NLRP12 and NLRC5 modulators and methods of using them to modulate disease

Heme and PAMPs/DAMPs activate NLRP12 and NLRC5 for targeted inflammatory cell death, addressing unclear activation roles and reducing inflammation in diseases.

JP2025540914APending Publication Date: 2025-12-17ST JUDE CHILDRENS RES HOSPITAL INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025526249
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-05-11
Filing Date
2023-10-26
Publication Date
2025-12-17

AI Technical Summary

Technical Problem

The roles and specific triggers for activation of NLRP12 and NLRC5, key cytoplasmic innate immune sensors, in inflammasome activation and inflammatory cell death remain unclear, leading to unaddressed pathogenic inflammation and excessive cytokine storms in infectious and inflammatory diseases.

Method used

A composition comprising heme and pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs) is used to induce or activate NLRP12 and NLRC5, promoting inflammatory cell death, while inhibitors targeting these sensors can mitigate excessive inflammation.

Benefits of technology

This approach effectively activates NLRP12 and NLRC5 to clear infections and damaged cells, while inhibiting their activation reduces inflammation in hemolytic diseases and cancer, offering therapeutic benefits.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025540914000001_ABST
    Figure 2025540914000001_ABST
Patent Text Reader

Abstract

Disclosed are compositions and methods for activating NLRP12 and / or NLRC5 and inflammatory cell death using heme and at least one PAMP and / or DAMP molecule.Also provided are screening assays for identifying NLRP12 and / or NLRC5 inhibitors, and the use of such inhibitors in treating or alleviating NLRP12-mediated or NLRC5-mediated inflammation associated with hemolytic disease, infectious disease, cancer, or inflammatory syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] introduction This application claims the benefit of U.S. Provisional Patent Application No. 63 / 422,601, filed November 4, 2022, and U.S. Provisional Patent Application No. 63 / 501,430, filed May 11, 2023, the contents of which are incorporated herein by reference in their entireties.

[0002] This invention was made with government support under Grant Nos. AI101935, AI124346, AI160179, AR056296, and CA253095 awarded by the National Institutes of Health. The government has certain rights in this invention.

[0003] Statement Regarding Electronic Submission of Sequence Listings A sequence listing in XML text format (6,280 bytes in size) submitted under 37 CFR § 1.821-1.834 and titled "SJ0105WO_ST26" was generated on September 18, 2023, submitted via EFS-Web, and provided in lieu of a paper copy. This sequence listing is incorporated herein by reference. [Background technology]

[0004] background Innate immune sensors called pattern recognition receptors (PRRs) play a critical role in protecting the host from invading pathogens. Each sensor recognizes specific pathogen-associated molecular patterns (PAMPs) or endogenous damage-associated molecular patterns (DAMPs), which encompass cellular components such as proteins, nucleic acids, or lipids, as well as cytokines and alarmins, and activates cognate innate immune signaling pathways, including the nuclear factor κB (NF-κB), mitogen-activated protein kinase (MAPK), and type I interferon (IFN) pathways. One subfamily of cytoplasmic PRRs, called nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs), plays diverse roles in activating inflammasomes and cell death, as well as inflammation. While some NLRs are relatively well characterized, little is known about the functions of many other sensors in this family.

[0005] Although the involvement of PRRs, including NLRs, is often beneficial and can reduce pathogen burden in infected hosts, excessive activation can lead to pathogenic inflammation, cytokine storms, tissue damage, and DAMP release. Together, PAMPs and DAMPs released during infection and inflammatory conditions can further induce multiple organ dysfunction and death. However, the innate immune sensors involved in detecting the collective release of PAMPs and DAMPs and their role in activating inflammasomes and inflammatory cell death to contribute to disease pathogenesis remain to be fully elucidated.

[0006] NLR family pyrin domain-containing 12 (NLRP12, also known as RNO, NALP12, PYPAF7, and Monarch-1) is a pyrin-containing NLR protein. Human NLRP12 is primarily expressed in myeloid cells, such as neutrophils, eosinophils, monocytes, macrophages, and immature dendritic cells. Mutations in the NLRP12 gene have been associated with a type of autoinflammatory syndrome called NLRP12AD, which encompasses some forms of familial cold autoinflammatory syndrome (Jeru et al. (2008) Proc. Natl. Acad. Sci. USA 105:1614-1619). Research has shown that the nonsense mutation p.Arg284X located within the NBD of NLRP12 is less effective at suppressing NF-κB activity compared to wild-type NLRP12 (Borghini et al. (2011) Arthritis Rheum. 63:830-839). Concomitant with the loss of proinflammatory function, the splicing defect-generating insertion also leads to a significant reduction in the inhibitory properties of NLRP12 against NF-κB signaling. However, in contrast to these findings, the missense mutation p.Asp294Glu, located within the evolutionarily conserved NBD, is associated with increased caspase-1 activation rather than inhibition of NF-κB signaling (Jeru et al. (2011) Arthritis Rheum. 63, 1459-1464).

[0007] NLRP12 has also been implicated as an inflammasome component that recognizes Yersinia pestis, the causative agent of the plague. - / - Mice suffered from increased mortality and bacterial burden after infection with Y. pestis, where the NLRP12 inflammasome was shown to be a central regulator of IL-18 and IL-1β production through activation of caspase-1. Furthermore, NLRP12 also induces IFN-γ production via IL-18, whereas NLRP12 - / -had little effect on NF-κB signaling after infection with Y. pestis strains (Vladimer et al. (2012) Immunity 37:96-107). Furthermore, the presence of NLRP3 and NLRP12 in monocytes from malaria patients and in the inflammasome complex in mouse models has led to the suggestion that NLRP3 / NLRP12-dependent caspase-1 activation is likely a key event in regulating systemic IL-1β expression and mediating hypersensitivity to secondary bacterial infection in malaria patients (Ataide et al. (2014) PLoS Pathog. 10:e1003885). However, the specific ligands that activate NLRP12 and the downstream signaling pathways involved in these situations remain unknown.

[0008] Similar to NLRP12, NLR family caspase activation and recruitment domain-containing 5 (NLRC5, also known as NOD27 and CLR16.1) is also an NLR protein. Human NLRC5 is expressed in many cell lineages, including immune cells (T cells, B cells, and myeloid cells) as well as microglial cells, gastric secretory cells, and adipocytes. Missense mutations in human NLRC5 have been associated with neurological conditions, including schizophrenia and amyotrophic lateral sclerosis. However, the causative role of these mutations remains unclear. NLRC5 is primarily known for its role as a transcriptional regulator of MHC-I expression. Contrasting functions for NLRC5 in inflammation have been reported. Under some conditions, NLRC5 is thought to negatively regulate inflammation by reducing NF-κB and type I IFN signaling (Cui et al. (2010) Cell 141:483-496), whereas under other conditions, NLRC5 contributes to inflammation by promoting NLRP3 inflammasome activation and cytokine release (Davis et al. (2011) J. Immunol. 186:1333-1337; Kumar et al. (2011) J. Immunol. 186:994-1000). However, each of these phenotypes is only observed in specific cell types and under specific conditions. Overall, the function of NLRC5 and its role in inflammation remain unclear. Summary of the Invention

[0009] Summary of the Invention The present invention provides a composition for inducing or activating the production of NLRP12 or NLRC5, the composition comprising heme and at least one PAMP molecule and / or DAMP molecule. In a specific aspect, the at least one PAMP molecule is selected from the group consisting of triacylated lipoprotein, lipoteichoic acid, peptidoglycan, porin, zymosan, Pam3CSK4, diacylated lipopeptide, dsRNA, polyadenylated-polyuridylic acid, polyinosinic:polycytidylic acid, lipopolysaccharide, flagellin, single-stranded RNA, CpGA, polyG10, polyG3, CpG oligonucleotide, PamCysPamSK4, Toxoplasma gondii profilin, double-stranded RNA, 5'ppp-dsRNA, phosphorylcholine, lipoarabinomannan, mycolic acid, β-1,3-glucan, N-formylmethionine, mannose-rich glycan, CL307, imiquimod, gardiquimod, resiquimod, motolimod, UC-IV150, EMD120108, IMO-2125, VTS-1463GS-9620, GSK2245035, TMX-101, TMX-201, TMX-202, isatoribine, AZD8848, MEDI9197, 3M-051, 3M-852, 3M-854A, S-34240, KU34B, CL663, SB9200, SB11285, or 8-substituted 2-amino-3H-benzo[b]azepine-4-carbozamide. In other aspects, the at least one DAMP molecule is a heme metabolite, such as tumor necrosis factor alpha or biliverdin. Pharmaceutical compositions including heme and at least one PAMP and / or DAMP molecule in admixture with a pharmaceutically acceptable carrier, excipient, vehicle, diluent, or preservative are also provided.

[0010] The present invention also includes methods of inducing inflammatory cell death and treating cancer or other diseases or conditions that would benefit from inflammatory cell death by administering heme and at least one PAMP and / or DAMP molecule to a subject in need of such treatment. In some aspects, the other disease or condition is an infectious disease, a proliferative condition, or a condition involving damaged cells.

[0011] Further provided is a method for treating or alleviating NLRP12- or NLRC5-mediated inflammation associated with hemolytic disease, infection, inflammatory syndrome, or cancer in a subject in need thereof by administering to the subject an effective amount of an inhibitor of NLRP12 or NLRC5 activation. In some aspects, the inhibitor of NLRP12 or NLRC5 production is a small molecule, peptide, antisense oligonucleotide, guide RNA, shRNA, antibody, or antibody fragment that targets upstream regulatory molecules of NLRP12 or NLRC5, including, for example, Toll-like receptors (TLRs), reactive oxygen species (ROS), the nicotinamide pathway, and / or interferon regulatory factors (IRFs). In another aspect, the inhibitor of NLRP12 or NLRC5 activation is a small molecule, peptide, antisense oligonucleotide, guide RNA, shRNA, antibody, or antibody fragment that directly inhibits NLRP12 or NLRC5 activation (e.g., directly interacts with NLRP12 or NLRC5 or a nucleic acid encoding NLRP12 or NLRC5). In another aspect, the hemolytic disease is beta-thalassemia, hemolytic anemia, or sickle cell disease; the infectious disease is SARS-CoV-2, malaria, influenza, or pneumonia; and the inflammatory syndrome is neuroinflammatory or systemic inflammatory response syndrome.

