments, the engineered macrophages secrete IL-6 and / or CXCL8.

[0114] According to another aspect of the present invention, there are provided methods for producing engineered macrophages that express IL-10 and MMP 9. In some embodiments, the methods comprise introducing into a macrophage or a cell from which a macrophage is derived a nucleic acid comprising at least one sequence encoding IL-10 and at least one sequence encoding MMP 9.

[0115] In certain embodiments, the method comprises transiently transfecting macrophages with an mRNA construct comprising at least one sequence encoding IL-10 and at least one sequence encoding MMP9. In another aspect, a method is provided for producing engineered macrophages that express IL-10, such that the engineered macrophages secrete at least 10,000 pg / mL of IL-10, the method comprising introducing an IL-10-encoding nucleic acid into the macrophages or cells from which the macrophages are derived. In some embodiments, the method further comprises contacting the macrophages with an anti-inflammatory treatment (e.g., IL-4 and IL-13) after transfection. In some embodiments, the method comprises contacting the macrophages with IL-4 and IL-13. In some embodiments, the macrophages are incubated with IL-4, IL-13, and M-CSF.

[0116] In some embodiments, the method comprises electroporation. In some embodiments, the macrophages are contacted with an anti-inflammatory treatment after electroporation.

[0117] In certain embodiments, the present invention provides: 1. Engineered macrophages containing an exogenous coding sequence for IL-10 and an exogenous coding sequence for MMP9.

[0118] 2. The engineered macrophage of embodiment 1, wherein expression of the exogenous coding sequence has a synergistic effect in restoring MMP activity and / or has a synergistic effect in monocyte recruitment by the macrophage when compared to engineered macrophages containing only the exogenous sequence for IL-10.

[0119] 3. The engineered macrophage of embodiment 1 or 2, wherein the macrophage and / or coding sequence is human.

[0120] 4. The engineered macrophage of any one of embodiments 1-3, wherein the exogenous coding sequence is present on one or more nucleic acid molecules or is integrated into the genome of the macrophage.

[0121] 5. The engineered macrophage of embodiment 4, wherein the nucleic acid molecule is a DNA or RNA molecule, preferably an mRNA molecule.

[0122] 6. The engineered macrophage of embodiment 5, wherein the mRNA molecule comprises a chemically modified residue, preferably a modified uracil residue, and optionally comprises at least one synthetic cap.

[0123] 7. The engineered macrophage of any one of embodiments 1 to 6, wherein the exogenous coding sequence for IL-10 is on the same nucleic acid as the exogenous coding sequence for MMP9.

[0124] 8. Engineered to overexpress IL-10, preferably with secreted IL-10 protein levels of 4 x 10 6 8. The engineered macrophage of any one of embodiments 1 to 7, wherein the engineered macrophage has a cell concentration of greater than about 300 pg / ml at a cell concentration of 1 / ml.

[0125] 9. The engineered macrophage of any one of embodiments 1 to 8, wherein the level of metalloproteinase activity is at least 1.5 times the metalloproteinase activity of non-engineered macrophages.

[0126] 10. The engineered macrophage of any one of embodiments 1 to 7, wherein the metalloprotease activity is restored compared to the reduced metalloprotease activity in macrophages engineered with only the IL-10 coding sequence.

[0127] 11. The engineered macrophage of any one of embodiments 1 to 10, which is transiently transfected, optionally via electroporation.

[0128] 12. The engineered macrophage of embodiment 10, wherein the transfection is non-viral.

[0129] 13. The engineered macrophage of any one of embodiments 1 to 12, having a pro-restorative phenotype.

[0130] 14. A population of engineered macrophages according to any one of embodiments 1 to 13.

[0131] 15. A therapeutic composition comprising a population of macrophages described in embodiment 14 and a pharmaceutically acceptable vehicle.

[0132] 16. The engineered macrophage of any one of embodiments 1 to 13, the population of macrophages of embodiment 14, or the composition of embodiment 15 for use in therapy.

[0133] 17. The engineered macrophage, population, or composition of embodiment 16, wherein said treatment is administered to a subject in need thereof.

[0134] 18. The engineered macrophage of any one of embodiments 1 to 13, the population of macrophages of embodiment 14, or the composition of embodiment 15 for use in treating an inflammatory condition in a subject.

[0135] 19. The engineered macrophage, population, or composition of embodiment 17 or 18, wherein the macrophages are autologous or allogeneic to the subject.

[0136] 20. The engineered macrophage, population, or composition of embodiment 18 or 19, wherein the condition is a chronic inflammatory condition with a fibrotic component, and optionally the condition is organ damage associated with chronic inflammation.

[0137] 21. The engineered macrophage, population, or composition of embodiment 18 or 19, wherein the condition is acute onset of chronic liver failure (ACLF).

[0138] 22. A method for improving monocyte migration into an inflamed area, comprising the use of an engineered macrophage, a population of engineered macrophages, or a composition according to any one of embodiments 1 to 21.

[0139] 23. The method of embodiment 22, wherein host monocytes / macrophages are polarized toward a pro-restorative phenotype and / or away from a pro-inflammatory phenotype.

[0140] 24. A method for producing an engineered macrophage according to any one of embodiments 1 to 13, comprising transiently transfecting macrophages with mRNA molecules encoding IL-10 and / or MMP9.

[0141] 25. The method of embodiment 24, comprising contacting the macrophages with IL-4 and IL-13 before, during, or after transfection.

[0142] 26. The method of embodiment 24 or 25, wherein the mRNA molecules encoding IL-10 and MMP9 are co-transfected using a bicistronic vector linked by a p2A linker sequence.

[0143] 27. An engineered macrophage according to any one of embodiments 1 to 13, which is engineered with an mRNA construct encoding human IL-10 fused to human MMP9 protein via a cleavable linker.

[0144] 28. A method for treating inflammation and / or fibrosis, comprising administering a therapeutically effective amount of the engineered macrophage described in any one of embodiments 1 to 13 to a subject in need thereof.

[0145] The present invention also provides the following embodiments, which may be combined with any other embodiment: 1. Engineered macrophages that have been engineered to overexpress IL-10.

[0146] 2. 4×10 6 2. The engineered macrophage of embodiment 1, wherein when cultured in vitro at a cell concentration of 10,000 pg / ml, the engineered macrophage secretes IL-10 at a culture supernatant concentration of at least 10,000 pg / ml.

[0147] 3. The engineered macrophage of embodiment 1 or 2, which has been further engineered to overexpress MMP9.

[0148] 4. The engineered macrophage of embodiment 3, comprising an exogenous coding sequence for IL-10 and an exogenous coding sequence for MMP9.

[0149] 5. The engineered macrophage of embodiment 4, wherein expression of the exogenous coding sequence has a synergistic effect in restoring MMP activity and / or has a synergistic effect in monocyte recruitment by the macrophage when compared to engineered macrophages containing only the exogenous sequence for IL-10.

[0150] 6. The engineered macrophage of any one of embodiments 1 to 5, wherein the macrophage and / or coding sequence is human.

[0151] 7. The engineered macrophage of any one of embodiments 4-6, wherein the exogenous coding sequence for IL-10 encodes a protein having an amino acid sequence at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4, and optionally, the IL-10 protein comprises an amino acid sequence identical to SEQ ID NO:4.

[0152] 8. The engineered macrophage of any one of embodiments 4-7, wherein the exogenous coding sequence for MMP9 encodes a protein having an amino acid sequence at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6, and optionally, the MMP9 protein comprises an amino acid sequence identical to SEQ ID NO:6.

[0153] 9. The engineered macrophage of embodiment 4, 5, 7, or 8, wherein the exogenous coding sequence is present on one or more nucleic acid molecules or is integrated into the genome of the macrophage.

[0154] 10. The engineered macrophage of embodiment 9, wherein the nucleic acid molecule is a DNA or RNA molecule, preferably an mRNA molecule, and optionally, IL-10 and MMP9 are expressed from the same mRNA molecule, and further optionally, the mRNA molecule encodes IL-10 and MMP9 linked by a linker sequence, and further optionally, the linker is a self-cleaving 2A linker, and further optionally, the linker is p2A.

[0155] 11. The engineered macrophage of embodiment 10, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13, and optionally the nucleic acid comprises SEQ ID NO: 13.

[0156] 12. The engineered macrophage of embodiment 10 or 11, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 14, and optionally the nucleic acid comprises SEQ ID NO: 14.

[0157] 13. The engineered macrophage of any one of embodiments 10-12, wherein the nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, wherein the linker sequence encodes a protein comprising the amino acid sequence set forth in SEQ ID NO:7, and optionally, the protein encoded by the linker sequence comprises the amino acid sequence set forth in SEQ ID NO:9.

[0158] 14. The engineered macrophage of any one of embodiments 10 to 13, wherein the nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, the linker sequence comprising an mRNA having the sequence set forth in SEQ ID NO: 15.

[0159] 15. The engineered macrophage of any one of embodiments 10-14, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 80% identical to SEQ ID NO: 10, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10, and optionally the mRNA further comprises a poly-A tail and / or a 5' cap of 65-250 residues in length, preferably 90-120 residues in length, preferably about 1000 residues in length.

[0160] 16. The engineered macrophage of any one of embodiments 10 to 15, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 80% identical to SEQ ID NO: 16, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 16, and optionally the mRNA further comprises a 5' cap.

[0161] 17. The engineered macrophage of embodiment 16, wherein the mRNA molecule comprises a chemically modified residue, preferably a modified uracil residue, and optionally comprises at least one synthetic cap.

[0162] 18. The engineered macrophage of any one of embodiments 4 to 17, wherein the exogenous coding sequence for IL-10 is on the same nucleic acid as the exogenous coding sequence for MMP9.

[0163] 19. The engineered macrophage of any one of embodiments 1 to 18, wherein the macrophage is engineered by editing the endogenous promoter of the IL-10 gene and / or the MMP9 gene, or the macrophage is engineered by modulating the expression of an endogenous silencing RNA, or the macrophage is engineered by introducing an exogenous silencing RNA sequence, optionally wherein the silencing RNA is an miRNA.

[0164] 20. The engineered macrophage of any one of embodiments 1 to 19, wherein the level of metalloproteinase activity is at least 1.5 times the metalloproteinase activity of non-engineered macrophages.

[0165] 21. An engineered macrophage according to any one of embodiments 1 to 20, wherein CD86 expression is reduced by at least two-fold compared to non-engineered non-polarized cells.

[0166] 22. An engineered macrophage according to any one of embodiments 1 to 21, in which HLA-DR expression is reduced by at least two-fold or more compared to non-engineered non-polarized cells.

[0167] 23. The engineered macrophage of any one of embodiments 1 to 22, which has at least a 1000-fold increase in IL-10 secretion compared to non-engineered, non-polarized cells.

[0168] 24. An engineered macrophage according to any one of embodiments 1 to 23, which has at least a 10-fold increase in MMP3 secretion compared to non-engineered non-polarized cells.

[0169] 25. An engineered macrophage described in any one of embodiments 1 to 24, which has at least a 20-fold increase in secretion of MMP10 compared to non-engineered non-polarized cells.

[0170] 26. 4×10 6 26. The engineered macrophage of any one of embodiments 1 to 25, which, when cultured in vitro at a cell concentration of 10,000 pg / ml, secretes IL-10 at a culture supernatant concentration of at least 10,000 pg / ml.

[0171] 27. 4×10 6 27. The engineered macrophage of any one of embodiments 1 to 26, which secretes MMP9 at a culture supernatant concentration of at least 200 ng / ml when cultured in vitro at a cell concentration of 100 ng / ml.

[0172] 28. An engineered macrophage described in any one of embodiments 1 to 27, which has at least 5-fold increased expression of CD206 compared to monocytes.

[0173] 29. The engineered macrophage of any one of embodiments 1 to 28, wherein expression of 25F9 is increased by at least 5-fold compared to monocytes.

[0174] 30. An engineered macrophage according to any one of embodiments 1 to 29, wherein CD80 expression is reduced by at least 10% compared to non-engineered non-polarized cells.

[0175] 31. 4×10 6 31. The engineered macrophage of any one of embodiments 1 to 30, which secretes TNF-α at a culture supernatant concentration of up to 40 pg / ml when cultured in vitro at a cell concentration of 10 pg / ml.

[0176] 32. An engineered macrophage according to any one of embodiments 1 to 31, having a phagocytic capacity at least equivalent to that of a non-engineered, non-polarized cell.

[0177] 33. The engineered macrophage of any one of embodiments 1 to 32, wherein the metalloprotease activity is restored compared to the reduced metalloprotease activity in macrophages engineered with only the IL-10 coding sequence.

[0178] 34. An engineered macrophage according to any one of embodiments 1 to 33, which is transiently transfected, optionally via electroporation.

[0179] 35. The engineered macrophage of embodiment 34, wherein the transfection is non-viral.

[0180] 36. The engineered macrophage of any one of claims 1 to 35, having a pro-restorative phenotype.

[0181] 37. A population of engineered macrophages according to any one of embodiments 1 to 36.

[0182] 38. A therapeutic composition comprising a population of macrophages described in embodiment 37 and a pharmaceutically acceptable vehicle.

[0183] 39. An engineered macrophage according to any one of embodiments 1 to 36, a population of macrophages according to embodiment 37, or a composition according to embodiment 38, for use in therapy.

[0184] 40. The engineered macrophage, population, or composition of embodiment 39, wherein said treatment is administered to a subject in need thereof.

[0185] 41. An engineered macrophage according to any one of embodiments 1 to 36, a population of macrophages according to embodiment 37, or a composition according to embodiment 38, for use in treating an inflammatory condition in a subject.

[0186] 42. The engineered macrophage, population, or composition of embodiment 40 or 41, wherein the macrophage is autologous or allogeneic to the subject.

[0187] 43. The engineered macrophage, population, or composition of embodiment 41, wherein the inflammatory condition is liver injury, optionally chronic liver injury.

[0188] 44. The engineered macrophage, population, or composition of embodiment 41 or 43, wherein the condition is a chronic inflammatory condition with a fibrotic component, and optionally the condition is organ damage associated with chronic inflammation.

[0189] 45. The engineered macrophage, population, or composition of embodiment 41, 43, or 44, wherein the condition is fibrosis, and the fibrosis is in or affects an organ selected from the group consisting of the liver, lung, heart, kidney, pancreas, skin, gastrointestinal tract, bone marrow, hematopoietic tissue, nervous system, eye, and combinations thereof.

[0190] 46. ​​The engineered macrophage, population, or composition of embodiment 43 or 44, wherein the condition is cirrhosis of the liver.

[0191] 47. The engineered macrophage, population, or composition of embodiment 46, wherein the cirrhosis results from at least one disease or condition selected from the group consisting of non-alcoholic fatty liver disease (NAFL) (e.g., non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH)), alcoholic liver disease (e.g., alcoholic fatty liver disease (AFLD) or alcoholic steatohepatitis (ASH)), mechanical trauma to the liver, bile duct obstruction, autoimmune hepatitis, iron overload, hepatitis B infection (HBV), and hepatitis C infection (HCV).

[0192] 48. The engineered macrophage, population, or composition of embodiment 46, wherein the cirrhosis results from fatty liver disease (SLD), and optionally the fatty liver disease is metabolic dysfunction-associated fatty liver disease, metabolic-associated steatohepatitis, Met-ALD, or idiopathic SLD.

[0193] 49. The engineered macrophage, population, or composition of any one of embodiments 46 to 48, wherein the cirrhosis is selected from compensated cirrhosis or decompensated cirrhosis.

[0194] 50. The engineered macrophage, population, or composition of any one of embodiments 41 to 49, wherein the condition is acute onset of chronic liver failure (ACLF).

[0195] 51. The engineered macrophage, population, or composition of any one of embodiments 46-49 for use in treating a subject who has recovered (recompensated) from an initial liver decompensation event, optionally wherein the initial liver decompensation event required hospitalization of the subject, and preferably wherein the subject does not experience a further liver decompensation event after recovering from the initial liver decompensation event.

[0196] 52. The engineered macrophage, population, or composition of any one of embodiments 46-49 and 51, wherein the subject is exhibiting or recovering from one or more clinical signs of liver decompensation selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding.

[0197] 53. The engineered macrophage, population, or composition of any one of embodiments 1-52, wherein the macrophages are derived from human monocyte-derived macrophages (hMDMs) or stem cells, and optionally, the stem cells are induced pluripotent stem cells (iPSCs).

[0198] 54. The engineered macrophage, population, or composition of embodiment 53, wherein the macrophage is derived from iPSCs, and the iPSCs essentially lack functional HLA I and II complexes on their surface.

[0199] 55. A method for improving monocyte migration into an inflamed area, comprising the use of an engineered macrophage, a population of engineered macrophages, or a composition described in any one of embodiments 1 to 54.

[0200] 56. The method of embodiment 55, wherein host monocytes / macrophages are polarized toward a pro-restorative phenotype and / or away from a pro-inflammatory phenotype.

[0201] 57. A method for producing an engineered macrophage according to any one of embodiments 1 to 36, comprising transiently transfecting macrophages with mRNA molecules encoding IL-10 and / or MMP9.

[0202] 58. The method of embodiment 57, comprising contacting the macrophages with IL-4, IL-13, and M-CSF before, during, or after transfection.

[0203] 59. The method of embodiment 57 or 58, wherein the mRNA molecules encoding IL-10 and MMP9 are co-transfected using a bicistronic vector linked by a p2A linker sequence.

[0204] 60. An engineered macrophage described in any one of embodiments 1 to 36, which is engineered with an mRNA construct encoding human IL-10 fused to human MMP9 protein via a cleavable linker.

