Non-human animals with engineered immunoglobulin lambda light chains and uses thereof

Abstract

To provide non-human animals having an engineered immunoglobulin lambda light chain and uses thereof.SOLUTION: Non-human animals (and / or non-human cells) having a genome comprising human antibody-encoding sequences (i.e., immunoglobulin genes) and methods of use thereof are provided. The non-human animals described herein express antibodies comprising an immunoglobulin (Ig) light chain characterized by the presence of a human V λ domain. The non-human animals provided herein are, in some embodiments, characterized by expressing an antibody that comprises a human V λ light chain encoded by a human Ig λ light chain coding sequence inserted into the endogenous Ig κ light chain locus of the non-human animal. Methods for producing an antibody comprising a human variable region and a mouse constant region from a non-human animal are also provided.SELECTED DRAWING: Figure 18

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62 / 594,944, filed December 5, 2017, U.S. Provisional Application No. 62 / 594,946, filed December 5, 2017, U.S. Provisional Application No. 62 / 609,241, filed December 21, 2017, and U.S. Provisional Application No. 62 / 609,251, filed December 21, 2017, each of which is incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing, which has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. This ASCII copy was created on December 3, 2018, is named 2010794-1440_SL.txt, and is 30,059 bytes in size. [Background technology]

[0003] Human antibodies are the fastest growing class of therapeutic agents. Among the technologies currently used to generate human antibodies, the development of genetically engineered animals (e.g., rodents) engineered with genetic material encoding all or part of a human antibody has revolutionized the field of human therapeutic monoclonal antibodies for the treatment of various diseases, although there remains a need to develop improved in vivo systems for producing human monoclonal antibodies that maximize the human antibody repertoire in the genetically engineered host animal. Summary of the Invention

[0004] In some embodiments, the present disclosure provides a rodent, wherein the germline genome of the rodent comprises: (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments; (c) one or more Cλ genes; an engineered endogenous immunoglobulin kappa light chain locus comprising Including, The one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to one or more Cλ genes, and the rodent does not contain a rodent Cκ gene at the engineered endogenous immunoglobulin κ locus.

[0005] In some embodiments, the one or more Cλ genes is a Cλ gene. In some embodiments, the Cλ gene is or comprises a rodent Cλ gene. In some embodiments, the rodent Cλ gene has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a mouse Cλ1 gene, a mouse Cλ2 gene, or a mouse Cλ3 gene. In some embodiments, the rodent Cλ gene is or comprises a mouse Cλ1 gene. In some embodiments, the rodent Cλ gene is or comprises a rat Cλ gene. In some embodiments, the rat Cλ gene has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a rat Cλ1 gene, a rat Cλ2 gene, a rat Cλ3 gene, or a rat Cλ4 gene.

[0006] In some embodiments, one or more human Vλ gene segments and one or more human Jλ gene segments are present in place of one or more rodent Vκ gene segments, one or more rodent Jκ gene segments, or any combination thereof. In some embodiments, one or more human Vλ gene segments and one or more human Jλ gene segments replace one or more rodent Vκ gene segments, one or more rodent Jκ gene segments, or any combination thereof. In some embodiments, one or more human Vλ gene segments and one or more human Jλ gene segments replace all functional rodent Vκ gene segments and / or all functional rodent Jκ gene segments.

[0007] In some embodiments, the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof. In some embodiments, the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof. In some embodiments, the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1.

[0008] In some embodiments, the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof, hi some embodiments, the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, and Jλ7.

[0009] In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Vλ non-coding sequences each adjacent to at least one of one or more human Vλ gene segments, where the one or more human Vλ non-coding sequences are naturally found adjacent to a human Vλ gene segment at an endogenous human immunoglobulin λ light chain locus. For example, with reference to Figure 20, a first exemplary endogenous human Vλ non-coding sequence is naturally found adjacent to (3' of) the Vλ3-12 gene segment at an endogenous human immunoglobulin λ light chain locus. An engineered endogenous immunoglobulin κ light chain locus comprising the first exemplary endogenous human Vλ non-coding sequence may comprise the non-coding sequence adjacent to (preferably 3' of) the Vλ3-12 gene segment at the engineered endogenous immunoglobulin κ light chain locus. An engineered endogenous immunoglobulin κ light chain locus comprising the first exemplary endogenous human Vλ non-coding sequence can also comprise the non-coding sequence adjacent to (preferably 5' to) a Vλ2-11 gene segment at the engineered endogenous immunoglobulin κ light chain locus. In some cases, an engineered endogenous immunoglobulin κ light chain locus comprising the first exemplary endogenous human Vλ non-coding sequence can also comprise the non-coding sequence adjacent to (preferably 3' to) a Vλ3-12 gene segment and (preferably 5' to) a Vλ2-11 gene segment at the engineered endogenous immunoglobulin κ light chain locus. In some embodiments, each of the one or more human Vλ non-coding sequences is or comprises an intron.

[0010] In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jλ non-coding sequences each flanking at least one of one or more human Jλ gene segments, where the one or more human Jλ non-coding sequences are naturally found adjacent to a human Jλ gene segment at an endogenous human immunoglobulin κ light chain locus. In some embodiments, each of the one or more human Jλ non-coding sequences is an intron or comprises an intron. In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jκ non-coding sequences each flanking at least one of one or more human Jλ gene segments, where the one or more human Jκ non-coding sequences are naturally found adjacent to a human Jκ gene segment at an endogenous human immunoglobulin κ light chain locus. For example, with reference to Figure 21, a first exemplary endogenous human Jκ non-coding sequence is naturally found at an endogenous human immunoglobulin κ light chain locus. An engineered endogenous immunoglobulin κ light chain locus comprising a first exemplary endogenous human Jκ non-coding sequence may comprise a non-coding sequence adjacent to a Jλ gene segment (e.g., Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7) in the engineered endogenous immunoglobulin κ light chain locus. In some embodiments, each of the one or more human Jκ non-coding sequences is or comprises an intron.

[0011] In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises any of the following: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ1-55, Vλ2-56, Vλ3-57, Vλ4-58, Vλ5-59, Vλ6-60, Vλ7-61, Vλ8-62, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ1-56, Vλ2-58, Vλ1-59, Vλ2-61, Vλ2-62, Vλ3-63, Vλ4-64, Vλ5-59, Vλ6-59, Vλ7-61, Vλ8-62, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ1-56, Vλ1-57, Vλ1-58, Vλ2-59, Vλ1-59, Vλ2-61, Vλ1-59, Vλ2-62, Vλ2-63, Vλ3-64, Vλ4-64, Vλ5-59, Vλ6-59, Vλ7-61, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ1-59, Vλ2-59, Vλ1-59, V One or more adjacent to λ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 or a plurality of human Vλ non-coding sequences, wherein each of the one or more human Vλ non-coding sequences naturally corresponds to one of Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1- 44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1. In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jλ non-coding sequences each flanked by a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the engineered endogenous immunoglobulin κ light chain locus, wherein each of the one or more human Jλ non-coding sequences is naturally found adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin κ light chain locus. In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jκ non-coding sequences each flanked by a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the engineered endogenous immunoglobulin κ light chain locus, wherein each of the one or more human Jκ non-coding sequences is naturally found adjacent to a Jκ1, Jκ2, Jλ3, Jλ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus.

[0012] In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises a κ light chain non-coding sequence between one or more human Vλ gene segments and one or more human Jλ gene segments. In some embodiments, the κ light chain non-coding sequence is a human κ light chain non-coding sequence. In some embodiments, the human κ light chain non-coding sequence has a sequence that is naturally found between a human Vκ4-1 gene segment and a human Jκ1 gene segment in an endogenous human immunoglobulin κ light chain locus.

[0013] In some embodiments, the rodent described herein is homozygous for the engineered endogenous immunoglobulin κ light chain locus. In some embodiments, the rodent described herein is heterozygous for the engineered endogenous immunoglobulin κ light chain locus. In some embodiments, the germline genome of the rodent is (a) one or more human Vκ gene segments; (b) one or more human Jκ gene segments; a second engineered endogenous immunoglobulin kappa light chain locus comprising Including, One or more human Vκ gene segments and one or more human Jκ gene segments are operably linked to the Cκ gene.

[0014] In some embodiments, the rodent genome further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. In some embodiments, the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin κ light chain transcriptional control element, an immunoglobulin λ light chain transcriptional control element, or any combination thereof. In some embodiments, the nucleic acid sequence encoding the exogenous TdT is located at an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. In some embodiments, the TdT is human TdT. In some embodiments, the TdT is the short isoform of TdT (TdTS).

[0015] In some embodiments, the rodents described herein comprise in their germline genome a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element, and exhibit at least a 1.2-fold, at least a 1.5-fold, at least a 1.75-fold, at least a 2-fold, at least a 3-fold, at least a 4-fold, or at least a 5-fold increase in light chain junctional diversity (e.g., express a light chain variable domain with such increased junctional diversity) compared to a comparable mouse (e.g., a littermate) that does not comprise in its germline genome an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. In some embodiments, junctional diversity is measured by the number of unique CDR3s per 10,000 reads.

[0016] In some embodiments, the rodents described herein comprise in their germline genome a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element, and at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, or at least 65% of the light chains (e.g., lambda and / or kappa light chains) produced by the rodent occur via non-templated nucleotide addition.

[0017] In some embodiments, the germline genome of a rodent described herein comprises: (a) one or more human V H a gene segment; (b) one or more human D H a gene segment; (c) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising Including, One or more human V H gene segment, one or more human D H gene segment, and one or more human J H The gene segment is operably linked to a rodent immunoglobulin heavy chain constant region at an engineered endogenous immunoglobulin heavy chain locus.

[0018] In some embodiments, one or more human V H gene segment, one or more human D H gene segment, and one or more human J H The gene segment may be one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H In one embodiment, one or more human V gene segments are present in place of one or more human V gene segments, or a combination thereof.H gene segment, one or more human D H gene segment, and one or more human J H Depending on the gene segment, one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H Gene segments, or any combination thereof, may be substituted.

[0019] In some embodiments, one or more human V H The gene segment is V H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H7-4-1, V H 4-4, V H 1-3, V H 1-2, V H 6-1, or any combination thereof. In some embodiments, one or more human V H The gene segment is V H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, and V H Including 6-1.

[0020] In some embodiments, one or more human D HThe gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, D H 7-27, or any combination thereof. In some embodiments, one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, and D H Including 7-27.

[0021] In some embodiments, one or more human J H The gene segment is J H 1. JH 2. J H 3. J H 4. J H 5. J H 6, or any combination thereof. In some embodiments, one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5, and J H Includes 6.

[0022] In some embodiments, the engineered endogenous immunoglobulin heavy chain locus comprises one or more human V H one or more human Vs each flanking at least one of the gene segments H Contains non-coding sequences and one or more V H Each non-coding sequence naturally occurs as a human VV at the endogenous human immunoglobulin heavy chain locus. H In some embodiments, one or more human V H Each non-coding sequence is or comprises an intron. In some embodiments, the engineered endogenous immunoglobulin heavy chain locus comprises one or more human D H one or more human Ds each flanking at least one of the gene segments H Contains non-coding sequences and one or more D H Each non-coding sequence naturally occurs as a human D at the endogenous human immunoglobulin heavy chain locus. H In some embodiments, one or more human D H Each non-coding sequence is or comprises an intron. In some embodiments, the engineered endogenous immunoglobulin heavy chain locus comprises one or more human J H one or more human J each flanking at least one of the gene segments H Contains non-coding sequences and one or more J HEach non-coding sequence naturally occurs as a human J at the endogenous human immunoglobulin heavy chain locus. H In some embodiments, one or more human J H Each non-coding sequence is or includes an intron.

[0023] In some embodiments, the rodents described herein are homozygous for the engineered endogenous immunoglobulin heavy chain locus.

[0024] In some embodiments, the rodent immunoglobulin heavy chain constant region is an endogenous rodent immunoglobulin heavy chain constant region.

[0025] In some embodiments, the endogenous Vλ gene segments, endogenous Jλ gene segments, and endogenous Cλ genes are deleted in whole or in part. In some embodiments, the rodents described herein do not detectably express endogenous immunoglobulin λ light chain variable domains. In some embodiments, the rodents described herein do not detectably express endogenous immunoglobulin κ light chain variable domains.

[0026] In some embodiments, the engineered endogenous immunoglobulin heavy chain locus does not contain a functional endogenous rodent Adam6 gene. In some embodiments, the rodent germline genome comprises one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. In some embodiments, the one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are expressed (e.g., in cells of the male reproductive system (e.g., testicular cells)).

[0027] In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained on the same chromosome as the engineered endogenous immunoglobulin heavy chain locus. ... H Gene segments and the second human V H In some embodiments, the first human V H The gene segment is V H 1-2 and the second human V H The gene segment is V H 6-1. In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of the human Adam6 pseudogene. In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof replace the human Adam6 pseudogene. In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of the human Adam6 pseudogene. H Gene segments and human D H Located between gene segments.

[0028] In some embodiments, the rodents described herein comprise a B cell population that expresses antibodies comprising immunoglobulin λ light chains, each comprising a human immunoglobulin λ light chain variable domain. In some embodiments, the human immunoglobulin λ light chain variable domain is encoded by a rearranged human immunoglobulin λ light chain variable region sequence that includes (i) one or more human Vλ gene segments or somatically hypermutated variants thereof, and (ii) one or more human Jλ gene segments or somatically hypermutated variants thereof.

[0029] In some embodiments, the rodents described herein comprise a population of B cells that express antibodies comprising immunoglobulin heavy chains, each of which comprises a human immunoglobulin heavy chain variable domain. In some embodiments, the human immunoglobulin heavy chain variable domain comprises (i) one or more human V H (ii) one or more human D H (ii) one or more human J H and a rearranged human immunoglobulin heavy chain variable region sequence comprising one of the gene segments, or a variant thereof that has undergone somatic hypermutation.

[0030] In some embodiments, the rodents described herein produce B cell populations in response to immunization with an antigen comprising one or more epitopes. In some embodiments, the rodents produce B cell populations that express antibodies that bind (e.g., specifically bind) to one or more epitopes of the antigen of interest. In some embodiments, the antibodies expressed by the B cell populations produced in response to the antigen comprise a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence and / or a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein. In some embodiments, the antibodies expressed by the B cell populations produced in response to the antigen comprise a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence and / or a kappa light chain having a human kappa light chain variable domain encoded by a human kappa light chain variable region sequence described herein.

[0031] In some embodiments, the rodent produces a B cell population that expresses antibodies that bind to one or more epitopes of the antigen of interest, and the antibodies expressed by the B cell population produced in response to the antigen comprise (i) a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence, (ii) a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein, (iii) a kappa light chain having a human kappa light chain variable domain encoded by a human kappa light chain variable region sequence described herein, or (iv) any combination thereof.

[0032] In some embodiments, the human heavy chain variable region sequences, human λ light chain variable region sequences, and / or human κ light chain variable region sequences described herein undergo somatic hypermutation. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of B cells in a B cell population produced in response to an antigen comprise human heavy chain variable region sequences, human λ light chain variable region sequences, and / or human κ light chain variable region sequences that have undergone somatic hypermutation.

[0033] In some embodiments, the rodent described herein is a mouse or a rat.

[0034] In some embodiments, described herein are cells and / or tissues (e.g., isolated cells and / or tissues) obtained from rodents. In some embodiments, the provided cells and tissues include, for example, lymphoid tissue, splenocytes, B cells, stem cells, and / or germ cells. In some embodiments, the provided cells are isolated. In some embodiments, the isolated cells are or include pro-B cells, pre-B cells, immature B cells, mature naive B cells, activated B cells, memory B cells, B-lineage lymphocytes, and / or plasma cells. In some embodiments, the isolated cells include stem cells (e.g., embryonic stem cells) and / or germ cells (e.g., sperm, oocytes).

[0035] In some embodiments, the present disclosure provides an isolated rodent cell, wherein the germline genome of the isolated rodent cell comprises: (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments; (c) the Cλ gene; an engineered endogenous immunoglobulin kappa light chain locus comprising Including, One or more human Vλ gene segments and one or more human Jλ gene segments are operably linked to the Cλ gene.

[0036] In some embodiments, the isolated rodent cells described herein do not contain a rodent Cκ gene at the engineered endogenous immunoglobulin κ locus.

[0037] In some embodiments, the isolated rodent cells described herein are rodent embryonic stem (ES) cells.

[0038] In some embodiments, the present disclosure provides rodent embryos that arise from the rodent ES cells described herein.

[0039] In some embodiments, the present disclosure provides immortalized cells derived from the isolated rodent cells described herein.

[0040] In some embodiments, the present disclosure provides a method of producing a rodent that comprises an engineered endogenous immunoglobulin κ light chain locus in its germline genome, the method comprising: (a) introducing one or more DNA fragments into the germline genome of a rodent ES cell, wherein the one or more DNA fragments comprise: (i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments, and (iii) one or more Cλ genes Including, introducing one or more human Vλ gene segments, one or more human Jλ gene segments, and one or more Cλ genes into an endogenous immunoglobulin κ light chain locus in the germline genome of the rodent ES cell, wherein the one or more human Vλ gene segments, one or more human Jλ gene segments, and one or more Cλ genes are operably linked; (b) generating a rodent using the rodent ES cells generated in (a); Includes:

[0041] In some embodiments, a method for producing a rodent that comprises an engineered endogenous immunoglobulin κ light chain locus in its germline genome comprises introducing a κ light chain non-coding sequence into the germline genome of a rodent ES cell such that the κ light chain non-coding sequence is located between one or more human Vλ gene segments and one or more human Jλ gene segments in the germline genome of the rodent ES cell.

[0042] In some embodiments, the present disclosure provides a method of producing a rodent that comprises an engineered endogenous immunoglobulin κ light chain locus in its germline genome, the method comprising: The endogenous immunoglobulin kappa light chain locus in the germline genome is (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments; (c) one or more Cλ genes; the step of: Including, one or more human Vλ gene segments and one or more human Jλ gene segments are operably linked to one or more Cλ genes; One or more Cλ genes are inserted into the endogenous immunoglobulin κ locus in place of the rodent Cκ gene.

[0043] In some embodiments, the Cλ gene replaces the rodent Cκ gene at the endogenous immunoglobulin κ locus.

