Compositions and methods for the treatment of Friedreich's ataxia

Abstract

The present application provides compositions for the treatment of Friedreich's ataxia (FA), including, but not limited to, nucleic acid constructs and recombinant AAV7 vectors containing human frataxin 5' untranslated region (5'UTR FXN) and human frataxin (FXN).

Description

[Technical Field]

[0001] (Prior Art) This application claims the benefit of U.S. Provisional Patent Application No. 63 / 421,477, filed November 1, 2022. U.S. Provisional Patent Application No. 63 / 445,126, filed February 13, 2023, and U.S. Provisional Patent Application No. 63 / 445,518, filed February 14, 2023, are incorporated herein by reference in their entireties.

[0002] FIELD OF THE INVENTION FIELD OF THE DISCLOSURE The present disclosure relates generally to compositions and methods for the treatment of Friedreich's Ataxia (FA).

[0003] (Reference to sequence listing submitted as XML via EFS-WEB) SEQUENCE LISTING This application contains a Sequence Listing in XML format. The Sequence Listing, entitled 105740-1413992.xml, was created on November 1, 2023, is 22 kilobytes in size, and is incorporated herein by reference in its entirety. [Background technology]

[0004] Friedreich's ataxia (FA) is an autosomal recessive disorder in which inheritance of a trinucleotide repeat expansion in the first intron of the human FXN (hFXN) gene results in defective expression of the frataxin protein. FA is a progressive neurodegenerative movement disorder with a typical age of onset between 10 and 15 years of age. FA is caused by loss-of-function mutations in the frataxin gene (FXN). The prevalence of FA is approximately 1 in 40,000. FA is the most common hereditary ataxia in Europe, the Middle East, South Asia, and North Africa. It is characterized by restless posture, frequent falls, and progressive gait difficulty due to impaired ability to coordinate voluntary movements. A form of heart disease (cardiomyopathy) can develop in more than half of people with FA. FA-associated cardiomyopathy is the most common cause of death in FA patients. Summary of the Invention

[0005] Provided herein are adeno-associated virus (AAV) genetic constructs (e.g., recombinant AAV7 vectors) for delivering nucleic acids encoding hFXN to tissues affected by FA (e.g., the CNS and heart). In some embodiments, the AAV genetic constructs can be used to restore functional levels of frataxin, treat FA, and / or prevent the progression of FA disease.

[0006] Provided herein is a recombinant viral AAV7 vector comprising, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter, (b) a nucleic acid sequence comprising 5'UTR FXN, and (d) a nucleic acid sequence encoding human FXN, wherein the RNA polymerase II promoter is operably linked to the 5'UTR FXN and the nucleic acid sequence encoding human FXN, and the vector is flanked on each side by AAV2 inverted terminal repeats.

[0007] In some embodiments, the RNA polymerase II promoter is a desmin promoter. In some embodiments, human FXN comprises SEQ ID NO:1. In some embodiments, human FXN is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:3. In some embodiments, the 5'UTR FXN comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:2 or SEQ ID NO:4. In some embodiments, the intron comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:5. In some embodiments, the desmin promoter comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:6.

[0008] In some embodiments, the recombinant AAV7 vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence. In some embodiments, the nucleic acid sequence encoding the polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:7. In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:14 or SEQ ID NO:15. In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO:6, (b) a 5'UTR FXN comprising SEQ ID NO:4, (c) an intron comprising SEQ ID NO:5, and (d) a nucleic acid sequence comprising SEQ ID NO:3. In some embodiments, the recombinant AAV7 vector comprises SEQ ID NO:14 or SEQ ID NO:15.

[0009] Also provided are recombinant AAV7 particles and populations of AAV7 particles comprising any of the recombinant AAV7 vectors described herein. In some embodiments, the AAV7 particles comprise AAV7 capsid proteins.

[0010] Pharmaceutical compositions comprising any of the recombinant AAV7 particles described herein are also provided.

[0011] Also provided are methods for treating a patient with Friedreich's ataxia (FA), comprising administering a therapeutically effective amount of any of the recombinant AAV7 particles or pharmaceutical compositions described herein. [Brief explanation of the drawings]

[0012] This application includes the following figures. The figures are intended to illustrate certain embodiments and / or features of the compositions and methods and to supplement any description of the compositions and methods. The figures do not limit the scope of the compositions and methods unless the written description expressly indicates this is the case. [Figure 1-1](A and C) Schematic diagram showing that expression of the codon-optimized human FXN cDNA is under the control of a synthetic unique regulatory element incorporating sequences from the DES and FXN promoter regions. (B) AAV7 is a neuro- and myotropic capsid that targets tissues and cell types affected in FA. [Figure 1-2] (A and C) Schematic diagram showing that expression of the codon-optimized human FXN cDNA is under the control of a synthetic unique regulatory element incorporating sequences from the DES and FXN promoter regions. (B) AAV7 is a neuro- and myotropic capsid that targets tissues and cell types affected in FA. [Figure 2] Figures A-C show schematic diagrams of an exemplary experiment. PV-Cre conditional mFXN KO (PV) mice were obtained from Jax Labs at 5 weeks of age. Mice were assigned to gender-balanced groups and stereotactic injections of LTX401 or vehicle were performed unilaterally into the CSF and bilaterally into the deep cerebellar nuclei (DCN) for a total of three injections per brain (Figure 2A). Motor performance was assessed using an accelerating rotarod. Aphenotypic vehicle-injected littermates served as unaffected controls (Figure 2B). Histological analysis included H&E and anti-hFXN staining (Figure 2C). Biochemical analysis included hFXN-specific ELISA and qPCR of vector genomes. [Figure 3] (A) Performance of PV mice on the accelerating rotarod was significantly improved after injection of 1x or 0.5x doses of LTX401 at 5 weeks of age compared with injection of vehicle alone. Black stars correspond to p-values ​​relative to vehicle-injected controls, and red stars correspond to p-values ​​relative to vehicle-injected PV (Excip.-PV). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). (B) and (C) show dose-dependent expression of hFXN protein in the thoracic DRG and cerebellum, respectively. (D) shows dose-dependent accumulation of LTX401 vector genome in the cerebellum. All data are expressed as mean ± SEM. [Figure 4-1](A) The performance of PV mice on the accelerating rotarod was significantly improved after injection of a 1x dose of LTX401 at 7.5 weeks of late symptomatic age compared with injection of vehicle alone. Black stars correspond to p-values ​​relative to vehicle-injected controls, and red stars correspond to p-values ​​relative to vehicle-injected PV (Excip.-PV). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). (B) and (C) show growth curves and weight change rates between 5 and 20 weeks of age for all experimental groups, respectively. (D) and (E) show hFXN protein expression in the thoracic DRG and cerebellum, respectively. (F) shows quantification of LTX401 vector genome in the cerebellum. [Figure 4-2] (A) The performance of PV mice on the accelerating rotarod was significantly improved after injection of a 1x dose of LTX401 at 7.5 weeks of late symptomatic age compared with injection of vehicle alone. Black stars correspond to p-values ​​relative to vehicle-injected controls, and red stars correspond to p-values ​​relative to vehicle-injected PV (Excip.-PV). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). (B) and (C) show growth curves and weight change rates between 5 and 20 weeks of age for all experimental groups, respectively. (D) and (E) show hFXN protein expression in the thoracic DRG and cerebellum, respectively. (F) shows quantification of LTX401 vector genome in the cerebellum. [Figure 4-3] (A) The performance of PV mice on the accelerating rotarod was significantly improved after injection of a 1x dose of LTX401 at 7.5 weeks of late symptomatic age compared with injection of vehicle alone. Black stars correspond to p-values ​​relative to vehicle-injected controls, and red stars correspond to p-values ​​relative to vehicle-injected PV (Excip.-PV). *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001). (B) and (C) show growth curves and weight change rates between 5 and 20 weeks of age for all experimental groups, respectively. (D) and (E) show hFXN protein expression in the thoracic DRG and cerebellum, respectively. (F) shows quantification of LTX401 vector genome in the cerebellum. [Figure 5-1](A) Growth curves showing that injection of LTX401 via the combined CNS+IV administration route in WT mice did not adversely affect weight gain compared to vehicle-injected controls. (B) Expression of hFXN protein in the cerebellum, heart, liver, and thoracic DRG. (C) Quantification of LTX401 vector genome in the cerebellum, heart, and liver. [Figure 5-2] (A) Growth curves showing that injection of LTX401 via the combined CNS+IV administration route in WT mice did not adversely affect weight gain compared to vehicle-injected controls. (B) Expression of hFXN protein in the cerebellum, heart, liver, and thoracic DRG. (C) Quantification of LTX401 vector genome in the cerebellum, heart, and liver. [Figure 6] A and B show sagittal and coronal views of post-injection MRI showing gadolinium contrast in the bilateral dentate nuclei and CSF after convection-enhanced delivery of LTX40. [Figure 7A] The design of the LTX401 vector is shown. The LTX401 FXN expression cassette features a tissue-restricted modified desmin promoter and the FXN 5'UTR region. The 5'UTR contains transcription factor binding sites to regulate FXN and avoid toxic overexpression. This cassette is packaged into an AAV7 capsid, which is myotropic and neurotropic, making it ideal for targeting cardiac and neuronal tissues in the FA. [Figure 7B] Experimental design of the MCK mouse study is shown. MCK-Cre conditional mFXNKO mice were intravenously administered LTX401 at approximately 5 weeks of age and maintained until 20 weeks of age (WOA). At 20 WOA, animals were evaluated with cardiac MRI and subsequently necropsied for further tissue evaluation. [Figure 8-1] A shows that LTX401 treatment increases the survival probability (WOA) of 20-week-old MCK mice. [Figure 8-2] C shows cardiac MRI of MCK mice treated with LTX 401. [Figure 8-3]D shows cardiac MRI of MCK mice treated with LTX 401. [Figure 9A] FIG. 1 shows the histology of the heart and liver of MCK mice treated with LTX 401, and is a photomicrograph of the liver from an MCK mouse treated with LTX 401 compared to that of both an uninjected C57BL / 6J (B6) mouse and an MCK mouse (rows A-III). [Figure 9B] 1 provides an assessment of LTX401 vector genome copies and hFXN protein levels present in the heart and liver tissues of MCKs treated with LTX401. [Figure 10A] 1 provides an assessment of LTX401 vector genome copies and FXN protein levels present in heart and liver tissues of African Green Monkeys (AGM) treated with LTX401. [Figure 10B] 1 shows the histology of the heart and liver of AGM treated with LTX 401. [Figure 11] FIG. 1 is a schematic diagram of a vector (LP-1188 or LTX401) containing SEQ ID NO: 14. DETAILED DESCRIPTION OF THE INVENTION

[0013] The following description lists various aspects and embodiments of the compositions and methods of the present invention. No embodiment is intended to define the scope of the compositions and methods. Rather, the embodiments merely provide non-limiting examples of various compositions and methods that fall at least within the scope of the disclosed compositions and methods. The description should be read from the perspective of one skilled in the art. Therefore, it does not necessarily include information known to one skilled in the art.