[0205] 61. A method for treating inflammation and / or fibrosis, comprising administering a therapeutically effective amount of an engineered macrophage described in any one of embodiments 1 to 36 to a subject in need thereof.

[0206] 62. A method for polarizing macrophages toward a pro-restorative phenotype, wherein the polarized macrophages have increased expression of CD163 and CD206 and decreased expression of HLA DR and CD86 compared to cells not polarized toward a pro-restorative phenotype, the method comprising engineering the macrophages to express above endogenous levels of IL-10 and MMP9.

[0207] 63. The method of embodiment 62, wherein the macrophages have been engineered to express IL-10 and MMP9 by introducing an exogenous nucleic acid comprising a nucleotide sequence encoding IL-10 and MMP9.

[0208] 64. The method of embodiment 63, wherein the nucleotide sequences encoding IL-10 and MMP9 are present on the same nucleic acid molecule.

[0209] 65. The method of embodiment 63, wherein the nucleotide sequences encoding IL-10 and MMP9 are present on separate nucleic acid molecules.

[0210] 66. The method of any one of embodiments 63 to 65, wherein the nucleic acid is mRNA.

[0211] 67. A method of polarizing macrophages to a pro-restorative phenotype, wherein the polarized macrophages have increased expression of CD163 and CD206 and decreased expression of HLA DR and CD86 compared to cells not polarized to a pro-restorative phenotype, the method comprising engineering the macrophages to overexpress IL-10, optionally wherein the macrophages are cultured at a concentration of 4×10 6 When cultured in vitro at a cell concentration of 10,000 cells / ml, the cells secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml.

[0212] 68. The method of embodiment 67, wherein the macrophages have been engineered to express IL-10 by introducing an exogenous nucleic acid comprising a nucleotide sequence encoding IL-10.

[0213] 69. The method of embodiment 67 or 68, wherein the nucleic acid is mRNA.

[0214] 70. A method for improving the cryoprotectivity of macrophages, comprising incubating macrophages in a medium containing IL-4, IL-13, and M-CSF.

[0215] 71. A method for cryopreserving macrophages, comprising incubating the macrophages in a medium containing IL-4, IL-13, and M-CSF prior to cryopreservation.

[0216] 72. The concentrations of IL-4 and IL-13 in the medium were 20 ng / ml, the concentration of M-CSF was 100 ng / ml, and the number of macrophages was 4 × 10 6 72. The method of embodiment 70 or 71, wherein the cell is at a concentration of cells / ml.

[0217] 73. A method according to any one of embodiments 70 to 72, wherein the cells are incubated overnight in a medium containing IL-4, IL-13, and M-CSF.

[0218] 74. Cryopreserved macrophages obtained by a method according to any one of embodiments 70 to 73.

[0219] According to a preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 for use in a method of treating liver cirrhosis in a subject hospitalized after a first liver decompensation event. In a preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 for use in a method of treating liver cirrhosis in a subject hospitalized after a first liver decompensation event, wherein the subject is treated with the engineered macrophages after the subject has recovered from the first liver decompensation event and before experiencing a further liver decompensation event. In a particularly preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and MMP9 for use in a method of treating liver cirrhosis in a subject hospitalized after a first liver decompensation event, wherein the subject is treated with the engineered macrophages after the subject has recovered from the first liver decompensation event and before experiencing a further liver decompensation event.

[0220] According to a further preferred embodiment, the present invention provides engineered macrophages that are derived from iPSCs and engineered to overexpress IL-10. Preferably, the engineered iPSC-derived macrophages are used in the treatment of liver cirrhosis, particularly in subjects hospitalized after a first liver decompensation event. In a particularly preferred embodiment, the engineered iPSC-derived macrophages are used in the treatment of liver cirrhosis, particularly in subjects hospitalized after a first liver decompensation event, wherein the subject is treated with the engineered macrophages after the subject has recovered from the first liver decompensation event and before the subject experiences a further liver decompensation event.

[0221] According to a further preferred embodiment, the present invention provides engineered macrophages engineered to overexpress IL-10 and MMP9, the engineered macrophages comprising exogenous mRNA encoding IL-10 and MMP9, optionally separated by a cleavable linker. Preferably, the exogenous mRNA comprises the sequence set forth in SEQ ID NO: 10, a polyA tail (optionally 65-250 residues in length, preferably 90-120 residues in length), and a 5' cap. In another preferred embodiment, the exogenous mRNA sequence comprises the sequence set forth in SEQ ID NO: 16 and a 5' cap. Preferably, the engineered macrophages are for use in the treatment of liver cirrhosis, particularly in subjects hospitalized after a first liver decompensation event. In a particularly preferred embodiment, the engineered macrophages are for use in the treatment of liver cirrhosis, particularly in subjects hospitalized after a first liver decompensation event, wherein the subject has recovered from the first liver decompensation event and before experiencing a further liver decompensation event, and the subject is treated with the engineered macrophages.

[0222] According to a further preferred embodiment, the present invention provides engineered macrophages derived from iPSCs and engineered to overexpress IL-10 and MMP9, the engineered macrophages comprising exogenous mRNA encoding IL-10 and MMP9, optionally separated by a cleavable linker. Preferably, the exogenous mRNA comprises the sequence set forth in SEQ ID NO: 10, a polyA tail (optionally 65-250 residues in length, preferably 90-120 residues in length, preferably about 90 residues in length), and / or a 5' cap. In another preferred embodiment, the exogenous mRNA sequence comprises the sequence set forth in SEQ ID NO: 16 and a 5' cap. Preferably, the iPSC-derived engineered macrophages are for use in the treatment of liver cirrhosis, particularly in subjects hospitalized after a first liver decompensation event. In a particularly preferred embodiment, the iPSC-derived engineered macrophages are used to treat liver cirrhosis, particularly in subjects who have been hospitalized after a first liver decompensation event, and the subject is treated with the engineered macrophages after the subject has recovered from the first liver decompensation event and before the subject experiences a further liver decompensation event.

[0223] According to a further preferred embodiment, the present invention provides engineered macrophages that have been engineered to overexpress IL-10 for use in a method for treating liver cirrhosis, particularly in subjects hospitalized after a first liver decompensation event, comprising: 4×10 6

[0010] According to a particularly preferred embodiment, the present invention provides engineered macrophages that have been engineered to overexpress IL-10 for use in a method for treating liver cirrhosis, particularly in a subject hospitalized after a first liver decompensation event, wherein the engineered macrophages secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml when cultured in vitro at a cell concentration of 4 x 10 cells / ml. 6The engineered macrophages secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml when cultured in vitro at a cell concentration of 10,000 pg / ml, and a subject is treated with the engineered macrophages once the subject has recovered from an initial liver decompensation event and before the subject experiences a further liver decompensation event.

[0224] According to a further preferred embodiment, the present invention provides an engineered macrophage that has been engineered to overexpress IL-10 and MMP9, and has a level of metalloproteinase activity that is at least 1.5-fold greater than that of non-engineered macrophages; at least a two-fold reduction in CD86 expression compared to non-engineered non-polarized cells; at least a two-fold reduction in HLA-DR expression compared to non-engineered non-polarized cells; at least a 1000-fold increase in IL-10 secretion compared to non-engineered non-polarized cells; at least a 10-fold increase in MMP3 secretion compared to non-engineered non-polarized cells; at least a 20-fold increase in MMP10 secretion compared to non-engineered non-polarized cells; at least a five-fold increase in CD206 expression compared to monocytes; at least a five-fold increase in 25F9 expression compared to monocytes; at least a 10% reduction in CD80 expression compared to non-engineered non-polarized cells; and at least a 4x10 6 When cultured in vitro at a cell density of 4 x 10 cells / ml, they secrete IL-10 at a concentration of at least 10,000 pg / ml in the culture supernatant; 6 When cultured in vitro at a cell density of 100 cells / ml, the cells secrete MMP9 at a culture supernatant concentration of at least 200 ng / ml; and 6The present invention provides engineered macrophages that secrete TNF-α at a culture supernatant concentration of up to 40 pg / ml when cultured in vitro at a cell concentration of 1000 cells / ml. In a particularly preferred embodiment, the engineered macrophages are derived from iPSCs, and the macrophages contain exogenous mRNA encoding IL-10 and MMP9, optionally separated by a cleavable linker. Preferably, the iPSC-derived engineered macrophages are for use in the treatment of liver cirrhosis, particularly in subjects hospitalized after a first liver decompensation event. The invention will now be further described with reference to the following headed sections. Any feature under any section may be combined with any of the aspects or embodiments of the invention, in any practicable order.

[0225] explanation The following definitions are provided:

[0226] "Payload," as used herein, refers to a gene of therapeutic interest that is introduced by transfection and tested for its effect on macrophages.

[0227] "Non-polarized macrophages," as used herein, refer to mature macrophages that have not received further stimulation to elicit a specific functional capability; non-polarized macrophages may also refer to naive or non-activated macrophages.

[0228] "Mature macrophages" refer to macrophages that express mature cell surface markers (preferably CCR2-, CD14+, and 25F9+).

[0229] Macrophages can adopt a variety of states termed "polarization," which is usually simplistically divided into two main extremes: "pro-inflammatory" (or classically activated, "M1," "M1-like") and "pro-regenerative" (or "pro-resolving," alternatively activated, "M2," "M2-like," anti-inflammatory, or anti-fibrotic). However, macrophages can adopt states between these extremes; states can be "non-polarized," resting, or naive (M0), or can approach anti-inflammatory or pro-inflammatory states.

[0230] It is generally assumed that M1 macrophages are proinflammatory, while M2 macrophages are involved in immune regulation and wound healing responses. However, it is becoming increasingly clear that this binary classification fails to address the more complex heterogeneity in vivo, where macrophages adopt distinct phenotypes and even switch phenotypes in response to various stimuli. These in vivo macrophage phenotypes cannot be accurately reproduced in tissue culture models, highlighting the importance of functional macrophage characterization. Macrophages acquire a "pro-regenerative" state under the influence of a combination of various factors, including macrophage colony-stimulating factor (M-CSF), IL-4, IL-13, IL-10, and TGF-β. Macrophages primarily mediate wound healing and tissue regeneration.

[0231] Due to the complexity of macrophage biology, the classification into "M1" and "M2" may be considered an oversimplification. For example, "M2" macrophages are actually considered to be a spectrum depending on the environment. Therefore, further subcategorization of pro-regenerative M2-like states has been attempted, such as the following subcategorization proposed by Gharavi, AT et al., "The role of macrophage subtypes and exosomes in immunomodulation," Cell Mol Biol Lett 27, 83 (2022). This subcategorization includes, for example: "M2a" cells are thought to be anti-inflammatory, pro-fibrotic, and involved in allergy and wound healing. Such cells are classified by their expression of IL-10, IL-1R, IL-27a, CCL1, CCL17, CCL18, CCL22, CD11b, CD45, CD206, YM1, RELMa, IGF1, DCIR, stabilin 1, factor XIII-A, Ly6C, TREM-2, and DC-SIGN. The M2a state can be achieved under the influence of factors such as IL-4, IL-13, IL-10, and PPARg. "M2b" cells are thought to be involved in activating T helper 2 (Th2)-type responses, immunoregulation, and promoting tumor progression. Such cells are classified by their expression of IL-6, TNF-α, CD86, and SPHK1. The M2b state can be achieved under the influence of IL-1b or exposure to LPS. "M2c" cells are associated with immunosuppression, phagocytosis, tissue repair, and extracellular matrix remodeling. Such cells are classified by their expression of IL-10, CXCL13, CD163, CD206, CXCR4, TGF-b, and MerTK. The M2c state can be achieved under the influence of IL-10, glucocorticoids, IL-6, IL-10, TNF-a, and TLR stimulation. "M2d" cells are associated with tumor progression, angiogenesis, and clearance of apoptotic tissue. Such cells are characterized by expression of IL-10, VEGF, and TGF-b. The M2d state can be attained upon exposure to LPS.

[0232] Among the markers associated with each of these pro-restorative states, the engineered macrophages of the present invention may typically express IL-10, CCL22, CD11b, CD45, CD206, CD86, CD163, and CXCR4. The engineered macrophages of the present invention may also express MHC II, which is typically associated with pro-inflammatory macrophages at elevated levels. Thus, the engineered macrophages of the present invention express markers associated with multiple subtypes (e.g., both M2a- and M2c-like cells), demonstrating their distinctness from the pro-restorative, anti-inflammatory macrophages described in the literature. However, in all aspects of the present invention, the engineered macrophages of the present invention may express markers consistent with functional human monocyte-derived macrophages, such as CD45, CD14, CD206, CCR2, CD163, CD169, and 25F9.

[0233] The engineered macrophages of the present invention (containing IL-10 and MMP9) function as "pro-restoring" macrophages. As described, for example, in Ramachandran et al., Proc Natl Acad Sci USA. 2012 Nov. 13; 109(46): E3186-E3195, pro-restoring macrophages exhibit a loss of pro-inflammatory gene expression, an increase in expression of matrix-degrading enzymes, and an enrichment of phagocytosis-related genes. Furthermore, the phenotype of pro-restoring macrophages falls outside the M1 / M2 paradigm, highlighting the limitations of this classification in an in vivo setting. Pro-restoring macrophages play an important role in tissue remodeling (e.g., resolving fibrosis).

[0234] The macrophages reported in Ramachandran et al. have high MMP activity. Furthermore, in Figure 5, the authors show several genes regulated in pro-restorative macrophages. Notably, there is upregulation of Mrc1 (now CD206), which is also expressed in the macrophages of the examples presented here. Furthermore, as shown in the examples presented here, there are low levels of TNFα and IL1b. This may therefore indicate a pro-restorative phenotype. However, these macrophages described in this paper naturally express low levels of IL-10.

[0235] "GMP-compliant," as used herein, means that a method complies with the principles of good manufacturing practice and may be used interchangeably with "GMP-compatible" and "GMP-grade." For example, GMP-compliant media must be serum-free, antibiotic-free, animal-substance-free, and xenoprotein-free. The WHO provides the following guidance on what is required for good manufacturing practice: "Chapter 1: WHO good manufacturing practices: Main principles for pharmaceutical products." Quality Assurance of Pharmaceuticals: A compendium of guidelines and related materials - Good manufacturing practices and inspection. 2 (2nd updated ed.). WHO Press. pp. 17-18. ISBN 9789241547086.

[0236] As used herein, "UT," "NTRx," or "UT N / T" refers to untransfected macrophages that have been differentiated from monocytes by the same process used to differentiate transfected macrophages, but without any further incubation with additional factors and / or transfection. Such macrophages are similar to the unpolarized, untransfected cells used in the MATCH study described in WO2019175595 (and therefore UT may also be described herein as MATCH-like cells), except that the macrophages in the MATCH study were matured for 7 days, whereas the UT macrophages in the present application were matured for 5 days.

[0237] As used herein, "UT+TR," "NTRx+Tr," or "UT T" refers to untransfected cells (described above) that have been treated similarly to the transfected cells (i.e., mock transfection followed by incubation with IL-4, IL-13, and M-CSF). Incubation with IL-4, IL-13, and M-CSF is described in more detail in the Examples herein.

[0238] Also described herein are hMDMs that have been transfected with constructs encoding particular products, such as MMP9 and / or IL-10, that have not been treated with IL-4+IL-13+M-CSF as described herein. Such cells are referred to as "TRx," e.g., cells that have been transfected with IL-10 but not incubated with IL-4+IL-13+M-CSF are designated "IL-10 TRx."

[0239] Also described herein are hMDMs transfected with constructs encoding specific products and further treated with IL-4+IL-13+M-CSF. Such cells are designated "TRx+TR," such as "IL-10 TRx+TR." Also described herein are hMDMs transfected with an exogenous bicistronic mRNA construct expressing IL-10 and MMP9. Such cells are designated "RTX001." Without wishing to be bound by theory or mechanism, overexpression of IL-10 and MMP9 implies that RTX001 cells may self-polarize toward an anti-inflammatory and / or pro-restorative phenotype.

[0240] It should be noted that the term "a" or "an" entity refers to one or more of that entity.

[0241] "About" means + / -10%, + / -9%, + / -8%, + / -7%, + / -6%, + / -5%, + / -4%, + / -3%, + / -2%, + / -1% of the stated value, unless otherwise defined.

[0242] Engineered macrophages used as cell therapy In a preferred embodiment, the present invention relates to engineered macrophages, which contain exogenous coding sequences for one or more of IL-10 and MMP9.

[0243] The present invention relates to engineered macrophages that have been engineered to express IL-10 and MMP9. The macrophages can be engineered to express these proteins by including exogenous coding sequences. The exogenous coding sequences can be extrachromosomal or integrated into the genome of the cells. The engineered macrophages express the exogenous coding sequences for IL-10 and MMP9.

[0244] In some embodiments, the engineered macrophages carry one or more exogenous sequences that can initiate endogenous expression of IL-10 and / or MMP 9. Any macrophage that has been genetically modified by any means via an exogenous sequence (i.e., a sequence that is not part of the native macrophage genome) is an engineered macrophage according to the present invention.

[0245] The engineered macrophages may be used in therapies used in the treatment of, for example, inflammatory and / or fibrotic conditions in a subject.

[0246] Preferably, administration of the engineered macrophages to a subject is not associated with an inflammatory response, and in particular, administration of the engineered macrophages to a subject is not associated with an increase in the concentration of inflammatory cytokines in the plasma, such as IL-1b and / or TNF-α.