[0012] Also provided is a method for identifying an agent that inhibits the activation of NLRP12-dependent or NLRC5-dependent inflammasomes and inflammatory signal transduction and inflammatory cell death.The present invention relates to the steps of (a) contacting a cell sample with heme and at least one PAMP or DAMP molecule to induce or activate the production of NLRP12 or NLRC5; and (b) contacting the cell sample of (a) with at least one test agent, wherein a decrease in the production or activation of NLRP12 or NLRC5 in the presence of the test agent compared to the production or activation of NLRP12 or NLRC5 in the absence of the test agent indicates an agent that inhibits the activation of NLRP12-dependent or NLRC5-dependent inflammasomes and inflammatory signal transduction and inflammatory cell death. In some aspects, NLRP12 or NLRC5 production or activation is determined by measuring the amount of NLRP12 or NLRC5 mRNA or protein; cleavage of one or more of gasdermin D, gasdermin E, caspase-1, caspase-8, caspase-3, and caspase-7; phosphorylation of mixed lineage kinase domain-like protein; cell death; or release of IL-1β or IL-18 by cells of the sample. [Brief explanation of the drawings]

[0013] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1] Figure 1 shows quantification of cell death in wild-type (WT) bone marrow-derived macrophages (BMDMs) after 48 hours of treatment with medium or Pam3CSK4 (Pam3) plus LPS, poly(I:C), or R848; or LPS plus poly(I:C) or R848; or poly(I:C) plus R848. Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using one-way ANOVA. Data are presented as mean ± SEM.

[0014] [Figure 2]Figure 2 shows quantification of cell death in WT BMDMs treated with HMGB1, MSU, heme, or S100A8 / A9 in combination with PAMPs for 48 hours. Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using one-way ANOVA. Data are presented as mean ± SEM.

[0015] [Figure 3] Figure 3 shows quantification of cell death in WT and Nlrp12- / - bone marrow-derived macrophages (BMDMs) treated with heme and Pam3, heme and LPS, or heme and R848 for 36 hours, or heme and TNF-α for 48 hours. Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using an unpaired t-test. Data are presented as mean ± SEM.

[0016] [Figure 4] Figure 4 shows quantification of cell death in WT and Nlrc5- / - bone marrow-derived macrophages (BMDMs) treated with heme and Pam3, heme and LPS, or heme and TNF-α for 48 hours. Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using an unpaired t-test. Data are presented as mean ± SEM.

[0017] [Figure 5] Figure 5 shows quantification of cell death in WT and Casp1- / -Casp8- / -Ripk3- / - (TKO) bone marrow-derived macrophages (BMDMs) stimulated with heme and Pam3 or heme and LPS for 36 hours. Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using an unpaired t-test. Data are shown as mean ± SEM.

[0018] [Figure 6]Figure 6 shows quantification of ASC specks in WT and Nlrp12- / - BMDMs treated with heme and Pam3 for 36 hours. Unstimulated WT BMDMs were used as mock controls. Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using one-way ANOVA. Data are presented as mean ± SEM.

[0019] [Figure 7] Figure 7 shows measurements of IL-1β and IL-18 release from supernatants of WT and Nlrp12- / - BMDMs treated with heme and Pam3 for 42 hours. Data are representative of at least three independent experiments. *P < 0.05. Analysis was performed using an unpaired t-test. Data are presented as mean ± SEM.

[0020] [Figure 8] Figure 8 shows the relative expression of Nlrp12 and Nlrc5 mRNA in WT BMDMs treated with medium, heme, Pam3, or a combination of heme and Pam3 for 36 hours. Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using one-way ANOVA. Data are presented as mean ± SEM.

[0021] [Figure 9] Figure 9 shows serum BUN release in WT mice injected with PBS (n = 5), LPS (n = 5), phenylhydrazine (PHZ; n = 6), or LPS and PHZ (n = 6). Data are representative of at least three independent experiments. ****P < 0.0001. Analysis was performed using one-way ANOVA. Data are presented as mean ± SEM.

[0022] [Figure 10]Figure 10 shows serum creatinine release in WT and Nlrp12- / - or Nlrc5- / - mice injected with PBS or LPS plus PHZ (WT PBS, n = 5-9; WT LPS + PHZ, n = 8-17; Nlrp12- / - LPS + PHZ, n = 7; Nlrc5- / - LPS + PHZ, n = 18). Data are representative of at least three independent experiments. *P < 0.05, ****P < 0.0001. Analysis was performed using one-way ANOVA. Data are presented as mean ± SEM.

[0023] [Figure 11] Figure 11 shows survival in WT, Nlrp12- / -, and Nlrc5- / - mice injected with LPS and PHZ. Data are representative of at least three independent experiments. **P < 0.01, ****P < 0.0001. Analysis was performed using the log-rank test (Mantel-Cox test).

[0024] [Figure 12] Figure 12 shows the survival rates of WT and Nlrp12- / -Nlrc5- / - mice infected with Plasmodium berghei ANKA (1 x 105 infected erythrocytes). ****P < 0.0001. Analysis was performed using the log-rank test (Mantel-Cox test).

[0025] [Figure 13A] 13A-13B show NLRP12-mediated activation of cell death and inflammation (FIG. 13A) and NLRC5-mediated activation of cell death and inflammation (FIG. 13B). [Figure 13B] 13A-13B show NLRP12-mediated activation of cell death and inflammation (FIG. 13A) and NLRC5-mediated activation of cell death and inflammation (FIG. 13B). DETAILED DESCRIPTION OF THE INVENTION

[0026] Detailed Description of the Invention Innate immunity provides the first line of defense against infection and sterile injury. Innate immune sensors are critical for assembling cytoplasmic protein complexes, such as inflammasomes, which induce inflammation and inflammatory cell death to clear infectious agents and alert the broader immune system. The cytoplasmic innate immune sensors, NLRP12 and NLRC5, have been implicated in several infectious diseases and inflammatory diseases. However, their role in inflammasome activation and inflammatory cell death, as well as the specific triggers that activate them, remain unclear.

[0027] We now know that both NLRP12 and NLRC5 activate caspase-1, driving IL-1β and IL-18 maturation and inducing inflammatory cell death through the caspase-1 / caspase-8 / RIPK3 axis (Figures 13A-13B). In particular, we observed that a composition consisting of heme plus PAMPs or DAMPs mimics infection and induces inflammatory cell death. We also demonstrated that NLRP12 and NLRC5 are innate immune cytosolic sensors that respond to heme and PAMPs or DAMPs to activate inflammasomes and induce inflammatory cell death. In patients, NLRP12 was highly upregulated across multiple infectious and inflammatory conditions, including SARS-CoV-2, influenza, pneumonia, systemic inflammatory response syndrome (SIRS), and hemolytic disease. Furthermore, deletion of Nlrp12 or Nlrc5 significantly reduced mouse mortality in a hemolytic model, and combined deletion of Nlrp12 and Nlrc5 significantly reduced mouse mortality in a hemolytic infection model. Overall, these findings suggest that NLRP12 and NLRC5 are essential cytoplasmic sensors for heme-mediated inflammasome activation, inflammatory cell death, and pathology, suggesting that NLRP12, NLRC5, and inflammatory cell death molecules could be drug targets for hemolytic diseases and inflammatory syndromes. More specifically, the production and activation of NLRP12 or NLRC5 may be beneficial for therapeutic purposes to eliminate infections, damaged cells, or tumor cells, while blocking NLRP12 or NLRC5 activation and downstream cell death pathways could be used to prevent inflammation during hemolytic diseases and infections, inflammatory syndromes, and cancer.

[0028] Thus, according to the present invention, the expression or activity of NLRP12 and / or NLRC5 may be modulated (i.e., activated or inhibited) using one or a combination of modulators (i.e., activators or inhibitors). The term "activator" is not intended to encompass all non-selective inducers of gene expression or protein synthesis. Similarly, the term "inhibitor" is not intended to encompass all non-selective suppressors of gene expression or protein synthesis, or general toxins.

[0029] In one aspect, the present invention provides a composition comprising heme and at least one PAMP and / or DAMP molecule, and its use for activating NLRP12 and / or NLRC5 and inducing inflammatory cell death. Advantageously, the combination of heme and at least one PAMP and / or DAMP molecule provides a synergistic (i.e., greater than additive) increase in inflammatory cell death, making this combination useful for eliminating infectious diseases, damaged cells, or tumor cells.

[0030] The NLR family, including NACHT domain-, leucine-rich repeat-, and Pyd-containing protein 12 (NALP12); pyrin domain-containing Apaf1-like protein 7 (PYPAF7); and pyrin domain-containing 12 (NLRP12), also known as regulated by nitric oxide (RNO) and Monarch-1, contain an N-terminal pyrin domain (PYD) followed by FISNA (fish-specific NACHT-related domain), a NACHT domain, a NACHT-related domain (NAD), and a C-terminal leucine-rich repeat (LRR) region. NLRP12 functions as a negative regulator of TLR- and TNFR-induced NF-κB signaling in a context-dependent manner in human cells. NLRP12 blocks the hyperphosphorylation / activation of IRAK (IL-1R-associated kinase)-1 and promotes the degradation of NF-κB-inducing kinase (NIK), leading to reduced NF-κB activation. The amino acid sequence of human NLRP12 is known in the art and is available under UNIPROT accession number P59046.

[0031] The NLR family member, caspase activation and recruitment domain-containing 5 (NLRC5), also known as NOD27 and CLR16.1, contains an N-terminal atypical caspase activation and recruitment domain (CARD) followed by a NACHT domain, a NACHT-associated domain (NAD), and a C-terminal leucine-rich repeat (LRR) region. The function of NLRC5 is largely unknown, but its role as a transcriptional regulator of MHC-I, as both a positive and negative regulator of inflammation through NF-κB and IFN signaling, and as a regulator of the NLRP3 inflammasome has been suggested. The amino acid sequence of human NLRC5 is known in the art and is available under UNIPROT accession number Q86WI3.

[0032] For purposes of this invention, "heme" or "hemin" refers to a ferric iron (Fe) with a coordinated chloride ligand. 3+ ) ion containing protoporphyrin IX. [ka]

[0033] Heme may be obtained from natural sources and isolated to homogeneity, or may be synthesized. Representative commercial sources of heme include Thermo Scientific, Sigma-Aldrich, and Selleckchem.

[0034] The compositions and methods of the present invention include at least one PAMP and / or DAMP molecule in combination with heme. In some aspects, the compositions and methods may include two, three, four, or more PAMPs and / or DAMPs. As used herein, "pathogen-associated molecular pattern molecules" or "PAMPs" are microbial molecules that share several different common "patterns" or structures that alert immune cells to destroy invading pathogens. It is well established that PAMPs are recognized by pattern recognition receptors (PRRs), such as Toll-like receptors (TLRs), nucleotide-binding oligomerization domain-like receptors (NLRs), and mannose receptors expressed on innate immune cells. See, for example, Amarante-Mendes et al. (2018) Front. Immunol. 9:2379.

