Composition for caring for keratinous materials comprising at least indole-3-lactic acid, indole-3-carboxaldehyde, indole-3-acetic acid and an adjuvant, use and method of implementing said composition
By activating skin cell adhesion proteins through indole compounds, the problem of weakened skin barrier function is solved, thereby enhancing skin hydration and barrier function and improving symptoms such as tightness, itching, and roughness of dry skin.
Patent Information
- Application Number
- JP2025535397
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-12-21
- Filing Date
- 2023-12-20
- Publication Date
- 2025-12-25
Smart Images

Figure 2025542202000011 
Figure 2025542202000012 
Figure 2025542202000013
Abstract
Description
[Technical Field]
[0001] The present invention relates to the use of a mixture of indoles for improving the barrier function and moisturizing the skin.
[0002] More particularly, the present invention relates to a composition, in particular a cosmetic composition, in particular a composition for caring for keratinous materials, in particular a cosmetic composition, which comprises, in a physiologically acceptable medium: At least indole-3-lactic acid and / or a salt thereof, indole-3-carboxaldehyde and / or a salt thereof, and indole-3-acetic acid and / or a salt thereof; and at least one adjuvant selected from the group consisting of fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof. The present invention aims to propose a composition as described above, which comprises:
[0003] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of such a composition for preventing a decline in the skin barrier function and / or for strengthening the skin barrier function in an individual.
[0004] Furthermore, the present invention relates to the cosmetic use, especially the topical cosmetic use, of such compositions to improve skin moisturization.
[0005] Furthermore, the present invention relates to the cosmetic use, especially the topical cosmetic use, of such compositions for improving the quality of said skin, especially the quality of dry skin.
[0006] Furthermore, the present invention relates to the cosmetic use, in particular the topical cosmetic use, of such compositions for preventing and / or treating cosmetic manifestations associated with dry skin, in particular cosmetic manifestations associated with dry skin selected from tautness, itching, feelings of discomfort, dull complexion, skin roughness and marked microrelief of the skin.
[0007] Furthermore, the present invention relates to the cosmetic use, especially the topical cosmetic use, of such compositions for preventing and / or treating pruritus, especially pruritus of skin affected by skin disorders, such as atopic dermatitis.
[0008] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of such compositions for the prevention and / or treatment of atopic dermatitis.
[0009] Finally, the present invention relates to a non-therapeutic cosmetic method for caring for keratinous materials, in particular skin, in particular dry skin, which comprises the topical application of such a composition to these keratinous materials. [Background technology]
[0010] Skin is a tissue in which cells are interconnected and integrally attached to one another. Skin tissue forms the outer covering, which contains sebaceous or sweat glands and hair follicles. Skin is an epithelium that constantly renews. This renewal, or desquamation, is a regulated and finely controlled process that results in the imperceptible removal of surface cells.
[0011] Human skin consists of two parts: the upper epidermis and the deep compartment dermis.
[0012] The epidermis is conventionally divided into a basal layer of keratinocytes that constitutes the germinal layer of the epidermis; a spinous layer consisting of several layers of polyhedral cells located above the germinal layer; one to three "granular" layers composed of flat cells containing distinct cytoplasmic inclusions called keratohyalin granules; and finally, a set of upper layers called the cornified layers (or stratum corneum) composed of keratinocytes, which are in the final stage of differentiation. The organization and, above all, cohesion between these various cell layers is made possible by a series of intercellular junctions, including adherens junctions, which contribute to maintaining homeostasis in epithelial tissues. These adherens junctions are specifically referred to as desmosomes. Desmosomes are composed of transmembrane proteins from the cadherin family, such as desmoglein. These junctions play an essential role in the structure, maintenance, and architectural cohesion of the epidermis and allow the transmission and attenuation of mechanical forces acting on keratinocytes. These adherens junctions are primarily present in the middle to uppermost layers of the epidermis, i.e., the cornified layer composed of keratinocytes.
[0013] Keratinocytes are anucleate cells composed primarily of cytokeratin-containing fibrous material, surrounded by a cornified envelope (CE), and comprise, among other things, the protein filaggrin. Filaggrin aggregates keratin filaments into macrofibrils in the lower stratum corneum. Closer to the skin surface, filaggrin is primarily degraded to free amino acids, which form the main components of the highly hygroscopic complex natural moisturizing factor (NMF). NMF is important for maintaining stratum corneum moisture and skin suppleness.
[0014] New keratinocytes are constantly being produced to compensate for the continuous loss of epidermal cells in the cornified layers, by a mechanism referred to as desquamation.
[0015] Nevertheless, an imbalance between cell production and desquamation rate in the basal layer can lead to the formation of scales, particularly on the skin surface.
[0016] Similarly, for various reasons, lack of terminal differentiation of the cells of the stratum corneum can result in the formation of large, thick cell clusters called "squamae" that are visible to the naked eye, and in other circumstances, thinning of the stratum corneum.
[0017] In addition, the overall junction system responsible for cell-cell cohesion is impaired, which directly results in a reduction in the effectiveness of the skin's barrier function.
[0018] Thus, one or more of these internal factors can result in a weakening in the barrier function of the epidermis, chronic dehydration of the stratum corneum, loss of mechanical elasticity, skin tightness, and also loss of skin radiance and clarity.
[0019] In parallel, weakening of the skin barrier can also occur in the presence of external aggressions, in particular irritants (detergents, acids, bases, oxidizing agents, reducing agents, concentrated solvents, toxic gases or smoke), temperature or climatic imbalances (cold, drought, radiation), xenobiotics (undesirable microorganisms, allergens, pollutants).
[0020] One of the key steps in the terminal differentiation process of the stratum corneum is the cross-linking of precursor proteins of the cornified envelope (CE). This phenomenon plays an essential role in the development and maintenance of skin cohesion and physical properties of the skin, such as barrier function, and is a step in the terminal differentiation process described above. The cornified envelope is an essential component of the keratinocyte.
[0021] Commonly used moisturizing active ingredients, such as moisturizers, moisturizing polymers, or occlusive fatty substances, such as liquid petroleum jelly, temporarily change the surface properties of the skin. These active ingredients can cause mechanical softening of the stratum corneum, increasing its moisturizing state and / or improving the micro-relaxation of the skin by forming a film on the skin surface. However, these effects do not necessarily last particularly long over time and disappear after cleansing the skin. Moreover, these active ingredients can be removed by the cleansing action.
[0022] To overcome these drawbacks, it may be advantageous to select active ingredients that have beneficial effects on biological pathways and biomarkers involved in skin barrier function.
[0023] In addition to the aforementioned key factors involved in skin barrier function, particularly filaggrin and adherens junctions (desmogleins), the tryptophan metabolic pathway, i.e., the aryl hydrocarbon receptor (AhR) pathway, has been attracting particular attention because it is known to be involved in various skin disorders, such as accelerated aging and inflammation (Parrado, C. et al. Front. Pharmacol. 10, (2019); Krutmann, J. Dermatol. Sci. 85, 152-161 (2017); Vogeley, C., Int. J. Mol. Sci. 20, (2019); Hidaka, T., Front. Med. 6, (2019); Stockinger, B. Annu. Rev. Immunol. 32, 403-432 (2014)).