[0044] In some embodiments, the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof. In some embodiments, the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1. In some embodiments, the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1.

[0045] In some embodiments, the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof, hi some embodiments, the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, and Jλ7.

[0046] In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Vλ non-coding sequences each flanked by at least one of one or more human Vλ gene segments, wherein the one or more human Vλ non-coding sequences are naturally found adjacent to human Vλ gene segments in an endogenous human immunoglobulin λ light chain locus. In some embodiments, each of the one or more human Vλ non-coding sequences is or comprises an intron. In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jλ non-coding sequences each flanked by at least one of one or more human Jλ gene segments, wherein the one or more human Jλ non-coding sequences are naturally found adjacent to human Jλ gene segments in an endogenous human immunoglobulin λ light chain locus. In some embodiments, each of the one or more human Jλ non-coding sequences is or comprises an intron. In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jκ non-coding sequences each flanking at least one of one or more human Jλ gene segments, wherein the one or more human Jκ non-coding sequences are naturally found flanking human Jκ gene segments in the endogenous human immunoglobulin κ light chain locus. In some embodiments, each of the one or more human Jκ non-coding sequences is or comprises an intron.

[0047] In some embodiments, the Cλ gene is or comprises a rodent Cλ gene. In some embodiments, the rodent Cλ gene has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a mouse Cλ1 gene, a mouse Cλ2 gene, or a mouse Cλ3 gene. In some embodiments, the rodent Cλ gene is or comprises a mouse Cλ1 gene. In some embodiments, the rodent Cλ gene is or comprises a rat Cλ gene. In some embodiments, the rat Cλ gene has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a rat Cλ1 gene, a rat Cλ2 gene, a rat Cλ3 gene, or a rat Cλ4 gene.

[0048] In some embodiments, the one or more DNA fragments comprise at least one selectable marker. In some embodiments, the one or more DNA fragments comprise at least one site-specific recombination site.

[0049] In some embodiments, the germline genome of the rodent comprises: (a) one or more human V H a gene segment; (b) one or more human D H a gene segment; (c) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising Including, One or more human V H gene segment, one or more human D H gene segment, and one or more human J H The gene segment is operably linked to a rodent immunoglobulin heavy chain constant region.

[0050] In some embodiments, manipulating the endogenous immunoglobulin κ light chain locus in the germline genome comprises manipulating one or more human V κ light chain loci operably linked to a rodent immunoglobulin heavy chain constant region. H gene segment, one or more human D H gene segment, and one or more human J H This is performed in rodent ES cells that contain an engineered endogenous immunoglobulin heavy chain locus containing gene segments in their germline genome.

[0051] In some embodiments, the engineered endogenous immunoglobulin heavy chain locus comprises one or more human V H one or more human Vs each flanking at least one of the gene segments H containing non-coding sequences and one or more human V H Each non-coding sequence naturally occurs as a human VV at the endogenous human immunoglobulin heavy chain locus. H In some embodiments, one or more human V H Each non-coding sequence is or comprises an intron. In some embodiments, the engineered endogenous immunoglobulin heavy chain locus comprises one or more human D H one or more human Ds each flanking at least one of the gene segments H Contains non-coding sequences and one or more D H Each non-coding sequence naturally occurs as a human D at the endogenous human immunoglobulin heavy chain locus. H In some embodiments, one or more human D H Each non-coding sequence is or comprises an intron. In some embodiments, the engineered endogenous immunoglobulin heavy chain locus comprises one or more human J H one or more human J each flanking at least one of the gene segments H Contains non-coding sequences and one or more JH Each non-coding sequence naturally occurs as a human J at the endogenous human immunoglobulin heavy chain locus. H In some embodiments, one or more human J H Each non-coding sequence is or includes an intron.

[0052] In some embodiments, the present disclosure provides a method for producing an antibody in a rodent, the method comprising: (i) immunizing a rodent with an antigen of interest, Rodents, (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments, and (c) one or more Cλ genes; an engineered endogenous immunoglobulin kappa light chain locus comprising and having a germline genome comprising one or more human Vλ gene segments and one or more human Jλ gene segments are operably linked to a Cλ gene; immunizing, wherein one or more Cλ genes are present at an engineered endogenous immunoglobulin κ locus in place of a rodent Cκ gene; maintaining the rodent under conditions sufficient for the rodent to generate an immune response against the antigen of interest; recovering antibodies that bind to the antigen of interest from the rodent, from a cell of the rodent, or from a cell derived from a cell of the rodent; Includes:

[0053] In some embodiments, in response to the immunization step, the rodent produces B cells that express an antibody that binds to the antigen of interest. In some embodiments, the antibody expressed by the B cells comprises a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence and / or a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein. In some embodiments, the antibody expressed by the B cells comprises (i) a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence, (ii) a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein, (iii) a kappa light chain having a human kappa light chain variable domain encoded by a human kappa light chain variable region sequence described herein, or (iv) any combination thereof.

[0054] In some embodiments, in response to the immunization step, the rodent produces a B cell population that expresses an antibody that binds to the antigen of interest. In some embodiments, the antibodies expressed by the B cell population produced in response to the antigen comprise a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence and / or a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein. In some embodiments, the antibodies expressed by the B cell population produced in response to the antigen comprise (i) a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence, (ii) a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein, (iii) a kappa light chain having a human kappa light chain variable domain encoded by a human kappa light chain variable region sequence described herein, or (iv) any combination thereof.

[0055] In some embodiments, in response to the immunizing step, the rodent produces a B cell population that expresses antibodies that bind to one or more epitopes of the antigen of interest, and the antibodies expressed by the B cell population produced in response to the antigen comprise (i) a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence, (ii) a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein, (iii) a kappa light chain having a human kappa light chain variable domain encoded by a human kappa light chain variable region sequence described herein, or (iv) any combination thereof.

[0056] In some embodiments, the human heavy chain variable region sequences, human λ light chain variable region sequences, and / or human κ light chain variable region sequences described herein undergo somatic hypermutation. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of B cells in a B cell population produced in response to an antigen comprise human heavy chain variable region sequences, human λ light chain variable region sequences, and / or human κ light chain variable region sequences that have undergone somatic hypermutation.

[0057] In some embodiments, antibodies that bind to an antigen of interest are isolated, recovered, or identified from B cells of a rodent. In some embodiments, antibodies that bind to an antigen of interest are isolated, recovered, or identified from hybridomas generated using B cells of a rodent.

[0058] In some embodiments, an antigen comprises one or more epitopes, and an antibody that binds to the antigen of interest binds to one of the one or more epitopes.

[0059] In some embodiments, the Cλ gene is or comprises a rodent Cλ gene. In some embodiments, the rodent Cλ gene has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a mouse Cλ1 gene, a mouse Cλ2 gene, or a mouse Cλ3 gene. In some embodiments, the rodent Cλ gene is or comprises a mouse Cλ1 gene. In some embodiments, the rodent Cλ gene is or comprises a rat Cλ gene. In some embodiments, the rat Cλ gene has a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to a rat Cλ1 gene, a rat Cλ2 gene, a rat Cλ3 gene, or a rat Cλ4 gene.

[0060] In some embodiments, the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof. In some embodiments, the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1. In some embodiments, the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, and Vλ3-1.

[0061] In some embodiments, the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof, hi some embodiments, the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, and Jλ7.

[0062] In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, each flanking the engineered endogenous immunoglobulin κ light chain locus. or a plurality of human Vλ non-coding sequences, wherein each of the one or more human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at the endogenous human immunoglobulin λ light chain locus. In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jλ non-coding sequences each flanked by a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the engineered endogenous immunoglobulin κ light chain locus, wherein each of the one or more human Jλ non-coding sequences is naturally found adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin κ light chain locus. In some embodiments, the engineered endogenous immunoglobulin κ light chain locus comprises one or more human Jκ non-coding sequences each flanked by a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the engineered endogenous immunoglobulin κ light chain locus, wherein each of the one or more human Jκ non-coding sequences is naturally found adjacent to a Jκ1, Jκ2, Jλ3, Jλ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus.

[0063] In some embodiments, the rodent is (a) one or more human V H a gene segment; (b) one or more human D H a gene segment; (c) one or more human J H a gene segment; a germline genome comprising an engineered endogenous immunoglobulin heavy chain locus comprising and One or more human V H gene segment, one or more human D H gene segment, and one or more human J H The gene segment is operably linked to a rodent immunoglobulin heavy chain constant region.

[0064] In some embodiments, one or more human V H The gene segment is V H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, VH 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, V H 6-1, or any combination thereof. In some embodiments, one or more human V H The gene segment is V H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H4-4, V H 1-3, V H 1-2, and V H Including 6-1.

[0065] In some embodiments, one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, D H 7-27, or any combination thereof. In some embodiments, one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, DH 1-26, and D H Including 7-27.

[0066] In some embodiments, one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5. J H 6, or any combination thereof. In some embodiments, one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5, and J H Includes 6.

[0067] In some embodiments, the engineered endogenous immunoglobulin heavy chain locus comprises a V at the engineered endogenous immunoglobulin heavy chain locus. H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, or V H One or more human Vs each flanking 6-1 H containing non-coding sequences and one or more human V H Each non-coding sequence naturally corresponds to a V of the endogenous human immunoglobulin heavy chain locus. H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, VH 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, or V H In some embodiments, the engineered endogenous immunoglobulin heavy chain locus is found adjacent to D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, or D H 7-27, each flanked by one or more human D H Contains non-coding sequences and one or more human D H Each non-coding sequence naturally occurs in the D region of the endogenous human immunoglobulin heavy chain locus. H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, or D H In some embodiments, the engineered endogenous immunoglobulin heavy chain locus is found adjacent to J at the engineered endogenous immunoglobulin heavy chain locus. H 1. J H 2. J H 3. J H 4. J H 5, or J H 6, each flanked by one or more human J H containing non-coding sequences and one or more human J H Each non-coding sequence naturally corresponds to a J of the endogenous human immunoglobulin heavy chain locus. H 1. J H 2. J H 3. J H 4. J H 5, or J H 6. In some embodiments, the recovered rodent cells are B cells. In some embodiments, the cells derived from the rodent cells are hybridomas.

[0068] In some embodiments, the nucleotide sequences encoding the human heavy chain variable region sequence, the human lambda light chain variable region sequence, and / or the human kappa light chain variable region sequence are obtained from a B cell.

[0069] In some embodiments, the engineered endogenous immunoglobulin heavy chain locus does not contain a functional endogenous rodent Adam6 gene. In some embodiments, the rodent germline genome comprises one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. In some embodiments, the one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are expressed (e.g., in cells of the male reproductive system (e.g., testicular cells)).

[0070] In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained on the same chromosome as the engineered endogenous immunoglobulin heavy chain locus. ... H Gene segments and the second human V H In some embodiments, the first human V H The gene segment is V H 1-2 and the second human V H The gene segment is V H6-1. In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of the human Adam6 pseudogene. In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof replace the human Adam6 pseudogene. In some embodiments, one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of the human Adam6 pseudogene. H Gene segments and human D H Located between gene segments.

[0071] In some embodiments, the rodent is a mouse or a rat.

[0072] In some embodiments, the present disclosure provides a rodent comprising a homozygous engineered endogenous immunoglobulin κ light chain locus in its germline genome, wherein the engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ gene segments, including Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) one or more human Jλ gene segments, including Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; (iii) a rodent Cλ gene; and Including, one or more human Vλ gene segments, one or more human Jλ gene segments, and a rodent Cλ gene are operably linked to each other; The rodent Cλ gene is present in place of the rodent Cκ gene at the endogenous immunoglobulin κ light chain locus, The engineered endogenous immunoglobulin kappa light chain locus is (a) one or more human Vλ non-coding sequences, each flanked by Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an engineered endogenous immunoglobulin κ light chain locus; and wherein the one or more human Vλ non-coding sequences are naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus, respectively; (b) one or more human Jκ non-coding sequences each flanked by a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are naturally found flanked by a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; Including, The immunoglobulin κ light chain locus comprises a human κ light chain non-coding sequence between one or more human Vλ gene segments and one or more human Jλ gene segments, which human κ light chain non-coding sequence has a sequence that is naturally found between the human Vκ4-1 and human Jκ1 gene segments in an endogenous human immunoglobulin κ light chain locus.

[0073] In some embodiments, the rodent Cλ gene is a mouse Cλ1 gene.

[0074] In some embodiments, the engineered endogenous immunoglobulin kappa light chain locus is a rodent immunoglobulin kappa light chain enhancer, Eκ i and Eκ3′.

[0075] In some embodiments, the engineered endogenous immunoglobulin κ light chain locus lacks one or more rodent Vκ gene segments and / or one or more Jκ gene segments, hi some embodiments, the engineered endogenous immunoglobulin κ light chain locus lacks all functional rodent Vκ gene segments and / or rodent Jκ gene segments.

[0076] In some embodiments, the present disclosure provides a rodent, wherein the germline genome of the rodent comprises: (a) one or more human V-type nucleotides operably linked to one or more endogenous immunoglobulin heavy chain constant region genes such that the rodent expresses immunoglobulin heavy chains, each of which comprises a human heavy chain variable domain sequence and a rodent heavy chain constant domain sequence; H gene segment, one or more human D H gene segment, and one or more human J H a homozygous endogenous immunoglobulin heavy chain locus comprising a gene segment; (b) a first engineered endogenous immunoglobulin κ light chain locus comprising one or more human Vκ gene segments and one or more Jκ gene segments operably linked to an endogenous rodent Cκ region gene such that the rodent expresses an immunoglobulin light chain comprising a human κ light chain variable domain sequence and a rodent κ light chain constant domain sequence, respectively; (c) a second engineered endogenous immunoglobulin κ light chain locus, wherein the second engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ gene segments, including Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) one or more human Jλ gene segments, including Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; and (iii) rodent Cλ gene Including, one or more human Vλ gene segments, one or more human Jλ gene segments, and a rodent Cλ gene operably linked to one another; a rodent Cλ gene is present in place of a rodent Cκ gene at the endogenous immunoglobulin κ light chain locus; The engineered endogenous immunoglobulin kappa light chain locus is (a) one or more human Vλ non-coding sequences, each flanked by Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an engineered endogenous immunoglobulin κ light chain locus; one or more human Vλ non-coding sequences, each of which is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; and (b) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are naturally found flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively. Including, the immunoglobulin κ light chain locus comprises a human κ light chain non-coding sequence between one or more human Vλ gene segments and one or more human Jλ gene segments, the human κ light chain non-coding sequence having a sequence found naturally between a human Vκ4-1 gene segment and a human Jκ1 gene segment in an endogenous human immunoglobulin κ light chain locus; the second engineered endogenous immunoglobulin κ light chain locus, such that the rodent expresses immunoglobulin light chains each comprising a human λ light chain variable domain sequence and a rodent λ light chain constant domain sequence; Includes.

[0077] In some embodiments, the rodents described herein comprise an inactivated endogenous λ immunoglobulin light chain locus. In some embodiments, the rodents described herein are heterozygous for the inactivated endogenous λ immunoglobulin light chain locus. In some embodiments, the rodents described herein are homozygous for the inactivated endogenous λ immunoglobulin light chain locus.

[0078] In some embodiments, the rodent genome further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. In some embodiments, the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin κ light chain transcriptional control element, an immunoglobulin λ light chain transcriptional control element, or any combination thereof. In some embodiments, the nucleic acid sequence encoding the exogenous TdT is located at an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. In some embodiments, the TdT is human TdT. In some embodiments, the TdT is the short isoform of TdT (TdTS).

[0079] In some embodiments, the rodent described herein comprises in its germline genome a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element, and exhibits at least 1.2-fold, at least 1.5-fold, at least 1.75-fold, at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold increased light chain junction diversity (e.g., expresses a light chain variable domain with such increased junction diversity) compared to a comparable mouse (e.g., a littermate) that does not comprise in its germline genome an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. In some embodiments, junction diversity is measured by the number of unique CDR3s per 10,000 reads. In some embodiments, junction diversity is measured by the number of unique CDR3s per 10,000 reads.

[0080] In some embodiments, the rodents described herein comprise in their germline genome a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element, and at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, or at least 65% of the light chains (e.g., lambda and / or kappa light chains) produced by the rodent occur via non-templated nucleotide addition.

[0081] In some embodiments, the rodent described herein is a rat or a mouse.

[0082] In some embodiments, the disclosure provides an antibody prepared by a method, the method comprising: (a) providing a rodent as described herein; (b) immunizing the rodent with an antigen of interest; (c) maintaining the rodent under conditions sufficient for the rodent to generate an immune response against the antigen of interest; (d) recovering antibodies that bind to the antigen of interest from the rodent, or from a cell of the rodent, or from a cell derived from a rodent; Including, The antibody described in (d) comprises a human heavy chain variable domain and a human λ light chain variable domain.

[0083] In some embodiments, the disclosure provides an antibody prepared by a method, the method comprising: (a) immunizing a rodent as described herein with an antigen of interest; (b) maintaining the rodent under conditions sufficient for the rodent to generate an immune response against the antigen of interest; (c) recovering antibodies that bind to the antigen of interest from the rodent, or from a cell of the rodent, or from a cell derived from a rodent; Including, The antibody described in (c) comprises a human heavy chain variable domain and a human λ light chain variable domain.

[0084] In some embodiments, the rodent does not detectably express an endogenous immunoglobulin κ light chain variable domain. In some embodiments, the rodent does not detectably express an endogenous immunoglobulin λ light chain variable domain.

[0085] In some embodiments, the rodents described herein produce B cell populations in response to immunization with an antigen comprising one or more epitopes. In some embodiments, the rodents produce B cell populations that express antibodies that bind (e.g., specifically bind) to one or more epitopes of the antigen of interest. In some embodiments, the antibodies expressed by the B cell populations produced in response to the antigen comprise a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence and / or a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein. In some embodiments, the antibodies expressed by the B cell populations produced in response to the antigen comprise (i) a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence, (ii) a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein, (iii) a kappa light chain having a human kappa light chain variable domain encoded by a human kappa light chain variable region sequence described herein, or (iv) any combination thereof.

