Compounds and methods for reducing MECP2 expression

Oligomeric agents targeting MECP2 RNA/protein levels address the lack of treatments for MECP2 duplication syndrome, effectively ameliorating symptoms like autism and intellectual disability.

JP2025532128APending Publication Date: 2025-09-29IONIS PHARMACEUTICALS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025517347
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-09-23
Filing Date
2023-09-22
Publication Date
2025-09-29

AI Technical Summary

Technical Problem

There is a lack of effective treatments for MECP2 duplication syndrome, which is characterized by autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, and premature death, primarily affecting males.

Method used

Development of oligomeric agents and pharmaceutical compositions that reduce MECP2 expression by targeting MECP2 RNA or protein levels in cells or animals, using modified oligonucleotides with specific nucleobase sequences and chemical modifications to inhibit MECP2 activity.

Benefits of technology

These agents effectively ameliorate symptoms of MECP2 duplication syndrome, including reducing severity or frequency of symptoms such as autism, intellectual disability, and other neurological issues.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025532128000001
    Figure 2025532128000001
  • Figure 2025532128000002
    Figure 2025532128000002
  • Figure 2025532128000003
    Figure 2025532128000003
Patent Text Reader

Abstract

Oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of methyl-CpG-binding protein 2 (MECP2) RNA in a cell or animal, and optionally reducing the amount of MECP2 protein in a cell or animal. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a neurodevelopmental disease or disorder associated with MECP2. Such neurodevelopmental diseases or disorders include MECP2 duplication syndromes. Such symptoms or characteristics include autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Sequence Listing

[0001] This application is submitted with an electronic Sequence Listing. The Sequence Listing is provided in the file BIOL0428SEQ.xml, created on September 13, 2023, and is 2,195 Kb in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0002] Oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of methyl-CpG-binding protein 2 (MECP2) RNA in cells or animals, and optionally reducing MECP2 protein in cells or animals. Such oligomeric agents, oligomeric compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of a neurodevelopmental disease or disorder. Such neurodevelopmental diseases or disorders include MECP2 duplication syndromes. Such symptoms or characteristic characteristics include autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death. [Background technology]

[0003] Methyl-CpG-binding protein 2 (MECP2), located on chromosome Xq28, plays a fundamental role in epigenetics, chromatin state regulation, and the expression of thousands of genes (Chahrour et al., Science, 2008, 320:1224-1229; Nan et al., Nature, 1998, 393:386-389; Jones et al., Nat. Genet., 1998, 19:187-191). MECP2 duplication syndrome, caused by MECP2 overexpression, is characterized by autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and early death, and primarily affects males (Ramocki et al., Am J Med Genet A, 2010, 152A:1079-1088).

[0004] Currently, there is a lack of acceptable options for treating such neurological diseases. It is therefore an object of the present invention to provide compounds and pharmaceutical compositions for treating such diseases and disorders. Summary of the Invention

[0005] Certain embodiments of the oligomeric agents, oligomeric compounds, and pharmaceutical compositions described herein are useful for reducing or inhibiting MECP2 expression in cells or animals. In certain embodiments, MECP2 RNA or protein levels may be reduced in cells or animals. Methods for treating MECP2 duplication syndrome are also provided. DETAILED DESCRIPTION OF THE INVENTION

[0006] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "comprises" is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components that contain a single unit and elements and components that contain multiple subunits, unless expressly stated otherwise.

[0007] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application (including, but not limited to, patents, patent applications, articles, books, papers, GenBank, ENSEMBL, and NCBI reference sequence records), as well as portions of documents discussed herein, are expressly incorporated by reference in their entirety.

[0008] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, and other materials referenced throughout the disclosure are incorporated herein by reference in their entirety.

[0009] Unless otherwise stated, the following terms have the following meanings:

[0010] As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which contains a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0011] As used herein, "2'-MOE" refers to an OCH2CHOCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" or "2'-MOE ribosyl sugar moiety" refers to a sugar moiety having an OCH2CHOCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.

[0012] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0013] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-OMe sugar moiety is in the β-D-ribosyl configuration.

[0014] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0015] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-F sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-F sugar moiety is in the β-D ribosyl stereochemical configuration.

[0016] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F sugar moiety.

[0017] As used herein, "2'-NMA" refers to a 2'-OCH2C(=O)-N(H)CH3 group in place of the 2'-OH group of a furanosyl sugar moiety. A "2-NMA sugar moiety" or "2'-O-[2-(methylamino)-2-oxoethyl] sugar moiety" refers to a sugar moiety having a 2'-OCH2C(=O)-N(H)CH3 group in place of the 2'-OH group of a furanosyl sugar moiety.

[0018] "2'-NMA sugar moiety" means the sugar portion of a 2'-NMA nucleoside.

[0019] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.

[0020] As used herein, "3' target site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0021] As used herein, "5' target site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an antisense oligonucleotide when the antisense oligonucleotide is hybridized to the target nucleic acid.

[0022] As used herein, "5-methylcytosine" means a cytosine modified by being attached to a methyl group at position 5. 5-methylcytosine is a modified nucleobase.

[0023] As used herein, "abasic sugar moiety" means the sugar portion of a nucleoside that is not linked to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0024] As used herein, "improve" in relation to treatment refers to the improvement of at least one symptom or characteristic compared with the same symptom or characteristic when not treated.In certain embodiments, improvement is the reduction in the severity or frequency of symptom or characteristic, or the delay in the onset or progression of the severity or frequency of symptom or characteristic.In certain embodiments, symptom or characteristic is one or more of autism, intellectual disability, motor dysfunction, hypotension, general developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infection, epileptic encephalopathy, and early death.The progression or severity of indicators can be determined by subjective or objective measures known to those skilled in the art.

[0025] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" means a modified sugar moiety comprising two rings, the second ring being formed via a bridge connecting two atoms of the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety. Examples of bicyclic sugar moieties include LNA (locked nucleic acid) sugar moieties and cEt sugar moieties, as defined herein.

[0026] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0027] As used herein, "blunt" or "blunt-ended" in reference to an oligomeric duplex formed by two oligonucleotides means that there are no unpaired nucleotides at the ends (i.e., no overhanging nucleotides). One or both ends of the oligomeric duplex can be blunt.

[0028] As used herein, "cell targeting moiety" means a conjugate moiety or a portion of a conjugate moiety that is capable of binding to a specific cell type or specific cell types.

[0029] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties (e.g., osmolality, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with cerebrospinal fluid.

[0030] As used herein, "chiral control" with respect to an internucleoside linkage means that the chirality at that linkage is enriched for a particular stereochemical configuration.

[0031] As used herein, "chiral enrichment" in reference to a population means that there are multiple molecules of the same molecular formula, but the number or percentage of molecules in the population containing a specific stereochemical configuration at a specific chiral center is greater than the number or percentage of molecules expected to contain the same specific stereochemical configuration at the same specific chiral center in the population if the specific chiral center were stereorandom as defined herein. A chiral enriched molecular population having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorus atom of a mesylphosphoramidate internucleoside linkage.

[0032] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, for example, inside a cell, animal, or human.

[0033] As used herein, "complementary" with respect to an oligonucleotide means that, when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid, or one or more regions thereof, can hydrogen bond with each other. A "complementary region" with respect to a region of an oligonucleotide means that, when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid, or one or more regions thereof, can hydrogen bond with each other. Complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Certain modified nucleobases that pair with unmodified nucleobases or other modified nucleobases are known in the art and, unless otherwise specified, are not considered complementary nucleobases as defined herein. For example, inosine can pair with adenosine, cytosine, or uracil, but is not considered complementary. Complementary oligonucleotides and / or nucleic acids do not need to have nucleic acid base complementarity at each nucleoside. Rather, some mismatches are allowed. As used herein, "fully complementary" or "100% complementary" in relation to an oligonucleotide means that an oligonucleotide is complementary to another oligonucleotide or nucleic acid at each nucleic acid base of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0034] As used herein, "region of complementarity" with respect to an oligonucleotide refers to the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.

[0035] As used herein, "conjugate group" means a group of atoms directly attached to an oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate group moiety to the oligonucleotide.

[0036] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0037] As used herein, "conjugate moiety" means a group of atoms that modifies one or more properties of a molecule compared to the same molecule lacking the conjugate moiety, such properties including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0038] As used herein, "constrained ethyl" or "cEt" or "cEt sugar moiety" means a β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0039] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0040] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0041] As used herein, a "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, in which at least 70% of the nucleosides contain a β-D-2'-deoxyribosyl sugar moiety. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap of a gapmer.

[0042] As used herein, "diluent" refers to an ingredient in a composition that has no pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in a composition to be injected can be a liquid such as aCSF, PBS, or saline.

[0043] As used herein, "double-stranded" with respect to a region or oligonucleotide refers to a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are folded regions of the same molecule (e.g., a hairpin structure).

[0044] As used herein, "duplex" or "duplex region" means the structure formed by two oligonucleotides or portions thereof hybridized to one another.

[0045] As used herein, a "gapmer" refers to a modified oligonucleotide comprising an internal region located between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides comprising the external regions, such that the modified oligonucleotide supports RNase H cleavage. The internal region may be referred to as a "gap," and the external regions may be referred to as "wings." In certain embodiments, the internal region is a deoxy region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5'-end of the internal region. Unless otherwise specified, "gapmer" refers to a sugar motif. In certain embodiments, the internal region is a "deoxy region." In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remaining nucleosides in the gap are 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise specified, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications need not follow the gapmer pattern of sugar modifications.

[0046] As used herein, a "hotspot region" is a range of nucleobases on a target nucleic acid that is suitable for reducing the amount or activity of the target nucleic acid by the action of an oligomeric agent, oligomeric compound, modified oligonucleotide, antisense compound, or antisense agent.

[0047] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding (which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleic acid bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0048] As used herein, "internucleoside bond" refers to the covalent bond between adjacent nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than phosphodiester internucleoside bond."Phosphorothioate internucleoside bond" or "PS internucleoside bond" refers to a modified internucleoside bond in which one of the non-bridging oxygen atoms of phosphodiester internucleoside bond is replaced with a sulfur atom.

[0049] As used herein, "inverted nucleoside" means a nucleotide having 3' to 3' and / or 5' to 5' internucleoside linkages as shown herein.

[0050] As used herein, "inverted sugar moiety" means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having 3' to 3' and / or 5' to 5' internucleoside linkages.

[0051] As used herein, "linked nucleosides" are nucleosides joined in contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0052] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide moiety of the oligomeric compound, even if they are contiguous with the oligonucleotide.

[0053] As used herein, "mismatch" or "non-complementary" means that the nucleobases of a first nucleic acid sequence are not complementary to the corresponding nucleobases of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposite orientations.

[0054] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0055] As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety.

[0056] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0057] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.

[0058] As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0059] As used herein, the "nucleobase sequence" of a reference SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO, and therefore, unless otherwise specified, includes compounds in which each sugar moiety and each internucleoside linkage is independently modified or unmodified, with or without the modifications indicated in the reference SEQ ID NO.

[0060] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which is independently unmodified or modified.

[0061] As used herein, "oligomeric agent" means an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or an oligomeric duplex formed by two complementary oligomeric compounds.

[0062] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0063] The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "duplex oligomeric compound."

[0064] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications. An oligonucleotide may or may not be paired with a second oligonucleotide complementary to the oligonucleotide. A "single-stranded oligonucleotide" is an unpaired oligonucleotide. A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0065] As used herein, "pharmaceutically acceptable carrier or diluent" means a substance suitable for use in administration to an animal. Certain such carriers enable the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0066] As used herein, "pharmaceutically acceptable salt(s)" refers to physiologically and pharmaceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

[0067] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0068] As used herein, a "population" means a plurality of molecules having the same molecular formula.

[0069] As used herein, "prodrug" refers to an inactive or less active form of a compound that is metabolized to form an active or more active compound upon administration to a subject. In certain embodiments, a prodrug comprises a cell-targeting moiety and at least one active compound.

[0070] As used herein, "RNA" means RNA transcript, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0071] As used herein, "RNAi agent" refers to an antisense agent that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA (including microRNA mimics). RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent regulates the amount and / or activity of a target nucleic acid. The term RNAi agent does not include antisense agents that act through RNase H.

[0072] As used herein, "RNase H agent" refers to an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single-stranded. In certain embodiments, the RNase H agent is double-stranded. The RNase H compound may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent does not include antisense agents that act primarily through RISC / Ago2.

[0073] As used herein, "antisense RNase H oligonucleotide" means an oligonucleotide that includes a region complementary to a target sequence and that contains at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.

[0074] As used herein, "antisense RNAi oligonucleotide" means an oligonucleotide that includes a region complementary to a target sequence and that contains at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.

[0075] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that at least partially hybridizes with itself.

[0076] As used herein, "single-stranded" means a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a duplex. A single-stranded compound can hybridize with a complementary nucleic acid to form a duplex, at which point it is no longer single-stranded.

[0077] As used herein, a "stabilizing phosphate group" refers to a 5'-chemical moiety that stabilizes the 5'-phosphate portion of the 5'-terminal nucleoside of an oligonucleotide compared to the stability of the unmodified 5'-phosphate of the unmodified nucleoside under biological conditions. Such stabilization of the 5'-phosphate group includes, but is not limited to, resistance to removal by phosphatases. Stabilizing phosphate groups include, but are not limited to, 5'-vinyl phosphonate and 5'-cyclopropyl phosphonate.

[0078] As used herein, "standard cellular assay" means the in vitro assay described in Examples 1 and 2 and reasonable variations thereof.

[0079] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that is not controlled during synthesis or enriched after synthesis with respect to a particular absolute stereochemical configuration. The stereochemical configuration of a chiral center is random if it is the result of a synthetic method not designed to control the stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral center may be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral center ("racemic"). In certain embodiments, the stereorandom chiral center is not racemic because one absolute configuration predominates as a result of synthesis, for example, by the action of a non-chiral reagent adjacent to the adjacent sugar moiety of enriched stereochemistry. In certain embodiments, the stereorandom chiral center is at the phosphorus atom of a stereorandom phosphorothioate or mesyl phosphoramidate internucleoside linkage.

[0080] As used herein, "subject" means a human or non-human animal. The terms "subject," "animal," and "individual" are used interchangeably. In certain embodiments, the subject is a human.

[0081] In certain embodiments, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H) ribosyl moiety found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H) deoxyribosyl sugar moiety found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0082] As used herein, "sugar surrogate" refers to a modified sugar moiety that can attach a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide, but that is not a furanosyl sugar moiety or a bicyclic sugar moiety. Modified nucleosides containing sugar surrogates can be incorporated into one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids. Examples of sugar surrogates include GNA (glycol nucleic acid), FHNA (fluorohexitol nucleic acid), morpholino, and other structures described herein and known in the art.

[0083] As used herein, "symptoms or characteristics" refers to physical characteristics or test results that indicate the presence or extent of a disease or disorder. In certain embodiments, the symptoms are apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the characteristics are revealed by invasive diagnostic testing, including but not limited to post-mortem examination. In certain embodiments, the characteristics are revealed by an MRI scan of the brain. In certain embodiments, such symptoms and characteristics include autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death.

[0084] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an oligomeric compound is designed to affect. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0085] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0086] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0087] As used herein, "treatment" means improving a disease or condition in a subject by administering an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent described herein. In certain embodiments, treating a subject improves symptoms compared to the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0088] As used herein, "therapeutically effective amount" means an amount of a pharmaceutical agent or composition that confers a therapeutic benefit on an animal, e.g., administration of a therapeutically effective amount results in amelioration of disease symptoms.

[0089] As used herein, "antisense activity" refers to a detectable and / or measurable change resulting from hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound. In certain embodiments, antisense activity is modulation of target pre-mRNA splicing.

[0090] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0091] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0092] As used herein, "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0093] As used herein, "antisense oligonucleotide" refers to an oligonucleotide (including the oligonucleotide portion of an antisense compound) that can hybridize to a target nucleic acid and have at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0094] As used herein, "sense oligonucleotide" means an oligonucleotide that comprises the oligonucleotide portion of a sense compound and is capable of hybridizing to an antisense oligonucleotide.

[0095] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0096] Embodiment 1: An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an equal length portion of an MECP2 nucleic acid, and said modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0097] Embodiment 2. The oligomeric compound of embodiment 1, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340.

[0098] In embodiment 3, the nucleobase sequence of the modified oligonucleotide is selected from the group consisting of nucleobases 10858 to 10885, 11534 to 11588, 11597 to 11620, 12936 to 12962, 13599 to 13641, 13669 to 13711, 14716 to 14746, 15883 to 15905, 16362 to 16396, 18941 to 18975, 19046 to 19091, 20216 to 20271, and 21505 to 21532 of SEQ ID NO: 1. , 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970-24995, 32385-32414, 32447-32508, 32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202.

[0099] Embodiment 4. The oligomeric compound of any one of embodiments 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an isometric portion within nucleobases 32588 to 32671 of SEQ ID NO:1.

[0100] Embodiment 5. The oligomeric compound of any one of embodiments 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32611 to 32630 of SEQ ID NO:1.

[0101] Embodiment 6. The oligomeric compound of any one of Embodiments 1-5, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of the MECP2 nucleic acid.

[0102] 80. An oligomeric compound comprising a modified oligonucleotide consisting of the linked nucleosides of embodiments 7, 8 to 80, and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18 to 2339, wherein the modified oligonucleotide has at least one modification selected from a modified sugar and a modified internucleoside linkage.

[0103] Embodiment 8. The oligomeric compound of embodiment 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 18-2339.

[0104] Embodiment 9: The oligomeric compound of embodiment 7 or embodiment 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 18 to 2339.

[0105] Embodiment 10: The oligomeric compound of any one of embodiments 7-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2335.

[0106] Embodiment 11: The oligomeric compound of any one of embodiments 7-9, wherein the modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 2336-2339.

[0107] Embodiment 12. The oligomeric compound of any one of embodiments 7 to 10, wherein said modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 1197.

[0108] Embodiment 13. The oligomeric compound of any one of embodiments 7 to 10, wherein said modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 1197.

[0109] Embodiment 14: The oligomeric compound of any one of Embodiments 1-13, wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an MECP2 nucleic acid, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340.

[0110] In embodiment 15, the modified oligonucleotide is selected from the group consisting of 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 15. The oligomeric compound of any one of embodiments 1-14, consisting of 30, 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0111] Embodiment 16. The oligomeric compound according to any one of embodiments 1 to 15, wherein said modified oligonucleotide consists of 18 linked nucleosides.

[0112] Embodiment 17. The oligomeric compound according to any one of embodiments 1 to 15, wherein said modified oligonucleotide consists of 20 linked nucleosides.

[0113] Embodiment 18. The oligomeric compound according to any one of embodiments 1 to 17, wherein the modified oligonucleotide comprises at least one modified nucleoside.

[0114] Embodiment 19. The oligomeric compound of embodiment 18, wherein the at least one modified nucleoside comprises a modified sugar moiety.

[0115] Embodiment 20. The oligomeric compound of embodiment 19, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0116] Embodiment 21. The oligomeric compound of embodiment 20, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0117] Embodiment 22. The oligomeric compound of embodiment 19, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

[0118] Embodiment 23. The oligomeric compound of embodiment 22, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0119] Embodiment 24. The oligomeric compound of any one of embodiments 1 to 23, wherein at least one nucleoside of the modified oligonucleotide comprises a sugar surrogate.

[0120] Embodiment 25. The oligomeric compound of embodiment 24, wherein the sugar surrogate is a morpholino or a PNA.

[0121] Embodiment 26. The oligomeric compound according to any one of embodiments 1 to 25, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0122] Embodiment 27. The oligomeric compound of embodiment 26, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0123] Embodiment 28. The oligomeric compound of embodiment 26, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0124] Embodiment 29. The oligomeric compound of embodiment 26 or embodiment 27, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.

[0125] Embodiment 30. The oligomeric compound of any one of embodiments 26 or 28-29, wherein each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0126] Embodiment 31: The oligomeric compound of any one of embodiments 26 or 28-30, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages.

[0127] Embodiment 32. The oligomeric compound of any one of embodiments 26-28 or 30-31, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

[0128] Embodiment 33: The oligomeric compound of any one of embodiments 26 or 28-31, wherein the internucleoside linkage motif of the modified oligonucleotide is selected from 5'-soooossssssssssooss-3' and 5'-sooosssssssssooss-3', wherein each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0129] Embodiment 34. The oligomeric compound of any one of embodiments 1 to 33, wherein the modified oligonucleotide comprises at least one modified nucleobase.

[0130] Embodiment 35. The oligomeric compound of embodiment 34, wherein the modified nucleobase is 5-methylcytosine.

[0131] Embodiment 36. The oligomeric compound of embodiment 35, wherein each cytosine is a 5-methylcytosine.

[0132] Embodiment 37. The oligomeric compound of any one of embodiments 1-36, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12-22, 12-20, 14-18, 14-20, 15-17, 15-25, 16-20, 16-18, 18-20, 18-22, 18-25, 18-20, 20-25, or 21-23 linked nucleosides, or a pharmaceutically acceptable salt thereof.

[0133] Embodiment 38. The oligomeric compound of any one of embodiments 1 to 37, wherein the modified oligonucleotide comprises a deoxy region.

[0134] Embodiment 39. The oligomeric compound of embodiment 38, wherein each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.

[0135] Embodiment 40. The oligomeric compound of embodiment 38 or embodiment 39, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

[0136] Embodiment 41. The oligomeric compound of any one of embodiments 38-40, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.

[0137] In embodiment 42, the deoxy region is adjacent to a 5'-exoregion consisting of 1 to 6 linked 5'-exoregion nucleosides on the 5'-side and adjacent to a 3'-exoregion consisting of 1 to 6 linked 3'-exoregion nucleosides on the 3'-side; the 3'-most nucleoside of the 5' exoregion nucleosides comprises a modified sugar moiety; and 42. The oligomeric compound of any one of embodiments 38-41, wherein the 5'-most nucleoside of said 3' exoregion nucleosides comprises a modified sugar moiety.

[0138] Embodiment 43. The oligomeric compound of embodiment 41 or embodiment 42, wherein each of the 3' exoregion nucleosides comprises a modified sugar moiety.

[0139] Embodiment 44, the modified oligonucleotide a 5' exoregion consisting of 5 linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and having a 3' exoregion consisting of 5 linked nucleosides; The oligomeric compound of embodiment 43, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a 2'-MOE nucleoside.

[0140] Embodiment 45, the modified oligonucleotide a 5' exoregion consisting of 5 linked 5'-exoregion nucleosides; a deoxy region consisting of 8 linked nucleosides, and having a 3' exoregion consisting of 5 linked 3'-exoregion nucleosides; The oligomeric compound of embodiment 42 or embodiment 43, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a 2'-MOE nucleoside.

[0141] Embodiment 46, the modified oligonucleotide comprises: a 5' exoregion consisting of 1 to 6 linked nucleosides; a deoxy region consisting of 6 to 10 linked nucleosides, and a sugar motif comprising a 3' exoregion consisting of 1 to 6 linked nucleosides; The oligomeric compound of embodiment 42 or embodiment 43, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a cEt nucleoside or a 2'-MOE nucleoside, and each of the deoxyregion nucleosides is a 2'-β-D-deoxynucleoside.

[0142] Embodiment 47. The oligomeric compound of any one of embodiments 1 to 46, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from eeeeeddddddddddeeeee and eeeeeddddddddeeeee, wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.

[0143] Embodiment 48. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es m C eo A eo A eo m C eo A ds T ds T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eoA es G es m C e (SEQ ID NO: 2341), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety s = phosphorothioate internucleoside linkage, and Oligomeric compounds where o = phosphodiester internucleoside linkage.

[0144] Embodiment 49. The oligomeric compound according to any one of embodiments 1 to 48, consisting of said modified oligonucleotide.

[0145] Embodiment 50. The oligomeric compound of any one of embodiments 1 to 48, wherein the oligomeric compound comprises a conjugate group.