[0024] It is also known to be essential for the integrity of the skin barrier (Haas, K. et al. J. Invest. Dermatol. 136, 2260-2269 (2016)), and its activation, particularly by the CYP1A1 gene and / or the OVOL1 gene, can improve the skin barrier in the context of atopic dermatitis (Furue, M., Hashimoto-Hachiya, A. & Tsuji, G. Int. J. Mol. Sci. 20, (2019)). Summary of the Invention [Problem to be solved by the invention]
[0025] Therefore, there is a need to identify new active ingredients that are not only able to stimulate the tryptophan metabolic pathway, i.e., the aryl hydrocarbon receptor (AhR) pathway, but also to stimulate the expression of filaggrin and / or adherens junctions, such as desmoglein.
[0026] There is a need for active ingredients that enable skin, especially dry skin, to maintain its barrier function.
[0027] There is a need for active ingredients that are capable of preventing a decline in and / or strengthening the skin barrier function in an individual.
[0028] There is also a need for active ingredients that make it possible to improve skin moisturization.
[0029] There is also a need for active ingredients that make it possible to improve the quality of the skin, in particular dry skin.
[0030] There is further a need for active ingredients that make it possible to prevent and / or treat the cosmetic signs associated with dry skin, in particular those selected from tightness, itching, discomfort, dull complexion, roughness of the skin and pronounced microrelief of the skin.
[0031] There is also a need for active ingredients that make it possible to prevent and / or treat pruritus, in particular pruritus of skin affected by skin disorders, such as atopic dermatitis.
[0032] There is further a need for active ingredients that make it possible to prevent and / or treat atopic dermatitis.
[0033] The object of the present invention is to solve the above-mentioned technical problems.
[0034] In fact, the inventors have now discovered that the mixture of indoles according to the invention overexpresses genes for activating the AHR pathway (in particular the CYP1A1 gene and / or the OVOL1 gene described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and genes for stimulating epidermal differentiation (FLG-filagrin and / or DSG1-(Desmoglein 1)), thereby preventing a decline in the skin barrier function in an individual and / or strengthening said skin barrier function. This mixture is therefore advantageous in improving the skin's barrier function and moisturizing properties. [Means for solving the problem]
[0035] Thus, according to a first aspect, the present invention provides a composition, in particular a cosmetic composition, a composition for caring for keratinous materials, in particular a cosmetic composition, comprising, in a physiologically acceptable medium: At least indole-3-lactic acid and / or a salt thereof, indole-3-carboxaldehyde and / or a salt thereof, and indole-3-acetic acid and / or a salt thereof; and at least one adjuvant selected from the group consisting of fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof. The present invention relates to the composition comprising:
[0036] Suitable polyols for use in the present invention are intended to be linear, branched, or cyclic, saturated or unsaturated alkyl-type compounds having at least two -OH functional groups on the alkyl chain, particularly at least three -OH functional groups, more particularly at least four -OH functional groups.
[0037] Polyols suitable for formulating the compositions according to the invention are in particular polyols containing from 2 to 32 carbon atoms, preferably from 3 to 16 carbon atoms.
[0038] "Fillers" are to be understood as colorless or white solid particles of any shape, which are in an insoluble form and are dispersed in the medium of the composition, and which may be of mineral or organic nature, and which give the composition body or rigidity and / or softness.
[0039] The fillers used in the compositions according to the invention can be lamellar, globular, spherical, fibrous, or any other intermediate shape between these defined shapes.
[0040] Fillers in the context of the present invention may be superficially coated or uncoated, and may in particular be surface-treated with silicones, amino acids, fluorinated derivatives or any other substance that promotes the dispersion and compatibility of the filler in the composition.
[0041] The fillers can be inorganic or organic.
[0042] The inorganic filler may be selected from synthetic or natural mica; silica powder; talc; kaolin; boron nitride; or combinations thereof.
[0043] The organic filler can be selected from: Silicone resin-coated organopolysiloxane powders, such as those sold by Shin-Etsu Chemical Co., Ltd. under the trade names "KSP-100", "KSP-101", "KSP-102", "KSP-103", "KSP-104", and "KSP-105"; Polymethylsilsesquioxane powders, such as those sold under the trade name TOSPEARL by Momentive Performance Materials; Polyamide powders (also known as Nylon), such as Nylon-1 (Polyamide 1), Nylon-12 (Polyamide 12), for example Nylon-66 (Polyamide 66) sold under the trade name ORGASOL by Arkema; Nylon-6 (Polyamide 6); polyethylene powder; Microspheres based on acrylic copolymers, such as those made from ethylene glycol dimethacrylate / lauryl methacrylate copolymer sold under the trade name POLYTRAP by Dow Corning; Expanded powders, such as hollow microspheres, in particular those sold under the trade name EXPANCEL by Nouryon; methyl polymethacrylarte microspheres, such as those sold under the trade name MICROSPHERE M-100 by Matsumoto Yushi Pharmaceutical Co., Ltd. and those sold under the trade name COVABEAD LH85 by Sensient; Ethylene-acrylate copolymer powders, such as those sold under the trade name FLOBEADS by Sumitomo Seika Chemicals Co., Ltd.; natural organic material powders, such as starch powders, in particular corn, wheat or rice starch, optionally crosslinked, for example starch powders crosslinked with octenylsuccinic anhydride, such as those sold under the trade name DRY-FLO by Nouryon; Poly-p-phenylene terephthamide powder; and combinations thereof.
[0044] The propellant may be selected from compressed or liquefied gases.
[0045] Examples of compressed gases include air, nitrogen, carbon dioxide (or carbon dioxide), and mixtures thereof.
[0046] Examples of liquefied gases include dimethyl ether, chlorinated and / or fluorinated hydrocarbons such as trichlorofluoromethane, dichlorodifluoromethane, chlorodifluoromethane, 1,1,1,2-tetrafluoroethane, chloropentafluoroethane, 1-chloro-1,1-difluoroethane, and 1,1-difluoroethane; and volatile hydrocarbons, in particular C3-C5 alkanes, such as propane, isopropane, n-butane, isobutane, and pentane, either alone or in mixture. Preferably, the hydrocarbons include propane, isopropane, n-butane, and isobutane, either alone or in mixture.
[0047] As shown in the following examples, the applicant has surprisingly discovered that a composition according to the present invention comprising at least indole-3-lactic acid and / or a salt thereof, indole-3-carboxaldehyde and / or a salt thereof, and indole-3-acetic acid and / or a salt thereof, can overexpress genes for activating the AHR pathway (particularly the CYP1A1 gene and / or the OVOL1 gene) and genes for stimulating differentiation (FLG-filaggrin and / or DSG1-desmoglein 1), thereby preventing and / or strengthening the skin barrier function. This discovery forms the basis of the present invention (see, for example, Hoober JK, Eggink LL. Int. J. Mol. Sci., 2022 Jan 27;23(3):1455).
[0048] In fact, filaggrin (FLG) is a major structural protein involved in the skin's surface barrier. Mutations in the gene encoding filaggrin are the most important risk factor for skin diseases. Approximately 50% of patients with atopic dermatitis have loss-of-function mutations in filaggrin. Esparza-Gordillo et al. (Curr Opin Allergy Clin Immunol. 2010 Oct;10(5):418-26) showed that 10%-20% of people in industrialized countries suffer from atopic dermatitis, and that mothers with FLG gene mutations have a strong predisposition to atopic dermatitis in children. Mutations in the FLG gene have also been associated with ichthyosis vulgaris, a common skin disease characterized by dry, squamous epithelium with a prevalence of at least 1 in 250 people.