[0247] "Macrophage," as used herein, refers to a phagocyte that is involved in the detection, engulfment, and destruction of pathogens and apoptotic cells and is generated by the differentiation of monocytes. "Engineered macrophages" of the present invention refer to macrophages that have been engineered to express IL-10 and / or MMP9. In particular, this expression exceeds endogenous levels, such that the engineered macrophages express IL-10 and / or MMP9 at elevated levels compared to non-engineered cells. Macrophages can be engineered to express these proteins by including exogenous coding sequences. In some embodiments, macrophages can be engineered to express IL-10 and / or MMP9 at levels exceeding 4×10 6 When cultured in vitro at a cell concentration of 4×10 cells / ml, the macrophages secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. 6 When cultured in vitro at a cell density of 100 cells / ml, the cells secrete MMP9 at a culture supernatant concentration of at least 200 ng / ml.

[0248] In some embodiments, the IL-10 amino acid sequence is encoded by an mRNA comprising the sequence of SEQ ID NO: 1. The native mRNA sequence of IL-10 mRNA is provided in NCBI Reference Sequence: NM_000572.3. Variants and homologues of this sequence are also included.

[0249] MMP9 (matrix metallopeptidase 9) is a matrix metalloproteinase that is a type IV collagenase. MMP9 is also known as 92 kDa type IV collagenase, 92 kDa gelatinase, or gelatinase B (GELB). Matrix metalloproteinases (MMPs), also known as matrix metalloproteinases or matrixins, are a family of peptidases that can collectively cleave all components of the extracellular matrix (ECM). MMPs can also process bioactive mediators such as growth factors, cytokines, chemokines, and cell surface receptors. Twenty-five mammalian MMPs have been identified, which play various roles in ECM maintenance and tissue repair processes, and play both inhibitory and stimulatory roles in fibrosis.

[0250] In some embodiments, the MMP9 coding sequence is human MMP9 as set forth in NCBI Reference Sequence: NM_004994.3. In some embodiments, the amino acid sequence is encoded by an mRNA comprising the sequence of SEQ ID NO:3, or a variant at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% similar to SEQ ID NO:3.

[0251] In some embodiments, the mRNA is modified. In some embodiments, the mRNA modification is selected from chemical modifications of uridine and / or chemical modifications of cytidine and pseudouridine. In some embodiments, the mRNA modification comprises pseudouridine, N1-methylpseudouridine, 5-methoxy-uridine, 5-methyl-cytidine, and preferably 5-methoxy-uridine. In a preferred embodiment, all endogenous uridines are replaced with 5-methoxy-uridine.

[0252] In some embodiments, the mRNA comprises a poly-A tail at the 3' end. Suitable poly-A tails are 65-250 residues in length, preferably 90-120 residues in length. In preferred embodiments, the 3'UTR and 5'UTR are modified relative to the endogenous 3'UTR and 5'UTR. In some embodiments, the poly-A tail is 120 residues in length. In preferred embodiments, the poly-A tail is longer than the endogenous poly-A tail. In particularly preferred embodiments, the poly-A tail is 90 residues in length. In particularly preferred embodiments, the mRNA comprises the sequence of SEQ ID NO: 10, or a variant at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% similar to SEQ ID NO: 10. In another preferred embodiment, the exogenous mRNA sequence comprises a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 16. In a particularly preferred embodiment, the exogenous mRNA sequence comprises the sequence set forth in SEQ ID NO: 16. As used herein, endogenous uridines in SEQ ID NOs: 10 and 16 are replaced with 5-methoxy-uridine. In a preferred embodiment, the mRNA comprises the sequence of SEQ ID NO: 10, a 90 residue long poly-A tail, and a 5' cap. In a preferred embodiment, the mRNA comprises the sequence of SEQ ID NO: 16 and a 5' cap.

[0253] In some embodiments, the mRNA is resistant to degradation. In some embodiments, the mRNA is not immunogenic.

[0254] In some embodiments, the IL-10 protein and the MMP9 protein are expressed by separate exogenous coding sequences or nucleic acid molecules, hi some embodiments, the IL-10 protein and the MMP9 protein are expressed as a fusion protein encoded by a single mRNA molecule linked by a cleavable linker.

[0255] In some embodiments, the mRNA comprises the sequence of SEQ ID NO:2, or a variant that is at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, 99% similar to SEQ ID NO:2.

[0256] In some embodiments, the mRNA is modified at either or both the 5' and 3' ends by any means that enhances stability and / or ability to express the encoded protein.

[0257] In some embodiments, one or more of the ribonucleotides of the mRNA molecule are modified, hi some embodiments, one or more uracil bases are modified, preferably to 5-methoxy-uridine.

[0258] In some embodiments, one or both caps on the mRNA molecule are synthetic, preferably CleanCap®.

[0259] Overexpression is understood as "excessive" or higher level expression of a gene, such as caused by an increase in the transcription frequency of the gene. Therefore, overexpression can also be considered as exceeding the wild-type or normal expression level. Overexpression can be defined by referring to the amount of protein produced for a cell population, or by referring to a fold increase from the wild-type or normal expression level. Expression level can be described as the amount of protein secreted per volume of cell culture. However, increased transcription may not necessarily lead to an increase in the amount of secreted protein.

[0260] Cells that overexpress IL-10 and / or MMP9 contain coding sequences that express IL-10 and / or MMP9 at elevated levels relative to unengineered cells. As discussed above, overexpression can be achieved by introduction of exogenous nucleic acid encoding IL-10 and / or MMP9, such as mRNA, or by genetic modification that stimulates expression of IL-10 and / or MMP9 from endogenous coding sequences. Engineered macrophages that overexpress IL-10 and / or MMP9 may not necessarily secrete greater amounts of IL-10 and / or MMP9 relative to unengineered macrophages.

[0261] As used herein, overexpression refers to an increase in the amount of artificial expression of a gene compared to the expression level of the gene that has not been artificially modified (which may be referred to herein as wild-type or native macrophages). As used in the Examples, expression levels were quantified 16-24 hours after transfection. The expression levels listed herein are those above 4 x 10 6 pieces / ml(1cm 2 2 x 10 6 The secreted protein concentration is obtained for a macrophage population at a concentration of 1000-150 ...

[0262] In one embodiment, overexpression of IL-10 refers to a secreted IL-10 protein level greater than about 300 pg / ml. Preferably, the IL-10 expression level is greater than about 300 pg / ml, 400 pg / ml, 500 pg / ml, 600 pg / ml, 700 pg / ml, 800 pg / ml, 900 pg / ml, 1,000 pg / ml, 2,000 pg / ml, 3,000 pg / ml, 4,000 pg / ml, 5,000 pg / ml, 6,000 pg / ml, 7,000 pg / ml, 8,000 pg / ml, 9,000 pg / ml, 10,000 pg / ml, or 11,000 pg / ml. In a preferred embodiment, the level of secreted IL-10 protein is greater than 10,000 pg / ml.

[0263] In one embodiment, "relative overexpression" of IL-10 in a culture of IL-10-engineered macrophages means that the level of secreted IL-10 protein in the culture is increased by about 100-300 pg / ml or by more than about 300 pg / ml compared to the average wild-type protein secretion in a culture of wild-type macrophages cultured under identical conditions. Suitably, the increase in IL-10 expression level is greater than about 300 pg / ml, or 400 pg / ml, or 500 pg / ml, or 600 pg / ml, or 700 pg / ml, or 800 pg / ml, or 900 pg / ml, or 1,000 pg / ml, or 2,000 pg / ml, or 3,000 pg / ml, or 4,000 pg / ml, or 5,000 pg / ml, or 6,000 pg / ml, or 7,000 pg / ml, or 8,000 pg / ml, or 9,000 pg / ml, or 10,000 pg / ml, or 11,000 pg / ml. In a preferred embodiment, the level of secreted IL-10 protein is greater than 10,000 pg / ml. Preferably, these IL-10 protein levels are measured by culturing macrophages as described above, with the concentration of macrophages in the culture medium being 4×10 6 cells / ml (2 x 10 6 cells / cm 2The protein concentration can be measured by culturing macrophages at a density of 4×10 6 When cultured in vivo at a cell concentration of 10,000 pg / ml, the engineered macrophages secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml. In some embodiments, the engineered macrophages can secrete IL-10 at levels 1000-fold higher than non-engineered, non-polarized hMDMs. Non-engineered, non-polarized hMDMs have been described in the art, for example, in WO2019175595.

[0264] In one embodiment, expression of MMP9 means that the level of secreted MMP9 protein is about 200 ng / ml to 2000 ng / ml. Preferably, the secreted MMP9 protein is greater than about 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, or 1,000 ng / ml. Preferably, the level of secreted MMP9 protein is about 200 ng / ml to 2000 ng / ml. In a preferred embodiment, the level of secreted MMP9 is greater than 200 ng / ml. Preferably, the engineered macrophages (containing IL-10 and MMP9) have a higher level of secreted MMP9 protein compared to the average level of secreted MMP9 protein in macrophages engineered with IL-10 alone. Suitably, the overall MMP activity of the engineered macrophages of the present invention is also increased compared to the overall MMP activity of macrophages engineered with IL-10 alone, hi a preferred embodiment, the overall MMP activity of the engineered macrophages is at least 1.5-fold increased compared to untransfected macrophages.

[0265] In one embodiment, "relative overexpression of MMP9" in a culture of MMP9-engineered macrophages means that the level of secreted MMP9 protein in the culture is increased by 200 ng / ml to 2000 ng / ml compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, the level of secreted MMP9 protein is greater than about 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, or 1,000 ng / ml compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, the increase in the level of secreted MMP9 protein in the culture is about 200 ng / ml to 2000 ng / ml compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, these MMP9 protein levels are measured by culturing macrophages as described above, with the concentration of macrophages in the culture medium being 4×10 6 cells / ml (2 x 10 6 cells / cm 2 The protein concentration can be measured by culturing macrophages at a density of 4×10 6When cultured in vivo at a cell concentration of 100 / ml, the engineered macrophages secrete MMP9 at a culture supernatant concentration of at least 200 ng / ml. In preferred embodiments, the level of secreted MMP9 exceeds 200 ng / ml. Preferably, the increase in secreted MMP9 levels in cultures of IL-10-MMP9-engineered macrophages (i.e., containing IL-10 and MMP9) is greater than the average increase in secreted MMP9 protein in cultures of macrophages engineered with MMP9 alone, compared to the average wild-type protein expression in cultures of wild-type macrophages cultured under identical conditions. Preferably, the overall MMP activity of the engineered macrophages of the present invention is also greater than the overall MMP activity of macrophages engineered with IL-10 alone. In some embodiments, these increases are synergistic. In preferred embodiments, the overall MMP activity of the engineered macrophages is at least 1.5-fold greater than that of untransfected macrophages.

[0266] In one embodiment, "relative overexpression of MMP9" in a culture of IL-10-manipulated macrophages means that the level of secreted MMP9 protein in the culture is reduced by about 50 ng / ml to 100 ng / ml, about 100 ng / ml to 200 ng / ml, or about 200 ng / ml to 2000 ng / ml, compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, the reduction in the level of secreted MMP9 protein is greater than about 100 ng / ml, 300 ng / ml, 400 ng / ml, 500 ng / ml, 600 ng / ml, 700 ng / ml, 800 ng / ml, 900 ng / ml, or 1,000 ng / ml, compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under the same conditions. Preferably, the reduction in the level of secreted MMP9 protein is about 200 ng / ml to 500 ng / ml compared to the average wild-type protein expression in a culture of wild-type macrophages cultured under identical conditions.

[0267] The engineered macrophages of the present invention (containing IL-10 and MMP9) secrete elevated levels of MMP9 compared to the levels of MMP9 expressed by macrophages engineered with IL-10 alone (see Figure 1: IL-10-MMP9 Trx vs. IL-10 Trx). In one embodiment, the macrophages are engineered with at least one DNA vector encoding IL-10 and / or MMP9. It will be appreciated that the DNA vector may require one or more accessory sequences, such as a promoter, terminator, poly(A) signal sequence, etc.

[0268] A "promoter" is a nucleotide sequence that initiates and controls the transcription of a polynucleotide. Promoters can include inducible promoters (expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. The terms "promoter" or "regulatory element" are intended to include full-length promoter regions and functional segments of these regions (such as segments that control transcription or translation).

[0269] In one embodiment, the DNA vector may include one or more liver-specific or cirrhosis-specific promoters. In some embodiments, the DNA vector may include the CX3CR1 promoter, insulin-like growth factor 1 (IGF1), or CD1 IB promoter.

[0270] "Operably linked" refers to an arrangement of elements in which the components so described are configured to perform their normal function. Thus, a given promoter operably linked to a nucleic acid sequence can affect the expression of that sequence when the appropriate enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to induce expression of that sequence. Thus, for example, a promoter sequence can still be considered "operably linked" to a coding sequence even if untranslated but transcribed sequences exist between the promoter sequence and the nucleic acid sequence. Thus, the term "operably linked" is intended to encompass any spacing or orientation between a promoter element and a DNA sequence of interest that allows initiation of transcription of the DNA sequence of interest upon recognition of the promoter element by a transcription complex.

[0271] "Treatment," as used herein, refers to an intervention in a physiological condition that prevents, reduces, or eliminates clinical symptoms associated with a given physiological condition in a subject.

[0272] A "therapeutically effective amount" of macrophages, as described herein, is any amount that, when used alone or in combination with another therapeutic agent, protects a subject from developing disease or promotes disease regression as evidenced by a reduction in the severity of disease symptoms, an increase in the frequency and duration of disease symptom-free periods, or prevention of functional impairment or disability due to disease affliction. The ability of a therapeutic agent to promote disease regression can be assessed using a variety of methods known to the skilled practitioner, for example, in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in an in vitro assay. Therapeutically effective amounts and administration regimens can be determined empirically by testing in known in vitro or in vivo (e.g., animal model) systems.

[0273] "Subject," or "individual," or "animal," or "patient," means any subject (particularly a mammalian subject) for whom diagnosis, prognosis, or treatment is desired, except where the subject is defined as a "healthy subject." Mammalian subjects include humans; domestic animals; farm animals; such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, and dairy cows.

[0274] Preferably, the subject may be in need of treatment. Thus, preferably, the subject may be suffering from a disease, condition, or disorder, or may be at risk of developing a disease, condition, or disorder. Preferably, the subject may exhibit one or more symptoms of a disease, condition, or disorder.

[0275] The engineered macrophages of the present invention may be used for therapy. The macrophages of the present invention may be used for treating an inflammatory condition and / or a fibrotic condition in a subject. As defined above, treating herein may refer to the prevention, reduction, or elimination of inflammation / fibrosis / organ damage. For example, the engineered macrophages may be administered to a subject in an acute inflammatory stage for the purpose of preventing a chronic inflammatory condition. The engineered macrophages may also be administered to a subject in a chronic inflammatory stage for the purpose of preventing / reducing chronic fibrosis. The engineered macrophages may also be administered to a subject experiencing an acute exacerbation of a chronic inflammatory stage, such as acute exacerbation of chronic liver failure (ACLF).

[0276] Suitably, an acute disease or injury may be classified as a disease or injury that occurs less than 24 weeks from the cause. Suitably, a chronic disease may be classified as a disease or injury that has persisted for more than 6 months. Suitably, an acute exacerbation of a chronic disease may be classified as a disease or injury that occurs less than 24 weeks from the cause in a patient already suffering from a chronic disease that has persisted for more than 6 months. Suitably, the engineered macrophages of the present invention may be administered to a subject with an acute disease to prevent the transition to or increase in chronic inflammation and fibrosis.

[0277] Fibrosis refers to the deposition of extracellular matrix and connective tissue following tissue injury, which results in replacement of parenchymal tissue and, if excessive, may ultimately lead to scarring. In some embodiments, the condition is fibrosis.

[0278] In some embodiments, the condition is in or affects an organ selected from the group consisting of the liver, lung, heart, kidney, pancreas, skin, gastrointestinal, bone marrow, hematopoietic tissue, nervous system, eye, or a combination thereof.

[0279] Preferably, the condition is chronic organ damage associated with chronic inflammation. Preferably, the condition relates to the kidney, liver, or lung. For example, the condition may be inflammatory liver damage, inflammatory kidney damage, or inflammatory lung damage.

[0280] Advantageously, the present invention relates to a cell therapy product for inflammatory organ injury based on monocyte-derived macrophages genetically modified with a payload that induces a pro-restorative phenotype.

[0281] Preferably, the engineered macrophages have a pro-restorative phenotype and are anti-inflammatory and anti-fibrotic.

[0282] The M2-like phenotype is pro-restorative, whereas the M1-like phenotype is pro-inflammatory.

[0283] The engineered macrophages contain exogenous coding sequences for IL-10 and MMP9. The exogenous coding sequences can be provided in any suitable manner. They can be in the form of a nucleic acid vector, delivered by any method, or genetically modified. For example, by using viral or non-viral vectors, by using DNA or RNA constructs, or by gene editing using any suitable technique.

[0284] Macrophages engineered to express IL-10 and MMP9 may be genetically engineered in any suitable manner, for example, by the use of viral or non-viral vectors, by the use of DNA or RNA constructs, or by gene editing using any suitable technique.

[0285] Macrophages can be engineered by viruses. Such genetic engineering methods use viruses such as lentivirus, adenovirus, or AAV to introduce exogenous coding sequences / payloads into macrophages. The virus can provide the exogenous coding sequence / payload as an "extrachromosomal" construct, or the gene can be integrated into the macrophage genome. Viral engineering of macrophages requires careful techniques, as documented in the art, to prevent macrophages from phagocytosing the virus.

[0286] Preferably, the engineered macrophages are engineered non-virally, for example, using a nucleic acid vector containing an exogenous coding sequence. The nucleic acid can be any suitable nucleic acid, including DNA and RNA. Preferably, the macrophages are transfected with a DNA vector. Preferably, the DNA vector is a naked DNA vector, such that it is free of proteins and / or lipids. Preferably, the DNA vector is not derived from a viral genome. Optionally, the DNA vector is a non-integrating vector, such that it can function without being integrated into the macrophage chromosome. Alternatively, the nucleic acid vector is a messenger RNA (mRNA) molecule.

