Compounds and methods for reducing MECP2 expression

Abstract

Oligomeric compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of methyl-CpG-binding protein 2 (MECP2) RNA in cells or animals, and optionally reducing the amount of MECP2 protein in cells or animals. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a neurodevelopmental disease or disorder. Such neurodevelopmental diseases or disorders include MECP2 duplication syndromes. Such symptoms or characteristic characteristics include autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death.

Description

[Technical Field]

[0001] Sequence Listing This application is submitted with an electronic Sequence Listing, which is provided as the file BIOL0429SEQ.xml, created on September 11, 2023, and is 118 Kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0002] Oligomeric compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of methyl-CpG-binding protein 2 (MECP2) RNA in cells or animals, and optionally reducing MECP2 protein in cells or animals. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a neurodevelopmental disease or disorder. Such neurodevelopmental diseases or disorders include MECP2 duplication syndromes. Such symptoms or characteristic characteristics include autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death. [Background technology]

[0003] Methyl-CpG-binding protein 2 (MECP2), located on chromosome Xq28, plays a fundamental role in epigenetics, chromatin state regulation, and the expression of thousands of genes (Chahrour et al., Science, 2008, 320:1224-1229; Nan et al., Nature, 1998, 393:386-389; Jones et al., Nat. Genet., 1998, 19:187-191). MECP2 duplication syndrome, caused by MECP2 overexpression, is characterized by autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death, and primarily affects males (Ramocki et al., Am J Med Genet A, 2010, 152A:1079-1088).

[0004] Currently, there is a lack of acceptable options for treating such neurological diseases. It is therefore an object of the present invention to provide compounds and pharmaceutical compositions for treating such diseases and disorders. Summary of the Invention

[0005] Certain embodiments of the oligomeric agents, oligomeric compounds, and pharmaceutical compositions described herein are useful for reducing or inhibiting MECP2 expression in cells or animals. In certain embodiments, MECP2 RNA or protein levels may be reduced in cells or animals. Methods for treating MECP2 duplication syndrome are also provided. DETAILED DESCRIPTION OF THE INVENTION

[0006] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "comprises" is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components that contain a single unit and elements and components that contain multiple subunits, unless expressly stated otherwise.

[0007] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application (including, but not limited to, patents, patent applications, articles, books, papers, GenBank, ENSEMBL, and NCBI reference sequence records), as well as portions of documents discussed herein, are expressly incorporated by reference in their entirety.

[0008] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, and other materials referenced throughout the disclosure are incorporated herein by reference in their entirety.

[0009] Unless otherwise stated, the following terms have the following meanings:

[0010] As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which contains a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0011] As used herein, "2'-MOE" refers to an OCH2CHOCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" or "2'-MOE ribosyl sugar moiety" refers to a sugar moiety having an OCH2CHOCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0012] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0013] As used herein, "5-methylcytosine" means a cytosine modified by being attached to a methyl group at position 5. 5-methylcytosine is a modified nucleobase.

[0014] As used herein, "improve" in relation to treatment refers to the improvement of at least one symptom or characteristic compared with the same symptom or characteristic when not treated.In certain embodiments, improvement is the reduction in the severity or frequency of symptom or characteristic, or the delay in the onset or progression of the severity or frequency of symptom or characteristic.In certain embodiments, symptom or characteristic is one or more of autism, intellectual disability, motor dysfunction, hypotension, general developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infection, epileptic encephalopathy, and early death.The progression or severity of indicators can be determined by subjective or objective measures known to those skilled in the art.

[0015] As used herein, "cell targeting moiety" means a conjugate moiety or a portion of a conjugate moiety that is capable of binding to a specific cell type or specific cell types.

[0016] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties (e.g., osmolality, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with cerebrospinal fluid.

[0017] As used herein, "chiral control" with respect to an internucleoside linkage means that the chirality at that linkage is enriched for a particular stereochemical configuration.

[0018] As used herein, "chiral enrichment" in reference to a population means that there are multiple molecules of the same molecular formula, but the number or percentage of molecules in the population containing a specific stereochemical configuration at a specific chiral center is greater than the number or percentage of molecules expected to contain the same specific stereochemical configuration at the same specific chiral center in the population if the specific chiral center were stereorandom as defined herein. A chiral enriched molecular population having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorus atom of a mesylphosphoramidate internucleoside linkage.

[0019] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, for example, inside a cell, animal, or human.

[0020] As used herein, "complementary" with respect to an oligonucleotide means that, when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid, or one or more regions thereof, can hydrogen bond with each other. A "complementary region" with respect to a region of an oligonucleotide means that, when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid, or one or more regions thereof, can hydrogen bond with each other. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or other modified nucleobases are known in the art and, unless otherwise specified, are not considered complementary nucleobases as defined herein. For example, inosine can pair with adenosine, cytosine, or uracil, but is not considered complementary. Complementary oligonucleotides and / or nucleic acids do not need to have nucleic acid base complementarity at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" in relation to an oligonucleotide means that an oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleic acid base of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0021] As used herein, "region of complementarity" with respect to an oligonucleotide refers to the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.

[0022] As used herein, "conjugate group" means a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate group moiety to the oligonucleotide.

[0023] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0024] As used herein, "conjugate moiety" means a group of atoms that modifies one or more properties of a molecule (including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance) compared to the same molecule lacking the conjugate moiety.

[0025] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0026] As used herein, "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, in which at least 70% of the nucleosides contain a β-D-2'-deoxyribosyl sugar moiety. In certain embodiments, the deoxy region is the gap of a gapmer. In certain embodiments, the deoxy region supports RNase H activity.

[0027] As used herein, "diluent" refers to an ingredient in a composition that has no pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in a composition to be injected can be a liquid such as aCSF, PBS, or saline.

[0028] As used herein, "double-stranded" with respect to a region or oligonucleotide refers to a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are folded regions of the same molecule (e.g., a hairpin structure).

[0029] As used herein, "duplex" or "duplex region" means the structure formed by two oligonucleotides or portions thereof hybridized to one another.

[0030] As used herein, a "gapmer" refers to a modified oligonucleotide comprising an internal region located between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides comprising the external regions, such that the modified oligonucleotide supports RNase H cleavage. The internal region may be referred to as a "gap," and the external regions may be referred to as "wings." In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5'-end of the internal region. Unless otherwise specified, "gapmer" refers to a sugar motif. In certain embodiments, the internal region is a "deoxy region." In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remaining nucleosides in the gap are 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise specified, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications need not follow the gapmer pattern of sugar modifications.

[0031] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is suitable for reducing the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, modified oligonucleotide, antisense compound, or antisense agent.

[0032] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding (which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleic acid bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0033] As used herein, "internucleoside linkage" refers to a covalent bond between adjacent nucleosides within an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom. As used herein, "linked nucleosides" refer to nucleosides connected in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0034] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide moiety of the oligomeric compound, even if they are contiguous with the oligonucleotide.

[0035] As used herein, "mismatch" or "non-complementary" means that the nucleobases of a first nucleic acid sequence are not complementary to the corresponding nucleobases of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposite orientations.

[0036] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0037] As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety.

[0038] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0039] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.

[0040] As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0041] As used herein, the "nucleobase sequence" of a reference SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO, and therefore, unless otherwise specified, includes compounds in which each sugar moiety and each internucleoside linkage is independently modified or unmodified, with or without the modifications indicated in the reference SEQ ID NO.

[0042] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which is independently unmodified or modified.

[0043] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0044] The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "duplex oligomeric compound."

[0045] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications. An oligonucleotide may or may not be paired with a second oligonucleotide complementary to the oligonucleotide. A "single-stranded oligonucleotide" is an unpaired oligonucleotide. A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0046] As used herein, "pharmaceutically acceptable carrier or diluent" means a substance suitable for use in administration to an animal. Certain such carriers enable the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0047] As used herein, "pharmaceutically acceptable salt(s)" refers to physiologically and pharmaceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0048] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0049] As used herein, "RNA" means RNA transcript, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0050] As used herein, "RNAi agent" refers to an antisense agent that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA (including microRNA mimics). RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent regulates the amount and / or activity of a target nucleic acid. The term RNAi agent does not include antisense agents that act through RNase H.