[0035] As used herein, "damage-associated molecular pattern molecules" or "DAMPs" are components released by dead, dying, or damaged cells that share several different common "patterns" or structures and alert immune cells by interacting with PRRs. DAMPs contribute to host defense but also promote pathological inflammatory responses. DAMPs used in the present invention are recognized by macrophages or other cell types, and inflammatory responses are triggered by various pathways, including TLRs, inflammasomes, and panoptosomes. DAMPs can arise from a variety of sources and include extracellular proteins such as biglycan and tenascin-C; intracellular proteins such as high-mobility group box 1 (HMGB1), histones, S100 proteins, and heat shock proteins (HSPs); and plasma proteins such as fibrinogen, Gc globulin, and serum amyloid A (SAA). In addition to proteins, DAMPs include nucleic acids or lipids, as well as cytokines and alarmins. In certain aspects, DAMPs used in the present invention include, but are not limited to, tumor necrosis factor alpha (TNF-α) or heme metabolites such as biliverdin.

[0036] Examples of PAMPs that can be used in the present invention include triacylated lipoproteins, lipoteichoic acid (CAS No. 56411-57-5), peptidoglycan, porin, zymosan (CAS No. 58856-93-2), Pam3CSK4 (CAS No. 112208-00-1), diacylated lipopeptides, dsRNA, polyadenylated-polyuridylic acid (polyA:U, e.g., CAS No. 24936-38-7), polyinosinic:polycytidylic acid (polyI:C, e.g., CAS No. 42424-50-0), lipopolysaccharide (LPS), flagellin, single-stranded RNA (ssRNA), C Examples of PAMPs include, but are not limited to, pGA, polyG10, polyG3, CpG oligonucleotides, PamCysPamSK4, Toxoplasma gondii profilin, double-stranded RNA (dsRNA), 5'ppp-dsRNA, phosphorylcholine (CAS No. 107-73-3), lipoarabinomannan, mycolic acid (CAS No. 37281-34-8), β-1,3-glucan, N-formylmethionine (CAS No. 4289-98-9), and mannose-rich glycans (i.e., short carbohydrate chains with the sugar mannose or fructose as the terminal sugar). In certain aspects, the PAMP is Pam3CSK4 or LPS.

[0037] The LPS and / or porin used in the present invention may be obtained from the outer membrane of the cell wall of Gram-negative bacteria; peptidoglycan and / or lipoteichoic acid may be obtained from the cell wall of Gram-positive bacteria; lipoarabinomannan and / or mycolic acid may be obtained from the cell wall of acid-fast bacteria; zymosan may be obtained from the cell wall of yeast; phosphorylcholine and other lipids may be obtained from the membrane of microorganisms; and dsRNA and ssRNA may be obtained from viruses or produced synthetically.As known in the art, CpG oligonucleotides are unmethylated cytosine-guanine oligonucleotide sequences that are frequently found in the genomes of bacteria and viruses.Peptidoglycan molecules are characterized by containing mesodiaminopimelic acid (meso-DAP), an amino acid unique to peptidoglycans. PAMPs can be obtained from natural sources (e.g., bacterial cell walls or viral genomes, such as from Bacillus Calmette-Guerin (BCG)) or can be synthetic (e.g., Pam3CSK4 or PamCysPamSK4).

[0038] Other molecules that are recognized by pattern recognition receptors and can be used in accordance with the present invention include CL307 (CAS No. 1548551-79-6), imiquimod (CAS No. 99011-02-6), gardiquimod (CAS No. 1020412-43-4), resiquimod (R848; CAS No. 144875-48-9), motolimod (CAS No. 926927-61-9), UC-IV150, EMD120108, I Examples of PAMPs include MO-2125, VTS-1463GS-9620, GSK2245035, TMX-101, TMX-201, TMX-202, isatoribine, AZD8848, MEDI9197, 3M-051, 3M-852, 3M-052, 3M-854A, S-34240, KU34B, CL663, SB9200, SB11285, and 8-substituted 2-amino-3H-benzo[b]azepine-4-carbozamides. See also Gambara et al. (2013) J. Cell. Mol. Med. 17(6):713-722. In one aspect, the PAMP is resiquimod (R848).

[0039] Compositions comprising heme and at least one PAMP and / or DAMP molecule are particularly useful in activating NLRP12 and / or NLRC5, activating inflammasomes and / or other multiprotein complexes (such as the panoptosome), and / or inducing inflammatory cell death (panoptosome) (e.g., eliminating infected, damaged, or tumor cells). In particular, coadministration of heme and at least one PAMP and / or DAMP molecule provides a synergistic increase in inflammatory cell death. Thus, the present invention provides a method for activating NLRP12 and / or NLRC5 and activating inflammatory cell death by contacting cells with an effective amount of a composition comprising heme and at least one PAMP and / or DAMP molecule. Cells to be treated according to this method include populations of cells, particularly populations of cells including undesirable cells such as infected cells or tumor cells. As used herein, an "effective amount" refers to an amount of a substance sufficient to produce a beneficial or desired result. According to the methods of the present invention, the desired result is the production and activation of NLRP12 and / or NLRC5, or inflammatory cell death. The production and activation of NLRP12 and / or NLRC5 can be determined by measuring the expression (e.g., transcript or protein) or activity (e.g., regulation of downstream signaling pathways) of NLRP12 and / or NLRC5. Inflammatory cell death can be assessed, for example, by propidium iodide uptake, as described herein.

[0040] In some aspects, the present invention provides for the administration of heme and at least one PAMP and / or DAMP molecule to a subject having, suspected of having, or at risk of having cancer or other diseases or conditions that would benefit from inflammatory cell death, such as a condition involving or mediated by a proliferative disease, infected cells, or damaged cells, to treat or alleviate the cancer, proliferative disease, infectious disease, or other disease or condition. The heme and at least one PAMP and / or DAMP molecule are administered in an amount effective to treat, alleviate, or mitigate the cancer or other disease or condition. In some aspects, treatment is initiated after the appearance of clinical signs and / or symptoms of cancer. In other aspects, the treatment, alleviation, or mitigate of the cancer or other disease or condition is affected by the administration of heme and at least one PAMP and / or DAMP molecule in the absence of any other therapeutic agent.

[0041] Administration of heme and at least one PAMP and / or DAMP molecule, whether administered before or after the onset of clinical signs and / or symptoms of cancer, can alleviate the signs or symptoms of cancer. In this regard, an effective amount of heme and at least one PAMP and / or DAMP molecule is, for example, an amount that can reduce or inhibit tumor growth. For example, an effective amount is an amount that reduces tumor growth by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% compared to tumor growth in the absence of heme and at least one PAMP and / or DAMP therapy. Whether tumor growth is reduced can be determined, for example, by measuring actual tumor size or any symptom associated with cancer, such as weight, fatigue, fever, or changes in bowel or bladder function. Treatment or reduction of tumor growth can also prolong survival and improve quality of life.

[0042] Cancers that may be treated according to the methods herein include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, anal carcinoma, astrocytoma, atypical teratoid / rhabdoid tumor, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain stem glioma, brain tumor, breast cancer, bronchial tumor, Burkitt's lymphoma, carcinoid tumor, cervical cancer, chordoma, chronic lymphocytic leukemia, chronic myeloproliferative disorder, colon cancer, colorectal cancer, and craniopharyngioma. , cutaneous T-cell lymphoma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer, gallbladder cancer, stomach cancer, gastroesophageal cancer, gastrointestinal cancer, germ cell tumor, gestational trophoblastic tumor, glioma (e.g., glioblastoma, astrocytoma, or oligodendrocytoma), hairy cell leukemia, head and neck cancer, hepatocellular carcinoma, histiocytosis, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, pancreatic islet cell tumor, Kaposi's sarcoma, kidney cancer, Langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, malignant teratoma, non-Hodgkin's lymphoma, macroglobulinemia, osteosarcoma, medulloblastoma, melanoma, Merkel cell carcinoma, mesothelioma, oral cancer, mycosis fungoides, myelodysplastic syndrome, multiple myeloma, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, non-small cell lung cancer These include, but are not limited to, lung cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma, ovarian cancer, epithelial ovarian cancer, pancreatic cancer, papillomatosis, parathyroid cancer, penile cancer, pharyngeal cancer, pituitary tumors, prostate cancer, rectal cancer, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, skin cancer, small intestine cancer, soft tissue sarcoma, testicular cancer, pharyngeal cancer, thymic carcinoma, thyroid cancer, urethral cancer, uterine cancer, vaginal cancer, and Wilms' tumor.

[0043] The present invention also provides methods for producing medicaments for treating cancer or other proliferative diseases or for eliminating infection, and kits for carrying out such methods. The kits of the present invention include heme and at least one PAMP and / or DAMP molecule. The kits may provide single or multiple doses of heme and at least one PAMP and / or DAMP molecule, and the heme and at least one PAMP and / or DAMP molecule may be provided individually or as a co-formulation. The kits may take the form of a blister package; a blister with a lid; a blister card or packet; a clamshell; an intravenous (IV) package, an IV packet or container, a tray, or shrink-wrap, containing heme and at least one PAMP and / or DAMP molecule and instructions for using the composition in the treatment method.

[0044] Insofar as the data provided herein provide markers for heme- and PAMP / DAMP-mediated NLRP12 or NLRC5 production or activation and inflammatory cell death, the present invention also provides a method for identifying agents that inhibit NLRP12- or NLRC5-dependent inflammasome, panoptosome, and inflammatory signaling activation, and inflammatory cell death. The screening method of the present invention includes contacting a cell sample with heme and at least one PAMP or DAMP molecule to activate NLRP12 or NLRC5 in the cells, and contacting the cell sample with at least one test agent, wherein a decrease in NLRP12 or NLRC5 production or activation in the presence of the test agent compared to NLRP12 or NLRC5 production or activation in the absence of the test agent is indicative of an agent that inhibits NLRP12- or NLRC5-dependent inflammasome and inflammatory signaling activation and inflammatory cell death. Thus, the method is used to identify NLRP12 and / or NLRC5 inhibitors that inhibit the expression or activity of NLRP12 and / or NLRC5, as well as inhibitors of upstream regulatory molecules of NLRP12 or NLRC5, including, for example, TLRs, ROS, nicotinamide pathway components, and / or IRFs.

[0045] As used herein, the terms "sample" and "biological sample" refer to any sample suitable for the methods provided by the present invention. In one aspect, a biological sample of the present invention is a tissue sample, e.g., a biopsy specimen, such as a sample from a needle biopsy (i.e., a biopsy sample). In other embodiments, a biological sample of the present invention is a sample of a bodily fluid, e.g., serum, plasma, sputum, lung aspirate, urine, and semen.