[0287] Preferably, the DNA vector comprises at least one sequence encoding IL-10 and / or MMP9 operably linked to a promoter.

[0288] As used herein, "encoding" refers to the ability of a particular nucleotide sequence, such as a gene or mRNA, to serve as a template for the synthesis of a macromolecule, such as a protein, within a cell. A gene encodes a protein if the protein is produced within a cell by transcription and translation of the mRNA corresponding to that gene.

[0289] Preferably, the engineered macrophages are genetically engineered macrophages that contain a nucleic acid construct that overexpresses IL-10 and expresses MMP9.

[0290] Preferably, the mRNA molecule expresses IL-10 and / or MMP9. In other words, the mRNA contains coding sequences for IL-10 and MMP9 that are exogenous to macrophages. The mRNA may be chemically modified. The chemical modification may be any suitable modification, most notably any suitable modification for improving the half-life of the mRNA within the cell. Suitable modifications are discussed extensively herein.

[0291] Nucleic acid vectors can be introduced into cells using any suitable transfection method (e.g., but not limited to, cationic liposome-mediated transfection, lipofection, polymer encapsulation, peptide-mediated transfection, or biolistic particle delivery systems such as "gene guns"). Preferably, macrophages are transfected with nucleic acids via electroporation. Other suitable transfection methods include nucleofection.

[0292] Macrophages can be suitably manipulated by modifying their genomes through gene editing. Gene editing allows for the permanent insertion of exogenous coding sequences. Numerous gene editing techniques are known, including those that require the use of nucleases. A variety of nucleases are known that can be used to modify genomes, ranging from base editing technology, prime editing technology, to gene editing. Many nucleases are known, including zinc finger, TALEN, and guided nucleases. These can be induced by RNA ("RNA"-guided nucleases), and can be induced by enzymes involved in CRISPR, including, but not limited to, Cas9, Cas12a, Cas13, Mad7, etc. Macrophages themselves can be the subject of gene editing, or progenitor cells can be gene-edited before being converted into macrophages.

[0293] Preferably, the macrophages are transfected with one or more free nucleic acids or vectors.

[0294] Preferably, macrophages are transfected with exogenous coding sequences for one or more of IL-10 and MMP9.

[0295] Preferably, the macrophages are provided with at least one exogenous coding sequence for IL-10 and at least one exogenous coding sequence for MMP9.

[0296] Preferably, the macrophages are engineered to overexpress IL-10 and express MMP9.

[0297] Preferably, the macrophages are autologous or allogeneic to the subject.

[0298] The present invention also relates to populations of engineered macrophages described herein, which may be used as cell therapies.

[0299] Preferably, the use comprises administering to a subject an effective amount of the engineered macrophages.

[0300] The present invention also relates to a composition comprising the engineered macrophages or populations thereof of the present invention. Preferably, the composition is a pharmaceutical composition.

[0301] Preferably, the engineered macrophages can be formulated into a pharmaceutical composition. Preferably, the composition is suitable for administration to a subject. Preferably, the composition is a liquid. Preferably, the composition is an insoluble liquid.

[0302] Preferably, the engineered macrophages are administered to a subject by any route. Delivery to a subject is by local administration or systemic administration. In some embodiments, administration is by, for example, local injection, aerosol, or systemic injection. Preferably, the engineered macrophages are administered to a subject by injection. Preferably, the engineered macrophages are administered to a subject parenterally (preferably intravenously). Preferably, the engineered macrophages are administered to a subject by injection or infusion. Preferably, the engineered macrophages are administered to a subject intravenously by infusion.

[0303] The present invention also relates to a method of improving monocyte migration into inflammation, the method comprising the use of an engineered macrophage according to the first aspect of the invention, a macrophage population according to the second aspect of the invention, or a composition according to the third aspect of the invention.

[0304] Preferably, the engineered macrophages, engineered macrophages for use in therapy, or engineered macrophages used in methods for improving monocyte migration to inflammation have a chemoattractant effect on monocytes. The engineered macrophages may have a chemoattractant effect on monocytes in vitro or in vivo. Recruitment of host monocytes at the site of inflammation / damaged organ is advantageous for treating inflammatory conditions. In some embodiments, the engineered macrophages have a chemoattractant effect specifically on monocytes and not on other immune cell types. In some embodiments, the engineered macrophages, when administered to a subject with fibrosis, e.g., a subject with a chronic inflammatory condition with a fibrotic component, localize to and / or recruit monocytes to the site of fibrosis. The presence of engineered macrophages or monocytes at the site of fibrosis may be determined by flow cytometry, as described in the Examples herein. In some embodiments, the site of fibrosis may be the lung or liver.

[0305] Generation of engineered macrophages expressing IL-10 and MMPs The present invention also relates to a method for producing engineered macrophages that express IL-10 and MMP9, comprising transiently transfecting macrophages with a composite mRNA construct comprising at least one sequence encoding IL-10 and at least one sequence encoding MMP9. In some embodiments, the macrophages are contacted with an anti-inflammatory treatment after transfection. In some embodiments, the macrophages are contacted with IL-4 and IL-13. In other embodiments, the macrophages are contacted with IL-4, IL-13, and M-CSF. Preferably, the engineered macrophages overexpress IL-10 and, as a result of coexpression with MMP9, restore MMP activity (whereas MMP activity is otherwise suppressed by IL-10). Preferably, the engineered macrophages are pro-restorative. Preferably, the engineered macrophages produced may be used in cell therapy.

[0306] In particular, macrophages engineered to overexpress IL-10 or to overexpress IL-10 and MMP9 exhibit a pro-regenerative phenotype without further anti-inflammatory treatment after transfection. Preferably, the engineered macrophages produced are manufactured according to GMP standards. Thus, preferably, the engineered macrophages and populations thereof are GMP-compliant.

[0307] In another embodiment, the method of producing an engineered macrophage comprises introducing sequences encoding IL-10 and / or MMP9 into the genome of the macrophage.

[0308] In a preferred embodiment, in the population of engineered macrophages produced by the present method, at least 80% of the macrophages secrete IL-10.

[0309] Also provided herein are methods for improving the cryoresistance of macrophages, the method comprising incubating macrophages in a medium containing IL-4, IL-13, and M-CSF. According to some embodiments, the incubation with IL-4, IL-13, and M-CSF occurs prior to cryopreservation. According to some embodiments, IL-4, IL-13, and M-CSF are removed from the medium prior to cryopreservation, such that IL-4, IL-13, and M-CSF are absent from the cryopreservation medium. According to some embodiments, provided herein are methods for cryopreserving macrophages, the method comprising incubating macrophages in a medium containing IL-4, IL-13, and M-CSF prior to cryopreservation. According to some embodiments, the method for improving cryoresistance or the method for cryopreserving macrophages further comprises removing IL-4, IL-13, and M-CSF from the medium prior to cryopreservation. As used herein, the term "cryoresilience" (which may also be referred to as "recovery") refers to the viability of macrophages after cryopreservation, optionally as measured by the percentage of cryopreserved macrophages that survive freezing. In some embodiments, the concentrations of IL-4 and IL-13 in the medium are 20 ng / ml, the concentration of M-CSF is 100 ng / ml, and macrophages are 4×10 6 In some embodiments, the cells are incubated overnight in medium containing IL-4, IL-13, and M-CSF.

[0310] Macrophages for manipulation Preferably, the macrophages to be engineered are produced from any suitable progenitor cells. Preferably, the macrophages are produced in vitro.

[0311] Preferably, the macrophages to be engineered are derived from monocytes. Preferably, the macrophages to be engineered are human monocyte-derived macrophages (hMDMs). Monocyte-derived refers to macrophages differentiated from monocytes. Monocytes are the natural precursors of macrophages and dendritic cells and are found in blood and bone marrow. Preferably, the macrophages are derived from peripheral blood monocytes, and preferably, the macrophages are peripheral blood monocyte-derived macrophages. Preferably, the macrophages are human peripheral blood monocyte-derived macrophages. Preferably, the monocytes are isolated from a human subject.

[0312] Preferably, the macrophages are derived from monocytes by culturing the monocytes, preferably in vitro. Preferably, the macrophages are derived from monocytes using any suitable culture method.

[0313] Preferably, macrophages are produced in vitro from monocytes by a culture method lasting 3-8 days, optionally lasting 4-8 days. Preferably, macrophages are produced in vitro from monocytes by a culture method lasting 3-7 days, particularly 4-7 days or 5-7 days. In one embodiment, macrophages are produced in vitro from monocytes by a culture method lasting 3-5 days, 4 or 5 days, or 7 days, known as the 5-day method or the 7-day method, respectively. An example of an in vitro method for producing macrophages from monocytes is described in WO 2019 / 175595. The "5-day" method is described in Application No. PCT / GB2021 / 051294, the contents of which are incorporated herein by reference.

[0314] Preferably, the macrophages are cultured using the "day 5" method, (a) culturing monocytes in a medium for 3-5 days or 4-5 days to produce macrophages, wherein the medium contains one or more growth factors to stimulate macrophage production; The method is carried out by carrying out all of step (a) in the same medium.

[0315] Preferably, the medium contains one or more growth factors selected from the CSF family, preferably M-CSF. Preferably, the medium contains M-CSF at a concentration of 25 to 150 ng / mL. Preferably, the medium contains 100 ng / mL GMP-grade recombinant human macrophage colony-stimulating factor 1 (rhM-CSF-1, also known as "rh(recombinant human) CSF-1").

[0316] In other embodiments, the macrophages are produced from stem cells, such as pluripotent or multipotent stem cells, hi certain embodiments, the macrophages are produced from induced pluripotent stem cells (iPSCs).

[0317] Anti-inflammatory treatment In one embodiment, a method for producing engineered macrophages engineered with a combination of IL-10 and MMP9 comprises transient transfection of macrophages with exogenous coding sequences for IL-10 and MMP9. The coding sequences may be provided by transfection with a nucleic acid (e.g., one or more mRNA molecules).

[0318] Macrophages are provided with at least one exogenous coding sequence for IL-10 and at least one exogenous coding sequence for MMP9.

[0319] In some embodiments, macrophages are contacted with an anti-inflammatory treatment after transfection with an exogenous coding sequence. Preferably, the anti-inflammatory treatment comprises an anti-inflammatory cytokine. In some embodiments, macrophages are contacted with an anti-inflammatory treatment comprising IL4 and IL3.

[0320] In some embodiments, an anti-inflammatory treatment may be added during the process of transfecting macrophages.

[0321] The transfected macrophages may be contacted with these anti-inflammatory cytokines (IL4 and IL13) for a period of about 2 hours to about 48 hours, preferably for a period of 4 hours to 40 hours, preferably for a period of 12 to 24 hours, optionally for about 16 hours.

[0322] The transfected macrophages may be contacted with these anti-inflammatory cytokines (IL4 and IL13) at a concentration of 2 ng / mL to 200 ng / mL, preferably at a concentration of 5 ng / mL to 150 ng / mL, preferably at a concentration of 10 ng / mL to 100 ng / mL, preferably at a concentration of 15 ng / mL to 75 ng / mL, preferably at a concentration of 20 ng / mL to 50 ng / mL.

[0323] Preferably, the anti-inflammatory treatment is used as a solution.

[0324] In the step of contacting macrophages with IL4+IL13, the cells are preferably seeded as follows: 4×10 6 2 x 10 cells / mL 6 hMDM / cm 2 .

[0325] The present invention will now be described with reference to the following figures. [Brief explanation of the drawings]