[0051] As used herein, "RNase H agent" refers to an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single-stranded. In certain embodiments, the RNase H agent is double-stranded. The RNase H compound may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent does not include antisense agents that act primarily through RISC / Ago2.

[0052] As used herein, "single-stranded" means a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a duplex. A single-stranded compound can hybridize with a complementary nucleic acid to form a duplex, at which point it is no longer single-stranded.

[0053] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that is not controlled during synthesis or enriched after synthesis with respect to a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral center may be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral center ("racemic"). In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates as a result of synthesis, for example, by the action of a non-chiral reagent adjacent to the adjacent sugar moiety of enriched stereochemistry. In certain embodiments, the stereorandom chiral center is at the phosphorus atom of a stereorandom phosphorothioate or mesyl phosphoramidate internucleoside linkage.

[0054] As used herein, "subject" means a human or non-human animal. The terms "subject," "animal," and "individual" are used interchangeably. In certain embodiments, the subject is a human.

[0055] In certain embodiments, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H) deoxyribosyl sugar moiety found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0056] As used herein, "symptoms or characteristics" refers to physical characteristics or test results that indicate the presence or extent of a disease or disorder. In certain embodiments, the symptoms are apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the characteristics are revealed by invasive diagnostic testing, including but not limited to post-mortem examination. In certain embodiments, the characteristics are revealed by an MRI scan of the brain. In certain embodiments, such symptoms and characteristics include autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death.

[0057] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an oligomeric compound is designed to affect. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0058] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0059] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0060] As used herein, "treatment" refers to improving a disease or condition in a subject by administering an oligomeric compound, oligomeric duplex, or antisense agent described herein. In certain embodiments, treating a subject improves symptoms compared to the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0061] As used herein, "therapeutically effective amount" means an amount of a pharmaceutical agent or composition that confers a therapeutic benefit on an animal, e.g., administration of a therapeutically effective amount results in amelioration of disease symptoms.

[0062] As used herein, "antisense activity" refers to a detectable and / or measurable change resulting from hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound. In certain embodiments, antisense activity is modulation of target pre-mRNA splicing.

[0063] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0064] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0065] As used herein, "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0066] As used herein, "antisense oligonucleotide" refers to an oligonucleotide (including the oligonucleotide portion of an antisense compound) that can hybridize to a target nucleic acid and have at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0067] As used herein, "sense oligonucleotide" means an oligonucleotide that comprises the oligonucleotide portion of a sense compound and is capable of hybridizing to an antisense oligonucleotide.

[0068] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0069] Embodiment 1. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 19), or a pharmaceutically acceptable salt thereof.

[0070] Embodiment 2. The modified oligonucleotide of embodiment 1, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0071] Embodiment 3. The modified oligonucleotide of embodiment 1, wherein the modified oligonucleotide is the sodium salt or the potassium salt.

[0072] Embodiment 4. A modified oligonucleotide according to the following chemical structure: [ka] (SEQ ID NO: 19).

[0073] Embodiment 5. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es m C eo A eo A eo m C eo A ds T ds T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eo A es G es m C e (SEQ ID NO: 19), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and Oligomeric compounds where o = phosphodiester internucleoside linkage.

[0074] Embodiment 6. The population of modified oligonucleotides of embodiment 1, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides are all stereorandom.

[0075] Embodiment 7. A pharmaceutical composition comprising a modified oligonucleotide according to embodiment 1 and a pharmaceutically acceptable diluent.

[0076] Embodiment 8. The pharmaceutical composition of embodiment 7, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0077] Embodiment 9. The pharmaceutical composition of embodiment 8, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

[0078] Embodiment 10. The population of modified oligonucleotides of embodiment 2, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides are all stereorandom.

[0079] Embodiment 11. A pharmaceutical composition comprising a modified oligonucleotide according to embodiment 2 and a pharmaceutically acceptable diluent.

[0080] Embodiment 12. The pharmaceutical composition of embodiment 11, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0081] Embodiment 13. The pharmaceutical composition of embodiment 12, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

[0082] Embodiment 14. The population of modified oligonucleotides of embodiment 4, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides are all stereorandom.

[0083] Embodiment 15. A pharmaceutical composition comprising a modified oligonucleotide according to embodiment 4 and a pharmaceutically acceptable diluent.

[0084] Embodiment 16. The pharmaceutical composition of embodiment 15, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0085] Embodiment 17. The pharmaceutical composition of embodiment 16, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

[0086] Embodiment 18. The population of oligomeric compounds of embodiment 5, wherein all of the phosphorothioate internucleoside linkages of said oligomeric compounds are stereorandom.

[0087] Embodiment 19. A pharmaceutical composition comprising an oligomeric compound according to embodiment 5 and a pharmaceutically acceptable diluent.

[0088] Embodiment 20. The pharmaceutical composition of embodiment 19, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0089] Embodiment 21. The pharmaceutical composition of embodiment 20, wherein the pharmaceutical composition consists essentially of the oligomeric compound and the phosphate buffered saline or artificial cerebrospinal fluid.

[0090] Embodiment 22. A pharmaceutical composition comprising the population of embodiment 6 and a pharmaceutically acceptable diluent.

[0091] Embodiment 23. The pharmaceutical composition of embodiment 22, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0092] Embodiment 24. A pharmaceutical composition comprising the population of embodiment 10 and a pharmaceutically acceptable diluent.

[0093] Embodiment 25. The pharmaceutical composition of embodiment 24, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0094] Embodiment 26. A pharmaceutical composition comprising the population of embodiment 14 and a pharmaceutically acceptable diluent.

[0095] Embodiment 27. The pharmaceutical composition of embodiment 26, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0096] Embodiment 28. A pharmaceutical composition comprising the population of embodiment 18 and a pharmaceutically acceptable diluent.

[0097] Embodiment 29. The pharmaceutical composition of embodiment 28, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

[0098] Embodiment 30. A method comprising administering to a subject a modified oligonucleotide according to any one of embodiments 1 to 4, an oligomeric compound according to embodiment 5, a population according to any one of embodiments 6, 10, 14 and 18, or a pharmaceutical composition according to any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29.

[0099] Embodiment 31. The method of embodiment 30, wherein the subject has a disease or disorder associated with MECP2.

[0100] Embodiment 32 The method of embodiment 31, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

[0101] Embodiment 33 The method of embodiment 31 or embodiment 32, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0102] Embodiment 34. A method of treating a disease or disorder associated with MECP2, comprising administering to a subject having or at risk of developing a disease or disorder associated with MECP2 a therapeutically effective amount of a modified oligonucleotide described in any one of Embodiments 1-4, an oligomeric compound described in Embodiment 5, a population described in any one of Embodiments 6, 10, 14, and 18, or a pharmaceutical composition described in any one of Embodiments 7-9, 11-13, 15-17, and 19-29, thereby treating said disease or disorder associated with MECP2.

[0103] Embodiment 35. The method of embodiment 34, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

[0104] Embodiment 36 The method of embodiment 34 or embodiment 35, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0105] Embodiment 37. The method of any one of embodiments 34-36, wherein at least one symptom or feature of said disease or disorder associated with MECP2 is ameliorated.

[0106] Embodiment 38. The method of embodiment 37, wherein the symptom or characteristic is autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, or premature death.

[0107] Embodiment 39. The method of any one of embodiments 34-38, wherein the disease or disorder associated with MECP2 is associated with elevated MECP2 levels in the subject.

[0108] Embodiment 40. The method of any one of embodiments 34-39, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms in the subject, or improves motor function, motor development, muscle tone, cognitive development, language, or social skill development in the subject.

[0109] Embodiment 41. The method of any one of embodiments 31 to 40, wherein the subject is a human.

[0110] Embodiment 42. A method for reducing expression of MECP2 in a cell, comprising contacting the cell with a modified oligonucleotide described in any one of embodiments 1-4, an oligomeric compound described in embodiment 5, a population described in any one of embodiments 6, 10, 14, and 18, or a pharmaceutical composition described in any one of embodiments 7-9, 11-13, 15-17, and 19-29.