[0046] In some aspects, activation of NLRP12 and / or NLRC5 is determined by measuring the level or amount of NLRP12 or NLRC5 mRNA and / or protein (e.g., changes in NLRP12 and / or NLRC5 mRNA and / or protein levels); cleavage of one or more of gasdermin D (GSDMD), GSDME, caspase-1, caspase-8, caspase-3, and caspase-7; phosphorylation of mixed lineage kinase domain-like (MLKL) protein; cell death; or release of IL-1β or IL-18 by cells of a sample. Methods for assessing cleavage of GSDMD, GSDME, caspase-1, caspase-8, caspase-3, and caspase-7; phosphorylation of MLKL protein; cell death; and release of IL-1β or IL-18 are described in the Examples herein.

[0047] As used herein, the term "test agent" or "candidate agent" refers to an agent to be screened in the assays described herein. Virtually any compound can be the agent. It can exist as a single, isolated compound or be a member of a chemical library (e.g., combinatorial). In one embodiment, the test agent is a small organic molecule. The term small organic molecule refers to any molecule of a size comparable to organic molecules commonly used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). In certain embodiments, the size of a small organic molecule ranges up to about 5000 Da, up to 2000 Da, or up to about 1000 Da. Test agents of the present invention may be peptides, antisense oligonucleotides, RNA hairpins, guide DNA, antibodies, or antibody fragments.

[0048] In some aspects, the inhibitor identified by the screening assay of the present invention is an inhibitory nucleic acid that inhibits the expression of NLRP12 or NLRC5. As used herein, "inhibitory nucleic acid" refers to RNA, DNA, or a combination thereof that disrupts or interrupts the translation of mRNA. Inhibitory nucleic acids can be single-stranded or double-stranded. The terms "short inhibitory RNA" and "siRNA" are interchangeable and refer to short double-stranded RNA oligonucleotides that mediate RNA interference (also known as "RNA-mediated interference" or "RNAi"). The terms "small hairpin RNA" and "shRNA" are interchangeable and refer to artificial RNA molecules with tight hairpin turns that can be used to suppress the expression of target genes through RNAi. RNAi is a highly conserved gene silencing event that functions through the targeted destruction of individual mRNAs by homologous double-stranded small interfering RNA (siRNA) (Fire et al. (1998) Nature 391:806-811). The mechanism of RNAi is reviewed in, for example, Bayne & Allshire (2005) Trends in Genetics 21:370-73; Morris (2005) Cell. Mol. Life Sci. 62:3057-66; Filipowicz et al. (2005) Current Opin. Struct. Biol. 15:331-41. In various aspects, the inhibitory nucleic acid is selected from the group of siRNA, shRNA, gRNA, oligonucleotide, antisense RNA or ribozyme that inhibits the synthesis of NLRP12 or NLRC5.The siRNA suitable for reducing the expression of NLRP12 or NLRC5 is known in the art and can be obtained from commercial sources such as Thermo Fisher.Similarly, the shRNA plasmid suitable for inhibiting the expression of NLRP12 or NLRC5 by RNA interference can be obtained from Abbexa Ltd. When using gRNA to inhibit the expression of NLRP12 or NLRC5, any suitable CRISPR system can be used, including but not limited to Cas9.Exemplary gRNAs / crRNAs for genome editing using wild-type SpCas9 vectors or Cas9 proteins are available from GenScript.

[0049] The nucleotides of inhibitory nucleic acids can be chemically modified, natural, or artificial. For antisense, siRNA, or ribozyme oligonucleotides, phosphorothioate oligonucleotides can be used. Modifications of the phosphodiester linkage, heterocycle, or sugar may provide increased efficacy. Phosphorothioates are used to modify phosphodiester bonds. The N3'-P5' phosphoramidate linkage has been described to stabilize oligonucleotides against nucleases and enhance binding to RNA. Peptide nucleic acid (PNA) linkages are a complete replacement of the ribose and phosphodiester backbone, providing nuclease stability, increased binding affinity to RNA, and preventing cleavage by RNase H. Their basic structure is also amenable to modifications that may allow for their optimization as antisense components. Regarding heterocycle modifications, certain heterocycle modifications have been shown to increase antisense efficacy without interfering with RNase H activity. One example of such a modification is the C-5 thiazole modification. Finally, sugar modifications may also be considered. 2′-O-propyl and 2′-methoxyethoxy ribose modifications stabilize oligonucleotides to nucleases in cell culture and in vivo.

[0050] Inhibitory oligonucleotides can be delivered to cells by direct transfection or transfection and expression via an expression vector. Suitable expression vectors include mammalian expression vectors and viral vectors, into which inhibitory oligonucleotides are cloned with appropriate regulatory sequences, including a promoter, for expressing antisense RNA in host cells. Suitable promoters can be constitutive promoters or developmentally specific promoters. Transfection delivery can be achieved by liposomal transfection reagents known in the art (e.g., XTREME transfection reagent, Roche, Alameda, California; LIPOFECTAMINE formulation, Invitrogen, Carlsbad, California). Delivery can be mediated by cationic liposomes, nanoparticles, retroviral vectors, and direct delivery is efficient. Another possible delivery mode is targeting using antibodies against cell surface markers of target cells.

[0051] The NLRP12 and / or NLRC5 inhibitors of the present invention, such as those identified by the screening assays herein, block NLRP12- and / or NLRC5-mediated inflammasome, panoptosome, and inflammatory signaling activation, and are used to alleviate or treat inflammation during hemolytic diseases, infectious diseases, inflammatory syndromes, and cancer. Thus, in one aspect, the present invention provides a method for treating or alleviating NLRP12- and / or NLRC5-mediated inflammation associated with hemolytic diseases, infectious diseases, or inflammatory syndromes in a subject in need thereof by administering to the subject an effective amount of an inhibitor of NLRP12 and / or NLRC5 activation or production. In some aspects, the inhibitor of NLRP12 or NLRC5 activation or production may directly inhibit the expression or activity of NLRP12 or NLRC5. For example, an inhibitor of NLRP12 or NLRC5 activation or production may be a small molecule, peptide, antisense oligonucleotide, guide RNA, shRNA, antibody, or antibody fragment that interacts with NLRP12 or NLRC5 or interacts with a nucleic acid encoding NLRP12 or NLRC5 and inhibits the expression or activity of NLRP12 or NLRC5. In another aspect, an inhibitor of NLRP12 or NLRC5 activation or production may target an upstream regulatory molecule of NLRP12 or NLRC5, such as a Toll-like receptor (TLR), reactive oxygen species (ROS), and / or interferon regulatory factor (IRF), thereby inhibiting the production or activation of NLRP12 or NLRC5. An inhibitor targeting an upstream regulatory molecule of NLRP12 or NLRC5 may be a small molecule, peptide, antisense oligonucleotide, guide RNA, shRNA, antibody, or antibody fragment.

[0052] The terms "treat," "treating," or "treatment" refer to an approach to obtaining beneficial or desired clinical results. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, treatment of NLRP12-mediated inflammation and / or NLRC5-mediated inflammation. As used herein, the term "alleviating" means that clinical signs and / or symptoms associated with NLRP12-mediated inflammation and / or NLRC5-mediated inflammation are reduced. The signs or symptoms to be monitored are characteristic of a particular disease or disorder and are familiar to skilled clinicians, as are methods for monitoring the signs and conditions.

[0053] As indicated, NLRP12-mediated inflammation and / or NLRC5-mediated inflammation may be associated with hemolytic diseases, including but not limited to, beta-thalassemia, hemolytic anemia, and sickle cell disease (SCD); infectious diseases, including but not limited to, SARS-CoV-2, malaria, influenza, and pneumonia; and inflammatory syndromes, including but not limited to, neuroinflammation (e.g., schizophrenia, ALS, Alzheimer's disease, dementia) or systemic inflammatory response syndrome (SIRS).

[0054] Generally, the compositions of the present invention, such as heme and at least one PAMP and / or DAMP molecule, or NLRP12 and / or NLRC5 inhibitor, are formulated to be suitable for administration to any vertebrate subject, including mammalian subjects (e.g., human subjects).Such formulated compositions are useful as medicaments for treating subjects suffering from any of the above-mentioned diseases.

[0055] Preferably, the compositions of the present invention include isolated molecules. An isolated molecule is one that is substantially pure and, to a degree practical and appropriate for its intended use, free from other substances with which it is normally found in nature or in vivo systems. In particular, the molecular species is sufficiently pure and sufficiently free from other biological components of host cells to be useful, for example, for the production of pharmaceutical formulations or for sequencing, if the molecular species is a nucleic acid or peptide. The isolated molecular species of the present invention can be mixed with a pharmaceutically acceptable carrier in a pharmaceutical formulation, such that the molecular species will comprise only a small weight percent of the formulation. Nevertheless, the molecular species is substantially pure in that it has been substantially separated from substances with which it would be associated in a biological system.

[0056] The composition used in the method of the present invention can be provided as a pharmaceutical composition, including the composition mixed with at least one pharmaceutically acceptable carrier, excipient, vehicle, diluent, or preservative. Pharmaceutically acceptable carriers are preferably non-pyrogenic and can include, but are not limited to, saline, buffered saline, dextrose, and water. Various aqueous carriers can be used, such as 0.4% saline, 0.3% glycine, etc. These solutions are sterile and usually free of particulate matter. These solutions can be sterilized by conventional, well-known sterilization techniques (for example, filtration).

[0057] Pharmaceutical compositions may contain pharmaceutically acceptable auxiliary substances as needed.Acceptable auxiliary substances are preferably non-toxic to recipients at the dosage and concentration used.Auxiliary substances may be used to maintain or preserve, for example, the pH value, osmotic pressure, viscosity, transparency, color, isotonicity, odor, sterility, stability, dissolution rate or release rate, adsorption, or permeability of the composition. Suitable formulation materials include amino acids (such as glycine, glutamine, asparagine, arginine, or lysine), antimicrobial agents, antioxidants (such as ascorbic acid, sodium sulfite, or sodium bisulfite), buffers (such as borate, bicarbonate, Tris hydrochloride, citrate, phosphate, or other organic acids), bulking agents (such as mannitol or glycine), chelating agents (such as ethylenediaminetetraacetic acid (EDTA)), complexing agents (such as caffeine, polyvinylpyrrolidone, β-cyclodextrin, or hydroxypropyl-β-cyclodextrin), fillers, monosaccharides, disaccharides, and other carbohydrates (such as glucose, mannose, or dextrin), proteins (such as serum albumin, gelatin, or immunoglobulins), colorants, flavorings, and diluents, emulsifiers, hydrophilic polymers (such as polyvinylpyrrolidone). , low molecular weight polypeptides, salt-forming counterions (such as sodium), preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chlorhexidine, sorbic acid, or hydrogen peroxide), solvents (such as glycerin, propylene glycol, or polyethylene glycol), sugar alcohols (such as mannitol or sorbitol), suspending agents, surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20 or polysorbate 80, tromethamine, lecithin, or cholesterol), stability enhancers (such as sucrose or sorbitol), tonicity enhancers (such as alkali metal halides), delivery vehicles, diluents, excipients, and / or pharmaceutical adjuvants.See Remington's Pharmaceutical Sciences (18th Ed., AR Gennaro, ed., Mack Publishing Company 1990).