[0049] Furthermore, DSG1 encodes desmoglein 1, a major component of desmosomes. Desmosomes connect the cell surface to the keratin cytoskeleton and play an important role in maintaining epidermal integrity and barrier function. Mutations causing psoriasiform dermatitis, SAM syndrome (severe dermatitis, multiple allergies, and metabolic wasting syndrome), are reflected in the lack of membrane expression of DSG1, resulting in a loss of cell-cell adhesion (Oh, J. et al. Nature 514, 59-64 (2014)). Lack of desmoglein 1 leads to severe dermatitis, multiple allergies, and metabolic disorders (Samuelov L et al. Nat Genet. 2013 Oct;45(10):1244-1248; Lisa M Godsel et al. J Clin Invest. 2022 Feb 1;132(3):e144363).
[0050] These two proteins are therefore key to the barrier role played by the skin.
[0051] The composition according to the invention may further comprise tryptamine and / or a salt thereof, in particular in a content of at least 0.00001% by weight relative to the total weight of the composition, more in particular at least 0.0001% by weight relative to the total weight of the composition.
[0052] The composition according to the invention additionally comprises: indole-3-lactic acid and / or salts thereof in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; indole-3-carboxaldehyde and / or its salts in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and Indole-3-acetic acid and / or salts thereof in a content of at least 0.000002% by weight relative to the total weight of the composition, in particular at least 0.00001% by weight relative to the total weight of the composition. It is characterized by including
[0053] The composition according to the invention may be such that the total content of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid and / or one of their salts represents at least 0.0001% by weight relative to the total weight of the composition.
[0054] The composition according to the invention may be such that the total content of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid and / or one of their salts is 0.0001% to 10% by weight relative to the total weight of the composition, in particular 0.0001% to 1% by weight relative to the total weight of the composition, more in particular 0.0001% to 0.1% by weight relative to the total weight of the composition, even more in particular 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.00011% by weight relative to the total weight of the composition.
[0055] The composition according to the invention additionally comprises: indole-3-lactic acid and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more in particular ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more in particular ranging from 0.0001% to 0.01% by weight, in particular 0.0001% by weight relative to the total weight of the composition; indole-3-carboxaldehyde and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more in particular ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more in particular ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; and Indole-3-acetic acid and / or a salt thereof, in a content ranging from 0.000002% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.00001% to 1% by weight relative to the total weight of the composition, more in particular ranging from 0.00001% to 0.1% by weight relative to the total weight of the composition, even more in particular ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, in particular 0.00001% by weight relative to the total weight of the composition may include:
[0056] The composition according to the invention may comprise tryptamine and / or its salts in a content of at least 0.00001% by weight relative to the total weight of the composition, more particularly at least 0.0001% by weight relative to the total weight of the composition.
[0057] The composition according to the invention may in particular be such that the weight ratio [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof)] is between 0.5 and 50, in particular between 1 and 10, in particular 1.
[0058] The composition according to the invention may in particular be such that the weight ratio [(indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof)] is 0.5 to 150, in particular 1 to 100, more in particular 1 to 10, in particular 1 or 10.
[0059] The composition according to the invention may in particular be such that the weight ratio [(indole-3-lactic acid and / or salts thereof) / (indole-3-acetic acid and / or salts thereof)] is 0.5 to 50, in particular 1 to 10, in particular 1.
[0060] The composition according to the invention may in particular be such that the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof)] is 1:1:1 to 10:10:1.
[0061] The composition according to the invention may in particular be such that the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof) / (tryptamine and / or a salt thereof)] is 1:1:1:1 to 10:10:1:10, preferably 1:1:1:1 to 10:10:1:1.
[0062] In particular, the compositions according to the invention are those having deposit numbers I-5689 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5904 (deposited by L'Oreal at the CNCM on September 21, 2022), I-5691 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5693 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5694 (deposited by L'Oreal at the CNCM on September 21, 2022), I-5695 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5696 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5697 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5698 (deposited by L'Oreal at the CNCM on September 21, 2022), I-5699 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5699 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5690 (deposited by L'Oreal at the CNCM on September 21, 2022), I-5691 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5692 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5693 (deposited by L'Oreal at the CNCM on June 3, 2021), I-5694 (deposited by L'Oreal at the CNCM on September 21, 2 The culture supernatant or a fraction of a culture supernatant of at least one bacterial strain of the species Staphylococcus epidermidis selected from the group consisting of the bacteria deposited at the CNCM under I-5694 (deposited by L'Oreal at the CNCM on June 7, 2021), I-5694 (deposited by L'Oreal at the CNCM on June 7, 2021), and I-5695 (deposited by L'Oreal at the CNCM on June 7, 2021).
[0063] The compositions according to the invention may be particularly suitable for topical administration.
[0064] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for preventing a decline in the skin barrier function and / or for strengthening the skin barrier function in an individual, which for the purposes of the present invention is preferably a human being.
[0065] Furthermore, the present invention relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for improving skin moisturization.
[0066] The present invention relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for improving the quality of the skin, in particular the quality of dry skin.
[0067] Dry skin feels rough to the touch, appears scaly, and is essentially manifested by a feeling of tightness and / or tension. In fact, dry skin is commonly accompanied by desquamation.
[0068] In physiological terms, dry skin is often associated with a decrease in skin moisture and a negative impact on the barrier function, measured in particular by insensible water loss. Sensory-wise, it is characterized in particular by a feeling of tightness, itchiness, discomfort and / or tension in the skin.
[0069] Dry skin, also known as "xerosis," can appear at any age and may not be associated with a medical condition.
[0070] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for preventing and / or treating cosmetic signs associated with dry skin, in particular selected from tightness, itching, discomfort, dull complexion, rough skin and pronounced microrelief of the skin.
[0071] Furthermore, the present invention relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for preventing and / or treating pruritus, in particular pruritus of skin affected by skin disorders, such as atopic dermatitis.
[0072] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for the prevention and / or treatment of atopic dermatitis. In the implementation of a composition according to the invention, the composition may be particularly suitable for topical administration.
[0073] Finally, the present invention relates to a non-therapeutic cosmetic method for caring for keratinous materials, in particular skin, in particular dry skin, in particular dry skin, which comprises topically applying to these keratinous materials a composition according to the invention.