[0111] Embodiment 43 The method of embodiment 42, wherein the cell is a neuron.

[0112] Embodiment 44 The method of embodiment 42 or embodiment 43, wherein the cells are human cells.

[0113] Embodiment 45. Use of a modified oligonucleotide according to any one of embodiments 1 to 4, an oligomeric compound according to embodiment 5, a population according to any one of embodiments 6, 10, 14 and 18, or a pharmaceutical composition according to any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29 in the treatment of a disease or disorder associated with MECP2.

[0114] Embodiment 46. Use of a modified oligonucleotide according to any one of embodiments 1 to 4, an oligomeric compound according to embodiment 5, a population according to any one of embodiments 6, 10, 14 and 18, or a pharmaceutical composition according to any one of embodiments 7 to 9, 11 to 13, 15 to 17 and 19 to 29 in the manufacture of a medicament for the treatment of a disease or disorder associated with MECP2.

[0115] Embodiment 47. The use of embodiment 45 or embodiment 46, wherein the disease or disorder is associated with elevated MECP2 levels.

[0116] Embodiment 48. The use of any one of embodiments 45 to 47, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0117] Compound number 1435454 In certain embodiments, compound number 1435454 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having the nucleobase sequence (5' to 3') of GCAACATTTTCAGTTTCAGC (SEQ ID NO: 18), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and The internucleoside bond between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 is a phosphodiester internucleoside bond, and the internucleoside bond between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 is a phosphorothioate internucleoside bond, and each cytosine is a 5-methylcytosine.

[0118] In certain embodiments, compound number 1435454 is represented by the following chemical notation: G es m C eo A eo A eo m Ceo A ds T ds T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eo A es G es m C e (SEQ ID NO: 19), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0119] In certain embodiments, compound number 1435454 is represented by the following chemical structure: [ka] (SEQ ID NO: 19).

[0120] Structure 1, compound 1435454.

[0121] In certain embodiments, the oligomeric compound comprises a pharmaceutically acceptable salt of a modified oligonucleotide represented by Structure 1, comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0122] In certain embodiments, the sodium salt of compound number 1435454 is represented by the following chemical structure: [ka] (SEQ ID NO: 19).

[0123] Structure 2, sodium salt of compound 1435454.

[0124] I. Certain Oligonucleotides In certain embodiments, the present disclosure provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Specific modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0125] A. Certain modified nucleosides Modified nucleosides comprise a modified sugar moiety, a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases can be incorporated into modified oligonucleotides:

[0126] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring and one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be located at any position on the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions.

[0127] In certain embodiments, a non-bicyclic modified sugar moiety has a substituent at the 2'-position. Examples of suitable substituents for the 2'-position of a non-bicyclic modified sugar moiety include, but are not limited to, -F, -OCH ("Ome" or "O-methyl"), and -O(CH)OCH ("MOE" or "O-methoxyethyl"). In certain embodiments, a 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH, and OCHCHOCH. In certain embodiments, a 2'-substituted non-bicyclic modified nucleoside comprises a sugar moiety that includes a non-bridging 2'-substituent of OCHCHOCH.

[0128] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations in addition to the natural β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2019 / 157531. 2'-modified sugar moieties have an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranosyl sugar moiety. Thus, a total of 16 isomeric configurations are possible for such sugar moieties. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0129] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides contain one or more nucleosides containing unmodified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides containing modified nucleobases. An example of a modified nucleobase is 5-methylcytosine. In certain embodiments, modified oligonucleotides contain one or more nucleosides that do not contain a nucleobase (called abasic nucleosides). In certain embodiments, modified oligonucleotides contain one or more inosine nucleosides (i.e., nucleosides containing a hypoxanthine nucleobase). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.

[0130] In certain embodiments, the modified adenine has the structure (I). [ka]

[0131] In the formula, R 2A is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl, or substituted C1-C6 thioalkyl, C1-C6 alkyloxy, or substituted C1-C6 alkyloxy, and R 6A is H,N(R a )(R b ), oxo, acetyl, formyl, or O-phenyl; Y 7A is N and R 7A is absent or is C1-C6 alkyl, or Y 7A is C and R 7A is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8A is N and R 8Adoes not exist or Y 8A is C and R 8A is selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, provided that Y 7A N, Y 8A C, R 8A H, R 2A H, R 6A The case where is NH2 (unmodified adenine) is excluded.

[0132] In certain embodiments, the modified guanine has the structure (II). [ka]

[0133] In the formula, R 2G is N(R a )(R b ) and R 6G is oxo and R 1G is H or R 6G is selected from O—C1-C6 alkyl or S—C1-C6 alkyl, and R 1G does not exist, Y 7G is N and R 7A is absent or is C1-C6 alkyl, or Y 7G is C and R 7G is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8G is N and R 8G does not exist or Y 8G is C and R 8G is selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R bare independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, provided that Y 7G is N and Y 8G C, R 8G H, R 2G is NH2, R 6G The case where =O (unmodified guanosine) is excluded.

[0134] In certain embodiments, the modified thymine or uracil has the structure (III). [ka]

[0135] wherein X is selected from O or S, and R 5U H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and when each X is O, R 5U is not H or CH3 (unmodified uracil and unmodified thymine, respectively).

[0136] In certain embodiments, the modified cytosine has the structure (IV). [ka]

[0137] wherein X is selected from O or S, and R 4C is N(R a )(R b ) and R 5C H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, and formyl, or together form a 5- to 7-membered heterocycle, provided that X is not O, R 4C is NH2, R 5C However, H (unmodified cytosine) is excluded.

[0138] In certain embodiments, the modified nucleobase of the modified oligonucleotide is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are 5-methylcytosine, hypoxanthine, 1-methylpseudouridine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (C□C-CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, Selected from 8-aza and other 8-substituted purines, 5-halo (especially 5-bromo), 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Englisch, U. et al., Angew. Chem. Int. Ed. 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0139] The efficiency of the thermodynamic cycle of the specimen was reported by Manoharan et al.,US 2003 / 0158403;Manoharan et al.,US 2003 / 0175906;Dinh et al.,US4,845,205;Spielvogel et al.,US5,130,302;Rogers et al.,US5,134,066;Bischofberger et al.,US5,175,273;Urdea et al al.,US5,367,066;Benner et al.,US5,432,272;Matteucci et al.,US5,434,257;Gmeiner et al.,US5,457,187;Cook et al.,US5,459,255;Froehler et al.,US5,484,908;Matteucci et al al.,US5,502,177;Hawkins et al.,US5,525,711;Haralambidis et al.,US5,552,540;Cook et al.,US5,587,469;Froehler et al.,US5,594,121;Switzer et al.,US5,596,091;Cook et al al.,US5,614,617;Froehler et al.,US5,645,985;Cook et al.,US5,681,941;Cook et al.,US5,811,534;Cook et al.,US5,750,692; al.,US5,587,470;Cook et al.,US5,457,191;Matteucci et al.,US5,763,588;Froehler et al.,US5,830,653;Cook et al.,US5,808,027;Cook et al.,US6,166,199; al.,US6,005,096.

[0140] In certain embodiments, each nucleobase of a modified oligonucleotide is an unmodified A, an unmodified G, an unmodified C, an unmodified T, an unmodified U, m C, or hypoxanthine.

[0141] 3. Certain modified internucleoside linkages The natural internucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, the nucleosides of modified oligonucleotides can be linked to each other using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also referred to as unmodified or native linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphate-containing phosphorodithioates ("HS-P=S"). Compared to natural phosphate linkages, modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0142] Representative internucleoside linkages having a chiral center include, but are not limited to, phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages of a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that randomly selects the stereochemical configuration of each phosphorothioate linkage. Nevertheless, each phosphorothioate in each oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in a specific, independently selected stereochemical configuration. In certain embodiments, a specific configuration of a specific phosphorothioate linkage is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 99% of the molecules in the population. Such a chirally enriched population of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Sp) configuration.In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising the (Rp) and / or (Sp) phosphorothioate each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka]

[0143] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be of a specific stereochemical configuration.