[0014] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0015] vector Reports have shown that overexpression of FXN is toxic both in vitro (Vannocci Barton et al., "Adding a temporal dimension to the study of Friedreich's ataxia: the effect of frataxin overexpression in a human cell model," Dis Model Mech. 2018, 11(6):dmm032706) and in vivo (Belbellaa et al., "High levels of frataxin overexpression leads to mitochondrial and cardiac toxicity in mouse models," April 2020, doi.org?10.1101 / 2020.03.31.015255; Belbella et al., "Correction of half the cardiomyocytes fully rescue Friedreich ataxia mitochondrial cardiomyopathy through cell-autonomous mechanisms," Hum Mol Genet. 2019, 28(8):1274-1285). Provided herein are recombinant vectors that can be administered to a subject to regulate the expression of FXN while reducing toxicity (eg, neurotoxicity and / or cardiotoxicity) in the subject.

[0016] Any of the vectors provided herein can be used to regulate physiological levels of FXN in a subject. For example, the vectors provided herein can be used to regulate physiological levels of FXN expression in muscle- or neural-derived cells, including cells containing a homozygous GAA repeat expansion FXN allele. Such regulated physiological levels of FXN expression can reduce the negative effects on cellular mitochondrial function in diseased cells lacking FXN or in cells containing excess FXN due to unregulated expression of the FXN gene. Regulated physiological levels of FXN expression (e.g., at the protein level) can be at least 1%, at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 100%, at least 150%, at least 200%, at least 250%, at least 300%, at least 350%, at least 400%, at least 450%, at least 500%, at least 550%, at least 600%, at least 650%, at least 700%, at least 750%, at least 800%, at least 850%, at least 900%, at least 10 ... It can be 95%, at least 99%, at least 100%, at least 105%, at least 110%, at least 115%, at least 120%, at least 125%, at least 130%, at least 135%, at least 140%, at least 145%, at least 150%, at least 155%, at least 160%, at least 165%, at least 170%, at least 175%, at least 180%, at least 185%, at least 190%, at least 195%, or at least 200%.

[0017] Provided herein is a recombinant AAV vector, e.g., an AAV7 vector, comprising, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter, (b) a nucleic acid sequence comprising 5'UTR FXN, (c) an intron, and (d) a nucleic acid sequence encoding human FXN, wherein the RNA polymerase II promoter is operably linked to the 5'UTR FXN and the nucleic acid sequence encoding human FXN. In some embodiments, the RNA polymerase II promoter is a desmin promoter. In some embodiments, the vector is flanked on each side by AAV2 inverted terminal repeats. See, e.g., Figure 1A.

[0018] In some embodiments, human FXN comprises SEQ ID NO:1 or an amino acid sequence having at least about 80%, 85%, 90%, 95%, 99% identity to SEQ ID NO:1. In some embodiments, human FXN comprises an amino acid sequence comprising SEQ ID NO:1 with one or more conservative substitutions. In some embodiments, human FXN is encoded by a codon-optimized nucleic acid sequence. In some embodiments, human FXN is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:3.

[0019] In some embodiments, the 5'UTR FXN comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:2 or SEQ ID NO:4. In some embodiments, the intron comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:5. In some embodiments, the desmin promoter comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:6. In some embodiments, the recombinant AAV7 vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence. In some embodiments, the nucleic acid sequence encoding the polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:7. In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:14 or SEQ ID NO:15.

[0020] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:6; (b) a 5'UTR FXN comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:4; (c) an intron comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:5; and (d) a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:3.

[0021] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:6; (b) a 5'UTR FXN comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:4; (c) an intron comprising a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:5; and (d) a nucleic acid sequence encoding SEQ ID NO:1.

[0022] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO: 6; (b) a 5'UTR FXN comprising SEQ ID NO: 4; (c) an intron comprising SEQ ID NO: 5; and (d) a nucleic acid sequence comprising SEQ ID NO: 3.

[0023] In some embodiments, the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO:6, (b) a 5'UTR FXN comprising SEQ ID NO:4, c) an intron comprising SEQ ID NO:5, (d) a nucleic acid sequence comprising SEQ ID NO:3, and (e) a nucleic acid comprising SEQ ID NO:7. In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:14 or SEQ ID NO:15. In some embodiments, the recombinant AAV7 vector comprises SEQ ID NO:14 or SEQ ID NO:15. In some embodiments, the nucleic acid sequence encoding human frataxin encodes an amino acid sequence comprising SEQ ID NO:1, or an amino acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:1. Also see, for example, GenBank Accession No. AAH48097.1 for the amino acid sequence of human frataxin. mwtlgrrava gllaspspaq aqtltrvprp aelaplcgrr glrtdidatc tprrassnqr glnqiwnvkk qsvylmnlrk sgtlghpgsl dettyerlae etldslaeff edladkpytf edydvsfgsg vltvklggdl gtyvinkqtp nkqiwlssps sgpkrydwtg knwvyshdgv slhellaael tkalktkldl sslaysgkda(SEQ ID NO:1)

[0024] In some embodiments, the nucleic acid sequence encoding human frataxin comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:3, as shown below. (SEQ ID NO: 3)

[0025] In some embodiments, the 5'UTR FXN comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:2 (described below) or a fragment thereof. CAGTCTCCCTTGGGTCAGGGGTCCTGGTTGCACTCCGTGCTTTGCACAAAGCAGGCTCTCCATTTTTGTTAAATGCACGAATAGTGCTAAGCTGGGAAGTTCTTCCTGAGGTCTAACCTCTAGCTGCTCCCCCACAGAAGAGTGCCTGCGGCCAGTGGCCACCAGGGGTCGCCGCAGCACCCAGCGCTGGAGGGCGGAGCGGGCGGCAGACCCGGAGCAGC (SEQ ID NO: 2)

[0026] In some embodiments, the 5'UTR FXN comprises a nucleotide sequence or fragment thereof having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:4 (described below). CTGCAGTCTCCCTTGGGTCAGGGGTCCTGGTTGCACTCCGTGCTTTGCACAAAGCAGGCTCTCCATTTTTGTTAAATGCACGAATAGTGCTAAGCTGGGAAGTTCTTCCTGAGGTCTAACCTCTAGCTGCTCCCCCACAGAAGAGTGCCTGCGCCAGTGGCCACCAGGGGTCGCCGCAGCACCCAGCGCTGGAGGGCGGAGCGGGCGGCAGACCCGGAGCAGC (SEQ ID NO: 4)

[0027] In some embodiments, the 5'UTR FXN comprises a nucleotide sequence or fragment thereof having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 21 (described below). CAGTCTCCCTTGGGTCAGGGGTCCTGGTTGCACTCCGTGCTTTGCACAAAGCAGGCTCTCCATTTTTGTTAAATGCACGAATAGTGCTAAGCTGGGAAGTTCTTCCTGAGGTCTAACCTCTAGCTGCTCCCCCACAGAAGAGTGCCTGCGCCAGTGGCCACCAGGGGTCGCCGCAGCACCCAGCGCTGGAGGGCGGAGCGGGCGGCAGACCCGGAGCAGC (SEQ ID NO: 21)

[0028] In some embodiments, one or more introns in the recombinant vector is a chimeric intron, e.g., Huβ-globin & Ig heavy chain receptor. In some embodiments, the intron comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 5 (described below) or a fragment thereof. GTAAGTATCAAAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCGAGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCACTTTGCCTTTCTCTCCACAG (SEQ ID NO: 5)

[0029] Numerous promoters can be used in the genetic constructs described herein. A promoter is a region or sequence located upstream and / or downstream from the start of transcription that is involved in the recognition and binding of RNA polymerase and other proteins to initiate transcription. In some embodiments, the promoter is an RNA polymerase II promoter, such as, but not limited to, an RNA polymerase II CORE promoter. As used herein, an RNA polymerase II CORE promoter is a minimal sequence that allows the basal transcription machinery to assemble. For example, this sequence may be 40 base pairs in length and may include a TATA box, an initiator element (Inr), and / or a downstream promoter element (DPE). See, e.g., Domenger and Grimm, "Next generation AAV vectors—do not judge a virus (only) by its cover," Human Mol. Genetics 29(R1):R3-R14 (2019). In some embodiments, any of the genetic constructs described herein does not include the human frataxin promoter (e.g., SEQ ID NO: 16 or SEQ ID NO: 17), e.g., the full-length frataxin promoter, or the 3'UTR of the frataxin gene (e.g., SEQ ID NO: 18 or SEQ ID NO: 19).

[0030] In some embodiments, the promoter is an inducible promoter, e.g., the promoter can be chemically or physically regulated. Chemically regulated promoters and / or enhancers can be regulated, for example, by the presence of alcohol, tetracycline, steroids, or metals. Examples include tetracycline-inducible promoters or glucocorticoid-inducible promoters. The nucleic acids of the present invention can also be under the control of a tissue-specific promoter to promote expression of the nucleic acid in specific cells, tissues, or organs. Any regulatable promoter, such as a metallothionein promoter, a heat shock promoter, and other regulatable promoters, are also contemplated, many examples of which are known in the art. Furthermore, in addition to the Cre-IoxP inducible system, an Flp recombinase-inducible promoter system can also be used, both of which are known in the art.

[0031] As used herein, the terms "operably linked," "operably positioned," and the like mean that a first nucleic acid sequence (e.g., a protein-coding sequence or a non-coding RNA sequence) is covalently linked to at least a second nucleic acid sequence such that at least one of the two sequences can exert an effect on the other nucleic acid sequence. For example, a human FXN nucleotide sequence can be operably linked to a promoter sequence such that the promoter sequence can direct transcription of the human FXN nucleotide sequence, thereby contributing to expression of the human FXN nucleotide sequence. Similarly, a 5'UTR FXN sequence can be operably positioned between the promoter sequence and the human FXN nucleotide sequence such that the 5'UTR FXN sequence can regulate expression of the human FXN nucleotide sequence.

[0032] In some embodiments, the promoter is a desmin promoter, hi some embodiments, the desmin promoter comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 6 (described below), or a fragment thereof. (SEQ ID NO: 6)

[0033] It is understood that fragments of the desmin promoter can also be used in the genetic constructs described herein, so long as they retain at least one activity of the desmin promoter from which they are derived, e.g., at least 75%, 80%, 85%, 90%, 95%, 100%, or more of promoting transcription of a nucleic acid in a cell (e.g., a neuronal or muscle cell). The fragment can be at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 300, 400, 500, or more nucleotides shorter than the wild-type promoter or a promoter sequence having at least 85% identity to the wild-type promoter sequence. For example, fragments at least 10, 20, 30, 40, 50, 100, or 200 base pairs shorter in length than SEQ ID NO:6 can be used as promoters.