[0326] [Figure 1] Plots showing experimental results of transfection of macrophages with IL-10 and IL-10 + MMP9 - macrophages secrete high levels of IL-10. A: hMDMs transfected with IL-10 show reduced expression levels of MMP9. B: hMDMs transfected with IL-10 + MMP9 show elevated levels of MMP9. The dotted line represents the minimum desired level of product. [Figure 2]1 is a plot showing experimental results of transfection of macrophages with various constructs. Shown is the percentage of IL-10 secreting cells over a 2-hour period using a flow cytometry capture assay. Both constructs result in a high percentage of secreting cells. Each symbol represents an independent donor. [Figure 3] Figure 1 shows the experimental results of transfection of macrophages with various constructs in terms of cell surface markers. Flow cytometry analysis of hMDM identity cell surface markers. The solid black line is the normalized level of expression by unmanipulated cells. Each plot represents a different macrophage cell surface marker: A: CD45, B: CD14, C: CD206, D: CCR2, E: CD163, F: CD169, and G: 25F9. [Figure 4] Plots showing experimental results of macrophage transfection with various constructs in terms of proinflammatory markers. As measured by flow cytometry, the proinflammatory markers CD86 (A) and HLA-DR (B) are significantly downregulated in engineered cells. Other inflammatory markers are substantially unchanged compared to non-Trx hMDM. CD80 expression is desired to be 20% or less or 10-15% above non-engineered (NTx) levels. The solid black line represents the level in non-Trx cells. The dotted red line represents the maximum desired level. Each symbol represents an independent donor. [Figure 5] 1 is a plot showing experimental results of transfection of macrophages with various constructs in terms of phagocytic capacity. Phagocytosis is measured using pH-sensitive (pHrodo) beads coated with E. coli. The percentage of phagocytic macrophages is measured by flow cytometry. Each symbol represents an independent donor. The dotted line represents the minimum desired percentage of phagocytic macrophages. [Figure 6]Figure 1 shows the experimental results of macrophage transfection with various constructs in terms of M1 (A and B) and M2 (C and D) markers. M1 and M2 markers are used as indicators of the pro- and anti-inflammatory phenotypes of in vitro-generated macrophages. Flow cytometry analysis of M1 and M2 cell surface markers in macrophages treated overnight with the supernatant of non-Trx, non-Trx, IL-10 Trx, and IL-10 + MMP9 Trx hMDM. M2 = positive control: macrophages from the same donor polarized with high levels of IL-10 (dotted line). Plot A shows the results for CD86, plot B shows the results for HLA DR, plot C shows the results for CD206, and plot D shows the results for CD163. [Figure 7] Figure 1 shows experimental results of transfection of macrophages with various constructs in terms of their effect on migration of other cells. Results of a PBMC migration assay as measured by flow cytometry. Only monocytes showed significant migration. Data are normalized to Ntrx cells (black line), and the minimum desired increase is indicated by the dotted line. [Figure 8] 1 is a plot showing experimental results of transfection of macrophages with various constructs on MMP expression. Shown are MMP activity assays in the supernatants of tested NTrx, NTrx + treated, IL-10 Trx, and IL-10 + MMP9 Trx hMDMs. The dotted line represents 1.5-fold the activity level measured in the supernatants of NTrx hMDMs. Each symbol represents an independent donor. [Figure 9A] 1A-1C are plots showing experimental results of transfection of macrophages with various constructs at the location of an in vivo injury site. Shown is the percentage of live (7AAD-) human macrophages measured in digests from fibrotic livers using flow cytometry. Each point represents an individual mouse. Data are reported as the mean ± standard deviation (SD). Plot A is lung localization. [Figure 9B]1A-1C are plots showing experimental results of transfection of macrophages with various constructs at the site of injury in vivo. Shown is the percentage of live (7AAD-) human macrophages measured in digests from fibrotic livers using flow cytometry. Each point represents an individual mouse. Data are reported as the mean ± standard deviation (SD). Plot B is liver localization. [Figure 10A] 1A and 1B are plots showing experimental results of transfection of macrophages with various constructs on the expression of IL-10 and MMP9 in vivo. Shown are measurements of human IL-10 and human MMP9 by EKISA in the circulation of mice with chronic liver fibrosis at different time points after cell injection. Each point represents an individual mouse. Data are reported as the mean ± SD. Plot A is IL-10 in plasma. [Figure 10B] 1A and 1B are plots showing experimental results of transfection of macrophages with various constructs on the expression of IL-10 and MMP9 in vivo. Shown are measurements of human IL-10 and human MMP9 by EKISA in the circulation of mice with chronic liver fibrosis at different time points after cell injection. Each point represents an individual mouse. Data are reported as the mean ± SD. Plot B is MMP9 in plasma. [Figure 11] 1A-1C are plots showing experimental results of transfection of macrophages with various constructs after injection into a mouse model. Mouse inflammatory cytokines IL1b and TNFa were measured in plasma by ELISA to verify inflammation, if any, induced by injection of engineered and unengineered cells. Measurements were performed at various time points after cell injection. The black dotted line represents the maximum tolerated level. Each point represents an individual mouse. Data are reported as mean ± SD. Plot A shows the results for mIL-1β, and plot B shows the results for mTNF-α. [Figure 12]Human monocyte recruitment by conditioned medium from unmanipulated hMDMs or hMDMs transfected with various genes, as indicated. The assay was performed as described in Materials and Methods, and results were analyzed by flow cytometry. Each symbol represents conditioned medium from an independent donor. Data are reported as the variance, mean, and standard deviation of a single donor. [Figure 13] Conditioned medium from IL-10-transfected hMDMs specifically recruits monocytes. The data shown was generated using the same protocol as in Figure 12, but shows the migration of individual cell types. All symbols represent conditioned medium from independent donors. Data are reported as the variance, mean, and standard deviation of a single donor. [Figure 14] Conditioned medium from IL-10-transfected macrophages polarizes nonpolarized macrophages toward a pro-restorative phenotype. This assay was performed as shown in part (A). Day 5 cultured macrophages (culture methods described in the Examples) were treated with conditioned medium from unengineered cells treated with IL-4, IL-13, and M-CSF, cells engineered with either IL-10 or MERTK payloads, or polarizing medium (containing MexMACS and IL-10 at 50 ng / ml). Expression of HLA-DR (B), CD86 (C), 25F9 (D), CD206 (E), and CD163 (F) was assessed using flow cytometry as described in the Examples. [Figure 15]Conditioned medium from IL-10-transfected macrophages rescues proinflammatory macrophages and promotes a pro-restorative phenotype. This assay was performed as shown in part (A). Day 5 cultured macrophages (culture methods described in the Examples) were treated with conditioned medium from unengineered cells treated with IL-4, IL-13, and M-CSF, cells engineered with either IL-10 or MERTK payloads, or polarization medium (containing MexMACS and IL-10 at 50 ng / ml). Expression of HLA-DR (B), CD86 (C), 25F9 (D), CD206 (E), and CD163 (F) was assessed using flow cytometry as described in the Examples. [Figure 16] Macrophages transfected with IL-10 alone have a secretome comparable to unmanipulated, nonpolarized macrophages. Cells were treated as shown: untransfected cells with (UT TR) or without (UT) post-transfection treatment with IL-4, IL-13, and M-CSF, or cells transfected with the indicated payloads (IL-10, MERTK, MMP9, or MMP12, as indicated on the x-axis). IL-10 (A), IL-6 (B), CXCL8 (C), IL-12p70 (D), IL-2 (E), IL-1β (F), TNF-α (G), and IFN-Y (H) concentrations were measured in culture supernatants from cells cultured at 4 x 10 cells / ml as described herein. [Figure 17] Macrophages transfected with IL-10 alone localize to the liver after administration to mice in a liver fibrosis model. IL-10-transfected cells or PBS were administered intravenously to mice in a CCl4-induced model of fibrotic liver injury, as described in Example 8. [Figure 18]Macrophages transfected with MMP9 show increased MMP activity. Total MMP activity was measured in untransfected macrophages or macrophages transfected with the indicated payloads, with or without treatment with inhibitor of stimulator of interferon genes (iSTING), as described in the Examples. Data are presented as mean ± SD. ***p≦0.005. [Figure 19] MMP9-transfected macrophages show increased expression of other matrix metalloproteinases. Expression of MMP1, 3, 7, 8, and 10 was measured in non-transfected macrophages (NT), macrophages treated with or without a STING inhibitor (STINGi), or macrophages transfected with MMP9 alone. Darker shading indicates higher expression. [Figure 20] RTX001 macrophages recruit monocytes in vitro. RTX001 macrophages were generated by transfection with a bicistronic construct having the sequence shown in SEQ ID NO: 16. PBMC migration assays were performed as described in the Examples, and results were measured by flow cytometry. Results were normalized to non-transfected (NTrx) cells. [Figure 21] RTX001 macrophages recruit monocytes in vivo. Recruitment of total bone marrow cells was assessed using flow cytometry to detect CD11b+ Tim4- cells as a percentage of total CD45+ cells (left panel). Monocytes were identified by flow cytometry as Ly6Chi CD64- CD45+ cells (right panel). Recruitment was measured in a murine CCl4-induced model of liver fibrosis. Mice were injected with RTX001-transfected macrophages, untransfected macrophages, or PBS vehicle, and recruitment was assessed 24 hours post-injection. [Figure 22]RTX001 macrophages promote an anti-inflammatory environment in vivo. Mouse IL-10 was measured in liver homogenates 24 hours after administration of RTX001 macrophages, untransfected macrophages, or a PBS control to a CCL4-induced mouse model of liver fibrosis. [Figure 23] Macrophages engineered to express IL-10 alone and those engineered to express IL-10 and MMP9 exhibit similar pro-restorative secretomes. The amounts of secreted IL-2 (A), IL-12p70 (B), IFNg (C), TNF-α (D), and IL1B (E) were measured in the supernatant of the culture medium. The engineered cells were cultured at a concentration of 4 x 106 cells / ml. [Figure 24] Administration of RTX001 macrophages reduced scar-forming cells in vivo. RTX001 macrophages, untransfected macrophages, or PBS vehicle were administered to a CCL4-induced mouse model of liver fibrosis. Tissue sections were collected from the mice one week after administration and stained for a-SMA (left panel). The percentage of a-SMA-positive areas in the sections was enumerated, and the results are shown in the right panel. [Figure 25] RTX001 macrophage CM significantly reduced LX-2 αSMA expression. (A) Fold change in αSMA mean fluorescence intensity (MFI) compared to the TGF-β stimulated control (no CM). (B) Graph comparing the percentage of cells expressing αSMA. Experiments were repeated three times and averaged, and data are presented as mean ± SD (n=1). **p≦0.01. [Figure 26]The optimized bicistronic mRNA improves the recovery-promoting properties. Cells were transfected with either non-optimized mRNA (SEQ ID NO: 2, further containing a 120-residue polyA tail) or optimized mRNA (SEQ ID NO: 16), both of which are bicistronic mRNAs encoding both IL-10 and MMP9. The amounts of MMP9 (left panel) and IL-10 (right panel) secreted into the culture supernatant were detected, and MMP activity was measured as described herein. MMP activity was normalized to that of untransfected cells. [Figure 27] RTX001 is stable in an inflammatory environment. Changes in CD80 and CD86 (inflammatory markers) and CD206 (pro-healing marker and general macrophage-identifying marker) were measured in engineered macrophages exposed to IFN-γ at the indicated concentrations. No significant changes were observed in pro-inflammatory markers (CD80 and CD86) or the macrophage-identifying marker CD206 (A). MATCH-like (Ntrx) cells and RTX0001 (Trx+tr) cells were incubated with IFN-γ (1.05, 10.5, or 105 ng / mL) for 24 hours. The MFI of the pro-inflammatory markers HLA-DR and CD80 was assessed using flow cytometry. Data shown are fold changes relative to Ntrx cells cultured without IFN-γ (B and C). [Figure 28] Post-transfection treatment does not contribute to further polarization of engineered macrophages. Expression of cD86 (left) and MHC II (right) was detected in macrophage products by flow cytometry. The macrophage products tested consisted of the following: untransfected macrophages either untreated (NTx) or treated (NTx + TR) with IL-4, IL-13, and M-CSF; macrophages transfected with both MMP9 and IL-10, or untreated (IL-10-MMP9) or treated (IL-10-MMP9 + TR) with IL-4, IL-13, and M-CSF after transfection. [Figure 29] 1 is a table showing the expression of macrophage markers or cytokine secretion in the indicated macrophage products. Macrophage products consisted of cells that were untransfected and untreated (UT) or treated with IL-4, IL-13, and M-CSF (UT+TR); transfected with IL-10 and MMP9 and untreated (IL-10 MMP9 TRx), or treated with IL-4, IL-13, and M-CSF after transfection (IL-10 MMP9 TRx+TR). Mean fluorescence intensity was measured by flow cytometry as described herein. [Figure 30] Treatment with IL-4, IL-13, and M-CSF improved cryoprotection. The viability of the macrophage product population was determined after cryopreservation. The macrophage product consisted of: untransfected macrophages that were not (NTrx) or treated (NTrx+Tr) with IL-4, IL-13, and M-CSF; and macrophages transfected with both IL-10 and MMP9 that were not (Trx) or treated (Trx+Tr) with IL-4, IL-13, and M-CSF after transfection. Viability was assessed by measuring the cells still viable after cryopreservation as a percentage of the total cells viable before cryopreservation. [Figure 31] 16 is a summary of the protocol used to measure efficacy in the mouse-on-mouse model of Example 25. [Figure 32] FIG. 1 is a schematic diagram outlining the mechanisms thought to underlie the therapeutic effects of engineered macrophages. DETAILED DESCRIPTION OF THE INVENTION

[0327] The data presented in these figures demonstrate that the surprisingly effective combination of tandem expression of two specific genes, IL-10 and MMP9, results in surprising and unexpected benefits to the phenotype of engineered macrophages. Surprisingly, expression of MMP9 alone was able to restore the reduced MMP expression / activity seen in IL-10-transfected macrophages. As shown above, this effect appears to be synergistic. Furthermore, the superior monocyte recruitment by this combined overexpression was unexpected, given that entities such as cytokines have traditionally been implicated in the recruitment process.

[0328] Genetic engineering of macrophages to allow overexpression of IL-10 in combination with MMP9 provides many desirable features and functions for cell therapy useful in inflammatory conditions such as organ injury regeneration. The inventors have shown that IL-10 in combination with MMP9 results in: - Robust macrophage identity that is not perturbed by the manipulation process. - Strong anti-inflammatory phenotype. - The ability to pattern naive macrophages into a pro-restorative phenotype. - Excellent phagocytic ability. - Encouraging stability and biodistribution profile, including penetration into injured organs and rapid clearance / elimination in other organs.

[0329] The above characteristics are common to macrophages engineered with IL-10 alone, which we have already investigated. However, the combination of IL-10 and MMP9 provides several unique and surprising characteristics that are key to the desired therapeutic effect, including: - A strong ability to attract and then pattern monocytes into a pro-restorative phenotype. - Ability to restore MMP activity (a proxy for fibrosis / extracellular matrix (ECM) remodeling) that is suppressed by manipulation of IL-10 alone.

[0330] Therefore, the inventors believe that engineering macrophages with a combination of IL-10 and MMP9 will result in an effective product that may have both anti-inflammatory and anti-fibrotic functions in the treatment of, for example, several organ injury situations, both acute and chronic. In acute injury situations, reconstitution of ECM components is paramount to ensure tissue restoration and proper regeneration.

[0331] equivalent Those skilled in the art will recognize, or be able to recognize using no more than routine experimentation, equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by the scope of the following claims. Any combination of the embodiments disclosed in any multiple dependent claims or examples is contemplated as being within the scope of the present disclosure.

[0332] Incorporation by Reference The disclosures of any and all patents, patent application publications, and scientific publications mentioned herein, as well as the contents of any drawings thereof, are specifically incorporated herein by reference in their entirety.

[0333] Sequence Listing Italics - protein coding Bold - Linker In all mRNA sequences, uridine is transcribed as thymine.

[0334] SEQ ID NO: 1 1. Single hIL10 mRNA [ka]

[0335] SEQ ID NO: 2 2. Bicistronic hIL10-P2A-hMMP9 [ka] [ka]

[0336] SEQ ID NO: 3 3. MMP9 [ka] [ka]

[0337] SEQ ID NO:4 Protein sequence human IL10 (bold = open reading frame) [ka]

[0338] SEQ ID NO:5 Protein sequence IL10-p2a-MMP9 (bold = open reading frame, underline = linker) [ka]

[0339] SEQ ID NO:6 Protein sequence human MMP9 (bold = open reading frame) [ka]

[0340] SEQ ID NO:7 p2A motif DXEXNPGP

[0341] SEQ ID NO:8 Non-optimized p2A mRNA sequence GGAAGCGGAGCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCCGGGCCT

[0342] SEQ ID NO:9 p2A amino acid sequence GSGATNFSLLKQAGDVEENPGP

[0343] SEQ ID NO: 10 Optimized bicistronic mRNA coding sequence (linker sequences are underlined). All uridines (here transcribed as thymines) are 5-methoxy-uridines. [ka]

[0344] SEQ ID NO: 11 Amino acid sequence encoded by the optimized bicistronic mRNA sequence (IL-10-p2A-MMP9 fusion protein) (linker sequence is underlined) [ka]

[0345] SEQ ID NO: 12 Sequence of the mouse mRNA-based transcript introduced into mRTX001. [ka]

[0346] SEQ ID NO: 13 Optimized sequence of IL-10 mRNA. All uridines (here transcribed as thymines) are 5-methoxy-uridines. [ka]

[0347] SEQ ID NO: 14 Optimized sequence of MMP9 mRNA. All uridines (here transcribed as thymines) are 5-methoxy-uridines. [ka]

[0348] SEQ ID NO: 15 Linker optimized mRNA sequence. All uridines (transcribed here as thymines) are 5-methoxy-uridines. GGCTCCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCA

[0349] SEQ ID NO: 16 Optimized bicistronic mRNA (containing a 5'UTR and a 3'UTR). All uridines (here transcribed as thymines) are 5-methoxy-uridines. [ka]

[0350] SEQ ID NO: 17 - 5'UTR of optimized bicistronic mRNA construct (all uridines (here transcribed as thymines) are 5-methoxyuridines) [ka]

[0351] SEQ ID NO: 18 - 3'UTR of optimized bicistronic mRNA construct (all uridines (here transcribed as thymines) are 5-methoxyuridines) [ka]

[0352] SEQ ID NO: 19 - 5'UTR of non-optimized bicistronic mRNA construct AGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCACC

[0353] SEQ ID NO: 20 - 3'UTR of non-optimized bicistronic mRNA construct [ka]

[0354] (References) TIFF2025532094000019.tif210150TIFF2025532094000020.tif202150TIFF2025532094000021.tif211150TIFF2025532094 000022.tif210150TIFF2025532094000023.tif210150TIFF2025532094000024.tif220150TIFF2025532094000025.tif75150 [Example]

[0355] Materials and Methods The following protocol was used to generate the data described in the Examples below.

[0356] Macrophage cell culture We isolated monocytes from buffy coat products from healthy volunteers provided by the Scottish National Blood Transfusion Service (SNBTS) using a Ficoll gradient (GE Healthcare) followed by magnetic column selection using CliniMACS CD14 Reagent (Miltenyi Biotec). We then matured monocytes for 1–7 days in culture in phenol red-free TexMACS (Miltenyi Biotec) in the presence of 100 ng / mL GMP-grade recombinant human macrophage colony-stimulating factor (rhM-CSF) (R&D System, Biotech). hMDMs were cultured at 2 × 10 for 5 days. 6 pieces / cm 2 hMDMs were cultured in 6-well multiwell plates (Corning Costar) at a density of 1000 x 1000. hMDMs were counted using an automatic counter (TC20, BioRad).

[0357] Macrophage manipulation Small / Medium Scale Transfection - RNA Mature macrophages were pelleted at 300 x g for 5 minutes, the supernatant removed, and the cells resuspended in supplemented buffer P3 (Lonza) at a density of 50 x 10^6 or 100 x 10^6 cells / ml. mRNA was added at a concentration of 2 μg / 10^6 cells for IL10 (798NT) or 8 μg / 10^6 cells for IL10-MMP9 (2985NT) and mixed thoroughly by pipetting. The cell suspension was transferred to an electroporation cuvette / cassette (100 μl / 1 ml). Cells were transfected with a Lonza Nucleofector using pulse code CM-137. Cells were collected in a sterile Falcon tube. The electroporation cuvette / cassette is washed with 100ul / 1ml TexMACS medium supplemented with M-CSF (100ng / ml), IL4 (20ng / ml), and IL13 (20ng / ml) and added to the cell suspension. The cells are placed in a TC incubator for 20 minutes. A cell count is performed and the cell density is adjusted to 4x10^6 cells / ml. The cells are plated at 2x10^6 cells / cm. 2 and place in a cell culture incubator.

[0358] Large-scale fluid transfection - mRNA Mature macrophages were pelleted at 300 × g for 5 minutes. The supernatant was removed, and the cells were resuspended in supplementary buffer P3 (Lonza) at a density of 200 × 10^6 cells / ml. mRNA was transferred to a sterile Falcon tube at a concentration of 2 μg / 10^6 cells for IL10 (798NT) or 8 μg / 10^6 cells for IL10-MMP9 (2985NT), and supplemented with supplementary buffer P3 to a volume equal to the cell suspension. A Lonza Nucleofector LV transfection was set up. The cell suspension and mRNA were transferred appropriately to the 4D-Nucleofector LV Reservoir. Cell culture bags pre-filled with TexMACS medium supplemented with M-CSF (100 ng / ml), IL4 (20 ng / ml), and IL13 (20 ng / ml) were attached to the tubing of an electroporation cassette to eluate the cells. Cells were transfected with a Lonza Nucleofector using pulse code CM-137. The bag containing the cells was transferred to a TC incubator for 20 minutes. A cell count was performed and the cell density was adjusted to 4 x 10^6 cells / ml. Cells were plated at 2 x 10^6 cells / cm. 2 and placed in a cell culture incubator.

[0359] Small-scale transfection - pDNA "Payload," as used herein, refers to a gene of therapeutic interest that is introduced by transfection to test its effect on macrophages.

[0360] Day 5 human monocyte-derived macrophages (hMDMs) were resuspended in CliniMACS® El Electroporation Buffer (Miltenyi Biotec, #170-076-625) at a density of 75 x 10^6 or 150 x 10^6 cells / ml, and 100–300 μl of the suspension was transferred to an electroporation cuvette with a 0.2 cm gap. 5 μg of plasmid DNA per 5 x 10^6 cells was added directly to the cuvette, and the cuvette was gently tapped to mix with the cells. Cells were transfected using a CliniMACS® electroporator controlled by a CliniMACS Prodigy®. Electroporation parameters are outlined in Table 1 below (further described in patent application PCT / GB2021 / 051300, published as WO 2021240167).

[0361] [Table 1]

[0362] After transfection, cells were harvested from the cuvette into sterile TexMACS™ GMP medium (Miltenyi Biotec, #170-076-306) using an 18G sterile needle attached to a 1 mL syringe or similar device. Cell counts were performed using a TC-20 automated cell counter (Bio-Rad). Cells were spun down at 300 × g for 5 minutes at room temperature. The supernatant was aspirated and the cells were resuspended in sterile TexMACS™ GMP medium (Miltenyi Biotec, #170-076-306) supplemented with 100 ng / mL rhM-CSF (R&D systems, #AFL216), 20 ng / mL rhIL4 (R&D systems, #AFL204), and 20 ng / mL rhIL13 (R&D systems, #213-ILB / CF) at a concentration of 4 x 10 cells / mL and 2 x 10 cells / cm. 2 were sown at a density of

[0363] Macrophages used to generate the data shown in Figures 1-11 and 20-30 were transfected with RNA constructs. Macrophages used to generate the data shown in Figures 12-16, 18, and 19 were transfected with plasmid DNA constructs.