[0144] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified sugar moieties, unmodified sugar moieties, and differentially modified nucleobases and / or internucleoside linkages of the modified oligonucleotides define a pattern or motif. Unless otherwise specified, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to the nucleobases independently of the sequence of the nucleobases).

[0145] 1. A specific glycomotif In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or a region thereof. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications described herein.

[0146] In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5 to 12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, at least one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides in the deoxy region comprise a modified sugar moiety.

[0147] In certain embodiments, the deoxy region is flanked on its 5'-side by a 5'-region consisting of linked 5'-region nucleosides and on its 3'-side by a 3'-region consisting of linked 3'-region nucleosides, wherein the 3'-most nucleoside of the 5'-region is a modified nucleoside and the 5'-most nucleoside of the 3'-region is a modified nucleoside. At least one nucleoside in the 5'-region contains a modified sugar moiety, and at least one nucleoside in the 3'-region contains a modified sugar moiety. The three regions (5'-region, deoxy region, and 3'-region) form a continuous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3'-most nucleoside in the 5'-region and the sugar moiety of the 5'-most nucleoside in the 3'-region are different from the sugar moieties of adjacent nucleosides in the deoxy region, thus defining the boundaries between the 5'-region, the deoxy region, and the 3'-region. In certain embodiments, each nucleoside in the 5'-region and each nucleoside in the 3'-region comprises a modified sugar moiety. In certain embodiments, the nucleosides in the 5'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 5'-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides in the 3'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 3'-region comprise two or more different sugar modifications.

[0148] In certain embodiments, the 5'-region and 3'-region of the modified oligonucleotide each comprise 1 to 8 nucleosides. In certain embodiments, the 5'-region comprises 1 to 7 nucleosides. In certain embodiments, the 5'-region comprises 1 to 6 nucleosides. In certain embodiments, the 5'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3'-region comprises 1 to 7 nucleosides. In certain embodiments, the 3'-region comprises 1 to 6 nucleosides. In certain embodiments, the 3'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0149] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif defined by two outer regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a continuous sequence of nucleosides, with at least some of the sugar moieties of the nucleosides in each wing being different from at least some of the sugar moieties of the nucleosides in the gap. In particular, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties that differ from the sugar moieties of one or more other nucleosides within the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).

[0150] In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of a gapmer comprise a modified sugar moiety.

[0151] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0152] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2'-Ome sugar moiety.

[0153] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer can be represented using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and 10 linked nucleosides in the gap. When a specific modification is followed by this nomenclature, the modification is in each sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer contains five linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. A 5-8-5 MOE gapmer contains five linked 2'-MOE nucleosides in the 5'-wing, eight linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing.

[0154] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer.

[0155] In certain embodiments, modified oligonucleotides have a sugar motif from 5' to 3': eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE ribosyl sugar moiety.

[0156] 2. Certain nucleobase motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or its region. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0157] In certain embodiments, the oligonucleotide having gapmer motif comprises a nucleoside that comprises a modified nucleobase.In certain such embodiments, one nucleoside that comprises a modified nucleobase is located in the central gap of the oligonucleotide having gapmer motif.In certain such embodiments, the sugar moiety of the nucleoside is a 2-deoxyribosyl sugar moiety.

[0158] 3. Certain internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0159] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages of the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif includes at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not the terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing such internucleoside linkage motifs.

[0160] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3') sooooossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0161] C. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom within the stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom among the modified oligonucleotides in the population. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for β-D ribosyl sugar moieties, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0162] D. Nucleic acid base sequence In certain embodiments, the oligonucleotide (unmodified or modified oligonucleotide) is further described by its nucleobase sequence. In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, a region or the entire length of the oligonucleotide has a nucleobase sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid (such as a target nucleic acid).

[0163] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group comprises one or more conjugate moieties and a conjugate linker connecting the conjugate moieties to the oligonucleotide. A conjugate group can be attached to one or both termini of an oligonucleotide and / or any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to one or both termini of an oligonucleotide is a terminal group. In certain embodiments, a conjugate group or terminal group is attached to the 3'-terminus and / or 5'-terminus of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3'-terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3'-terminus of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 5'-terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5'-end of the oligonucleotide.

[0164] A. Certain conjugate groups In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups, which modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0165] In certain embodiments, one or more properties of a modified oligonucleotide can be altered by conjugating one or more carbohydrate moieties to the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier attached to a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this manner is referred to herein as a modified sugar moiety, a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0166] In certain embodiments, the conjugate group confers a new property to the attached oligonucleotide (e.g., a fluorophore or reporter group that allows for detection of the oligonucleotide). Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or the palmityl moiety of adamantaneacetic acid (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J.Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0167] In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0168] In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0169] In certain embodiments, the conjugate group has the structure: [ka]

[0170] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0171] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folic acid, benzothiadiazide, chlorothiazide, diazepine, indomethicine, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0172] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In some oligomer compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In some oligomer compounds, conjugate linker comprises chain structure such as hydrocarbyl chain, or oligomer of repeating unit such as ethylene glycol, nucleoside or amino acid unit.

[0173] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0174] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0175] In certain embodiments, the conjugate linker (including the conjugate linkers described above) is a bifunctional linking moiety, known in the art to be useful for attaching a conjugate group to a compound, such as the oligonucleotides provided herein. Typically, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0176] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0177] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 1 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises 1 to 3 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, linker nucleosides are unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0178] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker containing linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising 1 to 10 consecutive linker nucleosides from the modified oligonucleotide. The total number of consecutively linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of consecutively linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.

[0179] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide.For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but after the oligomeric compound is taken up, it is desirable to cleave the conjugate group to release the unconjugated or parent oligonucleotide.Therefore, certain conjugate linkers can contain one or more cleavable moieties.In certain embodiments, the cleavable moiety is a cleavable bond.In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond.In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds.In certain embodiments, the cleavable moiety is selectively cleaved within cells or intracellular compartments such as lysosomes.In certain embodiments, the cleavable moiety is selectively cleaved by endogenous enzymes such as nucleases.

[0180] In certain embodiments, the cleavable bond is selected from amide, ester, ether, one or both esters of a phosphodiester, phosphate ester, carbamate, and disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0181] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0182] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka]

[0183] In the formula, n is 1 to about 3, when n is 1, m is 0, when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.

[0184] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0185] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one linked ligand. In certain embodiments, the cell targeting moiety comprises two linked ligands covalently bound to the branching group. In certain embodiments, the cell targeting moiety comprises three linked ligands covalently bound to the branching group.

[0186] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO 2011 / 131693, WO 2014 / 064257.

[0187] In certain embodiments, the conjugate group comprises a cell-targeting moiety having affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including but not limited to those described in WO 1991 / 004753, WO 2013 / 103800, WO 2014 / 144060, WO 2016 / 081643, WO 2016 / 179257, WO 2016 / 207240, WO 2017 / 221883, WO 2018 / 129384, WO 2018 / 124121, WO 2019 / 151539, WO 2020 / 132584, WO 2020 / 028864, US 7,208,174, US 9,034,329, and US 10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0188] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO 2019 / 140050, WO 2020 / 037150, WO 2020 / 124032, and US 10,138,483.

[0189] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO 2013 / 163303, WO 2019 / 033051, and WO 2020 / 245198.

[0190] B. Certain end groups In certain embodiments, an oligomeric compound comprises one or more terminal groups. Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate group, a protecting group, a modified or unmodified nucleoside, and two or more independently modified or unmodified nucleosides. In certain such embodiments, an oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates (including, but not limited to, 5'-vinylphosphonate). In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain embodiments, the 2'-linked group is an abasic sugar moiety.

[0191] III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acids and produce at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense agents. In certain embodiments, antisense agents have antisense activity when they reduce or inhibit the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense agents selectively act on one or more target nucleic acids. Such antisense agents comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to produce one or more desired antisense activities and does not hybridize to one or more non-target nucleic acids, or does not produce significant undesired antisense activity even when hybridized to one or more non-target nucleic acids.

[0192] In certain antisense activities, hybridization of an antisense agent or a portion of an antisense agent with a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense agents result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA within such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, the antisense agents described herein are antisense agents comprising antisense oligomeric compounds that include antisense oligonucleotides with sufficient "DNA-likeness" to induce RNase H activity. In certain embodiments, the presence of one or more non-DNA-like nucleosides within the gapmer gap is permitted.