[0058] In yet another preparation, the compositions disclosed herein can be formulated into injectable microspheres, bioerodible particles, polymeric compounds (such as polylactic acid or polyglycolic acid), beads, or liposomes to provide controlled or sustained release of the product, which can then be delivered by depot injection. Other suitable means for introducing the desired inhibitor include implantable drug delivery devices.

[0059] The composition used for in vivo administration must typically be sterilized.This can be achieved by filtration through a sterile filtration membrane.If the composition is lyophilized, sterilization using this method can be carried out before or after lyophilization and reconstitution.

[0060] The concentration of the active ingredient in the composition can vary widely, i.e., less than about 0.5% by weight, usually at least about 1% by weight up to 15 or 20% by weight, and will be selected primarily based on the volume, viscosity, etc. of the liquid, depending on the particular mode of administration selected.

[0061] The compositions of the present invention may be administered by any number of routes described herein, including but not limited to intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracerebroventricular, intrathecal lumbar, intracisternal, transdermal, subcutaneous, intraperitoneal, intranasal, intratumor, parenteral, topical, sublingual, or rectal means.

[0062] The following non-limiting examples are provided to further illustrate the present invention.

[0063] Example 1: Materials and Methods Mouse. Casp1 - / - (Man et al. (2016) Cell 167:382-396), Casp3- / - (Zheng et al. (2000) Nat. Med. 6:1241-1247), Casp7 - / - (Lakhani et al. (2006) Science 311:847-851), Ripk3 - / - (Newton et al. (2004) Mol. Cell. Biol. 24:1464-1469), Nlrp1b - / - (Kovarova et al. (2012) J. Immunol. 189:2006-2016), Nlrp3 - / - (Kanneganti et al. (2006) Nature 440:233-236), Nlrp6 - / - (Chen et al. (2011) J. Immunol. 186:7187-7194), Nlrp12 - / - (Zaki et al. (2011) Cancer Cell 20:649-660), and Nlrc5 - / - (Kumar et al. (2011) J. Immunol. 186:994-10000) Mouse has been previously described. - / - Casp8 - / - Ripk3 - / - Mouse: Ripk3 - / - Casp8 - / - (Oberst et al. (2011) Nature 471:363-367) and Casp1 - / - The mice were bred by crossing with Nlrp12. - / - Nlrc5 - / - Mice are Nlrp12 - / - and Nlrc5 - / -Mice were bred by crossing WT and Nlrp12 mice. All mice were generated on a C57 / BL6 background or extensively backcrossed to a C57 / BL6 background. Mice were bred and maintained under specific pathogen-free conditions at the St. Jude Children's Research Hospital Animal Resource Center. Age- and sex-matched male mice aged 8–10 weeks were used in this study. Mice were maintained on a 12-hour light / dark cycle and fed a standard diet. Animal experiments were performed in accordance with protocols approved by the St. Jude Children's Research Hospital Animal Care and Use Committee. WT and Nlrp12 mice were bred on a 12-hour light / dark cycle and maintained under specific pathogen-free conditions at the St. Jude Children's Research Hospital Animal Resource Center. - / - animals, or WT and Nlrc5 - / - The animals were housed together for 2 weeks before performing the in vivo experiments.

[0064] Bone marrow-derived macrophages (BMDM). Primary mouse BMDM from wild-type and indicated mutant mice were cultured for 6 days in Iscove's modified Dulbecco's medium (IMDM, Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (Biowest), 30% L929 conditioned medium, 1% non-essential amino acids (Thermo Fisher Scientific), and 1% penicillin and streptomycin (Thermo Fisher Scientific). 1 × 10 cells were cultured in 12-well plates. 6 Cells / well, 5x10 in 24-well plates 5 BMDMs at a density of 10 cells / well were seeded in growth medium overnight before use.

[0065] Cell stimulation. BMDMs were stimulated with the following PAMPs, DAMPs, and inhibitors, alone or in the indicated combinations: 50 μM hemin (heme; Sigma-Aldrich), 0.75 μg / mL Pam3CSK4 (Pam3; InvivoGen), 15 ng / mL ultrapure lipopolysaccharide (LPS) from E. coli 0111:B4 (InvivoGen), 500 ng / mL R848 (InvivoGen), 100 ng / mL TNF-α (Peprotech), 1 μg / mL poly(I:C) (Invivogen), 200 ng / mL sodium urate crystals (Invivogen), 200 ng / mL recombinant mouse S100A8 / S100A9 heterodimer (bio-techne), 200 ng / mL erythrocyte stimulator (Invivogen), and 200 ng / mL erythrocyte stimulator (InvivoGen). ng / mL recombinant mouse HMGB1 (Abcam), 25 μM Z-VAD(OMe)-FMK (zVAD; Cayman Chemical), and 45 μM necrostatin 2 racemate (Nec-1; Selleckchem).

[0066] Real-time imaging of cell death. The kinetics of cell death were monitored using an IncuCyte S3 or SX5 (Sartorius) live cell analysis system. BMDM (5x10 5 Cells (cells / well) were seeded into 24-well tissue culture plates and treated with the indicated stimuli. Cell death was measured by propidium iodide (PI; Life Technologies) uptake according to the manufacturer's protocol. Plates were scanned at the indicated time intervals, and fluorescence and phase-contrast images were acquired hourly in real time. PI-positive dead cells were marked with a red mask and quantified using the software package provided with the IncuCyte imager.

[0067] Immunoblot analysis. After appropriate treatment, cells were lysed with the culture supernatant in caspase lysis buffer (containing 10% NP-40, 25 mM DTT, 1X protease and phosphatase inhibitors) and SDS sample loading buffer (containing 2-mercaptoethanol) to examine caspase activation. For immunoblot evaluation of signal transduction activation, the culture supernatant was removed, cells were washed once with 1X DPBS, and lysed in RIPA buffer and SDS sample loading buffer. Proteins were separated on an 8-12% polyacrylamide gel and transferred to a PVDF membrane (Millipore) using the Trans-BLOT® TURBO™ system. After blocking nonspecific binding with 5% skim milk, the membranes were incubated overnight with the following primary antibodies: caspase-1 (AdipoGen), caspase-3 (Cell Signaling Technology [CST]), cleaved caspase-3 (CST), caspase-7 (CST), cleaved caspase-7 (CST), caspase-8 (AdipoGen), cleaved caspase-8 (CST), pMLKL (CST), tMLKL (Abgent), GSDMD (Abcam), GSDME (Abcam), HO-1 (CST), and β-actin (Santa Cruz). The membranes were then washed and probed with the appropriate horseradish peroxidase (HRP)-conjugated secondary antibodies (anti-mouse and anti-rabbit, Jackson ImmunoResearch Laboratories). Immunoblot images were acquired on an Amersham Imager using IMMOBILON® Forte Western HRP Substrate (Millipore).

[0068] Cytokine Measurement. In vitro cytokines were detected in the supernatants using multiplex ELISA (Millipore) and IL-18 ELISA (Invitrogen) according to the manufacturer's instructions.

[0069] Microarray and RNA-seq analysis. Seven datasets deposited in GEO (accession IDs: GSE34404 (Idaghdour et al. (2012) Proc. Natl. Acad. Sci. USA 109:16786-16793), GSE136046 (Brito et al. (2022) J. Infect. Dis. 225:1274-1283), GSE102881 (Lagresle-Peyrou et al. (2018) Haematologica 103:778-786), GSE168532 (Lagresle-Peyrou et al. (2018) Haematologica 103:778-786; Liu et al. (2021) Blood 138:1162-1171), and GSE58287 (Connor et al. (2015) J. Virol. 89:9865-9874), GSE40012 (Parnell et al. (2012) Crit. Care 16:R157), and GSE171110 (Levy et al. (2021) iScience 24:102711) were used to estimate the role of NLRPs in datasets related to hemolytic and pandemic diseases. GSE34404 (Idaghdour et al. (2012) Proc. Natl. Acad. Sci. USA 109:16786-16793) compared whole blood RNA-seq profiles of 155 West African children, including 94 cases of symptomatic Plasmodium falciparum infection and 61 age-matched controls. GSE136046 (Brito et al. (2022) J. Infect. Dis. 225:1274-1283) was performed on affinity-purified CD71 markers from three patients infected with Plasmodium vivax at days 1 (diagnosis visit) and 42 (convalescence visit) after treatment with therapeutic drugs. + GSE102881 (Lagresle-Peyrou et al. (2018) Haematologica 103:778-786) contains CD34 expression profiles from bone marrow samples of two healthy donors and two patients with sickle cell disease (SCD).+ RNA-seq profiles were obtained from hematopoietic stem / progenitor cells (HSPCs). GSE168532 (Lagresle-Peyrou et al. (2018) Haematologica 103:778-786; Liu et al. (2021) Blood 138:1162-1171) included transcriptome profiles of classical monocytes from the peripheral blood of six healthy controls and 13 patients with SCD. GSE58287 (Connor et al. (2015) J. Virol. 89:9865-9874) included temporal transcriptome profiles from 30 peripheral blood mononuclear cells from 15 cynomolgus macaques infected with Marburg virus. The dataset included transcriptome profiles from 15 macaques on day 0 of infection and three macaques on days 1, 3, 5, 7, and 9 postinfection.

[0070] GSE40012 (Parnell et al. Care 16:R157) included whole blood samples from patients in the intensive care unit for up to 5 days and assayed with an Illumina HT-12 gene expression bead array. The dataset included influenza A infection (n=11), bacterial infection (n=16), and systemic inflammatory response (n=13) along with healthy control samples (n=36). To compare severe disease phenotypes with healthy controls while maintaining a maximum number of patient samples per phenotype, we examined day 4 patient samples for influenza (n=11), pneumonia (n=10), and systemic inflammatory response (n=6). GSE171110 (Parnell et al. (2012) Crit. Care 16:R157) included whole blood transcriptomics from 44 severe COVID-19 patients and 10 healthy controls for comparison. Additionally, a cohort of 18 patients infected with Crimean-Congo hemorrhagic fever virus (CCHFV) (Sequence Read Archive: PRJNA680886; Neogi et al. (2022) Elife 11) was obtained, and blood transcriptomics data from 12 patients with severe CCHFV were available. This enabled differential expression analysis of CCHFV-infected patients between the time of infection and approximately 1 year after recovery (convalescent group).