[0074] Other features, aspects and advantages of the present invention will become apparent from reading the following detailed description. [Brief explanation of the drawings]
[0075] [Figure 1] Figure 1 shows the quantification of total indole concentrations, i.e., the sum of ILA (indole-3-lactic acid), IAld (indole-3-carboxaldehyde), IAA (indole-3-acetic acid), and tryptamine concentrations, in the culture supernatants of the six tested strains, namely the reference strains CNCM I-5689, I-5904, I-5691, I-5693, I-5694, and I-5695. X-axis: From left to right: control, CNCM I-5694, CNCM I-5695, CNCM I-5693, CNCM I-5904, CNCM I-5689, and CNCM I-5691. Y-axis: total indole, pmol / ml. [Figure 2]Figure 2 shows the expression results of AHR pathway markers (CYP1A1) and barrier function markers (FLG) in keratinocytes stimulated with ILA at different concentrations. GAPDH is a reference gene that constitutes NHEK. X-axis: From left to right: 0.005 μM ILA, 0.5 μM ILA, 5 μM ILA, 50 μM ILA, and 250 μM ILA. For each concentration, the bars indicate, from left to right: GAPDH, FLG, and then CYP1A1. Y-axis: Percentage (%) of GAPDH, FLG, and CYP1A1 mRNA expression relative to GAPDH. [Figure 3] Figure 3 shows the expression results of AHR pathway markers (CYP1A1) and barrier function markers (FLG) in keratinocytes stimulated with Iald at different concentrations. GAPDH is a reference gene that constitutes NHEK. X-axis: From left to right: 0.005 μM IAld, 0.5 μM IAld, 5 μM IAld, 50 μM Iald, and 250 μM IAld. For each concentration, the bars indicate, from left to right: GAPDH, FLG, and then CYP1A1. Y-axis: Percentage (%) of GAPDH, FLG, and CYP1A1 mRNA expression relative to GAPDH. [Figure 4] Figure 4 shows the expression results of AHR pathway markers (CYP1A1) and barrier function markers (FLG) in keratinocytes stimulated with IAA at different concentrations. GAPDH is a reference gene that constitutes NHEK. X-axis: From left to right: 0.005 μM IAA, 5 μM IAA, 50 μM IAA, and 250 μM IAA. For each concentration, the bars indicate, from left to right: GAPDH, FLG, and then CYP1A1. Y-axis: Percentage (%) of GAPDH, FLG, and CYP1A1 mRNA expression relative to GAPDH. [Figure 5]Figure 5 shows the expression results of AHR pathway markers (CYP1A1) and barrier function markers (FLG) in keratinocytes stimulated with tryptamine at different concentrations. GAPDH is a reference gene that constitutes NHEK. X-axis: From left to right: 0.005 μM tryptamine, 0.5 μM tryptamine, 5 μM tryptamine, 50 μM tryptamine, and 250 μM tryptamine. For each concentration, the bars indicate, from left to right: GAPDH, FLG, and then CYP1A1. Y-axis: Percentage (%) of GAPDH, FLG, and CYP1A1 mRNA expression relative to GAPDH. [Figure 6] Figure 6 shows the expression results of AHR pathway markers (CYP1A1) and barrier function markers (FLG) in keratinocytes stimulated with a 1:1:1:1 mixture of ILA, IAld, IAA, and tryptamine (0.5 μM (4 × 0.5 μM), 5 μM (4 × 5 μM), or 50 μM (4 × 50 μM) dose for each compound). GAPDH is a reference gene that constitutes NHEK. X-axis: From left to right: 4 × 0.5 μM mixture, 4 × 5 μM mixture, and 4 × 50 μM mixture. At each concentration, the bars indicate, from left to right: GAPDH, FLG, and CYP1A1. Y-axis: Percentage (%) of GAPDH, FLG, and CYP1A1 mRNA expression relative to GAPDH. [Figure 7] Figure 7 shows the expression results of AHR pathway markers (CYP1A1) and barrier function markers (FLG) in keratinocytes stimulated with two compositions containing (i) 5 μM ILA, 0.5 μM Iald, and 0.5 μM IAA (5 + 0.5 + 0.5 μM), or (ii) 5 μM ILA, 0.5 μM Iald, and 5 μM IAA (5 + 0.5 + 5 μM). GAPDH is a reference gene constituting NHEK. X-axis: From left to right: 5 + 0.5 + 0.5 μM mixture; 5 + 0.5 + 5 μM mixture. At each concentration, the bars indicate, from left to right: GAPDH, FLG, and then CYP1A1. Y-axis: Percentage (%) of GAPDH, FLG, and CYP1A1 mRNA expression relative to GAPDH. DETAILED DESCRIPTION OF THE INVENTION
[0076] Compositions according to the invention
[0077] The composition according to the invention is preferably a cosmetic product.
[0078] The compositions according to the invention are preferably suitable for topical application to keratinous materials, in particular to the skin, and therefore comprise a physiologically acceptable medium, ie a medium that is compatible with said skin.
[0079] The term "cosmetics" means compositions that are compatible with keratinous materials, in particular the skin, mucous membranes and skin appendages. The compositions according to the invention are non-therapeutic.
[0080] The term "keratinous materials" is intended to refer in particular to skin, mucous membranes, fibers, eyelashes and skin appendages.
[0081] The term "skin" means all skin of the body, preferably the skin of the face, the skin of the scalp, the skin of the nape of the neck, the skin of the arms and the skin of the forearms, more preferably also the skin of the face (in particular the skin of the forehead, nose, cheeks and chin), the skin of the nape of the neck and the skin of the neck.
[0082] For the purposes of the present invention, the term "physiologically acceptable" is intended to mean a medium that has a pleasant color, odor and feel and does not cause any unacceptable discomfort, i.e., stinging or tightness, that would discourage the user from applying the composition.
[0083] As used herein, the terms "treat" and "treatment" refer to the alleviation and / or elimination of symptoms associated with a particular disorder or condition, and also the complete disappearance of the disorder or condition in question.
[0084] In the context of the present invention, the words "prevent" and "prevention" refer to reducing to a lesser extent the risk or probability of occurrence of a given phenomenon.
[0085] The invention therefore makes it possible to impart beneficial properties to the skin, in particular an effective barrier function; a moisturizing effect; elasticity and smooth texture of the skin; a surface morphology with less roughness; good tissue cohesion; a good thickness of the stratum corneum; and an improvement in the visual appearance of the skin, in a particularly durable manner.
[0086] In physiological terms, dry skin is often associated with, among other things, a decrease in skin moisture content and a negative impact on the barrier function, as measured by insensible water loss. Sensory-wise, it is characterized in particular by a feeling of tightness, itchiness, discomfort, and / or tension in the skin. For obvious reasons, these symptoms are unpleasant.
[0087] The compositions according to the invention therefore prove very particularly effective for treating conditions of dry skin, for treating dry skin, for treating itching and / or tightness associated with dry skin, for physiological restoration of the proper moisturizing state of the stratum corneum, for treating hyposeborrheic dry skin, for improving the comfort of dry skin or for combating the dull and / or lifeless appearance of the skin as a result of dryness.
[0088] As previously indicated, the compositions according to the present invention comprise: (i) indole-3-lactic acid (ILA) and / or salts thereof; (ii) indole-3-carboxaldehyde (IAld) and / or salts thereof; and (iii) indole-3-acetic acid (IAA) and / or salts thereof.
[0089] According to the present invention, a "salt" of an indole means a salt formed with an inorganic or organic acid or with an inorganic or organic base.
[0090] As examples of acid salts, mention may be made of sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, isonicotinate, lactate, salicylate, tartrate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharinate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, aspartate and glutamate.
[0091] Examples of base salts that may be mentioned include hydroxides of alkali metals, such as sodium, potassium, and lithium; hydroxides of alkaline earth metals, such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; aqueous ammonia and organic amines, such as unsubstituted or hydroxy-substituted mono-, di-, or trialkylamines; dicyclohexylamine; tributylamine; pyridine; N-methyl-N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris(2-hydroxyalkylamines), such as mono-, bis-, or tris(2-hydroxyethyl)amine; 2-hydroxy-tert-butylamine, or tris(hydroxymethyl)methylamine, N,N-dialkyl-N-(hydroxyalkyl)amines, such as N,N-dimethyl-N-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids, such as arginine and lysine.
[0092] The indole salts according to the invention are preferably basic salts, in particular sodium or potassium salts.
[0093] According to one variant, in the composition according to the invention, the indole-3-acetic acid is in the form of a base salt, preferably in the form of an inorganic base salt, more preferably in the form of an alkali metal salt, such as sodium, potassium and lithium, and even more preferably in the form of the sodium salt.
[0094] According to one variant, in the composition according to the invention, the indole-3-carboxaldehyde is present in non-salified form.
[0095] According to one variant, in the composition according to the invention, the indole-3-lactic acid is present in non-salted form or in the form of a base salt, preferably in the form of an inorganic base salt, more preferably in the form of a salt of an alkali metal, such as sodium, potassium and lithium, even more preferably in the form of a sodium salt, and preferably the indole-3-lactic acid is present in non-salted form.