[0193] In certain antisense activity, antisense agent or part of antisense agent is loaded into RNA-induced silencing complex (RISC), and finally target nucleic acid is cut.For example, certain antisense agent causes target nucleic acid to be cut by Argonaute.The antisense agent that is loaded into RISC is RNAi agent.RNAi agent is double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0194] In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid alters the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid inhibits the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid alters the translation of the target nucleic acid.

[0195] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a change in phenotype in a cell or animal.

[0196] IV. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA comprising introns, exons, and untranslated regions. In certain embodiments, the target RNA is mature mRNA. In certain embodiments, the target nucleic acid is pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron.

[0197] A.MECP2 In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is an MECP2 nucleic acid. In certain embodiments, the MECP2 nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NC_000023.11, truncated from nucleosides 154019001 to 154101000) or SEQ ID NO: 2 (GenBank Accession No. NM_004992.3). In certain embodiments, contacting a cell with an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of MECP2 RNA, and in certain embodiments, reduces the amount of MECP2 protein. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide and a conjugate group.

[0198] In certain embodiments, contacting a cell with an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of MECP2 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 reduces the amount of MECP2 protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, contacting a cell in a subject with an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO: 1 or SEQ ID NO: 2 ameliorates one or more symptoms or characteristics of a neurodegenerative disease or disorder associated with MECP2. In certain embodiments, the neurodegenerative disease or disorder associated with MECP2 is MECP duplication syndrome. In certain embodiments, the symptom or characteristic is any one of autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death.

[0199] In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of MECP2 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in a standard cell assay. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of MECP2 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of MECP2 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of MECP2 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of MECP2 RNA in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 can reduce the detectable amount of MECP2 protein in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0200] B. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is expressed in pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the brain and spinal cord. In certain embodiments, the target nucleic acid is expressed in pharmacologically relevant cells. In certain embodiments, the pharmacologically relevant cells are cells that express MECP2. In certain embodiments, the pharmacologically relevant cells are neurons or glial cells. In certain embodiments, the pharmacologically relevant cells are neural cells. In certain embodiments, the pharmacologically relevant cells are astrocytes, oligodendrocytes, or microglial cells.

[0201] IV. Certain Methods and Uses Certain embodiments provided herein relate to methods for reducing or inhibiting MECP2 expression or activity, which may be useful for treating, preventing, or ameliorating a disease or disorder associated with MECP2 overexpression in a subject by administering an oligomeric compound, oligomeric duplex, or antisense agent, all of which include a modified oligonucleotide having a nucleobase sequence complementary to an MECP2 nucleic acid. In certain embodiments, the disease or disorder associated with MECP2 overexpression is a neurodegenerative disease or disorder. In certain embodiments, the neurodegenerative disease or disorder is an MECP2 duplication syndrome.

[0202] In certain embodiments, the method comprises administering to a subject an oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid. In certain embodiments, the subject has or is at risk of developing MECP2 duplication syndrome.

[0203] In certain embodiments, a method for treating a neurodegenerative disease or disorder associated with MECP2 comprises administering to a subject a therapeutically effective amount of an oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk of developing a neurodegenerative disease or disorder associated with MECP2. In certain embodiments, the disease or disorder is associated with elevated MECP2 levels in the subject.

[0204] In certain embodiments, the subject has or is at risk of developing MECP2 duplication syndrome. In certain embodiments, at least one symptom or characteristic of a neurodegenerative disease or disorder associated with MECP2 duplication syndrome is ameliorated. Exemplary symptoms or characteristics include, but are not limited to, autism, intellectual disability, motor dysfunction, hypotension, general developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death.

[0205] In certain embodiments, a method for reducing the expression of MECP2 nucleic acid, e.g., RNA, or reducing the expression of MECP2 protein in a cell comprises administering to a subject an oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby inhibiting the expression of MECP2 nucleic acid in the subject. In certain embodiments, administration of the oligomeric compound, oligomeric duplex, or antisense agent inhibits MECP2 expression in the brain or spinal cord of the subject. In certain embodiments, the subject has or is at risk of developing a neurological disease or condition associated with MECP2. In certain embodiments, the subject has or is at risk of developing an MECP2 duplication syndrome.

[0206] In certain embodiments, a method for inhibiting expression of an MECP2 nucleic acid in a cell comprises contacting the cell with an oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby inhibiting expression of the MECP2 nucleic acid in the cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron or a glial cell (e.g., an astrocyte, an oligodendrocyte, or a microglial cell). In certain embodiments, the cell is obtained from a subject who has, for example, a disease or disorder associated with MECP2 or is at risk of developing such a disease or disorder. In certain embodiments, the cell is from a subject who has a disease or condition associated with MECP2, such as an MECP2 duplication syndrome.

[0207] In certain embodiments, a method for reducing MECP2 expression, e.g., MECP2 RNA expression, or a method for reducing MECP2 protein expression in a cell comprises contacting the cell with an oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an ATN1 nucleic acid. In certain embodiments, the subject has or is at risk of developing MECP2 duplication syndrome (MDS). In certain embodiments, the subject has MDS. In certain embodiments, the cell is a neuron or glial cell. In certain embodiments, the cell is a human cell.

[0208] Certain embodiments relate to oligomeric compounds, oligomeric duplexes, or antisense agents having a nucleobase sequence complementary to an MECP2 nucleic acid for use in treating a disease or disorder associated with elevated MECP2 signaling or overexpression of MECP2. In certain embodiments, the disease or disorder is MECP2 duplication syndrome. In certain embodiments, the oligomeric compound, oligomeric duplex, or antisense agent is used to ameliorate a symptom or characteristic of a disease or condition associated with MECP2 duplication syndrome. In certain embodiments, the symptom or characteristic is selected from autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death. In certain embodiments, the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent is used to reduce MECP2 expression in a subject.

[0209] Certain embodiments relate to oligomeric compounds, oligomeric duplexes, or antisense agents comprising modified oligonucleotides having a nucleobase sequence complementary to an MECP2 nucleic acid, for the manufacture or preparation of a medicament for treating a disease associated with MECP2. In certain embodiments, the disease is MECP2 duplication syndrome. In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents are for the manufacture or preparation of a medicament for ameliorating a symptom or characteristic associated with MECP2 duplication syndrome. In certain embodiments, the symptom or characteristic is selected from autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death. In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents are for the manufacture or preparation of a medicament for use in reducing MECP2 expression in a subject.

[0210] In any of the methods or uses described herein, the oligomeric compound, oligomeric duplex, or antisense agent may be any of those described herein.

[0211] V. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the one or more oligomeric compounds each consist of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0212] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and PBS. In certain embodiments, the pharmaceutical composition consists of an oligomeric compound and PBS. In certain embodiments, the pharmaceutical composition consists essentially of an oligomeric compound and PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0213] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0214] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the oligomeric compound and the artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the oligomeric compound and the artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0215] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and aCSF. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF. In certain embodiments, the aCSF is pharmaceutical grade. In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, disodium phosphate anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1 to 7.3, or about 7.2, with an appropriate pH adjuster, for example, an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0216] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0217] In certain embodiments, the oligomeric compounds can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The formulation and method of pharmaceutical compositions depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage.

[0218] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds containing one or more modified oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof upon administration to a subject, including a human subject. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, magnesium salts, and the like. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0219] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF. In certain embodiments, the sodium salt of the oligomeric compound is the sodium salt of a modified oligonucleotide.

[0220] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes are formed with monocationic or polycationic lipids in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.

[0221] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0222] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0223] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Such a cosolvent system may include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such a cosolvent system is used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such a cosolvent system can be varied significantly without significantly altering the solubility or toxicity characteristics. Furthermore, the types of cosolvent components can be varied, for example, by substituting other surfactants for Polysorbate 80™, varying the proportion of polyethylene glycol, substituting other biocompatible polymers such as polyvinylpyrrolidone for polyethylene glycol, or substituting other sugars or polysaccharides for dextrose.