[0086] In some embodiments, the rodent produces a B cell population that expresses antibodies that bind to one or more epitopes of the antigen of interest, and the antibodies expressed by the B cell population produced in response to the antigen comprise (i) a heavy chain having a human heavy chain variable domain encoded by a human heavy chain variable region sequence, (ii) a lambda light chain having a human lambda light chain variable domain encoded by a human lambda light chain variable region sequence described herein, and / or (iii) a kappa light chain having a human kappa light chain variable domain encoded by a human kappa light chain variable region sequence described herein.

[0087] In some embodiments, the human heavy chain variable region sequences, human λ light chain variable region sequences, and / or human κ light chain variable region sequences described herein undergo somatic hypermutation. In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, or at least about 90% of B cells in a B cell population produced in response to an antigen comprise human heavy chain variable region sequences, human λ light chain variable region sequences, and / or human κ light chain variable region sequences that have undergone somatic hypermutation.

[0088] In some embodiments, the present disclosure provides a method of making an antibody, the method comprising: (i) expressing in a host cell a first nucleotide sequence encoding an immunoglobulin heavy chain, wherein the first nucleotide sequence comprises a human heavy chain variable region sequence; (ii) expressing in the host cell a second nucleotide sequence encoding an immunoglobulin λ light chain, wherein the second nucleotide sequence comprises a human λ light chain variable region sequence identified (e.g., expressed and / or isolated) from a rodent, the germline genome of which is (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments; (c) one or more Cλ genes; an engineered endogenous immunoglobulin kappa light chain locus comprising Including, one or more human Vλ gene segments and one or more human Jλ gene segments operably linked to one or more Cλ genes; the rodent does not contain a rodent Cκ gene at the engineered endogenous immunoglobulin κ locus; (iii) culturing the host cells to express the immunoglobulin light chain and the immunoglobulin heavy chain and form the antibody; and (iv) obtaining the antibody from the host cell and / or host cell culture; Includes:

[0089] In some embodiments, the first nucleotide sequence comprises a human heavy chain constant region. In some embodiments, the antibody is a fully human antibody.

[0090] In some embodiments, the second nucleotide comprises a human lambda light chain constant region sequence.

[0091] In some embodiments, the antibody is a reverse chimeric antibody. In some embodiments, the first nucleotide sequence comprises a rodent heavy chain constant region. In some embodiments, the second nucleotide sequence comprises a rodent lambda light chain constant region sequence.

[0092] In some embodiments, the present disclosure provides a rodent, wherein the germline genome of the rodent comprises: (a)(i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments, and (iii) Cλ gene a first engineered endogenous immunoglobulin κ light chain locus comprising: one or more human Vλ gene segments and one or more human Jλ gene segments are operably linked to a Cλ gene; a first engineered endogenous immunoglobulin κ light chain locus, wherein the rodent does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ locus; (b)(i) one or more human Vκ gene segments, and (ii) one or more human Jκ gene segments a second engineered endogenous immunoglobulin κ light chain locus, further comprising: the second engineered endogenous immunoglobulin κ light chain locus, wherein one or more human Vκ gene segments and one or more human Jκ gene segments are operably linked to a CK gene; Includes:

[0093] In some embodiments, the Cκ gene is an endogenous rodent Cκ gene.

[0094] In some embodiments, the rodent genome further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. In some embodiments, the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin κ light chain transcriptional control element, an immunoglobulin λ light chain transcriptional control element, or any combination thereof. In some embodiments, the nucleic acid sequence encoding the exogenous TdT is located at an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. In some embodiments, the TdT is human TdT. In some embodiments, the TdT is the short isoform of TdT (TdTS).

[0095] In some embodiments, the rodent genome further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. In some embodiments, the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin κ light chain transcriptional control element, an immunoglobulin λ light chain transcriptional control element, or any combination thereof. In some embodiments, the nucleic acid sequence encoding the exogenous TdT is located at an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. In some embodiments, the TdT is human TdT. In some embodiments, the TdT is the short isoform of TdT (TdTS).

[0096] In some embodiments, the rodent described herein comprises in its germline genome a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element, and exhibits at least 1.2-fold, at least 1.5-fold, at least 1.75-fold, at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold increased light chain junction diversity (e.g., expresses a light chain variable domain with such increased junction diversity) compared to a comparable mouse (e.g., a littermate) that does not comprise in its germline genome an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. In some embodiments, junction diversity is measured by the number of unique CDR3s per 10,000 reads. In some embodiments, junction diversity is measured by the number of unique CDR3s per 10,000 reads.

[0097] In some embodiments, the rodents described herein comprise in their germline genome a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element, and at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, or at least 65% of the light chains (e.g., lambda and / or kappa light chains) produced by the rodent occur via non-templated nucleotide addition.