[0071] For each of these datasets, a quality control step was performed to incorporate normalized quartiles using the "normalize.quantiles" function in the preprocessCore v1.58.0 package when counts were not normalized, followed by log2 transformation for downstream differential expression analysis. Differential expression analysis was performed using the limma v3.52.1 package (Love et al. (2014) Genome Biol. 15:550) in R v4.1.1. Benjamini & Hochberg (1995) JR Stat. Soc. Series B Stat. Methodol. 57:289-300) determined the set of differentially expressed genes using an adjusted P value < 0.05 for GSE34404, GSE168532, GSE40012, and GSE171110. However, due to small sample sizes for GSE136046 (three cases and three controls), GSE102881 (two cases and two controls), and GSE58287 (three cases each on days 1, 3, 5, 7, and 9), no P-value adjustments were performed for these three datasets. A P-value < 0.05 was used to estimate the set of differentially expressed genes for GSE136046 and GSE102881. Cytoplasmic sensors, specifically NLRPs, were evaluated to determine which were overexpressed across disease-associated datasets. NLRPs were categorized based on their average fold change across these datasets and visualized using a heatmap from the Complex Heatmap v2.8.0 package (Gu et al. (2016) Bioinformatics 32:2847-2849).

[0072] Single-cell analysis. Single-cell transcriptomics data were obtained from GSE133181 (Hua et al. (2019) Blood 134:2111-2115). This dataset includes bone marrow CD34 transcriptomes from four normal patients (BM), three patients with thalassemia major (BT), and five patients with SCD analyzed through the 10X chromium platform. + The original dataset consisted of single cells obtained from 32,389 BM cells, 9,862 BT cells, and 16,266 SCD cells, as well as the expression profiles of 33,694 genes. It was analyzed using the Seurat v4.1.1 package in R v4.1.1. Quality control steps were performed as previously suggested (Hua et al. (2019) Blood 134:2111-2115). Cells were excluded if the number of detected genes was less than 500 or if the proportion of mitochondrial genes was greater than 5%. Log-normalization was performed using the "NormalizeData" function with a scale factor of 10,000. All variable genes that passed the "vst" filter were included for further analysis. Biological variation within the same group was removed using the "ScaleData" function. Principal component analysis was performed using the "RunPCA" function. The top 20 principal components (PCs) were used for downstream analysis. Louvain graph-based clustering and t-SNE-based dimensionality reduction were also performed to obtain low-dimensional representations and visualize the dataset.

[0073] To determine cell type annotation, we used a set of known markers and transcription factors for myeloid cell types as previously described (Hua et al. (2019) Blood 134:2111-2115). Each cell was annotated using the "AUCell_buildRankings," "AUCell_calcAUC," and "AUCell_exploreThresholds" functions (in that order) from the AUCell v1.18.0 package.

[0074] The final dataset consisted of 24,864 BM cells, 6,159 BT cells, and 8,018 SCD cells, distributed across four cell types: lymphoid (LymP), myeloid (G / M_P), erythroid (M / E_P), and multipotent hematopoietic stem (HSPC1) progenitor cells. A nonparametric Mann-Whitney-Wilcoxon test (Hettmansperger & McKean (2010) Robust Nonparametric Statistical Methods (2nd ed.), CRC Press) was used to compare mean NLRP12 expression between BT cells vs. BM cells and SCD cells vs. BM cells across the various cell types.

[0075] Confocal microscopy. BMDMs were seeded on poly-D-lysine-coated coverslips. After appropriate treatment, cells were washed with DPBS, fixed with 4% paraformaldehyde, and permeabilized with 0.5% TRITON X-100. After blocking nonspecific binding with 10% normal goat serum, cells were incubated overnight at 4°C with a primary antibody against ASC (1:100, Millipore). After washing three times with PBS-T (0.05% polysorbate 20 in PBS), coverslips were incubated with ALEXA FLUOR® 488 dye-conjugated secondary antibody against mouse IgG (1:1000, Invitrogen) at room temperature for 2 hours. Cells were counterstained with DAPI (4',6-diamidino-2-phenylindole, Biotium) to visualize nuclei, and images were acquired using a Marianas spinning disk confocal system (Intelligent Imaging Innovations) consisting of an inverted AxioObserver Z.1 microscope (Carl Zeiss), a CSU-W1 with SoRa (Yokogawa), a Prime95B sCMOS camera (Photometrics), 405 nm, 473 nm, 561 nm, and 647 nm solid-state laser lines (Coherent), and a 1.4 NA 60X oil objective. Images were acquired using Slidebook software.

[0076] RT-PCR analysis. Total RNA was extracted at the indicated time points using TRIZOL® RNA Extraction Reagent (Thermo Fisher Scientific). cDNA was synthesized from 1 μg of extracted RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Real-time quantitative PCR was performed on an Applied Biosystems 7500 real-time PCR instrument using SYBR® Green (Applied Biosystems) as the fluorescent reporter. The mouse primer sequences used were as follows: mNlrp12-forward primer: AAGACCGCAATGCACGATTAG (SEQ ID NO: 1); reverse primer: TGGAGCGTTCCCACTCTACA (SEQ ID NO: 2); mActin-forward primer: GGCTGTATTCCCCTCCATCG (SEQ ID NO: 3); reverse primer: CCAGTTGGTAACAATGCCATGT (SEQ ID NO: 4); mNlrc5-forward primer: GTGCCAAACGTCCTTTTCAGA (SEQ ID NO: 5); reverse primer: AGTGAGGAGTAAGCCATGCTC (SEQ ID NO: 6).

[0077] Hemin preparation. A 100 mM stock of hemin (heme; ferriprotoporphyrin IX chloride, Sigma-Aldrich) was prepared by dissolving it in filter-sterilized 0.1 M NaOH and neutralizing (to pH 7.2) with 1 M HCl as previously described (Rossi et al. (2018) Biochem. Biophys. Res. Commun. 503:2820-2825). The prepared stock was aliquoted and stored at -80 °C until use.

[0078] In vivo injections. LPS (1 μg / g body weight (Sigma)) and phenylhydrazine (0.125 mg / g body weight (Sigma)) were used for in vivo experiments. Briefly, LPS was dissolved in sterile DPBS, aliquoted, and stored at -80°C until use. Phenylhydrazine was weighed and dissolved in sterile DPBS; the pH was then adjusted to 7.4 using 2 M NaOH, and the phenylhydrazine was filtered through a 0.22 μm syringe filter (Millipore). Age- and sex-matched, 6- to 8-week-old house-mates of the indicated genotype were intraperitoneally injected with 1 μg / g body weight of LPS alone, 0.125 mg / g body weight of phenylhydrazine alone, or LPS together with phenylhydrazine. For LPS-phenylhydrazine combination injections, LPS was added to sterile-filtered phenylhydrazine and mixed prior to injection. For Plasmodium berghei ANKA infection, 6- to 8-week-old housed mice of the indicated genotypes were infected with 10 5 infected red blood cells (iRBCs) were injected intraperitoneally. Infected animals were monitored daily for survival.

[0079] Clinical chemistry analysis. Serum heme was detected using a heme assay kit (Sigma). BUN, creatinine, AST, and iron were detected using ABX Pentra 400 reagent (HORIBA) according to the manufacturer's instructions.

[0080] Statistical analysis. GraphPad Prism 8.0 software was used for data analysis. Data are presented as mean ± SEM. Statistical significance was determined by t-test (two-tailed) for two groups and one-way or two-way ANOVA (with Dunnett's or Tukey's multiple comparison test) for three or more groups. A P value < 0.05 was considered statistically significant.

[0081] Example 2: Identification of unique PAMP and DAMP combinations that induce inflammatory cell death Innate immunity is activated in response to pathogens, PAMPs, or DAMPs. Enhanced immune activation can lead to excessive cell death, tissue destruction, and organ damage, as well as the release of DAMPs. PRRs have long been studied for their ability to sense specific PAMPs or DAMPs. However, the combined activation of PRRs by multiple PAMPs and DAMPs has not been fully characterized. It has been hypothesized that the presence of multiple stimuli mimics infection and drives inflammatory cell death.

[0082] To investigate the involvement of multiple PAMPs in cell death and explore combinations that could mimic infection, we tested lipopolysaccharide (LPS) and Pam3CSK4 (Pam3), which mimic bacterial infection, and polyinosinic:polycytidylic acid (poly(I:C)) and resiquimod (R848), which mimic viral infection. To test whether individual PAMPs alone could induce cell death, bone marrow-derived macrophages (BMDMs) were treated with Pam3, poly(I:C), LPS, or R848. Minimal cell death occurred with these triggers. However, when PAMPs were combined, robust cell death was observed in many combinations, as would be expected in natural infections (Figure 1).

[0083] Because tissue damage and the release of DAMPs frequently occur during infection and inflammatory conditions, the involvement of DAMPs in cell death has also been identified. To assess this, we used DAMPs associated with infection and inflammatory diseases, such as high-mobility group box 1 protein (HMGB1), monosodium urate (MSU), S100A8 / A9, and heme. Similar to what was observed with PAMPs, individual DAMPs were found not to induce cell death in BMDMs. Similarly, combinations of DAMPs did not induce cell death.

[0084] We then determined whether combinations of PAMPs and DAMPs could induce cell death. Specifically, potent cell death was clearly observed when heme was combined with Pam3, LPS, or R848, but not with other tested combinations, including heme and poly(I:C) (Figure 2). Together, these results indicate signaling driven by specific PAMP combinations and that the combination of heme and PAMPs can induce potent cell death.

[0085] Although heme is known to induce cell death (Fortes et al. (2012) Blood 119:2368-2375), the cytoplasmic sensor and associated molecular mechanism remain unclear. Therefore, the biochemical characteristics of cell death induced by the combination of heme and PAMPs have been elucidated. First, cleavage of caspase-1 was observed, indicating the involvement of inflammasome activation. Downstream of inflammasome activation, gasdermin D (GSDMD) is processed to release its pore-forming N-terminus, which can execute cell death (He et al. (2015) Cell Res. 25:1285-1298; Kayagaki et al. (2015) Nature 526:666-671; Shi et al. (2015) Nature 526:660-665). Consistent with caspase-1 activation, cleavage of GSDMD into this pore-forming P30 fragment was observed, albeit at low levels. Another member of the gasdermin family, gasdermin E (GSDME), has been shown to induce cell death under certain conditions (Wang et al. (2017) Nature 547:99-103), and cleavage of GSDME was also observed herein. Furthermore, cleavage of the apoptotic caspases caspase-8, -3, and -7 was observed in BMDMs treated with heme plus PAMP. Previous studies have shown that activation of caspase-3 and caspase-7 inactivates GSDMD by processing it and producing the P20 fragment (Chen et al. (2019) EMBO J. 38: e101638; Taabazuing et al. (2017) Cell. Chem. Biol. 24:507-514; Wang et al. (2021) J. Immunol. 207:2411-2416), which was also observed here. Furthermore, phosphorylation of MLKL was also detected.Together, these data indicate that synergistic signaling from heme and PAMPs induces inflammatory cell death characterized by activation of caspase-1, GSDMD, GSDME, caspases-8, -3, -7, and MLKL, a hallmark of panoptosis.