[0034] In some embodiments, the nucleic acid gene construct comprises a bovine growth hormone polyadenylation sequence. In some embodiments, the nucleic acid sequence encoding the bovine growth hormone polyadenylation sequence comprises a nucleotide sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:7 (described below), or a fragment thereof. CTAGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCC TGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAA AATGAGGAAATTGCATGGCATTGTCTGAGTAGGTGTCATTCTATTCTGGG GGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCA GGCATGCTGG GGA (SEQ ID NO: 7)

[0035] In some embodiments, the 5'UTR FXN comprises a nucleic acid sequence encoding one or more regulatory sequences selected from the group consisting of an L2 retrotransposition element, a serum response factor (SRF), and a specificity protein 1 (SP1). Exemplary nucleotide sequences comprising an L2 retrotransposition element include, but are not limited to, SEQ ID NO:9 and nucleotide sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:9 (GTGCTTTGCACAAAGCAGGCTCTCCATTTTTGTTAAATGCACGAATA). Exemplary nucleotide sequences containing SRF include, but are not limited to, SEQ ID NO: 10 and nucleotide sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 10 (GCTCTCCATTTTTGTTAAA). Exemplary nucleotide sequences containing SP1 include, but are not limited to, SEQ ID NO: 11 and nucleotide sequences having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 11 (TGGAGGGCGGAGCGG).

[0036] In some embodiments, the recombinant AAV7 vector contains a selectable marker gene for selection of transformed cells. Marker genes include genes that confer antibiotic resistance, such as genes that confer hygromycin resistance, kanamycin resistance, ampicillin resistance, gentamicin resistance, and neomycin resistance, to name a few. Additional selectable markers are known, and any may be used. Exemplary sequences of genes that confer ampicillin resistance and kanamycin resistance are provided herein as SEQ ID NO: 12 and SEQ ID NO: 13, respectively.

[0037] In some embodiments, the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 15. SEQ ID NO: 14 and SEQ ID NO: 15 comprise, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter (i.e., a desmin promoter comprising SEQ ID NO: 6), (b) a nucleic acid sequence comprising 5' UTR FXN (SEQ ID NO: 4), (c) an intron (SEQ ID NO: 4), and (d) a nucleic acid sequence encoding human FXN (SEQ ID NO: 3), wherein the RNA polymerase II promoter is operably linked to the 5' UTR FXN and the nucleic acid sequence encoding human FXN. The nucleic acid gene construct further comprises a polyadenylation (polyA) sequence located downstream of SEQ ID NO: 3, i.e., a nucleic acid sequence encoding a polyA bovine growth hormone sequence (SEQ ID NO: 7).

[0038] In SEQ ID NO:14 and SEQ ID NO:15, the nucleic acid gene construct is flanked on each side by AAV2 inverted terminal repeats (SEQ ID NO:8 or SEQ ID NO:20). In SEQ ID NO:14 and SEQ ID NO:15, the 5'UTR FXN (SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:21) comprises SEQ ID NO:8, SEQ ID NO:10, and SEQ ID NO:11.

[0039] SEQ ID NO:14 and SEQ ID NO:15 also contain a kanamycin resistance gene (SEQ ID NO:13). Figure 1C is a schematic diagram of the expression cassette (SEQ ID NO:15). Figure 11 is a schematic diagram of a vector (LP-1188 or LTX401) containing SEQ ID NO:14. It is understood that LP-1188 and LTX401 are used interchangeably to refer to the recombinant AAV7 vector shown in Figure 11 and used in the experiments described herein.

[0040] The recombinant AAV7 vector may further comprise viral sequences for packaging. Any missing viral functions may be supplied in trans by the packaging cell. For example, a recombinant AAV vector used in gene therapy may have only one or more inverted terminal repeat (ITR) sequences from the recombinant AAV genome, and the remainder of the vector may contain a sequence of interest (e.g., 5'UTR FXN and FXN nucleotide sequences). ITR sequences, such as AAV2 ITR sequences, may be included for packaging into AAV capsids. Exemplary ITR sequences may include a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:8 or SEQ ID NO:20 (described below). AGGAATGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC (SEQ ID NO: 8) TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC (SEQ ID NO: 20)

[0041] In some embodiments, the AAV vector comprises a nucleic acid gene construct comprising (a) a nucleic acid sequence comprising an RNA polymerase II promoter, (b) a nucleic acid sequence comprising a 5'UTR FXN, (c) an intron, and (d) a nucleic acid sequence encoding human FXN, each of which is flanked by ITRs. Exemplary ITR sequences include, but are not limited to, SEQ ID NO: 8 and its reverse complement, or a nucleic acid sequence having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 8 and its reverse complement.

[0042] Packaging cells can also contain plasmids encoding other AAV genes (e.g., rep and cap) but lacking ITR sequences. Plasmids encoding the rep and cap genes may not be packaged in significant amounts due to the lack of ITR sequences. Packaging cells can also be infected with adenovirus as a helper virus, which can promote AAV vector replication and AAV gene expression from the plasmid encoding the rep and cap genes. Packaging cells can be transfected with a helper plasmid encoding the gene products of a helper virus (e.g., adenovirus), which promotes AAV vector replication and AAV gene expression from the plasmid encoding the rep and cap genes.

[0043] The nucleic acid sequences provided herein are understood to comprise, consist of, or consist essentially of a nucleic acid sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity, or any percentage of identity between, to any of the nucleic acid sequences set forth in SEQ ID NOs: 1 through 21. Also provided are any of SEQ ID NOs: 1 through 21 containing deletions of 1, 2, 3, 4, 5, 6, 7, or more nucleotides at the 3' or 5' end, as well as nucleic acid sequences having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identity, or any percentage of identity between, to any of these sequences containing the deletions.

[0044] The terms "identity" or "substantial identity," as used in the context of polynucleotide or polypeptide sequences described herein, refer to a sequence having at least 60% sequence identity to a reference sequence. Alternatively, the percent identity can be any integer between 60% and 100%. Exemplary embodiments include at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity compared to a reference sequence using the programs described herein. BLAST, using standard parameters as described below, is preferred. Those skilled in the art will recognize that these values ​​can be appropriately adjusted by considering codon degeneracy, amino acid similarity, reading frame position, and the like, to determine the corresponding identity of proteins encoded by two nucleotide sequences.

[0045] For sequence comparison, typically, one sequence serves as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the program parameters.

[0046] As used herein, a "comparison window" includes reference to any segment of the number of contiguous positions selected from the group consisting of 20 to 600, usually about 50 to about 200, and more usually about 100 to about 150, within which a sequence can be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Sequence alignment methods for comparison are known in the art. Optimal sequence alignment of sequences for comparison may be performed, for example, using the homology alignment algorithm of Smith & Waterman, Add. APL. Math. 2:482 (1981), Needleman and Wunsch J. Mol. Biol. 48:443 (1970), by the similarity search method of Pearson and Lipman, Proc. Natl. Acad. Sci. (USA) 85:2444 (1988), by computer implementations of these algorithms (e.g., BLAST), or by manual alignment and visual inspection.

[0047] Suitable algorithms for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al. (1990) J. Mol. Biol. 215:403-410 and Altschul et al. (1977) Nucleic Acids Res. 25:3389-3402, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI) website. This algorithm involves initially identifying high-scoring sequence pairs (HSPs) by identifying short words of length W in a query sequence that, when aligned with words of the same length in a database sequence, match or meet some positive threshold score T. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues, always >0) and N (penalty score for mismatching residues, always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of the word hits in each direction is halted when the cumulative alignment score falls below its maximum achieved value by an amount X; the cumulative score falls below zero due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a word size (W) of 28, an expectation (E) of 10, M=1, N=-2, and a comparison of both strands.For amino acid sequences, the BLASTP program uses as defaults a word size (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)).

[0048] The BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Nat'l. Acad. Sci. USA 90:5873-5787 (1993)). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability that a match between two nucleotide or amino acid sequences would occur by chance. For example, nucleic acids are selected such that the smallest sum probability in a comparison of a test nucleic acid to a reference nucleic acid is less than about 0.01, more preferably less than about 10 -5 less than, most preferably about 10 -20 If the sequence is less than 1, it is considered similar to the reference sequence.

[0049] virus particles Also provided are recombinant AAV particles, for example, AAV7 particles comprising any of the recombinant AAV7 vectors described herein. In some embodiments, the AAV7 particles comprise AAV7 capsid proteins. Also provided are pharmaceutical compositions comprising any of the recombinant AAV7 particles described herein, including a plurality of recombinant AAV7 particles.

[0050] Any of the AAV7 gene constructs described herein can be packaged into virions. As used herein, a recombinant AAV particle or virion is a viral particle comprising at least one AAV capsid protein and an encapsidated recombinant AAV vector. As used herein, a recombinant AAV particle is a viral particle comprising at least one AAV capsid protein and an encapsidated recombinant AAV vector. An "AAV virus," "AAV virion," "AAV viral particle," or "recombinant AAV vector particle" refers to a viral particle composed of at least one AAV capsid protein and an encapsidated polynucleotide recombinant AAV vector. If the particle comprises a heterologous nucleic acid sequence (i.e., a nucleic acid sequence other than the wild-type AAV genome, such as a transgene delivered to a mammalian cell), it may be referred to as a recombinant AAV vector. Therefore, the production of recombinant AAV particles or virions necessarily includes the production of recombinant AAV vectors, since such vectors are contained within the recombinant AAV particles. Methods for producing AAV vectors and virions are known in the art. See, for example, Shin et al., "Recombinant Adeno-Associated Viral Vector Production and Purification," Methods Mol. Biol. 798:267-284 (2012). The AAV capsid protein can be derived from any natural or recombinant AAV serotype, such as AAV1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, to name a few.

[0051] Cells containing any of the vectors described herein are also provided. Host cells can be in vitro host cells, ex vivo host cells, or in vivo host cells. Populations of any of the host cells described herein are also provided. Cell cultures containing one or more host cells described herein are also provided. Methods for the culture and production of many cells are available in the art, including cells of bacterial (e.g., E. coli and other bacterial strains), animal (particularly mammalian), and archaeal origin. See, e.g., Sambrook, Ausubel, and Berger (all supra), and Freshney (1994) Culture of Animal Cells, a Manual of Basic Technique, 3rd Ed., Wiley-Liss, New York and references cited therein; Doyle and Griffiths (1997) Mammalian Cell Culture: Essential Techniques, John Wiley and Sons, NY; Humason (1979) Animal Tissue Techniques, 4th Ed. W.H. Freeman and Company; and Ricciardelli et al. (1989) In Vitro Cell Dev. Biol. 25, 1016, 1024.

[0052] The host cell can be, for example, a prokaryotic cell, including a bacterial cell. Alternatively, the cell can be a eukaryotic cell, such as a mammalian cell. In some embodiments, the cell can be a HEK293T cell, a Chinese hamster ovary (CHO) cell, a COS-7 cell, a HELA cell, an avian cell, a myeloma cell, a Pichia cell, an insect cell, or a plant cell. Many other suitable host cell lines have been developed, including myeloma cell lines, fibroblast cell lines, and various tumor cell lines (e.g., melanoma cell lines). The vector containing the nucleic acid segment of interest can be transferred or introduced into the host cell by known methods that vary depending on the type of cellular host.