[0098] In various embodiments, the non-human animals, cells, or tissues described herein are rodents, rodent cells, or rodent tissues, and in some embodiments, mice, mouse cells, or mouse tissues, and in some embodiments, rats, rat cells, or rat tissues. In some embodiments, the mice, mouse cells, or mouse tissues described herein comprise a genetic background comprising a 129 strain, a BALB / c strain, a C57BL / 6 strain, a 129xC57BL / 6 mixed strain, or a combination thereof. In certain embodiments, for example, the following are provided: (Item 1) 1. A genetically modified rodent, wherein the germline genome of said genetically modified rodent comprises: (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments; (c) the Cλ gene; a first engineered endogenous immunoglobulin kappa light chain locus comprising Including, the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; The genetically modified rodent, wherein the rodent does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ light chain locus. (Item 2) 2. The genetically modified rodent of item 1, wherein the rodent is homozygous for the first engineered endogenous immunoglobulin kappa light chain locus. (Item 3) 2. The genetically modified rodent of item 1, wherein the rodent is heterozygous for the first engineered endogenous immunoglobulin kappa light chain gene. (Item 4) the germline genome of the rodent is (a) one or more human Vκ gene segments; (b) one or more human Jκ gene segments; a second engineered endogenous immunoglobulin kappa light chain locus comprising Including, 4. The genetically modified rodent of item 3, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a Cκ gene. (Item 5) 5. The genetically modified rodent of item 4, wherein the Cκ gene in the second engineered endogenous immunoglobulin kappa light chain locus is an endogenous rodent Cκ gene. (Item 6) 6. The genetically modified rodent of any one of items 1 to 5, wherein the rodent does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ light chain locus. (Item 7) 1. A genetically modified rodent, wherein the germline genome of said genetically modified rodent comprises: (a)(i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments, and (iii) Cλ gene a first engineered endogenous immunoglobulin κ light chain locus comprising: the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; a first engineered endogenous immunoglobulin κ light chain locus, wherein the rodent does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ light chain locus; (b)(i) one or more human Vκ gene segments, and (ii) one or more human Jκ gene segments a second engineered endogenous immunoglobulin κ light chain locus comprising: the second engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a Cκ gene; and The genetically modified rodent comprising: (Item 8) 8. The genetically modified rodent of item 7, wherein the Cκ gene in the second engineered endogenous immunoglobulin kappa light chain locus is an endogenous rodent Cκ gene. (Item 9) 9. The genetically modified rodent of any one of items 1 to 8, wherein the Cλ gene at the first engineered endogenous immunoglobulin κ light chain locus comprises a rodent Cλ gene. (Item 10) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each flanking at least one of the one or more human Vλ gene segments, wherein the one or more human Vλ non-coding sequences are naturally found adjacent to a human Vλ gene segment at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking at least one of the one or more human Jλ gene segments, wherein the one or more human Jλ non-coding sequences are naturally found adjacent to a human Jλ gene segment at an endogenous human immunoglobulin λ light chain locus; or (iii) any combination thereof 10. The genetically modified rodent of any one of items 1 to 9, further comprising: (Item 11) (i) the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; 11. The genetically modified rodent according to any one of items 1 to 10. (Item 12) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at the first engineered endogenous immunoglobulin κ light chain locus, wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; 12. The genetically modified rodent according to item 11, comprising: (Item 13) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences, each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at said first engineered endogenous immunoglobulin κ light chain locus; wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; 12. The genetically modified rodent according to item 11, comprising: (Item 14) (i) the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; 14. The genetically modified rodent according to any one of items 1 to 13. (Item 15) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) at the first engineered endogenous immunoglobulin κ light chain locus, Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37 , Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, each flanked by one or more human Vλ non-coding sequences. Several human Vλ non-coding sequences naturally occur at the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, and Vλ5-39. , Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; 15. The genetically modified rodent according to item 14, comprising: (Item 16) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) determining whether or not the Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1 one or more human Vλ non-coding sequences each flanking Vλ3-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, are multiple human Vλ non-coding sequences naturally occurring in the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, and Vλ one or more human Vλ non-coding sequences found adjacent to Vλ3-1, Vλ4-1, Vλ5-1, Vλ6-1, Vλ7-1, Vλ8-1, Vλ9-1, Vλ10-1, Vλ11-1, Vλ12-1, Vλ13-1, Vλ14-1, Vλ15-1, Vλ16-1, Vλ17-1, Vλ18-1, Vλ19-2, Vλ210-2, Vλ22-2, Vλ23-3, Vλ24-3, Vλ25-4, Vλ26-5, Vλ27-6, Vλ28-7, Vλ39-8, Vλ4-9, Vλ4-10, Vλ4-2, Vλ4-3, or Vλ5-1; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; 15. The genetically modified rodent according to item 14, comprising: (Item 17) 1. A genetically modified rodent, wherein the germline genome of the genetically modified rodent comprises a first engineered endogenous immunoglobulin κ light chain locus, the first engineered endogenous immunoglobulin κ light chain locus comprising: (i) one or more human Vλ gene segments, including Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) one or more human Jλ gene segments, including Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; (iii) a rodent Cλ gene; and (iv) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 in the engineered endogenous immunoglobulin κ light chain locus, a plurality of human Vλ non-coding sequences, each of which is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 of an endogenous human immunoglobulin λ light chain locus; (v) one or more human Jκ non-coding sequences each flanking said Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at said engineered endogenous immunoglobulin κ light chain locus, wherein said one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; (vi) a human κ light chain non-coding sequence located between the one or more human Vλ gene segments and the one or more human Jλ gene segments, wherein the human κ light chain non-coding sequence has a sequence found naturally between a human Vκ4-1 gene segment and a human Jκ1 gene segment at an endogenous human immunoglobulin κ light chain locus; Including, the one or more human Vλ gene segments, the one or more human Jλ gene segments, and the rodent Cλ gene are operably linked to one another; The genetically modified rodent, wherein the rodent Cλ gene is present in place of a rodent Cκ gene at the endogenous immunoglobulin κ light chain locus. (Item 18) the germline genome of the rodent is (a) one or more human Vκ gene segments; (b) one or more human Jκ gene segments; a second engineered endogenous immunoglobulin kappa light chain locus comprising Including, 18. The genetically modified rodent of item 17, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a Cκ gene. (Item 19) 20. The genetically modified rodent of claim 18, wherein the Cκ gene in the second engineered endogenous immunoglobulin κ light chain locus is an endogenous rodent Cκ gene. the germline genome of the rodent is (a) one or more human V H a gene segment; (b) one or more human D H a gene segment; (c) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising further comprising the one or more human V H gene segment, said one or more human D H gene segments, and the one or more human J H 20. The genetically modified rodent of any one of paragraphs 1 to 19, wherein the gene segments are operably linked to one or more rodent immunoglobulin heavy chain constant region genes at the engineered endogenous immunoglobulin heavy chain locus. (Item 21) 1. A genetically modified rodent, wherein the germline genome of said genetically modified rodent comprises: (a) one or more human V-type immunoglobulins operably linked to one or more endogenous immunoglobulin heavy chain constant region genes such that the rodent expresses an immunoglobulin heavy chain comprising a human heavy chain variable domain sequence and a rodent heavy chain constant domain sequence; H gene segment, one or more human D H gene segment, and one or more human J H an engineered endogenous immunoglobulin heavy chain locus comprising a gene segment, wherein the germline genome is homozygous for the engineered endogenous immunoglobulin heavy chain locus; (b) a first engineered endogenous immunoglobulin κ light chain locus, wherein said first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ gene segments, including Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) one or more human Jλ gene segments, including Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; (iii) a rodent Cλ gene; and (iv) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at the second engineered endogenous immunoglobulin κ light chain locus, wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 of an endogenous human immunoglobulin λ light chain locus; (v) one or more human Jκ non-coding sequences each flanking said Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at said second engineered endogenous immunoglobulin κ light chain locus, wherein said one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; (vi) a human κ light chain non-coding sequence located between the one or more human Vλ gene segments and the one or more human Jλ gene segments, wherein the human κ light chain non-coding sequence has a sequence found naturally between a human Vκ4-1 gene segment and a human Jκ1 gene segment at an endogenous human immunoglobulin κ light chain locus; Including, the one or more human Vλ gene segments, the one or more human Jλ gene segments, and the rodent Cλ gene are operably linked to one another; the first engineered endogenous immunoglobulin κ light chain locus, wherein the rodent Cλ gene is present at the second endogenous immunoglobulin κ light chain locus in place of a rodent Cκ gene; and (c) a second engineered endogenous immunoglobulin κ light chain locus comprising one or more human Vκ gene segments and one or more Jκ gene segments operably linked to an endogenous rodent Cκ region gene such that the rodent expresses an immunoglobulin light chain comprising a human κ light chain variable domain sequence and a rodent κ light chain constant domain sequence; The genetically modified rodent, wherein the rodent expresses an immunoglobulin light chain comprising a human lambda light chain variable domain sequence and a rodent lambda light chain constant domain sequence. (Item 22) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J HThe gene segment is a member of one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 22. The genetically modified rodent of claim 20 or 21, wherein the gene segment is present instead of the gene segment, or a combination thereof. (Item 23) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H Depending on the gene segment, one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 23. The genetically modified rodent of any one of items 20 to 22, wherein a gene segment, a gene segment, or any combination thereof is replaced. (Item 24) the engineered endogenous immunoglobulin heavy chain locus (i) the one or more human V H one or more human V sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally occurs as a human V at the endogenous human immunoglobulin heavy chain locus. H the one or more human V sequences found adjacent to the gene segment H non-coding sequences, (ii) the one or more human D H one or more human Ds each flanking at least one of the gene segments H a non-coding sequence, H Each of the non-coding sequences naturally contains a human D at the endogenous human immunoglobulin heavy chain locus. H the one or more human D sequences found adjacent to the gene segment H non-coding sequences, (iii) the one or more human J H one or more human J sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally contains a human J at the endogenous human immunoglobulin heavy chain locus. H the one or more human J sequences found adjacent to the gene segment H a non-coding sequence, or (iv) any combination thereof 24. The genetically modified rodent according to any one of items 20 to 23, further comprising: (Item 25) 25. The genetically modified rodent of any one of items 20 to 24, wherein the one or more rodent immunoglobulin heavy chain constant region genes are one or more endogenous rodent immunoglobulin heavy chain constant region genes. (Item 26) (i) the one or more human V H If the gene segment is V H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, VH 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, V H 6-1, or any combination thereof, (ii) the one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, D H 7-27, or any combination thereof, (iii) the one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5. J H 6, or any combination thereof, 26. The genetically modified rodent according to any one of items 20 to 25. (Item 27) 27. The genetically modified rodent of any one of paragraphs 20 to 26, wherein the engineered endogenous immunoglobulin heavy chain locus does not comprise a functional endogenous rodent Adam6 gene. (Item 28) 28. The genetically modified rodent of any one of paragraphs 20 to 27, wherein the germline genome further comprises one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. (Item 29) 29. The genetically modified rodent of item 28, wherein the one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are expressed. (Item 30) 30. The genetically modified rodent of claim 28 or 29, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained on the same chromosome as the engineered endogenous immunoglobulin heavy chain locus. (Item 31) 31. The genetically modified rodent of any one of paragraphs 28 to 30, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained in the engineered endogenous immunoglobulin heavy chain locus. (Item 32) 32. The genetically modified rodent of any one of paragraphs 28 to 31, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of a human Adam6 pseudogene. (Item 33) 33. The genetically modified rodent of any one of items 28 to 32, wherein the human Adam6 pseudogene is replaced by the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. (Item 34) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of a first human V H Gene segments and the second human V H 34. The genetically modified rodent according to any one of items 28 to 33, wherein the gene segment is located between the gene segment. (Item 35) The first human V H Gene segment V H 1-2, and said second human V H Gene segment V H 35. The genetically modified rodent according to item 34, wherein the rodent is 6-1. (Item 36) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of human V H Gene segments and human D H 32. The genetically modified rodent according to any one of items 28 to 31, wherein the gene segment is located between the gene segment. (Item 37) 37. The genetically modified rodent of any one of items 20 and 22 to 36, wherein the rodent is homozygous for the engineered endogenous immunoglobulin heavy chain locus. (Item 38) 38. The genetically modified rodent of any one of items 9 to 37, wherein the rodent Cλ gene has a sequence that is at least 80% identical to a mouse Cλ1 gene, a mouse Cλ2 gene, or a mouse Cλ3 gene. (Item 39) 39. The genetically modified rodent of any one of items 9 to 38, wherein the rodent Cλ gene comprises a mouse Cλ1 gene. (Item 40) 40. The genetically modified rodent of any one of items 9 to 39, wherein the rodent Cλ gene comprises a rat Cλ gene. (Item 41) 41. The genetically modified rodent of item 40, wherein the rat Cλ gene has a sequence that is at least 80% identical to a rat Cλ1 gene, a rat Cλ2 gene, a rat Cλ3 gene, or a rat Cλ4 gene. (Item 42) 42. The genetically modified rodent of any one of paragraphs 1 to 41, wherein the one or more human Vλ gene segments and the one or more human Jλ gene segments are present in place of one or more rodent Vκ gene segments, one or more rodent Jκ gene segments, or any combination thereof. (Item 43) 43. The genetically modified rodent of any one of paragraphs 1 to 42, wherein the one or more human Vλ gene segments and the one or more human Jλ gene segments replace one or more rodent Vκ gene segments, one or more rodent Jκ gene segments, or any combination thereof. (Item 44) 44. The genetically modified rodent of any one of paragraphs 1 to 43, wherein the first engineered endogenous immunoglobulin κ light chain locus further comprises a κ light chain non-coding sequence between the one or more human Vλ gene segments and the one or more human Jλ gene segments. (Item 45) 45. The genetically modified rodent of item 44, wherein the κ light chain non-coding sequence is a human κ light chain non-coding sequence. (Item 46) 46. ​​The genetically modified rodent of paragraph 45, wherein the human κ light chain non-coding sequence has a sequence found naturally between the human Vκ4-1 gene segment and the human Jκ1 gene segment at an endogenous human immunoglobulin κ light chain locus. (Item 47) 47. The genetically modified rodent of any one of paragraphs 1 to 46, further comprising an inactivated endogenous immunoglobulin lambda light chain locus. (Item 48) 48. The genetically modified rodent of item 47, wherein the rodent is heterozygous for the inactivated endogenous immunoglobulin lambda light chain locus. (Item 49) 48. The genetically modified rodent of item 47, wherein the rodent is homozygous for the inactivated endogenous immunoglobulin lambda light chain locus. (Item 50) 50. The genetically modified rodent of any one of items 1 to 49, wherein all or part of the endogenous Vλ gene segment, the endogenous Jλ gene segment, and the endogenous Cλ gene are deleted. (Item 51) 51. The genetically modified rodent of any one of items 1 to 50, wherein the rodent does not detectably express an endogenous immunoglobulin lambda light chain variable domain. (Item 52) 52. The genetically modified rodent of any one of items 1 to 51, wherein the rodent does not detectably express an endogenous immunoglobulin kappa light chain variable domain. (Item 53) 53. The genetically modified rodent of any one of paragraphs 1 to 52, wherein the rodent comprises a B cell population that expresses antibodies comprising immunoglobulin λ light chains, each of which comprises a human immunoglobulin λ light chain variable domain. (Item 54) 54. The genetically modified rodent of claim 53, wherein the human immunoglobulin λ light chain variable domain is encoded by a rearranged human immunoglobulin λ light chain variable region sequence comprising: (i) one of the one or more human Vλ gene segments or somatically hypermutated variants thereof; and (ii) one of the one or more human Jλ gene segments or somatically hypermutated variants thereof. (Item 55) 56. The genetically modified rodent of any one of claims 1 to 54, wherein the germline genome of the rodent further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. 56. The genetically modified rodent of item 55, wherein the TdT is the short isoform of TdT (TdTS). (Item 57) 57. The genetically modified rodent of claim 55 or 56, wherein the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin kappa light chain transcriptional control element, an immunoglobulin lambda light chain transcriptional control element, or any combination thereof. (Item 58) 58. The genetically modified rodent of any one of Items 55 to 57, wherein the nucleic acid sequence encoding exogenous TdT is present in the germline genome at an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. (Item 59) 1. A genetically modified rodent, wherein the germline genome of said genetically modified rodent comprises: (a) an exogenous terminal deoxynucleotidyl transferase (TdT)-encoding nucleic acid sequence operably linked to a transcriptional control element; (b) one or more human V-type nucleotides operably linked to one or more endogenous immunoglobulin heavy chain constant region genes such that the rodent expresses immunoglobulin heavy chains, each comprising a human heavy chain variable domain sequence and a rodent heavy chain constant domain sequence. H gene segment, one or more human D H gene segment, and one or more human J H an engineered endogenous immunoglobulin heavy chain locus comprising a gene segment, wherein the germline genome is homozygous for the engineered endogenous immunoglobulin heavy chain locus; and (c) an engineered endogenous immunoglobulin κ light chain locus, wherein the engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ gene segments, including Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) one or more human Jλ gene segments, including Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; (iii) a rodent Cλ gene; and (iv) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 in the engineered endogenous immunoglobulin κ light chain locus, a plurality of human Vλ non-coding sequences, each of which is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 of an endogenous human immunoglobulin λ light chain locus; (v) one or more human Jκ non-coding sequences each flanking said Jλ1, Jλ2, Jλ3, Jλ6, and Jλ7 at said engineered endogenous immunoglobulin κ light chain locus, wherein said one or more human Jκ non-coding sequences are found naturally adjacent to Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; (vi) a human κ light chain non-coding sequence located between the one or more human Vλ gene segments and the one or more human Jλ gene segments, wherein the human κ light chain non-coding sequence comprises a sequence found naturally between a human Vκ4-1 gene segment and a human Jκ1 gene segment at an endogenous human immunoglobulin κ light chain locus; and the engineered endogenous immunoglobulin κ light chain locus comprising Including, the one or more human Vλ gene segments, the one or more human Jλ gene segments, and the rodent Cλ gene are operably linked to one another; the rodent Cλ gene is present in place of a rodent Cκ gene at the endogenous immunoglobulin κ light chain locus; the germline genome is homozygous for the engineered endogenous immunoglobulin κ light chain locus; The genetically modified rodent, wherein the rodent expresses an immunoglobulin light chain comprising a human lambda light chain variable domain sequence fused to a rodent lambda light chain constant domain sequence. (Item 60) 60. The genetically modified rodent of any one of items 1 to 59, wherein the rodent is a rat or a mouse. (Item 61) 61. An isolated rodent cell obtained from the rodent of any one of items 1 to 60. (Item 62) 62. An immortalized cell derived from the isolated rodent cell of item 61. (Item 63) 62. The isolated rodent cell of paragraph 61, wherein the rodent cell is a rodent embryonic stem (ES) cell. (Item 64) 64. A rodent embryo generated from the rodent ES cell of item 63. (Item 65) 61. Use of a rodent according to any one of items 1 to 60 for preparing an antibody. (Item 66) 61. Use of the rodent of any one of items 1 to 60 for preparing a light chain variable region sequence. (Item 67) 61. Use of the rodent of any one of items 1 to 60 for preparing a light chain variable domain sequence. (Item 68) 61. An isolated B cell obtained from the rodent according to any one of items 1 to 60, wherein the genome of the B cell comprises: (a) a rearranged human lambda light chain variable region sequence operably linked to a lambda light chain variable region sequence; Including, the rearranged human lambda light chain variable region sequence is (i) one of said one or more human Vλ gene segments, or a somatically hypermutated variant thereof; (ii) one of said one or more human Jλ gene segments or a somatically hypermutated variant thereof; Including, The isolated B cells. (Item 69) (b) the isolated B cell of paragraph 68, further comprising a rearranged human heavy chain variable region sequence operably linked to the rodent heavy chain variable region sequence; the rearranged human heavy chain variable region sequence is (i) the one or more human V H One of the gene segments or its variants that have undergone somatic hypermutation, (ii) the one or more human D H One of the gene segments or its variants that have undergone somatic hypermutation, (iii) the one or more human J H One of the gene segments or its variants that have undergone somatic hypermutation, Including, The isolated B cells. (Item 70) (a) providing a rodent according to any one of items 1 to 60; (b) immunizing the rodent with an antigen of interest; (c) maintaining the rodent under conditions sufficient for the rodent to generate an immune response against the antigen of interest; (d) from said rodent (i) an antibody that binds to the target antigen; (ii) nucleotides encoding the human light chain variable domain or human heavy chain variable domain, light chain, or heavy chain of an antibody that binds to the target antigen; or (iii) a cell expressing an antibody that binds to the target antigen; and recovering the 1. An antibody prepared by a method comprising: The antibody according to (d), comprising a human heavy chain variable domain and a human λ light chain variable domain. (Item 71) 1. An isolated rodent cell, wherein the genome of said isolated rodent cell comprises: (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments; (c) the Cλ gene; a first engineered endogenous immunoglobulin kappa light chain locus comprising Including, the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; The isolated rodent cell, wherein the isolated rodent cell does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ light chain locus. (Item 72) 72. The isolated rodent cell of paragraph 71, wherein the isolated rodent cell is homozygous for the first engineered endogenous immunoglobulin kappa light chain locus. (Item 73) 72. The isolated rodent cell of paragraph 71, wherein the isolated rodent cell is heterozygous for the first engineered endogenous immunoglobulin kappa light chain locus. (Item 74) the genome of the isolated rodent cell comprises: (a) one or more human Vκ gene segments; (b) one or more human Jκ gene segments; a second engineered endogenous immunoglobulin kappa light chain locus comprising Including, 74. The isolated rodent cell of paragraph 73, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a CK gene. (Item 75) 75. The isolated rodent cell of paragraph 74, wherein the Cκ gene in the second engineered endogenous immunoglobulin kappa light chain locus is an endogenous rodent Cκ gene. (Item 76) 76. The isolated rodent cell of any one of paragraphs 71 to 75, wherein the isolated rodent cell does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ light chain locus. (Item 77) 77. The isolated rodent cell of any one of paragraphs 71 to 76, wherein the Cλ gene at the first engineered endogenous immunoglobulin κ light chain locus comprises a rodent Cλ gene. (Item 78) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each flanking at least one of the one or more human Vλ gene segments, wherein the one or more human Vλ non-coding sequences are naturally found adjacent to a human Vλ gene segment at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking at least one of the one or more human Jλ gene segments, wherein the one or more human Jλ non-coding sequences are naturally found adjacent to a human Jλ gene segment at an endogenous human immunoglobulin λ light chain locus; or (iii) any combination thereof 78. The isolated rodent cell of any one of items 71 to 77, further comprising: (Item 79) (i) the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; 79. The isolated rodent cell of any one of items 71 to 78. (Item 80) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at the first engineered endogenous immunoglobulin κ light chain locus, wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; 80. The isolated rodent cell of item 79, comprising: (Item 81) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences, each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at said first engineered endogenous immunoglobulin κ light chain locus; wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; 80. The isolated rodent cell of item 79, comprising: (Item 82) (a) the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (b) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; 82. The isolated rodent cell of any one of items 71 to 81. (Item 83) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) at the first engineered endogenous immunoglobulin κ light chain locus, Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37 , Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, each flanked by one or more human Vλ non-coding sequences. Several human Vλ non-coding sequences naturally occur at the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, and Vλ5-39. , Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; 83. The isolated rodent cell of item 82, comprising: (Item 84) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) determining whether or not the Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1 one or more human Vλ non-coding sequences each flanking Vλ3-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, are multiple human Vλ non-coding sequences naturally occurring in the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, and Vλ one or more human Vλ non-coding sequences found adjacent to Vλ3-1, Vλ4-1, Vλ5-1, Vλ6-1, Vλ7-1, Vλ8-1, Vλ9-1, Vλ10-1, Vλ11-1, Vλ12-1, Vλ13-1, Vλ14-1, Vλ15-1, Vλ16-1, Vλ17-1, Vλ18-1, Vλ19-2, Vλ210-2, Vλ22-2, Vλ23-3, Vλ24-3, Vλ25-4, Vλ26-5, Vλ27-6, Vλ28-7, Vλ39-8, Vλ4-9, Vλ4-10, Vλ4-2, Vλ4-3, or Vλ5-1; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; 83. The isolated rodent cell of item 82, comprising: (Item 85) the genome of the rodent cell (a) one or more human V H a gene segment; (b) one or more human D Ha gene segment; (c) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising further comprising the one or more human V H gene segment, said one or more human D H gene segments, and the one or more human J H 85. The isolated rodent cell of any one of paragraphs 71 to 84, wherein the gene segments are operably linked to one or more rodent immunoglobulin heavy chain constant region genes at the engineered endogenous immunoglobulin heavy chain locus. (Item 86) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H The gene segment is a member of one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 86. The isolated rodent cell of claim 85, wherein the nucleotide sequence of the gene segment is present in place of the nucleotide sequence of the gene segment, or a combination thereof. (Item 87) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H Depending on the gene segment, one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 87. The isolated rodent cell of claim 85 or 86, wherein a gene segment, a nucleotide sequence, or any combination thereof is substituted. (Item 88) the engineered endogenous immunoglobulin heavy chain locus (i) the one or more human V H one or more human V sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally occurs as a human V at the endogenous human immunoglobulin heavy chain locus. H the one or more human V sequences found adjacent to the gene segment H non-coding sequences, (ii) the one or more human D H one or more human Ds each flanking at least one of the gene segments H a non-coding sequence, H Each of the non-coding sequences naturally contains a human D at the endogenous human immunoglobulin heavy chain locus. H the one or more human D sequences found adjacent to the gene segment H non-coding sequences, (iii) the one or more human J H one or more human J sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally contains a human J at the endogenous human immunoglobulin heavy chain locus. H the one or more human J sequences found adjacent to the gene segment H a non-coding sequence, or (iv) any combination thereof 88. The isolated rodent cell of any one of items 85 to 87, further comprising: (Item 89) 89. The isolated rodent cell of any one of paragraphs 85 to 88, wherein the one or more rodent immunoglobulin heavy chain constant region genes are one or more endogenous rodent immunoglobulin heavy chain constant region genes. (Item 90) (i) the one or more human V H If the gene segment is V H3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, V H 6-1, or any combination thereof, (ii) the one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, DH 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, D H 7-27, or any combination thereof, (iii) the one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5. J H 6, or any combination thereof, 89. The isolated rodent cell of any one of items 85 to 89. (Item 91) 91. The isolated rodent cell of any one of paragraphs 85 to 90, wherein the engineered endogenous immunoglobulin heavy chain locus does not comprise a functional endogenous rodent Adam6 gene. (Item 92) 92. The isolated rodent cell of any one of paragraphs 85 to 91, wherein the genome of the rodent cell further comprises one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. (Item 93) 93. The isolated rodent cell of Item 92, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained on the same chromosome as the engineered endogenous immunoglobulin heavy chain locus. (Item 94) 94. The isolated rodent cell of claim 92 or 93, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained in the engineered endogenous immunoglobulin heavy chain locus. (Item 95) 95. The isolated rodent cell of any one of paragraphs 92 to 94, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of a human Adam6 pseudogene. (Item 96) 96. The isolated rodent cell of any one of paragraphs 92 to 95, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof, replace a human Adam6 pseudogene. (Item 97) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of a first human V H Gene segments and the second human V H 97. The isolated rodent cell of any one of paragraphs 92 to 96, wherein the gene segment is located between the (Item 98) The first human V H Gene segment V H 1-2, and said second human V H Gene segment V H 98. The isolated rodent cell of item 97, wherein the cell is 6-1. (Item 99) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of human V H Gene segments and human D H Item 100: The isolated rodent cell according to any one of Items 92 to 94, wherein the gene segment is located between the gene segment. 99. The isolated rodent cell of any one of paragraphs 85 to 99, wherein the isolated rodent cell is homozygous for the engineered endogenous immunoglobulin heavy chain locus. (Item 101) 101. The isolated rodent cell of any one of items 71 to 100, wherein the genome of the isolated rodent cell further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. (Item 102) 102. The isolated rodent cell of item 101, wherein the TdT is the short isoform of TdT (TdTS). (Item 103) 103. The isolated rodent cell of claim 101 or 102, wherein the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin kappa light chain transcriptional control element, an immunoglobulin lambda light chain transcriptional control element, or any combination thereof. (Item 104) 104. The isolated rodent cell of any one of paragraphs 101 to 103, wherein the nucleic acid sequence encoding exogenous TdT is present at an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus in the genome of the rodent cell. (Item 105) 105. The isolated rodent cell of any one of items 71 to 104, wherein the rodent cell is a rat cell or a mouse cell. (Item 106) 106. An immortalized cell derived from the isolated rodent cell of any one of items 71 to 105. (Item 107) 106. The isolated rodent cell of any one of paragraphs 71 to 105, wherein the rodent cell is a rodent embryonic stem (ES) cell. (Item 108) 108. A rodent embryo generated from the rodent ES cell of item 107. (Item 109) 1. A method for producing a genetically modified rodent, said method comprising: (a) introducing one or more DNA fragments into a first engineered immunoglobulin κ light chain locus in the genome of a rodent ES cell; the one or more DNA fragments (i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments, and (iii) Cλ gene Including, introducing the one or more human Vλ gene segments, the one or more human Jλ gene segments, and the Cλ gene into the endogenous immunoglobulin κ light chain locus in the genome of the rodent ES cell such that the one or more human Vλ gene segments, the one or more human Jλ gene segments, and the Cλ gene are operably linked; (b) generating a rodent using the rodent ES cells generated in (a); The method comprising: (Item 110) the genome of the rodent ES cell is (i) one or more human Vκ gene segments; (ii) one or more human Jκ gene segments; a second engineered endogenous immunoglobulin kappa light chain locus comprising Including, 110. The method of claim 109, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a CK gene. (Item 111) the genome of the rodent ES cell is (i) one or more human V H a gene segment; (ii) one or more human D H a gene segment; (iii) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising Including, the one or more human V H gene segment, said one or more human D H gene segments, and the one or more human J H 111. The method of claim 109 or claim 110, wherein the gene segments are operably linked to one or more rodent immunoglobulin heavy chain constant region genes at the engineered endogenous immunoglobulin heavy chain locus. (Item 112) 112. The method of any one of items 109 to 111, wherein the one or more DNA fragments further comprise at least one selectable marker. (Item 113) 113. The method of any one of items 109 to 112, wherein the one or more DNA fragments further comprise at least one site-specific recombination site. (Item 114) 114. The method of any one of paragraphs 109 to 113, further comprising introducing one or more human Vλ non-coding sequences and one or more human Vλ non-coding sequences into the first engineered endogenous immunoglobulin κ light chain locus, wherein each of the one or more human Vλ non-coding sequences is flanked by a human Vλ gene segment and each of the one or more human Jλ non-coding sequences is flanked by a human Jλ gene segment. (Item 115) 115. The method of any one of paragraphs 109-114, further comprising introducing the κ light chain non-coding sequence into the genome of the rodent ES cell such that the κ light chain non-coding sequence is positioned between the one or more human Vλ gene segments and the one or more human Jλ gene segments at the first engineered endogenous immunoglobulin κ light chain locus. (Item 116) 116. The method according to any one of items 109 to 115, wherein the rodent ES cells are rat ES cells or mouse ES cells. (Item 117) 1. A method for producing a genetically modified rodent, said method comprising: (a)(i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments; (iii) a Cλ gene; manipulating a first endogenous immunoglobulin κ light chain locus in the germline genome of the rodent to comprise Including, the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; The method, wherein the Cλ gene is inserted into the first endogenous immunoglobulin κ light chain locus. (Item 118) The method comprises: (b)(i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments; (iii) a Cλ gene; manipulating a second endogenous immunoglobulin κ light chain locus in the germline genome of the rodent to comprise further comprising the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; 118. The method of claim 117, wherein the Cλ gene is inserted into the second endogenous immunoglobulin κ light chain locus. (Item 119) The method comprises: (b)(i) one or more human Vκ gene segments; (ii) one or more human Jκ gene segments; engineering a second engineered endogenous immunoglobulin κ light chain locus in the germline genome of the rodent to comprise further comprising 118. The method of claim 117, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a CK gene. (Item 120) 120. The method of claim 119, wherein the Cκ gene in the second engineered endogenous immunoglobulin kappa light chain locus is an endogenous rodent Cκ gene. (Item 121) The method comprises: (c)(i) one or more human V H a gene segment; (ii) one or more human D H a gene segment; (iii) one or more human J H a gene segment; manipulating an engineered endogenous immunoglobulin heavy chain locus in the germline genome of said rodent to comprise further comprising the one or more human V H gene segment, said one or more human D H gene segments, and the one or more human J H 121. The method of any one of paragraphs 117 to 120, wherein the gene segments are operably linked to one or more rodent immunoglobulin heavy chain constant region genes. (Item 122) 122. The method of any one of paragraphs 117 to 121, wherein the step of manipulating a first endogenous immunoglobulin κ light chain locus in the germline genome of the rodent is carried out in a rodent embryonic stem cell that comprises in its genome a second engineered endogenous immunoglobulin κ light chain locus comprising one or more human Vκ gene segments and one or more human Jκ gene segments operably linked to a Cκ gene. (Item 123) 123. The method of claim 122, wherein the Cκ gene in the second engineered endogenous immunoglobulin kappa light chain locus is an endogenous rodent Cκ gene. (Item 124) The manipulating step comprises generating one or more human V-type nucleotides operably linked to one or more rodent immunoglobulin heavy chain constant region genes. H gene segment, one or more human D H gene segment, and one or more human J H 124. The method of any one of Items 117 to 120, 122, and 123, performed in a rodent ES cell that contains in its genome an engineered endogenous immunoglobulin heavy chain locus comprising the gene segment. (Item 125) The engineered endogenous immunoglobulin heavy chain locus comprises one or more human V H one or more human Vs each flanking at