[0224] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that enhance solubility or act as preservatives) are also included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain injectable pharmaceutical compositions are provided in unit dosage form, e.g., in ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending agents, stabilizers, and / or dispersing agents. Certain vehicles suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0225] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in protonated (free acid) or ionized (cationized salt) forms, but aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate linkages of oligonucleotides in aqueous solution exist in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides may have multiple such linkages, each in equilibrium. Thus, oligonucleotides in solution may exist in multiple locations as a collection of various forms, all in equilibrium. The term "oligonucleotide" is intended to encompass all such forms. Drawn structures necessarily represent a single form. However, unless otherwise specified, such drawings are intended to encompass corresponding forms as well. Herein, when a structure depicting the free acid of a compound is followed by the terms "or a salt thereof" or "or a pharmaceutically acceptable salt thereof," all forms, whether fully or partially protonated, deprotonated, cationic, or associated with a combination of cations, are expressly included. In certain embodiments, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, when a structure representing the free acid of a compound is followed by the term "or a pharmaceutically acceptable salt thereof," all forms that may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium are expressly included.

[0226] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0227] Certain specific dosage amounts are described herein. Dosage amounts can be in the form of dosage units. For clarity, the milligram dosage (or dosage unit) of a modified oligonucleotide or oligomeric compound refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anion and salt form. However, for the purpose of calculating dosage amounts, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid.

[0228] For example, when a modified oligonucleotide or oligomeric compound is in a sodium-containing solution (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons counts toward the dose weight, while the mass of the sodium ions does not. Thus, for example, a 10 mg dose or dosage unit of Compound No. 1435454 corresponds to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1435454.

[0229] In certain embodiments, when a modified oligonucleotide or oligomeric compound is present in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with sodium, potassium, calcium, and / or magnesium, but the mass of the protons is counted in the dose weight, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the dose weight.

[0230] In certain embodiments, when an oligomeric compound includes a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also contains an acid, it is assumed that the conjugate group is also fully protonated for the purposes of calculating the dosage.

[0231] Non-Limiting Disclosure and Incorporation by Reference Each of the references and patent publications mentioned herein is incorporated by reference in its entirety.

[0232] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are intended only to illustrate the compounds described herein and are not intended to limit the compounds. Each reference, GenBank accession number, etc. cited in this application is incorporated herein by reference in its entirety.

[0233] In this specification, when a compound is described as "having the nucleobase sequence of a SEQ ID NO," only the nucleobase sequence is described. Thus, unless otherwise specified, the description of a compound referring to the nucleobase sequence of a SEQ ID NO does not limit the presence or absence of additional substituents such as sugar or internucleoside linkage modifications or conjugate groups. Furthermore, unless otherwise specified, the nucleobase of a compound "having the nucleobase sequence" of a SEQ ID NO includes compounds having modified forms of the specific nucleobases described herein.

[0234] While the Sequence Listing accompanying this application identifies each sequence as "RNA" or "DNA" as appropriate, those of skill in the art will readily understand that the designation "RNA" or "DNA" to describe modified oligonucleotides is, in some cases, arbitrary. For example, an oligonucleotide containing a nucleoside having a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar moiety (2'-OH instead of a single 2'-H in DNA) or as an RNA with a modified base (thymine (methylated uracil) instead of uracil in RNA), and certain nucleic acid compounds described herein contain one or more nucleosides containing a modified sugar moiety with 2'-substituent(s) that are neither OH nor H. Those of skill in the art will readily understand that labeling such nucleic acid compounds as "RNA" or "DNA" does not alter or limit the description of such nucleic acid compounds. Accordingly, the nucleic acid sequences provided herein (including, but not limited to, those contained in the Sequence Listing) are intended to encompass nucleic acids comprising any combination of natural or modified RNA and / or DNA, including, but not limited to, modified nucleobases, unless otherwise specified. By way of further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG" encompasses any oligomeric compound having such a nucleobase sequence, whether modified or unmodified, including compounds containing RNA bases, such as compounds having the sequence "AUCGAUCG," and compounds containing some DNA bases and some RNA bases, such as "AUCGATCG," as well as compounds containing "AT m Oligomeric compounds with other modified nucleobases such as "CGAUCG" ( m (C denotes a cytosine base containing a methyl group at position 5). Finally, for clarity, unless otherwise specified, the phrase "nucleobase sequence of SEQ ID NO: X" refers only to the nucleobase sequence of SEQ ID NO: X, regardless of any sugar or internucleoside linkage modifications set forth in such SEQ ID NO.

[0235] Certain compounds described herein (e.g., modified oligonucleotides) possess one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), α or β, as in the case of sugar anomers, or (D) or (L), as in the case of amino acids. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein depicted or described as having no defined stereochemistry include all possible isomers, including stereorandom and optically pure forms, unless otherwise specified. Similarly, all cis and trans isomers and tautomers of the compounds described herein are included unless otherwise specified. Oligomeric compounds described herein include chirally pure or chirally enriched mixtures, as well as racemic mixtures. For example, oligomeric compounds having a plurality of phosphorothioate internucleoside linkages include compounds in which the chirality of the phosphorothioate internucleoside linkages is controlled or random. Unless otherwise specified, the compounds described herein are intended to include the corresponding salt forms.

[0236] As used herein, when a compound is described by chemical notation (subscripts and / or superscripts indicating chemical modifications) without reference to a specific compound number, it includes only each modification described, but may include additional substituents such as conjugate groups unless otherwise specified. For example, "A es T ko m C ez G dsThe chemical notation "C" indicates that a first nucleoside comprises a 2'-MOE sugar moiety (denoted by the subscript "e") and an unmodified adenine nucleobase (denoted by the subscript "s") linked to a second nucleoside via a phosphorothioate bond, the second nucleoside comprises a cEt sugar moiety (denoted by the subscript "k") and an unmodified thymine nucleobase (denoted by the subscript "o") linked to a third nucleoside via a phosphodiester bond, and the third nucleoside comprises a 2'-MOE sugar moiety and an unmodified thymine nucleobase (denoted by the subscript "o") linked to a third nucleoside via a phosphodiester bond. and a 5-methyl-modified cytosine nucleobase (denoted by the superscript "m") linked via a phosphorothioate linkage to a fourth nucleoside (denoted by the letter "z"), the fourth nucleoside comprising a 2'-β-D-deoxyribosyl sugar moiety (denoted by the subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a phosphorothioate linkage, and the fifth nucleoside comprising a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase, and which compounds may include additional substituents such as conjugate groups.

[0237] As used herein, when a particular compound (e.g., see Compound Number) is described by chemical notation (as in the Examples), each nucleobase, sugar, and internucleoside linkage of such particular compound is modified only as shown. Thus, in the context of describing a particular compound having a particular Compound Number, "A es T ko m C ez G dsThe chemical notation "C" indicates a nucleotide sequence in which a first nucleoside comprises a 2'-MOE sugar moiety (denoted by the subscript "e") and an unmodified adenine nucleobase (denoted by the subscript "s") linked to a second nucleoside via a phosphorothioate bond, the second nucleoside comprises a cEt sugar moiety (denoted by the subscript "k") and an unmodified thymine nucleobase (denoted by the subscript "o") linked to a third nucleoside via a phosphodiester bond, and the third nucleoside comprises a 2'-MOE sugar moiety and a mesylphosphoramidate and a 5-methyl-modified cytosine nucleobase (denoted by superscript "m") linked to a fourth nucleoside via a bond (denoted by subscript "z"), wherein the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (denoted by subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a phosphorothioate bond, and wherein the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase, and wherein the compound does not include any additional substituents.

[0238] As used herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within the nucleotide or nucleobase sequence (e.g., in superscript or subscript, as described above) or may be indicated in text accompanying the sequence (e.g., in separate text displayed above or below in a table of compounds).

[0239] Where a particular compound is described herein by a depicted chemical structure, each nucleobase, sugar, and internucleoside linkage of such particular compound contains only the modifications shown in the depicted chemical structure. However, one of ordinary skill in the art will understand that the depicted compound may exist in equilibrium between tautomers and / or as a salt in equilibrium with a protonated or ionic form. The depicted structure is intended to capture all forms of such compounds.