[0096] The composition according to the present invention preferably comprises (i) indole-3-lactic acid (ILA) or a salt thereof; (ii) indole-3-carboxaldehyde (IAld) or a salt thereof, and (iii) indole-3-acetic acid (IAA) or a salt thereof.
[0097] The indole-3-lactic acid (ILA) of the composition according to the invention is of formula (I) below: [ka]
[0098] The composition according to the invention may comprise indole-3-lactic acid and / or salts thereof in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition.
[0099] The composition according to the invention may comprise indole-3-lactic acid and / or salts thereof in a content of at least 0.001% by weight relative to the total weight of the composition, in particular at least 0.005% by weight relative to the total weight of the composition.
[0100] The composition according to the invention may comprise indole-3-lactic acid and / or salts thereof in a content of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight relative to the total weight of the composition, more in particular less than 0.1% by weight relative to the total weight of the composition, and even more in particular less than 0.01% by weight relative to the total weight of the composition.
[0101] The composition according to the present invention may contain indole-3-lactic acid and / or a salt thereof in a content ranging from 0.00001% by weight to 10% by weight relative to the total weight of the composition, particularly ranging from 0.0001% by weight to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% by weight to 0.1% by weight relative to the total weight of the composition, and even more particularly ranging from 0.0001% by weight to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition.
[0102] The indole-3-carboxaldehyde (IAld) of the composition according to the invention may be of formula (II) below: [ka]
[0103] The composition according to the invention may comprise indole-3-carboxaldehyde (IAld) and / or its salts in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition.
[0104] The composition according to the invention may comprise indole-3-carboxaldehyde and / or its salts in a content of at least 0.001% by weight relative to the total weight of the composition, in particular at least 0.004% by weight relative to the total weight of the composition.
[0105] The composition according to the invention may comprise indole-3-carboxaldehyde and / or its salts in a content of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight relative to the total weight of the composition, more in particular less than 0.1% by weight relative to the total weight of the composition, and even more in particular less than 0.01% by weight relative to the total weight of the composition.
[0106] The composition according to the present invention may comprise indole-3-carboxaldehyde and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular from 0.0001% to 1% by weight relative to the total weight of the composition, more in particular from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more in particular from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition.
[0107] The indole-3-acetic acid (IAA) of the composition according to the invention is of formula (III) below: [ka]
[0108] The composition according to the invention may comprise indole-3-acetic acid (IAA) and / or salts thereof in a content of at least 0.000002% by weight relative to the total weight of the composition, in particular at least 0.00001% by weight relative to the total weight of the composition.
[0109] The composition according to the invention may comprise indole-3-acetic acid (IAA) and / or its salts in a content of at least 0.001% by weight relative to the total weight of the composition, in particular at least 0.004% by weight relative to the total weight of the composition.
[0110] The composition according to the invention may comprise indole-3-acetic acid and / or salts thereof in a content of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight relative to the total weight of the composition, more in particular less than 0.1% by weight relative to the total weight of the composition, and even more in particular less than 0.01% by weight relative to the total weight of the composition.
[0111] The composition according to the present invention may comprise indole-3-acetic acid and / or a salt thereof in a content ranging from 0.000002% to 10% by weight relative to the total weight of the composition, in particular from 0.00001% to 1% by weight relative to the total weight of the composition, more in particular from 0.00001% to 0.1% by weight relative to the total weight of the composition, and even more in particular from 0.00001% to 0.01% by weight relative to the total weight of the composition, for example 0.00001% by weight relative to the total weight of the composition.
[0112] Indole-3-acetic acid (IAA) may in particular be present in the composition according to the invention, wholly or partly, in the form of a base salt, preferably an alkali metal salt, more preferably a sodium salt.
[0113] In the composition according to the invention, the total content of indole-3-lactic acid (and / or salts thereof), indole-3-carboxaldehyde (and / or salts thereof) and indole-3-acetic acid (and / or salts thereof) may be at least 0.0001% by weight relative to the total weight of the composition, in particular at least 0.00011% by weight relative to the total weight of the composition.
[0114] The composition according to the invention may in particular be one in which the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof)] is 0.5 to 50, in particular 1 to 10, for example 1.
[0115] The composition according to the invention may in particular be one in which the weight ratio of [(indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof)] is 0.5 to 150, in particular 1 to 100, more in particular 1 to 10, for example 1 or 10.
[0116] The composition according to the invention may in particular be one in which the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof)] is 0.5 to 50, in particular 1 to 10, for example 1.
[0117] The composition according to the present invention may particularly be one in which the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof)] is 1:1:1 to 10:10:1.
[0118] In particular, the composition according to the invention comprises: indole-3-lactic acid and / or a salt thereof, in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more in particular ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more in particular ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition; indole-3-carboxaldehyde and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition; and The composition may contain indole-3-acetic acid and / or a salt thereof, particularly the sodium salt, in an amount ranging from 0.000002% by weight to 10% by weight relative to the total weight of the composition, particularly ranging from 0.00001% by weight to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.00001% by weight to 0.1% by weight relative to the total weight of the composition, even more particularly ranging from 0.00001% by weight to 0.01% by weight, for example, 0.00001% by weight relative to the total weight of the composition.
[0119] The composition according to the invention may further comprise tryptamine and / or a salt thereof.
[0120] The tryptamine is of formula (IV): [ka]
[0121] Tryptamine and / or its salts may be present in the composition according to the invention in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition.
[0122] The composition according to the invention may comprise tryptamine and / or salts thereof in a content of less than 10% by weight relative to the total weight of the composition, in particular less than 1% by weight relative to the total weight of the composition, more in particular less than 0.1% by weight relative to the total weight of the composition, and even more in particular less than 0.01% by weight relative to the total weight of the composition.
[0123] The composition according to the present invention may contain tryptamine and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, particularly ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, and even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition.
[0124] In particular, the composition according to the invention comprises: Indole-3-lactic acid and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, for example 0.0001% by weight relative to the total weight of the composition; and indole-3-carboxaldehyde and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more particularly ranging from 0.0001% to 0.01% by weight, for example 0.0001% by weight relative to the total weight of the composition; and indole-3-acetic acid and / or a salt thereof, in particular the sodium salt, in a content ranging from 0.000002% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.00001% to 1% by weight relative to the total weight of the composition, more in particular ranging from 0.00001% to 0.1% by weight relative to the total weight of the composition, even more in particular ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, for example 0.00001% by weight relative to the total weight of the composition; and Tryptamine and / or a salt thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more particularly ranging from 0.0001% to 0.01% by weight, for example 0.0001% by weight relative to the total weight of the composition. may include:
[0125] In the composition according to the present invention, the total content of indole-3-lactic acid (and / or a salt thereof), indole-3-carboxaldehyde (and / or a salt thereof), indole-3-acetic acid (and / or a salt thereof), and tryptamine and / or a salt thereof may be at least 0.0003% by weight, based on the total weight of the composition.
[0126] The composition according to the invention may in particular be such that the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof) / (tryptamine and / or a salt thereof)] is 1:1:1:1 to 10:10:1:10, preferably 1:1:1:1 to 10:10:1:1.
[0127] The composition according to the invention may in particular comprise a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain producing indole-3-lactic acid and / or its salts, indole-3-carboxaldehyde and / or its salts and indole-3-acetic acid and / or its salts, and optionally tryptamine and / or its salts, in particular also tryptamine and / or its salts.
[0128] The composition according to the invention may in particular comprise a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain of the species Staphylococcus epidermidis which produces indole-3-lactic acid and / or its salts, indole-3-carboxaldehyde and / or its salts and indole-3-acetic acid and / or its salts, and also optionally tryptamine and / or its salts, and in particular also tryptamine.