least one of the gene segments H the one or more human V sequences comprising non-coding sequences; H Each non-coding sequence naturally occurs as a human V at the endogenous human immunoglobulin heavy chain locus. H 125. The method of any one of items 121 to 124, wherein the gene segment is found adjacent to the gene segment. (Item 126) The engineered endogenous immunoglobulin heavy chain locus comprises one or more human D H one or more human Ds each flanking at least one of the gene segments H a non-coding sequence,H Each of the non-coding sequences naturally contains a human D at the endogenous human immunoglobulin heavy chain locus. H 126. The method of any one of items 121 to 125, wherein the gene segment is found adjacent to the gene segment. (Item 127) The engineered endogenous immunoglobulin heavy chain locus comprises one or more human J H one or more human J each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally contains a human J at the endogenous human immunoglobulin heavy chain locus. H 127. The method of any one of items 121 to 126, wherein the gene segment is found adjacent to the gene segment. (Item 128) 128. The method of any one of items 109 to 127, wherein the first engineered endogenous immunoglobulin κ light chain locus does not comprise a rodent Cκ gene. (Item 129) 129. The method of any one of items 110 to 115 and 119 to 128, wherein the Cκ gene in the second engineered endogenous immunoglobulin κ light chain locus is an endogenous rodent Cκ gene. (Item 130) 130. The method of any one of items 109 to 129, wherein the Cλ gene in the first engineered endogenous immunoglobulin κ light chain locus comprises a rodent Cλ gene. (Item 131) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each flanking at least one of the one or more human Vλ gene segments, wherein the one or more human Vλ non-coding sequences are naturally found adjacent to a human Vλ gene segment at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking at least one of the one or more human Jλ gene segments, wherein the one or more human Jλ non-coding sequences are naturally found adjacent to a human Jλ gene segment at an endogenous human immunoglobulin λ light chain locus; or (iii) any combination thereof 131. The method according to any one of items 109 to 130, further comprising: (Item 132) (i) the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; Item 132. The method according to any one of Items 109 to 131. (Item 133) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at the first engineered endogenous immunoglobulin κ light chain locus, wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; Item 133. The method of item 132, comprising: (Item 134) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences, each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at said first engineered endogenous immunoglobulin κ light chain locus; wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; Item 133. The method of item 132, comprising: (Item 135) (i) the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; The method according to any one of items 109 to 134. (Item 136) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) at the first engineered endogenous immunoglobulin κ light chain locus, Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37 , Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, each flanked by one or more human Vλ non-coding sequences. Several human Vλ non-coding sequences naturally occur at the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, and Vλ5-39. , Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; Item 136. The method according to Item 135, comprising: (Item 137) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) determining whether or not the Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1 one or more human Vλ non-coding sequences each flanking Vλ3-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, are multiple human Vλ non-coding sequences naturally occurring in the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, and Vλ one or more human Vλ non-coding sequences found adjacent to Vλ3-1, Vλ4-1, Vλ5-1, Vλ6-1, Vλ7-1, Vλ8-1, Vλ9-1, Vλ10-1, Vλ11-1, Vλ12-1, Vλ13-1, Vλ14-1, Vλ15-1, Vλ16-1, Vλ17-1, Vλ18-1, Vλ19-2, Vλ210-2, Vλ22-2, Vλ23-3, Vλ24-3, Vλ25-4, Vλ26-5, Vλ27-6, Vλ28-7, Vλ39-8, Vλ4-9, Vλ4-10, Vλ4-2, Vλ4-3, or Vλ5-1; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; Item 136. The method according to Item 135, comprising: (Item 138) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J HThe gene segment is a member of one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 138. The method according to any one of items 111 to 116 and 121 to 137, wherein the nucleic acid sequence is present instead of a gene segment, or a combination thereof. (Item 139) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H Depending on the gene segment, one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H The method according to any one of Items 111 to 116 and Items 121 to 138, wherein a gene segment, or any combination thereof, is substituted. (Item 140) the engineered endogenous immunoglobulin heavy chain locus (i) the one or more human V H one or more human V sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally occurs as a human V at the endogenous human immunoglobulin heavy chain locus. H the one or more human V sequences found adjacent to the gene segment H non-coding sequences, (ii) the one or more human D H one or more human Ds each flanking at least one of the gene segments H a non-coding sequence, H Each of the non-coding sequences naturally contains a human D at the endogenous human immunoglobulin heavy chain locus. H the one or more human D sequences found adjacent to the gene segment H non-coding sequences, (iii) the one or more human J H one or more human J sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally contains a human J at the endogenous human immunoglobulin heavy chain locus. H the one or more human J sequences found adjacent to the gene segment H a non-coding sequence, or (iv) any combination thereof The method according to any one of Items 111 to 116 and Items 121 to 139, further comprising: (Item 141) 141. The method of any one of Items 111 to 116 and 121 to 140, wherein the one or more rodent immunoglobulin heavy chain constant region genes are one or more endogenous rodent immunoglobulin heavy chain constant region genes. (Item 142) (i) the one or more human V H If the gene segment is V H 3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, V H 6-1, or any combination thereof, (ii) the one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, D H 7-27, or any combination thereof, (iii) the one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5. J H 6, or any combination thereof, The method according to any one of Items 111 to 116 and Items 121 to 141. (Item 143) 143. The method of any one of items 111 to 116 and 121 to 142, wherein the engineered endogenous immunoglobulin heavy chain locus does not comprise a functional endogenous rodent Adam6 gene. (Item 144) The method of any one of Items 111 to 116 and 121 to 143, wherein the genome of the rodent ES cell or the germ cell genome of the rodent further comprises one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. (Item 145) 145. The method of claim 144, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained on the same chromosome as the engineered endogenous immunoglobulin heavy chain locus. (Item 146) The method of claim 144 or 145, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained in the engineered endogenous immunoglobulin heavy chain locus. (Item 147) 147. The method of any one of items 144 to 146, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of a human Adam6 pseudogene. (Item 148) 148. The method of any one of items 144 to 147, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof, replace a human Adam6 pseudogene. (Item 149) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of a first human V H Gene segments and the second human V H 149. The method according to any one of items 144 to 148, wherein the gene segment is located between the gene segment. (Item 150) The first human V H Gene segment V H 1-2, and said second human V H Gene segment V H Item 149. The method according to Item 149, wherein the method is 6-1. (Item 151) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of human V H Gene segments and human D H 147. The method according to any one of items 144 to 146, wherein the gene segment is located between the gene segment. (Item 152) Item 153. The method of any one of Items 111 to 116 and 121 to 151, wherein the rodent is homozygous for the engineered endogenous immunoglobulin heavy chain locus. 153. The method of any one of items 109 to 152, wherein the genome of the rodent ES cell or the germ cell genome of the rodent further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. (Item 154) Item 154. The method of item 153, wherein the TdT is the short chain isoform of TdT (TdTS). (Item 155) 155. The method of claim 153 or 154, wherein the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin kappa light chain transcriptional control element, an immunoglobulin lambda light chain transcriptional control element, or any combination thereof. (Item 156) 156. The method of any one of Items 153 to 155, wherein the nucleic acid sequence encoding exogenous TdT is present in an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. (Item 157) 157. The method of any one of items 109 to 156, wherein the rodent is a rat or a mouse. (Item 158) 1. A method for producing antibodies in a genetically modified rodent, said method comprising: (a) immunizing a rodent with an antigen of interest, the rodent (i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments, and (iii) Cλ gene a first engineered endogenous immunoglobulin kappa light chain locus comprising and having a germline genome comprising the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; the immunizing step, wherein the Cλ gene (c) is present in the first engineered endogenous immunoglobulin κ light chain locus in place of a rodent Cκ gene; (b) maintaining the rodent under conditions sufficient for the rodent to generate an immune response against the antigen of interest; (c) from said rodent (i) an antibody that binds to the target antigen; (ii) nucleotides encoding the human light chain variable domain or human heavy chain variable domain, light chain, or heavy chain of an antibody that binds to the target antigen; or (iii) a cell expressing an antibody that binds to the target antigen; and recovering the The method comprising: (Item 159) 159. The method of claim 158, wherein the cells of the rodent are B cells. (Item 160) 160. The method of claim 159, further comprising generating hybridomas from the B cells. (Item 161) 1. A method for preparing an antibody, said method comprising: (a) expressing in a host cell a first nucleotide sequence encoding an immunoglobulin heavy chain, wherein said first nucleotide sequence comprises a human heavy chain variable region sequence; (b) expressing in the host cell a second nucleotide sequence encoding an immunoglobulin λ light chain, wherein the second nucleotide sequence comprises a human λ light chain variable region sequence identified from the genetically modified rodent; the genetically modified rodent germline genome comprises: (i) one or more human Vλ gene segments; (ii) one or more human Jλ gene segments; (iii) a Cλ gene; a first engineered endogenous immunoglobulin kappa light chain locus comprising Including, the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; the rodent does not contain a rodent Cκ gene at the engineered endogenous immunoglobulin κ light chain locus; (c) culturing the host cells to express the immunoglobulin light chain and the immunoglobulin heavy chain and form the antibody; and (d) obtaining said antibody from said host cell or host cell culture. The method comprising: (Item 162) 162. The method of claim 161, wherein the first nucleotide further comprises a human heavy chain constant region gene. (Item 163) 163. The method of claim 161 or 162, wherein the second nucleotide sequence further comprises a human lambda light chain constant region gene. (Item 164) 164. The method of any one of items 158 to 163, wherein the rodent is homozygous for the first engineered endogenous immunoglobulin κ light chain locus. (Item 165) 164. The method of any one of items 158 to 163, wherein the rodent is heterozygous for the first engineered endogenous immunoglobulin κ light chain locus. (Item 166) the germline genome of the rodent is (a) one or more human Vκ gene segments; (b) one or more human Jκ gene segments; a second engineered endogenous immunoglobulin kappa light chain locus comprising Including, 166. The method of claim 165, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a CK gene. (Item 167) 167. The method of claim 166, wherein the Cκ gene in the second engineered endogenous immunoglobulin kappa light chain locus is an endogenous rodent Cκ gene. (Item 168) 168. The method of any one of items 158 to 167, wherein the rodent does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ light chain locus. (Item 169) 169. The method of any one of items 158 to 168, wherein the Cλ gene in the first engineered endogenous immunoglobulin κ light chain locus comprises a rodent Cλ gene. (Item 170) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each flanking at least one of the one or more human Vλ gene segments, wherein the one or more human Vλ non-coding sequences are naturally found adjacent to a human Vλ gene segment at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking at least one of the one or more human Jλ gene segments, wherein the one or more human Jλ non-coding sequences are naturally found adjacent to a human Jλ gene segment at an endogenous human immunoglobulin λ light chain locus; or (iii) any combination thereof 169. The method according to any one of items 158 to 169, further comprising: (Item 171) (i) the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; 171. The method according to any one of items 158 to 170. (Item 172) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at the first engineered endogenous immunoglobulin κ light chain locus, wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; Item 171. The method according to Item 171, comprising: (Item 173) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences, each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at said first engineered endogenous immunoglobulin κ light chain locus; wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; Item 171. The method according to Item 171, comprising: (Item 174) (i) the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; Item 174. The method according to any one of items 158 to 173. (Item 175) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) at the first engineered endogenous immunoglobulin κ light chain locus, Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37 , Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, each flanked by one or more human Vλ non-coding sequences. Several human Vλ non-coding sequences naturally occur at the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, and Vλ5-39. , Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; Item 175. The method of item 174, comprising: (Item 176) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) determining whether or not the Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1 one or more human Vλ non-coding sequences each flanking Vλ3-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, are multiple human Vλ non-coding sequences naturally occurring in the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, and Vλ one or more human Vλ non-coding sequences found adjacent to Vλ3-1, Vλ4-1, Vλ5-1, Vλ6-1, Vλ7-1, Vλ8-1, Vλ9-1, Vλ10-1, Vλ11-1, Vλ12-1, Vλ13-1, Vλ14-1, Vλ15-1, Vλ16-1, Vλ17-1, Vλ18-1, Vλ19-2, Vλ210-2, Vλ22-2, Vλ23-3, Vλ24-3, Vλ25-4, Vλ26-5, Vλ27-6, Vλ28-7, Vλ39-8, Vλ4-9, Vλ4-10, Vλ4-2, Vλ4-3, or Vλ5-1; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; Item 175. The method of item 174, comprising: (Item 177) the germline genome of the rodent is (a) one or more human V H a gene segment; (b) one or more human D Ha gene segment; (c) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising further comprising the one or more human V H gene segment, said one or more human D H gene segments, and the one or more human J H 177. The method of any one of paragraphs 158 to 176, wherein the gene segments are operably linked to one or more rodent immunoglobulin heavy chain constant region genes at the engineered endogenous immunoglobulin heavy chain locus. (Item 178) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H The gene segment is a member of one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 178. The method of claim 177, wherein the nucleotide sequence of the present invention is present in place of a gene segment, or a combination thereof. (Item 179) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H Depending on the gene segment, one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 179. The method of claim 177 or 178, wherein gene segments, or any combination thereof, are substituted. (Item 180) the engineered endogenous immunoglobulin heavy chain locus (i) the one or more human VH one or more human V sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally occurs as a human V at the endogenous human immunoglobulin heavy chain locus. H the one or more human V sequences found adjacent to the gene segment H non-coding sequences, (ii) the one or more human D H one or more human Ds each flanking at least one of the gene segments H a non-coding sequence, H Each of the non-coding sequences naturally contains a human D at the endogenous human immunoglobulin heavy chain locus. H the one or more human D sequences found adjacent to the gene segment H non-coding sequences, (iii) the one or more human J H one or more human J sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally contains a human J at the endogenous human immunoglobulin heavy chain locus. H the one or more human J sequences found adjacent to the gene segment H a non-coding sequence, or (iv) any combination thereof 179. The method according to any one of items 177 to 179, further comprising: (Item 181) 181. The method of any one of items 177 to 180, wherein the one or more rodent immunoglobulin heavy chain constant region genes are one or more endogenous rodent immunoglobulin heavy chain constant region genes. (Item 182) (i) the one or more human V H If the gene segment is V H 3-74, V H 3-73, VH 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, V H 6-1, or any combination thereof, (ii) the one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, D H 3-10, D H5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, D H 7-27, or any combination thereof, (iii) the one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5. J H 6, or any combination thereof, 182. The method according to any one of items 177 to 181. (Item 183) 183. The method of any one of items 177 to 182, wherein the engineered endogenous immunoglobulin heavy chain locus does not comprise a functional endogenous rodent Adam6 gene. (Item 184) 184. The method of any one of items 177 to 183, wherein the germline genome of the rodent further comprises one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. (Item 185) 185. The method of claim 184, wherein the one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are expressed. (Item 186) 186. The method of claim 184 or 185, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained on the same chromosome as the engineered endogenous immunoglobulin heavy chain locus. (Item 187) 187. The method of any one of paragraphs 184 to 186, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are comprised in the engineered endogenous immunoglobulin heavy chain locus. (Item 188) 188. The method of any one of paragraphs 184 to 187, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of a human Adam6 pseudogene. (Item 189) 189. The method of any one of paragraphs 184 to 188, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof, replace a human Adam6 pseudogene. (Item 190) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of a first human V H Gene segments and the second human V H 189. The method according to any one of items 184 to 189, wherein the gene segment is located between the gene segment. (Item 191) The first human V H Gene segment V H 1-2, and said second human V HGene segment V H Item 190. The method according to Item 190, wherein the method is 6-1. (Item 192) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of human V H Gene segments and human D H 188. The method according to any one of items 184 to 187, wherein the gene segment is located between the gene segment. (Item 193) 193. The method of any one of items 177 to 192, wherein the rodent is homozygous for the engineered endogenous immunoglobulin heavy chain locus. (Item 194) 194. The method of any one of items 158 to 193, wherein the rodent comprises a B cell population expressing antibodies comprising immunoglobulin lambda light chains, each of which comprises a human immunoglobulin lambda light chain variable domain. (Item 195) 195. The method of claim 194, wherein the human immunoglobulin λ light chain variable domain is encoded by a rearranged human immunoglobulin λ light chain variable region sequence comprising: (i) one of the one or more human Vλ gene segments or a somatically hypermutated variant thereof; and (ii) one of the one or more human Jλ gene segments or a somatically hypermutated variant thereof. (Item 196) 196. The method of any one of items 158 to 195, wherein the germline genome of the rodent further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. (Item 197) 197. The method of claim 196, wherein the TdT is the short isoform of TdT (TdTS). (Item 198) 198. The method of claim 196 or 197, wherein the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin kappa light chain transcriptional control element, an immunoglobulin lambda light chain transcriptional control element, or any combination thereof. (Item 199) 199. The method of any one of Items 196 to 198, wherein the nucleic acid sequence encoding exogenous TdT is present in the germline genome at an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. (Item 200) 199. The method of any one of items 158 to 199, wherein the rodent is a rat or a mouse. (Item 201) A rodent embryonic stem (ES) cell, wherein the genome of said rodent ES cell comprises: (a) one or more human Vλ gene segments; (b) one or more human Jλ gene segments; (c) the Cλ gene; a first engineered endogenous immunoglobulin kappa light chain locus comprising Including, the one or more human Vλ gene segments and the one or more human Jλ gene segments are operably linked to the Cλ gene; The rodent ES cell, wherein the rodent ES cell does not contain a rodent Cκ gene in the first engineered endogenous immunoglobulin κ light chain locus. (Item 202) 202. The rodent ES cell of paragraph 201, wherein the rodent ES cell is homozygous for the first engineered endogenous immunoglobulin kappa light chain locus. (Item 203) 202. The rodent ES cell of paragraph 201, wherein the rodent ES cell is heterozygous for the first engineered endogenous immunoglobulin kappa light chain locus. (Item 204) the genome of the rodent ES cell is (i) one or more human Vκ gene segments; (ii) one or more human Jκ gene segments; a second engineered endogenous immunoglobulin kappa light chain locus comprising Including, 204. The rodent ES cell of paragraph 203, wherein the one or more human Vκ gene segments and the one or more human Jκ gene segments are operably linked to a Cκ gene. (Item 205) 205. The rodent ES cell of paragraph 204, wherein the Cκ gene in the second engineered endogenous immunoglobulin kappa light chain locus is an endogenous rodent Cκ gene. (Item 206) the genome of the rodent ES cell is (i) one or more human V H a gene segment; (ii) one or more human D H a gene segment; (iii) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising Including, the one or more human V H gene segment, said one or more human D H gene segments, and the one or more human J H 206. The rodent ES cell of any one of paragraphs 201 to 205, wherein the gene segments are operably linked to one or more rodent immunoglobulin heavy chain constant region genes at the engineered endogenous immunoglobulin heavy chain locus. (Item 207) 207. The rodent ES cell of items 201 to 206, wherein the rodent does not comprise a rodent Cκ gene at the first engineered endogenous immunoglobulin κ light chain locus. (Item 208) 208. The rodent ES cell of any one of items 201 to 207, wherein the Cλ gene in the first engineered endogenous immunoglobulin κ light chain locus comprises a rodent Cλ gene. (Item 209) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each flanking at least one of the one or more human Vλ gene segments, wherein the one or more human Vλ non-coding sequences are naturally found adjacent to a human Vλ gene segment at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking at least one of the one or more human Jλ gene segments, wherein the one or more human Jλ non-coding sequences are naturally found adjacent to a human Jλ gene segment at an endogenous human immunoglobulin λ light chain locus; or (iii) any combination thereof 209. The rodent ES cell of any one of items 201 to 208, further comprising: (Item 210) (i) the one or more human Vλ gene segments comprise Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; 209. The rodent ES cell of any one of items 201 to 209. (Item 211) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at the first engineered endogenous immunoglobulin κ light chain locus, wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; 211. The rodent ES cell of item 210, comprising: (Item 212) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) one or more human Vλ non-coding sequences, each adjacent to said Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at said first engineered endogenous immunoglobulin κ light chain locus; wherein each of the plurality of human Vλ non-coding sequences is naturally found adjacent to Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1 at an endogenous human immunoglobulin λ light chain locus; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; 211. The rodent ES cell of item 210, comprising: (Item 213) (i) the one or more human Vλ gene segments comprise Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, Vλ3-1, or any combination thereof; (ii) the one or more human Jλ gene segments comprise Jλ1, Jλ2, Jλ3, Jλ6, Jλ7, or any combination thereof; 213. The rodent ES cell of any one of items 201 to 212. (Item 214) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) at the first engineered endogenous immunoglobulin κ light chain locus, Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37 , Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, each flanked by one or more human Vλ non-coding sequences. Several human Vλ non-coding sequences naturally occur at the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, and Vλ5-39. , Vλ5-37, Vλ1-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1; (ii) one or more human Jλ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jλ non-coding sequences are found naturally adjacent to a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at an endogenous human immunoglobulin λ light chain locus, respectively; 214. The rodent ES cell of item 213, comprising: (Item 215) the first engineered endogenous immunoglobulin κ light chain locus comprises: (i) determining whether or not the Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, Vλ5-37, Vλ1 one or more human Vλ non-coding sequences each flanking Vλ3-36, Vλ3-27, Vλ3-25, Vλ2-23, Vλ3-22, Vλ3-21, Vλ3-19, Vλ2-18, Vλ3-16, Vλ2-14, Vλ3-12, Vλ2-11, Vλ3-10, Vλ3-9, Vλ2-8, Vλ4-3, or Vλ3-1, are multiple human Vλ non-coding sequences naturally occurring in the endogenous human immunoglobulin λ light chain locus: Vλ4-69, Vλ8-61, Vλ4-60, Vλ6-57, Vλ10-54, Vλ5-52, Vλ1-51, Vλ9-49, Vλ1-47, Vλ7-46, Vλ5-45, Vλ1-44, Vλ7-43, Vλ1-40, Vλ5-39, and Vλ one or more human Vλ non-coding sequences found adjacent to Vλ3-1, Vλ4-1, Vλ5-1, Vλ6-1, Vλ7-1, Vλ8-1, Vλ9-1, Vλ10-1, Vλ11-1, Vλ12-1, Vλ13-1, Vλ14-1, Vλ15-1, Vλ16-1, Vλ17-1, Vλ18-1, Vλ19-2, Vλ210-2, Vλ22-2, Vλ23-3, Vλ24-3, Vλ25-4, Vλ26-5, Vλ27-6, Vλ28-7, Vλ39-8, Vλ4-9, Vλ4-10, Vλ4-2, Vλ4-3, or Vλ5-1; (ii) one or more human Jκ non-coding sequences each flanking a Jλ1, Jλ2, Jλ3, Jλ6, or Jλ7 at the first engineered endogenous immunoglobulin κ light chain locus, wherein the one or more human Jκ non-coding sequences are found naturally flanking a Jκ1, Jκ2, Jκ3, Jκ4, or Jκ5 at an endogenous human immunoglobulin κ light chain locus, respectively; 214. The rodent ES cell of item 213, comprising: (Item 216) the genome of the rodent ES cell is (a) one or more human V H a gene segment; (b) one or more human D Ha gene segment; (c) one or more human J H a gene segment; an engineered endogenous immunoglobulin heavy chain locus comprising further comprising the one or more human V H gene segment, said one or more human D H gene segments, and the one or more human J H 216. The rodent ES cell of any one of paragraphs 201 to 215, wherein the gene segments are operably linked to one or more rodent immunoglobulin heavy chain constant region genes at the engineered endogenous immunoglobulin heavy chain locus. (Item 217) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H The gene segment is a member of one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 217. The rodent ES cell of paragraph 216, wherein the gene segment, or a combination thereof, is present instead of the gene segment, or a combination thereof. (Item 218) the one or more human V H gene segment, one or more human D H gene segment, and one or more human J H Depending on the gene segment, one or more rodent V H gene segment, one or more rodent D H gene segment, one or more rodent J H 218. The rodent ES cell of claim 216 or 217, wherein a gene segment, a gene segment, or any combination thereof is substituted. (Item 219) the engineered endogenous immunoglobulin heavy chain locus (i) the one or more human V H one or more human V sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally occurs as a human V at the endogenous human immunoglobulin heavy chain locus. H the one or more human V sequences found adjacent to the gene segment H non-coding sequences, (ii) the one or more human D H one or more human Ds each flanking at least one of the gene segments H a non-coding sequence, H Each of the non-coding sequences naturally contains a human D at the endogenous human immunoglobulin heavy chain locus. H the one or more human D sequences found adjacent to the gene segment H non-coding sequences, (iii) the one or more human J H one or more human J sequences each flanking at least one of the gene segments H a non-coding sequence, H Each non-coding sequence naturally contains a human J at the endogenous human immunoglobulin heavy chain locus. H the one or more human J sequences found adjacent to the gene segment H a non-coding sequence, or (iv) any combination thereof 219. The rodent ES cell of any one of items 216 to 218, further comprising: (Item 220) 219. The rodent ES cell of any one of items 216 to 219, wherein the one or more rodent immunoglobulin heavy chain constant region genes are one or more endogenous rodent immunoglobulin heavy chain constant region genes. (Item 221) (i) the one or more human V H If the gene segment is V H3-74, V H 3-73, V H 3-72, V H 2-70, V H 1-69, V H 3-66, V H 3-64, V H 4-61, V H 4-59, V H 1-58, V H 3-53, V H 5-51, V H 3-49, V H 3-48, V H 1-46, V H 1-45, V H 3-43, V H 4-39, V H 4-34, V H 3-33, V H 4-31, V H 3-30, V H 4-28, V H 2-26, V H 1-24, V H 3-23, V H 3-21, V H 3-20, V H 1-18, V H 3-15, V H 3-13, V H 3-11, V H 3-9, V H 1-8, V H 3-7, V H 2-5, V H 7-4-1, V H 4-4, V H 1-3, V H 1-2, V H 6-1, or any combination thereof, (ii) the one or more human D H The gene segment is D H 1-1, D H 2-2, D H 3-3, D H 4-4, D H 5-5, D H 6-6, D H 1-7, D H 2-8, D H 3-9, DH 3-10, D H 5-12, D H 6-13, D H 2-15, D H 3-16, D H 4-17, D H 6-19, D H 1-20, D H 2-21, D H 3-22, D H 6-25, D H 1-26, D H 7-27, or any combination thereof, (iii) the one or more human J H The gene segment is J H 1. J H 2. J H 3. J H 4. J H 5. J H 6, or any combination thereof, 221. The rodent ES cell of any one of items 216 to 220. (Item 222) 222. The rodent ES cell of any one of items 216 to 221, wherein the engineered endogenous immunoglobulin heavy chain locus does not comprise a functional endogenous rodent Adam6 gene. (Item 223) 223. The rodent ES cell of any one of items 216 to 222, wherein the genome of the rodent further comprises one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. (Item 224) 224. The rodent ES cell of Item 223, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained on the same chromosome as the engineered endogenous immunoglobulin heavy chain locus. (Item 225) 225. The rodent ES cell of claim 223 or 224, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are contained in the engineered endogenous immunoglobulin heavy chain locus. (Item 226) 226. The rodent ES cell of any one of paragraphs 223 to 225, wherein the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are present in place of a human Adam6 pseudogene. (Item 227) 227. The rodent ES cell of any one of paragraphs 223 to 226, wherein the human Adam6 pseudogene is replaced by the one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof. (Item 228) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of a first human V H Gene segments and the second human V H 228. The rodent ES cell of any one of items 223 to 227, wherein the gene segment is located between the (Item 229) The first human V H Gene segment V H 1-2, and said second human V H Gene segment V H 229. The rodent ES cell according to item 228, which is 6-1. (Item 230) The one or more nucleotide sequences encoding one or more rodent ADAM6 polypeptides, rodent ADAM6 functional orthologs, rodent ADAM6 functional homologs, or functional fragments thereof are selected from the group consisting of human V H Gene segments and human D H 226. The rodent ES cell of any one of items 223 to 225, wherein the gene segment is located between the (Item 231) 231. The rodent ES cell of any one of items 216 to 230, wherein the rodent cell is homozygous for the engineered endogenous immunoglobulin heavy chain locus. (Item 232) 232. The rodent ES cell of any one of items 201 to 231, wherein the genome of the rodent ES cell further comprises a nucleic acid sequence encoding an exogenous terminal deoxynucleotidyl transferase (TdT) operably linked to a transcriptional control element. (Item 233) 233. The rodent ES cell of item 232, wherein the TdT is the short isoform of TdT (TdTS). (Item 234) 234. The rodent ES cell of claim 232 or 233, wherein the transcriptional control element comprises a RAG1 transcriptional control element, a RAG2 transcriptional control element, an immunoglobulin heavy chain transcriptional control element, an immunoglobulin kappa light chain transcriptional control element, an immunoglobulin lambda light chain transcriptional control element, or any combination thereof. (Item 235) 236. The rodent ES cell of any one of Items 232 to 234, wherein the nucleic acid sequence encoding exogenous TdT is present in an immunoglobulin κ light chain locus, an immunoglobulin λ light chain locus, an immunoglobulin heavy chain locus, a RAG1 locus, or a RAG2 locus. 236. The rodent ES cell of any one of items 201 to 235, wherein the rodent ES cell is a rat ES cell or a mouse ES cell. (Item 237) 1. A method for preparing a fully human antibody specific to an antigen, said method comprising: (a) immunizing a rodent according to any one of items 1 to 60 with the antigen; (b) determining the nucleotide sequence encoding the human heavy chain variable domain of an antibody produced by the genetically modified mouse that specifically binds to the antigen, and / or determining the nucleotide sequence encoding the human λ light chain variable domain of an antibody produced by the genetically modified mouse that specifically binds to the antigen; (c)(i) a nucleotide sequence encoding the human heavy chain variable domain of (b) operably linked to a human heavy chain constant region gene; and / or (ii) the nucleotide sequence encoding the human λ light chain variable domain of (b) operably linked to a human light chain constant region gene; expressing a fully human antibody by using The method comprising: (Item 238) 1. A method for preparing a fully human antibody specific to an antigen, said method comprising: (a) expressing in a mammalian cell a fully human antibody comprising two human λ light chains and two human heavy chains, wherein each human λ light chain comprises a human λ light chain variable domain encoded by a human λ light chain variable region, and each human heavy chain comprises a human heavy chain variable domain encoded by a human heavy chain variable region, and wherein the nucleotide sequence of at least one human heavy chain variable region or human λ light chain variable region is obtained from the rodent of any one of items 1 to 60; (b) obtaining said fully human antibody; The method comprising: (Item 239) 1. A method for preparing a fully human antibody specific to an antigen, said method comprising: (a) immunizing a rodent according to any one of items 1 to 60; (b) determining the human heavy chain variable domain sequence of an antibody produced by the genetically modified mouse that specifically binds to the antigen, and / or determining the human λ light chain variable domain sequence of an antibody produced by the genetically modified mouse that specifically binds to the antigen; (c)(i) the human heavy chain variable domain sequence of (b) operably linked to a human heavy chain constant domain sequence, and / or (ii) a human lambda light chain variable domain sequence according to (b) operably linked to a human light chain constant domain sequence; expressing a fully human antibody by using The method comprising: (Item 240) 239. The method of claim 239, wherein using the human heavy chain variable domain sequence of (b) operably linked to a human heavy chain constant domain sequence comprises expressing the human heavy chain variable domain sequence of (b) and a nucleotide sequence encoding the human heavy chain constant domain sequence. (Item 241) 241. The method of claim 239 or 240, wherein using the human λ light chain variable domain sequence of (b) operably linked to a human light chain constant domain sequence comprises expressing the human λ light chain variable domain sequence of (b) and a nucleotide sequence encoding the human light chain constant domain sequence. (Item 242) 1. A method for preparing a fully human antibody specific to an antigen, said method comprising: (a) expressing in a mammalian cell the fully human antibody comprising two human λ light chains and two human heavy chains, wherein each human λ light chain comprises a human light chain variable domain and each human heavy chain comprises a human heavy chain variable domain, and the amino acid sequence of at least one human heavy chain variable domain or human λ light chain variable domain is obtained from the rodent according to any one of items 1 to 60; (b) obtaining said fully human antibody; The method comprising: (Item 243) 1. A method for generating a human heavy chain variable domain sequence or a human lambda light chain variable domain sequence, the method comprising: (a) immunizing a rodent according to any one of items 1 to 60; (b) determining the human heavy chain variable domain sequence or the human λ light chain variable domain sequence of an antibody produced by the genetically modified mouse that specifically binds to the antigen; The method comprising: (Item 244) 244. The method of claim 243, wherein determining the human heavy chain variable domain sequence or the human λ light chain variable domain sequence comprises determining a nucleotide sequence encoding the human heavy chain variable domain sequence or the human λ light chain variable domain sequence. (Item 245) 1. A method for preparing a fully human heavy chain or a fully human light chain, said method comprising: (a) immunizing a rodent according to any one of items 1 to 60; (b) determining the human heavy chain variable domain sequence or the human λ light chain variable domain sequence of an antibody produced by the genetically modified mouse that specifically binds to the antigen; (c) operably linking the human heavy chain variable domain sequence or the human lambda light chain variable domain sequence to a human heavy chain constant domain sequence or a human light chain constant domain sequence, respectively, to form a fully human heavy chain or a fully human light chain; The method comprising: (Item 246) 246. The method of claim 245, wherein operably linking the human heavy chain variable domain sequence or human λ light chain variable domain sequence to a human heavy chain constant domain sequence or human light chain constant domain sequence, respectively, comprises operably linking a nucleotide sequence encoding the human heavy chain variable domain sequence or human λ light chain variable domain sequence to a nucleotide sequence encoding the human heavy chain constant domain sequence or human light chain constant domain sequence. (Item 247) 1. A method for generating a human heavy chain variable region sequence or a human lambda light chain variable region sequence, the method comprising: (a) immunizing a rodent according to any one of items 1 to 60; (b) determining a human heavy chain variable region sequence or a human λ light chain variable region sequence encoding the human heavy chain variable domain or the human λ light chain variable domain, respectively, of an antibody produced by the genetically modified mouse and that specifically binds to the antigen; The method comprising: (Item 248) 1. A method for preparing a nucleotide sequence encoding a fully human heavy chain or a fully human light chain, said method comprising: (a) immunizing a rodent according to any one of items 1 to 60; (b) determining a human heavy chain variable region sequence or a human λ light chain variable region sequence encoding the human heavy chain variable domain or the human λ light chain variable domain, respectively, of an antibody produced by the genetically modified mouse and that specifically binds to the antigen; (c) operably linking the human heavy chain variable region sequence or the human λ light chain variable region sequence to a human heavy chain constant region gene or a human light chain constant region gene, respectively, to form a nucleotide sequence encoding a complete human heavy chain or a complete human light chain; The method comprising:

[0099] The drawings contained herein consist of the following figures, which are for purposes of illustration only and not limitation: [Brief explanation of the drawings]

[0100] [Figure 1A] FIG. 1 illustrates an example embodiment of a strategy for constructing a targeting vector (described in Example 1.1) used to generate rodent embodiments according to the present disclosure (not to scale). [Figure 1B]FIG. 1 illustrates an example embodiment of a strategy for constructing a targeting vector (described in Example 1.1) used to generate rodent embodiments according to the present disclosure (not to scale). [Figure 2A] FIG. 1 illustrates an example embodiment of inserting a targeting vector (as described in Example 1.1) into an engineered Igκ light chain locus of a rodent embryonic stem (ES) cell clone (used to generate embodiments according to the present disclosure) (not to scale). [Figure 2B] FIG. 1 illustrates an example embodiment of recombinase-mediated removal of selection cassette(s) in an engineered Igκ light chain locus resulting from insertion of the targeting vector (described in Example 1.1) used to generate rodent embodiments according to the present disclosure (not to scale). [Figure 3] FIG. 1 illustrates an example embodiment of a strategy for constructing a targeting vector (described in Example 1.2) used to generate rodent embodiments according to the present disclosure (not to scale). [Figure 4A] FIG. 1 illustrates the insertion of a targeting vector (described in Example 1.2) into an engineered Igκ light chain locus of a rodent embryonic stem (ES) cell clone (used to generate rodent embodiments according to the present disclosure) (not to scale). [Figure 4B] FIG. 1 illustrates an example embodiment of recombinase-mediated removal of selection cassette(s) in an engineered Igκ light chain locus resulting from insertion of the targeting vector (described in Example 1.2) used to generate rodent embodiments according to the present disclosure (not to scale). [Figure 5] 1 shows results obtained from a representative embodiment according to the present disclosure, where single cell gating of splenocytes collected from wild-type (WT) and 6558HO (LiK, homozygous) mice is shown, with the top row showing expression of CD19 (y-axis) and CD3 (x-axis), and the bottom row showing expression of immunoglobulin D (IgD, y-axis) and immunoglobulin M (IgM, x-axis) by CD19+ gated splenocytes. [Figure 6] Results from an exemplary embodiment according to the present disclosure are shown, representative of single cell gated bone marrow collected from wild-type (WT) and 6558HO (LiK, homozygous) mice, with the top row showing expression of CD19 (y-axis) and CD3 (x-axis), and the bottom row showing expression of immunoglobulin M (IgD, y-axis) and B220 (x-axis). [Figure 7] 1 shows results obtained from an exemplary embodiment according to the present disclosure, where a representative CD19+ gated sample of splenocytes obtained from wild-type (WT) and 6558HO (LiK, homozygous) mice shows expression of immunoglobulin light chains comprising the mouse Igλ (y-axis) or mouse Igκ (x-axis) constant region. [Figure 8] 1 shows results obtained from an exemplary embodiment according to the present disclosure, with CD19 (y-axis) and CD3 (x-axis) expression shown by representative single-cell gated splenocytes collected from the various humanized mice shown. HOH / LiK / λ- / - mice represent mice homozygous for a humanized immunoglobulin heavy chain (see, e.g., U.S. Pat. Nos. 8,642,835 and 8,697,940), homozygous for the LiK locus, and homozygous for an inactivated endogenous immunoglobulin λ light chain locus. HOH / KoK / LiK / λ- / - mice represent mice homozygous for a humanized immunoglobulin heavy chain (see, e.g., U.S. Patent Nos. 8,642,835 and 8,697,940), hemizygous for one kappa locus comprising a LiK locus and a second kappa locus comprising a humanized immunoglobulin kappa light chain locus, and homozygous for an inactivated endogenous immunoglobulin λ light chain locus. HOH / KoK mice represent control mice homozygous for a humanized immunoglobulin heavy chain and homozygous for a humanized immunoglobulin kappa light chain. [Figure 9]1 shows results obtained from an exemplary embodiment according to the present disclosure, with a representative CD19+ gated sample of splenocytes collected from the various humanized mice shown, showing expression of immunoglobulin light chains comprising the mouse Igλ (y-axis) or mouse Igκ (x-axis) constant region. [Figure 10] 1 shows results obtained from an exemplary embodiment according to the present disclosure, with immunoglobulin M (IgD, y-axis) and B220 (x-axis) expression shown by representative single cell gated bone marrow samples collected from various humanized mice as indicated. [Figure 11] 1 shows results obtained from an exemplary embodiment according to the present disclosure, representative of single cell gated bone marrow collected from various humanized mice as indicated, showing expression of immunoglobulin light chains comprising the mouse Igλ (y-axis) or mouse Igκ (x-axis) constant region in immature (top row) and mature (bottom row) B cells. [Figure 12] 1 is a schematic diagram (not to scale) illustrating an example embodiment of the present disclosure, showing an engineered immunoglobulin κ light chain locus as described herein and rearrangement of the locus to form an mRNA molecule. [Figure 13]