[0146] Embodiment 51. The oligomeric compound of embodiment 50, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0147] Embodiment 52. The oligomeric compound of embodiment 51, wherein the conjugate linker consists of a single bond.

[0148] Embodiment 53. The oligomeric compound of any one of embodiments 51-52, wherein the conjugate linker is cleavable.

[0149] Embodiment 54. The oligomeric compound of embodiment 51 or embodiment 53, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0150] Embodiment 55. The oligomeric compound of any one of embodiments 51 to 53, wherein the conjugate linker does not comprise any linker nucleosides.

[0151] Embodiment 56. The oligomeric compound according to any one of embodiments 50 to 55, wherein the conjugate group is attached to the modified oligonucleotide at the 5′-end of the modified oligonucleotide.

[0152] Embodiment 57. The oligomeric compound according to any one of embodiments 50 to 55, wherein the conjugate group is attached to the modified oligonucleotide at the 3′-end of the modified oligonucleotide.

[0153] Embodiment 58. The oligomeric compound of any one of embodiments 1 to 57, wherein the oligomeric compound comprises a terminal group.

[0154] Embodiment 59. The oligomeric compound of embodiment 58, wherein the terminal group is an abasic sugar moiety.

[0155] Embodiment 60. The oligomeric compound of any one of embodiments 1 to 59, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0156] Embodiment 61, a modified oligonucleotide according to the following chemical structure (SEQ ID NO: 2341): [ka] or a pharmaceutically acceptable salt thereof.

[0157] Embodiment 62. The modified oligonucleotide of embodiment 61, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0158] Embodiment 63. The modified oligonucleotide of embodiment 61, which is a sodium salt or a potassium salt.

[0159] Embodiment 64, a modified oligonucleotide according to the following chemical structure (SEQ ID NO: 2341): [ka] or a pharmaceutically acceptable salt thereof.

[0160] 65. A chiral enriched population of the oligomeric compounds of any one of embodiments 1 to 60, or a chiral enriched population of the modified oligonucleotides of any one of embodiments 61 to 64, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having a specific stereochemical configuration.

[0161] Embodiment 66. The chirally enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides comprising at least one specific phosphorothioate internucleoside linkage having an (Sp) or (Rp) configuration.

[0162] Embodiment 67. The chirally enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0163] Embodiment 68. The chiral enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides having the (Rp) configuration at one particular phosphorothioate internucleoside linkage and the (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

[0164] Embodiment 69. The chirally enriched population of embodiment 65, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction.

[0165] Embodiment 70. The population of oligomeric compounds of any one of embodiments 1 to 60, or the population of modified oligonucleotides of any one of embodiments 61 to 64, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0166] Embodiment 71. An oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide, wherein said first oligomeric compound is the oligomeric compound of any one of embodiments 1 to 60.

[0167] Embodiment 72. The oligomeric duplex of embodiment 71, wherein the second modified oligonucleotide consists of 8 to 80 linked nucleosides and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide.

[0168] Embodiment 73. The oligomeric duplex of any one of embodiments 71-72, wherein the first modified oligonucleotide comprises a 5'-stabilizing phosphate group.

[0169] Embodiment 74. The oligomeric duplex of embodiment 73, wherein said 5'-stabilizing phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.

[0170] Embodiment 75. The oligomeric duplex of any one of embodiments 71 to 74, wherein the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate.

[0171] Embodiment 76. The oligomeric duplex of any one of embodiments 71 to 74, wherein the first modified oligonucleotide comprises a 2'-NMA sugar moiety.

[0172] Embodiment 77. The oligomeric duplex of any one of embodiments 71 to 76, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

[0173] Embodiment 78. The oligomeric duplex of embodiment 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

[0174] Embodiment 79. The oligomeric duplex of embodiment 78, wherein the bicyclic sugar moiety of the second modified oligonucleotide comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0175] Embodiment 80. The oligomeric duplex of embodiment 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

[0176] Embodiment 81. The oligomeric duplex of embodiment 80, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

[0177] Embodiment 82. The oligomeric duplex of any one of embodiments 71 to 81, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

[0178] Embodiment 83. The oligomeric duplex of any one of embodiments 71 to 82, wherein at least one internucleoside linkage of said second modified oligonucleotide is a modified internucleoside linkage.

[0179] Embodiment 84. The oligomeric duplex of embodiment 83, wherein at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage.

[0180] Embodiment 85. The oligomeric duplex of any one of embodiments 71 to 84, wherein at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage.

[0181] Embodiment 86. The oligomeric duplex of any one of embodiments 71 to 85, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0182] Embodiment 87. The oligomeric duplex of any one of embodiments 71 to 86, wherein said second modified oligonucleotide comprises at least one modified nucleobase.

[0183] Embodiment 88. The oligomeric duplex of embodiment 87, wherein at least one modified nucleobase of said second modified oligonucleotide is 5-methylcytosine.

[0184] Embodiment 89. The oligomeric duplex of any one of embodiments 71 to 88, wherein the second modified oligonucleotide comprises a conjugate group.

[0185] Embodiment 90. The oligomeric duplex of embodiment 89, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

[0186] Embodiment 91. The oligomeric duplex of embodiment 89 or embodiment 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 5'-end of the second modified oligonucleotide.

[0187] Embodiment 92. The oligomeric duplex of embodiment 89 or embodiment 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 3′-end of the second modified oligonucleotide.

[0188] Embodiment 93. The oligomeric duplex of embodiment 89 or embodiment 90, wherein the conjugate group is attached via the 2' position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

[0189] Embodiment 94. The oligomeric duplex of any one of embodiments 89-93, wherein the conjugate group comprises a lipid.

[0190] Embodiment 95. The oligomeric duplex of any one of embodiments 71 to 94, wherein the second modified oligonucleotide comprises a terminal group.

[0191] Embodiment 96. The oligomeric duplex of embodiment 95, wherein the terminal group is an abasic sugar moiety.

[0192] Embodiment 97, the second modified oligonucleotide is selected from the group consisting of 10 to 25, 10 to 30, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 30 97. The oligomeric duplex of any one of embodiments 71-96, consisting of 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0193] Embodiment 98: An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound described in any one of embodiments 1 to 60, or a modified oligonucleotide described in any one of embodiments 61 to 64.

[0194] Embodiment 99. An antisense agent which is an oligomeric duplex according to any one of embodiments 71 to 97.

[0195]

[0019] Embodiment 100, the antisense agent is i. an RNase H agent capable of reducing the amount of MECP2 nucleic acid through activation of RNase H, or ii. The antisense agent of embodiment 98 or embodiment 99, which is an RNAi agent capable of reducing the amount of MECP2 nucleic acid through activation of RISC / Ago2.

[0196] Embodiment 101. The antisense agent of any one of embodiments 98-100, wherein the antisense agent comprises a conjugate group, and the conjugate group is a cell targeting moiety.

[0197] 102. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 60, a modified oligonucleotide according to any one of embodiments 61 to 64, a population according to any one of embodiments 65 to 70, an oligomeric duplex according to any one of embodiments 71 to 97, or an antisense agent according to any one of embodiments 98 to 101, and a pharmaceutically acceptable diluent.

[0198] Embodiment 103. The pharmaceutical composition of embodiment 102, wherein the pharmaceutically acceptable diluent is phosphate-buffered saline or artificial cerebrospinal fluid.

[0199] Embodiment 104: The pharmaceutical composition of embodiment 103, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and the phosphate-buffered saline or the artificial cerebrospinal fluid.

[0200] A method comprising administering to a subject an oligomeric compound according to embodiment 105, an oligomeric compound according to any one of embodiments 1 to 60, a modified oligonucleotide according to any one of embodiments 61 to 64, a population according to any one of embodiments 65 to 70, an oligomeric duplex according to any one of embodiments 71 to 97, an antisense agent according to any one of embodiments 98 to 101, or a pharmaceutical composition according to any one of embodiments 102 to 104.

[0201]

[0018] Embodiment 106. The method of embodiment 105, wherein the subject has a disease or disorder associated with MECP2.

[0202] Embodiment 107. The method of embodiment 106, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

[0203] Embodiment 108. The method of embodiment 105 or embodiment 106, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0204] Embodiment 109. A method of treating a disease or disorder associated with MECP2, comprising administering to a subject having or at risk of developing a disease or disorder associated with MECP2 a therapeutically effective amount of the oligomeric compound of any one of embodiments 1-60, the modified oligonucleotide of any one of embodiments 61-64, the population of any one of embodiments 65-70, the oligomeric duplex of any one of embodiments 71-97, the antisense agent of any one of embodiments 98-101, or the pharmaceutical composition of any one of embodiments 102-104, thereby treating said disease or disorder associated with MECP2.

[0205]

[0072] Embodiment 110: The method of embodiment 109, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

[0206] Embodiment 111. The method of embodiment 109 or embodiment 110, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

[0207] Embodiment 112: The method of any one of embodiments 109-111, wherein at least one symptom or feature of said disease or disorder associated with MECP2 is ameliorated.

[0208] Embodiment 113: The method of embodiment 112, wherein the symptom or characteristic is autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, or premature death.

[0209] Embodiment 114: The method of embodiments 109-113, wherein the disease or disorder is associated with elevated MECP2 levels in the subject.

[0210] Embodiment 115: The method of any one of embodiments 105-114, wherein administering the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, the antisense agent, or the pharmaceutical composition reduces seizures in the subject, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms, or improves motor function, motor development, muscle tone, cognitive development, language, or social skill development in the subject.

[0211] Embodiment 116: The method of any one of embodiments 105 to 115, wherein the subject is a human.

[0212] Embodiment 117. A method for reducing expression of MECP2 in a cell, comprising contacting the cell with an oligomeric compound of any one of embodiments 1 to 60, a modified oligonucleotide of any one of embodiments 61 to 64, a population of any one of embodiments 65 to 70, an oligomeric duplex of any one of embodiments 71 to 97, an antisense agent of any one of embodiments 98 to 101, or a pharmaceutical composition of any one of embodiments 102 to 104.

[0213]

[0018] Embodiment 118: The method of embodiment 117, wherein the cell is a neuron.

[0214]

[00182] Embodiment 119: The method of embodiment 117 or embodiment 118, wherein the cells are human cells.

[0215] Use of embodiment 120, an oligomeric compound according to any one of embodiments 1 to 60, a modified oligonucleotide according to any one of embodiments 61 to 64, a population according to any one of embodiments 65 to 70, an oligomeric duplex according to any one of embodiments 71 to 97, an antisense agent according to any one of embodiments 98 to 101, or a pharmaceutical composition according to any one of embodiments 102 to 104 for the treatment of a disease or disorder associated with MECP2.

[0216] Embodiment 121: Use of an oligomeric compound according to any one of embodiments 1 to 60, a modified oligonucleotide according to any one of embodiments 61 to 64, a population according to any one of embodiments 65 to 70, an oligomeric duplex according to any one of embodiments 71 to 97, or an antisense agent according to any one of embodiments 98 to 101, or a pharmaceutical composition according to any one of embodiments 102 to 104 in the manufacture of a medicament for treating a disease or disorder associated with MECP2.

[0217] Embodiment 122. The use of embodiment 120 or embodiment 121, wherein the disease or disorder is associated with elevated MECP2 levels.

[0218] Embodiment 123. The use according to any one of embodiments 120 to 122, wherein the disease or disorder is MECP2 duplication syndrome.

[0219] Certain Oligomeric Agents and Compounds Certain embodiments provide oligomeric agents that target MECP2 nucleic acids. In certain embodiments, the MECP2 nucleic acid has the sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NC_000023.11, truncated from nucleosides 154019001 to 154101000), or SEQ ID NO: 2 (GenBank Accession No. NM_004992.3), or SEQ ID NO: 2340 (complement of GenBank Accession No. NT_167198.1, truncated from nucleosides 4203000 to 4283000), each of which is incorporated by reference in its entirety. In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound. In certain embodiments, the oligomeric agent is an oligomeric duplex.