[0129] Thus, the composition according to the invention preferably comprises a culture supernatant or a fraction of a culture supernatant of at least one bacterial strain of the species Staphylococcus epidermidis selected from the group constituted by the bacteria deposited at the CNCM under the accession numbers I-5689, I-5904, I-5691, I-5693, I-5694 and I-5695.
[0130] The composition according to the invention additionally comprises at least one adjuvant selected from the group consisting of fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof.
[0131] Such adjuvants may represent from 0.0001% to 20% by weight, preferably from 0.01% to 10% and better still from 0.1% to 5% by weight relative to the total weight of the composition.
[0132] Of course, the skilled artisan will take care to select the adjuvant or adjuvants and / or the amount thereof so that the advantageous properties of the indole derivatives of the compositions according to the invention are not or substantially not adversely affected by the envisaged addition.
[0133] According to one embodiment, the composition according to the invention may comprise water.
[0134] In particular, the composition according to the invention may contain 20% to 90% by weight, preferably 30% to 60% by weight, of water relative to the total weight of the composition.
[0135] The composition according to the invention may further comprise at least one additional cosmetic active agent.
[0136] This may in particular be at least one active agent for caring for dry skin, such as glycerol or urea.
[0137] In the context of the present invention, the term "additional active agent" means a compound that acts on its own, i.e., a compound that does not require the intervention of an external agent to be active.
[0138] Additional active agents that can be used in the compositions of the present invention can be selected from desquamating agents, soothing agents, anti-inflammatory agents, anti-aging agents, wound healing agents, antibacterial agents, vitamins, and mixtures thereof in any proportion.
[0139] The additional active agents used in the composition according to the invention may represent from 0.0001% to 20% by weight, preferably from 0.01% to 10% by weight, and better still from 0.1% to 5% by weight, relative to the total weight of the composition.
[0140] Of course, one skilled in the art will take care to select this compound or any one or more of these additional compounds, and / or the amount thereof, such that the advantageous properties of the compositions according to the invention are not adversely affected or are not substantially affected by the envisaged addition.
[0141] The compositions according to the invention may be in any presentation form normally used in the cosmetics field.
[0142] The compositions according to the invention may in particular be in the form of an aqueous or aqueous-alcoholic solution, which may be gelled, a lotion-type dispersion, a two-phase dispersion, an oil-in-water or water-in-oil emulsion, a multiple emulsion, an aqueous gel, or a dispersion of oil in an aqueous phase, and in particular may use spheres, which may be polymer particles or, better still, lipid vesicles of ionic and / or nonionic type, and which have a more or less fluid liquid consistency.
[0143] Preferably, the compositions according to the invention are different from compositions which essentially have a detergent purpose with respect to the skin, hair and / or mucous membranes, such as soaps, shampoos and shower gels for washing and / or cleansing.
[0144] The compositions according to the invention are preferably suitable for topical administration.
[0145] Thus, the compositions according to the invention may contain all the ingredients normally used in the topical application and administration envisaged.
[0146] The compositions according to the invention may advantageously be in the form of an emulsion, in particular of liquid or semi-liquid consistency of the milk type, or of soft consistency, obtained by dispersion of an aqueous phase in a fatty phase (W / O) or of a fatty phase in an aqueous phase (O / W), or even in the form of a multiple emulsion (W / O / W or O / W / O). These compositions are prepared according to the usual known methods.
[0147] More particularly, the compositions according to the invention may be intended for topical application and may preferably be in the form of an emulsion, preferably an oil-in-water emulsion, preferably such an emulsion is not intended to be washed off after application.
[0148] The compositions according to the invention are preferably intended to be applied to the skin.
[0149] Preferably, the skin is the skin of the face, scalp, nape, neck, arms or forearms, or more preferably the skin of the face (especially the forehead, nose, cheeks, chin), nape and neck.
[0150] The pH of the composition is advantageously less than or equal to 8, preferably in the range 4 to 7, more preferably in the range 4.5 to 6.5.
[0151] Alternatively, the composition may be in the form of a face and / or body care or make-up product, packaged, for example, as a cream in a jar or a fluid in a tube or in a pump or dropper bottle.
[0152] The compositions according to the present invention may be prepared via any known method generally known in the cosmetic art.
[0153] The ingredients are mixed before molding in an order and under conditions that can be readily determined by one skilled in the art.
[0154] According to a particular embodiment of the invention, other agents intended to enhance the appearance and / or texture of the skin may also be added to the compositions according to the invention.
[0155] Use and Method
[0156] According to one of its aspects, the invention relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for preventing a decline in the skin barrier function and / or for strengthening the skin barrier function in an individual.
[0157] According to yet another of its aspects, the invention relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for improving skin moisturization.
[0158] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for improving the quality of said skin, in particular the quality of dry skin.
[0159] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for preventing and / or treating cosmetic signs associated with dry skin, in particular selected from tightness, itching, discomfort, dull complexion, rough skin and pronounced microrelief of the skin.
[0160] Moreover, one subject of the present invention relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention for preventing and / or treating pruritus, in particular pruritus of skin affected by skin disorders, such as atopic dermatitis.
[0161] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of such compositions for the prevention and / or treatment of atopic dermatitis.
[0162] According to yet another of its aspects, the present invention relates to a non-therapeutic cosmetic method as described above for caring for keratinous materials, in particular skin, in particular dry skin, which comprises topically applying to these keratinous materials a composition according to the invention.
[0163] The cosmetic uses and methods contemplated according to the present invention are non-therapeutic.
[0164] The cosmetic uses and methods of the present invention are preferably carried out by topically administering a composition according to the present invention.
[0165] Topical administration consists of applying the cosmetic composition externally to the skin, according to the usual techniques for using these compositions.
[0166] By way of example, a cosmetic use or method according to the invention may be carried out by topically, for example daily, applying at least one composition according to the invention, which may be formulated, for example, in the form of a cream, gel, serum, lotion, emulsion or makeup-removing milk, preferably in the form of an emulsion.
[0167] The administration may be repeated, for example, once or twice daily for one or more days, generally for an extended period of at least 4 weeks, and even 4 to 15 weeks, with one or more rest periods, if appropriate.
[0168] According to one embodiment, the administration is daily (once a day) and is generally carried out over an extended period of at least 4 weeks, and even 4 to 15 weeks, with one or more rest periods, if appropriate.
[0169] According to one embodiment, the cosmetic treatment method according to the invention may comprise a single application.
[0170] Throughout this specification, including the claims, the words "to" and "ranging from" should be understood to mean inclusive limits unless otherwise indicated.
[0171] The examples presented below illustrate the invention without limiting its scope.
[0172] In the examples, unless otherwise specified, temperatures are room temperature (20° C.) and are expressed in degrees Celsius, and pressures are atmospheric.
[0173] Example
[0174] Materials and Methods
[0175] Strain origin, CNCM name, and cultivation method
[0176] Eight selected strains of Staphylococcus epidermidis were collected from normal, healthy subjects. The samples were obtained using the swabbing method, as previously described in, for example, Leung, MHY et al., "Changes of the human skin microbiota upon chronic exposure to polycyclic aromatic hydrocarbon pollutants," Microbiome 8, 100 (2020). The collected bacteria were isolated on tryptone soy agar (TSA) and stored in the form of frozen stocks.