[0053] Methods for introducing vectors into cells are known in the art. As used herein, the phrase "introducing," in the context of introducing a nucleic acid into a cell, refers to the transfer of a nucleic acid sequence from outside the cell to inside the cell. In some cases, introducing refers to the transfer of a nucleic acid from outside the cell to inside the nucleus of the cell. Various methods of such transfer are contemplated, including, but not limited to, electroporation, nanoparticle delivery, viral delivery, contact with nanowires or nanotubes, receptor-mediated internalization, cell-penetrating peptide-mediated transfer, and liposome-mediated transfer. DEAE-dextran, lipofectamine, calcium phosphate, or any currently known or future identified method for the introduction of nucleic acids into prokaryotic or eukaryotic cell hosts. Targeted nuclease systems (e.g., RNA-guided nucleases (e.g., CRISPR / Cas9 systems), Transcription Activator-Like Effector Nucleases (TALENs), Zinc Finger Nucleases (ZFNs), or megaTALs (MTs) (Li et al., Signal Transduction and Targeted Therapy 5. Paper No. 1 (2020)) can also be used to introduce nucleic acids into host cells.

[0054] Pharmaceutical Composition Pharmaceutical compositions containing any of the recombinant viral vectors or viral particles described herein are provided herein. Pharmaceutical compositions may contain additional components suitable for, for example, increasing delivery (e.g., increasing infection of target cells and / or increasing the range of cells that can be infected), increasing the stability of the recombinant vector, or decreasing the immunogenicity of the recombinant vector, e.g., the AAV7 vector. For example, pharmaceutical compositions may contain pharmaceutically acceptable carriers, excipients, and / or salts. Pharmaceutically acceptable carriers may exclude buffers, compounds, cryopreservatives, preservatives, or other agents in amounts that may substantially interfere with the delivery or activity of the recombinant AAV vector to a patient. An exemplary liquid carrier is a sterile aqueous solution that contains no materials in addition to the recombinant AAV vector and water, or a buffer such as sodium phosphate, saline, or phosphate-buffered saline at a physiological pH. Additionally, aqueous carriers may contain more than one buffer salt, as well as salts such as sodium chloride and potassium chloride, dextrose, polyethylene glycol, and other solutes. Liquid compositions may contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions.

[0055] The pharmaceutical composition may be delivered to a subject to allow production of an expression product in one or more cells of the subject. The pharmaceutical composition includes sufficient genetic material to allow the recipient to produce an effective amount of an expression product to modulate FXN expression in the cells and / or treat FA in the subject.

[0056] In some embodiments, the pharmaceutical composition also contains a pharmaceutically acceptable excipient. Such excipients include any pharmaceutical agent that does not itself induce a harmful immune response in the individual receiving the composition and that can be administered without undue toxicity. Pharmaceutically acceptable excipients include liquids such as water, saline, glycerol, sugar, and ethanol. Pharmaceutically acceptable salts may be included therein, such as mineral acid salts such as hydrochloride, hydrobromide, phosphate, and sulfate, and salts of organic acids such as acetate, propionate, malonate, and benzoate. Additionally, auxiliary substances such as wetting or emulsifying agents, pH buffering substances, and the like may be present in such vehicles. The preparation of pharmaceutically acceptable carriers, excipients, and formulations containing these substances is described, for example, in Remington: The Science and Practice of Pharmacy, 22nd edition, Loyd V. Allen et al., editors, Pharmaceutical Press (2012).

[0057] Pharmaceutical preparations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances that increase the viscosity of the suspension, such as sodium carboxymethylcellulose, sorbitol, or dextran. Additionally, suspensions of active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate or triglycerides, or liposomes. Optionally, the suspension can also contain suitable stabilizers or agents that increase the solubility of the compound, allowing for the preparation of highly concentrated solutions.

[0058] Genetically modified cells Also provided herein are genetically modified cells containing any of the nucleic acid gene constructs or recombinant viral vectors described herein. As used herein, "genetically modified cells" refer to cells that have at least one genome modification as a result of introducing any of the nucleic acid gene constructs or recombinant viral vectors described herein into the cells. Genetically modified cells can be in vitro genetically modified cells, ex vivo genetically modified cells, or in vivo genetically modified cells.

[0059] The genetically modified cells can be any suitable genetically modified cells, such as those selected from the group consisting of human stem cells (e.g., pluripotent stem cells, e.g., mesenchymal stem cells that can differentiate into neurons and cardiomyocytes), human neurons, human cardiomyocytes, human smooth muscle cells, human skeletal muscle cells, and human hepatocytes.

[0060] In some embodiments, bone marrow-derived mesenchymal stem cells are isolated from a subject with FA and genetically modified to insert any of the nucleic acid gene constructs described herein, including a 5'UTR and a nucleic acid sequence encoding human FX. The genetically modified cells are then autologously transplanted back into the subject. In some embodiments, the genetically modified cells can be delivered systemically to enable targeted delivery of the graft to the brain and heart of FA patients. See, e.g., Tajiri et al., "Autologous Stem Cell Transplant with Gene Therapy for Friedreich Ataxia," Med. Hypothesis 83(3):296-298 (2014). Methods for introducing nucleic acids and vectors for genetic modification of cells are described above.

[0061] The term "genetic modification" refers to any change in the DNA genome (or in some cases the RNA genome) of a cell, organism, virus, viral vector, or other biological agent. Non-limiting examples of genetic modifications include insertions, deletions, substitutions, procedures such as transfection or transformation in which exogenous nucleic acid is added to a cell and / or organism, and cloning techniques.

[0062] The term "insertion" refers to the addition of one or more nucleotides in a nucleic acid sequence. Insertions can range from small insertions of a few nucleotides to the insertion of large segments such as cDNA or genes.

[0063] The term "deletion" refers to the loss or removal of one or more nucleotides in a nucleic acid sequence, or the loss or removal of gene function. In some cases, a deletion can include, for example, the loss of a few nucleotides, an exon, an intron, a gene segment, or the entire sequence of a gene. In some cases, a gene deletion refers to the elimination or reduction of function or expression of a gene or its gene product. This can result not only from the deletion of sequences within or near a gene, but also from other events that disrupt gene expression (e.g., insertions, nonsense mutations).

[0064] The term "substitution" refers to the replacement of one or more nucleotides in a nucleic acid sequence with the same number of nucleotides.

[0065] Genetic modification of a nucleic acid sequence can result in a "recombinant" sequence. For example, the present disclosure provides a "recombinant AAV vector" that has been genetically modified to include the elements disclosed herein.

[0066] Treatment method Further provided is a method of treating a patient with Friedreich's ataxia (FA), comprising administering a therapeutically effective amount of any of the pharmaceutical compositions or recombinant AAV7 particles described herein.

[0067] The term "effective amount" as used throughout is defined as any amount necessary to produce a desired physiological response, for example, to reduce or delay one or more effects or symptoms of FA (e.g., muscle loss, ataxia of the arms and legs in a subject, diabetes, cardiomyopathy, etc.). Effective amounts and schedules for administering the recombinant AAV virions described herein can be determined empirically, and making such determinations is within the skill of the art. The dosage range for administration is about an amount sufficient to produce the desired effect in which one or more symptoms of a disease or disorder are affected (e.g., alleviated or delayed). The dosage should not be so large as to cause substantial adverse side effects, such as undesirable cross-reactivity, undesirable cell death, etc. Generally, dosages vary depending on the species, age, weight, general health, sex, and diet of the subject, the mode and time of administration, and the severity of the particular condition, and can be determined by one of skill in the art. Dosages can be adjusted by the individual physician in the event of any contraindications. Dosages can vary and can be administered in one or more doses.

[0068] Effective amounts of any of the recombinant AAV virions described herein will vary and can be determined by one of skill in the art through experimentation and / or clinical trials. For example, for in vivo injection, e.g., direct injection into the inner ear of a subject, an effective dose may be about 10 6 ~about 10 15 recombinant rAAV virions, or any value within this range, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 The recombinant AAV particles may be

[0069] In some embodiments, the number of rAAV particles administered to a subject is about 10 6 ~10 15 on the order of vector genomes (vg) / mL, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 In some embodiments, the number of rAAV particles administered to a subject can be about 10 6 ~10 15 vg / kg, or any value between these amounts, e.g., about 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , or 10 15 Other effective dosages can be readily established by one skilled in the art through routine trials to establish dose-response curves.

[0070] Any of the methods provided herein can further include administering to the subject with FA a second therapeutic agent, e.g., a beta blocker, an ACE inhibitor, an antioxidant, a diuretic, an antidiabetic agent, or a combination thereof.

[0071] The compositions described herein can be administered in several ways, depending on whether local or systemic treatment is desired. The compositions can be administered via any of several routes: intraparenchymal injection, intravenous, intrathecal, intramuscular, intravesical, intracoronary, intramyocardial, intradermal, or endomyocardial injection, or a combination thereof. In some embodiments, more than one route can be used to administer the therapy. These routes can be simultaneous or sequential. Effective doses for any of the administration methods described herein can be extrapolated from dose-response curves obtained from in vitro or animal model test systems. It is understood that combinations, such as the recombinant AAV7 particles described herein and a second therapeutic agent described herein, can be administered separately but simultaneously (e.g., via separate intravenous lines into the same subject) or sequentially (e.g., one of the agents is given first, followed by the second).

[0072] As used throughout, "patient" is used interchangeably with "subject." Subject means an individual. A subject can be an adult subject or a pediatric subject. Pediatric subjects include subjects ranging in age from birth to 18 years of age. Preferably, the subject is an animal, e.g., a mammal such as a primate, more preferably a human. Non-human primates are subjects as well. The term subject includes domesticated animals such as cats, dogs, farm animals (e.g., cows, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., ferrets, chinchillas, mice, rabbits, rats, gerbils, guinea pigs, etc.). Thus, veterinary uses and pharmaceutical formulations are contemplated herein.

[0073] As used throughout, "treat," "treating," and "treatment" refer to a method of reducing or delaying one or more effects or symptoms of FA. A subject may be diagnosed with FA. Treatment may also refer to a method of alleviating the underlying pathology, not just the symptoms. The effect of administration to a subject may have the effect of, but is not limited to, alleviating one or more symptoms of the disease, reducing the severity of the disease, completely eliminating the disease, delaying recurrence, or delaying the onset or worsening of one or more symptoms. For example, the disclosed methods are considered to be therapeutic if there is about a 10% reduction in one or more symptoms of the disease (e.g., muscle loss, ataxia of the arms and legs in a subject, diabetes, cardiomyopathy, etc.) when compared to the subject before treatment or when compared to a control subject or control value. Thus, the reduction can be about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount therebetween, compared to a control (e.g., a subject not treated with a recombinant AAV vector described herein). Any of the therapeutic methods provided herein can result in a reduction or decrease in neurotoxicity and / or cardiac toxicity compared to a control. The methods provided herein can also be used to target frataxin expression in disease-related tissues (e.g., the cerebellum, dorsal root ganglia (DRG), spinal cord, and heart) while reducing off-target effects in other cells or tissues (e.g., compared to a control).