[0220] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal-length portion of an MECP2 nucleic acid, and the modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0221] In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises nucleobases 2055-2074, 2267-2286, 2321-2340, 2411-2430, 2485-2504, 2536-2555, 2547-2566, 2553-2572, 2683-2702, 2840-2859, 3060-3079, 3075-3094, 3701-3719, 3703-3722, 4286-4305, 4302-4321, 4327-4346, 4456-4475, 4482-4501, 4509-4528, 4511-4519, 4521-4530, 4536-4540, 4541-4542, 4551-4552, 4553-4554, 4555-4556, 4553-4572 ... 530, 4531~4550, 4550~4569, 4560~4579, 4574~4593, 4575~4594, 4659~4678, 4820~4839, 4823~4842, 4825~4844, 4847~4866, 4858~4877, 4876~4895, 4877~4896, 4879~4898, 4880~4899, 4884~4903, 4941~4960, 4964~4983, 4967~4986, 5044~5063, 5053~5072, 5107~5126, 5173~5192, 5177~5196, 5213 ~5232, 5243~5262, 5253~5272, 5263~5282, 5271~5290, 5272~5291, 5273~5292, 5293~5312, 5303~5322, 5310~5329, 5355~5374, 5363~5382, 5365~538 4, 5371~5390, 5539~5558, 5642~5661, 5643~5662, 5644~5663, 5764~5783, 5795~5814, 5802~5821, 5809~5828, 5844~5863, 5858~5877, 5864~5883, 58 71~5890, 5879~5898, 5994~6013, 5995~6014, 6003~6022, 6036~6055, 6113~6132, 6114~6133, 6115~6134, 6116~6135, 6120~6139, 6130~6149, 6172~6 191, 6216~6235, 6229~6248, 6315~6334, 6363~6382, 6555~6574, 6556~6575, 6557~6576, 6629~6648, 6673~6692, 6674~6693, 6675~6694, 6676~6695,6695~6714、6696~6715、6697~6716、6698~6717、6744~6763、6747~6766、6790~6809、6805~6824、6806~6825、6919~6938、7066~7085、7514~7533、7539~7558、7545~7564、7593~7612、7594~7613、7595~7614、7596~7615、7626~7645、7629~7648、7630~7649、7631~7650、7712~7731、7713~7732、7723~7742、7729~7748、7746~7765、7777~7796、7781~7800、7792~7811、7852~7871、7901~7920、7902~7921、7916~7935、7924~7943、7926~7945、7927~7946、7975~7994、8036~8055、8042~8061、8043~8062、8045~8064、8052~8071、8054~8073、8090~8109、8091~8110、8115~8134、8117~8136、8130~、 8149、8131~8150、8132~8151、8146~8165、8157~8176、8234~8253、8272~8291、8280~8299、8324~8343、8325~8344、8368~8387、8370~8389、8382~8401、8385~8404、8386~8405、8388~8407、8389~8408、8391~8410、8394~8413、8456~8475、8466~8485、8477~8496、8478~8497、8504~8523、8571~8590、8573~8592、8575~8594、8581~8600、8629~8648、8630~8649、8631~8650、8632~8651、8633~8652、8690~8709、8694~8713、8719~8738、8721~8740、8782~8801、8783~8802、8784~8803、8797~8816、8809~8828、8810~8829、8906~8925、8927~8946、8929~8948、8951~8970、8952~8971、8953~8972、9007~9026、9008~9027、9010~9029、9012~9031、9014~9033、9016~9035、9123~9142、9175~9194、9181~9200、9185~9204、9191~9210、9196~9215、9213~9232、9215~9234、9227~9246、9229~9248、9230~9249、9238~9257、9239~9258、9253~9272、9266~9285、9267~9286、9270~9289、9271~9290、9275~9294、9308~9327、9335~9354、9339~9358、9341~9360、9342~9361、9344~9363、9369~9388、9371~9390、9372~9391、9377~9396、9378~9397、9390~9409、9391~9410、9392~9411、9424~9443、9425~9444、9431~9450、9457~9476、9483~9502、9494~9513、9495~9514、9497~9516、9516~9535、9538~9557、9539~9558、9636~9655、9666~9685、9672~9691、9691~9710、9692~9711、9699~9718、9700~9719、9828~9847、9829~9848、9836~9855、9837~9856、9838~9857、9839~9858、9843~9862、9856~9875、9873~9892、9901~9920、9903~9922、9905~9924、9907~9926、9909~9928、9911~9930、9939~9958、9953~9972、9967~9986、9971~9990、9988~10007、9989~10008、9990~10009、9991~10010、9994~10013、9996~10015、10049~、 10068、10054~10073、10071~10090、10081~10100、10083~10102、10084~10103、10088~10107、10090~10109、10091~10110、10116~10135、10117~10136、10118~10137、10132~10151、10133~10152、10134~10153、10135~10154、10238~10257、10240~10259、10249~10268、10250~10269、10252~10271、10258~10277、10281~10300、10288~10307、10290~10309、10293~10312、10306~10325、10338~10357、10354~10373、10364~10383、10366~10385、10375~10394、10378~10397、10379~10398、10419~10438、10456~10475、10697~10716、10707~10726、10854~10873、10856~10875、10857~10876、10858~10877、10859~10878、10860~10879、10861~10880、10862~10881、10863~10882、10864~10883、10866~10885、10869~10888、10909~10928、10919~10938、10929~10948、10959~10978、11305~11324、11390~11409、11402~11421、11435~11454、11437~11456、11452~11471、11455~11474、11467~11486、11475~11494、11477~11496、11478~11497、11479~11498、11485~11504、11495~11514、11497~11516、11499~11518、11500~11519、11505~11524、11507~11526、11508~11527、11534~11553、11535~11554、11539~11558、11540~11559、11556~11575、11565~11584、11567~11586、11568~11587、11569~11588、11570~11589、11571~11590、11574~11593、11578~11597、11589~11608、11597~11616、11598~11617、11599~11618、11600~11619、11601~11620、11605~11624、11607~11626、11609~11628、11615~11634、11617~11636、11618~11637、11619~11638、11629~11648、11633~11652、11635~11654、11636~11655、11638~11657、11641~11660、11647~11666、11648~11667、11657~11676、11658~11677、11659~11678、11667~、 11686、11744~11763、12563~12582、12587~12606、12617~12636、12618~12637、12620~12639、12621~12640、12644~12663、12657~12676、12715~12734、12836~12855、12877~12896、12878~12897、12909~12928、12914~12933、12915~12934、12936~12955、12937~12956、12940~12959、12941~12960、12943~12962、12952~12971、12971~12990、12997~13016、13025~13044、13027~13046、13028~13047、13041~13060、13055~13074、13056~13075、13171~13190、13172~13191、13229~13248、13246~13265、13247~13266、13248~13267、13249~13268、13374~13393、13488~13507、13490~13509、13503~13522、13529~13548、13549~13568、13559~13578、13582~13601、13594~13613、13596~13615、13597~13616、13598~13617、13599~13618、13600~13619、13601~13620、13602~13621、13604~13623、13612~13631、13619~13638、13622~13641、13629~13648、13632~13651、13639~13658、13649~13668、13662~13681、13667~13686、13669~13688、13670~13689、13671~13690、13672~13691、13679~13698、13689~13708、13690~13709、13691~13710、13692~13711、13699~13718、13702~13721、14337~14356、14339~14358、14342~14361、14393~14412、14716~14735、14717~14736、14718~ 14737、14719~14738、14720~14739、14722~14741、14724~14743、14725~14744、14726~14745、14727~14746、14728~14747、14729~14748、14731~14750、14734~14753、14764~14783、14766~14785、15192~15211、15600~15619、15827~15846、15854~15873、15855~15874、15859~15878、15883~15902、15884~15903、15885~15904、15886~15905、15892~15911、15895~15914、15896~15915、15901~15920、15902~15921、15904~15923、15971~15990、15988~16007、16004~16023、16039~16058、16048~16067、16082~16101、16110~16129、16112~16131、16113~16132、16115~16134、16116~16135、16165~16184、16227~16246、16228~16247、16229~16248、16230~16249、16236~16255、16242~16261、16248~16267、16250~16269、16263~16282、16264~16283、16277~16296、16287~16306、16307~16326、16317~16336、16330~16349、16337~16356、16357~16376、16359~16378、16362~16381、16373~16392、16374~16393、16375~16394、16377~16396、16397~16416、16402~16421、16408~16427、16409~16428、16411~16430、16425~16444、16426~16445、16428~16447、16431~16450、16437~16456、16439~16458、16445~16464、16447~16466、16457~16476、16459~16478、16469~16488、16470~16489、16487~16506、16499~16518、16554~16573、16555~16574、16562~16581、16565~16584、16567~16586、16588~16607、16589~16608、16590~16609、16591~16610、16606~16625、16608~16627、16615~16634、16625~16644、16632~16651、16635~16654、16636~16655、16656~16675、16729~16748、17271~17290、17342~17361、17348~17367、17362~17381、17443~17462、17449~17468、17450~、 17469、17457~17476、17459~17478、17683~17702、17693~17712、17703~17722、17720~17739、17723~17742、17733~17752、17743~17762、17757~17776、17768~17787、17771~17790、17772~17791、17773~17792、17775~17794、17818~17837、17894~17913、17911~17930、17912~17931、17914~17933、17942~17961、17945~17964、17955~17974、17959~17978、17993~18012、18008~18027、18009~18028、18028~18047、18043~18062、18053~18072、18065~18084、18068~18087、18073~18092、18075~18094、18077~18096、18079~18098、18080~18099、18081~18100、18082~18101、18083~18102、18084~18103、18085~18104、18086~18105、18093~18112、18113~18132、18117~18136、18120~18139、18143~18162、18183~18202、18203~18222、18248~18267、18289~18308、18291~18310、18293~18312、18304~18323、18306~18325、18307~18326、18366~18385、18367~18386、18372~18391、18736~18755、18738~18757、18740~18759、18741~18760、18742~18761、18743~18762、18744~18763、18753~18772、18758~18777、18768~18787、18778~18797、18788~18807、18798~18817、18808~18827、18828~18847、18848~18867、18851~18870、18871~18890、18873~18892、18881~18900、18885~18904、18886~18905、18887~18906、18901~18920、18911~18930、18921~18940、18941~18960、18946~18965、18949~18968、18951~18970、18952~18971、18954~18973、18956~18975、18961~18980、18962~18981、18963~18982、18965~18984、18980~18999、18981~19000、19001~19020、19016~19035、19021~、 19040、19026~19045、19032~19051、19036~19055、19046~19065、19048~19067、19049~19068、19051~19070、19052~19071、19054~19073、19056~19075、19060~19079、19062~19081、19064~19083、19066~19085、19072~19091、19082~19101、19086~19105、19091~19110、19092~19111、19093~19112、19094~19113、19095~19114、19096~19115、19097~19116、19098~19117、19099~19118、19101~19120、19106~19125、19112~19131、19115~19134、19116~19135、19122~19141、19125~19144、19126~19145、19127~19146、19128~19147、19129~19148、19131~19150、19132~19151、19133~19152、19138~19157、19148~19167、19152~19171、19154~19173、19158~19177、19165~19184、19166~19185、19176~19195、19178~19197、19192~19211、19205~19224、19208~19227、19210~19229、19212~19231、19213~19232、19214~19233、19215~19234、19217~19236、19218~19237、19220~19239、19221~19240、19224~19243、19225~19244、19228~19247、19232~19251、19235~19254、19237~19256、19238~19257、19239~19258、19240~19259、19241~19260、19242~19261、19243~19262、19244~19263、19247~19266、19248~19267、19249~19268、19251~19270、19252~19271、19253~19272、19254~19273、19256~19275、19257~19276、19258~19277、19387~19406、19388~19407、19389~19408、19390~19409、19393~19412、19398~19417、19408~19427、19458~19477、19468~19487、20039~20058、20041~20060、20054~20073、20059~20078、20064~20083、20093~20112、20096~20115、20100~20119、20121~20140、20131~20150、20141~20160、20151~20170、20211~20230、20216~20235、20220~20239、20221~20240、20222~20241、20224~、 20243、20226~20245、20231~20250、20251~20270、20252~20271、20261~20280、20262~20281、20282~20301、20291~20310、20318~20337、20320~20339、20321~20340、20324~20343、20327~20346、20337~20356、20340~20359、20341~20360、20342~20361、20343~20362、20344~20363、20345~20364、20347~20366、20352~20371、20362~20381、20390~20409、20391~20410、20393~20412、20402~20421、20412~20431、20414~20433、20539~20558、20583~20602、20586~20605、20594~20613、20606~20625、20616~20635、20646~20665、20656~20675、20670~20689、20671~20690、20675~20694、20676~20695、20677~20696、20679~20698、20706~20725、20716~20735、20726~20745、20741~20760、20746~20765、21082~21101、21084~21103、21086~21105、21105~21124、21448~21467、21458~21477、21468~21487、21478~21497、21479~21498、21498~21517、21499~21518、21503~21522、21505~21524、21506~21525、21507~21526、21508~21527、21509~21528、21510~21529、21511~21530、21513~21532、21528~21547、21529~21548、21538~21557、21539~21558、21543~21562、21558~21577、21559~21578、21564~21583、21566~21585、21567~21586、21569~21588、21915~21934、21916~21935、21925~21944、21926~21945、21935~21954、21945~21964、21946~21965、21948~21967、21951~21970、21953~21972、21954~21973、21955~21974、21956~21975、21957~21976、21959~21978、21960~21979、21961~21980、21962~21981、21963~21982、21964~21983、21965~21984、21966~21985、21967~、 21986、21968~21987、21970~21989、21976~21995、21985~22004、21995~22014、21996~22015、22005~22024、22006~22025、22016~22035、22020~22039、22042~22061、22055~22074、22056~22075、22065~22084、22094~22113、22130~22149、22208~22227、22237~22256、22285~22304、22349~22368、23004~23023、23043~23062、23044~23063、23579~23598、23589~23608、23659~23678、23662~23681、23663~23682、23664~23683、23665~23684、23666~23685、23679~23698、23687~23706、23689~23708、23690~23709、23691~23710、23692~23711、23693~23712、23694~23713、23739~23758、23749~23768、23753~23772、23769~23788、23779~23798、23863~23882、23865~23884、23867~23886、23870~23889、23872~23891、23974~23993、23975~23994、24004~24023、24005~24024、24021~24040、24029~24048、24032~24051、24045~24064、24052~24071、24061~24080、24062~24081、24063~24082、24064~24083、24065~24084、24067~24086、24129~24148、24132~24151、24150~24169、24151~24170、24152~24171、24159~24178、24161~24180、24162~24181、24165~24184、24169~24188、24225~24244、24226~24245、24227~24246、24229~ 24248、24231~24250、24233~24252、24234~24253、24236~24255、24241~24260、24261~24280、24271~24290、24293~24312、24299~24318、24358~24377、24368~24387、24375~24394、24378~24397、24408~24427、24423~24442、24427~24446、24428~24447、24431~24450、24528~24547、24531~24550、24548~24567、24550~24569、24552~24571、24553~24572、24557~24576、24590~24609、24591~24610、24693~24712、24704~24723、24708~24727、24709~24728、24710~24729、24711~24730、24731~24750、24741~24760、24751~24770、24752~24771、24781~24800、24783~24802、24791~24810、24801~24820、24811~24830、24814~24833、24861~24880、24871~24890、24873~24892、24882~24901、24883~24902、24901~24920、24902~24921、24903~24922、24911~24930、24912~24931、24913~24932、24922~24941、24923~24942、24932~24951、24942~24961、24943~24962、24952~24971、24953~24972、24955~24974、24968~24987、24970~24989、24971~24990、24972~24991、24973~24992、24974~24993、24975~24994、24976~24995、24977~24996、24980~24999、24981~25000、24982~25001、24983~25002、24984~25003、24985~25004、24987~25006、25013~25032、25355~25374、25385~25404、25395~25414、25445~25464、25450~、 25469、25452~25471、25453~25472、25455~25474、25456~25475、25458~25477、25475~25494、25494~25513、25495~25514、25535~25554、25545~25564、25567~25586、25580~25599、25600~25619、25602~25621、25728~25747、25899~25918、26032~26051、26034~26053、26079~26098、26092~26111、26093~26112、26095~26114、26104~26123、26110~26129、26111~26130、26112~26131、26113~26132、26114~26133、26115~26134、26116~26135、26117~26136、26181~26200、26215~26234、26217~26236、26230~26249、26268~26287、26320~26339、26323~26342、26324~26343、26325~26342、26327~26346、26433~26452、26435~26454、26544~26563、26555~26574、26571~26590、26583~26602、26620~26639、26627~26646、26628~26647、26633~26652、26766~26785、26768~26787、26827~26846、26991~27010、27449~27468、27503~27522、27507~27526、27509~27528、27525~27544、27537~27556、27555~27574、27557~27576、27565~27584、27567~27586、27577~27596、27585~27604、27595~27614、27604~27623、27605~27624、27607~27626、27608~27627、27610~27629、27612~27631、27614~27633、27615~27634、27647~27666、27655~27674、27657~27676、27665~27684、27677~27696、27687~27706、27695~27714、27715~27734、27804~27823、28177~28196、28269~28288、28280~28299、28283~28302、28460~28479、28465~28484、28483~28502、28488~28507、28496~28515、28497~28516、28502~28521、28509~28528、28528~28547、28529~28548、28544~28563、28550~28569、28626~28645、28636~28655、28688~28707、28691~28710、28701~28720、28709~28728、28710~28729、28711~28730、28731~28750、28751~28770、28761~28780、28774~28793、28786~28805、28790~28809、28791~28810、28796~、 28815、28811~28830、28814~28833、28851~28870、28861~28880、28871~28890、28881~28900、28889~28908、28924~28943、28952~28971、28983~29002、28993~29012、29001~29020、29002~29021、29003~29022、29013~29032、29023~29042、29043~29062、29080~29099、29081~29100、29082~29101、29083~29102、29084~29103、29085~29104、29088~29107、29123~29142、29143~29162、29153~29172、29163~29182、29183~29202、29243~29262、29260~29279、29296~29315、29478~29497、29999~30018、30020~30039、30023~30042、30174~30193、30219~30238、30522~30541、30542~30561、30602~30621、30617~30636、30622~30641、30623~30642、30624~30643、30625~30644、30630~30649、30632~30651、30702~30721、31466~31485、31534~31553、31535~31554、31544~31563、31623~31642、31673~31692、31688~31707、31689~31708、31690~31709、31708~31727、31709~31728、31746~31765、31747~31766、31814~31833、32013~32032、32019~32038、32127~32146、32128~32147、32129~32148、32130~32149、32131~32150、32133~32152、32133~32152、32133~32150、32134~32151、32135~32154、32135~32152、32136~32155、32138~32157、32143~32162、32145~32164、32163~32182、32203~32222、32205~32224、32213~32232、32223~32242、32224~32243、32230~32249、32235~32254、32236~32255、32237~32256、32239~32258、32241~32260、32243~32262、32244~32263、32283~32302、32284~32303、32285~32304、32286~32305、32290~32309、32300~32319、32307~32326、32309~32328、32312~32331、32313~32332、32314~32333、32316~32335、32318~32337、32320~32339、32350~32369、32360~32379、32362~32381、32368~32387、32369~32388、32370~、 32389、32372~32391、32373~32392、32380~32399、32385~32404、32387~32406、32388~32407、32390~32409、32391~32410、32392~32411、32393~32412、32395~32414、32410~32429、32420~32439、32430~32449、32440~32459、32447~32466、32450~32469、32460~32479、32470~32489、32480~32499、32483~32502、32484~32503、32485~32504、32489~32508、32490~32509、32491~32510、32499~32518、32501~32520、32521~32540、32531~32550、32541~32560、32546~32565、32548~32567、32550~32569、32551~32570、32556~32575、32560~32579、32561~32580、32562~ 32581、32571~32590、32576~32595、32580~32599、32581~32600、32582~32601、32588~32607、32589~32608、32590~32609、32591~32610、32592~32611、32593~32612、32594~32613、32596~32615、32606~32625、32611~32630、32612~32631、32613~32632、32614~32633、32616~32635、32620~32639、32630~32649、32645~32664、32646~32665、32648~32667、32649~32668、32650~32669、32651~32670、32652~32671、32653~32672、32654~32673、32655~32674、32656~32675、32661~32680、32666~32685、32672~32691、32679~32698、32680~32699、32681~32700、32686~32705、32691~32710、32692~32711、32700~32719、32702~32721、32712~32731、32716~32735、32720~32739、32722~32741、32726~32745、32740~32759、32746~32765、32752~32771、32782~32801、32785~32804、33090~33109、33093~33112、33110~33129、33128~33147、33130~33149、33132~33151、33133~33152、33136~33155、33138~33157、33140~33159、33142~33161、33143~33162、33144~33163、33145~33164、33146~33165、33148~33167、33149~33168、33150~33169、33151~33170、33152~33171、33153~33172、33155~33174、33163~33182、33170~33189、33171~ 33190、33173~33192、33183~33202、33193~33212、33205~33224、33223~33242、33224~33243、33225~33244、33228~33247、33230~33249、33233~33252、33250~33269、33255~33274、33256~33275、33257~33276、33350~33369、33642~33661、33644~33663、33646~33665、33648~33667、33649~33668、33650~33669、33652~33671、33653~33672、33656~33675、33662~33681、33676~33695、33686~33705、33691~33710、33708~33727、33716~33735、33718~33737、33736~33755、33887~33906、33888~33907、33973~33992、34024~34043、34042~34061、34476~34495、34484~34503、34490~34509、34491~34510、34572~34591、34600~34619、34608~34627、34612~34631、34675~34694、34679~34698、35038~35057、35048~35067、35056~35075、35076~35095、35082~35101、35086~35105、35106~35125、35116~35135、35126~35145、35135~35154、35136~35155、35137~35156、35138~35157、35139~35158、35176~35195、35596~35615、35768~35787、35867~35886、35968~35987、36285~36304、36341~36360、36383~36402、36393~36412、36403~36422、36409~36428、36410~36429、36413~36432、36443~36462、36444~36463、36446~36465、36457~36476、36463~36482、36473~36492、36480~36499、36481~36500、36482~36501、36483~36502、36488~36507、36513~36532、36514~36533、36515~36534、36516~36535、36518~36537、36521~36540、36542~36561、36553~36572、36573~36592、36583~36602、36678~36697、36801~36820、36860~36879、36904~36923、36935~36954、36937~36956、36994~37013、37240~37259、37346~37365、37415~37434、37425~37444、37433~37452、37455~、 37474、37475~37494、37485~37504、37490~37509、37492~37511、37494~37513、37495~37514、37496~37515、37497~37516、37498~37517、37500~37519、37505~37524、37515~37534、37557~37576、37575~37594、37605~37624、37611~37630、37729~37748、38088~38107、38461~38480、38605~38624、38824~38843、38953~38972、38981~39000、39153~39172、39294~39313、39518~39537、39522~39541、39523~39542、39646~39665、39860~39879、40096~40115、40122~40141、40148~40167、40224~40243、40246~40265、40312~40331、40527~40546、40603~40622、40614~40633、40615~40634、40617~40636、40619~40638、40648~40667、40662~40681、40690~40709、40692~40711、40693~40712、40699~40718、40711~40730、40722~40741、40723~40742、40733~40752、40735~40754、40749~40768、40781~40800、40816~40835、40904~40923、40910~40929、40911~40930、40996~41015、41061~41080、41075~41094、41231~41250、41309~41328、41329~41348、41330~41349、41331~41350、41418~41437、41426~41445、41437~41456、41488~41507、41698~41717、41699~41718、41700~41719、41701~41720、41702~41721、41703~41722、41732~41751、41738~41757、41745~41764、41802~41821、41817~41836、41828~41847、41829~41848、41830~41849、41837~41856、41839~41858、41878~41897、41879~41898、41889~41908、41902~41921、41906~41925、41909~41928、41911~41930、41913~41932、41950~41969、42062~42081、42092~42111、42093~42112、42110~42129、42177~42196、42180~42199、42182~42201、42183~42202、42187~42206、42212~42231、42222~42241、42250~42269、42252~42271、42262~42281、42272~、 42291、42274~42293、42275~42294、42276~42295、42282~42301、42379~42398、42399~42418、42436~42455、42439~42458、42440~42459、42441~42460、42626~42645、42642~42661、42648~42667、42649~42668、42654~42673、42656~42675、42662~42681、42794~42813、42884~42903、42902~42921、42939~42958、42955~42974、42997~43016、43005~43024、43010~43029、43013~43032、43044~43063、43148~43167、43151~43170、43171~43190、43181~43200、43191~43210、43196~43215、43201~43220、43213~43232、43214~43233、43220~43239、43226~43245、43227~43246、43228~43247、43246~43265、43248~43267、43249~43268、43250~43269、43251~43270、43252~43271、43254~43273、43281~43300、43283~43302、43301~43320、43311~43330、43321~43340、43331~43350、43434~43453、43451~43470、43476~43495、43512~43531、43513~43532、43515~43534、43587~43606、43589~43608、43599~43618、43612~43631、43618~43637、43619~43638、43620~43639、43640~43659、43664~43683、43703~43722、43705~43724、43706~43725、43713~43732、43743~43762、43744~43763、43746~43765、43751~43770、43763~43782、43791~43810、43792~43811、43793~43812、43794~43813、43803~43822、43809~43828、43813~43832、43818~43837、43819~43838、43820~43839、43821~43840、43823~43842、43827~43846、43830~43849、43840~43859、43843~43862、43847~43866、43853~43872、43856~43875、43857~43876、43858~43877、43861~43880、43863~43882、43873~43892、43880~、 43899、43883~43902、43893~43912、43900~43919、43901~43920、43902~43921、43903~43922、43904~43923、43905~43924、43906~43925、43908~43927、43940~43959、43941~43960、43942~43961、43943~43962、43950~43969、43963~43982、43973~43992、43974~43993、43993~44012、44003~44022、44134~44153、44144~44163、44160~44179、44161~ 44180、44165~44184、44194~44213、44205~44224、44272~44291、44367~44386、44480~44499、44485~44504、45056~45075、45134~45153、45154~45173、45174~45193、45204~45223、45209~45228、45211~45230、45212~45231、45213~45232、45214~45233、45215~45234、45216~45235、45217~45236、45219~45238、45530~45549、45540~45559、45542~45561、45557~45576、45560~45579、45569~45588、45570~45589、45603~45622、45627~45646、45638~45657、45640~45659、45642~45661、45643~45662、45660~45679、45664~45683、45665~45684、45913~45932、46333~46352、47060~47079、47066~47085、47100~47119、47130~47149、47140~47159、47156~47175、47158~47177、47160~47179、47162~47181、47210~47229、47211~47230、47213~47232、47217~47236、47362~47381、47363~47382、47364~47383、47365~47384、47415~47434、47425~47444、47435~47454、47465~47484、47577~47596、47579~47598、47609~47628、47631~47650、47640~47659、47643~47662、47661~47680、47842~47861、47843~47862、47852~47871、47863~47882、47910~47929、48689~48708、48718~48737、48774~48793、48963~48982、49038~49057、49067~49086、49184~49203、49188~49207、49197~49216、49200~49219、49276~49295、49298~49317、49308~49327、49329~49348、49334~49353、49335~49354、49338~49357、49407~49426、49600~49619、49614~49633、49800~49819、49822~49841、49825~49844、49826~、 49845、49925~49944、50144~50163、50248~50267、50437~50456、50492~50511、50545~50564、50660~50679、50807~50826、51074~51093、51426~51445、51428~51447、51435~51454、51489~51508、51490~51509、51491~51510、51557~51576、51644~51663、51724~51743、51735~51754、51805~51824、51835~51854、51890~51909、51891~51910、51892~51911、51988~52007、52079~52098、52176~52195、52252~52271、52334~52353、52472~52491、53035~53054、53054~53073、53059~53078、53628~53647、53710~53729、53712~53731、53716~53735、53725~53744、53805~53824、53895~53914、54096~54115、54204~54223、54235~54254、54283~54302、54402~54421、54470~54489、54560~54579、54572~54591、54663~54682、54914~54933、54915~54934、54989~55008、54996~55015、55004~55023、55023~55042、55136~55155、55150~55169、55770~55789、55806~55825、55882~55901、55886~55905、55938~55957、55983~56002、55985~56004、56069~56088、56071~56090、56086~56105、56123~56142、56124~56143、56128~56147、56140~56159、56194~56213、56195~56214、56198~56217、56206~56225、56237~56256、56239~56258、56245~56264、56285~56304、56295~56314、56305~56324、56315~56334、56334~56353、56335~56354、56351~56370、56355~56374、56356~56375、56362~56381、56365~56384、56375~56394、56380~56399、56381~56400、56385~56404、56395~56414、56401~56420、56402~56421、56405~56424、56415~56434、56416~56435、56419~56438、56421~56440、56444~56463、56445~56464、56447~56466、56448~、 56467、56449~56468、56460~56479、56462~56481、56464~56483、56467~56486、56486~56505、56582~56601、56617~56636、56628~56647、56631~56650、56941~56960、57020~57039、57022~57041、57040~57059、57043~57062、57044~57063、57097~57116、57134~57153、57154~57173、57157~57176、57174~57193、57184~57203、57224~57243、57231~57250、57233~57252、57234~57253、57235~57254、57236~57255、57237~57256、57239~57258、57249~57268、57274~57293、57289~57308、57302~57321、57304~57323、57314~57333、57324~57343、57334~57353、57471~57490、57697~57716、58089~58108、58113~58132、58302~58321、58459~58478、58493~58512、58494~58513、58570~58589、58620~58639、58622~58641、58744~58763、58761~58780、58810~58829、58918~58937、58919~58938、58941~58960、58956~58975、58990~59009、58993~59012、58997~59016、59000~59019、59002~59021、59003~59022、59006~59025、59128~59147、59180~59199、59193~59212、59200~59219、59246~59265、59308~59327、59320~59339、59378~59397、59519~59538、59521~59540、59560~59579、59577~59596、59578~59597、59614~59633、59685~59704、59812~59831、59830~59849、59834~59853、60224~60243、60258~60277、60260~60279、60310~60329、60311~60330、60314~60333、60328~60347、60375~60394、60376~60395、60405~60424、60411~60430、60414~60433、60424~60443、60477~60496、60634~60653、60664~60683、60694~60713、60876~60895、60957~60976、61141~61160、61175~61194、61333~61352、61688~61707、61689~61708、61692~61711、61695~61714、61838~61857、61840~61859、61921~61940、61952~61971、62015~62034、62018~62037、62019~62038、62021~62040、62060~62079、62079~62098、62241~62260、62801~62820、62821~62840、62950~62969、63158~63177、63285~63304、63291~63310、63374~63393、63388~63407、63667~63686、63668~63687、63913~63932、64179~64198、64180~64199、64181~64200、64182~64201、64183~64202、64191~64210、64206~64225、64241~64260、64251~64270、64281~64300、64679~64698、64723~64742、64730~64749、64955~64974、64968~64987、65307~65326、65573~65592、65654~65673、65661~65680、65662~65681、65665~65684、65983~66002、66092~66111、66108~、 66127、66115~66134、66121~66140、66129~66148、66144~66163、66235~66254、66331~66350、66394~66413、66457~66476、66698~66717、66824~66843、66857~66876、66912~66931、66914~66933、66990~67009、67010~67029、67012~67031、67054~67073、67123~67142、67218~67237、67249~67268、67489~67508、67578~67597、67672~67691、67834~67853、67835~67854、67838~67857、67839~67858、67840~67859、67841~67860、67843~67862、67867~67886、67869~67888、67870~67889、67872~67891、67962~67981、67977~67996、67984~68003、67995~68014、68082~68101、68140~68159、68154~68173、68310~68329、68357~68376、68439~68458、68492~68511、68506~68525、68508~68527、68736~68755、68743~68762、68763~68782、68788~68807、68789~68808、68892~68911、68893~68912、68908~68927、68920~68939、68921~68940、68923~68942、68925~68944、69037~69056、69093~69112、69170~69189、69223~69242、69806~69825、69807~69826、70508~70527、70512~70531、70542~70561、70544~70563、70550~70569、70615~70634、70616~70635、70661~70680、70662~70681、70700~ 70719、70702~70721、70704~70723、70706~70725、70708~70727、70710~70729、70787~70806、70831~70850、70853~70872、70855~70874、70859~70878、70860~70879、70997~71016、71117~71136、71141~71160、71142~71161、71336~71355、71413~71432、71595~71614、71603~71622、71633~71652、71643~71662、71649~71668、71663~71682、71665~71684、71673~71692、71698~71717、71700~71719、71703~71722、71706~71725、71708~71727、71713~71732、71723~71742、71733~71752、71743~71762、71749~71768、71753~71772、71766~71785、71773~71792、71797~71816、71931~71950、71946~71965、72236~72255、72247~72266、72260~72279、72340~72359、72371~72390、72500~72519、72536~72555、72553~72572、72718~72737、72719~72738、72720~72739、72732~72751、72740~72759、72752~72771、72753~72772、72754~72773、72755~72774、72756~72775、72770~72789、72861~72880、72875~72894、72885~72904、73042~73061、73043~73062、73086~73105、73089~73108、73091~73110、73092~73111、73093~73112、73094~73113、73338~73357、73507~73526、73853~73872、73866~73885、73979~73998、74487~74506、74499~74518、74500~74519、74516~74535、74518~74537、74521~74540、74527~74546、74547~74566、74557~74576、74577~74596、74587~74606、74597~74616、74603~74622、74704~74723、74935~74954、75211~75230、75212~75231、75213~75232、75228~75247、75309~75328、75319~75338、75927~75946、75972~75991、76228~76247、76488~76507、76846~76865、76856~76875、76950~76969、76952~76971、76953~76972、77215~77234、77374~77393、77377~77396、77488~77507、77489~77508、77490~77509、77526~77545、77641~77660、77810~77829、77843~77862、77847~77866、77949~77968、78009~78028、78010~、 78029, 78014~78033, 78015~78034, 78254~78273, 78432~78451, 78626~78645, 78986~79005, 78987~79006, 78988~79007, 79008~79027, 79009~79028, 79010~79029, 79090~79109, 79091~79110, 79092~79111, 79228~79247, 79254~79273, 79298~79317, 79314~79333, 79315~7 At least 80% complementary to the isometric portions within 9334, 79317-79336, 79318-79337, 79319-79338, 79513-79532, 79517-79536, 79656-79675, 79910-79929, 80109-80128, 80262-80281, 80314-80333, 80372-80391, 80496-80515, 80559-80578, 80569-80588, 80573-80592, 80666-80685, and 80675-8069. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an MECP2 nucleic acid.