[0177] These six strains are: Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021, under the accession number CNCM I-5689 (I-5689); Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on September 21, 2021, under the accession number CNCM I-5904 (I-5904); Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on September 21, 2021, under the accession number CNCM I-5904 (I-5904). A Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021 under accession number I-5691 (I-5691); a Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021 under accession number I-5693 (I-5693); a Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 7, 2021 under accession number I-5694 (I-5694); and a Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 7, 2021 under accession number I-5694 (I-5694). The S. epidermidis (S. epidermidis) strain was deposited by L'Oreal at the CNCM on June 7, 2021, under the accession number CNCM I-5695 (I-5695).
[0178] The bacterial strains were cultured using conventional microbiological techniques in either tryptic soy broth (TSB) or keratinocyte serum-free medium (KSFM).
[0179] Culture and treatment of keratinocytes
[0180] Normal neonatal human primary epidermal keratinocytes (NHEK) (CellnTec) were cultured in medium supplemented with CnT-57 (CellnTec) containing bovine pituitary extract (BPE) at 37°C and 5% CO2. NHEK cells were cultured to approximately 90% confluence in keratinocyte-SFM medium (Gibco, LifeTech, Corp., Grand Island, USA) supplemented with 0.035 μg / μl EGF and 12.4 mg / ml BPE (Gibco) for 24 hours before treatment. For bacterial supernatant treatment, NHEK cells were treated with sterile bacterial supernatant at a final concentration of 50% (v / v) in KSFM medium and incubated for 14 hours. NHEK cells were then harvested for RNA extraction. After treatment, the medium was collected and subjected to IL-8 quantification (IL-8 DuoSet ELISA, R&D Systems) and cytotoxicity assay (CyQuant™ LDH cytotoxicity assay, Thermo Fisher Scientific), and the cells were harvested for real-time quantitative PCR assay.
[0181] Real-time quantitative PCR
[0182] Total RNA was extracted from keratinocytes using the Rneasy Micro kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol, with additional treatment with DNase (Rnase-Free Dnase Set, Qiagen). The RNA concentration was measured using Nanodrop 商標 The mRNA levels were determined using a Nanodrop 1000 (Thermo Scientific). iScript cDNA Synthesis (Biorad) was used for cDNA synthesis. 商標 Real-Time PCR system (Applied Biosystems商標 ) and SYBR Green Master Mix (Biorad). Data from quantitative PCR (qPCR) were analyzed using the 2-ΔΔCt quantification method, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for eukaryotic cells and GyrB (DNA gyrase subunit B) for staphylococcus as endogenous controls. Primers for FLG, IVL, KLK7, DSG1, CDSN, Ki67, DEFB4, STAT6, OVOL1, and OVOL2 were provided by Biorad; other primer sequences are listed below.
[0183] Target gene CYP1A1: Sense primer (5'-3') sequence of SEQ ID NO: 1: CAGCTCAGCTCAGTACCTCA (SEQ ID NO: 1), and antisense primer (3'-5') sequence of SEQ ID NO: 2: CTTGAGGCCCTGATTACCCA (SEQ ID NO: 2).
[0184] Target gene GyrB Se: sense primer (5'-3') sequence of SEQ ID NO: 3: GTTGTAATTGAGAAAGACAATTG (SEQ ID NO: 3), and antisense primer of SEQ ID NO: 4: TACAGTTAAGATAACTTCGACAG (SEQ ID NO: 4).
[0185] Quantification of AhR metabolites / ligands
[0186] Preparation: 5-hydroxyindoleacetic acid-d5, serotonin-d4, indole-3-acetic acid-d4, kynurenic acid-d5, melatonin-d4, piconylic acid-d3, tryptamine-d4, and xanthurenic acid-d4 were purchased from Santa Cruz Biotechnology. 3-hydroxyanthranilic acid-d4, 3-hydroxykynurenine-13C2-15N, 5-hydroxytryptophan-d4, indole-3-acetamide-d5, kynurenine-d4, and tryptophan-d5 were purchased from Toronto Research Chemicals.
[0187] Stock solutions of labeled analytes were prepared in water containing 0.1% formic acid, and final concentrations were chosen to correspond to the estimated concentrations of endogenous metabolites.
[0188] Metabolite extraction: Metabolites were extracted from 50 μl of culture medium and collected as described above. After adding 100 μl of the preparation shown above and 300 μl of methanol, the sample was mixed for 15 seconds and homogenized at −20°C for 30 minutes. After centrifugation at 5000 rpm for 10 minutes at −4°C, 350 μl of supernatant was collected and concentrated under a stream of nitrogen. The residue was redissolved in 100 μl of methanol / water (1:9) and transferred to a 96-well plate for LC-HRMS analysis.
[0189] Instrumentation: The analysis was performed as previously described in Lefevre, A. et al., Talanta 195, 593-598 (2019). Briefly, 2 μl was analyzed by LC-MS (XEVO-TQ-XS, Waters 登録商標 ) was injected into a Kinetex C18 xb column (1.7 μm × 150 mm × 2.1 mm, temperature 55°C) with a gradient of two-phase mobile phase (phase A: water + 0.5% formic acid; phase B: methanol + 0.5% formic acid) at a flow rate of 0.4 ml / min.
[0190] For each metabolite, a calibration curve was used to determine the concentration of each metabolite in the samples.
[0191] statistical analysis
[0192] All experiments were performed in at least three biological replicates. Data are presented as mean ± SEM. GraphPad Prism (version 7.0; GraphPad Software, La Jolla, California) was used. Data were analyzed using the Kruskal-Wallis test followed by Dunnett's multicomparison test. Results were considered statistically significant when p < 0.05.
[0193] Example 1: Selection of six Staphylococcus epidermidis strains based on secretion of indole in the culture supernatant
[0194] This selection of Staphylococcus epidermidis strains was based on their secretion of indole into the culture supernatant when cultured alone, and the ability of the supernatant to activate the AHR pathway and genes involved in skin barrier function.
[0195] Multiple unique strains were cultured in TSB for 16 h, then the supernatants were collected to first quantify indole metabolites, and then keratinocytes were processed and Rt-qPCR analysis of targeted genes was performed according to the protocol detailed above.
[0196] result
[0197] Quantification of the concentration of indoles in the culture supernatants showed that for six of the strains tested, namely those previously designated with reference numbers I-5689, I-5904, I-5691, I-5693, I-5694 and I-5695, the total indole concentration (i.e., the sum of the concentrations of ILA (indole-3-lactic acid), IAld (indole-3-carboxaldehyde), IAA (indole-3-acetic acid) and tryptamine) was greater than 443 pmol / ml (see Table 1 below and Figure 1).
[0198] [Table 1]
[0199] Supernatants from each of these strains not only result in overexpression of CYP1A1 (more than 2.7-fold) compared to untreated cells, but also in overexpression of OVOL1.
[0200] [Table 2]
[0201] [Table 3]
[0202] Example 2: Specific compositions of indoles that mimic the presence of bacteria and maintain skin barrier function
[0203] This example describes indole compositions that activate the AHR pathway and maintain skin barrier function.
[0204] An effective mixture of indoles is a composition that leads to overexpression of genes for AHR pathway activation (specifically, the CYP1A1 and OVOL1 genes, as described by Furue et al. Int. J. Mol. Sci. 20, (2019)) and stimulation of differentiation (FLG-filaggrin).
[0205] Cytotoxicity and inflammation (IL-8) were not measured with any of the indoles or indole mixtures tested.
[0206] A. First, four indoles alone were tested according to the protocol presented above at different concentrations: 0.005 μM; 0.5 μM; 5 μM; 50 μM; or 250 μM for ILA, Iald, and tryptamine, and 0.005 μM; 5 μM; 50 μM; or 250 μM for IAA.