[0240] While every effort has been made to accurately describe the compounds in the attached sequence listing, in the event of any discrepancy between the description in this specification and the description in the attached sequence listing, the description in this specification, not the sequence listing, shall prevail.

[0241] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds containing hydrogen atoms as described herein include 1 Isotopic substitutions encompassed in the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 These include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution can confer new properties to oligomeric compounds, making them useful as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make compounds suitable for research or diagnostic purposes, such as imaging. [Example]

[0242] The following examples show certain specific embodiments of the present disclosure, but are not limited thereto. Furthermore, when specific embodiments are provided, the inventors consider the general applicability of these specific embodiments. For example, the disclosure of an oligonucleotide having a specific motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, when a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are also considered suitable, unless otherwise specified.

[0243] Example 1. In vitro effects of a single dose of a 5-10-5 MOE gapmer complementary to human MECP2 RNA Modified oligonucleotides complementary to human MECP2 nucleic acid were designed and tested for single-dose effects on MECP2 RNA in vitro.

[0244] The modified oligonucleotides in the following table are 5-10-5 MOE gapmers with mixed PO / PS linkages. The modified oligonucleotides in the following table are 20 nucleosides in length, and the sugar motif of the modified oligonucleotides is (5' to 3'): eeeeeddddddddddeeeee, where each "e" represents a 2'-MOE ribosyl sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif of the modified oligonucleotides is (5' to 3'): sooooossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester linkage. Each cytosine residue is a 5-methylcytosine.

[0245] The modified oligonucleotides listed in the table below are 100% complementary to SEQ ID NO:1 (complement of GenBank Accession No. NC_000023.11, truncated from nucleoside 154019001 to 154101000), SEQ ID NO:2 (GenBank Accession No. NM_004992.3), or both. "Start Site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "Stop Site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "Not Applicable" indicates that the modified oligonucleotide is not 100% complementary to a particular target nucleic acid sequence.

[0246] A431 cells were treated with modified oligonucleotides at a concentration of 4,000 nM by free uptake at a density of 10,000 cells per well. After a treatment period of approximately 48 hours, total RNA was isolated from the cells, and MECP2 RNA levels were measured by quantitative real-time RT-PCR. MECP2 RNA levels were measured using human primer probe set RTS37209 (forward sequence CAAGGCCAAACAGAGAGGA (herein designated SEQ ID NO: 3), reverse sequence TTGTCAGAGCCCTACCCATA (herein designated SEQ ID NO: 4), probe sequence AGAATAAAGGCAGGTCGTTGTCTCTTCTCC (herein designated SEQ ID NO: 5)). MECP2 RNA levels were normalized to total RNA content measured with RIBOGREEN®. The reduction in MECP2 RNA is shown in the table below as the percent MECP2 RNA relative to the amount of MECP2 RNA in untreated control cells (% UTC). [Table 1]

[0247] Example 2. Effect of Multiple Administrations of Modified Oligonucleotides on Human MECP2 in Vitro Modified oligonucleotides were tested at various doses in A431 cells. A431 cells seeded at a density of 10,000 per well were treated by free uptake with modified oligonucleotides at the concentrations shown in the table below. After a treatment period of approximately 48 hours, total RNA was isolated from the cells and MECP2 RNA levels were measured by quantitative real-time RT PCR. RNA levels were measured as described above using the human MECP2 primer probe set RTS37209 (described above). MECP2 RNA levels were normalized to total RNA content measured with RIBOGREEN®. The reduction in MECP2 RNA is shown in the table below as a percent of MECP2 RNA relative to untreated control cells (%UTC). The half-maximal inhibitory concentrations (IC) of modified oligonucleotides were 50) was calculated using linear regression of a log / linear plot of the data in Excel and is also shown in the table below. Each experiment is presented in a separate table. [Table 2]

[0248] Example 3. Effect of Multiple Administrations of Modified Oligonucleotides on Human MECP2 in Vitro The modified oligonucleotides were tested at various doses in SH-SY5Y cells. Compound No. 1435454, described above, is a modified oligonucleotide having the nucleobase sequence (5' to 3') GCAACATTTTCAGTTTCAGC (SEQ ID NO: 18), in which nucleosides 1 to 5 and 16 to 20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6 to 15 are each 2'-β-D-deoxynucleosides, and nucleosides 2 to 3, 3 to 4, 4 to 5, 5 to 6, 6 to 7, 7 to 8, 8 to 9, 9 to 10, 10 to 11, 11 to 12, 12 to 13, 13 to 14, 14 to 15, 15 to 16, 16 to 20 ... The internucleoside linkages between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0249] Comparative compound number 628785, previously described in WO 2016 / 141145, WO 2016 / 141236, and Sztainberg et al., Nature 528(7580):123-126 (2015), is 5-10-5 is an MOE gapmer and has the nucleobase sequence of (5' to 3'): GGTTTTTCTCCTTTATTATC (incorporated herein as SEQ ID NO: 20), wherein the sugar motif of Compound No. 628785 is (5' to 3'): eeeeeddddddddddeeeee, wherein each "e" represents a 2'-MOE ribosyl sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, wherein the internucleoside linkage motif is (5' to 3'): soooossssssssssooss, wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester linkage, and wherein each cytosine residue is a 5-methylcytosine.

[0250] Comparative Compound No. 912669, previously described in Shao et al., Sci. Trans. Med. 13(583)(2021), is a 5-10-5 MOE gapmer and has the nucleobase sequence of (5' to 3'): TATGGTTTTTCTCCTTTATT (incorporated herein as SEQ ID NO: 21), wherein the sugar motif of Compound No. 912669 is (5' to 3'): eeeeedddddddddd eeeee, where each "e" represents a 2'-MOE ribosyl sugar moiety, each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, where the internucleoside linkage motif is (5' to 3'): sooooossssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage, and each "o" represents a phosphodiester bond, and where each cytosine residue is a 5-methylcytosine.

[0251] Compounds 628785 and 912669 are 100% complementary to SEQ ID NO: 1 (described herein above). In the table below, "START SITE" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary, and "STOP SITE" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "Not applicable" indicates that the modified oligonucleotide is not 100% complementary to a particular target nucleic acid sequence. [Table 3]

[0252] SHSY5Y cells seeded at a density of 12,500 per well were differentiated for 10 days in Neurobasal medium supplemented with B27 (ThermoFisher), GlutaMAX (ThermoFisher), and 10 μM retinoic acid (Sigma). Differentiated SH-SY5Y cells were treated with modified oligonucleotides at the concentrations shown in the table below by free uptake. After a 5-day treatment period, total RNA was isolated from the cells, and MECP2 RNA levels were measured by quantitative real-time RT-PCR. The human MECP2 primer probe set RTS52360 (forward sequence: GATCAATCCCCAGGGAAAAGC (herein designated as SEQ ID NO: 12), reverse sequence: CCTCTCCCCAGTTACCGTGAAG (herein designated as SEQ ID NO: 13), probe sequence: CATTAGGGTCCAGGGATGTGTCGC (herein designated as SEQ ID NO: 14)) was used to measure RNA levels as described above. MECP2 RNA levels were normalized to human GAPDH. Human GAPDH was amplified using human primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC (designated herein as SEQ ID NO: 15), reverse sequence GAAGATGGTGATGGATTTC (designated herein as SEQ ID NO: 16), probe sequence CAAGCTTCCCGTTCTCAGCC (designated herein as SEQ ID NO: 17)).

[0253] The reduction in MECP2 RNA is shown in the table below as a percent of MECP2 RNA relative to the amount of MECP2 RNA in untreated control cells (% UTC). The half-maximal inhibitory concentration (IC) for each modified oligonucleotide was 50 ) was calculated using GraphPad Prism software.

[0254] As shown in the table below, Compound No. 1435454 is more potent than Comparative Compound No. 628785 and Comparative Compound No. 912669 in this assay. [Table 4]

[0255] Example 4. Activity of modified oligonucleotides complementary to human MECP2 in transgenic mice MECP2 transgenic line MECP2 described in Collins AL, et al., Human Molecular Genetics, Volume 13, Issue 21, November 1, 2004, pages 2679-2689 Tg1 was used to examine the effects of the modified oligonucleotides described above on MECP2 RNA.