[0222] In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises nucleobases 129-148, 154-173, 156-175, 217-236, 218-237, 219-238, 232-251, 301-320, 315-334, 317-336, 545-564, 552-571, 572-591, 859-878, 860-879, 1561-1580, 1565-1584, 1595-1614, 1597-1616, 1603-1622, 1668-1687, 1669-1688, 1714-1733, 1715-1738, 1716-1739, 1720-1721, 1722-1723, 1724-1725, 1726-1727, 1728-1729, 1730-1731, 1732-1733, 1734-1735, 1736-1737, 1738-1740, 1740-1741, 1742-1743, 1744-1745, 1746-1747, 1748-1749, 1750-1751, 1752-1753, 1754-1755, 1756-1757, 1758-1759, 1760-1761, 1762-1763, 734, 1753~1772, 1755~1774, 1757~1776, 1759~1778, 1761~1780, 1763~1782, 1840~1859, 1884~1903, 1906~1925, 1908~1927, 1912~1931, 1913~1932, 2050~2069, 2170~2189, 2194~2213, 2195~2214, 2389~2408, 2466~2485, 2648~2667, 2656~2675, 2686~2705, 2696~2715, 2702~2721, 2716~2735, 2718 ~2737, 2726~2745, 2751~2770, 2753~2772, 2756~2775, 2759~2778, 2761~2780, 2766~2785, 2776~2795, 2786~2805, 2796~2815, 2802~2821, 2806~282 5, 2819~2838, 2826~2845, 2850~2869, 2984~3003, 2999~3018, 3289~3308, 3300~3319, 3313~3332, 3393~3412, 3424~3443, 3553~3572, 3589~3608, 36 06~3625, 3771~3790, 3772~3791, 3773~3792, 3785~3804, 3793~3812, 3805~3824, 3806~3825, 3807~3826, 3808~3827, 3809~3828, 3823~3842, 3914~3 933, 3928~3947, 3938~3957, 4095~4114, 4096~4115, 4139~4158, 4142~4161, 4144~4163, 4145~4164, 4146~4165, 4147~4166, 4391~4410, 4560~4579,4906~4925, 4919~4938, 5032~5051, 5540~5559, 5552~5571, 5553~5572, 5569~5588, 5571~5590, 5574~5593, 5580~5599, 5600~5619, 5610~5629, 5630~5649, 5640~5659, 5650~5669, 5656~5675, 575 7~5776, 5988~6007, 6264~6283, 6265~6284, 6266~6285, 6281~6300, 6362~6381, 6372~6391, 6980~6999, 7025~7044, 7281~7300, 7541~7560, 7899~7918, 7909~7928, 8003~8022, 8005~8024, 8006~808 025, 8268~8287, 8427~8446, 8430~8449, 8541~8560, 8542~8561, 8543~8562, 8579~8598, 8694~8713, 8863~8882, 8896~8915, 8900~8919, 9002~9021, 9062~9081, 9063~9082, 9067~9086, 9068~9087 , 9307-9326, 9485-9504, 9679-9698, 10039-10058, 10040-10059, 10041-10060, 10061-10080, 10062-10081, 10063-10082, 10143-10162, 10144-10163, or 10145-10164. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0223] In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 2305-2324 of SEQ ID NO:2340.

[0224] In certain embodiments, the nucleobase sequence of the modified oligonucleotide comprises nucleobases 10858-10885, 11534-11588, 11597-11620, 12936-12962, 13599-13641, 13669-13711, 14716-14746, 15883-15905, 16362-16396, 18941-18975, 19046-19091, 20216-20226, 20236-20246, 20256-20268, 20269-20281, 20271-20282, 20271-20283, 20271-20284, 20271-20285, 20271-20286, 20271-20287, 20271-20288, 20271-20289, 20272-20289, 20273-20289, 20274-20281, 20275-20282, 20276-20283, 20278-20284, 20279-20285, 20279-20286, 20279-20289, 20279-20289, 20279-20281, 20279-20282, 20279-20283, 20279-20284, 20279- 271, 21505-21532, 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970-24995, 32385-32414, 32447-32508, 32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32588-32671 of SEQ ID NO:1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal-length portion within nucleobases 32611 to 32630 of SEQ ID NO: 1. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0225] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of any of SEQ ID NOs: 18-2339.

[0226] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 18-2339.

[0227] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 18-2339.

[0228] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 18 to 2335.

[0229] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 18-2335.

[0230] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 2336-2339.

[0231] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 18 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of any of SEQ ID NOs: 2336-2339.

[0232] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises the nucleobase sequence of SEQ ID NO:1197.

[0233] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO:1197.

[0234] In any of the oligomeric compounds described herein, the nucleobase sequence of the modified oligonucleotide can be at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an MECP2 nucleic acid, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or 2.

[0235] In any of the oligomeric compounds described herein, the modified oligonucleotides may be 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 16-60, 16-70, 16-80, 16-90, 16-110, 16-120, 16-130, 16-140, 16-150, 16-160, 16-20, 16-25, 16-30, 16-50, 16-180, 16-20, 16-30, 16-50, 16-180, 16-25, 16-30, 16-50, 16-50, 16-60, 16-70, 16-80, 16-90, 16-110, 16-120, 16-140, 16-150, 16-160, 16-180, 16-20, 16-25, 16-30, 16-50, 16-180, 16-190, 16-210, 16-220, 16-230, 16-240, 16-2 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

[0236] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide can comprise a modified sugar moiety. In certain embodiments, the modified sugar moiety comprises a bicyclic sugar moiety, such as a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0237] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide compound can comprise a sugar surrogate.

[0238] In any of the oligomeric compounds provided herein, at least one internucleoside linkage of the modified oligonucleotide may include a modified internucleoside linkage, such as a phosphorothioate internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide may be a modified internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide may be a phosphorothioate internucleoside linkage. In certain embodiments, at least one internucleoside linkage of the modified oligonucleotide may be a phosphodiester internucleoside linkage. In certain embodiments, each internucleoside linkage of the modified oligonucleotide may be independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage. In certain embodiments, at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside linkages of the modified oligonucleotide may be a phosphodiester internucleoside linkage. In certain embodiments, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or 19 internucleoside linkages of the modified oligonucleotide can be phosphorothioate internucleoside linkages.

[0239] In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide can be a modified nucleobase, such as 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

[0240] In any of the oligomeric compounds described herein, the modified oligonucleotide can comprise a deoxy region consisting of 5 to 12 consecutive 2'-deoxynucleosides. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is adjacent to a 5'-exoregion consisting of 1 to 6 linked 5'-exoregion nucleosides and to a 3'-exoregion consisting of 1 to 6 linked 3'-exoregion nucleosides, wherein the 3'-most nucleoside of the 5'-region comprises a modified sugar moiety and the 5'-most nucleoside of the 3'-region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 3'-region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 5'-region comprises a modified sugar moiety.

[0241] Compound number 1435454 In certain embodiments, compound number 1435454 is characterized as a 5-10-5 MOE gapmer of linked nucleosides having the nucleobase sequence (5' to 3') of GCAACATTTTCAGTTTCAGC (SEQ ID NO: 1197), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, and each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside; The internucleoside bonds between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside bonds, and the internucleoside bonds between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside bonds, and each cytosine is a 5-methylcytosine.

[0242] In certain embodiments, compound number 1435454 is represented by the following chemical notation: G es m C eo A eo A eo m C eo A ds T ds T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eo A es G es m C e (SEQ ID NO: 2341), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase, G = guanine nucleobase, T=thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkage.

[0243] In one particular embodiment, compound number 1435454 is represented by the following chemical structure (SEQ ID NO: 2341): [ka]

[0244] Structure 1, compound 1435454.

[0245] In certain embodiments, the oligomeric compound comprises a pharmaceutically acceptable salt of a modified oligonucleotide represented by Structure 1, comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0246] In one particular embodiment, the sodium salt of compound number 1435454 is represented by the following chemical structure (SEQ ID NO: 2341): [ka]

[0247] Structure 2, sodium salt of compound 1435454.

[0248] Certain oligomeric duplexes Certain embodiments relate to oligomeric duplexes comprising a first oligomeric compound and a second oligomeric compound.

[0249] In certain embodiments, the oligomeric duplex comprises:

[0250] A first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is selected from the group consisting of nucleobases 2055 to 2074, 2267 to 2286, 2321 to 2340, 2411 to 2430, 2485 to 2504, 2536 to 2555, 2547 to 2566, 2553 to 2572, 2683 to 2702, 2840 to 2859, 3060 to 3079, 3075 to 3094, 3701 to 3719, 3703 to 3722, 4286 to 4305, 4302 to 4321, 4322 to 4323, 4324 to 4325, 4326 to 4327, 4328 to 4329, 4329 to 4330, 4331 to 4332, 4333 to 4334, 4335 to 4336, 4337 to 4338, 4339 to 4340, 4341 to 4342, 4343 to 4344, 4345 to 4346, 4347 to 4348, 4349 to 4350, 4351 to 4352, 4353 to 4354, 4355 to 4356, 4357 to 4358, 4359 to 4360, 4361 to 4362, 4362 to 4364, 4 7~4346, 4456~4475, 4482~4501, 4509~4528, 4511~4530, 4531~4550, 4550~4569, 4560~4579, 4574~4593, 4575~4594, 4659~4678, 4820~4839, 4823~48 42, 4825~4844, 4847~4866, 4858~4877, 4876~4895, 4877~4896, 4879~4898, 4880~4899, 4884~4903, 4941~4960, 4964~4983, 4967~4986, 5044~5063, 50 53~5072, 5107~5126, 5173~5192, 5177~5196, 5213~5232, 5243~5262, 5253~5272, 5263~5282, 5271~5290, 5272~5291, 5273~5292, 5293~5312, 5303~5 322, 5310~5329, 5355~5374, 5363~5382, 5365~5384, 5371~5390, 5539~5558, 5642~5661, 5643~5662, 5644~5663, 5764~5783, 5795~5814, 5802~5821, 5 809~5828, 5844~5863, 5858~5877, 5864~5883, 5871~5890, 5879~5898, 5994~6013, 5995~6014, 6003~6022, 6036~6055, 6113~6132, 6114~6133, 6115~ 6134, 6116~6135, 6120~6139, 6130~6149, 6172~6191, 6216~6235, 6229~6248, 6315~6334, 6363~6382, 6555~6574, 6556~6575, 6557~6576, 6629~6648,6673~6692、6674~6693、6675~6694、6676~6695、6695~6714、6696~6715、6697~6716、6698~6717、6744~6763、6747~6766、6790~6809、6805~6824、6806~6825、6919~6938、7066~7085、7514~7533、7539~7558、7545~7564、7593~7612、7594~7613、7595~7614、7596~7615、7626~7645、7629~7648、7630~7649、7631~7650、7712~7731、7713~7732、7723~7742、7729~7748、7746~7765、7777~7796、7781~7800、7792~7811、7852~7871、7901~7920、7902~7921、7916~7935、7924~7943、7926~7945、7927~7946、7975~7994、8036~8055、8042~8061、8043~8062、8045~8064、8052~8071、8054~8073、8090~8109、8091~8110、8115~8134、8117~8136、8130~8149、8131~8150、8132~8151、8146~8165、8157~8176、8234~8253、8272~8291、8280~8299、8324~8343、8325~8344、8368~8387、8370~8389、8382~8401、8385~8404、8386~8405、8388~8407、8389~8408、8391~8410、8394~8413、8456~8475、8466~8485、8477~8496、8478~8497、8504~8523、8571~8590、8573~8592、8575~8594、8581~8600、8629~8648、8630~8649、8631~8650、8632~8651、8633~8652、8690~8709、8694~8713、8719~8738、8721~8740、8782~8801、8783~8802、8784~8803、8797、 ~8816、8809~8828、8810~8829、8906~8925、8927~8946、8929~8948、8951~8970、8952~8971、8953~8972、9007~9026、9008~9027、9010~9029、9012~9031、9014~9033、9016~9035、9123~9142、9175~9194、9181~9200、9185~9204、9191~9210、9196~9215、9213~9232、9215~9234、9227~9246、9229~9248、9230~9249、9238~9257、9239~9258、9253~9272、9266~9285、9267~9286、9270~9289、9271~9290、9275~9294、9308~9327、9335~9354、9339~9358、9341~9360、9342~9361、9344~9363、9369~9388、9371~9390、9372~9391、9377~9396、9378~9397、9390~9409、9391~9410、9392~9411、9424~9443、9425~9444、9431~9450、9457~9476、9483~9502、9494~9513、9495~9514、9497~9516、9516~9535、9538~9557、9539~9558、9636~9655、9666~9685、9672~9691、9691~9710、9692~9711、9699~9718、9700~9719、9828~9847、9829~9848、9836~9855、9837~9856、9838~9857、9839~9858、9843~9862、9856~9875、9873~9892、9901~9920、9903~9922、9905~9924、9907~9926、9909~9928、9911~9930、9939~9958、9953~9972、9967~9986、9971~9990、9988~10007、9989~10008、9990~10009、9991~10010、9994~10013、9996~10015、10049~10068、10054~10073、10071~10090、10081~10100、10083~10102、10084~10103、10088~10107、10090~10109、10091~10110、10116~10135、10117~10136、10118~10137、10132~10151、10133~10152、10134~10153、10135~10154、10238~10257、10240~10259、10249~10268、10250~10269、10252~10271、10258~10277、10281~10300、10288~10307、10290~10309、10293~10312、10306~10325、10338~10357、10354~10373、10364~10383、10366~10385、10375~10394、10378~10397、10379~10398、10419~10438、10456~10475、10697~10716、10707~10726、10854~10873、10856~10875、10857~10876、10858~10877、10859~10878、10860~10879、10861~10880、10862~10881、10863~10882、10864~10883、10866~10885、10869~10888、10909~10928、10919~10938、10929~10948、10959~10978、11305~11324、11390~11409、11402~11421、11435~11454、11437~11456、11452~11471、11455~、 11474、11467~11486、11475~11494、11477~11496、11478~11497、11479~11498、11485~11504、11495~11514、11497~11516、11499~11518、11500~11519、11505~11524、11507~11526、11508~11527、11534~11553、11535~11554、11539~11558、11540~11559、11556~11575、11565~11584、11567~11586、11568~11587、11569~11588、11570~11589、11571~11590、11574~11593、11578~11597、11589~11608、11597~11616、11598~11617、11599~11618、11600~11619、11601~11620、11605~11624、11607~11626、11609~11628、11615~11634、11617~11636、11618~11637、11619~11638、11629~11648、11633~11652、11635~11654、11636~11655、11638~11657、11641~11660、11647~11666、11648~11667、11657~11676、11658~11677、11659~11678、11667~11686、11744~11763、12563~12582、12587~12606、12617~12636、12618~12637、12620~12639、12621~12640、12644~12663、12657~12676、12715~12734、12836~12855、12877~12896、12878~12897、12909~12928、12914~12933、12915~12934、12936~12955、12937~12956、12940~12959、12941~12960、12943~12962、12952~12971、12971~12990、12997~13016、13025~13044、13027~13046、13028~13047、13041~13060、13055~13074、13056~13075、13171~13190、13172~13191、13229~13248、13246~13265、13247~13266、13248~13267、13249~13268、13374~13393、13488~13507、13490~13509、13503~13522、13529~13548、13549~13568、13559~13578、13582~13601、13594~13613、13596~13615、13597~13616、13598~13617、13599~13618、13600~13619、13601~13620、13602~13621、13604~13623、13612~13631、13619~13638、13622~13641、13629~13648、13632~13651、13639~13658、13649~13668、13662~13681、13667~13686、13669~13688、13670~13689、13671~、 13690、13672~13691、13679~13698、13689~13708、13690~13709、13691~13710、13692~13711、13699~13718、13702~13721、14337~14356、14339~14358、14342~14361、14393~14412、14716~14735、14717~14736、14718~14737、14719~14738、14720~14739、14722~14741、14724~14743、14725~14744、14726~14745、14727~14746、14728~14747、14729~14748、14731~14750、14734~14753、14764~14783、14766~14785、15192~15211、15600~15619、15827~15846、15854~15873、15855~15874、15859~15878、15883~15902、15884~15903、15885~15904、15886~15905、15892~15911、15895~15914、15896~15915、15901~15920、15902~15921、15904~15923、15971~15990、15988~16007、16004~16023、16039~16058、16048~16067、16082~16101、16110~16129、16112~16131、16113~16132、16115~16134、16116~16135、16165~16184、16227~16246、16228~16247、16229~16248、16230~16249、16236~16255、16242~16261、16248~16267、16250~16269、16263~16282、16264~16283、16277~16296、16287~16306、16307~16326、16317~16336、16330~16349、16337~16356、16357~16376、16359~16378、16362~16381、16373~16392、16374~16393、16375~ 16394、16377~16396、16397~16416、16402~16421、16408~16427、16409~16428、16411~16430、16425~16444、16426~16445、16428~16447、16431~16450、16437~16456、16439~16458、16445~16464、16447~16466、16457~16476、16459~16478、16469~16488、16470~16489、16487~16506、16499~16518、16554~16573、16555~16574、16562~16581、16565~16584、16567~16586、16588~16607、16589~16608、16590~16609、16591~16610、16606~16625、16608~16627、16615~16634、16625~16644、16632~16651、16635~16654、16636~16655、16656~16675、16729~16748、17271~17290、17342~17361、17348~17367、17362~17381、17443~17462、17449~17468、17450~17469、17457~17476、17459~17478、17683~17702、17693~17712、17703~17722、17720~17739、17723~17742、17733~17752、17743~17762、17757~17776、17768~17787、17771~17790、17772~17791、17773~17792、17775~17794、17818~17837、17894~17913、17911~17930、17912~17931、17914~17933、17942~17961、17945~17964、17955~17974、17959~17978、17993~18012、18008~18027、18009~18028、18028~18047、18043~18062、18053~18072、18065~18084、18068~18087、18073~18092、18075~18094、18077~18096、18079~18098、18080~18099、18081~18100、18082~18101、18083~18102、18084~18103、18085~18104、18086~18105、18093~18112、18113~18132、18117~18136、18120~18139、18143~18162、18183~18202、18203~18222、18248~18267、18289~18308、18291~18310、18293~18312、18304~18323、18306~18325、18307~18326、18366~18385、18367~18386、18372~18391、18736~18755、18738~18757、18740~18759、18741~18760、18742~18761、18743~18762、18744~18763、18753~18772、18758~18777、18768~18787、18778~18797、18788~18807、18798~18817、18808~18827、18828~18847、18848~18867、18851~18870、18871~18890、18873~18892、18881~18900、18885~18904、18886~18905、18887~18906、18901~18920、18911~18930、18921~18940、18941~18960、18946~18965、18949~18968、18951~18970、18952~18971、18954~18973、18956~18975、18961~18980、18962~18981、18963~18982、18965~18984、18980~18999、18981~19000、19001~19020、19016~19035、19021~19040、19026~19045、19032~19051、19036~19055、19046~19065、19048~19067、19049~19068、19051~19070、19052~19071、19054~19073、19056~19075、19060~19079、19062~19081、19064~19083、19066~19085、19072~19091、19082~19101、19086~19105、19091~19110、19092~19111、19093~19112、19094~19113、19095~19114、19096~19115、19097~19116、19098~19117、19099~19118、19101~19120、19106~19125、19112~19131、19115~19134、19116~19135、19122~19141、19125~19144、19126~19145、19127~19146、19128~19147、19129~19148、19131~19150、19132~19151、19133~19152、19138~19157、19148~19167、19152~19171、19154~19173、19158~19177、19165~19184、19166~19185、19176~19195、19178~19197、19192~19211、19205~19224、19208~19227、19210~19229、19212~19231、19213~19232、19214~19233、19215~19234、19217~19236、19218~19237、19220~19239、19221~19240、19224~19243、19225~19244、19228~19247、19232~19251、19235~19254、19237~19256、19238~19257、19239~19258、19240~19259、19241~19260、19242~19261、19243~19262、19244~19263、19247~19266、19248~19267、19249~19268、19251~19270、19252~19271、19253~19272、19254~19273、19256~19275、19257~19276、19258~、 19277、19387~19406、19388~19407、19389~19408、19390~19409、19393~19412、19398~19417、19408~19427、19458~19477、19468~19487、20039~20058、20041~20060、20054~20073、20059~20078、20064~20083、20093~20112、20096~20115、20100~20119、20121~20140、20131~20150、20141~20160、20151~20170、20211~20230、20216~20235、20220~20239、20221~20240、20222~20241、20224~20243、20226~20245、20231~20250、20251~20270、20252~20271、20261~20280、20262~20281、20282~20301、20291~20310、20318~20337、20320~20339、20321~20340、20324~20343、20327~20346、20337~20356、20340~20359、20341~20360、20342~20361、20343~20362、20344~20363、20345~20364、20347~20366、20352~20371、20362~20381、20390~20409、20391~20410、20393~20412、20402~20421、20412~20431、20414~20433、20539~20558、20583~20602、20586~20605、20594~20613、20606~20625、20616~20635、20646~20665、20656~20675、20670~20689、20671~20690、20675~20694、20676~20695、20677~20696、20679~20698、20706~20725、20716~20735、20726~20745、20741~20760、20746~20765、21082~21101、21084~21103、21086~21105、21105~21124、21448~21467、21458~21477、21468~21487、21478~21497、21479~21498、21498~21517、21499~21518、21503~21522、21505~21524、21506~21525、21507~21526、21508~21527、21509~21528、21510~21529、21511~21530、21513~21532、21528~21547、21529~21548、21538~21557、21539~21558、21543~21562、21558~21577、21559~21578、21564~21583、21566~21585、21567~21586、21569~21588、21915~21934、21916~21935、21925~21944、21926~21945、21935~、 21954、21945~21964、21946~21965、21948~21967、21951~21970、21953~21972、21954~21973、21955~21974、21956~21975、21957~21976、21959~21978、21960~21979、21961~21980、21962~21981、21963~21982、21964~21983、21965~21984、21966~21985、21967~21986、21968~21987、21970~21989、21976~21995、21985~22004、21995~22014、21996~22015、22005~22024、22006~22025、22016~22035、22020~22039、22042~22061、22055~22074、22056~22075、22065~22084、22094~22113、22130~22149、22208~22227、22237~22256、22285~22304、22349~22368、23004~23023、23043~23062、23044~23063、23579~23598、23589~23608、23659~23678、23662~23681、23663~23682、23664~23683、23665~23684、23666~23685、23679~23698、23687~23706、23689~23708、23690~23709、23691~23710、23692~23711、23693~23712、23694~23713、23739~23758、23749~23768、23753~23772、23769~23788、23779~23798、23863~23882、23865~23884、23867~23886、23870~23889、23872~23891、23974~23993、23975~23994、24004~24023、24005~24024、24021~24040、24029~24048、24032~24051、24045~24064、24052~24071、24061~24080、24062~ 24081、24063~24082、24064~24083、24065~24084、24067~24086、24129~24148、24132~24151、24150~24169、24151~24170、24152~24171、24159~24178、24161~24180、24162~24181、24165~24184、24169~24188、24225~24244、24226~24245、24227~24246、24229~24248、24231~24250、24233~24252、24234~24253、24236~24255、24241~24260、24261~24280、24271~24290、24293~24312、24299~24318、24358~24377、24368~24387、24375~24394、24378~24397、24408~24427、24423~24442、24427~24446、24428~24447、24431~24450、24528~24547、24531~24550、24548~24567、24550~24569、24552~24571、24553~24572、24557~24576、24590~24609、24591~24610、24693~24712、24704~24723、24708~24727、24709~24728、24710~24729、24711~24730、24731~24750、24741~24760、24751~24770、24752~24771、24781~24800、24783~24802、24791~24810、24801~24820、24811~24830、24814~24833、24861~24880、24871~24890、24873~24892、24882~24901、24883~24902、24901~24920、24902~24921、24903~24922、24911~24930、24912~24931、24913~24932、24922~24941、24923~24942、24932~24951、24942~24961、24943~24962、24952~24971、24953~24972、24955~24974、24968~24987、24970~24989、24971~24990、24972~24991、24973~24992、24974~24993、24975~24994、24976~24995、24977~24996、24980~24999、24981~25000、24982~25001、24983~25002、24984~25003、24985~25004、24987~25006、25013~25032、25355~25374、25385~25404、25395~25414、25445~25464、25450~25469、25452~25471、25453~25472、25455~25474、25456~25475、25458~25477、25475~25494、25494~25513、25495~25514、25535~25554、25545~25564、25567~25586、25580~25599、25600~25619、25602~25621、25728~25747、25899~25918、26032~26051、26034~、 26053、26079~26098、26092~26111、26093~26112、26095~26114、26104~26123、26110~26129、26111~26130、26112~26131、26113~26132、26114~26133、26115~26134、26116~26135、26117~26136、26181~26200、26215~26234、26217~26236、26230~26249、26268~26287、26320~26339、26323~26342、26324~26343、26325~26342、26327~26346、26433~26452、26435~26454、26544~26563、26555~26574、26571~26590、26583~26602、26620~26639、26627~26646、26628~26647、26633~26652、26766~26785、26768~26787、26827~26846、26991~27010、27449~27468、27503~27522、27507~27526、27509~27528、27525~27544、27537~27556、27555~27574、27557~27576、27565~27584、27567~27586、27577~27596、27585~27604、27595~27614、27604~27623、27605~27624、27607~27626、27608~27627、27610~27629、27612~27631、27614~27633、27615~27634、27647~27666、27655~27674、27657~27676、27665~27684、27677~27696、27687~27706、27695~27714、27715~27734、27804~27823、28177~28196、28269~28288、28280~28299、28283~28302、28460~28479、28465~28484、28483~28502、28488~28507、28496~28515、28497~28516、28502~28521、28509~28528、28528~28547、28529~28548、28544~28563、28550~28569、28626~28645、28636~28655、28688~28707、28691~28710、28701~28720、28709~28728、28710~28729、28711~28730、28731~28750、28751~28770、28761~28780、28774~28793、28786~28805、28790~28809、28791~28810、28796~28815、28811~28830、28814~28833、28851~28870、28861~28880、28871~28890、28881~28900、28889~28908、28924~28943、28952~28971、28983~29002、28993~29012、29001~29020、29002~29021、29003~29022、29013~29032、29023~29042、29043~29062、29080~29099、29081~29100、29082~29101、29083~、 29102、29084~29103、29085~29104、29088~29107、29123~29142、29143~29162、29153~29172、29163~29182、29183~29202、29243~29262、29260~29279、29296~29315、29478~29497、29999~30018、30020~30039、30023~30042、30174~30193、30219~30238、30522~30541、30542~30561、30602~30621、30617~30636、30622~30641、30623~30642、30624~30643、30625~30644、30630~30649、30632~30651、30702~30721、31466~31485、31534~31553、31535~31554、31544~31563、31623~31642、31673~31692、31688~31707、31689~31708、31690~31709、31708~31727、31709~31728、31746~31765、31747~31766、31814~31833、32013~32032、32019~32038、32127~32146、32128~32147、32129~32148、32130~32149、32131~32150、32133~32152、32133~32152、32133~32150、32134~32151、32135~32154、32135~32152、32136~32155、32138~32157、32143~32162、32145~32164、32163~32182、32203~32222、32205~32224、32213~32232、32223~32242、32224~32243、32230~32249、32235~32254、32236~32255、32237~32256、32239~32258、32241~32260、32243~32262、32244~32263、32283~32302、32284~32303、32285~32304、32286~32305、32290~32309、32300~32319、32307~32326、32309~32328、32312~32331、32313~32332、32314~32333、32316~32335、32318~32337、32320~32339、32350~32369、32360~32379、32362~32381、32368~32387、32369~32388、32370~32389、32372~32391、32373~32392、32380~32399、32385~32404、32387~32406、32388~32407、32390~32409、32391~32410、32392~32411、32393~32412、32395~32414、32410~32429、32420~32439、32430~32449、32440~32459、32447~32466、32450~32469、32460~32479、32470~32489、32480~32499、32483~、 32502、32484~32503、32485~32504、32489~32508、32490~32509、32491~32510、32499~32518、32501~32520、32521~32540、32531~32550、32541~32560、32546~32565、32548~32567、32550~32569、32551~32570、32556~32575、32560~32579、32561~32580、32562~32581、32571~32590、32576~32595、32580~32599、32581~32600、32582~32601、32588~32607、32589~32608、32590~32609、32591~32610、32592~32611、32593~32612、32594~32613、32596~32615、32606~32625、32611~32630、32612~32631、32613~32632、32614~32633、32616~32635、32620~32639、32630~32649、32645~32664、32646~32665、32648~32667、32649~32668、32650~32669、32651~32670、32652~32671、32653~32672、32654~32673、32655~32674、32656~32675、32661~32680、32666~32685、32672~32691、32679~32698、32680~32699、32681~32700、32686~32705、32691~32710、32692~32711、32700~32719、32702~32721、32712~32731、32716~32735、32720~32739、32722~32741、32726~32745、32740~32759、32746~32765、32752~32771、32782~32801、32785~32804、33090~33109、33093~33112、33110~33129、33128~ 33147、33130~33149、33132~33151、33133~33152、33136~33155、33138~33157、33140~33159、33142~33161、33143~33162、33144~33163、33145~33164、33146~33165、33148~33167、33149~33168、33150~33169、33151~33170、33152~33171、33153~33172、33155~33174、33163~33182、33170~33189、33171~33190、33173~33192、33183~33202、33193~33212、33205~33224、33223~33242、33224~33243、33225~33244、33228~33247、33230~33249、33233~33252、33250~33269、33255~33274、33256~33275、33257~33276、33350~33369、33642~33661、33644~33663、33646~33665、33648~33667、33649~33668、33650~33669、33652~33671、33653~33672、33656~33675、33662~33681、33676~33695、33686~33705、33691~33710、33708~33727、33716~33735、33718~33737、33736~33755、33887~33906、33888~33907、33973~33992、34024~34043、34042~34061、34476~34495、34484~34503、34490~34509、34491~34510、34572~34591、34600~34619、34608~34627、34612~34631、34675~34694、34679~34698、35038~35057、35048~35067、35056~35075、35076~35095、35082~35101、35086~35105、35106~35125、35116~35135、35126~35145、35135~35154、35136~35155、35137~35156、35138~35157、35139~35158、35176~35195、35596~35615、35768~35787、35867~35886、35968~、 35987、36285~36304、36341~36360、36383~36402、36393~36412、36403~36422、36409~36428、36410~36429、36413~36432、36443~36462、36444~36463、36446~36465、36457~36476、36463~36482、36473~36492、36480~36499、36481~36500、36482~36501、36483~36502、36488~36507、36513~36532、36514~36533、36515~36534、36516~36535、36518~36537、36521~36540、36542~36561、36553~36572、36573~36592、36583~36602、36678~36697、36801~36820、36860~36879、36904~36923、36935~36954、36937~36956、36994~37013、37240~37259、37346~37365、37415~37434、37425~37444、37433~37452、37455~37474、37475~37494、37485~37504、37490~37509、37492~37511、37494~37513、37495~37514、37496~37515、37497~37516、37498~37517、37500~37519、37505~37524、37515~37534、37557~37576、37575~37594、37605~37624、37611~37630、37729~37748、38088~38107、38461~38480、38605~38624、38824~38843、38953~38972、38981~39000、39153~39172、39294~39313、39518~39537、39522~39541、39523~39542、39646~39665、39860~39879、40096~40115、40122~40141、40148~40167、40224~40243、40246~40265、40312~40331、40527~40546、40603~40622、40614~40633、40615~40634、40617~40636、40619~40638、40648~40667、40662~40681、40690~40709、40692~40711、40693~40712、40699~40718、40711~40730、40722~40741、40723~、 40742、40733~40752、40735~40754、40749~40768、40781~40800、40816~40835、40904~40923、40910~40929、40911~40930、40996~41015、41061~41080、41075~41094、41231~41250、41309~41328、41329~41348、41330~41349、41331~41350、41418~41437、41426~41445、41437~41456、41488~41507、41698~41717、41699~41718、41700~41719、41701~41720、41702~41721、41703~41722、41732~41751、41738~41757、41745~41764、41802~41821、41817~41836、41828~41847、41829~41848、41830~41849、41837~41856、41839~41858、41878~41897、41879~41898、41889~41908、41902~41921、41906~41925、41909~41928、41911~41930、41913~41932、41950~41969、42062~42081、42092~42111、42093~42112、42110~42129、42177~42196、42180~42199、42182~42201、42183~42202、42187~42206、42212~42231、42222~42241、42250~42269、42252~42271、42262~42281、42272~42291、42274~42293、42275~42294、42276~42295、42282~42301、42379~42398、42399~42418、42436~42455、42439~42458、42440~42459、42441~42460、42626~42645、42642~42661、42648~42667、42649~42668、42654~42673、42656~42675、42662~42681、42794~42813、42884~42903、42902~42921、42939~42958、42955~42974、42997~43016、43005~43024、43010~43029、43013~43032、43044~43063、43148~43167、43151~43170、43171~43190、43181~43200、43191~43210、43196~43215、43201~43220、43213~43232、43214~43233、43220~43239、43226~43245、43227~43246、43228~43247、43246~43265、43248~43267、43249~43268、43250~43269、43251~43270、43252~43271、43254~43273、43281~43300、43283~43302、43301~43320、43311~、 43330、43321~43340、43331~43350、43434~43453、43451~43470、43476~43495、43512~43531、43513~43532、43515~43534、43587~43606、43589~43608、43599~43618、43612~43631、43618~43637、43619~43638、43620~43639、43640~43659、43664~43683、43703~43722、43705~43724、43706~43725、43713~43732、43743~43762、43744~43763、43746~43765、43751~43770、43763~43782、43791~43810、43792~43811、43793~43812、43794~43813、43803~43822、43809~43828、43813~43832、43818~43837、43819~43838、43820~43839、43821~43840、43823~43842、43827~43846、43830~43849、43840~43859、43843~43862、43847~43866、43853~43872、43856~43875、43857~43876、43858~43877、43861~43880、43863~43882、43873~43892、43880~43899、43883~43902、43893~43912、43900~43919、43901~43920、43902~43921、43903~43922、43904~43923、43905~43924、43906~43925、43908~43927、43940~43959、43941~43960、43942~43961、43943~43962、43950~43969、43963~43982、43973~43992、43974~43993、43993~44012、44003~44022、44134~44153、44144~44163、44160~44179、44161~44180、44165~44184、44194~44213、44205~44224、44272~44291、44367~44386、44480~44499、44485~44504、45056~45075、45134~45153、45154~45173、45174~45193、45204~45223、45209~45228、45211~45230、45212~45231、45213~45232、45214~45233、45215~45234、45216~45235、45217~45236、45219~45238、45530~45549、45540~45559、45542~45561、45557~45576、45560~45579、45569~45588、45570~45589、45603~45622、45627~、 45646、45638~45657、45640~45659、45642~45661、45643~45662、45660~45679、45664~45683、45665~45684、45913~45932、46333~46352、47060~47079、47066~47085、47100~47119、47130~47149、47140~47159、47156~47175、47158~47177、47160~47179、47162~47181、47210~47229、47211~47230、47213~47232、47217~47236、47362~47381、47363~47382、47364~47383、47365~47384、47415~47434、47425~47444、47435~47454、47465~47484、47577~47596、47579~47598、47609~47628、47631~47650、47640~47659、47643~47662、47661~47680、47842~47861、47843~47862、47852~47871、47863~47882、47910~47929、48689~48708、48718~48737、48774~48793、48963~48982、49038~49057、49067~49086、49184~49203、49188~49207、49197~49216、49200~49219、49276~49295、49298~49317、49308~49327、49329~49348、49334~49353、49335~49354、49338~49357、49407~49426、49600~49619、49614~49633、49800~49819、49822~49841、49825~49844、49826~49845、49925~49944、50144~50163、50248~50267、50437~50456、50492~50511、50545~50564、50660~50679、50807~50826、51074~51093、51426~51445、51428~51447、51435~51454、51489~51508、51490~51509、51491~51510、51557~51576、51644~51663、51724~51743、51735~51754、51805~51824、51835~51854、51890~51909、51891~51910、51892~51911、51988~52007、52079~52098、52176~52195、52252~52271、52334~52353、52472~52491、53035~53054、53054~53073、53059~53078、53628~53647、53710~53729、53712~53731、53716~53735、53725~53744、53805~53824、53895~53914、54096~54115、54204~、 54223、54235~54254、54283~54302、54402~54421、54470~54489、54560~54579、54572~54591、54663~54682、54914~54933、54915~54934、54989~55008、54996~55015、55004~55023、55023~55042、55136~55155、55150~55169、55770~55789、55806~55825、55882~55901、55886~55905、55938~55957、55983~56002、55985~56004、56069~56088、56071~56090、56086~56105、56123~56142、56124~56143、56128~56147、56140~56159、56194~56213、56195~56214、56198~56217、56206~56225、56237~56256、56239~56258、56245~56264、56285~56304、56295~56314、56305~56324、56315~56334、56334~56353、56335~56354、56351~56370、56355~56374、56356~56375、56362~56381、56365~56384、56375~56394、56380~56399、56381~56400、56385~56404、56395~56414、56401~56420、56402~56421、56405~56424、56415~56434、56416~56435、56419~56438、56421~56440、56444~56463、56445~56464、56447~56466、56448~56467、56449~56468、56460~56479、56462~56481、56464~56483、56467~56486、56486~56505、56582~56601、56617~56636、56628~56647、56631~56650、56941~56960、57020~57039、57022~57041、57040~57059、57043~57062、57044~57063、57097~57116、57134~57153、57154~57173、57157~57176、57174~57193、57184~57203、57224~57243、57231~57250、57233~57252、57234~57253、57235~57254、57236~57255、57237~57256、57239~57258、57249~57268、57274~57293、57289~57308、57302~57321、57304~57323、57314~57333、57324~57343、57334~57353、57471~57490、57697~57716、58089~58108、58113~、 58132、58302~58321、58459~58478、58493~58512、58494~58513、58570~58589、58620~58639、58622~58641、58744~58763、58761~58780、58810~58829、58918~58937、58919~58938、58941~58960、58956~58975、58990~59009、58993~59012、58997~59016、59000~59019、59002~59021、59003~59022、59006~59025、59128~59147、59180~59199、59193~59212、59200~59219、59246~59265、59308~59327、59320~59339、59378~59397、59519~59538、59521~59540、59560~59579、59577~59596、59578~59597、59614~59633、59685~59704、59812~59831、59830~59849、59834~59853、60224~60243、60258~60277、60260~60279、60310~60329、60311~60330、60314~60333、60328~60347、60375~60394、60376~60395、60405~60424、60411~60430、60414~60433、60424~60443、60477~60496、60634~60653、60664~60683、60694~60713、60876~60895、60957~60976、61141~61160、61175~61194、61333~61352、61688~61707、61689~61708、61692~61711、61695~61714、61838~61857、61840~61859、61921~61940、61952~61971、62015~62034、62018~62037、62019~62038、62021~62040、62060~62079、62079~62098、62241~62260、62801~62820、62821~62840、62950~62969、63158~63177、63285~63304、63291~63310、63374~63393、63388~63407、63667~63686、63668~63687、63913~63932、64179~64198、64180~64199、64181~64200、64182~64201、64183~64202、64191~64210、64206~64225、64241~64260、64251~64270、64281~64300、64679~64698、64723~64742、64730~64749、64955~64974、64968~64987、65307~65326、65573~65592、65654~65673、65661~65680、65662~65681、65665~65684、65983~66002、66092~66111、66108~66127、66115~66134、66121~66140、66129~、 66148、66144~66163、66235~66254、66331~66350、66394~66413、66457~66476、66698~66717、66824~66843、66857~66876、66912~66931、66914~66933、66990~67009、67010~67029、67012~67031、67054~67073、67123~67142、67218~67237、67249~67268、67489~67508、67578~67597、67672~67691、67834~67853、67835~67854、67838~67857、67839~67858、67840~67859、67841~67860、67843~67862、67867~67886、67869~67888、67870~67889、67872~67891、67962~67981、67977~67996、67984~68003、67995~68014、68082~68101、68140~68159、68154~68173、68310~68329、68357~68376、68439~68458、68492~68511、68506~68525、68508~68527、68736~68755、68743~68762、68763~68782、68788~68807、68789~68808、68892~68911、68893~68912、68908~68927、68920~68939、68921~68940、68923~68942、68925~68944、69037~69056、69093~69112、69170~69189、69223~69242、69806~69825、69807~69826、70508~70527、70512~70531、70542~70561、70544~ 70563、70550~70569、70615~70634、70616~70635、70661~70680、70662~70681、70700~70719、70702~70721、70704~70723、70706~70725、70708~70727、70710~70729、70787~70806、70831~70850、70853~70872、70855~70874、70859~70878、70860~70879、70997~71016、71117~71136、71141~71160、71142~71161、71336~71355、71413~71432、71595~71614、71603~71622、71633~71652、71643~71662、71649~71668、71663~71682、71665~71684、71673~71692、71698~71717、71700~71719、71703~71722、71706~71725、71708~71727、71713~71732、71723~71742、71733~71752、71743~71762、71749~71768、71753~71772、71766~71785、71773~71792、71797~71816、71931~71950、71946~71965、72236~72255、72247~72266、72260~72279、72340~72359、72371~72390、72500~72519、72536~72555、72553~72572、72718~72737、72719~72738、72720~72739、72732~72751、72740~72759、72752~72771、72753~72772、72754~72773、72755~72774、72756~72775、72770~72789、72861~72880、72875~72894、72885~72904、73042~73061、73043~73062、73086~73105、73089~73108、73091~73110、73092~73111、73093~73112、73094~73113、73338~73357、73507~73526、73853~73872、73866~73885、73979~73998、74487~74506、74499~74518、74500~74519、74516~74535、74518~74537、74521~74540、74527~74546、74547~74566、74557~74576、74577~74596、74587~74606、74597~74616、74603~74622、74704~74723、74935~74954、75211~75230、75212~、 75231, 75213~75232, 75228~75247, 75309~75328, 75319~75338, 75927~75946, 75972~75991, 76228~76247, 76488~76507, 76846~76865, 76856~76875, 76950~76969, 76952~76971, 76953~76972, 77215~77234, 77374~77393, 77377~77396, 774 88~77507, 77489~77508, 77490~77509, 77526~77545, 77641~77660, 77810~77829, 77843~77862, 77847~77866, 77949~77968, 78009~78028, 78010~78029, 78014~78033, 78015~78034, 78254~78273, 78432~78451, 78626~78645, 78986~79005, 78987~79006, 78988~79007, 79008~79027, 79009~79028, 79010~79029, 79090~79109, 79091~79110, 79092~79111, 79228~79247, 79254~79273, 79298~79317, 79314~79333, 79315~79334, 79317~79336, 79318~79337, 79319~79338, 79513~795 a first oligomeric compound that is at least 80% complementary to a nucleobase sequence of an isometric portion within: 32, 79517-79536, 79656-79675, 79910-79929, 80109-80128, 80262-80281, 80314-80333, 80372-80391, 80496-80515, 80559-80578, 80569-80588, 80573-80592, 80666-80685, or 80675-80694;

[0251] and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, the second oligomeric compound comprising the nucleobase sequence of the second modified oligonucleotide and a complementary region of at least 8 nucleobases that is at least 90% complementary to the nucleobase sequence of the equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of the equal-length portion of an MECP2 nucleic acid.

[0252] In certain embodiments, the oligomeric duplex comprises:

[0253] A first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide is selected from the group consisting of nucleobases 10858 to 10885, 11534 to 11588, 11597 to 11620, 12936 to 12962, 13599 to 13641, 13669 to 13711, 14716 to 14746, 15883 to 15905, 16362 to 16396, 18941 to 18975, 19046 to 19066 of SEQ ID NO: 1. a first oligomeric compound that is at least 80% complementary to a nucleobase sequence of an isometric portion within: 91, 20216-20271, 21505-21532, 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970-24995, 32385-32414, 32447-32508, 32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202;

[0254] and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 16 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0255] In certain embodiments, the oligomeric duplex comprises:

[0256] a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2339, wherein each thymine is replaced by uracil; and

[0257] and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0258] In certain embodiments, the oligomeric duplex comprises:

[0259] a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2339, wherein each thymine is replaced by uracil; and

[0260] and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0261] In certain embodiments, the oligomeric duplex comprises:

[0262] a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2335, wherein each thymine is replaced by uracil; and

[0263] and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0264] In certain embodiments, the oligomeric duplex comprises:

[0265] a first oligomeric compound comprising a first modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the first modified oligonucleotide comprises at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, or at least 16, at least 17, or 18 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 2336-2339, wherein each thymine is replaced by uracil; and

[0266] and a second oligomeric compound comprising a second modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal-length portion of the first modified oligonucleotide. In certain embodiments, the nucleobase sequence of the first modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an MECP2 nucleic acid.

[0267] In certain embodiments, the first oligomeric compound is antisense compound.In certain embodiments, the first modified oligonucleotide is antisense oligonucleotide.In certain embodiments, the second oligomeric compound is sense compound.In certain embodiments, the second modified oligonucleotide is sense oligonucleotide.

[0268] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide can comprise a modified sugar moiety. Examples of suitable modified sugar moieties include, but are not limited to, bicyclic sugar moieties such as a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-, and non-bicyclic sugar moieties such as a 2'-MOE sugar moiety, a 2'-F sugar moiety, a 2'-OMe sugar moiety, or a 2'-NMA sugar moiety. In certain embodiments, at least 80%, at least 90%, or 100% of the nucleosides of the first modified oligonucleotide and / or the second modified oligonucleotide comprise a modified sugar moiety selected from 2'-F and 2'-OMe.

[0269] In any of the oligomeric duplexes described herein, at least one nucleoside of the first modified oligonucleotide and / or at least one nucleoside of the second modified oligonucleotide may comprise a sugar surrogate. Examples of suitable sugar surrogates include, but are not limited to, morpholinos, peptide nucleic acids (PNAs), glycol nucleic acids (GNAs), and unlocked nucleic acids (UNAs). In certain embodiments, at least one nucleoside of the first modified oligonucleotide comprises a sugar surrogate that may be a GNA.

[0270] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or at least one internucleoside linkage of the second modified oligonucleotide can comprise a modified internucleoside linkage. In certain embodiments, the modified internucleoside linkage is a phosphorothioate internucleoside linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5'-end and / or 3'-end of the first modified oligonucleotide comprises a phosphorothioate linkage. In certain embodiments, at least one of the first, second, or third internucleoside linkages from the 5'-end and / or 3'-end of the second modified oligonucleotide comprises a phosphorothioate linkage.

[0271] In any of the oligomeric duplexes described herein, at least one internucleoside linkage of the first modified oligonucleotide and / or at least one internucleoside linkage of the second modified oligonucleotide can comprise a phosphodiester internucleoside linkage.

[0272] In any of the oligomeric duplexes described herein, each internucleoside linkage of a first modified oligonucleotide and / or each internucleoside linkage of a second modified oligonucleotide can be independently selected from a phosphodiester or a phosphorothioate internucleoside linkage.

[0273] In any of the oligomeric duplexes described herein, at least one nucleobase of the first modified oligonucleotide and / or at least one nucleobase of the second modified oligonucleotide can be a modified nucleobase. In certain embodiments, the modified nucleobase is 5-methylcytosine.

[0274] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can include a stabilizing phosphate group attached to the 5'-position of the 5'-most nucleoside. In certain embodiments, the stabilizing phosphate group comprises a cyclopropylphosphonate or an (E)-vinylphosphonate.

[0275] In any of the oligomeric duplexes described herein, the first modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 5'-end of the first modified oligonucleotide. In certain embodiments, the conjugate group is attached to the first modified oligonucleotide at the 3'-end of the modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for TfR1 and transferrin receptor (TfR), also known as CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the conjugate group may be selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0276] In any of the oligomeric duplexes described herein, the second modified oligonucleotide can comprise a conjugate group. In certain embodiments, the conjugate group comprises a conjugate linker and a conjugate moiety. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 5'-end of the second modified oligonucleotide. In certain embodiments, the conjugate group is attached to the second modified oligonucleotide at the 3'-end of the second modified oligonucleotide. In certain embodiments, the conjugate group comprises N-acetylgalactosamine. In certain embodiments, the conjugate group comprises a cell targeting moiety having affinity for TfR1 and transferrin receptor (TfR), also known as CD71. In certain embodiments, the conjugate group comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the conjugate group may be selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0277] In certain embodiments, the antisense agent comprises an antisense compound comprising an oligomeric compound or oligomeric duplex described herein. In certain embodiments, the antisense agent may comprise an oligomeric compound or oligomeric duplex described herein is an RNAi agent that can reduce the amount of MECP2 nucleic acid through activation of RISC / Ago2. In certain embodiments, the antisense agent may comprise an oligomeric compound or oligomeric duplex described herein is an RNAse H agent that can reduce the amount of MECP2 nucleic acid through activation of RNAse H.