[0207] The results of the expression of a marker of the AHR pathway (CYP1A1) and a marker of barrier function (FLG) in keratinocytes stimulated with indoles alone are presented in Figure 2 (ILA), Figure 3 (IAd), Figure 4 (IAA), and Figure 5 (tryptamine).
[0208] Thus, with the exception of ILA, which has a minimum active concentration of approximately 50 M, the other three indoles each have a minimum active concentration of 250 μM when used alone.
[0209] B. Various mixtures of these indoles were also tested additionally according to the protocol presented previously.
[0210] a. First, ILA, IAld, IAA and tryptamine were mixed in a 1:1:1:1 ratio and administered at doses of 0.5, 5 or 50 μM per compound (i.e., three experiments with total indole concentrations of 2, 20 and 200 μM).
[0211] The results obtained are shown in FIG.
[0212] Unexpectedly, the minimum active concentration of this mixture was observed at 20 μM (5 μM ILA+5 μM Iald+5 μM IAA+5 μM tryptamine).
[0213] This concentration is the concentration required to obtain activity that was only obtained with the individual compounds starting at 50 μM in the case of ILA and 250 μM in the case of the other three indoles.
[0214] Therefore, it was surprisingly observed that this composition was superior to the individual compounds.
[0215] b. Different mixtures containing ILA, Iald and IAA were also tested according to the protocol previously presented.
[0216] Therefore, two compositions containing (i) 5 μM ILA, 0.5 μM Iald and 0.5 μM IAA, or (ii) 5 μM ILA, 0.5 μM Iald and 5 μM IAA were tested, respectively.
[0217] The results obtained are shown in FIG.
[0218] Unexpectedly, the minimum active concentration of this mixture was observed at 10.5 μM (5 μM ILA+0.5 μM Iald+5 μM IAA sodium salt).
[0219] This concentration was necessary to obtain the activity obtained only when starting with 50 μM for ILA and 250 μM for the other three indoles. Moreover, this activity was obtained in the absence of tryptamine.
[0220] Therefore, it was surprisingly observed that this composition was superior to the individual compounds.
[0221] [Table 4]
[0222] [Table 5]
[0223] [Table 6]
Claims
1. In a physiologically acceptable medium, At least indole-3-lactic acid and / or a salt thereof; indole-3-carboxaldehyde and / or a salt thereof; and indole-3-acetic acid and / or a salt thereof; and fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof.
1. A composition, in particular a cosmetic composition, in particular a composition for caring for keratinous materials, in particular a cosmetic composition, comprising at least one adjuvant selected from the group consisting of:
2. The composition of claim 1 further comprising tryptamine and / or a salt thereof.
3. The composition comprises: indole-3-lactic acid and / or salts thereof in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and indole-3-carboxaldehyde and / or its salts in a content of at least 0.00001% by weight relative to the total weight of the composition, in particular at least 0.0001% by weight relative to the total weight of the composition; and indole-3-acetic acid and / or salts thereof in a content of at least 0.000002% by weight relative to the total weight of the composition, in particular at least 0.00001% by weight relative to the total weight of the composition 3. The composition according to claim 1 or 2, characterized in that it comprises:
4. 4. The composition according to claim 1, wherein the total content of indole-3-lactic acid, indole-3-carboxaldehyde and indole-3-acetic acid, and / or one of their salts, represents at least 0.0001% by weight relative to the total weight of the composition.
5. The composition comprises: indole-3-lactic acid and / or salts thereof in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; indole-3-carboxaldehyde and / or its salts in a content ranging from 0.00001% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.0001% to 1% by weight relative to the total weight of the composition, more particularly ranging from 0.0001% to 0.1% by weight relative to the total weight of the composition, even more particularly ranging from 0.0001% to 0.01% by weight relative to the total weight of the composition, in particular 0.0001% by weight relative to the total weight of the composition; and Indole-3-acetic acid and / or a salt thereof in a content ranging from 0.000002% to 10% by weight relative to the total weight of the composition, in particular ranging from 0.00001% to 1% by weight relative to the total weight of the composition, more in particular ranging from 0.00001% to 0.1% by weight relative to the total weight of the composition, even more in particular ranging from 0.00001% to 0.01% by weight relative to the total weight of the composition, in particular 0.00001% by weight relative to the total weight of the composition The composition according to any one of claims 1 to 4, characterized in that it comprises:
6. 6. The composition according to claim 2, wherein the content of tryptamine and / or salts thereof is at least 0.00001% by weight relative to the total weight of the composition, more particularly at least 0.0001% by weight relative to the total weight of the composition.
7. 7. The composition according to claim 1, wherein the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof)] is between 0.5 and 50, in particular between 1 and 10, in particular 1.
8. 8. The composition according to claim 1, wherein the weight ratio of [(indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof)] is 0.5 to 150, in particular 1 to 100, more in particular 1 to 10, in particular 1 or 10.
9. 9. The composition according to claim 1, wherein the weight ratio of [(indole-3-lactic acid and / or salts thereof) / (indole-3-acetic acid and / or salts thereof)] is 0.5 to 50, in particular 1 to 10, in particular 1.
10. The composition according to any one of claims 1 to 9, wherein the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof)] is 1:1:1 to 10:10:
1.
11. 11. The composition according to claim 2, wherein the weight ratio of [(indole-3-lactic acid and / or a salt thereof) / (indole-3-carboxaldehyde and / or a salt thereof) / (indole-3-acetic acid and / or a salt thereof) / (tryptamine and / or a salt thereof)] is 1:1:1:1 to 10:10:1:10, preferably 1:1:1:1 to 10:10:1:
1.
12. 12. The composition according to any one of claims 1 to 11, wherein the composition comprises a culture supernatant or a fraction of said culture supernatant of at least one bacterial strain of the species Staphylococcus epidermidis selected from the group consisting of the bacteria deposited at the CNCM under the accession numbers I-5689, I-5904, I-5691, I-5693, I-5694 and I-5695.
13. The composition of any one of claims 1 to 12, wherein the composition is suitable for topical administration.
14. Cosmetic use, in particular topical cosmetic use, of a composition according to any one of claims 1 to 13 for preventing a decline in skin barrier function and / or for strengthening said skin barrier function in an individual.
15. Cosmetic use, in particular topical cosmetic use, of a composition according to any one of claims 1 to 13 for improving skin moisturisation.
16. Cosmetic use, in particular topical cosmetic use, of a composition according to any one of claims 1 to 13 for improving the quality of said skin, in particular the quality of dry skin.
17. 14. Non-therapeutic cosmetic use, in particular non-therapeutic topical cosmetic use, of a composition according to any one of claims 1 to 13 for the prevention and / or treatment of cosmetic signs associated with dry skin, in particular cosmetic signs associated with dry skin selected from tightness, itching, discomfort, dull complexion, roughness of the skin and pronounced microrelief of the skin.
18. 14. Non-therapeutic cosmetic use, in particular non-therapeutic topical cosmetic use, of a composition according to any one of claims 1 to 13 for preventing and / or treating pruritus, in particular pruritus of skin affected by skin disorders, such as atopic dermatitis.
19. A composition according to any one of claims 1 to 13 for use in the prevention and / or treatment of atopic dermatitis.
20. Cosmetic use according to any one of claims 14 to 18, or composition for use according to claim 19, wherein the composition is suitable for topical administration.
21. A non-therapeutic cosmetic method for caring for keratinous materials, in particular skin, in particular dry skin, which comprises topically applying to these keratinous materials a composition according to any one of claims 1 to 13.