[0256] MECP2 transgenic mice were divided into groups of 2-4 mice each. Each mouse received a single ICV bolus injection of 350 μg or 500 μg of modified oligonucleotide, as specified in the table below. Groups of 2-4 mice also received a single ICV bolus injection with PBS as a negative control.

[0257] After 2 weeks of treatment, mice were sacrificed, RNA was extracted from the cortical brain tissue and spinal cord, and quantitative real-time RT-PCR analysis of MECP2 RNA expression was performed using human primer probe set RTS4253 (forward sequence TGAAGGAGTCTTCTATCCGATCTGT (designated herein as SEQ ID NO: 6), reverse sequence CACTTCCTTGACCTCGATGCT (designated herein as SEQ ID NO: 7), probe sequence AGACCGTACTCCCCATCAAGAAGCGC (designated herein as SEQ ID NO: 8)) or human primer probe set RTS37209 (described herein above). MECP2 RNA levels were normalized to mouse GAPDH. Mouse GAPDH was amplified using primer probe set mGapdh_LTS00102 (forward sequence GGCAAATTCAACGGCACAGT (designated herein as SEQ ID NO: 9), reverse sequence GGGTCTCGCTCCTGGAAGAT (designated herein as SEQ ID NO: 10), probe sequence AAGGCCGAGAATGGGAAGCTTGTCATC (designated herein as SEQ ID NO: 11)). Results are shown as a percent of human MECP2 RNA relative to the amount of MECP2 RNA in PBS-treated animals (% control). Each experiment is presented in a separate table. [Table 5] [Table 6] [Table 7]

[0258] Example 5. Activity of modified oligonucleotides complementary to human MECP2 in transgenic mice following multiple doses MECP2 transgenic mice (described above) were divided into groups of four. Each mouse received a single ICV bolus injection of various concentrations of modified oligonucleotides as defined in the table below. Groups of four mice received PBS as a negative control.

[0259] Two weeks after treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue, spinal cord, hippocampus, and cerebellum. MECP2 RNA levels were measured by quantitative real-time RT-PCR using the human primer probe set RTS4253 (described above). MECP2 RNA levels were normalized to mouse GAPDH, which was amplified using the primer probe set mGapdh_2 (described above). Results are presented as the percentage of human MECP2 RNA relative to the amount of MECP2 RNA in PBS-treated animals (% control). [Table 8]

Claims

1. A modified oligonucleotide according to the following chemical structure: 【Chemical 1】 (SEQ ID NO: 19), or a pharmaceutically acceptable salt thereof.

2. 2. The modified oligonucleotide of claim 1, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

3. The modified oligonucleotide of claim 1 , wherein the modified oligonucleotide is a sodium salt or a potassium salt.

4. A modified oligonucleotide according to the following chemical structure: 【Chemistry 2】 (SEQ ID NO: 19).

5. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: G ｅｓ ｍ C ｅｏ A ｅｏ A ｅｏ ｍ C ｅｏ A ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｓ ｍ C ｄｓ A ｄｓ G ｄｓ T ｄｓ T ｄｓ T ｅｏ ｍ C ｅｏ A ｅｓ G ｅｓ ｍ C ｅ (SEQ ID NO: 19), wherein: A = adenine nucleobase, ｍ C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkages, oligomeric compounds.

6. 2. The population of modified oligonucleotides of claim 1, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides are all stereorandom.

7. A pharmaceutical composition comprising the modified oligonucleotide of claim 1 and a pharmaceutically acceptable diluent.

8. 8. The pharmaceutical composition of claim 7, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

9. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

10. 3. The population of modified oligonucleotides of claim 2, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides are all stereorandom.

11. A pharmaceutical composition comprising the modified oligonucleotide of claim 2 and a pharmaceutically acceptable diluent.

12. 12. The pharmaceutical composition of claim 11, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

13. 13. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

14. 5. The population of modified oligonucleotides of claim 4, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides are all stereorandom.

15. A pharmaceutical composition comprising the modified oligonucleotide of claim 4 and a pharmaceutically acceptable diluent.

16. 16. The pharmaceutical composition of claim 15, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

17. 17. The pharmaceutical composition of claim 16, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and the phosphate buffered saline or the artificial cerebrospinal fluid.

18. 6. The population of oligomeric compounds of claim 5, wherein all of said phosphorothioate internucleoside linkages of said oligomeric compounds are stereorandom.

19. A pharmaceutical composition comprising the oligomeric compound of claim 5 and a pharmaceutically acceptable diluent.

20. 20. The pharmaceutical composition of claim 19, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

21. 21. The pharmaceutical composition of claim 20, wherein the pharmaceutical composition consists essentially of the oligomeric compound and the phosphate buffered saline or the artificial cerebrospinal fluid.

22. 10. A pharmaceutical composition comprising the population of claim 6 and a pharmaceutically acceptable diluent.

23. 23. The pharmaceutical composition of claim 22, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

24. 11. A pharmaceutical composition comprising the population of claim 10 and a pharmaceutically acceptable diluent.

25. 25. The pharmaceutical composition of claim 24, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

26. 15. A pharmaceutical composition comprising the population of claim 14 and a pharmaceutically acceptable diluent.

27. 27. The pharmaceutical composition of claim 26, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

28. 20. A pharmaceutical composition comprising the population of claim 18 and a pharmaceutically acceptable diluent.

29. 29. The pharmaceutical composition of claim 28, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

30. 19. A method comprising administering to a subject a modified oligonucleotide according to any one of claims 1 to 4, an oligomeric compound according to claim 5, a population according to any one of claims 6, 10, 14 and 18, or a pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29.

31. 31. The method of claim 30, wherein the subject has a disease or disorder associated with MECP2.

32. 32. The method of claim 31, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

33. 33. The method of claim 31 or 32, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

34. 19. A method of treating a disease or disorder associated with MECP2, comprising administering to a subject having or at risk of developing a disease or disorder associated with MECP2 a therapeutically effective amount of the modified oligonucleotide of any one of claims 1 to 4, the oligomeric compound of claim 5, the population of any one of claims 6, 10, 14 and 18, or the pharmaceutical composition of any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29, thereby treating said disease or disorder associated with MECP2.

35. 35. The method of claim 34, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

36. 36. The method of claim 34 or 35, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

37. 37. The method of any one of claims 34 to 36, wherein at least one symptom or feature of the disease or disorder associated with MECP2 is ameliorated.

38. 38. The method of claim 37, wherein the symptom or characteristic is autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, or premature death.

39. The method of any one of claims 34 to 38, wherein the disease or disorder associated with MECP2 is associated with elevated MECP2 levels in the subject.

40. 40. The method of any one of claims 34-39, wherein administration of the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms in the subject, or improves motor function, motor development, muscle tone, cognitive development, language, or social skill development in the subject.

41. The method of any one of claims 31 to 40, wherein the subject is a human.

42. 19. A method of reducing expression of MECP2 in a cell, comprising contacting the cell with a modified oligonucleotide according to any one of claims 1 to 4, an oligomeric compound according to claim 5, a population according to any one of claims 6, 10, 14 and 18, or a pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29.

43. 43. The method of claim 42, wherein the cell is a neuron.

44. 44. The method of claim 42 or claim 43, wherein the cell is a human cell.

45. 19. Use of a modified oligonucleotide according to any one of claims 1 to 4, an oligomeric compound according to claim 5, a population according to any one of claims 6, 10, 14 and 18, or a pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29 in the treatment of a disease or disorder associated with MECP2.

46. 30. Use of a modified oligonucleotide according to any one of claims 1 to 4, an oligomeric compound according to claim 5, a population according to any one of claims 6, 10, 14 and 18, or a pharmaceutical composition according to any one of claims 7 to 9, 11 to 13, 15 to 17 and 19 to 29 in the manufacture of a medicament for the treatment of a disease or disorder associated with MECP2.

47. 47. The use of claim 45 or 46, wherein the disease or disorder associated with MECP2 is associated with elevated MECP2 levels.

48. The use according to any one of claims 45 to 47, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

Images