[0278] Certain embodiments provide oligomeric agents comprising two or more oligomeric duplexes. In certain embodiments, the oligomeric agent comprises two or more of any of the oligomeric duplexes described herein. In certain embodiments, the oligomeric agent comprises two or more of the same oligomeric duplexes, which may be any of the oligomeric duplexes described herein. In certain embodiments, the two or more oligomeric duplexes are linked together. In certain embodiments, the two or more oligomeric duplexes are covalently linked. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked. In certain embodiments, the second modified oligonucleotides of the two or more oligomeric duplexes are covalently linked at the 3' end. In certain embodiments, the two or more oligomeric duplexes are covalently linked by a glycol linker, such as a tetraethylene glycol linker. Certain such compounds are described, for example, in Alterman, et al., Nature Biotech., 37:844-894, 2019.

[0279] I. Certain Oligonucleotides In certain embodiments, the present disclosure provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Specific modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0280] A. Certain modified nucleosides Modified nucleosides comprise a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases can be incorporated into modified oligonucleotides:

[0281] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions of other types of modified sugar moieties.

[0282] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring and one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents can be located at any position on the furanosyl, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety is branched.

[0283] In certain embodiments, a non-bicyclic modified sugar moiety has a substituent at the 2'-position. Examples of suitable substituents at the 2'-position of a non-bicyclic modified sugar moiety include, but are not limited to, -F, -OCH3 ("OMe" or "O-methyl"), and -O(CH2)2OCH3 ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m)-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 and 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0284] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 3' position. Examples of suitable substituents for the 3' position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0285] In certain embodiments, a non-bicyclic modified sugar moiety has a substituent at the 4'-position. Examples of suitable 4'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.

[0286] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 5'-position. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, methyl (R or S), vinyl, ethyl, and methoxy.

[0287] In certain embodiments, non-bicyclic modified sugar moieties include one or more non-bridging sugar substituents, such as, for example, 2'-F-5'-methyl sugar moieties, and modified sugar moieties and modified nucleosides described in Migawa et al., WO 2008 / 101157 and Rajeev et al., US2013 / 0203836.

[0288] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, O(CH)OCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein R m and R n each independently represents H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is alkyl.

[0289] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCF3, OCH3, O(CH2)2OCH3(MOE), O(CH2)2SCH3, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0290] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0291] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations in addition to the natural β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2019 / 157531. 2'-modified sugar moieties have an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranosyl sugar moiety. Thus, a total of 16 isomeric configurations are possible for such sugar moieties. 2'-modified sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0292] In natural nucleic acids, sugars are linked to each other from 3' to 5'. In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, such as from 2' to 3' or reversed from 5' to 3'. For example, if the linkage is at the 2'-position, the 2'-substituent may be at the 3'-position instead.

[0293] Certain modified sugar moieties include a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety includes a bridge between the 4'-furanose ring atom and the 2'-furanose ring atom. Nucleosides containing such bicyclic sugar moieties are referred to as bicyclic nucleosides (BNAs), locked nucleosides (LNAs), or conformationally restricted nucleotides (CRNs). Certain such compounds are described in US Patent Publication No. 2013 / 0190383 and PCT publication WO 2013 / 036868. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4'-furanose ring atom and the 2'-furanose ring atom. In certain embodiments, the furanose ring is a ribose ring.Examples of such 4'-2'-bridged sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (e.g., Seth et al., US 7,399,845, Bhat et al., US 7,569,686, Swayze et al., US 7,741,457, and Swayze et al., US 7,741,457). al., US 8,022,193), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., Prakash et al., US 8,278,425), 4'-CH2-ON(CH3)-2' (see, e.g., Allerson et al., US 7,696,345 and Allerson et al., US 8,124,745), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., Seth et al., US 8,278,283), al., US Pat. No. 8,278,426), 4'-C(R. a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where R, R a and R b are independently H, a protecting group, or C1-C 12 alkyl (see, for example, Imanishi et al., US Pat. No. 7,427,672).

[0294] In certain embodiments, such 4'-2' bridges independently comprise from 1 to 4 linked groups independently selected from -[C(Ra)(Rb)]n-, -[C(Ra)(Rb)]nO-, C(Ra)=C(Rb)-, C(Ra)=N-, C(=NRa)-, -C(=O)-, -C(=S)-, -O-, -Si(Ra)2-, -S(=O)x-, and N(Ra)-;

[0295] During the ceremony,

[0296] x is 0, 1 or 2,

[0297] n is 1, 2, 3, or 4;

[0298] Each of Ra and Rb is independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), and

[0299] J1 and J2 are each independently H, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0300] The particle size of the particles was determined by the chemical reaction and was reported by Freier et al.,Nucleic Acids Research,1997,25(22),4429-4443,Albaek et al.,J.Org.Chem.,2006,71,7731-7740,Singh et al.,Chem.Commun.,1998,4,455-456;Koshkin et al al.,Tetrahedron,1998,54,3607-3630;Wahlestedt et al.,Proc. Natl.Acad.Sci.USA,2000,97,5633-5638;Kumar et al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al.,J.Org.Chem.,1998,63,10035-10039;Srivastava et al al.,J.Am.Chem.Soc.,2007,129,8362-8379;Elayadi et al.,Curr.Opinion Invens.Drugs,2001,2,558-561;Braasch et al.,Chem.Biol.,2001,8,1-7;Orum et al.,Curr.Opinion Mol.Ther.,2001,3,239-243;Wengel et al.,US7,053,207,Imanishi et al.,US6,268,490,Imanishi et al.US6,770,748,Imanishi et al.,USRE44,779;Wengel et al.,US6,794,499,Wengel et al al.,US6,670,461;Wengel et al.,US7,034,133,Wengel et al.,US8,080,644;Wengel et al.,US8,034,909;Wengel et al.,US8,153,365;Wengel et al.,US7,572,582; al.,US6,525,191,Torsten et al.,WO 2004 / 106356,Wengel et al.,WO 1999 / 014226;Seth et al.,WO 2007 / 134181;Seth et al.,US7,547,684;Seth et al.,US7,666,854;Seth et al.,US8,088,746;Seth et al.,US7,750,131;Seth et al.,US8,030,467;Seth et al. al.,US8,268,980;Seth et al.,US8,546,556;Seth et al.,US8,530,640;Migawa et al.,US9,012,421;Seth et al.,US8,501,805;Allerson et al.,US2008 / 0039618;and Migawa et al. al., US2015 / 0191727. In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka]

[0301] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNA has been shown to improve siRNA stability in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research, 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther., 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research, 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. In exemplary embodiments herein, where positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified, they are in the β-D configuration unless otherwise specified.

[0302] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, a 5'-substituted sugar and a 4'-2'-bridging sugar).

[0303] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2'-position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5'-position.

[0304] In certain embodiments, the sugar surrogate contains a ring other than five atoms. For example, in certain embodiments, the sugar surrogate contains a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, e.g., Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), fluoroHNA, [ka] ("F-HNA" see e.g., Swayze et al., US 8,088,904; Swayze et al., US 8,440,803; Swayze et al., US 8,796,437; and Swayze et al., US 9,005,906, F-HNA is also called F-THP or 3'-fluorotetrahydropyran), and nucleosides including additional modified THP compounds having the formula: [ka] wherein, independently for each modified THP nucleoside:

[0305] Bx is a nucleobase moiety;

[0306] T3 and T4 are each independently an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group linking the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'- or 3'-terminal group;

[0307] q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl;

[0308] R1 and R2 are each independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and J1, J2, and J3 are each independently H or C1-C6 alkyl.

[0309] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0310] In certain embodiments, the sugar surrogate comprises a ring having five or more atoms and one or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (e.g., Braasch et al., Biochemistry, 2002, 41, 4503-4510 and Summerton et al., US 5,698,685; Summerton et al., US 5,166,315; Summerton et al., US 5,185,444; and Summerton et al., US 5,034,506). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]

[0311] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0312] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., WO 2011 / 133876. In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in Manoharan et al., US 2013 / 130378. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082, 5,714,331, and 5,719,262. Additional PNA compounds suitable for use in the oligonucleotides of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0313] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is an unlocked acyclic nucleic acid in which one of the sugar linkages is removed to form the unlocked sugar surrogate. Representative U.S. publications teaching the preparation of UNAs include, but are not limited to, U.S. Pat. Nos. 8,314,227, 2013 / 0096289, 2013 / 0011922, and 2011 / 0313020.

[0314] In certain embodiments, the sugar substitute is glycerol, found in GNA (glycol nucleic acid) nucleosides, as shown below: [ka]

[0315] In the formula, Bx represents any nucleic acid base.

[0316] Many other bicyclic and tricyclic sugars and sugar surrogates are known in the art that can be used in modified nucleosides.

[0317] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides contain one or more nucleosides containing unmodified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides containing modified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides that do not contain a nucleobase (referred to as abasic nucleosides). In certain embodiments, modified oligonucleotides contain one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleobases). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.

[0318] In certain embodiments, the modified adenine has the structure (I): [ka]

[0319] In the formula, R 2A is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl, or substituted C1-C6 thioalkyl, C1-C6 alkyloxy, or substituted C1-C6 alkyloxy, and R 6A is H,N(R a )(R b ), oxo, acetyl, formyl, or O-phenyl; Y7A is N and R 7A is absent or is C1-C6 alkyl, or Y 7A is C and R 7A is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8A is N and R 8A does not exist or Y 8A is C and R 8A is selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, provided that Y 7A N, Y 8A C, R 8A H, R 2A H, R 6A The case where is NH2 (unmodified adenine) is excluded.

[0320] In certain embodiments, the modified guanine has the structure (II): [ka]

[0321] In the formula, R 2G is N(R a )(R b ) and R 6G is oxo and R 1G is H or R 6G is selected from O—C1-C6 alkyl or S—C1-C6 alkyl, and R 1G does not exist, Y 7G is N and R 7A is absent or is C1-C6 alkyl, or Y 7G is C and R 7G is H, C1-C6 alkyl, or CN(R a )(Rb ) and Y 8G is N and R 8G does not exist or Y 8G is C and R 8G is selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, provided that Y 7G is N and Y 8G C, R 8G H, R 2G is NH2, R 6G The case where =O (unmodified guanosine) is excluded.

[0322] In certain embodiments, the modified thymine or uracil has the structure (III): [ka]

[0323] wherein X is selected from O or S, and R 5U H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and when each X is O, R 5U is not H or CH3 (unmodified uracil and unmodified thymine, respectively).

[0324] In certain embodiments, the modified cytosine has the structure (IV): [ka]

[0325] wherein X is selected from O or S, and R 4C is N(R a )(R b ) and R 5C H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, and formyl, or together form a 5- to 7-membered heterocycle, provided that X is not O, R 4C is NH2, R 5C However, H (unmodified cytosine) is excluded.

[0326] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases are 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and Other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Merigan et al., US 3,687,808, The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0327] The efficiency of the thermodynamic cycle of the specimen was reported by Manoharan et al.,US 2003 / 0158403;Manoharan et al.,US 2003 / 0175906;Dinh et al.,US4,845,205;Spielvogel et al.,US5,130,302;Rogers et al.,US5,134,066;Bischofberger et al.,US5,175,273;Urdea et al al.,US5,367,066;Benner et al.,US5,432,272;Matteucci et al.,US5,434,257;Gmeiner et al.,US5,457,187;Cook et al.,US5,459,255;Froehler et al.,US5,484,908;Matteucci et al al.,US5,502,177;Hawkins et al.,US5,525,711;Haralambidis et al.,US5,552,540;Cook et al.,US5,587,469;Froehler et al.,US5,594,121;Switzer et al.,US5,596,091;Cook et al al.,US5,614,617;Froehler et al.,US5,645,985;Cook et al.,US5,681,941;Cook et al.,US5,811,534;Cook et al.,US5,750,692; al.,US5,587,470;Cook et al.,US5,457,191;Matteucci et al.,US5,763,588;Froehler et al.,US5,830,653;Cook et al.,US5,808,027;Cook et al.,US6,166,199; al.,US6,005,096.

[0328] In certain embodiments, each nucleobase of a modified oligonucleotide is an unmodified A, an unmodified G, an unmodified C, an unmodified T, an unmodified U, m C, or hypoxanthine.

[0329] In certain embodiments, no modified nucleobases are present in the modified oligonucleotide, and each nucleobase of the modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U.

[0330] 3. Certain modified internucleoside linkages The natural internucleoside linkage in RNA and DNA is a 3'-5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide can be linked to each other using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also referred to as unmodified or native linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates ("P=S"), and phosphate-containing phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Compared to the native phosphate linkage, modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages containing chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0331] In certain embodiments, the modified internucleoside linkage is any of those described in WO2021 / 030778. In certain embodiments, the modified internucleoside linkage comprises the formula: [ka]

[0332] wherein, independently, for each internucleoside linking group of the modified oligonucleotide:

[0333] X is selected from O or S;

[0334] R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; and

[0335] T is selected from SO2R2, C(=O)R3 and P(=O)R4R5, wherein:

[0336] R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, and a conjugate group;

[0337] R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group;

[0338] R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; and

[0339] R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0340] In certain embodiments, the modified internucleoside linkage comprises a mesyl phosphoramidate linking group having the following formula: [ka]

[0341] In certain embodiments, the mesyl phosphoramidate internucleoside linkage may contain a chiral center. In certain embodiments, modified oligonucleotides containing (Rp) and / or (Sp) mesyl phosphoramidate each comprise one or more of the following formulae, where "B" represents a nucleobase: [ka]

[0342] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages of a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that randomly selects the stereochemical configuration of each phosphorothioate linkage. Nevertheless, each phosphorothioate in each oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate internucleoside linkages in specific, independently selected stereochemical configurations. In certain embodiments, a specific configuration of phosphorothioate linkages is present in at least 65% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 70% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 80% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 90% of the molecules in the population. In certain embodiments, a particular arrangement of phosphorothioate linkages is present in at least 99% of the molecules in the population. Such a population of chiral enriched modified oligonucleotides can be produced using synthetic methods known in the art, for example, those described in Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555.In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Sp) configuration. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas, where "B" represents a nucleobase: [ka]

[0343] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or can be of a specific stereochemical configuration.

[0344] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Neutral internucleoside linkages further include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Neutral internucleoside linkages further include nonionic linkages containing mixed N, O, S, and CH moieties.

[0345] In certain embodiments, modified oligonucleotides comprise one or more inverted nucleosides, as shown below: [ka]

[0346] In the formula, each Bx independently represents any nucleobase.

[0347] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), so that only one internucleoside linkage is present. In certain embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.

[0348] In certain embodiments, such groups lack a nucleobase and are referred to herein as inverted sugar moieties. In certain embodiments, the inverted sugar moiety is terminal (i.e., attached to the last nucleoside at one end of the oligonucleotide), so that only one internucleoside linkage is present. In certain embodiments, additional features (such as conjugate groups) can be attached to the inverted sugar moiety. Such terminal inverted sugar moieties can be attached to one or both ends of the oligonucleotide.

[0349] In certain embodiments, the nucleic acids can be linked in a 2' to 5' manner rather than the standard 3' to 5' manner. Such linkages are shown below: [ka]

[0350] In the formula, each Bx represents any nucleic acid base.

[0351] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified sugar moieties, unmodified sugar moieties, and differentially modified nucleobases and / or internucleoside linkages of the modified oligonucleotides define a pattern or motif. Unless otherwise specified, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to the nucleobases independently of the sequence of the nucleobases).

[0352] 1. A specific glycomotif In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or a region thereof. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications described herein.

[0353] In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5 to 12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, at least one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides in the deoxy region comprise a modified sugar moiety.

[0354] In certain embodiments, the deoxy region is adjacent to a 5'-region consisting of linked 5'-region nucleosides and adjacent to a 3'-region consisting of linked 3'-region nucleosides, the 3'-most nucleoside of the 5'-region being a modified nucleoside, and the 5'-most nucleoside of the 3'-region being a modified nucleoside. At least one nucleoside in the 5'-region comprises a modified sugar moiety, and at least one nucleoside in the 3'-region comprises a modified sugar moiety. The three regions (5'-region, deoxy region, and 3'-region) form a continuous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3'-most nucleoside in the 5'-region and the sugar moiety of the 5'-most nucleoside in the 3'-region are different from the sugar moieties of adjacent nucleosides in the deoxy region, thus defining the boundaries between the 5'-region, the deoxy region, and the 3'-region. In certain embodiments, each nucleoside in the 5'-region and each nucleoside in the 3'-region comprises a modified sugar moiety. In certain embodiments, the nucleosides in the 5'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 5'-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides in the 3'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 3'-region comprise two or more different sugar modifications.

[0355] In certain embodiments, the 5'-region and 3'-region of the modified oligonucleotide each comprise 1 to 8 nucleosides. In certain embodiments, the 5'-region comprises 1 to 7 nucleosides. In certain embodiments, the 5'-region comprises 1 to 6 nucleosides. In certain embodiments, the 5'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3'-region comprises 1 to 7 nucleosides. In certain embodiments, the 3'-region comprises 1 to 6 nucleosides. In certain embodiments, the 3'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0356] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif defined by two outer regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a continuous sequence of nucleosides, with at least some of the sugar moieties of the nucleosides in each wing being different from at least some of the sugar moieties of the nucleosides in the gap. In particular, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties that differ from the sugar moieties of one or more other nucleosides within the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).

[0357] In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of a gapmer comprise a modified sugar moiety.

[0358] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0359] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2'-OMe sugar moiety.

[0360] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer can be represented using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and 10 linked nucleosides in the gap. When a specific modification is followed by this nomenclature, the modification is in each sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer contains five linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. A 5-8-5 MOE gapmer contains five linked 2'-MOE nucleosides in the 5'-wing, eight linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing.

[0361] In certain embodiments, the modified oligonucleotides disclosed herein are modified by specific sugar modifications. In certain embodiments, the modified oligonucleotides are 5-10-5 MOE gapmers. In certain embodiments, the modified oligonucleotides are 5-8-5 MOE gapmers. In certain embodiments, modified oligonucleotides have a sugar motif of (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE ribosyl sugar moiety.

[0362] In certain embodiments, modified oligonucleotides have a sugar motif of (5' to 3') eeeeeddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE ribosyl sugar moiety.

[0363] 2. Certain nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0364] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5'-end of the oligonucleotide.

[0365] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0366] 3. Certain internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0367] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages of the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages of the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0368] In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of (5' to 3') soooossssssssssooss and soooosssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0369] In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif that comprises one or more mesyl phosphoramidate linkage groups. In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motifs described herein are replaced with mesyl phosphoramidate internucleoside linkages.

[0370] C. A certain length The length of oligonucleotides can be increased or decreased without compromising activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce target RNA cleavage in an oocyte injection model. Oligonucleotides 25 nucleobases long with 8 or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides containing 1 or 3 mismatches.

[0371] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have a range of lengths. In certain embodiments, oligonucleotides consist of X and Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, where X≦Y. For example, in certain embodiments, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19 9, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17 ~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20, 19~21, 19~22, 19~23, 19~24, 19~25, 19~26,19-27, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, It consists of 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0372] In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.

[0373] D. Certain Modified Oligonucleotides In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, these parameters are independent of each other. Thus, unless otherwise specified, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, regardless of the gapmer pattern of sugar modification. Unless otherwise specified, all modifications are independent of the nucleobase sequence.

[0374] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom within the stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom among the modified oligonucleotides in the population. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for β-D ribosyl sugar moieties, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0375] F. Nucleic Acid Sequence In certain embodiments, the oligonucleotide (unmodified or modified oligonucleotide) is further described by its nucleobase sequence. In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, a region of the oligonucleotide has a nucleobase sequence that is complementary to a specified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, a region or the entire length of the oligonucleotide has a nucleobase sequence that is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid (such as a target nucleic acid).

[0376] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group comprises one or more conjugate moieties and a conjugate linker connecting the conjugate moieties to the oligonucleotide. A conjugate group can be attached to one or both termini of an oligonucleotide and / or any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group attached to one or both termini of an oligonucleotide is a terminal group. In certain embodiments, a conjugate group or terminal group is attached to the 3'-terminus and / or 5'-terminus of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3'-terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3'-terminus of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 5'-terminus of an oligonucleotide. In certain embodiments, the conjugate group is attached near the 5'-end of the oligonucleotide.

[0377] A. Certain conjugate groups In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups, which modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0378] In certain embodiments, one or more properties of a modified oligonucleotide can be altered by conjugating one or more carbohydrate moieties to the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier attached to a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this manner is referred to herein as a modified sugar moiety, a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0379] In certain embodiments, the conjugate group confers a new property to the attached oligonucleotide (e.g., a fluorophore or reporter group that allows for detection of the oligonucleotide). Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or the palmityl moiety of adamantaneacetic acid (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J.Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0380] In certain embodiments, the conjugate group may be selected from C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0381] In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0382] In certain embodiments, the conjugate group has the structure: [ka]

[0383] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0384] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folic acid, benzothiadiazide, chlorothiazide, diazepine, indomethicine, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0385] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In some oligomer compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In some oligomer compounds, conjugate linker comprises chain structure such as hydrocarbyl chain, or oligomer of repeating unit such as ethylene glycol, nucleoside or amino acid unit.

[0386] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0387] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0388] In certain embodiments, the conjugate linker (including the conjugate linkers described above) is a bifunctional linking moiety, known in the art to be useful for attaching a conjugate group to a compound, such as the oligonucleotides provided herein. Typically, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0389] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl, including but not limited to alkynyl.

[0390] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 1 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises 1 to 3 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, linker nucleosides are unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0391] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker containing linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising 1 to 10 consecutive linker nucleosides from the modified oligonucleotide. The total number of consecutively linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of consecutively linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.

[0392] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide.For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but after the oligomeric compound is taken up, it is desirable to cleave the conjugate group to release the unconjugated or parent oligonucleotide.Therefore, certain conjugate linkers can contain one or more cleavable moieties.In certain embodiments, the cleavable moiety is a cleavable bond.In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond.In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds.In certain embodiments, the cleavable moiety is selectively cleaved within cells or intracellular compartments such as lysosomes.In certain embodiments, the cleavable moiety is selectively cleaved by endogenous enzymes such as nucleases.

[0393] In certain embodiments, the cleavable bond is selected from amide, ester, ether, one or both esters of a phosphodiester, phosphate ester, carbamate, and disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0394] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0395] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka]

[0396] In the formula, n is 1 to 3, when n is 1, m is 0, when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.

[0397] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0398] In certain embodiments, the conjugate group comprises a cell targeting moiety having at least one linked ligand. In certain embodiments, the cell targeting moiety comprises two linked ligands covalently bound to the branching group. In certain embodiments, the cell targeting moiety comprises three linked ligands covalently bound to the branching group.

[0399] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO 2011 / 131693, WO 2014 / 064257.

[0400] In certain embodiments, the conjugate group comprises a cell-targeting moiety having affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including but not limited to those described in WO 1991 / 004753, WO 2013 / 103800, WO 2014 / 144060, WO 2016 / 081643, WO 2016 / 179257, WO 2016 / 207240, WO 2017 / 221883, WO 2018 / 129384, WO 2018 / 124121, WO 2019 / 151539, WO 2020 / 132584, WO 2020 / 028864, US 7,208,174, US 9,034,329, and US 10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0401] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO 2019 / 140050, WO 2020 / 037150, WO 2020 / 124032, and US 10,138,483.

[0402] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO 2013 / 163303, WO 2019 / 033051, and WO 2020 / 245198.

[0403] B. Certain end groups In certain embodiments, an oligomeric compound comprises one or more terminal groups. Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate group, a protecting group, a modified or unmodified nucleoside, and two or more independently modified or unmodified nucleosides. In some embodiments, an oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates (including, but not limited to, 5'-vinylphosphonates). In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain embodiments, the 2'-linked group is an abasic sugar moiety.