[0364] Freezing and restoring process To improve the cryoprotectivity of engineered macrophages after transfection, macrophages were cultured at 4 x 10 6 cells / mL and 2 x 10 6 pieces / cm 2 The cells were incubated overnight at a cell concentration of 100 ng / mL in TexMACS serum-free medium (Miltenyi Biotec) containing 100 ng / mL M-CSF (BioTechne) and 20 ng / mL IL-4 and IL-13 (BioTechne).

[0365] Phagocytosis assay Briefly, macrophages were prepared for imaging analysis by plating at a density of 150,000 cells / well in a 96-well clear-bottom imaging plate (Grenier). The supernatant was removed, and cells were stained with 100 μl of PBS + NucBlue (ThermoFisher) and 5 μg / ml Cellmask Deep Red Plasma membrane stain (Invitrogen) for 30 minutes at 37°C and 5% CO2. Cells were washed three times with 100 μl of PBS. For TO analysis using the Opera Phenix High Content Screening System, 50 μl of PBS was added to the cells. After TO, 50 μl of 0.2 mg / ml pHrodo Red Zymosan beads (Life Technologies) were added to the cells. A series of images was acquired over a 96-minute period to monitor phagocytosis. Images were analyzed using Columbus data imaging software and a Tibco Spotfire data analysis system. Graphs were plotted using GraphPad Prism 9.2.0.

[0366] Cells were cultured at 2 × 10 in PBS + 0.5 mM EDTA (Life Technologies). 6 Cells were prepared for flow cytometry analysis by resuspending them at a concentration of 10 ... The supernatant was removed by tapping, and the cells were resuspended in PBS + 0.5 mM EDTA + 1:1000 DRAQ7. The cells were incubated at 4°C for 5 minutes. They were washed as before and resuspended in 100 μL of PBS + 0.5 mM EDTA + 0.1% human serum. 50 μL of cells were harvested using a Novocyte 3000 or Novocyte Quanteon (Agilent). Flow cytometry analysis was performed using NovoExpress software, using the following gating strategies to identify actively phagocytic macrophages: a "cell gate" to exclude debris, a "singlet gate" to exclude cell doublets, a "live gate" to exclude dead cells, a "CD14+ gate" to identify iMACS, and a "phRodo+ve gate" to measure the percentage of phagocytic macrophages.

[0367] IL-10 capture assay For each condition, 1 × 10 6The cells were resuspended in 80 μL of cold TexMACS, and 20 μL of IL-10 Catch Reagent was added and incubated on ice for 5 minutes. Then, 10 mL of warm TexMACS was added to the payload-transfected cells (test group), and 10 mL of cold TexMACS was added to a separate tube of payload-transfected cells as a negative control. The test group was incubated for 1.5 hours at 37°C under continuous rotation. The negative control was stored on ice. After incubation, the cells were washed again with 10 mL of cold buffer and spun down at 4°C. The cells were then resuspended in 80 μL of cold buffer, and 20 μL of detection antibody and 5 μL of CD14 VioBlue were added and incubated on ice for 10 minutes. The cells were washed with 5 mL of cold buffer and spun down at 4°C. The cells were then resuspended in 1 mL of 1:1000 Draq7 (in cold buffer) and 100 uL of the sample was transferred to a 96w plate. The plate was spun down, resuspended in 100 uL of cold buffer and acquired on a flow cytometer.

[0368] Flow cytometry labeling Macrophages were cultured at 1 × 10 in PBS + 0.5 mM EDTA (Life Technologies) + FcR block 1:100 (Miltenyi). 6 Cells were resuspended at a concentration of 100 μL / ml. 100 μL of cells were dispensed into a low-adhesion round-bottom 96-well plate. Cells were incubated for 5 minutes, then the appropriate antibody (see Table 2) was added to the appropriate test well and left at 4°C for 20 minutes. Cells were washed with PBS + 0.5 mM EDTA and spun down at 300 g for 5 minutes. The supernatant was removed by tapping, and cells were resuspended in PBS + 0.5 mM EDTA + 1:1000 DRAQ7. Incubated at 4°C for 5 minutes. Washed as before, then resuspended in 100 μL of PBS + 0.5 mM EDTA + 0.1% human serum. 50 μL of cells were harvested using a Novocyte 3000 or Novocyte Quanteon (Agilent).

[0369] [Table 2]

[0370] MSD V-plex cytokine dosage Cytokines in cell culture supernatants were analyzed using the V-PLEX Human Biomarker 10-Plex kit on a MESO Quickplex SQ 120 according to the manufacturer's instructions (Meso Scale Discovery). 10 μL of supernatant was tested. Results are shown in pg / mL. Values ​​have been adjusted to account for the dilution during testing. All data shown represent secretion over a 24-hour period. Reported data are net concentrations calculated by subtracting the amount of a given cytokine in the culture medium (TexMACS) alone from the amount of cytokine detected in the cell culture supernatant.

[0371] PBMC attraction / migration assay Buffy coat donations were purchased from SNBTS under sample management. Peripheral blood mononuclear cells were isolated from the buffy coats using standard methods and cultured at 50 × 10 in CryoStorCS10 (STEMCELL). 6 To set up the migration assay, PBMCs were thawed and placed in a TexMACS (Miltenyi) tube at 4.6 x 10 cells / mL. 6Cells were resuspended in 100 ml of TexMACS solution. 75 μl of cells were placed in the upper chamber of a 5-micron 96-well transwell (Corning). 150 μl of frozen and thawed conditioned medium was placed in the lower chamber. The transwell plate was placed in an incubator (37°C, 5% CO2). After 3 hours, the upper chamber was removed, and cells that had migrated to the lower chamber were stained with CD45-PerCP, CD14-VioBlue, CD15-Pevio770, CD16-BV605, CD56-PE, CD3-FITC, and CD19-APC using standard flow cytometry staining procedures and collected using a Novocyte3000 or Novocyte Quanteon (Agilent).

[0372] Polarization assay - non-polarized macrophages Mature day 5 macrophages were cultured at 2 × 10 in TexMACS + 100 ng / ml MCSF (R&D). 6 pieces / cm 2 Cells were seeded at a density of 1000 kJ / well into 96-well plates (Corning). Control wells (M2 polarization medium) contained 50 ng / ml IL-10 (R&D). After cells attached (5 hours), the medium was removed and replaced with conditioned medium. Cells were incubated with conditioned medium for 18 hours in an incubator (37°C, 5% CO2) and then stained with CD14-VioBlue, CD45-PerCP, CD206-BV711, 25F9-eF660, HLA-DR-PeCy7, CD86-PE, and CD163-FITC using standard flow cytometry staining protocols. DRAQ7 was used to stain dead cells. Cells were harvested using a Novocyte 3000 or Novocyte Quanteon (Agilent).

[0373] MMP activity assay MMP activity was confirmed by successful cleavage of a standard MMP peptide. The standard MMP peptide is flanked by a quencher and a fluorescent signal and does not fluoresce when intact. The cleaved peptide no longer quenches the fluorescent signal, thus releasing fluorescence, measured as relative fluorescence units (RFU). The assay was performed according to the manufacturer's instructions (https: / / www.abcam.com / ps / products / 112 / ab112146 / documents / ab112146%20MMP%20Activity%20Assay%20Kit%20Fluorometric%20-%20Green%20v4b%20(website).pdf - ab112146 MMP Activity Assay Kit Fluorometric - Green v4b), testing 25 μl of cell culture supernatant. All data shown represent the activity of secreted MMPs over a 24-hour period. Results are plotted as RFU minus the background fluorescence of the culture medium (TexMACS) alone.

[0374] statistics All dots reported represent separate donors. At least three donors were analyzed for each condition unless otherwise specified. Data are presented as mean ± SD where appropriate. Two-tailed t-tests were performed for paired data where appropriate.

[0375] result Example 1 Efficient transfection of IL-10 and IL-10+MMP9 in hMDMs To generate transfected (Trx) human monocyte-derived macrophages (hMDMs) for cell therapy, the expression and secretion levels of the desired payload must be significantly increased. We established minimum thresholds for our selected payloads, IL-10 and MMP9, based on internal and published results. Secreted protein levels were measured in cell culture supernatants 24 hours after transfection by ELISA. Interestingly, transfection of both IL-10 and IL1-0 + MMP9 (bicistronic vector) resulted in a significant increase in IL-10 secretion (Figure 1). The increase in IL-10 secretion in engineered macrophages was also confirmed by a flow cytometry-based IL-10 capture assay, which monitored IL-10 secretion in macrophages over a 2-hour period (Figure 2). However, MMP9 secretion did not increase dramatically, and transfection with IL-10 alone slightly reduced MMP9 secretion, which was at least partially restored by cotransfection of IL-10 and MMP9 (Figure 1), suggesting sufficient transfection efficiency of MMP9. In all experiments shown herein, we always analyzed non-transfected (NTrx), NTx + recovery treatment (IL4 + IL13), IL-10 only Trx, and IL-10 + MMP9 Trx. All Trx cells were subjected to recovery treatment. IL-10 and MMP9 were cotransfected using a bicistronic vector linked by a p2A linker sequence.

[0376] Example 2 IL-10-transfected hMDs and IL-10+MMP9-transfected hMDMs show preservation of macrophage identity markers Critical to achieving safe and effective macrophage cell therapy is the maintenance of macrophage cell surface identity markers. This indicates that the genetic engineering procedure does not fundamentally alter the identity of the cells. The pan-leukocyte marker CD45 is retained in all cell types. IL-10 + MMP9 slightly reduces the expression intensity of the myeloid marker CD14 (MFI fold change), but the percentage of positive cells remains unchanged, thus we are confident that the cells maintain their myeloid identity. The mature macrophage marker 25F9 is slightly increased in the engineered cells, a positive sign of strong macrophage identity. All other markers analyzed (CD206, CD163, CCR2, CD169) are unchanged or slightly increased in the engineered cells compared to the unengineered cells. These data support the notion that our engineering method is safe and does not disrupt the identity of the cells. The data are shown in Figure 3.

[0377] Example 3 IL-10-transfected hMDMs and IL-10+MMP9-transfected hMDMs have a pronounced anti-inflammatory profile Obtaining macrophages with high anti-inflammatory properties is crucial for treating acute and chronic inflammatory conditions, such as those associated with organ injury. Surprisingly, transfected macrophages not only retain all of the identity markers (Figure 3) but also show a reduction in several pro-inflammatory markers, such as CD86 and HLA-DR (Figure 4). This highlights the autocrine-paracrine effect of engineered IL-10 in inducing a potent anti-inflammatory phenotype in engineered macrophages. The slight increase in CD80 levels observed with IL-10 + MMP9 is within 10% of the desired level (red dotted line), and therefore is not considered significant in terms of biological effect.

[0378] Example 4 IL-10-transfected hMDMs and IL-10+MMP9-transfected hMDMs have superior phagocytic activity Another important aspect of effective macrophage cell therapy in acute and chronic inflammatory conditions, such as those associated with organ injury, is their ability to phagocytose efficiently. Here, we report that both engineered and non-engineered macrophages phagocytose efficiently, exceeding the minimally desired level (dotted line) (Figure 5).

[0379] Example 5 IL-10-transfected hMDMs and IL-10+MMP9-transfected hMDMs polarize naive macrophages toward a pro-restorative phenotype During inflammatory organ injury, local macrophages must acquire a pro-restorative phenotype to support fibrotic remodeling and / or tissue regeneration. In this assay, we evaluate the ability of cell culture supernatants from NTrx, NTrx+, IL-10 Trx, and IL-10+MMP9 Trx macrophages 24 hours after transfection to polarize macrophages from unrelated donors. M2 macrophages polarized from the same donor using recombinant IL-10 are used as a positive control (red dotted line). The desired outcome is a decrease in M1 markers CD86 and HLA-DR and similar or increased M2 markers CD206 and CD163 in macrophages treated with supernatant from engineered hMDMs compared to macrophages treated with supernatant from unmanipulated hMDMs. Supernatants from both IL-10 Trx and IL-10+MMP9 Trx hMDMs were effective in promoting the conversion of unrelated donor macrophages to a pro-restorative phenotype (reduced CD86 and HLA-DR, increased CD206, and similar levels of CD163) (Figure 6).

[0380] Example 6 IL-10+MMP9-transfected hMDMs have superior monocyte recruitment capacity compared to IL-10-transfected hMDMs An important function of macrophages is their ability to recruit new monocytes in situ and pattern this recruitment toward a pro-restorative phenotype. Evidence of the ability of IL-10 Trx and IL-10+MMP9 Trx hMDMs to induce such a phenotype in unpolarized macrophages is shown in Figure 6. The data shown in Figure 7 surprisingly support the idea that only supernatants from IL-10+MMP9 Trx hMDMs induce significant monocyte migration when tested in a PBMC migration assay.

[0381] Example 7 IL-10+MMP9-transfected macrophages are superior in metalloproteinase activity compared to IL-10-transfected macrophages A final important feature of macrophage cell therapy aimed at inducing tissue remodeling is its ability to digest extracellular matrix (ECM) components. In this assay, a fluorescent probe measures the ability of the entire MMP pool in cell culture supernatant to digest ECM components. Surprisingly, IL-10 Trx significantly reduced the overall MMP activity measured in the supernatant (-50%) compared to NTrx hMDM. Notably, cotransfection of MMP9 alone was sufficient to restore such activity in the supernatant and even increase it compared to NTrx hMDM. hMDMs coexpressing IL-10 and MMP9 had 1.5-fold higher MMP activity than NTrx hMDM, suggesting that MMP9 and IL-10 act synergistically to increase MMP activity in hMDM. This may highlight the ability of MMP9 transfection to also increase the activation of other MMPs. The data are shown in Figure 8.

[0382] Example 8 IL-10-transfected hMDMs and IL-10+MMP9-transfected hMDMs localized to the liver at 24 and 72 hours after injection and were rapidly eliminated from the lungs in models of chronic liver disease. For macrophage cell therapy to be effective, it must localize to the site of injury after injection. In this experiment, chronic liver disease was induced in immunodeficient mice (NSG strain) by injecting a toxin (CCl4). After 4 weeks of fibrosis induction, hMDMs were injected via the tail vein. Livers were harvested at various time points and enzymatically digested to recover the nonparenchymal fraction. Results show that both IL-10 Trx and IL-10+MMP9 Trx hMDMs initially localize to the lung and liver, but remain only in the liver by 72 hours. By one week after injection, the engineered cells had disappeared as expected (Figure 9). Thus, the cells demonstrate pharmacokinetics and distribution consistent with efficacy and safety.

[0383] Example 9 IL-10-transfected hMDMs and IL-10+MMP9-transfected hMDMs maintain payload expression for 24 hours post-injection in a model of chronic liver disease. In the same experiment outlined above, circulating human IL-10 and MMP9 were measured in the plasma of mice at various time points after injection of the cell therapy. Interestingly, both IL-10 and MMP9 were detected systemically (circulating in the blood) in the expected group of mice, despite macrophages concentrating in the liver and lungs (Figure 10). Appropriate controls were performed to ensure that the human proteins were reliably detected without cross-reactivity with mouse counterparts.

[0384] Example 10 IL-10 and IL-10+MMP9 have a favorable safety profile in chronic liver disease models Finally, to be successful in a clinical setting, cell therapies must be safe both at the time of injection and at various time points thereafter. In particular, it is paramount that cell therapies have no off-target effects in uninjured organs and are eliminated within a safe time frame. The data support the safety of both IL-10 Trx hMDM and IL-10+MMP9 Trx hMDM. Indeed, no embolism was detected at the time of injection, and no systemic inflammation was detected systemically in mice with chronic liver disease at various time points after injection (Table 3 and Figure 11). These data, coupled with the rapid clearance observed in Figure 10, rule out the possibility that these cells are tumorigenic or have any long-term toxicity.

[0385] [Table 3]

[0386] Example 11 Engineered macrophages that overexpress IL-10 specifically recruit monocytes Migration of PBMCs in response to conditioned medium from hMDMs treated as described in Figure 12 was measured as described herein. "D6 UT" cells were harvested after 6 days of culture as described herein and were not transfected or treated with IL-4 or IL-13 (the recovery treatment described herein). "D6 UT+TR" cells were harvested after 6 days of culture as described herein and were not transfected but were treated with IL-4 / IL-13 (the recovery treatment described herein). The remaining treatment groups were transfected with the indicated genes. Transfection with IL-10 alone induced the greatest monocyte recruitment, while transfection with CCR2 was the only other treatment that produced macrophages capable of significant monocyte recruitment. Figure 12 shows only monocyte recruitment identified by flow cytometry. Figure 13 shows the recruitment of other cell types (B cells, T cells, NK cells, neutrophils, and monocytes) by macrophages treated with a subset of the conditions shown in Figure 12 (UT and UT TR correspond to D6 UT and D6 UT TR cells described in Figure 12), as identified using flow cytometry. Figure 13 shows that IL-10-transfected cells specifically recruit monocytes without recruiting other cell types. Conditioned medium from untransfected macrophages and macrophages overexpressing MMP9 did not affect monocyte recruitment.