[0074] Also provided are methods for modulating FXN expression in human cells in vivo, ex vivo, or in vitro. In some embodiments, the methods comprise introducing any of the recombinant AAV vectors provided herein into a human cell. In some embodiments, the cell is within a subject.

[0075] Also provided are methods for increasing adenosine triphosphate (ATP) levels in human cells of a subject with FA. The methods include administering to the subject a therapeutically effective amount of any of the recombinant AAV particles provided herein. In some methods, the human cells are selected from the group consisting of neurons, cardiac muscle cells, smooth muscle cells, skeletal muscle cells, and hepatocytes.

[0076] As used throughout, an increase can be about a 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400% or more increase compared to a control. Increasing the level of ATP expressed in the cells of an FA patient can be beneficial for ameliorating one or more symptoms of the disease, increasing long-term survival, and / or reducing other treatment-related side effects. When the recombinant AAV vectors disclosed herein are administered to a human FA patient, the recombinant AAV vectors can express increased but regulated levels of FXN compared to the disease state, increasing ATP production by mitochondria.

[0077] In some embodiments, the FA patient receiving any of the recombinant AAV vectors described herein may have a cell population of 100,000 to 500,000 cells, 500,000 to 1,000,000 cells, 1,000,000 to 2,500,000 cells, 2,500,000 to 5,000,000 cells, 5,000,000 to 10,000,000 cells: 10,000,000 to 50,000,000 cells, 50,000,000 to 100,000,000 cells, 100,000,000 to 250,000,000 cells: 150,000,000 to 300,000,000 cells: 250,000,000 to 500,000,000 cells. cells, 500,000,000-1,000,000,000 cells: 1,000,000,000-5,000,00,000 cells, 5,000,000,000-10,000,000,000 cells, 10,000,000,000-20,000,000,000 cells, 15,000,000,000-30, 000,000,000 cells, 30,000,000,000 to 50,000,000,000 cells, 50,000,000 to 75,000,000,000 cells, or 75,000,000,000 to 100,000,000 cells may express increased, but still regulated, levels of FXN. In some methods, ATP production by mitochondria may be increased relative to ATP production in disease states. [Example]

[0078] Example 1 Biodistribution and efficacy of AAV-hFXN expression vectors in the rodent CNS An LTX401 gene expression cassette consisting of a human FXN (hFXN) sequence and a modified hFXN 5'UTR under the control of a synthetic desmin promoter was engineered using standard molecular biology techniques (Figure 1). See, e.g., Sambrook et al., Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 2001. Figures 1 and 11 are schematic diagrams of an LTX401 expression gene construct or vector comprising SEQ ID NO: 14 or SEQ ID NO: 15. SEQ ID NO: 14 and SEQ ID NO: 15 comprise, in the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter (i.e., a desmin promoter comprising SEQ ID NO: 6), (b) a nucleic acid sequence comprising the 5'UTR FXN (SEQ ID NO: 4), (c) an intron (SEQ ID NO: 5), and (d) a nucleic acid sequence encoding human FXN (SEQ ID NO: 3), wherein the RNA polymerase II promoter is operably linked to the 5'UTR FXN and the nucleic acid sequence encoding human FXN.

[0079] This gene construct was packaged into AAV serotype 7 for injection into the CNS of parvalbumin-Cre conditional frataxin knockout (PV) mice, which recapitulate features of FA neuropathophysiology. See, e.g., Zolotukhin et al., "Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors," Methods 2002 Oct. 28(2):158-67. Mice were assigned to gender-balanced groups, and stereotactic injections of LTX401 or vehicle were performed unilaterally into the CSF and bilaterally into the deep cerebellar nuclei (DCN), for a total of three injections per brain. Administration of LTX401 into the DCN (1 e 10 vg / site) and the fourth ventricle (7.5 e 10 viral genomes (vg)) was performed in a single surgical session. Group sizes were approximately 10–16 animals per cohort and were balanced by sex.

[0080] Cohorts of PV mice were injected with either LTX401 or vehicle via a combination of intracerebroventricular (fourth ventricle) and intraparenchymal (deep cerebellar nucleus DCN) routes. Motor performance was assessed using an accelerating rotarod until 17 or 19 weeks of age. Tissues were harvested from all cohorts at endpoint for biochemical and histological testing. Delivery of LTX401 via this novel administration route resulted in widespread biodistribution across multiple CNS and PNS-resident cells. Biochemical analysis revealed near-physiological human frataxin expression within critically affected tissues in FA, including the cerebellum and dorsal root ganglia. There were no gross histopathological findings or evidence of neurotoxicity after long-term CNS expression of LTX401. In addition to its safety profile, LTX401 was effective in significantly improving and stabilizing motor performance in the PV-Cre mouse model of FA. LTX401 may be used to treat myocardial and CNS-related pathologies in FA.

[0081] Figures 1A and 1C show that expression of the codon-optimized human FXN cDNA is under the control of a synthetic, unique regulatory element incorporating sequences from the DES and FXN promoter regions. This gene construct efficiently drives expression levels in disease-related tissues (cerebellum, dorsal root ganglia (DRG), spinal cord, and heart) and exhibits restricted expression in off-target tissues. Figure 1B shows that AAV7 is a neuro- and myotropic capsid that targets tissues and cell types affected in FA. The AAV7 capsid structure is closely related to AAV13 and belongs to the structurally unique AAV clade D.

[0082] Figures 2A-2C show a schematic diagram of an exemplary experiment. PV-Cre conditional mFXN KO (PV) mice were obtained from Jax Labs at 5 weeks of age. Mice were assigned to gender-balanced groups and stereotactic injections of LTX401 or vehicle were performed unilaterally into the CSF and bilaterally into the deep cerebellar nuclei (DCN) for a total of three injections per brain (Figure 2A). Motor performance was assessed by accelerating rotarod runs (accelerating speeds from 5 to 40 rpm, total duration 300 s). Vehicle-injected non-genotype littermates served as unaffected controls (Figure 2B). Histological analysis included H&E and anti-hFXN staining (Figure 2C). Biochemical analyses included an hFXN-specific ELISA (Abcam, Cambridge, UK, according to the manufacturer's instructions) and qPCR of the vector genome using standard molecular biology techniques and primers targeting the human frataxin (hFXN) sequence.

[0083] As shown in Figure 3A, the performance of PV mice on the accelerating rotarod was significantly improved after injection of LTX401 at 1x DCN 1e10 vg / site, 4th ventricle 7.5e10 vg or 0.5x (DCN 5e9 vg / site, 4th ventricle 3.75e10) doses at 5 weeks of age compared to injection of vehicle alone. Black stars correspond to p-values ​​relative to vehicle-injected controls, and red stars correspond to p-values ​​relative to vehicle-injected PV (Excip.-PV). * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001).

[0084] Figures 3B and 3C show dose-dependent expression of hFXN protein in the thoracic DRG and cerebellum, respectively. Figure 3D shows dose-dependent accumulation of LTX401 vector genome in the cerebellum. All data are presented as mean ± SEM.

[0085] Figure 4A shows that the performance of PV mice on the accelerating rotarod was significantly improved after injection of a 1x dose of LTX401 at the late symptomatic age of 7.5 weeks compared to injection of vehicle alone. Black stars correspond to p-values ​​relative to vehicle-injected controls, and red stars correspond to p-values ​​relative to vehicle-injected PV (Excip.-PV). * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001).

[0086] Figures 4B and 4C show growth curves and weight change rates, respectively, between 5 and 20 weeks of age for all experimental groups. LTX401 injection prevented the weight loss observed in vehicle-injected PV mice. Data are expressed as mean + / - SEM. * p<0.05 ** p<0.01. Figures 4D and 4E show hFXN protein expression in the thoracic DRG and cerebellum, respectively. Figure 4F shows quantification of LTX401 vector genomes in the cerebellum. All data are expressed as mean ± SEM. Figure 4G provides representative images of hFXN expression and H&E staining in the deep cerebellar nuclei of 20-week-old LTX401-injected PV mice compared with vehicle-injected controls.

[0087] Figure 5A shows growth curves demonstrating that injection of LTX401 via the combined CNS+IV administration route in WT mice did not adversely affect weight gain compared to vehicle-injected controls. Figure 5B shows hFXN protein expression in the cerebellum, heart, liver, and thoracic DRG. Figure 5C shows quantification of LTX401 vector genome in the cerebellum, heart, and liver. All data are expressed as mean ± SEM. Figure 5D provides representative images of hFXN expression and H&E staining in the heart and deep cerebellar nuclei and liver of 30-week-old LTX401-injected WT mice compared to vehicle-injected controls. * No hFXN staining was detected in the liver.

[0088] Figures 6A and 6B show sagittal and coronal views of post-injection MRI showing gadolinium contrast in the dentate nuclei and CSF bilaterally after convection-enhanced delivery of LTX40.

[0089] In summary, LTX401 exhibits desirable biodistribution, safety, and efficacy profiles in the adult CNS after delivery to the posterior fossa. LTX401 is also safe and effective after systemic delivery over a wide range of doses in the MCK mouse model of FA-associated cardiomyopathy (see below). The combination of CNS and intravenous delivery of LTX401 is safe in WT mice and provides robust and persistent expression of hFXN in target tissues for at least 24 weeks or 6 months after injection. These results indicate that LTX401 can be used to treat myocardial and CNS-related pathologies in FA.

[0090] Example 2 Biodistribution and activity of AAV-hFXN expression vectors in the MCK mouse model of FA An expression cassette containing the human FXN sequence and a modified FXN 5'UTR under the control of a synthetic desmin promoter was engineered. This gene construct was packaged into AAV serotype 7, herein designated LTX401. LTX401 was administered intravenously to 5-week-old MCK mice lacking frataxin in cardiac and skeletal muscle (strain #029720 (Fxn flox / null:MCK-Cre), The Jackson Laboratory, Bar Harbor, ME). After 15 weeks of administration, cardiac function in treated and untreated animals was evaluated by MRI. Animals were then harvested for biochemical and histological examination. As described in more detail below, intravenous delivery of LTX401 resulted in widespread biodistribution to cardiac tissue, restoration of cardiac function, and tolerability in MCK mice. Administration of the target dose resulted in near-physiological frataxin expression in the heart, which correlated with a significant improvement in cardiac ejection fraction. Furthermore, LTX401 was well tolerated in MCK and non-transgenic mice up to five times our target dose. No gross histopathological findings were observed in the heart or off-target tissues.

[0091] Figure 7A shows the design of the LTX401 vector. The LTX401 FXN expression cassette features a tissue-restricted, modified desmin promoter and FXN 5'UTR region. The 5'UTR contains transcription factor binding sites to regulate FXN and avoid toxic overexpression. This cassette is packaged into an AAV7 capsid, which is myotropic and neurotropic, making it ideal for targeting cardiac and neuronal tissues in the FA. Figure 7B shows the experimental design for the MCK mouse study. MCK-Cre conditional mFXNKO mice (approximately n = 6-10 per cohort) were administered LTX401 intravenously (5e13 vg / kg) at approximately 5 weeks of age and maintained until 20 weeks of age (WOA). At 20 WOA, animals were evaluated by cardiac MRI and then necropsied for further tissue evaluation.