[0404] III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acids and produce at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense agents. In certain embodiments, antisense agents have antisense activity when they reduce or inhibit the amount or activity of the target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, antisense agents selectively act on one or more target nucleic acids. Such antisense agents comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to produce one or more desired antisense activities and does not hybridize to one or more non-target nucleic acids, or does not produce significant undesired antisense activity even when hybridized to one or more non-target nucleic acids.

[0405] In certain antisense activities, hybridization of an antisense agent or a portion of an antisense agent with a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense agents result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA within such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, the antisense agents described herein are antisense agents comprising antisense oligomeric compounds that include antisense oligonucleotides with sufficient "DNA-likeness" to induce RNase H activity. In certain embodiments, the presence of one or more non-DNA-like nucleosides within the gapmer gap is permitted.

[0406] In certain antisense activity, antisense agent or part of antisense agent is loaded into RNA-induced silencing complex (RISC), and finally target nucleic acid is cut.For example, certain antisense agent causes target nucleic acid to be cut by Argonaute.The antisense agent that is loaded into RISC is RNAi agent.RNAi agent is double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0407] In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid alters the splicing of the target nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid inhibits the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, hybridization of an antisense agent, or a portion thereof, with a target nucleic acid alters the translation of the target nucleic acid.

[0408] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a change in phenotype in a cell or animal.

[0409] IV. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA comprising introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from a long non-coding RNA, a short non-coding RNA, or an intronic RNA molecule.

[0410] A. Complementarity / Mismatch and Double-Stranded Complementarity to Target Nucleic Acid In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the length of the fully complementary region is 6 to 20, 10 to 18, or 18 to 20 nucleobases.

[0411] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was capable of reducing the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide exhibited potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 nucleobase and 42 nucleobase oligonucleotides composed of sequences of two or three tandem oligonucleotides, for their ability to block translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, but to a lesser extent than the 28 or 42 nucleobase oligonucleotides.

[0412] In certain embodiments, an oligonucleotide contains one or more mismatched nucleobases relative to a target nucleic acid. In certain embodiments, such mismatches reduce antisense activity against the target, but further reduce activity against non-targets. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are located at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5'-end of the gap region. In certain embodiments, the mismatches are located at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3'-end of the gap region. In certain embodiments, the mismatches are located at positions 1, 2, 3, or 4 from the 5'-end of the wing region. In certain embodiments, the mismatches are located at positions 4, 3, 2, or 1 from the 3'-end of the wing region.

[0413] B.MECP2 In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is an MECP2 nucleic acid. In certain embodiments, the MECP2 nucleic acid has the nucleobase sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NC_000023.11, truncated from nucleosides 154019001 to 154101000), SEQ ID NO: 2 (GenBank Accession No. NM_004992.3), or SEQ ID NO: 2340 (complement of GenBank Accession No. NT_167198.1, truncated from nucleosides 4203000 to 4283000). In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1 or SEQ ID NO:2 reduces the amount of MECP2 RNA, and in certain embodiments, reduces the amount of MECP2 protein. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent consists of a modified oligonucleotide and a conjugate group.

[0414] In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 reduces the amount of MECP2 RNA in the cell. In certain embodiments, contacting a cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 reduces the amount of MECP2 protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, contacting a cell in a subject with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 ameliorates one or more symptoms or characteristics of a neurodegenerative disease or disorder associated with MECP2. In certain embodiments, the neurodegenerative disease or disorder associated with MECP2 is MECP duplication syndrome. In certain embodiments, the symptom or characteristic is any one of autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death. In certain embodiments, administration of the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent reduces seizures in a subject, reduces or delays cognitive dysfunction, reduces or delays intellectual disability, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms, or improves motor function, motor development, muscle tone, cognitive development, language, or social skill development in a subject.

[0415] In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 can reduce the detectable amount of MECP2 RNA in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in a standard cell assay. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 can reduce the detectable amount of MECP2 protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 can reduce the detectable amount of MECP2 RNA in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 can reduce the detectable amount of MECP2 protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 can reduce the detectable amount of MECP2 RNA in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent complementary to SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340 can reduce the detectable amount of MECP2 protein in the CSF of an animal by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0416] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is expressed in pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is the brain and spinal cord. In certain embodiments, the target nucleic acid is expressed in pharmacologically relevant cells. In certain embodiments, the pharmacologically relevant cells are cells that express MECP2. In certain embodiments, the pharmacologically relevant cells are neurons or glial cells. In certain embodiments, the pharmacologically relevant cells are neural cells. In certain embodiments, the pharmacologically relevant cells are astrocytes, oligodendrocytes, or microglial cells.

[0417] IV. Certain Methods and Uses Certain embodiments provided herein relate to methods for reducing or inhibiting MECP2 expression or activity, which may be useful for treating, preventing, or ameliorating a disease or disorder associated with MECP2 overexpression in a subject by administering an oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex, all of which include a modified oligonucleotide having a nucleobase sequence complementary to an MECP2 nucleic acid. In certain embodiments, the disease or disorder associated with MECP2 overexpression is a neurodegenerative disease or disorder. In certain embodiments, the neurodegenerative disease or disorder is an MECP2 duplication syndrome.

[0418] In certain embodiments, the method includes administering to a subject an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid. In certain embodiments, the subject has or is at risk of developing a disease or disorder associated with MECP2. In certain embodiments, the subject has or is at risk of developing an MECP2 duplication syndrome.

[0419] In certain embodiments, a method for treating a neurodegenerative disease or disorder associated with MECP2 comprises administering to a subject a therapeutically effective amount of an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby treating the subject. In certain embodiments, the subject has or is at risk of developing a neurodegenerative disease or disorder associated with MECP2. In certain embodiments, the disease or disorder is associated with elevated MECP2 levels in the subject. In certain embodiments, the subject has or is at risk of developing an MECP2 duplication syndrome. In certain embodiments, at least one symptom or characteristic of a neurodegenerative disease or disorder associated with MECP2 duplication syndrome is ameliorated. Exemplary symptoms or characteristics include, but are not limited to, autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death.

[0420] In certain embodiments, a method for reducing the expression of an MECP2 nucleic acid, e.g., RNA, or a method for reducing the expression of an MECP2 protein in a cell comprises administering to a subject an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby inhibiting the expression of the MECP2 nucleic acid in the subject. In certain embodiments, administration of the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent inhibits the expression of MECP2 in the brain or spinal cord of the subject. In certain embodiments, the subject has or is at risk of developing a neurological disease or condition associated with MECP2. In certain embodiments, the subject has or is at risk of developing an MECP2 duplication syndrome.

[0421] In certain embodiments, a method for inhibiting expression of an MECP2 nucleic acid in a cell comprises contacting the cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid, thereby inhibiting expression of an MECP2 nucleic acid in the cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron or a glial cell (e.g., an astrocyte, an oligodendrocyte, a microglial cell). In certain embodiments, the cell is obtained from a subject, for example, having or at risk of developing a disease or disorder associated with MECP2. In certain embodiments, the cell is from a subject having or at risk of developing a disease or condition associated with MECP2, such as an MECP2 duplication syndrome.

[0422] In certain embodiments, a method for reducing MECP2 expression, e.g., RNA expression, or a method for reducing MECP2 protein expression in a cell comprises contacting the cell with an oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an ATN1 nucleic acid. In certain embodiments, the subject has or is at risk of developing MECP2 duplication syndrome (MDS). In certain embodiments, the subject has MDS. In certain embodiments, the cell is a neuron or glial cell. In certain embodiments, the cell is a human cell.

[0423] Certain embodiments relate to an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an MECP2 nucleic acid for use in treating a disease or disorder associated with elevated MECP2 signaling or overexpression of MECP2. In certain embodiments, the disease or disorder is MECP2 duplication syndrome. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is used to ameliorate a symptom or characteristic of a disease or condition associated with MECP2 duplication syndrome. In certain embodiments, the symptom or characteristic is selected from autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death. In certain embodiments, the modified oligonucleotide, oligomeric duplex, or antisense agent is used to reduce MECP2 expression in a subject.

[0424] Certain embodiments relate to oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents having a nucleobase sequence complementary to an MECP2 nucleic acid for the manufacture or preparation of a medicament for treating a disease associated with MECP2. In certain embodiments, the disease is MECP2 duplication syndrome. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is for the manufacture or preparation of a medicament for ameliorating a symptom or characteristic associated with MECP2 duplication syndrome. In certain embodiments, the symptom or characteristic is selected from autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, and premature death. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is for the manufacture or preparation of a medicament for use in reducing MECP2 expression in a subject.

[0425] In any of the methods or uses described herein, the oligomeric agent, oligomeric compound, modified oligonucleotide, or oligomeric duplex can be any of those described herein.

[0426] V. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the one or more oligomeric compounds each consist of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.

[0427] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and PBS. In certain embodiments, the pharmaceutical composition consists of an oligomeric compound and PBS. In certain embodiments, the pharmaceutical composition consists essentially of an oligomeric compound and PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0428] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.

[0429] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and an artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the oligomeric compound and the artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the oligomeric compound and the artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0430] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and aCSF. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF. In certain embodiments, the aCSF is pharmaceutical grade. In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, disodium phosphate anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1 to 7.3, or about 7.2, with an appropriate pH adjuster, for example, an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0431] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0432] In certain embodiments, the oligomeric compounds can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The formulation and method of pharmaceutical compositions depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage.

[0433] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds containing one or more modified oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof upon administration to a subject, including a human subject. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, magnesium salts, and the like. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0434] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF. In certain embodiments, the sodium salt of the oligomeric compound is the sodium salt of a modified oligonucleotide.

[0435] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes are formed with monocationic or polycationic lipids in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.

[0436] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0437] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents, including the oligomeric compounds provided herein, to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0438] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Such a cosolvent system may include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such a cosolvent system is used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such a cosolvent system can be varied significantly without significantly altering the solubility or toxicity characteristics. Furthermore, the types of cosolvent components can be varied, for example, by substituting other surfactants for Polysorbate 80™, varying the proportion of polyethylene glycol, substituting other biocompatible polymers such as polyvinylpyrrolidone for polyethylene glycol, or substituting other sugars or polysaccharides for dextrose.

[0439] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that enhance solubility or act as preservatives) are also included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain injectable pharmaceutical compositions are provided in unit dosage form, e.g., in ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending agents, stabilizers, and / or dispersing agents. Certain vehicles suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0440] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in protonated (free acid) or ionized (cationized salt) forms, but aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate linkages of oligonucleotides in aqueous solution exist in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides may have multiple such linkages, each in equilibrium. Thus, oligonucleotides in solution may exist in multiple locations as a collection of various forms, all in equilibrium. The term "oligonucleotide" is intended to encompass all such forms. Drawn structures necessarily represent a single form. However, unless otherwise specified, such drawings are intended to encompass corresponding forms as well. Herein, when a structure depicting the free acid of a compound is followed by the terms "or a salt thereof" or "or a pharmaceutically acceptable salt thereof," all forms, whether fully or partially protonated, deprotonated, cationic, or associated with a combination of cations, are expressly included. In certain embodiments, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, when a structure representing the free acid of a compound is followed by the term "or a pharmaceutically acceptable salt thereof," all forms that may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium are expressly included.

[0441] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0442] Certain specific dosage amounts are described herein. Dosage amounts can be in the form of dosage units. For clarity, the milligram dosage (or dosage unit) of a modified oligonucleotide or oligomeric compound refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anion and salt forms. However, for the purpose of calculating dosage amounts, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid.

[0443] For example, when a modified oligonucleotide or oligomeric compound is in a sodium-containing solution (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons counts toward the dose weight, while the mass of the sodium ions does not. Thus, for example, a 10 mg dose or dosage unit of Compound No. 1435454 corresponds to the number of fully protonated molecules weighing 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1435454.

[0444] In certain embodiments, when a modified oligonucleotide or oligomeric compound is present in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with sodium, potassium, calcium, and / or magnesium, but the mass of the protons is counted in the dose weight, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the dose weight.

[0445] In certain embodiments, when an oligomeric compound includes a conjugate group, the mass of the conjugate group is included in the calculation of the dosage of such an oligomeric compound. If the conjugate group also contains an acid, it is assumed that the conjugate group is also fully protonated for the purposes of calculating the dosage.

[0446] VI. Specific Hotspot Areas 1. Nucleic acid bases 10,858 to 10,885 of SEQ ID NO: 1 In certain embodiments, nucleobases 10,858-10,885 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0447] The nucleobase sequences of SEQ ID NOs: 188, 673, 1893, 2012, 2031, 2104, 2233, and 2311 are complementary to portions of nucleobases 10,858 to 10,885 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985840, 1434926, 1435030, 1435374, 1435535, 1436154, 1436207, and 1436353 are complementary to portions of nucleobases 10,858 to 10,885 of SEQ ID NO: 1.

[0448] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1 achieve at least a 68% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 10,858-10,885 of SEQ ID NO: 1 achieve an average of 84.5% reduction in MECP2 RNA in a standard cell assay.

[0449] 2. Nucleic acid bases 11,534 to 11,588 of SEQ ID NO: 1 In certain embodiments, nucleobases 11,534-11,588 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3') sooooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0450] The nucleobase sequences of SEQ ID NOs: 35, 342, 419, 496, 573, 870, 975, 1030, and 1130 are complementary to portions of nucleobases 11,534 to 11,588 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985842, 985843, 985844, 985845, 985846, 1434938, 1435167, 1435529, and 1435649 are complementary to portions of nucleobases 11,534 to 11,588 of SEQ ID NO: 1.

[0451] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1 achieve at least a 58% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,534-11,588 of SEQ ID NO: 1 achieve an average of 84.3% reduction in MECP2 RNA in a standard cell assay.

[0452] 3. Nucleic acid bases 11,597 to 11,620 of SEQ ID NO: 1 In certain embodiments, nucleobases 11,597-11,620 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3') sooooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0453] The nucleobase sequences of SEQ ID NOs: 1589, 1652, 1780, 1823, and 1882 are complementary to portions of nucleobases 11,597 to 11,620 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 1435121, 1435143, 1435440, 1435634, and 1436258 are complementary to portions of nucleobases 11,597 to 11,620 of SEQ ID NO: 1.

[0454] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1 achieve at least a 76% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 11,597-11,620 of SEQ ID NO: 1 achieve an average of an 84% reduction in MECP2 RNA in a standard cell assay.

[0455] 4. Nucleic acid bases 12,936 to 12,962 of SEQ ID NO: 1 In certain embodiments, nucleobases 12,936-12,962 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0456] The nucleobase sequences of SEQ ID NOs: 964, 1058, 1106, 1192, and 1276 are complementary to a portion of nucleobases 12,936 to 12,962 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 1434953, 1435202, 1435393, 1435409, and 1435737 are complementary to a portion of nucleobases 12,936 to 12,962 of SEQ ID NO: 1.

[0457] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1 achieve at least an 82% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 12,936-12,962 of SEQ ID NO: 1 achieve an average of 88.2% reduction in MECP2 RNA in a standard cell assay.

[0458] 5. Nucleic acid bases 13,599 to 13,641 of SEQ ID NO: 1 In certain embodiments, nucleobases 13,599-13,641 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0459] The nucleobase sequences of SEQ ID NOs: 344, 1303, 1333, 1407, 1545, 1561, 1724, and 1648 are complementary to portions of nucleobases 13,599 to 13,641 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985858, 1434886, 1434892, 1434988, 1435017, 1435123, 1435927, and 1436211 are complementary to portions of nucleobases 13,599 to 13,641 of SEQ ID NO: 1.

[0460] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1 achieve at least a 67% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,599-13,641 of SEQ ID NO: 1 achieve an average of 87.9% reduction in MECP2 RNA in a standard cell assay.

[0461] 6. Nucleic acid bases 13,669 to 13,711 of SEQ ID NO: 1 In certain embodiments, nucleobases 13,669-13,711 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0462] The nucleobase sequences of SEQ ID NOs: 421, 663, 765, 835, 912, 990, 1042, 1096, and 2291 are complementary to portions of nucleobases 13,669 to 13,711 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985859, 1434822, 1435372, 1435404, 1435762, 1435891, 1435913, 1435934, and 1436156 are complementary to portions of nucleobases 13,669 to 13,711 of SEQ ID NO: 1.

[0463] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1 achieve at least a 61% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 13,669-13,711 of SEQ ID NO: 1 achieve an average of 79.1% reduction in MECP2 RNA in a standard cell assay.

[0464] 7. Nucleic acid bases 14,716 to 14,746 of SEQ ID NO: 1 In certain embodiments, nucleobases 14,716-14,746 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0465] The nucleobase sequences of SEQ ID NOs: 191, 268, 345, 422, 499, 1335, 1425, 1539, 1573, and 1705 are complementary to portions of nucleobases 14,716 to 14,746 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985864, 985865, 985866, 985867, 985868, 1435005, 1435124, 1435310, 1436093, and 1436367 are complementary to portions of nucleobases 14,716 to 14,746 of SEQ ID NO: 1.

[0466] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1 achieve at least a 57% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 14,716-14,746 of SEQ ID NO: 1 achieve an average of 76.1% reduction in MECP2 RNA in a standard cell assay.

[0467] 8. Nucleic acid bases 15,883 to 15,905 of SEQ ID NO: 1 In certain embodiments, nucleobases 15,883-15,905 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0468] The nucleobase sequences of SEQ ID NOs: 840, 914, 977, and 1085 are complementary to a portion of nucleobases 15,883 to 15,905 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 1435682, 1435914, 1435974, and 1436202 are complementary to a portion of nucleobases 15,883 to 15,905 of SEQ ID NO: 1.

[0469] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1 achieve at least an 85% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 15,883-15,905 of SEQ ID NO: 1 achieve an average of 94.8% reduction in MECP2 RNA in a standard cell assay.

[0470] 9. Nucleic acid bases 16,362 to 16,396 of SEQ ID NO: 1 In certain embodiments, nucleobases 16,362-16,396 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0471] The nucleobase sequences of SEQ ID NOs: 346, 1954, 2046, 2135, and 2183 are complementary to portions of nucleobases 16,362 to 16,396 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985874, 1435003, 1435056, 1435298, and 1435688 are complementary to portions of nucleobases 16,362 to 16,396 of SEQ ID NO: 1.

[0472] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1 achieve at least a 64% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 16,362-16,396 of SEQ ID NO: 1 achieve an average of 88.8% reduction in MECP2 RNA in a standard cell assay.

[0473] 10. Nucleic acid bases 18,941 to 18,975 of SEQ ID NO: 1 In certain embodiments, nucleobases 18,941-18,975 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 18,941-18,975 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0474] The nucleobase sequences of SEQ ID NOs: 580, 1806, 1869, 1949, 2054, 2111, and 2199 are complementary to portions of nucleobases 18,941 to 18,975 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985901, 1434874, 1434934, 1435116, 1435198, 1435424, and 1435426 are complementary to portions of nucleobases 18,941 to 18,975 of SEQ ID NO: 1.

[0475] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 18,941-18,975 of SEQ ID NO: 1 achieve at least a 65% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 18,941-18,975 of SEQ ID NO: 1 achieve an average of a 91% reduction in MECP2 RNA in a standard cell assay.

[0476] 11. Nucleic acid bases 19,046 to 19,091 of SEQ ID NO: 1 In certain embodiments, nucleobases 19,046-19,091 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0477] The nucleobase sequences of SEQ ID NOs: 1428, 1518, 1591, 1677, 1736, 1790, 1914, 2016, 2045, 2161, 2189, and 2313 are complementary to portions of nucleobases 19,046 to 19,091 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 1434868, 1435190, 1435276, 1435308, 1435328, 1435475, 1435622, 1435650, 1435969, 1436193, 1436230, and 1436403 are complementary to portions of nucleobases 19,046 to 19,091 of SEQ ID NO: 1.

[0478] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1 achieve at least a 62% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 19,046-19,091 of SEQ ID NO: 1 achieve an average of an 80% reduction in MECP2 RNA in a standard cell assay.

[0479] 12. Nucleic acid bases 20,216 to 20,271 of SEQ ID NO: 1 In certain embodiments, nucleobases 20,216-20,271 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0480] The nucleobase sequences of SEQ ID NOs: 428, 1710, 1741, 1834, 1904, 1953, 2062, 2149, and 2175 are complementary to portions of nucleobases 20,216 to 20,271 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985915, 1434860, 1434986, 1435359, 1435559, 1435747, 1435855, 1435956, and 1436440 are complementary to portions of nucleobases 20,216 to 20,271 of SEQ ID NO: 1.

[0481] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1 achieve at least a 75% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 20,216-20,271 of SEQ ID NO: 1 achieve an average of 88.2% reduction in MECP2 RNA in a standard cell assay.

[0482] 13. Nucleic acid bases 21,505 to 21,532 of SEQ ID NO: 1 In certain embodiments, nucleobases 21,505-21,532 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0483] The nucleobase sequences of SEQ ID NOs: 430, 650, 733, 817, 2071, 2134, 2224, and 2316 are complementary to portions of nucleobases 21,505 to 21,532 of SEQ ID NO: 1. The nucleobase sequences of compound Nos. 985930, 1435139, 1435251, 1435453, 1435687, 1435800, 1435885, and 1436303 are complementary to portions of nucleobases 21,505 to 21,532 of SEQ ID NO: 1.

[0484] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1 achieve at least a 73% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,505-21,532 of SEQ ID NO: 1 achieve an average of an 85% reduction in MECP2 RNA in a standard cell assay.

[0485] 14. Nucleic acid bases 21,945 to 21,976 of SEQ ID NO: 1 In certain embodiments, nucleobases 21,945-21,976 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0486] The nucleobase sequences of SEQ ID NOs: 46, 653, 770, 831, 1962, 2055, 2157, 2186, and 2327 are complementary to portions of nucleobases 21,945 to 21,976 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985933, 1435150, 1435185, 1435243, 1435431, 1435756, 1436047, 1436210, and 1436478 are complementary to portions of nucleobases 21,945 to 21,976 of SEQ ID NO: 1.

[0487] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1 achieve at least a 58% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 21,945-21,976 of SEQ ID NO: 1 achieve an average of 85.2% reduction in MECP2 RNA in a standard cell assay.

[0488] 15. Nucleic acid bases 23,689 to 23,713 of SEQ ID NO: 1 In certain embodiments, nucleobases 23,689-23,713 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0489] The nucleobase sequences of SEQ ID NOs: 278, 1687, 1756, 1855, 1932, and 1952 are complementary to portions of nucleobases 23,689 to 23,713 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985943, 1434976, 1435679, 1435846, 1436265, and 1436330 are complementary to portions of nucleobases 23,689 to 23,713 of SEQ ID NO: 1.

[0490] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1 achieve at least a 76% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 23,689-23,713 of SEQ ID NO: 1 achieve an average of 89.3% reduction in MECP2 RNA in a standard cell assay.

[0491] 16. Nucleic acid bases 24,791 to 24,833 of SEQ ID NO: 1 In certain embodiments, nucleobases 24,791-24,833 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0492] The nucleobase sequences of SEQ ID NOs: 434, 1647, 1749, and 1801 are complementary to portions of nucleobases 24,791 to 24,833 of SEQ ID NO: 1. The nucleobase sequences of compound Nos. 985961, 1435051, 1435091, and 1435574 are complementary to portions of nucleobases 24,791 to 24,833 of SEQ ID NO: 1.

[0493] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1 achieve at least a 69% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,791-24,833 of SEQ ID NO: 1 achieve an average of a 79.8% reduction in MECP2 RNA in a standard cell assay.

[0494] 17. Nucleic acid bases 24,901 to 24,930 of SEQ ID NO: 1 In certain embodiments, nucleobases 24,901-24,930 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0495] The nucleobase sequences of SEQ ID NOs: 635, 760, 807, and 2293 are complementary to a portion of nucleobases 24,901 to 24,930 of SEQ ID NO: 1. The nucleobase sequences of compound Nos. 1434808, 1435218, 1435824, and 1436028 are complementary to a portion of nucleobases 24,901 to 24,930 of SEQ ID NO: 1.