[0387] Example 12 Engineered macrophages that overexpress IL-10 convert both non-polarized and pro-inflammatory macrophages into a pro-restorative phenotype To test the ability of IL-10-overexpressing macrophages to convert monocyte-derived macrophages into pro-restorative macrophages, we examined the effect of CM from IL-10-overexpressing macrophages on the phenotype of M0 and M1 macrophages. When M0 macrophages (derived from monocytes incubated for 5 days in the presence of 100 ng / ml recombinant human macrophage colony-stimulating factor (rhM-CSF), essentially as described in WO 2021 / 240162) were incubated with CM from cells overexpressing IL-10, the M0 macrophages exhibited a marker profile associated with pro-restorative M2 macrophages (i.e., downregulation of HLA-DR and CD86, and upregulation of 25F9, CD206, and CD163). This effect was comparable to that observed when M0 macrophages were incubated with medium containing M2-polarizing medium (TexsMACS + 50 ng / ml IL-10) (Figure 14). Surface markers were assessed using flow cytometry and measuring mean fluorescence intensity (MFI).

[0388] Similarly, CM incubated with IL-10-overexpressing macrophages was able to "rescue" M1 macrophages, converting their phenotype to a pro-restorative M2 phenotype. To test this, CM was incubated with macrophages pre-polarized to an M1 phenotype using 100 ng / ml LPS + 50 ng / ml IFN-γ. This rescue ability was similar to that observed with M2-polarizing medium (Figure 15).

[0389] Example 13 Macrophages engineered to overexpress IL-10 have an anti-inflammatory secretome profile We measured the secretion levels of proinflammatory cytokines in macrophages overexpressing IL-10 alone, MMP9 alone, IL-10 and MMP9, and non-transfected, non-polarized macrophages. IL-10-overexpressing macrophages exhibited an anti-inflammatory secretome profile. Notably, when macrophages overexpressed IL-10, we did not observe secretion of proinflammatory factors such as TNF-α and IFN-γ (Figure 16). Surprisingly, macrophages overexpressing MMP9 alone showed increased secretion of proinflammatory cytokines such as IL2, IL12p70, IFNγ, TNFα, and IL1β (Figure 16), whereas macrophages overexpressing MMP9 and IL-10 showed secretion levels similar to those of macrophages overexpressing IL-10 alone (Figure 23). Similarly, the effect of macrophages on systemic inflammation was evaluated in vivo. Briefly, NSG mice were subjected to CCl4 intoxication for 4–5 weeks. On SD23, mice were randomized to receive macrophages overexpressing IL-10 alone (IL-10 Trx hMDM) or macrophages overexpressing IL-10 and MMP9 (IL-10-MMP Trx hMDM). Mice injected with phosphate-buffered saline (PBS) served as vehicle controls. Murine IL1β and TNFα levels were measured in liver homogenates by MSD assay. Surprisingly, despite the proinflammatory secretome profile of macrophages expressing MMP9 alone as measured in vitro, we found that neither macrophages overexpressing IL-10 alone nor macrophages overexpressing IL-10 and MMP9 induced an increase in inflammatory cytokines compared to vehicle controls (Figure 11).

[0390] Example 14 Engineered macrophages can be delivered to and persist in the liver In addition, IL-10-overexpressing human macrophages injected intravenously into a mouse liver fibrosis model localized to the liver and persisted for at least 72 hours after administration, suggesting that these human macrophages could be delivered to the treatment area of ​​patients suffering from liver fibrosis (Figure 17).

[0391] Example 15 Engineered macrophages have MMP and scar-remodeling activity To restore the ability of IL-10-overexpressing macrophages to induce scar remodeling, we considered the introduction of matrix metalloproteinases (MMPs), because MMPs are known to play an important role in the degradation of scar tissue in inflamed livers (e.g., Campana et al., Nature Reviews Molecular Cell Biology, vol. 22, pp. 608-624 (2021)). Because macrophages overexpressing either MMP9 or MMP12 demonstrated the ability to maintain some degree of phagocytic activity, we tested the scar remodeling ability of macrophages expressing either MMP. By measuring total MMP activity using a FRET-based fluorophore method, we observed that both MMP9 and MMP12 induced an increase in total MMP activity, with MMP9 inducing a greater increase in total activity (Figure 1).

[0392] Example 16 Macrophages engineered to overexpress both MMP9 and IL-10 recruit monocytes in vitro and in vivo RTX001 macrophages were generated by transfecting hMDMs with a single bicistronic mRNA containing sequences encoding both MMP9 and IL-10. Figure 20 shows results from a PBMC migration assay performed as described in Materials and Methods, comparing NTRx cells and RTX001 macrophages in vitro. The ability of macrophages overexpressing both MMP9 and IL-10 to recruit monocytes was also confirmed in vivo in a mouse model of liver fibrosis (liver injury induced by 4-5 weeks of CCl4 intoxication) 24 hours after administration. The results of this assay are shown in Figure 21. NSG mice were subjected to 4-5 weeks of CCl4 intoxication. RTX001 and NTrx cells were administered intravenously at SD23, and readouts were collected 24 hours after cell administration. Mice injected with phosphate-buffered saline (PBS) served as vehicle controls. Flow cytometric enumeration of myeloid cell (defined as CD45+, SiglecF-, Ly6G-, Tim4-, CD11b+) and classical monocyte (defined as CD45+, SiglecF-, Ly6G-, Tim4-, CD11b+, CD64-, Ly6Chi) recruitment as a percentage of mouse CD45 leukocytes was performed. In vivo migration was defined as cell recruitment to the liver compared to vehicle control. As shown in Figure 21, mice administered cells overexpressing IL-10 and MMP9 (RTX001) showed an increased percentage of recruited monocytes (right panel) and myeloid cells (left panel) from total leukocytes when compared to mice treated with non-transfected cells (NTRx) or PBS.

[0393] Example 17 Engineered macrophages convert liver cells to a pro-restorative phenotype in vivo NSG mice were subjected to 4-5 weeks of CCl4 intoxication. RTX001 and NTrx cells were administered intravenously at SD23, and readouts were collected 24 hours after cell administration. Mice injected with phosphate-buffered saline (PBS) served as vehicle controls. Mouse cytokines, such as IL-10 levels in liver homogenates, were assessed using the MAD assay. As shown in Figure 22, administration of human cells overexpressing IL-10 and MMP9 (RTX001) was able to induce an increase in mouse IL-10 (as measured in liver homogenates). This indicates that human IL-10 induced an anti-inflammatory phenotype, which, given the known polarizing properties of IL-10, suggests a conversion of mouse cells to a pro-recovery phenotype. (Notably, untransfected, non-polarized cells did not induce any increase in mouse IL-10 levels.)

[0394] Example 18 RTX001 macrophages reduce a-SMA expression in vitro and in vivo The beneficial effects of macrophages overexpressing IL-10 and MMP9 have been demonstrated in vivo in a mouse model of liver fibrosis (mice intoxicated with CCl4 for 4–5 weeks) at 1 week post-administration. When macrophages were intravenously injected into mice, reduced activation of scar-forming cells (i.e., activated hepatic stellate cells, HSCs) was observed within the scar tissue compared to non-transfected (NTrx) macrophages and PBS controls (visualized by staining for a-SMA, an activation marker for HSCs, and quantified in the results in the right panel) (Figure 24).

[0395] To further demonstrate the effects of IL-10 and MMP9-expressing macrophages (RTX001) on liver fibrosis, an in vitro system was developed using the LX-2 cell line (Sigma Aldrich, SCC064). The LX-2 line is a human hepatic stellate cell line that has been extensively characterized and shown to retain key characteristics of hepatic stellate cells, making it an appropriate model of human liver fibrosis. In this system, LX-2 cells were treated with 50 ng / ml TGF-β in DMEM medium for 24 hours to activate the cells, which occurs during liver fibrosis. The cells were then incubated with DMEM-conditioned medium (CM) for an additional 24 hours, in which the following macrophages were grown for approximately 18 hours: 1. Untreated / untransfected / UT human macrophages (Non-Trx CM). 2. Human macrophages expressing constructs encoding IL-10 and MMP9 (RTX001 CM). 3. Human macrophages expressing a construct encoding IL-10 alone (control CM).

[0396] For each of these groups, conditioned medium from macrophages from six different donors was used as biological replicates. After incubation with conditioned medium, we measured the number of LX-2 cells expressing a-SMA (Panel B) and the intracellular a-SMA expression level (Figure 25A). Because a-SMA is an activation marker for human hepatic stellate cells, a decrease in its level indicates reduced activation. Because hepatic stellate cells are involved in liver scar formation, a decrease in its activation indicates reduced liver fibrosis. As shown in Figure 25B, LX-2 cells treated with RTX001 showed both a decrease in the number of a-SMA-expressing cells and a decrease in a-SMA expression, indicating the inhibitory effect of RTX001 on hepatic stellate cell activation.

[0397] Example 19 Optimized bicistronic mRNA improves IL-10 secretion As can be seen in the right panel of Figure 26, transfection of the optimized bicistronic mRNA resulted in much higher IL-10 secretion. Surprisingly, despite the inhibitory effect of IL-10 on MMP9 secretion as shown in Figure 1B, the optimized sequence resulted in both much higher MMP9 secretion and much higher MMP activity compared to non-transfected macrophages (NTRx) (left and bottom panels of Figure 26). In these experiments, the conditions and mRNA concentrations used were identical for the optimized and non-optimized mRNAs.

[0398] Example 20 Engineered macrophages are stable in an inflammatory environment The livers of patients with end-stage chronic liver disease accumulate proinflammatory macrophages that secrete proinflammatory cytokines and enhance the inflammatory response (see, e.g., Campana et al., 2021 ).

[0399] To confirm that IL-10+MMP9-expressing macrophages do not revert to a pro-inflammatory phenotype when administered to patients and encounter the inflammatory environment of the liver, we performed a stability study in which we confirmed the stability of the pro-restorative phenotype of IL-10+MMP9-expressing macrophages in an inflammatory environment (mimicking the environment in the liver of patients with end-stage chronic liver disease by modeling the patient's hIFN-γ levels).

[0400] To test the stability of this phenotype, we examined the phenotype of cells after incubation with hIFN-γ using the following experimental procedure.

[0401] To obtain macrophages, PBMCs were isolated from steady-state leukapheresis samples or mobilized blood samples. CD14+ cells were isolated from the PBMCs and plated in TexMacs+M-CSF for 5 days to differentiate into macrophages. On day 5 of culture, macrophages were harvested and either transfected with IL-10+MMP9 or left untransfected. After transfection, macrophages were incubated overnight (approximately 16 hours) in TexMacs+100 ng / mL M-CSF, IL-4 (20 ng / mL), and IL-13 (20 ng / mL) at 37°C and 5% CO2. After this resting period, macrophages were harvested and plated at 2 x 10 cells / ml in TexMacs with or without stimulation (hIFN-γ). 5 Cells were plated at a density of 1000 cells / well onto U-bottom ultra-low attachment sterile culture plates (Corning, Cat. No. 7007). The concentration of hIFN-γ was calculated using the total IFN-γ in human liver, calculated using the total IFN-γ concentration in injured mouse livers determined by previous in vivo pharmacology experiments and scaled up to the mass of a human liver. This total IFN-γ level was then divided by the planned therapeutic cell dose to obtain the IFN-γ level per cell. This was used to create a concentration gradient to account for the possibility that patients may exhibit higher or lower levels of IFN-γ compared to the calculated concentration. All groups were plated to obtain three technical replicates. The macrophages were then cultured for 24 hours, after which they were centrifuged at 300×G for 5 minutes. Culture supernatants were collected and frozen at -20°C, and cells were subjected to flow cytometry to assess the levels of CD80, CD86, MHCII, 25F9, CD14, CD206, and CD163 present on the cell surface. After staining, cells were analyzed using Novocyte Quanteon, and data analysis was performed using NovoExpress and GraphPad Prism software. No significant changes were observed in proinflammatory markers (HLA-DR, CD80, and CD86) or the macrophage-identifying marker CD206.

[0402] As can be seen in Figure 27, the phenotype of cells expressing MMP9 and IL10 is stable under inflammatory conditions.

[0403] Example 21 Expression of macrophage markers differs between macrophage products Macrophage products consisted of: untransfected and untreated (UT) or treated with IL-4, IL-13, and M-CSF (UT+TR); transfected with IL-10 and MMP9 and untreated (IL-10 MMP9 TRx) or treated with IL-4, IL-13, and M-CSF after transfection (IL-10 MMP9 TRx+TR). Mean fluorescence intensity was measured by flow cytometry as described herein, and the results are shown in Figure 28.

[0404] Example 22 Post-transfection treatment does not contribute to further polarization of engineered macrophages but improves their cryoprotection capacity The expression of CD86 (A) and MHC II (B) was measured in cells transfected with a bicistronic construct encoding MMP9 and IL-10 without further treatment (IL-10-MMP9) or with further treatment with IL-4, IL-13, and M-CSF after transfection (IL-10-MMP9+TR). No difference in the expression of CD86 and MHC II could be detected between the IL-10-MMP9 and IL-10-MMP9+TR groups (Figure 29). Therefore, the transfected cells were completely self-polarized due to the secretion of IL-10 (e.g., the reduction of HLA-DR and CD86 was due solely to the secretion of IL-10 by the transfected cells). However, as shown in Figure 30, the cryoprotectivity of non-transfected (NTRx) or transfected (TRx) macrophages incubated with IL-4 + IL-13 is higher, as measured by the percentage of cells surviving after cryopreservation.

[0405] Example 23 Determining the antifibrotic potential of engineered macrophages in an immunodeficient mouse model of liver fibrosis The macrophages described herein are of human origin. Understanding macrophage behavior in mammalian systems requires immunodeficient mice that allow transient engraftment of human material in vivo. Otherwise, immunocompetent wild-type recipient strains would rapidly eliminate administered human cells through a mechanism of acute xenograft rejection. The highly immunodeficient "NSG" strain has been genetically modified to eliminate host T cell, B cell, and NK cell activity. Without wishing to be bound by theory or mechanism, the mechanism of action (MoA) of macrophages relies, in part, on the recruitment of host innate immune effector cells, such as monocytes (Thomas et al., 2011; Ma et al., 2017). While NSG mice can accept human cell transplants, they lack some of the host's functional immune cells that would mount a secondary immune response after macrophage treatment. As a result, immunodeficient strains cannot model the full pharmacological response expected in humans. In addition, due to species differences in receptor binding and downstream signaling pathways, some human proteins in the macrophage secretome are likely to be non-functional in mice. Therefore, due to limitations in immunodeficient strains, absolute demonstration of the efficacy of the macrophages described herein (as demonstrated by a statistically significant reduction in liver fibrosis) will be at best underestimated or completely impossible. Nevertheless, the following describes an in vivo experimental model for testing efficacy.

[0406] The macrophages used in this example are primary human monocyte-derived macrophages (hMDMs) whose phenotypes have been modified by transient transfection to deliver bicistronic mRNA transcripts encoding IL-10 and MMP-9 together with the P2A self-cleaving peptide. To demonstrate the antifibrotic potential of the cell therapy being tested, experimental liver fibrosis is modeled in an immunodeficient mouse strain. NSG mice (official name: NOD.Cg-PrkdcSCID Il2rgtm1Wjl / SzJ, supplied by Charles River Laboratories) lack T cells, B cells, and NK cells, rendering them immunodeficient and allowing transient engraftment of human cells in vivo. Liver fibrosis is induced in NSG mice by twice-weekly administration of carbon tetrachloride (CCl4, i.p., 0.4 μL / g body weight, diluted in olive oil) for 12 weeks. The CCl4 fibrosis model is a well-recognized and tractable rodent fibrosis model, and is a novel model for the treatment of obeticholic acid (Fan et al., 2019). 47 ;Younossi et al., 2019 48 ) and lanifibranor (Wettstein et al., 2017 49 ;Francque et al., 2021 50 ) demonstrated clinical predictability. The anti-fibrotic potential of the tested macrophages was evaluated in established liver fibrosis cases using cells (1 × 10 6 Injured mice receiving PBS alone will serve as vehicle controls. In addition, non-transfected human monocyte-derived macrophages (NTrx hMDM, 1 × 10 6Injured mice receiving 100 μL of CCl4 (iv) served as a comparator group for the subsequent manipulations. Cells or vehicle alone were administered 24 hours after the 17th dose of CCl4 (100 μL, iv, in PBS). All mice continued to receive CCl4 for an additional 4 weeks. All mice were humanely euthanized 24 hours after the 24th and final dose of CCl4 by exsanguination followed by cervical dislocation under terminal anesthesia. Whole blood was collected by cardiac puncture and processed to separate plasma or serum for evaluation of hepatic chemistry biomarkers. Liver, spleen, lungs, heart, and kidneys were collected and fixed for histological analysis. To determine the anti-fibrotic capacity of macrophages, liver fibrosis was quantified in histological liver sections using picrosirius red (PSR) staining to visualize collagen fibers. PSR-stained sections were digitized using a microscope slide scanner (Zeiss Axioscan, Zeiss AG), and liver fibrosis was quantified using image analysis software (Zen, Zeiss AG). The antifibrotic potential of macrophages was assessed by comparing the percentage of PSR in macrophage-treated mice with that in mice receiving vehicle alone or NTrx-hMDM treatment.