[0086] Example 3: NLRP12 regulates inflammatory cell death induced by heme plus PAMP Cytoplasmic sensors, particularly several NLR proteins, have been implicated in the induction of cell death and disease (Kanneganti (2020) Immunol. Rev. 297:5-12; Harton et al. (2002) J. Immunol. 169:4088-4093; Inohara & Nunez (2003) Nat. Rev. Immunol. 3:371-382). However, the role of many NLRs in innate immunity and cell death remains unclear. To understand which NLRPs may be important in hemolytic diseases, we reanalyzed public datasets on patients with malaria or sickle cell disease (SCD) (Idaghdour et al. (2012) Proc. Natl. Acad. Sci. USA 109:16786-16793; Brito et al. (2022) J. Infect. Dis. 225:1274-1283; Lagresle-Peyrou et al. (2018) Haematologica 103:778-786). Previous studies have suggested that heme can induce NLRP3 inflammasome activation and IL-1β secretion (Li et al. (2014) Cell. Biochem. Biophys. 69:495-502; Dutra et al. (2014) Proc. Natl. Acad. Sci. USA 111:E4110-411). However, we observed that NLRP12, NLRP3, and NLRP6 were significantly upregulated in malaria or SCD, whereas NLRP2 and NLRP1 were not. To confirm whether these upregulated NLRPs play a role in inflammatory cell death during hemolytic disease, we evaluated cell death in NLRP12-, NLRP3-, NLRP6-, and NLRP1b-deficient BMDMs stimulated with heme plus PAMP. - / - We observed that BMDMs were significantly protected from cell death (Fig. 3), while Nlrp3 - / - Moderate protection was seen in BMDMs, but Nlrp6 - / - and Nlrp1b- / - Protection from cell death was not significant in BMDMs. To further confirm that NLRP3 is not involved in inducing cell death, the NLRP3 inhibitor MCC950 (Coll et al. (2015) Nat. Med. 21:248-255) was used. Treatment with MCC950 prevented canonical NLRP3-mediated cell death in response to LPS+ATP, but not in heme+Pam3-treated BMDMs. To further confirm the role of NLRP12 in driving cell death in response to heme+PAMP, we compared WT and NLRP12-treated BMDMs. - / - BMDMs were treated with heme and R848. Consistent with heme and Pam3 or LPS stimulation, Nlrp12 - / - We found that BMDMs were significantly protected from cell death during heme and R848 treatment (Figure 3). To determine whether NLRP12 is also involved in cell death induced by the PAMP-PAMP combination, we analyzed WT and NLRP12 - / - BMDMs were stimulated with poly(I:C) and Pam3 or R848. However, compared with WT BMDMs, Nlrp12 - / - No significant cell death protection was observed in BMDMs, indicating that NLRP12 is not required to drive cell death in the PAMP-PAMP combination. Together, these data indicate that NLRP12 is specifically required to drive inflammatory cell death in response to heme plus PAMP.

[0087] Previous studies have also shown that heme plus TNF-α can induce cell death characterized by activation of necroptosis and apoptosis (Fortes et al. (2012) Blood 119:2368-2375; Seixas et al. (2009) Proc. Natl. Acad. Sci. USA 106:15837-15842). Therefore, we determined whether NLRP12 is also important for heme plus TNF-α-induced cell death. - / -We observed that BMDMs were significantly protected from cell death in response to heme plus TNF-α (Figure 3). Excessive circulating TNF-α is a hallmark of both infectious and inflammatory diseases (Bradley (2008) J. Pathol. 214:149-160), indicating a role for NLRP12 in heme-mediated cell death in both infectious and autoinflammatory disease conditions.

[0088] Example 4: NLRC5 regulates inflammatory cell death induced by heme plus PAMP In addition to testing a role for NLRP, it was also observed that NLRC5 plays a role in response to heme plus PAMPs. - / - We observed that BMDMs were significantly protected from cell death in response to heme + Pam3 and heme + LPS stimulation (Figure 4). To further confirm the role of NLRC5 in driving cell death in response to heme + PAMP, we analyzed WT and NLRC5 - / - BMDMs were treated with heme and R848. Consistent with heme and Pam3 or LPS stimulation, Nlrc5 - / - BMDMs were found to be significantly protected from cell death during heme and R848 treatment. - / - We observed that BMDMs were significantly protected from cell death in response to heme plus TNF-α (Figure 4). Together, these data indicate that NLRC5 is specifically required to drive inflammatory cell death in response to heme plus PAMPs and cytokines.

[0089] Example 5: NLRP12 and NLRC5 regulate heme + PAMP-induced panoptosis We then determined the molecular impact of loss of NLRP12 or NLRC5 on cell death. In response to treatment with heme and Pam3, NLRP12 - / - and Nlrc5 - / -In BMDMs, reduced cleavage of GSDMD (P20 form), GSDME, caspase-8, caspase-3, and caspase-7, and reduced phosphorylation of MLKL were observed compared with WT BMDMs, indicating that NLRP12 and NLRC5 regulate the activation of inflammasomes and inflammatory cell death molecules consistent with panoptosis in response to heme and PAMP. It has been hypothesized that the effects of NLRP12 and NLRC5 on cell death may be linked to heme oxygenase-1 (HO-1), which is upregulated in response to heme and is important for the heme detoxification process (Seixas et al. (2009) Proc. Natl. Acad. Sci. USA 106:15837-15842; Pamplona et al. (2007) Nat. Med. 13:703-710). Increased expression of HO-1 was observed in response to heme + PAMP; however, both WT and Nlrp12 - / - There was no difference in HO-1 expression between BMDM and NLRP12. These data indicate that the effect of NLRP12 on cell death is independent of HO-1 function. Together, these data indicate that NLRP12 and NLRC5 regulate panoptosis, an inflammatory cell death pathway, in response to heme and PAMPs.

[0090] Example 6: NLRP12 and NLRC5 drive caspase-1 / caspase-8 / RIPK3-dependent cell death induced by heme + PAMP Because NLRP12- and NLRC5-dependent activation of multiple cell death proteins, including caspase-1, -3, -7, and MLKL, was observed in response to heme + PAMPs, consistent with activation of panoptosis, the contribution of each of these cell death proteins to the overall cell death phenotype was determined. To address this question, we investigated the contribution of Casp1 - / - , Casp3 - / - , Casp7 - / - and Ripk - / - BMDMs were evaluated. WT and Casp1 cells were stimulated with heme + Pam3 or heme + LPS. - / - , Casp3 - / -, Casp7 - / - or Ripk3 - / - No significant reduction in cell death was observed between WT and BMDMs, indicating possible redundancy between these cell death molecules in executing NLRP12- and NLRC5-dependent cell death. To further evaluate the role of other cell death proteins in this phenotype, WT BMDMs were treated with the RIPK1 inhibitor Nec-1 or a combination of Nec-1 and the pan-caspase inhibitor z-VAD-FMK (zVAD). Nec-1 treatment partially reduced cell death in response to heme + Pam3 compared to PBS controls, and the addition of zVAD further reduced cell death, indicating that both RIPK1 and caspases are important for cell death in response to heme + Pam3.

[0091] We confirmed these findings using a genetic model, as we observed significant cell death protection in BMDMs treated with zVAD and Nec-1 upon heme + Pam3 stimulation. - / - Casp8 - / - Ripk3 - / - Although we used BMDMs (termed triple knockout [TKO]), these cells lack key components associated with panoptosis. In response to heme + Pam3 or heme + LPS, we observed significant protection from cell death in TKO BMDMs compared with WT BMDMs (Figure 5). Consistent with cell death protection, we observed reduced cleavage of GSDMD (P20 form), GSDME, caspase-3 and -7, and reduced phosphorylation of MLKL in TKO BMDMs compared with WT BMDMs upon heme + Pam3 or heme + LPS stimulation. Together, these results indicate that NLRP12- and NLRC5-dependent inflammatory cell death in response to heme and PAMPs is driven by the caspase-1 / caspase-8 / RIPK3 axis.

[0092] Example 7: NLRP12 and NLRC5 drive inflammasome formation in response to heme + PAMP Caspase-1 activation is a hallmark of inflammasome activation. Furthermore, NLRP12 has been suggested to function as an inflammasome sensor during Yersinia pestis or Plasmodium chabaudi infection (Vladimer et al. (2012) Immunity 37:96-107; Ataide et al. (2014) PLoS Pathog. 10:e1003885), and NLRC5 has been observed to act as a positive regulator of the NLRP3 inflammasome under certain conditions (Davis et al. (2011) J. Immunol. 186:1333-1337; Kumar et al. (2011) J. Immunol. 186:994-1000). However, NLRP12 also has inflammasome-independent functions that attenuate NF-κB and ERK activation during inflammation and Salmonella infection (Allen et al. (2012) Immunity 36:742-754; Zaki et al. Proc. Natl. Acad. Sci. USA 111:385-390), and loss of NLRP12 in mice results in increased susceptibility to colonic inflammation, colorectal tumor development, and atypical neuroinflammation (Allen et al. (2012) Immunity 36:742-754; Allen et al. (2012) Immunity 36:742-754; Zaki et al. (2011) Cancer Cell 20:649-660; Lukens et al. (2015) Immunity 42:654-664); and NLRC5 can attenuate NF-κB and IFN signaling pathways independently of the NLRP3 inflammasome (Cui et al. (2010) Cell 141:483-496). Therefore, we evaluated the role of NLRP12 and NLRC5 in inflammasome formation and activity in response to heme and PAMP. First, we examined the formation of ASC specks, a hallmark of inflammasome formation.The results of this analysis indicated that upon heme + Pam3 treatment, WT BMDMs exhibited increased ASC speck formation compared to untreated BMDMs (Figure 6). Furthermore, Nlrp12 increased ASC speck formation compared to WT BMDMs. - / - We observed that ASC speck formation in BMDMs was significantly reduced (Figure 6), indicating that NLRP12 is required for inflammasome assembly under these conditions. As a downstream readout of inflammasome activation, we assessed the release of IL-1β and IL-18, which are cleaved to their active forms by caspase-1. Consistent with ASC speck formation, treatment with heme + Pam3 led to the release of IL-1β and IL-18 in WT BMDMs, whereas NLRP12 - / - We found that cytokine release was significantly reduced in BMDMs (Figure 7). In addition, loss of either NLRP12 or NLRC5 reduced caspase-1 activation in response to heme + Pam3 stimulation. Together, these data indicate that NLRP12 and NLRC5 regulate inflammasome formation and activation in response to heme + PAMP.