[0496] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1 achieve at least an 83% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,901-24,930 of SEQ ID NO: 1 achieve an average of 84.5% reduction in MECP2 RNA in a standard cell assay.

[0497] 18. Nucleic acid bases 24,970 to 24,995 of SEQ ID NO: 1 In certain embodiments, nucleobases 24,970-24,995 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 24,970-24,995 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5'-3'):eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0498] The nucleobase sequences of SEQ ID NOs: 509, 1769, 1837, 1897, 1964, 2026, and 2150 are complementary to portions of nucleobases 24,970 to 24,995 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 985962, 1434946, 1435273, 1435478, 1435902, 1435958, and 1436004 are complementary to portions of nucleobases 24,970 to 24,995 of SEQ ID NO: 1.

[0499] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,970-24,995 of SEQ ID NO: 1 achieve at least a 71% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 24,970-24,995 of SEQ ID NO: 1 achieve an average of 86.1% reduction in MECP2 RNA in a standard cell assay.

[0500] 19. Nucleic acid bases 32,385 to 32,414 of SEQ ID NO: 1 In certain embodiments, nucleobases 32,385-32,414 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0501] The nucleobase sequences of SEQ ID NOs: 441, 919, 944, 1034, 1159, 1232, 1270, and 1361 are complementary to portions of nucleobases 32,385 to 32,414 of SEQ ID NO: 1. The nucleobase sequences of compound Nos. 986016, 1434812, 1435204, 1435287, 1435503, 1436016, 1436137, and 1436175 are complementary to portions of nucleobases 32,385 to 32,414 of SEQ ID NO: 1.

[0502] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1 achieve at least a 63% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,385-32,414 of SEQ ID NO: 1 achieve an average of a 77.5% reduction in MECP2 RNA in a standard cell assay.

[0503] 20. Nucleic acid bases 32,447 to 32,508 of SEQ ID NO: 1 In certain embodiments, nucleobases 32,447-32,508 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0504] The nucleobase sequences of SEQ ID NOs: 699, 1774, 1847, 1867, 1983, 2044, 2125, 2241, and 2312 are complementary to portions of nucleobases 32,447 to 32,508 of SEQ ID NO: 1. The nucleobase sequences of compound numbers 1434836, 1435240, 1435495, 1435763, 1436075, 1436111, 1436217, 1436232, and 1436289 are complementary to portions of nucleobases 32,447 to 32,508 of SEQ ID NO: 1.

[0505] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1 achieve at least a 67% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,447-32,508 of SEQ ID NO: 1 achieve an average of 84.6% reduction in MECP2 RNA in a standard cell assay.

[0506] 21. Nucleic acid bases 32,588 to 32,671 of SEQ ID NO: 1 In certain embodiments, nucleobases 32,588-32,671 of SEQ ID NO: 1 comprise a hotspot region. In certain embodiments, an oligomeric compound or antisense oligonucleotide is complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1. In certain embodiments, an oligomeric compound or antisense oligonucleotide is 20 nucleobases in length. In certain embodiments, an oligomeric compound or antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is an MOE gapmer. In certain embodiments, the MOE gapmer is a 5-10-5 MOE gapmer. In certain embodiments, the sugar motif of the gapmer is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. In certain embodiments, the internucleoside linkages of the oligomeric compound or antisense oligonucleotide are phosphorothioate and phosphodiester internucleoside linkages. In certain embodiments, the gapmer internucleoside linkage motif is (5' to 3'):soooossssssssssooss, where each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

[0507] The nucleic acid base sequences of SEQ ID NOs: 57, 134, 211, 516, 595, 640, 751, 795, 931, 980, 1073, 1120, 1197, 1266, 1341, 1448, 1500, 1582, 1663, 1722, 1814, 1881 and 2320 are complementary to a portion of nucleic acid bases 32,588 to 32,671 of SEQ ID NO: 1. The nucleic acid base sequences of compound numbers 986017, 986018, 986019, 986020, 986021, 1434897, 1434978, 1435012, 1435088, 1435101, 1435118, 1435267, 1435319, 1435334, 1435366, 1435412, 1435454, 1435755, 1435757, 1435879, 1435987, 1436284, and 1436337 are complementary to a portion of nucleic acid bases 32,588 to 32,671 of SEQ ID NO: 1.

[0508] In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1 achieve at least a 44% reduction in MECP2 RNA in a standard cell assay. In certain embodiments, oligomeric compounds or antisense oligonucleotides complementary to a portion of nucleobases 32,588-32,671 of SEQ ID NO: 1 achieve an average of an 81.1% reduction in MECP2 RNA in a standard cell assay.

[0509] 22. Nucleic acid bases 35,116 to 35,158 of...

Claims

1. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 80% complementary to an equal length portion of an MECP2 nucleic acid, and said modified oligonucleotide has at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

2. 2. The oligomeric compound of claim 1, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 2340.

3. The nucleobase sequences of the modified oligonucleotides are nucleobases 10858-10885, 11534-11588, 11597-11620, 12936-12962, 13599-13641, 13669-13711, 14716-14746, 15883-15905, 16362-16396, 18941-18975, 19046-19091, 20216-20271, 21505-21532 of SEQ ID NO: 1 3. The oligomeric compound of claim 1, wherein the oligomeric compound is at least 80% complementary to an isometric portion within the following sequence: 21945-21976, 23689-23713, 24791-24833, 24901-24930, 24970-24995, 32385-32414, 32447-32508, 32588-32671, 35116-35158, 43248-43273, 43863-43923, or 64179-64202.

4. 4. The oligomeric compound of any one of claims 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32588 to 32671 of SEQ ID NO:

1.

5. 4. The oligomeric compound of any one of claims 1 to 3, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal length portion within nucleobases 32611 to 32630 of SEQ ID NO:

1.

6. 6. The oligomeric compound of any one of claims 1 to 5, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to the nucleobase sequence of an equal length portion of the MECP2 nucleic acid.

7. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 18-2339, wherein said modified oligonucleotide has at least one modification selected from a modified sugar and a modified internucleoside linkage.

8. 8. The oligomeric compound of claim 7, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 18-2339.

9. The oligomeric compound of claim 7 or 8, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of any of SEQ ID NOs: 18 to 2339.

10. 10. The oligomeric compound of any one of claims 7-9, wherein said modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of said nucleobase sequence of any of SEQ ID NOs: 18-2335.

11. 10. The oligomeric compound of any one of claims 7-9, wherein said modified oligonucleotide has a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or 18 consecutive nucleobases of said nucleobase sequence of any of SEQ ID NOs: 2336-2339.

12. 11. The oligomeric compound of any one of claims 7 to 10, wherein said modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 1197.

13. 11. The oligomeric compound of any one of claims 7 to 10, wherein said modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 1197.

14. 14. The oligomeric compound of any one of claims 1 to 13, wherein the modified oligonucleotide is at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an MECP2 nucleic acid, wherein the MECP2 nucleic acid has the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:2340.

15. The modified oligonucleotides may be 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 15. The oligomeric compound of any one of claims 1-14, consisting of 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

16. The oligomeric compound of any one of claims 1 to 15, wherein the modified oligonucleotide consists of 18 linked nucleosides.

17. The oligomeric compound of any one of claims 1 to 15, wherein the modified oligonucleotide consists of 20 linked nucleosides.

18. The oligomeric compound of any one of claims 1 to 17, wherein the modified oligonucleotide comprises at least one modified nucleoside.

19. 20. The oligomeric compound of claim 18, wherein said at least one modified nucleoside comprises a modified sugar moiety.

20. 20. The oligomeric compound of claim 19, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

21. The bicyclic sugar moiety is —O—CH 2 - and -O-CH(CH 3 21. The oligomeric compound of claim 20, comprising a 2'-4' bridge selected from:

22. 20. The oligomeric compound of claim 19, wherein the modified sugar moiety comprises a non-bicyclic modified sugar moiety.

23. 23. The oligomeric compound of claim 22, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

24. The oligomeric compound of any one of claims 1 to 23, wherein at least one nucleoside of said modified oligonucleotide comprises a sugar surrogate.

25. 25. The oligomeric compound of claim 24, wherein the sugar surrogate is a morpholino or a PNA.

26. 26. The oligomeric compound of any one of claims 1 to 25, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

27. 27. The oligomeric compound of claim 26, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

28. 27. The oligomeric compound of claim 26, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

29. 28. The oligomeric compound of claim 26 or claim 27, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.

30. 30. The oligomeric compound of any one of claims 26 or 28-29, wherein each internucleoside linkage of said modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

31. 31. The oligomeric compound of any one of claims 26 or 28-30, wherein at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.

32. 32. The oligomeric compound of any one of claims 26-28 or 30-31, wherein each internucleoside linkage is a phosphorothioate internucleoside linkage.

33. 32. The oligomeric compound of any one of claims 26 or 28-31, wherein the internucleoside linkage motif of said modified oligonucleotide is selected from 5'-soooossssssssssooss-3' and 5'-soooosssssssssooss-3', wherein each "o" represents a phosphodiester internucleoside linkage and each "s" represents a phosphorothioate internucleoside linkage.

34. 34. The oligomeric compound of any one of claims 1 to 33, wherein said modified oligonucleotide comprises at least one modified nucleobase.

35. 35. The oligomeric compound of claim 34, wherein said modified nucleobase is 5-methylcytosine.

36. 36. The oligomeric compound of claim 35, wherein each cytosine is a 5-methylcytosine.

37. 37. The oligomeric compound of any one of claims 1 to 36, wherein the oligomeric compound comprises a modified oligonucleotide consisting of 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 16 to 18, 18 to 20, 18 to 22, 18 to 25, 18 to 20, 20 to 25, or 21 to 23 linked nucleosides, or a pharmaceutically acceptable salt thereof.

38. The oligomeric compound of any one of claims 1 to 37, wherein the modified oligonucleotide comprises a deoxy region.

39. 39. The oligomeric compound of claim 38, wherein each nucleoside of said deoxy region is a 2'-β-D-deoxynucleoside.

40. 40. The oligomeric compound of claim 38 or claim 39, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

41. 41. The oligomeric compound of any one of claims 38-40, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.

42. the deoxy region is adjacent to a 5'-exoregion consisting of 1 to 6 linked 5'-exoregion nucleosides on the 5'-side and adjacent to a 3'-exoregion consisting of 1 to 6 linked 3'-exoregion nucleosides on the 3'-side; the 3'-most nucleoside of the 5' exoregion nucleosides comprises a modified sugar moiety; and 42. The oligomeric compound of any one of claims 38-41, wherein the 5'-most nucleoside of said 3' exoregion nucleoside comprises a modified sugar moiety.

43. 43. The oligomeric compound of claim 41 or claim 42, wherein each of said 3' exoregion nucleosides comprises a modified sugar moiety.

44. The modified oligonucleotide comprises: a 5' exoregion consisting of 5 linked 5'-exoregion nucleosides; a deoxy region consisting of 10 linked nucleosides, and a 3' exoregion consisting of 5 linked 3'-exoregion nucleosides; 44. The oligomeric compound of claim 43, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a 2'-MOE nucleoside.

45. The modified oligonucleotide comprises: a 5' exoregion consisting of 5 linked nucleosides; a deoxy region consisting of 8 linked nucleosides, and a 3' exoregion consisting of 5 linked nucleosides; 44. The oligomeric compound of claim 42 or claim 43, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a 2'-MOE nucleoside.

46. The modified oligonucleotide comprises: a 5' exoregion consisting of 1 to 6 linked nucleosides; a deoxy region consisting of 6 to 10 linked nucleosides, and having a sugar motif comprising a 3' exoregion consisting of 1-6 linked nucleosides; 44. The oligomeric compound of claim 42 or claim 43, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a cEt nucleoside or a 2'-MOE nucleoside, and each of the deoxyregion nucleosides is a 2'-β-D-deoxynucleoside.

47. 47. The oligomeric compound of any one of claims 1 to 46, wherein the modified oligonucleotide has a sugar motif (5' to 3') selected from eeeeeddddddddddddeeee and eeeeeddddddddddeeeee, wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.

48. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: G es m C eo A eo A eo m C eo A ds T ds T ds T ds T ds m C ds A ds G ds T ds T ds T eo m C eo A es G es m C e (SEQ ID NO: 2341), wherein A = adenine nucleobase m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d = 2'-β-D-deoxyribosyl sugar moiety s = phosphorothioate internucleoside linkage, and o = phosphodiester internucleoside linkages, oligomeric compounds.

49. 49. The oligomeric compound of any one of claims 1 to 48, consisting of said modified oligonucleotide.

50. 49. The oligomeric compound of any one of claims 1 to 48, wherein the oligomeric compound comprises a conjugate group.

51. 51. The oligomeric compound of claim 50, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

52. 52. The oligomeric compound of claim 51, wherein said conjugate linker consists of a single bond.

53. 53. The oligomeric compound of any one of claims 51 to 52, wherein the conjugate linker is cleavable.

54. 54. The oligomeric compound of claim 51 or claim 53, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

55. 54. The oligomeric compound of any one of claims 51 to 53, wherein said conjugate linker does not comprise any linker nucleosides.

56. 56. The oligomeric compound of any one of claims 50 to 55, wherein the conjugate group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.

57. 56. The oligomeric compound of any one of claims 50 to 55, wherein the conjugate group is attached to the modified oligonucleotide at the 3'-end of the modified oligonucleotide.

58. 58. The oligomeric compound of any one of claims 1 to 57, wherein the oligomeric compound comprises a terminal group.

59. 59. The oligomeric compound of claim 58, wherein said terminal group is an abasic sugar moiety.

60. 60. The oligomeric compound of any one of claims 1 to 59, wherein the oligomeric compound is a single-stranded oligomeric compound.

61. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 2341): 【Chemical 1】 or a pharmaceutically acceptable salt thereof.

62. 62. The modified oligonucleotide of claim 61, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

63. 62. The modified oligonucleotide of claim 61, which is a sodium salt or a potassium salt.

64. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 2341): 【Chemistry 2】

65. 65. A chiral enriched population of oligomeric compounds according to any one of claims 1 to 60, or a chiral enriched population of modified oligonucleotides according to any one of claims 61 to 64, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

66. 66. The chiral enriched population of claim 65, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having an (Sp) or (Rp) configuration.

67. 66. The chiral enriched population of claim 65, wherein the population is enriched for modified oligonucleotides having a specific, independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

68. 66. The chiral enriched population of claim 65, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at each of the remaining phosphorothioate internucleoside linkages.

69. 66. The chiral enriched population of claim 65, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the Sp, Sp, and Rp configuration in the 5' to 3' direction.

70. 65. A population of oligomeric compounds according to any one of claims 1 to 60, or a population of modified oligonucleotides according to any one of claims 61 to 64, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

71. 61. An oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide and a second oligomeric compound comprising a second modified oligonucleotide, wherein the first oligomeric compound is the oligomeric compound of any one of claims 1 to 60.

72. 72. The oligomeric duplex of Claim 71, wherein the second modified oligonucleotide consists of 8 to 80 linked nucleosides and the nucleobase sequence of the second modified oligonucleotide comprises a complementary region of at least 8 nucleobases that is at least 90% complementary to an equal length portion of the first modified oligonucleotide.

73. 73. The oligomeric duplex of any one of claims 71 to 72, wherein the first modified oligonucleotide comprises a 5'-stabilizing phosphate group.

74. 74. The oligomeric duplex of claim 73, wherein said 5'-stabilizing phosphate group comprises a cyclopropylphosphonate or a vinylphosphonate.

75. 75. The oligomeric duplex of any one of claims 71 to 74, wherein the first modified oligonucleotide comprises a glycol nucleic acid (GNA) sugar surrogate.

76. 75. The oligomeric duplex of any one of claims 71 to 74, wherein the first modified oligonucleotide comprises a 2'-NMA sugar moiety.

77. 77. The oligomeric duplex of any one of claims 71 to 76, wherein at least one nucleoside of the second modified oligonucleotide comprises a modified sugar moiety.

78. 78. The oligomeric duplex of claim 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a bicyclic sugar moiety.

79. The bicyclic sugar moiety of the second modified oligonucleotide is —O—CH 2 - and -O-CH(CH 3 79. The oligomeric duplex of claim 78, comprising a 2'-4' bridge selected from:

80. 78. The oligomeric duplex of claim 77, wherein the modified sugar moiety of the second modified oligonucleotide comprises a non-bicyclic modified sugar moiety.

81. 81. The oligomeric duplex of claim 80, wherein the non-bicyclic modified sugar moiety of the second modified oligonucleotide is a 2'-MOE sugar moiety, a 2'-F sugar moiety, or a 2'-OMe sugar moiety.

82. 82. The oligomeric duplex of any one of claims 71-81, wherein at least one nucleoside of the second modified oligonucleotide comprises a sugar surrogate.

83. 83. The oligomeric duplex of any one of claims 71 to 82, wherein at least one internucleoside linkage of the second modified oligonucleotide is a modified internucleoside linkage.

84. 84. The oligomeric duplex of claim 83, wherein at least one modified internucleoside linkage of said second modified oligonucleotide is a phosphorothioate internucleoside linkage.

85. 85. The oligomeric duplex of any one of claims 71 to 84, wherein at least one internucleoside linkage of said second modified oligonucleotide is a phosphodiester internucleoside linkage.

86. 86. The oligomeric duplex of any one of claims 71-85, wherein each internucleoside linkage of the second modified oligonucleotide is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

87. 87. The oligomeric duplex of any one of claims 71 to 86, wherein the second modified oligonucleotide comprises at least one modified nucleobase.

88. 88. The oligomeric duplex of claim 87, wherein at least one modified nucleobase of said second modified oligonucleotide is 5-methylcytosine.

89. 89. The oligomeric duplex of any one of claims 71 to 88, wherein the second modified oligonucleotide comprises a conjugate group.

90. 90. The oligomeric duplex of claim 89, wherein the conjugate group comprises a conjugate linker and a conjugate moiety.

91. 91. The oligomeric duplex of claim 89 or claim 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 5'-end of the second modified oligonucleotide.

92. 91. The oligomeric duplex of claim 89 or claim 90, wherein the conjugate group is attached to the second modified oligonucleotide at the 3'-end of the second modified oligonucleotide.

93. 91. The oligomeric duplex of claim 89 or claim 90, wherein the conjugate group is attached via the 2' position of a ribosyl sugar moiety at an internal position of the second modified oligonucleotide.

94. 94. The oligomeric duplex of any one of claims 89 to 93, wherein the conjugate group comprises a lipid.

95. 95. The oligomeric duplex of any one of claims 71 to 94, wherein the second modified oligonucleotide comprises a terminal group.

96. 96. The oligomeric duplex of claim 95, wherein the terminal group is an abasic sugar moiety.

97. The second modified oligonucleotide may be 10-25, 10-30, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 17 97. The oligomeric duplex of any one of claims 71-96, consisting of up to 50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.

98. 65. An antisense agent comprising an antisense compound, wherein the antisense compound is an oligomeric compound according to any one of claims 1 to 60, or a modified oligonucleotide according to any one of claims 61 to 64.

99. 98. An antisense agent which is an oligomeric duplex of any one of claims 71-97.

100. The antisense agent is an RNase H agent capable of reducing the amount of MECP2 nucleic acid through activation of RNase H; or 100. The antisense agent of claim 98 or claim 99, which is an RNAi agent capable of reducing the amount of MECP2 nucleic acid through activation of RISC / Ago2.

101. 101. The antisense agent of any one of claims 98-100, wherein the antisense agent comprises a conjugate group, the conjugate group being a cell targeting moiety.

102. 102. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 60, a modified oligonucleotide according to any one of claims 61 to 64, a population according to any one of claims 65 to 70, an oligomeric duplex according to any one of claims 71 to 97, or an antisense agent according to any one of claims 98 to 101, and a pharmaceutically acceptable diluent.

103. 103. The pharmaceutical composition of claim 102, wherein the pharmaceutically acceptable diluent is phosphate buffered saline or artificial cerebrospinal fluid.

104. The pharmaceutical composition of claim 103, wherein the pharmaceutical composition consists essentially of the oligomeric compound, the modified oligonucleotide, the population, the oligomeric duplex, or the antisense agent, and the phosphate buffered saline or the artificial cerebrospinal fluid.

105. 104. A method comprising administering to a subject an oligomeric compound according to any one of claims 1 to 60, a modified oligonucleotide according to any one of claims 61 to 64, a population according to any one of claims 65 to 70, an oligomeric duplex according to any one of claims 71 to 97, an antisense agent according to any one of claims 98 to 101, or a pharmaceutical composition according to any one of claims 102 to 104.

106. 106. The method of claim 105, wherein the subject has a disease or disorder associated with MECP2.

107. 107. The method of claim 106, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

108. The method of claim 105 or claim 106, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

109. 104. A method of treating a disease or disorder associated with MECP2, comprising administering to a subject having or at risk of developing a disease or disorder associated with MECP2 a therapeutically effective amount of the oligomeric compound of any one of claims 1-60, the modified oligonucleotide of any one of claims 61-64, the population of any one of claims 65-70, the oligomeric duplex of any one of claims 71-97, the antisense agent of any one of claims 98-101, or the pharmaceutical composition of any one of claims 102-104, thereby treating the disease or disorder associated with MECP2.

110. 110. The method of claim 109, wherein the disease or disorder associated with MECP2 is a neurodevelopmental disease or disorder.

111. 111. The method of claim 109 or 110, wherein the disease or disorder associated with MECP2 is MECP2 duplication syndrome.

112. 112. The method of any one of claims 109 to 111, wherein at least one symptom or feature of said disease or disorder associated with MECP2 is ameliorated.

113. 113. The method of claim 112, wherein the symptom or characteristic is autism, intellectual disability, motor dysfunction, hypotension, global developmental delay, gastrointestinal symptoms, anxiety, epilepsy, recurrent respiratory infections, epileptic encephalopathy, or premature death.

114. 114. The method of any one of claims 109 to 113, wherein the disease or disorder is associated with elevated levels of MECP2 in the subject.

115. 115. The method of any one of claims 105-114, wherein administration of said oligomeric compound, said modified oligonucleotide, said population, said oligomeric duplex, said antisense agent, or said pharmaceutical composition reduces seizures, reduces or delays cognitive impairment, reduces or delays intellectual disability, reduces or delays symptoms of autism, reduces anxiety, or reduces gastrointestinal symptoms in said subject, or improves motor function, motor development, muscle tone, cognitive development, language, or social skill development in said subject.

116. The method of any one of claims 105 to 115, wherein the subject is a human.

117. 104. A method of reducing expression of MECP2 in a cell, comprising contacting the cell with an oligomeric compound of any one of claims 1-60, a modified oligonucleotide of any one of claims 61-64, a population of any one of claims 65-70, an oligomeric duplex of any one of claims 71-97, an antisense agent of any one of claims 98-101, or a pharmaceutical composition of any one of claims 102-104.

118. 118. The method of claim 117, wherein the cell is a neuron.

119. The method of claim 117 or claim 118, wherein the cell is a human cell.

120. 104. Use of an oligomeric compound according to any one of claims 1 to 60, a modified oligonucleotide according to any one of claims 61 to 64, a population according to any one of claims 65 to 70, an oligomeric duplex according to any one of claims 71 to 97, an antisense agent according to any one of claims 98 to 101, or a pharmaceutical composition according to any one of claims 102 to 104 for the treatment of a disease or disorder associated with MECP2.

121. 104. Use of an oligomeric compound according to any one of claims 1 to 60, a modified oligonucleotide according to any one of claims 61 to 64, a population according to any one of claims 65 to 70, an oligomeric duplex according to any one of claims 71 to 97, or an antisense agent according to any one of claims 98 to 101, or a pharmaceutical composition according to any one of claims 102 to 104 in the manufacture of a medicament for the treatment of a disease or disorder associated with MECP2.

122. 122. The use of claim 120 or claim 121, wherein the disease or disorder is associated with elevated levels of MECP2.

123. The use according to any one of claims 120 to 122, wherein the associated disease or disorder is MECP2 duplication syndrome.