[0092] Figure 8A shows that LTX401 treatment increases the survival probability (WOA) of 20-week-old MCK mice. LTX401-treated and untreated MCK mice are plotted against untreated C57BL / 6J (B6) mice. While 100% of untreated MCK mice reached moribund status by 10 WOA, 100% of treated MCK and untreated B6 mice survived to the study endpoint of 20 WOA. Figure 8B shows that LTX401 treatment significantly alters the heart / body weight ratio in MCK mice. This correction is noteworthy because MCKs experience cardiac hypertrophy and long-term weight loss. Figures 8C and 8D show cardiac MRI of MCK mice treated with LTX401. MRI-generated images of MCK hearts in the transverse plane show a decrease in left ventricular (LV) contractile activity at end-systole, with a visible improvement at 20 WOA in LTX 401-treated mice (C). MRI-based calculations of cardiac ejection fraction further demonstrate a significant recovery of MCK cardiac activity toward that of healthy B6 mice (D). One-way ANOVA was performed on B and C. * ,p<0.05, *** ,p<0.001, **** ,p<0.0001

[0093] Figure 9A shows the histology of the heart and liver of MCK mice treated with LTX 401. Hematoxylin-eosin (H&E) staining of cardiac tissue in columns A-I reveals fibrous accumulation of extracellular matrix (arrows) in the cardiac tissue of uninjected MCK mice at 9 weeks of age (WOA). This fibrosis is significantly reduced at 20 WOA in MCK mice receiving IV administration of 5E13 vg / kg of LTX 401 at 5 WOA. Immunohistochemical labeling of human frataxin protein in columns A-II demonstrates LTX 401-driven expression of hFXN in MCK hearts at 20 WOA. Human FXN signal was not detected in untreated animals. H&E staining of livers from MCK mice treated with LTX 401 did not detect perivascular immune infiltrates, compared with both uninjected C57BL / 6J (B6) mice and MCK mice (columns A-III).

[0094] Figure 9B provides an assessment of LTX401 vector genome copies and hFXN protein levels present in the heart and liver tissues of MCK mice treated with LTX401. Vector genomes were detected by qPCR in heart (I.) and liver (II.) tissues. Quantification of human frataxin protein (hFXN) present in heart (III) and liver (IV) tissues of MCK mice treated with LTX401 was performed by ELISA. Also shown are the average levels of endogenous mouse frataxin (End.mFXN) detected in c57BL / 6J mice using a similar ELISA. Despite the apparent higher vector genome deposition in the liver compared to the heart (I.-II.), hFXN protein overexpression was significantly lower in the liver at all doses tested (III.-IV).

[0095] The biodistribution and tolerability of LTX401 were evaluated in the heart and liver tissues of non-human primates 90 days after intravenous administration. Figure 10A provides an assessment of LTX401 vector genome copies and FXN protein levels present in the heart and liver tissues of African green monkeys (AGM) treated with LTX401. Vector genomes were assessed by qPCR in the left ventricle (LV) of the heart and in pooled tissues from various lobes of the liver (A-I). For both the 1.5E13 and 3E13 IV doses, vector genomes were detected in the LV at <1 copy per diploid AGM genome. In the liver, vector genomes were detected at 2–36 copies per diploid genome. Quantification of total frataxin protein present in the same tissues was performed by ELISA (A-II). Compared to endogenous AGM levels, mean FXN overexpression in the LV was detected at 41.8% and 75.8% for the 1.5E13 and 3E3 vg / Kg doses, respectively. In contrast, no significant overexpression of FXN was detected in the liver at either dose.

[0096] Figure 10B shows the histology of the heart and liver of AGM treated with LTX 401. No test substance-related lesions were detected in hematoxylin-eosin-stained hearts (B-I) or livers (B-II) of AGM 90 days after IV administration of LTX 401 at either 1.5E13 or 3E13 vg / Kg doses. Human FXN RNA was detected in a dose-dependent manner in the hearts of AGM treated with LTX-401 (B-III). Green - hFXN in situ hybridization, red - wheat germ agglutinin, blue - DAPI.

[0097] In summary, studies in the MCK mouse model demonstrated that LTX401 exhibits robust yet safe cardiac biodistribution and efficacy when administered intravenously to the MCK mouse model of Friedreich's ataxia. LTX401 also exhibits tolerability and cardiac biodistribution after systemic delivery to non-human primates.

[0098] General Terms As used herein, the grammatical articles "a," "an," and "the" are intended to include "at least one" or "one or more," unless otherwise indicated, even if "at least one" or "one or more" is expressly used in specific instances. Accordingly, articles are used herein to refer to one or to more than one (i.e., "at least one") of the grammatical object of the article. Furthermore, unless the context of usage requires otherwise, the use of a singular noun includes the plural and the use of a plural noun includes the singular.

[0099] As used herein, the use of the terms "comprising," "including," or "having," and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof, as well as additional elements. Embodiments described as "comprising," "including," or "having" particular elements are also contemplated as "consisting essentially of" and "consisting of" those specific elements.

[0100] As used herein, the transitional phrase "consisting essentially of" (and grammatical variations) should be construed to encompass the recited materials or steps "and those that do not materially affect the basic and novel characteristic(s)" of the claimed invention. See In re Herz, 537 F.2d 549,551-52,190 USPQ 461,463 (CCPA 1976) (emphasis in original); see also MPEP § 2111.03. Accordingly, the term "consisting essentially of," as used herein, should not be construed as equivalent to "comprising."

[0101] The use of any examples or exemplary language (e.g., "such as") provided herein is merely to better illustrate the invention and does not limit the scope of the invention unless otherwise stated.

[0102] The terms "may," "may be," "can," and "can be," and related terms, unless the context clearly indicates otherwise, are intended to convey that the associated subject matter is optional (i.e., the subject matter is present in some instances and absent in others) and are not a reference to the subject matter's ability or probability.

[0103] "About" is used to provide flexibility in the endpoints of a numerical range by providing that a given value can be "slightly above" or "slightly below" the endpoints without affecting the desired result.

[0104] Any numerical range described herein describes all subranges of the same numerical precision (i.e., having the same number of specified digits) contained within the described range. For example, even if a range of "1.0 to 10.0" is not explicitly recited in the body of this specification, a recited range of "1.0 to 10.0" describes all subranges between (and including) the recited minimum value of 2.4 and the recited maximum value of 7.6, such as "2.4 to 7.6." Also, unless expressly specified or required by context, all numerical parameters described herein (such as those representing values, ranges, amounts, percentages, etc.) can be read as if preceded by the word "about," even if the word "about" does not explicitly appear before the number. "About" is used to provide flexibility in the endpoints of numerical ranges by providing that a given value can be "slightly above" or "slightly below" the endpoint without affecting the desired result.

[0105] Disclosed are materials, compositions, and components that can be used for, used in combination with, used in preparation for, or are products of the disclosed methods and compositions. When these and other materials are disclosed herein, and when combinations, subsets, interactions, groups, etc. of these materials are disclosed, it is understood that specific reference to the various individual and collective combinations and permutations of each of these compounds may not be explicitly disclosed, but each is specifically contemplated and described herein. For example, when a method is disclosed and discussed, and several modifications that can be made to several molecules included in the method are discussed, any and all combinations and permutations of the method and possible modifications are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of the present disclosure, including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are various additional steps that may be performed, it is understood that each of these additional steps may be performed with any particular method step or combination of method steps of the disclosed methods, and that each such combination or subset of combinations should be considered to be specifically contemplated and disclosed.

[0106] Publications cited herein and the material for which they are cited are specifically incorporated herein by reference in their entirety.

[0107] Additional arrays SEQ ID NO: 12 (ampicillin resistance gene) atgagtattc aacatttccg tgtcgccctt attccctttt ttgcggcatt ttgccttcct gtttttgctc acccagaaac gctggtgaaa gtaaaagatg ctgaagatca gttgggtgca cgagtgggtt acatcgaact ggatctcaac agcggtaaga tccttgagag ttttcgcccc gaagaacgtt ttccaatgat gagcacttt aaagttctgc tatgtggcgc ggtattatcc cgtattgacg ccgggcaaga gcaactcggt cgccgcatac actattctca gaatgacttg gttgagtact caccagtcac agaaaagcat cttacggatg gcatgacagt aagagaatta tgcagtgctg cataaccat gagtgataac actgcggcca acttacttct gacaacgatc ggaggaccga aggagctaac cgcttttttg cacaacatgg gggatcatgt aactcgcctt gatcgttggg aaccggagct gaatgaagcc ataccaaacg acgagcgtga caccacgatg cctgtagcaa tggcaacaac gttgcgcaaa ctattaactg gcgaactact tactctagct tcccggcaac attaataga ctggatggag gcggataaag ttgcaggacc acttctgcgc tcggcccttc cggctggctg gttattgct gataaatctg gagccggtga gcgtgggtct cgcggtatca ttgcagcact ggggccagat ggtaagccct cccgtatcgt agttatctac acgacggggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc

[0108] SEQ ID NO: 13 (kanamycin resistance gene) and gagccatatt caacgggaaa cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca ttccaggtat tagagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg cattctcac cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga attaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg cttttcaaa aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt ttttctaa