[0033] Figure 3 shows results obtained from a representative embodiment according to the present disclosure, showing representative protein immunoblots (Western blots) from SDS-PAGE using serum isolated from wild-type (WT) and 6558 homozygous (LiK HO) mice as described in Example 3.3. [Figure 14]

[0023] Figure 1 shows the results of testing embodiments according to the present disclosure, where CD19 (y-axis) and CD3 (x-axis) expression is shown for representative single-cell gated splenocytes collected from humanized mice. HOH / LiK / λ- / - / TdT mice represent mice homozygous for a humanized immunoglobulin heavy chain (see, e.g., U.S. Pat. Nos. 8,642,835 and 8,697,940), homozygous for the LiK locus, and homozygous for an inactivated endogenous immunoglobulin λ light chain locus, and comprise a nucleic acid sequence encoding exogenous terminal deoxynucleotidyl transferase (TdT). HOH / KoK / LiK / λ- / - / TdT mice refer to mice that are homozygous for a humanized immunoglobulin heavy chain (see, e.g., U.S. Pat. Nos. 8,642,835 and 8,697,940), hemizygous for one kappa locus that comprises a LiK locus and a second kappa locus that comprises a humanized immunoglobulin kappa light chain locus, and homozygous for an inactivated endogenous immunoglobulin λ light chain locus, and that contain a nucleic acid sequence encoding exogenous terminal deoxynucleotidyl transferase (TdT). [Figure 15] 1 shows the results of testing embodiments according to the present disclosure, with representative CD19+ gated splenocytes collected from various humanized mice shown showing expression of immunoglobulin light chains comprising the mouse Igλ (y-axis) constant region or the mouse Igκ (x-axis) constant region. [Figure 16] 1 shows the results of testing embodiments according to the present disclosure, with immunoglobulin M (IgM, y-axis) and B220 (x-axis) expression shown by representative single cell gated bone marrow single cells collected from various humanized mice as indicated. [Figure 17]1 shows the results of testing embodiments according to the present disclosure, with representative single cell gates of bone marrow collected from various humanized mice shown, showing expression of immunoglobulin light chains comprising the mouse Igλ (y-axis) or mouse Igκ (x-axis) constant region in immature (top row) and mature (bottom row) B cells. [Figure 18] 1 shows the results of testing embodiments according to the present disclosure, and shows a graph comparing immune responses in LiK / VI-3, LiK / VI-3 / TdT, and VI-3 / TdT mouse strains after immunization with protein immunogens. [Figure 19] 1 shows the results of testing embodiments according to the present disclosure, showing a graph comparing the immune response to a His-tag in LiK / VI-3, LiK / VI-3 / TdT, and VI-3 / TdT mouse strains after immunization with an unrelated protein antigen fused to a HIS-tag. [Figure 20] A portion of an endogenous human immunoglobulin λ light chain locus is depicted (not to scale). In Figure 20, a first arrow indicates a representation of a first exemplary endogenous human Vλ non-coding sequence at the endogenous human immunoglobulin λ light chain locus. As shown, the first exemplary endogenous human Vλ non-coding sequence at the endogenous human immunoglobulin λ light chain locus (represented by a line) is naturally found adjacent to the human Vλ3-12 gene segment (represented by a dark gray box) and the human Vλ2-11 gene segment (represented by a dark gray box) at the endogenous human immunoglobulin Igλ light chain locus. Similarly, a second arrow indicates a representation of a second exemplary endogenous human Vλ non-coding sequence at the endogenous human immunoglobulin λ light chain locus. As shown, a second exemplary endogenous human Vλ non-coding sequence (indicated by a line) is naturally found adjacent to a human Vλ2-11 gene segment (represented by a dark gray box) and a human Vλ3-10 gene segment (represented by a dark gray box) at an endogenous human immunoglobulin λ light chain locus. [Figure 21] A portion of an endogenous human immunoglobulin κ light chain locus is depicted (not to scale). In Figure 21, a first arrow points to a representation of a first exemplary endogenous human Jκ non-coding sequence at the endogenous human immunoglobulin κ light chain locus. As shown, the first exemplary endogenous human Jκ non-coding sequence at the endogenous human immunoglobulin κ light chain locus (indicated by a line) is naturally found adjacent to a human Jκ1 gene segment (represented by a dark gray box) and a human Jκ2 gene segment (represented by a dark gray box) at the endogenous human immunoglobulin κ light chain locus. Similarly, a second arrow points to a representation of a second exemplary endogenous human Jκ non-coding sequence at the endogenous human immunoglobulin κ light chain locus. As shown, a second exemplary endogenous human Jκ non-coding sequence (indicated by a line) is naturally found adjacent to a human Jκ2 gene segment (represented by a dark gray box) and a human Jκ3 gene segment (represented by a dark gray box) at an endogenous human immunoglobulin κ light chain locus. DETAILED DESCRIPTION OF THE INVENTION

[0101] A brief description of the sequence selected from the sequence listing Below are representative nucleic acid and amino acid sequences of various immunoglobulin constant regions from the mouse, rat, or human lambda gene. The nucleic acid and amino acid sequences of immunoglobulin genes and polypeptides are available from the International Immunogenetics Information System website (www.imgt.org).

[0102] Mouse Cλ1 DNA (SEQ ID NO: 1): [ka]

[0103] Mouse Cλ1 amino acid (SEQ ID NO: 2): [ka]

[0104] Mouse Cλ2 DNA (SEQ ID NO: 3): GTCAGCCCAAGTCCACTCCCACTCTCACCGTGTTTCCACCTTCCTCTGAGGAGCTCAAGGAAAACAAAGCCACACTGGTGTGTCTGATTTCCAACTTTTCCCGAGTGGTGTGACAGTGGCCTGGAAGGCAAATGGTACACCTATCACCCAGGGTGT GGACACTTCAAATCCCACCAAAGAGGGCAACAAGTTCATGGCCAGCAGCTTCCTACATTTGACATCGGACCAGTGGAGATCTCACAACAGTTTTACCTGTCAAGTTACACATGAAGGGACACTGTGGAGAAGAGTCTGTCTCCTGCAGAATGTCTC

[0105] Mouse Cλ2 amino acid (SEQ ID NO: 4): [ka]

[0106] Mouse Cλ3 DNA (SEQ ID NO: 5): [ka]

[0107] Mouse Cλ3 amino acid (SEQ ID NO: 6): [ka]

[0108] Rat Cλ1 DNA (SEQ ID NO: 7): [ka]

[0109] Rat Cλ1 amino acid (SEQ ID NO: 8): [ka]

[0110] Rat Cλ2 DNA (SEQ ID NO: 9): ACCAACCCAAGGCTACGCCCTCAGTCACCCTGTTCCCACCTTCCTCTGAAGAGCTCAAGACTGACAAGGCTACACTGGTGTGTATGGTGACAGATTTCTACCCTGGTGTTATGACAGTGGTCTGGAAGGCAGATGGTACCCCTATCACTCAGGGTGT GGAGACTACCCAGCCTTTCAAACAGAACAACAAGTACATGGCTACCAGCTACCTGCTTTTGACAGCAAAAGCATGGGAGACTCATAGCAATTACAGCTGCCAGGTCACTCACGAAGAGAACACTGTGGAGAAGAGTTTGTCCCGTGCTGAGTGTTCC

[0111] Rat Cλ2 amino acid (SEQ ID NO: 10): [ka]

[0112] Rat Cλ3 DNA (SEQ ID NO: 11): [ka]

[0113] Rat Cλ3 amino acid (SEQ ID NO: 12): [ka]

[0114] Rat Cλ4 DNA (SEQ ID NO: 13): [ka]

[0115] Rat Cλ4 amino acid (SEQ ID NO: 14): [ka]

[0116] Human Cλ1 DNA (SEQ ID NO: 15): [ka]

[0117] Human Cλ1 amino acid (SEQ ID NO: 16): [ka]

[0118] Human Cλ2 DNA (SEQ ID NO: 17): [ka]

[0119] Human Cλ2 amino acid (SEQ ID NO: 18): [ka]

[0120] Human Cλ3 DNA (SEQ ID NO: 19): [ka]

[0121] Human Cλ3 amino acid (SEQ ID NO: 20): [ka]

[0122] Human Cλ6 DNA (SEQ ID NO: 21): [ka]

[0123] Human Cλ6 amino acid (SEQ ID NO: 22): [ka]

[0124] Human Cλ7 DNA (SEQ ID NO: 23): [ka]

[0125] Human Cλ7 amino acid (SEQ ID NO: 24): [ka]

[0126] definition The scope of the present invention is defined by the claims appended hereto, and is not limited by any particular embodiment described herein. Those skilled in the art will recognize, upon reading this specification, various modifications that may be equivalent to such described embodiments or otherwise fall within the scope of the claims. Generally, terms described herein are used according to their art-understood meanings unless expressly stated otherwise. Definitions of certain terms are explicitly provided below; the meanings of these and other terms used in specific examples throughout this specification will be clear to those skilled in the art from the context. Additional definitions for the following terms and other terms are provided throughout this specification. The patent and non-patent literature references cited herein, or relevant portions thereof, are incorporated herein by reference in their entirety.

[0127] The use of ordinal terms (such as "first," "second," "third," etc.) in the claims to modify claim elements does not by itself imply any priority, precedence, or order of one claim element over another, nor does it imply any temporal order in which the actions of a method are performed, but is merely used as a marker to distinguish one claim element having a particular name from another element having the same name (which is the same except for the use of ordinal terms) by which such claim elements are distinguished.

[0128] As used in this application, the terms "about" and "approximately" are used as equivalents. All numbers used in this application, whether modified by about or approximately, are intended to cover any normal increments or decrements that would be understood by one of ordinary skill in the art.

[0129] As used in the specification and claims, the articles "a" and "an" should be understood to include plural referents unless a different definition is clearly indicated. A claim or description including "or" between one or more members of a group is deemed to satisfy the case where one, more than one, or all of those group members are present in, used in, or otherwise associated with a given product or process, unless a different definition is indicated or otherwise apparent from the context. The invention includes embodiments in which exactly one member of the group is present in, used in, or otherwise associated with a given product or process. The invention also includes embodiments in which more than one or all members of the group are present in, used in, or otherwise associated with a given product or process. Furthermore, unless otherwise specified or unless it is assumed that a contradiction or inconsistency may arise that would be apparent to one skilled in the art, it will be understood that all variations, combinations, and permutations of one or more limitations, elements, clauses, descriptive terms, etc. introduced from one or more of the enumerated claims into another claim (or any other related claim) that relies on the same base claim are encompassed by the present invention. When elements are presented as lists (e.g., Markush groups or similar formats), it will be understood that each subgroup of such elements is also disclosed, and that any element(s) can be excluded from the group. In general, when the invention or aspects of the invention are referred to as comprising particular elements, features, etc., it will be understood that a particular embodiment of the invention, or a particular aspect of the invention, consists of or consists essentially of such elements, features, etc. For purposes of simplicity, such embodiments have not been specifically set forth herein in such numerous terms. It will also be understood that any embodiment or aspect of the invention can be specifically excluded from the claims, regardless of whether the exclusion is specifically set forth herein.

[0130] Administration: As used herein, this term includes administering a composition to a subject or system (e.g., a cell, organ, tissue, organism, or associated component or set of components thereof). One of skill in the art will appreciate that the route of administration can vary depending, for example, on the subject or system to which the composition is administered, the nature of the composition, the purpose of the administration, etc. For example, in certain embodiments, administration to an animal subject (e.g., a human or rodent) can be bronchial (including by bronchial infusion), buccal, enteral, interdermal, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (including by intratracheal infusion), transdermal, vaginal, and / or vitreous. In some embodiments, administration can be intermittent. In some embodiments, administration can be continuous (e.g., perfusion) for at least a selected period of time.

[0131] Amelioration: As used herein, this term includes the prevention, reduction, or alleviation of a condition, or improvement of a subject's condition. Amelioration includes, but is not required to, complete recovery or complete prevention of a disease, disorder, or condition.

[0132] Approximately: This term, as applied to one or more target values, includes values ​​similar to the stated reference value. In certain embodiments, the term "approximately" or "about" refers to a range of values ​​that is within ±10% of (above or below) the stated reference value, unless otherwise stated or otherwise clear from the context (except where such number would exceed 100% of possible values).

[0133] Biologically active: As used herein, this term refers to the characteristic of any substance that has activity in a biological system, in vitro or in vivo (e.g., within an organism). For example, a substance that has a biological effect within an organism when present in that organism is considered to be biologically active. In certain embodiments, if a protein or polypeptide is biologically active, a portion of that protein or polypeptide that shares at least one of the biological activities of that protein or polypeptide is typically referred to as a "biologically active" portion.

[0134] Equivalent: As used herein, this term refers to two or more substances, entities, situations, sets of conditions, etc. that may not be identical to one another, but are sufficiently similar to permit comparison between them that conclusions can reasonably be drawn based on the observed differences or similarities. One of ordinary skill in the art will understand, given the context, the level of identity required in any given situation for two or more such substances, entities, situations, sets of conditions, etc. to be considered equivalent.