[0407] Example 24 Determining the antifibrotic potential of engineered macrophages in an immunodeficient mouse model of fibrotic fatty liver disease To demonstrate the anti-fibrotic potential of the engineered macrophages described in Example 23, experimental liver fibrosis was modeled in an immunodeficient mouse strain with a fatty liver disease background. NSG mice (official name: NOD.Cg-PrkdcSCID Il2rgtm1Wjl / SzJ, provided by Charles River Laboratories) lack T cells, B cells, and NK cells, rendering them immunodeficient and allowing transient engraftment of human cells in vivo. Liver fibrosis was induced in mice by feeding them a choline-deficient, amino acid-defined, high-fat diet (CDAA HFD) with limited methionine content. Ad libitum feeding of the CDAA HFD induced hepatic steatosis and inflammation, resulting in a distinct histological pattern of fibrosis, without significant weight loss in the animals. Unlike other fibrosis models, the CDAA HFD model is valuable because CDAA HFD-induced fibrosis gradually resolves and remains stable for at least two weeks after cessation of the dietary challenge. Therefore, this feature of the model allows for the evaluation of test substances in the absence of ongoing injury. In this example, NSG mice are fed ad libitum with a CDAA-HFD for 12 weeks to induce the establishment of liver fibrosis in the context of fatty liver disease. After 2 weeks, the mice are switched to a standard diet. After resumption of the normal diet, the engineered macrophages are tested for their anti-fibrotic potential after intravenous administration. Injured mice receive PBS alone, which serves as a vehicle control. In addition, non-transfected human monocyte-derived macrophages (NTrx hMDMs, 1 × 10 6Injured mice receiving 100 μL of RM3 (iv) IV PBS served as a comparator group for subsequent manipulations. Twenty-four hours after resumption of standard (RM3) chow, cells or vehicle alone were administered (100 μL, iv, in PBS). All mice continued on standard chow for an additional 4 weeks. At the end of the study, all mice were humanely euthanized by exsanguination followed by cervical dislocation under terminal anesthesia. Whole blood was collected by cardiac puncture and processed to separate plasma or serum for evaluation of liver chemistry biomarkers. Liver, spleen, lungs, heart, and kidneys were collected and fixed for histological analysis. To measure liver fibrosis, histological liver sections were stained using picrosirius red (PSR) staining to visualize collagen fibers. PSR-stained sections were digitized using a microscope slide scanner (Zeiss Axioscan, Zeiss AG), and liver fibrosis was quantified using image analysis software (QuPath Image Analysis open source software). The anti-fibrotic potential of engineered macrophages will be assessed by comparing the percentage of PSR-positive staining in macrophage-treated mouse samples to samples from mice that received vehicle alone or NTrx-hMDM treatment.

[0408] Example 25 Use of engineered murine macrophages as surrogates for human engineered macrophages in immunocompetent models of liver fibrosis

[0409] [Table 4]

[0410] [Table 5]

[0411] conclusion In conclusion, genetic engineering of IL-10 in combination with MMP9 provides many desirable features and functions for cell therapy (e.g., prevention / treatment of inflammatory conditions and / or regeneration of organ damage). IL-10 in combination with MMP9 provides: - Robust macrophage identity that is not perturbed by the manipulating process. - Strong anti-inflammatory phenotype. - The ability to pattern naive macrophages into a pro-restorative phenotype. - Excellent phagocytic ability. - Encouraging stability and biodistribution profile, including penetration into injured organs and rapid clearance / elimination in other organs.

[0412] The above characteristics are common to macrophages engineered with IL-10 alone. However, the combination of IL-10 and MMP9 provides several unique and surprising characteristics that are key to our desired therapeutic effects, including the following: - A strong ability to attract and then pattern monocytes into a pro-restorative phenotype. - Ability to restore MMP activity (a proxy for fibrosis / ECM remodeling) that is suppressed by manipulation of IL-10 alone.

[0413] Therefore, the inventors believe that engineering macrophages with a combination of IL-10 and MMP9 will result in an effective product that may have both anti-inflammatory and anti-fibrotic functions in several organ injury situations, both acute and chronic (in which reconstitution of ECM components is paramount to ensure tissue restoration and proper regeneration).

Claims

1. Engineered macrophages that have been engineered to overexpress IL-10.

2. 4×10 6 2. The engineered macrophage of claim 1, wherein when cultured in vitro at a cell concentration of 10,000 pg / ml, the engineered macrophage secretes IL-10 at a culture supernatant concentration of at least 10,000 pg / ml.

3. The engineered macrophage of claim 1 or 2, which has been further engineered to overexpress MMP9.

4. 4. The engineered macrophage of claim 3, comprising an exogenous coding sequence for IL-10 and an exogenous coding sequence for MMP9.

5. 5. The engineered macrophage of claim 4, wherein expression of the exogenous coding sequence has a synergistic effect in restoring MMP activity and / or has a synergistic effect in monocyte recruitment by the macrophage when compared to engineered macrophages containing only the exogenous sequence for IL-10.

6. 6. The engineered macrophage of any one of claims 1 to 5, wherein the macrophage and / or coding sequence is human.

7. 7. The engineered macrophage of any one of claims 4 to 6, wherein the exogenous coding sequence for IL-10 encodes a protein having an amino acid sequence at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:4, and optionally the IL-10 protein comprises an amino acid sequence identical to SEQ ID NO:

4.

8. 8. The engineered macrophage of any one of claims 4 to 7, wherein the exogenous coding sequence for MMP9 encodes a protein having an amino acid sequence at least 85%, at least 90%, at least 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO:6, and optionally the MMP9 protein comprises an amino acid sequence identical to SEQ ID NO:

6.

9. 9. The engineered macrophage of Claims 4, 5, 7, or 8, wherein the exogenous coding sequence is present on one or more nucleic acid molecules or is integrated into the genome of the macrophage.

10. 10. The engineered macrophage of claim 9, wherein the nucleic acid molecule is a DNA or RNA molecule, preferably an mRNA molecule, and optionally, IL-10 and MMP9 are expressed from the same mRNA molecule, and further optionally, the mRNA molecule encodes IL-10 and MMP9 linked by a linker sequence, and further optionally, the linker is a self-cleaving 2A linker, and further optionally, the linker is p2A.

11. 11. The engineered macrophage of claim 10, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 13, and optionally the nucleic acid comprises SEQ ID NO:

13.

12. 12. The engineered macrophage of claim 10 or 11, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 14, and optionally the nucleic acid comprises SEQ ID NO:

14.

13. 13. The engineered macrophage of any one of claims 10 to 12, wherein the nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, wherein the linker sequence encodes a protein comprising the amino acid sequence set forth in SEQ ID NO:7, and optionally, the protein encoded by the linker sequence comprises the amino acid sequence set forth in SEQ ID NO:

9.

14. 14. The engineered macrophage of any one of claims 10 to 13, wherein the nucleic acid molecule is an mRNA molecule encoding IL-10 and MMP9 linked by a linker sequence, the linker sequence comprising an mRNA having the sequence set forth in SEQ ID NO:

15.

15. 15. The engineered macrophage of any one of claims 10 to 14, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 80% identical to SEQ ID NO: 10, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 10, and optionally the mRNA further comprises a poly-A tail of 65 to 250 residues in length, preferably 90 to 120 residues in length, preferably about 10, and / or a 5' cap.

16. 16. The engineered macrophage of any one of claims 10 to 15, wherein the nucleic acid molecule is an mRNA molecule comprising a sequence at least 80% identical to SEQ ID NO: 16, preferably at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 16, and optionally the mRNA further comprises a 5' cap.

17. 17. The engineered macrophage of claim 16, wherein the mRNA molecule comprises chemically modified residues, preferably modified uracil residues, and optionally comprises at least one synthetic cap.

18. 18. The engineered macrophage of any one of claims 4 to 17, wherein the exogenous coding sequence for IL-10 is on the same nucleic acid as the exogenous coding sequence for MMP9.

19. 19. The engineered macrophage of any one of claims 1 to 18, wherein the macrophage is engineered by editing the endogenous promoter of the IL-10 gene and / or the MMP9 gene, or wherein the macrophage is engineered by modulating expression of an endogenous silencing RNA, or wherein the macrophage is engineered by introducing an exogenous silencing RNA sequence, optionally wherein the silencing RNA is an miRNA.

20. 20. The engineered macrophage of any one of claims 1 to 19, wherein the level of metalloproteinase activity is at least 1.5 times the metalloproteinase activity of non-engineered macrophages.

21. 21. The engineered macrophage of any one of claims 1 to 20, wherein CD86 expression is reduced by at least two-fold compared to non-engineered non-polarized cells.

22. 22. The engineered macrophage of any one of claims 1 to 21, wherein HLA-DR expression is reduced by at least two-fold compared to non-engineered non-polarized cells.

23. 23. The engineered macrophage of any one of claims 1 to 22, wherein the secretion of IL-10 is increased by at least 1000-fold compared to non-engineered non-polarized cells.

24. 24. The engineered macrophage of any one of claims 1 to 23, wherein the secretion of MMP3 is increased by at least 10-fold compared to non-engineered non-polarized cells.

25. 25. The engineered macrophage of any one of claims 1 to 24, wherein the secretion of MMP10 is increased by at least 20-fold compared to non-engineered non-polarized cells.

26. 4×10 6 26. The engineered macrophage of any one of claims 1 to 25, which secretes IL-10 at a culture supernatant concentration of at least 10,000 pg / ml when cultured in vitro at a cell concentration of 10,000 pg / ml.

27. 4×10 6 27. The engineered macrophage of any one of claims 1 to 26, which secretes MMP9 at a culture supernatant concentration of at least 200 ng / ml when cultured in vitro at a cell concentration of 100 ng / ml.

28. 28. The engineered macrophage of any one of claims 1 to 27, wherein the expression of CD206 is increased by at least 5-fold compared to monocytes.

29. 29. The engineered macrophage of any one of claims 1 to 28, wherein the expression of 25F9 is increased by at least 5-fold compared to monocytes.

30. 30. The engineered macrophage of any one of claims 1 to 29, wherein expression of CD80 is reduced by at least 10% compared to non-engineered non-polarized cells.

31. 4×10 6 31. The engineered macrophage of any one of claims 1 to 30, which secretes TNF-α at a culture supernatant concentration of up to 40 pg / ml when cultured in vitro at a cell concentration of 1000 cells / ml.

32. 32. The engineered macrophage of any one of claims 1 to 31, having a phagocytic capacity at least equivalent to that of a non-engineered non-polarized cell.

33. 33. The engineered macrophage of any one of claims 1 to 32, wherein the metalloproteinase activity is restored compared to the reduced metalloproteinase activity in macrophages engineered with only the IL-10 coding sequence.

34. 34. The engineered macrophage of any one of claims 1 to 33, which is transiently transfected, optionally via electroporation.

35. 35. The engineered macrophage of claim 34, wherein the transfection is non-viral.

36. 36. The engineered macrophage of any one of claims 1 to 35, having a pro-restorative phenotype.

37. 37. The population of engineered macrophages of any one of claims 1 to 36.

38. 38. A therapeutic composition comprising the population of macrophages of claim 37 and a pharmaceutically acceptable vehicle.

39. 39. The engineered macrophage of any one of claims 1 to 36, the population of macrophages of claim 37, or the composition of claim 38 for use in therapy.

40. 40. The engineered macrophage, population, or composition of claim 39, wherein said treatment is administered to a subject in need thereof.

41. 39. The engineered macrophage of any one of claims 1 to 36, the population of macrophages of claim 37, or the composition of claim 38 for use in treating an inflammatory condition in a subject.

42. 42. The engineered macrophage, population, or composition of claim 40 or 41, wherein the macrophage is autologous or allogeneic to the subject.

43. 42. The engineered macrophage, population or composition of claim 41, wherein the inflammatory condition is liver injury, optionally chronic liver injury.

44. 44. The engineered macrophage, population, or composition of claim 41 or 43, wherein the condition is a chronic inflammatory condition with a fibrotic component, and optionally the condition is organ damage associated with chronic inflammation.

45. 45. The engineered macrophage, population, or composition of claim 41, 43, or 44, wherein the condition is fibrosis and the fibrosis is in or affects an organ selected from the group consisting of the liver, lung, heart, kidney, pancreas, skin, gastrointestinal tract, bone marrow, hematopoietic tissue, nervous system, eye, and combinations thereof.

46. 46. ​​The engineered macrophage, population, or composition of any one of claims 43 to 45, wherein the condition is cirrhosis of the liver.

47. 47. The engineered macrophage, population, or composition of claim 46, wherein the cirrhosis results from at least one disease or condition selected from the group consisting of non-alcoholic fatty liver disease (NAFL) (e.g., non-alcoholic fatty liver disease (NAFLD) or non-alcoholic steatohepatitis (NASH)), alcoholic liver disease (e.g., alcoholic fatty liver disease (AFLD) or alcoholic steatohepatitis (ASH)), mechanical trauma to the liver, bile duct obstruction, autoimmune hepatitis, iron overload, hepatitis B infection (HBV), and hepatitis C infection (HCV).

48. 47. The engineered macrophage, population, or composition of claim 46, wherein the cirrhosis results from fatty liver disease (SLD), and optionally the fatty liver disease is metabolic dysfunction-associated fatty liver disease, metabolic-associated steatohepatitis, Met-ALD, or idiopathic SLD.

49. 49. The engineered macrophage, population, or composition of any one of claims 46 to 48, wherein the cirrhosis is selected from compensated cirrhosis or decompensated cirrhosis.

50. 50. The engineered macrophage, population, or composition of any one of Claims 41 to 49, wherein the condition is Acute on Chronic Liver Failure (ACLF).

51. 50. The engineered macrophage, population, or composition of any one of claims 46 to 49 for use in treating a subject who has recovered (recompensated) from an initial liver decompensation event, optionally wherein the initial liver decompensation event required hospitalization of the subject, and preferably wherein the subject does not experience a further liver decompensation event after recovering from the initial liver decompensation event.

52. 52. The engineered macrophage, population, or composition of any one of Claims 46-49 and 51, wherein the subject is exhibiting or recovering from one or more clinical signs of liver decompensation selected from the list consisting of jaundice, ascites, hepatic encephalopathy, hepatorenal syndrome, variceal bleeding, and gastrointestinal bleeding.

53. 53. The engineered macrophage, population, or composition of any one of claims 1 to 52, wherein the macrophages are derived from human monocyte-derived macrophages (hMDMs) or stem cells, and optionally the stem cells are induced pluripotent stem cells (iPSCs).

54. 54. The engineered macrophage, population, or composition of claim 53, wherein the macrophage is derived from iPSCs, which essentially lack functional HLA I and II complexes on their surface.

55. 55. A method of improving monocyte migration into an inflamed area, comprising use of an engineered macrophage, population of engineered macrophages, or composition of any one of claims 1 to 54.

56. 56. The method of claim 55, wherein host monocytes / macrophages are polarized toward a pro-restorative phenotype and / or away from a pro-inflammatory phenotype.

57. 37. A method of producing the engineered macrophage of any one of claims 1 to 36, comprising transiently transfecting macrophages with mRNA molecules encoding IL-10 and / or MMP9.

58. 58. The method of claim 57, comprising contacting the macrophages with IL-4, IL-13, and M-CSF before, during, or after transfection.

59. 59. The method of claim 57 or 58, wherein the mRNA molecules encoding IL-10 and MMP9 are co-transfected using a bicistronic vector linked by a p2A linker sequence.

60. 37. The engineered macrophage of any one of claims 1 to 36, engineered with an mRNA construct encoding human IL-10 fused to human MMP9 protein via a cleavable linker.

61. 37. A method of treating inflammation and / or fibrosis, comprising administering to a subject in need thereof a therapeutically effective amount of the engineered macrophage of any one of claims 1 to 36.

62. 1. A method for polarizing macrophages toward a pro-restorative phenotype, wherein the polarized macrophages have increased expression of CD163 and CD206 and decreased expression of HLA DR and CD86 compared to cells not polarized toward a pro-restorative phenotype, the method comprising engineering the macrophages to express above endogenous levels of IL-10 and MMP9.

63. 63. The method of claim 62, wherein the macrophages have been engineered to express IL-10 and MMP9 by introducing exogenous nucleic acids comprising nucleotide sequences encoding IL-10 and MMP9.

64. The method of claim 63, wherein the nucleotide sequences encoding IL-10 and MMP9 are present on the same nucleic acid molecule.

65. 64. The method of claim 63, wherein the nucleotide sequences encoding IL-10 and MMP9 are present on separate nucleic acid molecules.

66. 66. The method of any one of claims 63 to 65, wherein the nucleic acid is mRNA.

67. 1. A method of polarizing macrophages to a pro-restorative phenotype, wherein the polarized macrophages have increased expression of CD163 and CD206 and decreased expression of HLA DR and CD86 compared to cells not polarized to a pro-restorative phenotype, the method comprising engineering the macrophages to overexpress IL-10, and optionally, the macrophages are cultured at a concentration of 4×10 6 When cultured in vitro at a cell concentration of 10,000 cells / ml, the cells secrete IL-10 at a culture supernatant concentration of at least 10,000 pg / ml.

68. 68. The method of claim 67, wherein the macrophages have been engineered to express IL-10 by introducing an exogenous nucleic acid comprising a nucleotide sequence encoding IL-10.

69. 69. The method of claim 67 or 68, wherein the nucleic acid is mRNA.

70. A method for improving the cryoprotectivity of macrophages, comprising incubating macrophages in a medium containing IL-4, IL-13, and M-CSF.

71. 1. A method for cryopreserving macrophages, comprising incubating the macrophages in a medium containing IL-4, IL-13, and M-CSF prior to cryopreservation.

72. The concentrations of IL-4 and IL-13 in the medium were 20 ng / ml, the concentration of M-CSF was 100 ng / ml, and the number of macrophages was 4 × 10 6 72. The method of claim 70 or 71, wherein the cell is at a concentration of cells / ml.

73. 73. The method of any one of claims 70 to 72, wherein the cells are incubated overnight in a medium containing IL-4, IL-13, and M-CSF.

74. 74. Cryopreserved macrophages obtained by the method of any one of claims 70 to 73.

Images