[0109] SEQ ID NO: 14 LTX401 ttacgattac cgttcatcgc cctgcgcgct cgctcgctca ctgaggccgc ccgggcaaag 60 cccgggcgtc gggcgacctt tggtcgcccg gcctcagtga gcgagcgagc gcgcagagag 120 ggagtggaat tcacgcgtgg taccgatctt accccctgcc ccccacagct cctctcctgt 180 gccttgtttc ccagccatgc gttctcctct ataaataccc gctctggtat ttggggttgg 240 cagctgttgc tgccagggag atggttgggt tgacatgcgg ctcctgacaa aacacaaacc 300 cctggtgtgt gtgggcgtgg gtggtgtgag tagggggatg aatcagggag ggggcggggg 360 acccaggggg caggagccac acaaagtctg tgcggggggtg ggagcgcaca tagcaattgg aaactgaaag cttatcagac cctttctgga aatcagccca ctgtttata acttgaggcc ccaccctcga throwcagg gctgaaagag gcccgcctgg gggctggaga catgcttgct 540 gcctgccctg gcgaaggatt ggcaggcttg cccgtcacag gaccccgct ggctgactca ggggcgcagg cctcttgcgg gggagctggc ctccccgccc ccccggccc gggccggccct 660 ttcctggcag gaccggga tcttgcagct gtcaggggag gggaggcgggg ggctgatgtc 720 aggaggata caaatagtgc cgacggctgg gggccctgca gtctcccttg ggtcaggggt 780 cctggttgca ctccgtgctt tgcacaaagc aggctctcca tttttgttaa atgcacgaat agtgctaagc tgggaagttc ttcctgaggt ctaacctcta gctgctcccc cacagaagag tgcctgcgcc agtggccacc aggggtcgcc gcagcaccca gcgctggagg gcggagcggg 960 cggcagaccc ggagcagcca ggtaagtatc aaagtatcaa ggttacaaga caggtttaag 1020 gagaccaata gaactgggc ttgtcgagac agagaagact cttgcgtttc tgataggcac 1080 ctattggtct tactgacatc cactttgcct ttctctccac aggctagcct tatcactagt 1140 gccaccatgt ggacactggg cagaagggca gtggctggcc tgctggcctc ccccagccct 1200 gcccaggccc agaccctgac cagagttccc aggcctgctg agctggcccc cctgtgtggc 1260 agaagaggcc tgagaagaga cattgatgcc acatgcaccc ctaggagagc cagcagcaac 1320 cagagaggcc tgaaccaaat ctggaatgtg 1380 agaaagtctg gcaccctggg ccaccctggc agcctggatg agaccaccta tgagagactg 1440 gctgaaa ccctggacag cctggctgaa ttctttgagg acctggctga caagccttac 1500 acctttgagg actatgatgt gagctttggc agtggagtgc tgacagtgaa actgggaga 1560 gacctgggca cctatgtgat acaagcag acaccaaa aacagatctg gctgagcagc 1620 cctagctctg gcccaaagag atatgactgg acaggcaaga actgggtcta cagccatgat 1680 ggagtgtccc tccatgaact cctggctgca gagctgacca aggccctgaa gaccaagctg 1740 gacctgagca gcctggccta ctctggcaag gatgcctagt ctagactgtg ccttctagtt 1800 gccagccatc tgttgtttgc ccctcccccc tgccttcctt gaccctggaa ggtgccactc 1860 ccactgtcct ttcctaataa aatgaggaaa ttgcatggca ttgtctgagt aggtgtcatt 1920 ctattctggg gggtggggtg gggcaggaca gcaaggggga ggattgggaa gacaatagca 1980 ggcatgctgg ggagagatcg atctgaggaa cccctagtga tggagttggc cactccctct 2040 ctgcgcgctc gctcgctcac tgaggccggg cgaccaaagg tcgcccgacg cccgggcttt 2100 gcccgggcgg cctcagtgag cgagcgagcg cgcagagagg gagtggcccc cccccccccc 2160 cccccggcga ttctcttgtt tgctccagac tctcaggcaa tgacctgata gcctttgtag 2220 agacctctca aaaatagcta ccctctccgg catgaattta tcagctagaa cggttgaata 2280 tcatattgat ggtgatttga ctgtctccgg cctttctcac ccgtttgaat ctttacctac 2340 acattactca ggcattgcat ttaaaatata tgagggttct aaaaattttt atccttgcgt 2400 tgaaataaag gcttctcccg caaaagtatt acagggtcat aatgtttttg gtacaaccga 2460 tttagcttta tgctctgagg ctttattgct taattttgct aattctttgc cttgcctgta 2520 tgatttattg gatgttggaa tcgcctgatg cggtattttc tccttacgca tctgtgcggt 2580 atttcacacc gcatatggtg cactctcagt acaatctgct ctgatgccgc atagttaagc 2640 cagccccgac acccgccaac actatggtgc actctcagta caatctgctc tgatgccgca 2700 tagttaagcc agccccgaca cccgccaaca cccgctgacg cgccctgacg ggcttgtctg 2760 ctcccggcat ccgcttacag acaagctgtg accgtctccg ggagctgcat gtgtcagagg 2820 ttttcaccgt catcaccgaa acgcgcgaga cgaaagggcc tcgtgatacg cctattttta 2880 taggttaatg tcatgataat aatggtttct tagacgtcag gtggcacttt tcggggaaat 2940 gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta tccgctcatg 3000 agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagccatatt 3060 caacgggaaa cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat 3120 aaatgggctc gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag 3180 cccgatgcgc cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca 3240 gatgagatgg tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat 3300 tttatccgta ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca 3360 ttccaggtat tagagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg 3420 ttcctgcgcc ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta 3480 tttcgtctcg ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgattttt 3540 gatgacgagc gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg 3600 cattctcac cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt 3660 gacgagggga attaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac 3720 caggatcttg ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg 3780 cttttcaaa aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg 3840 ctcgatgagt ttttctaatc agaattggtt aattggttgt aacattattc agattgggct 3900 tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct 3960 catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 4020 gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 4080 aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 4140 gaaggtaact ggcttcagca gagcgcagat accaaatact gttcttctag tgtagccgta 4200 gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 4260 gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 4320 atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 4380 cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 4440 cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 4500 agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 4560 tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 4620 gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 4680 catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg 4740 agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc 4800 ggaagagcgc ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag 4860 ctggcgtaat agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa 4920 tggcgaatgg cgattccgtt gcaatggctg gcggtaatat tgttctggatattacco 4980 aggccgatag tttgagttct tctactcagg caagtgatgt tattactaat caaagaagta 5040 ttgcgacaac ggttaatttg cgtgatggac agactctttt actcggtggc ctcactgatt 5100 ataaaaacac ttctcaggat tctggcgtac cgttcctgtc taaaatccct ttaatcggcc 5160 tcctgtttag ctcccgctct gattctaacg aggaaagcac gttatacgtg ctcgtcaaag 5220 caaccatagt acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc 5280 agcgtgaccg ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc 5340 tttctcgcca cgttcgccgg ctttccccgt caagctctaa atcgggggct ccctttaggg 5400 ttccgattta gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca 5460 cgtagtgggc catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc 5520 tttaatagtg gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct 5580 tttgatttat aagggatttt gccgatttcg gcctattggt taaaaaatga gctgatttaa 5640 caaaaattta acgcgaattt taacaaaata ttaacgctta caatttaaat atttgcttat 5700 acaatcttcc tgtttttggg gcttttctga ttatcaaccg gggtacatat gattgacatg 5760 ctagtt

[0110] SEQ ID NO: 15 (LTX401)

[0111] SEQ ID NO: 16 (human frataxin promoter) aaaaaactt tcacaatttg catccctttg Attctctttt 60 aaaatctatc aacaataggc aaggcacggt ggctcacgcc tgtcgtctca gcactttgtg 120 aggcccaggc gggcagatcg tttgagccta 180 gaaaccccct ttctacaaaa aatacaaaaa ctagctgggt gtggtggtgc acacctgtag 240 tcccagctac ttgggaaggct gaaatgggaa gactgcttga gcccgggagg gagaagttgc 300 agtaagccag gaccacacca ctgcactcca gcctgggcaa cagagtgaga ctctgtctca 360 aacaaacaaa taaatgaggc gggtggatca cgaggtcagt agatcgagac catcctggct 420 aacacggtga aacccgtctc tactaaaaa aaaaaaaaat acaaaaaatt agccaggcat 480 ggtggcgggc gcctgtagtc ccagttactc gggaggctga ggcaggagaa tggcgtgaaa 540 ccgggaggca gagcttgcag tgagccgaga tcgcaccact gccctccagc ctgggcgaca 600 gagcgagact ccgtctcaat caatcaatca atcaataaaa tctattaaca atatttattg 660 tgcacttaac aggaacatgc cctgtccaaa aaaaacttta cagggcttaa ctcattttat 720 ccttaccaca atcctatgaa gtaggaactt ttataaaacg cattttataa acaaggcaca 780 gagaggttaa ttaacttgcc ctctggtcac acagctagga agtgggcaga gtacagattt 840 acacaaggca tccgtctcct ggccccacat acccaactgc tgtaaaccca taccggcggc 900 caagcagcct caatttgtgc atgcacccac ttcccagcaa gacagcagct cccaagttcc 960 tcctgtttag aattttagaa gcggcgggcc accaggctgc agtctccctt gggtcagggg 1020 tcctggttgc actccgtgct ttgcacaaag caggctctcc atttttgtta aatgcacgaa 1080 tagtgctaag ctgggaagtt cttcctgagg tctaacctct agctgctccc ccacagaaga 1140 gtgcctgcgg ccagtggcca ccaggggtcg ccgcagcacc cagcgctgga gggcggagcg 1200 ggcggcagac ccggagcagc 1220

[0112] SEQ ID NO: 17 (human frataxin promoter) aaaaaactt tcacaatttg catccctttg Attctctttt 60 aaaatctatc aacaataggc aaggcacggt ggctcacgcc tgtcgtctca gcactttgtg 120 aggcccaggc gggcagatcg tttgagccta 180 gaaaccccct ttctacaaaa aatacaaaaa ctagctgggt gtggtggtgc acacctgtag 240 tcccagctac ttgggaaggct gaaatgggaa gactgcttga gcccgggagg gagaagttgc 300 agtaagccag gaccacacca ctgcactcca gcctgggcaa cagagtgaga ctctgtctca 360 aacaaacaaa taaatgaggc gggtggatca cgaggtcagt agatcgagac catcctggct 420 aacacggtga aacccgtctc tactaaaaa aaaaaaaaat acaaaaaatt agccaggcat 480 ggtggcgggc gcctgtagtc ccagttactc gggaggctga ggcaggagaa tggcgtgaaa 540 ccgggaggca gagcttgcag tgagccgaga tcgcaccact gccctccagc ctgggcgaca 600 gagcgagact ccgtctcaat caatcaatca atcaataaaa tctattaaca atatttattg 660 tgcacttaac aggaacatgc cctgtccaaa aaaaacttta cagggcttaa ctcattttat 720 ccttaccaca atcctatgaa gtaggaactt ttataaaacg cattttataa acaaggcaca 780 gagaggttaa ttaacttgcc ctctggtcac acagctagga agtgggcaga gtacagattt 840 acacaaggca tccgtctcct ggccccacat acccaactgc tgtaaaccca taccggcggc 900 caagcagcct caatttgtgc atgcacccac ttcccagcaa gacagcagct cccaagttcc 960 tcctgtttag aattttagaa gcggcgggcc accaggctg 999