[0093] Example 8: NLRP12 and NLRC5 form a multiprotein cell death complex induced by heme plus PAMP In response to heme + PAMP treatment, we observed a critical role for the inflammasome and caspase-8 axis. Inflammasomes and caspase-8 are essential components of the panoptosome complex, which induces cell death. Therefore, we evaluated the possible interaction between NLRP12, NLRC5, and panoptosome formation. Using immunoprecipitation in 293T cells overexpressing panoptosome components and NLRP12 and NLRC5, we observed that both NLRP12 and NLRC5 could be pulled down by NLRP3, ASC, caspase-8, and RIPK3. These findings indicate that NLRP12 and NLRC5 form a death-inducing panoptosome complex containing inflammasomes, caspase-8, and other cell death molecules in response to heme + PAMP, which executes cell death.

[0094] Example 9: NLRP12 and NLRC5 are upregulated in disease and cause pathology The expression of NLRP12 and NLRC5 has been shown to be upregulated in patients with multiple hemolytic diseases. To determine the impact of NLRP12 and NLRC5 on disease pathology, we measured the expression of murine Nlrp12 and Nlrc5 in BMDMs. Nlrp12 was significantly upregulated in response to heme + Pam3 treatment at 36 hours post-treatment (Figure 8), but not at 12 or 24 hours post-treatment. Similarly, Nlrc5 was significantly upregulated by 36 hours post-treatment with heme + Pam3 (Figure 8). Consistent with the increased expression of Nlrp12 and Nlrc5, cell death began 30–32 hours post-treatment, indicating that Nlrp12 and Nlrc5 expression correlates with cell death in response to heme + PAMP. Furthermore, expression of Nlrp12 was observed only in BMDMs treated with the combination of heme and Pam3, but not in BMDMs treated with heme or Pam3 alone (Figure 8), indicating that heme and PAMP together mediate the signaling necessary to induce the expression of Nlrp12 and Nlrc5. To further confirm these observations in human cells, we analyzed a single-cell transcriptomics dataset from patients with hemolytic disease (Hua et al. (2019) Blood 134:2111-2115). Increased expression of NLRP12 and NLRC5 was observed in erythroid, myeloid, and hematopoietic stem cells from patients with beta-thalassemia and SCD compared with cells derived from the bone marrow of healthy controls. Together, these results indicate that expression of NLRP12 and NLRC5 is significantly upregulated in response to heme and PAMP.

[0095] In addition to hemolytic diseases, heme is known to be released during infectious and inflammatory diseases due to hemorrhagic conditions and tissue injury. Increased expression of NLRP12 was observed in hemolytic diseases, leading to the determination of the NLRP expression profile in infectious and pandemic diseases associated with hemorrhagic conditions. Using publicly available datasets, NLRP12 was found to be significantly upregulated in patients infected with Crimean-Congo hemorrhagic fever virus (CCHFV) and macaques infected with Marburg virus. COVID-19, which is associated with hemolytic anemia (Lazarian et al. (2020) Br. J. Haematol. 190:29-31; AbouYabis & Bell (2021) J. Hematol. 10:221-227); influenza virus infection, in which the virus or hemagglutinin glycoprotein can cause hemolysis (Sato et al. (1983) Proc. Natl. Acad. Sci. USA 80:3153-3157; Huang et al. (1981) Virology 110:243-247); and pneumonia and SIRS, in which hemolysis and the release of free heme have been found to drive severe pathology and morbidity (Khan et al. (2009) Braz. J. Infect. Dis. 13:77-79; Wang et al. (2004) Acta Paediatr. Taiwan). Other infectious diseases in which hemolysis has been observed were also evaluated, including those in which hemolysis has been observed (Larsen et al. (2010) Sci. Transl. Med. 2:51ra71; Meinders & Dijkstra (2014) Blood 124:841). Using publicly available datasets, NLRP12 expression was found to be increased in patients with COVID-19, influenza, pneumonia, and SIRS, and NLRP12 was implicated in the development of hemorrhagic and pandemic diseases.

[0096] To directly test the role of NLRP12 and NLRC5 in disease pathogenesis in vivo, we injected mice with phenylhydrazine (PHZ), a known hemolysis-inducing agent (Beutler (1969) Pharmacol. Rev. 21:73-103), along with a sublethal dose of LPS. In wild-type (WT) mice, increased serum heme and iron levels were observed upon treatment with PHZ alone and in combination with LPS, indicating hemolysis in both groups. Furthermore, combined treatment with PHZ and LPS resulted in significantly increased levels of kidney injury markers, such as blood urea nitrogen (BUN) and creatinine, compared with treatment with PHZ or LPS alone (Figure 9). However, there was no significant increase in the levels of aspartate aminotransferase (AST), a marker of liver injury, in mice treated with PHZ and LPS. Previous studies have demonstrated that hemolysis and heme release can cause acute kidney injury and acute tubular necrosis (Ramos et al. (2019) Proc. Natl. Acad. Sci. USA 116:5681-5686; Vermeulen Windsant et al. (2010) Kidney Int. 77:913-920). Increased serum BUN was observed in WT mice treated with PHZ and LPS, but not with LPS or PHZ alone (Figure 9). To determine whether the observed pathogenesis was driven by NLRP12 or NLRC5, we compared serum BUN levels in WT mice treated with PHZ and LPS and NLRP12. - / - , and Nlrc5 - / - We examined BUN and creatinine levels in serum from mice. - / - Mouse and Nlrc5 - / - Significantly reduced BUN and creatinine levels were observed in serum from mice compared to WT serum samples (Figure 10). - / - There were no significant differences in serum AST and iron levels between the Nlrp12 mice and the control mice. - / -Mice were significantly protected against PHZ- and LPS-mediated death compared to WT mice (Figure 11). To determine the role of NLRC5 in this pathogenesis, WT and NLRC5 mice were treated with 100 mg / kg bw PBS. - / - Mice were treated with PHZ and LPS and monitored for survival. - / - We observed that mice were significantly protected from death in response to PHZ and LPS compared to WT mice (Figure 11). - / - Nlrc5 - / - Mice were significantly protected from death when infected with Plasmodium berghei ANKA (Figure 12). Overall, these results indicate that hemolytic disease models, including both ligand-based and infection models, induce NLRP12- and NLRC5-mediated pathology and that NLRP12 and NLRC5 are involved in disease development.

Claims

1. A composition for activating or inducing the production of NLR family pyrin domain-containing 12 (NLRP12) or NLR family caspase activation and recruitment domain-containing 5 (NLRC5), the composition comprising (a) heme and (b) at least one pathogen-associated molecular pattern (PAMP) molecule, at least one damage-associated molecular pattern (DAMP) molecule, or a combination thereof.

2. At least one PAMP molecule is a triacylated lipoprotein, lipoteichoic acid, peptidoglycan, porin, zymosan, Pam 3 CSK 4 , diacylated lipopeptide, dsRNA, polyadenylated-polyuridylic acid, polyinosinic:polycytidylic acid, lipopolysaccharide, flagellin, single-stranded RNA, CpGA, polyG10, polyG3, CpG oligonucleotide, PamCysPamSK 4 , Toxoplasma gondii profilin, double-stranded RNA, 5'ppp-dsRNA, phosphorylcholine, lipoarabinomannan, mycolic acid, β-1,3-glucan, N-formylmethionine, mannose-rich glycan, CL307, imiquimod, gardiquimod, resiquimod, motolimod, UC-IV150, EMD120108, IMO-2125, VTS-1463GS-962 0, GSK2245035, TMX-101, TMX-201, TMX-202, isatoribine, AZD8848, MEDI9197, 3M-051, 3M-852, 3M-052, 3M-854A, S-34240, KU34B, CL663, SB9200, SB11285, or an 8-substituted 2-amino-3H-benzo[b]azepine-4-carbozamide.

3. 2. The composition of claim 1, wherein at least one DAMP molecule is tumor necrosis factor alpha or a heme metabolite.

4. 10. A pharmaceutical composition comprising the composition of claim 1 in admixture with a pharmaceutically acceptable carrier, excipient, vehicle, diluent, or preservative.

5. 10. A method for inducing inflammatory cell death, comprising contacting a cell with an effective amount of the composition of claim 1, thereby inducing inflammatory cell death.

6. 10. A method for treating cancer or other diseases or conditions that would benefit from inflammatory cell death, comprising administering to a subject in need of such treatment an effective amount of the pharmaceutical composition of claim 4, thereby treating the cancer or other disease or condition in the subject that would benefit from inflammatory cell death.

7. 7. The method of claim 6, wherein the other disease or condition is an infection, a proliferative condition, or a condition involving damaged cells.

8. A method for treating or alleviating NLRP12-mediated inflammation or NLRC5-mediated inflammation associated with a hemolytic disease, an infection, an inflammatory syndrome, or cancer, comprising administering to a subject in need thereof an effective amount of an inhibitor of the production or activation of NLRP12 or NLRC5, thereby treating or alleviating NLRP12-mediated inflammation or NLRC5-mediated inflammation associated with a hemolytic disease, an infection, an inflammatory syndrome, or cancer in the subject.

9. The method of claim 8, wherein the inhibitor of the production or activation of NLRP12 or NLRC5 is a small molecule, peptide, antisense oligonucleotide, guide RNA, shRNA, antibody or antibody fragment that directly inhibits the expression or activity of NLRP12 or NLRC5.

10. The method of claim 8, wherein the inhibitor of the production or activation of NLRP12 or NLRC5 is a small molecule, peptide, antisense oligonucleotide, guide RNA, shRNA, antibody or antibody fragment that targets an upstream regulatory molecule of NLRP12 or NLRC5.

11. 9. The method of claim 8, wherein the hemolytic disease is beta thalassemia, hemolytic anemia, or sickle cell disease; the infectious disease is SARS-CoV-2, influenza, malaria, or pneumonia; and the inflammatory syndrome is neuroinflammatory or systemic inflammatory response syndrome.

12. 1. A method for identifying an agent that inhibits the production or activation of NLRP12-dependent or NLRC5-dependent inflammasome, panoptosome, and inflammatory signaling and inflammatory cell death, comprising: (a) contacting a sample of cells with the composition of claim 1 to produce or activate NLRP12 or NLRC5; and (b) contacting the sample of cells of (a) with at least one test agent, wherein a decrease in NLRP12 or NLRC5 production or activation in the presence of the test agent compared to NLRP12 or NLRC5 production or activation in the absence of the test agent is indicative of an agent that inhibits NLRP12-dependent or NLRC5-dependent activation of the inflammasome, panoptosome, and inflammatory signaling and inflammatory cell death. The method comprising:

13. The method of claim 12, wherein the production or activation of NLRP12 or NLRC5 is determined by measuring the amount of NLRP12 or NLRC5 mRNA or protein; cleavage of one or more of gasdermin D, gasdermin E, caspase-1, caspase-8, caspase-3, and caspase-7; phosphorylation of mixed lineage kinase domain-like protein; cell death; or release of IL-1β or IL-18 by cells of the sample.