[0113] SEQ ID NO: 18 (3'UTR frataxin promoter) actagtgcca ccatgtggac actggggaga agggccgtgg ctggactgct ggcttctcca 60 tctccagccc aggcccagac cctgaccaga gtgcctagac ctgccgaact ggcccctctg 120 tgtggcagaa gaggcctgag aaccgacatc gacgccacct gtacccccag aagggccagc 180 agcaatcagc ggggcctgaa tcagatctgg aacgtgaaga aacagagcgt gtacctgatg 240 aacctgagaa agagcggcac cctgggccac cctggaagcc tggatgagac aacctacgag 300 cggctggccg aggaaaccct ggattccctg gccgagttct tcgaggacct ggccgacaag 360 ccctacacct tcgaggatta cgacgtgtcc ttcggcagcg gcgtgctgac agtgaagctg 420 ggcggagatc tgggcaccta cgtgatcaac aagcagaccc ccaacaaaca gatctggctg 480 agcagcccca gcagcggccc caagagatac gattggaccg gcaagaactg ggtgttcagc 540 cacgacggcg tgtccctgca tgagctgctg gctgccgagc tgaccaaggc cctgaaaaca 600 aagctgggacc tgagctggct ggcctacagc ggcaaagatg ccatcgatat ccccagcccc 660 gtttaagga cattaaaagc tatcaggcca agaccccagc ttcattatgc agctgaggtc 720 tgttttttgt tgttgttgtt gtttattttt tttattcctg cttttgagga cagttgggct 780 atgtgtcaca gctctgtaga aagaatgtgt tgcctcctac cttgccccca agttctgatt 840 tttaatttct atggaagatt ttttggattg tcggatttcc tccctcacat gatacccctt 900 atcttttata atgtcttatg cctatacctg aatataacaa cctttaaaaa agcaaaataa 960 taagaaggaa aaattccagg agggaaaatg aattgtcttc actcttcatt ctttgaagga 1020 tttactgcaa gagatcatg aagagcagct ggtcaacctg ctcactgttc tatctccaaa 1080 tgagacacat taaagggtag cctacaaatg ttttcaggct tctttcaaag tgtaagcact 1140 tctgagctct ttagcattga agtgtcgaaa gcaactcaca cgggaagaatc atttcttatt 1200 tgtgctctgt gactgccaag gtgtggcctg cactgggttg tccagggaga catgcatcta 1260 gtgctgtttc tcccacatat tcacatacgt gtctgtgtgt atatatattt tttcaattta 1320 aaggttagta tggaatcagc tgctacaaga atgcaaaaaa tcttccaaag acaagaaaag 1380 aggaaaaaaa gccgttttca tgagctgagt gatgtagcgt aacaaacaaa atcatggagc 1440 tgaggggtg ccttgtaaac atgaaggggc 1500 catgttgatact aagagagccc tggtcctaga catagttcag ccacaaagta gttgtccctt tgtggacaag 1560 tttcccaaat tccctggacc tctgcttccc catctgttaa atgagagaat agagtatggt tgattcccag cattcagtgg tcctgtcaag ggctagttct aattccctat tgggtagtg aggggatgac aaagaacagt ttttaagcta tataggaac attgttattg gtgttgccct atcgtgattt cagttgatt catgtgaaaa taatagccat ccttggcctg gcgcggtggc tcacacctgt aatcccagca cttttggagg ccaaggttggg tggatcacct 1860. gaggtcagga gttcaagacc agcctggcca acatgatga accccgtctc tactaaaat acaaaaaatt agccgggcat gatggcaggt gcctgtaatc ccagctactt gggaggctga agcggaga tcgcttgac ccagaggtgg aggttgcagt gagccgagat cgtgccattg cactgtaacc tgggtgactg agcaaaactc tgtctcaaaa fatherac father tataatagc catcctttat tgtaccctta ctgggttaat cgtattatac cacattacct 2160 cattttaatt tttactgacc tgcactttat acaaagcaac aagcctccag gacattaaaa 2220 ttcatgcaaa gttatgctca tgttatatta ttttcttact taaagaagga tttattagtg 2280 gctgggcatg gtggcgtgca cctgtaatcc caggtactca ggaggctgag acggggagaat 2340 tgcttgaccc caggcggagg aggttacagt gagtcgagat cgtacctgag cgacagagcg 2400 agactccgtc tcaaaaaaaa aaaaaaggag ggtttattaa tgagaagtttt ggtcgac 2457

[0114] SEQ ID NO: 19 (3'UTR frataxin promoter) aagaaggaaa aattccagga gggaaaatga attgcttca ctcttcattc tttgaaggat 60 ttactgcaag aagtacatga agagcagctg gtcaacctgc tcactgttct atctccaaat 120 gagacacatt aaagggtagc ctacaaatgt tttcaggctt cttcaaagt gtaagcactt 180 ctgagctctt tagcattgaa gtgtcgaaag caactcacac gggaagatca tttcttattt 240 gtgctctgtg actgccaagg tgtggcctgc actgggttgt ccagggagac atgcatctag 300 tgctgtttct cccadatat defectacgtg tctgtgtgta tatatatttt ttcaatttaa 360 aggttagtat ggaatcagct gctacaagaa tgcaaaaaat cttccaaaga caagaaaaga 420 ggaaaaaaag ccgttttcat gagctgagtg atgtagcgta acaaacaaaa tcatggagct 480 gaggaggtgc cttgtaaaca tgaaggggca gataaaggaa ggagatactc atgttgataa 540 agagagccct ggtcctagac atagttcagc cacaaagtag ttgtcccttt gtggacaagt 600 ttcccaaatt ccctggacct ctgcttcccc atctgttaaa tgagagaata gagtatggtt 660 gattcccagc attcagtggt cctgtcaagc aacctaacag gctagttcta attccctatt 720 gggtagatga ggggatgaca aagaacagtt tttaagctat ataggaaaca ttgttattgg 780 tgttgcccta tcgtgatttc agttgaattc atgtgaaaat aatagccatc cttggcctgg 840 cgcggtggct cacacctgta atcccagcac ttttggaggc caaggtgggt ggatcacctg 900 aggtcaggag ttcaagacca gcctggccaa catgatgaaa ccccgtctct actaaaaata 960 caaaaaatta gccgggcatg atggcaggtg cctgtaatcc cagctacttg ggaggctgaa 1020 gcggaagaat cgcttgaacc cagaggtgga ggttgcagtg agccgagatc gtgccattgc 1080 actgtaacct gggtgactga gcaaaactct gtctcaaaat aataataaca atataataat 1140 aataatagcc atcctttatt gtacccttac tgggttaatc gtattatacc acattacctc 1200 attttaattt ttactgacct gcactttata caaagcaaca agcctccagg acattaaaat 1260 tcatgcaaag ttatgctcat gttatattat tttcttactt aaagaaggat ttattagtgg 1320 ctgggcatgg tggcgtgcac ctgtaatccc aggtactcag gaggctgaga cgggagaatt 1380 gcttgacccc aggcggagga ggttacagtg agtcgagatc gtacctgagc gacagagcga 1440 gactccgtct caaaaaaaaa aaaaaggagg gtttattaat gagaagtttg 1490

[0115] SEQ ID NO: 20 (AAV2 ITR) TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC

[0116] SEQ ID NO: 21 (alternative 5'UTR Frataxin) TGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCC

Claims

1. In the following order: (a) a nucleic acid sequence comprising an RNA polymerase II promoter; (b) a nucleic acid sequence comprising the 5'UTR FXN; (c) an intron; and (d) a nucleic acid sequence encoding human FXN, wherein the RNA polymerase II promoter is operably linked to the 5'UTR FXN and the nucleic acid sequence encoding human FXN; A recombinant viral AAV7 vector comprising: The vector is a recombinant viral AAV7 vector flanked on each side by AAV2 inverted terminal repeats.

2. 2. The recombinant AAV7 vector of claim 1, wherein the RNA polymerase II promoter is a desmin promoter.

3. 3. The recombinant AAV7 vector of claim 1 or 2, wherein the human FXN comprises SEQ ID NO:

1.

4. 4. The recombinant AAV7 vector of claim 3, wherein the human FXN is encoded by a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

3.

5. 5. The recombinant AAV7 vector of any one of claims 1 to 4, wherein the 5'UTR FXN comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:2 or SEQ ID NO:

4.

6. 6. The recombinant AAV7 vector of any one of claims 1 to 5, wherein the intron comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

5.

7. The recombinant AAV7 vector of any one of claims 2 to 6, wherein the desmin promoter comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

6.

8. The recombinant AAV7 vector according to any one of claims 1 to 7, wherein the recombinant AAV7 vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence.

9. 9. The recombinant AAV7 vector of claim 8, wherein the nucleic acid sequence encoding the polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

7.

10. 10. The recombinant AAV7 vector of any one of claims 1 to 9, wherein the recombinant AAV7 vector comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:14 or SEQ ID NO:

15.

11. 11. The recombinant AAV7 vector of any one of claims 1 to 10, wherein the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO:6; (b) a 5'UTR FXN comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO:2 or SEQ ID NO:4; (c) an intron comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO:5; and (d) a nucleic acid sequence comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO:

3.

12. 12. The recombinant AAV7 vector of any one of claims 1 to 11, wherein the recombinant AAV7 vector comprises, in the following order: (a) a desmin promoter comprising SEQ ID NO:6; (b) a 5'UTR FXN comprising SEQ ID NO:2 or SEQ ID NO:4; (c) an intron comprising SEQ ID NO:5; and (d) a nucleic acid sequence comprising SEQ ID NO:

3.

13. The recombinant AAV7 vector of any one of claims 1 to 12, wherein the vector further comprises (e) a nucleic acid sequence encoding a polyadenylation sequence.

14. 14. The recombinant AAV7 vector of claim 13, wherein the nucleic acid sequence encoding the polyadenylation sequence comprises a nucleic acid sequence having at least 85%, 90%, 95%, or 99% identity to SEQ ID NO:

7.

15. The recombinant AAV7 vector of any one of claims 1 to 14, wherein the recombinant AAV7 vector comprises SEQ ID NO: 14 or SEQ ID NO:

15.

16. 16. The recombinant AAV7 vector of any one of claims 1 to 15, wherein the vector is flanked on each side by an AAV2 inverted terminal repeat comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO:8 or SEQ ID NO:20, or a reverse complement of an AAV2 inverted terminal repeat comprising a nucleic acid sequence having at least 85% identity to SEQ ID NO:8 or SEQ ID NO:

20.

17. A recombinant AAV7 particle comprising the recombinant AAV7 vector of any one of claims 1 to 16.

18. The recombinant AAV7 particle of claim 17, wherein the AAV7 particle comprises an AAV7 capsid protein.

19. A pharmaceutical composition comprising the recombinant AAV7 particles described in claim 17 or 18.

20. 20. A method for regulating frataxin expression in a cell, comprising introducing into the cell: (a) a recombinant AAV7 vector described in any one of claims 1 to 16; (b) a recombinant AAV7 particle described in claim 17 or 18; or (c) a pharmaceutical composition described in claim 19.

21. 21. The method of claim 20, wherein the cell is an in vitro cell, an in vivo cell, or an ex vivo cell.

22. 22. The method of claim 20 or 21, wherein the cell comprises a mutated frataxin gene containing a GAA repeat.

23. 23. The method of claim 22, wherein the cell is in a subject.

24. A method for treating a patient with Friedreich's ataxia (FA), comprising administering to the patient a therapeutically effective amount of a recombinant AAV7 particle described in claim 17 or 18.

25. 25. The method of claim 24, wherein the recombinant AAV7 particles are administered intravenously, intracerebroventricularly, or intracerebral parenchyma.

26. 26. The method of claim 25, wherein the recombinant AAV7 particles are administered intracerebroventricularly and intraparenchymally.

Images