[0135] Conservative: As used herein, this term refers to the description of conservative amino acid substitutions, including the replacement of an amino acid residue with another amino acid residue having a side chain R group with similar chemical properties (e.g., charge or hydrophobicity). Generally, conservative amino acid substitutions do not substantially alter the desired functional properties of a protein (e.g., the ability of a receptor to bind to a ligand). Examples of amino acid groups with side chains with similar chemical properties include aliphatic side chains (such as glycine (Gly, G), alanine (Ala, A), valine (Val, V), leucine (Leu, L), and isoleucine (Ile, I)), aliphatic-hydroxyl side chains (such as serine (Ser, S) and threonine (Thr, T)), amide-containing side chains (such as asparagine (Asn, N) and glutamine (Gln, side chains such as phenylalanine (Phe, F), tyrosine (Tyr, Y), and tryptophan (Trp, W); basic side chains such as lysine (Lys, K), arginine (Arg, R), and histidine (His, H); acidic side chains such as aspartic acid (Asp, D) and glutamic acid (Glu, E); and sulfur-containing side chains such as cysteine ​​(Cys, C) and methionine (Met, M). Conservative amino acid substitution groups include, for example, valine / leucine / isoleucine (Val / Leu / Ile, V / L / I), phenylalanine / tyrosine (Phe / Tyr, F / Y), lysine / arginine (Lys / Arg, K / R), alanine / valine (Ala / Val, A / V), glutamic acid / aspartic acid (Glu / Asp, E / D), and asparagine / glutamine (Asn / Gln, N / Q). In some embodiments, conservative amino acid substitutions can be those that substitute alanine for any naturally occurring residue in a protein, such as those used in alanine scanning mutagenesis. In some embodiments, conservative substitutions are made that have positive values ​​in the PAM250 log-likelihood matrix disclosed in Gonnet, GH et al., 1992, Science 256:1443-1445, which is incorporated herein by reference in its entirety.In some embodiments, the substitution is a moderately conservative substitution, in which case the substitution has a non-negative value in the PAM250 log-likelihood matrix.

[0136] Control: As used herein, the term refers to a "control" in the art-understood sense of a standard against which results are compared. Controls are typically used to improve fairness in experiments by abstracting variables so that conclusions can be drawn about such variables. In some embodiments, a control is a reaction or assay performed simultaneously with a test reaction or assay to provide a comparison. "Control" also includes "control animals." A "control animal" may have a modification described herein, a different modification than those described herein, or no modification (i.e., wild-type animals). In one experiment, the "test" (i.e., the variable being tested) is administered, and in a second experiment, the variable being tested is not administered, providing a "control." In some embodiments, a control is a historical control (i.e., from a previously performed test or assay, or a quantity or result that is already known). In some embodiments, a control is or includes a published or otherwise archived record. A control can be a positive or negative control.

[0137] Disruption: As used herein, this term refers to the result of a homologous recombination event with a DNA molecule (e.g., one with an endogenous homologous sequence (such as a gene or locus)). In some embodiments, the disruption may result in or result in an insertion, deletion, substitution, substitution, missense mutation, or frameshift of DNA sequence(s), or any combination thereof. An insertion may include the insertion of an entire gene or a gene fragment (e.g., an exon), and such an entire gene or gene fragment may be of an origin other than the endogenous sequence (e.g., a heterologous sequence). In some embodiments, the disruption may increase the expression and / or activity of a gene or gene product (e.g., a polypeptide encoded by the gene). In some embodiments, the disruption may decrease the expression and / or activity of a gene or gene product. In some embodiments, the disruption may alter the sequence of a gene or encoded gene product (e.g., the encoded polypeptide). In some embodiments, the disruption may truncate or fragment a gene or encoded gene product (e.g., the encoded polypeptide). In some embodiments, the disruption may extend a gene or encoded gene product. In some such embodiments, the disruption may achieve assembly of the fusion polypeptide. In some embodiments, the disruption may affect the level of the gene or gene product, but not the activity of the gene or gene product. In some embodiments, the disruption may affect the activity of the gene or gene product, but not the level of the gene or gene product. In some embodiments, the disruption may not significantly affect the level of the gene or gene product. In some embodiments, the disruption may not significantly affect the activity of the gene or gene product. In some embodiments, the disruption may not significantly affect either the level or activity of the gene or gene product.

[0138] Determining, measuring, judging, evaluating, assaying, and analyzing: These terms are used interchangeably herein to refer to any form of measurement, including determining the presence or absence of an element. These terms include both quantitative and / or qualitative determinations. Assays can be relative or absolute. "Assaying for the presence of" can be determining the amount of something present and / or determining its presence or absence.

[0139] Endogenous promoter: As used herein, this term refers to the promoter naturally associated with an endogenous gene (e.g., in a wild-type organism).

[0140] Engineered: As used herein, this term generally refers to the aspect of being artificially manipulated. For example, in some embodiments, a polynucleotide can be considered "engineered" when two or more sequences that are not naturally linked together in that order are artificially manipulated to directly link them together in an engineered polynucleotide. In some embodiments, an engineered polynucleotide can include a regulatory sequence that is naturally found operably linked to a first coding sequence but not to a second coding sequence, and that is artificially linked to be operably linked to the second coding sequence. Alternatively or additionally, in some embodiments, a first nucleic acid sequence and a second nucleic acid sequence that each encode a polypeptide element or polypeptide domain and that are not naturally linked to each other can be linked to each other in a single engineered polynucleotide. Similarly, in some embodiments, a cell or organism can be considered "engineered" if its genetic information has been altered (e.g., new genetic material not previously present has been introduced, or previously present genetic material has been altered or removed). As is conventional and understood by those of skill in the art, the progeny of an engineered polynucleotide or cell are typically still referred to as "engineered," even though the actual manipulation was performed on the prior entity. Furthermore, as those of skill in the art will understand, a variety of methodologies are available by which the "engineering" described herein may be achieved. For example, in some embodiments, "engineering" may involve selection or design (e.g., selection or design of nucleic acid sequences, polypeptide sequences, cells, tissues, and / or organisms) by performing analysis or comparisons, or otherwise using a computer system programmed to analyze, recommend, and / or select sequences, modifications, and the like.Alternatively or additionally, in some embodiments, "manipulation" can involve the use of in vitro chemical synthesis methodologies and / or recombinant nucleic acid techniques (e.g., nucleic acid amplification (e.g., via polymerase chain reaction), hybridization, mutagenesis, transformation, transfection, etc.), and / or any of a variety of controlled conjugation methodologies. As one of skill in the art will appreciate, a variety of such established techniques (e.g., for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation) (e.g., electroporation, lipofection, etc.) are known in the art and are described in various general and more specific references cited and / or discussed throughout this specification. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual 2nd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989, and Principles of Gene Manipulation: An Introduction to Genetic Manipulation, 5th Ed., ed. By Old, R.W. and S.B. Primrose, Blackwell Science, Inc., 1994, which are incorporated herein by reference in their entireties.

[0141] Functional: As used herein, this term refers to a form or fragment of an entity (e.g., a gene or gene segment) that exhibits a particular property (e.g., forming part of a coding sequence) and / or activity. For example, in the context of immunoglobulins, variable regions are encoded by unique gene segments (i.e., V, D, and / or J) that assemble (or recombine) to form a functional coding sequence. When present in the genome, gene segments are grouped together in clusters, although diversity occurs. A "functional" gene segment is one that appears in an expressed sequence (i.e., a variable region) and whose corresponding genomic DNA has been isolated (i.e., cloned) and identified by sequencing. While immunoglobulin gene segment sequences may contain open reading frames and be considered functional, even though they do not appear in the expressed repertoire, immunoglobulin gene segment sequences may also contain mutations (e.g., point mutations, insertions, deletions, etc.) that result in stop codons and / or truncated sequences that render such gene segment sequences unable to exhibit the property(ies) and / or activity(ies) associated with the non-mutated sequence(s), such sequences do not appear in the expressed sequence and are therefore classified as pseudogenes.

[0142] Gene: As used herein, this term refers to a DNA sequence in a chromosome that encodes a product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene comprises coding sequence (i.e., a sequence that encodes a specific product). In some embodiments, a gene comprises non-coding sequence. In some specific embodiments, a gene can comprise both coding (e.g., exon) and non-coding (e.g., intron) sequences. In some embodiments, a gene can comprise one or more regulatory sequences (e.g., promoters, enhancers, etc.) and / or intron sequences, which can, for example, control or influence one or more aspects of gene expression (e.g., cell-type specific expression, inducible expression, etc.). For purposes of clarity, it should be noted that the term "gene," as used in this disclosure, generally refers to a portion of a nucleic acid that encodes a polypeptide or fragment thereof. As will be clear from the context to one of skill in the art, the term can optionally encompass regulatory sequences. This definition is not intended to exclude the application of the term "gene" to non-protein-coding expression units, but rather to clarify that as used herein, the term often refers to polypeptide-encoding nucleic acids.

[0143] Heterologous: As used herein, this term refers to a substance or entity that is derived from a different source. For example, when used with reference to a polypeptide, gene, or gene product present in a particular cell or organism, this term clarifies that the referenced polypeptide, gene, or gene product: 1) has been artificially engineered; 2) has been artificially introduced into the cell or organism (or a precursor thereof) (e.g., via genetic engineering); and / or 3) is not naturally produced by or does not naturally occur in the referenced cell or organism (e.g., the referenced cell type or organism type). "Heterologous" also includes a polypeptide, gene, or gene product that is normally present in a particular native cell or organism but has been altered or modified, for example, by mutagenesis or by placing it under the control of regulatory elements (e.g., a promoter) that are not naturally associated with it, and in some embodiments, are non-endogenous.

[0144] Host cell: As used herein, this term refers to a cell into which a nucleic acid or protein has been introduced. Those skilled in the art will understand from reading this disclosure that such terms are used not only to refer to the particular subject cell, but also to the progeny of such a cell. Such progeny may not actually be identical to the parent cell, as certain modifications may occur over generations due to mutation or environmental influences, but are still included within the scope of the phrase "host cell." In some embodiments, a host cell is or includes a prokaryotic or eukaryotic cell. In general, a host cell is any cell suitable for receiving and / or producing a heterologous nucleic acid or heterologous protein, regardless of the kingdom of life to which the cell is classified. Exemplary cells include prokaryotic and eukaryotic cells (single or multiple cells), bacterial cells (e.g., strains of Escherichia coli, Bacillus species, Streptomyces species, etc.), mycobacterial cells, fungal cells, yeast cells (e.g., Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Pichia methanolica, etc.), plant cells, insect cells (e.g., SF-9, SF-21, baculovirus-infected insect cells, Trichoplusia ni, etc.), non-human animal cells, human cells, or cell fusions (e.g., hybridomas or quadromas, etc.). In some embodiments, the cell is a human cell, a monkey cell, an ape cell, a hamster cell, a rat cell, or a mouse cell. In some embodiments, the cell is a eukaryotic cell and is selected from the following cells: CHO (e.g., CHO K1, DXB-11 CHO, Veggie-CHO), COS (e.g., COS-7), retinal cells, Vero, CV1, kidney cells (e.g., HEK293, 293EBNA, MSR293, MDCK, HaK, BHK), HeLa, HepG2, WI38, MRC5, Colo205, HB8065, HL-60, (e.g., BHK21), Jurkat, Daudi, A431 (epithelial), CV-1, U937, 3T3, L cells, C127 cells, SP2 / 0, NS-0, MMT060562, Sertoli cells, BRL 3A cells, HT1080 cells, myeloma cells, tumor cells, and cell lines derived from the foregoing. In some embodiments, the cells comprise, e.g., are retinal cells (e.g., PER.C6® cells) that contain, e.g., express, one or more viral genes. In some embodiments, the host cell is or comprises an isolated cell. In some embodiments, the host cell is part of a tissue. In some embodiments, the host cell is part of an organism.

[0145] Identity: As used herein in connection with sequence comparisons, this term refers to identity as determined by several different algorithms known to those skilled in the art that can be used to measure nucleotide and / or amino acid sequence identity. In some embodiments, identity as described herein is determined using ClustalW v.1.83 (slow) alignment with an open gap penalty of 10.0, an extension gap penalty of 0.1, and a Gonnet similarity matrix (MACVECTOR™ 10.0.2, MacVector Inc., 2008).

[0146] In place of: As used herein, this term refers to a positional replacement in which a first nucleic acid sequence is located at the position of a second nucleic acid sequence in a chromosome (e.g., a position in a chromosome where the second nucleic acid sequence was previously (e.g., originally) located, e.g., at the endogenous locus of the second nucleic acid sequence). The phrase "in place of" does not require that the second nucleic acid sequence be removed, e.g., from a locus or chromosome. In some embodiments, the second nucleic acid sequence and the first nucleic acid sequence are equivalent to each other, e.g., in that the first and second sequences are homologous to each other, contain corresponding elements (e.g., protein-coding elements, regulatory elements, etc.), and / or have similar or identical sequences. In some embodiments, the first nucleic acid sequence and / or the second nucleic acid sequence comprises one or more of a promoter, an enhancer, a splice donor site, a splice acceptor site, an intron, an exon, an untranslated region (UTR). In some embodiments, the first nucleic acid sequence and / or the second nucleic acid sequence comprises one or more coding sequences. In some embodiments, the first nucleic acid sequence is a homolog or variant (e.g., mutant) of the second nucleic acid sequence. In some embodiments, the first nucleic acid sequence is an ortholog or homolog of the second sequence. In some embodiments, the first nucleic acid sequence is or comprises a human nucleic acid sequence. In some embodiments, the second nucleic acid sequence is or comprises a rodent sequence (e.g., a mouse or rat sequence), including when the first nucleic acid sequence is or comprises a human nucleic acid sequence. In some embodiments, the second nucleic acid sequence is or comprises a human sequence, including when the first nucleic acid sequence is or comprises a human nucleic acid sequence. In some embodiments, the first nucleic acid sequence is a variant or mutant of the second sequence (i.e., a sequence that includes one or more sequence differences (e.g., substitutions) compared to the second sequence).The actually introduced nucleic acid sequence may include one or more regulatory sequences (e.g., promoters, enhancers, 5' untranslated regions, or 3' untranslated regions) that are part of the source nucleic acid sequence used to obtain the actually introduced sequence. For example, in various embodiments, the first nucleic acid sequence replaces an endogenous sequence with a heterologous sequence, such that this replacement results in the production of a gene product from the actually introduced nucleic acid sequence (including the heterologous sequence) but not the expression of the endogenous sequence. The first nucleic acid sequence has characteristics of the endogenous genomic sequence and includes a nucleic acid sequence encoding a polypeptide having a similar function to the polypeptide encoded by the endogenous sequence (e.g., the endogenous genomic sequence encodes all or part of a non-human variable region polypeptide, and the DNA fragment encodes all or part of one or more human variable region polypeptides). In various embodiments, a human immunoglobulin gene segment or fragment thereof is present in place of the endogenous non-human immunoglobulin gene segment or fragment thereof.

[0147] In vitro: As used herein, this term refers to events occurring in an artificial environment (e.g., in a test tube or reaction vessel, in cell culture, etc.) rather than in a multicellular organism.

[0148] In vivo: As used herein, this term refers to events occurring within a multicellular organism (such as a human and / or non-human animal). In the context of cell-based systems, the term can be used to refer to events occurring within living cells (e.g., in contrast to in vitro systems).

[0149] Isolated: As used herein, this term refers to a substance and / or entity that (1) has been separated from at least some of the components that accompanied it when it was originally generated (whether in nature and / or in an experimental context) and / or (2) has been artificially designed, generated, prepared, and / or manufactured. An isolated substance and / or entity can be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components that originally accompanied it. In some embodiments, an isolated material is 10% to 100%, 15% to 100%, 20% to 100%, 25% to 100%, 30% to 100%, 35% to 100%, 40% to 100%, 45% to 100%, 50% to 100%, 55% to 100%, 60% to 100%, 65% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 85% to 100%, 90% to 100%, 95% to 100%, 96% to 100%, 97% to 100%, 98% to 100%, or 99% to 100% separated from other components with which it was initially associated. In some embodiments, an isolated material is separated from 10% to 100%, 10% to 99%, 10% to 98%, 10% to 97%, 10% to 96%, 10% to 95%, 10% to 90%, 10% to 85%, 10% to 80%, 10% to 75%, 10% to 70%, 10% to 65%, 10% to 60%, 10% to 55%, 10% to 50%, 10% to 45%, 10% to 40%, 10% to 35%, 10% to 30%, 10% to 25%, 10% to 20%, or 10% to 15% of other components with which it was initially associated. In some embodiments, an isolated material is separated from 11% to 99%, 12% to 98%, 13% to 97%, 14% to 96%, 15% to 95%, 20% to 90%, 25% to 85%, 30% to 80%, 35% to 75%, 40% to 70%, 45% to 65%, 50% to 60%, or 55% to 60% of other components with which it was originally associated.In some embodiments, the purity of the isolated material is about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater than about 99%. In some embodiments, the purity of the isolated material is 80%-99%, 85%-99%, 90%-99%, 95%-99%, 96%-99%, 97%-99%, or 98%-99%. In some embodiments, the purity of the isolated material is 80%-99%, 80%-98%, 80%-97%, 80%-96%, 80%-95%, 80%-90%, or 80%-85%. In some embodiments, the purity of an isolated material is 85%-98%, 90%-97%, or 95%-96%. In some embodiments, a material is "pure" if it is substantially free of other components. In some embodiments, as one of skill in the art will understand, a material may still be considered "isolated" or even "pure" after being combined with certain other components (e.g., one or more carriers or excipients (e.g., buffers, solvents, water, etc.)). In such embodiments, the percent isolation or purity of the material is calculated without including such carriers or excipients. By way of example only, in some embodiments, a naturally occurring biological polymer (such as a polypeptide or polynucleotide) is considered to be "isolated" when: a) it is free from some or all of the components that accompany it in its natural state in nature due to the origin or source from which it is obtained, b) it is substantially free of other polypeptides or nucleic acids of the same species as that which naturally produces it, or c) it is expressed by or is otherwise associated with components derived from a cell or other expression system other than that which naturally produces it. Thus, for example, in some embodiments, a polypeptide is considered to be an "isolated" polypeptide when it is chemically synthesized or synthesized in a cellular system other than that which naturally produces it.Alternatively or additionally, in some embodiments, a polypeptide that has been subjected to one or more purification techniques may be considered to be an "isolated" polypeptide to the extent that it has been separated from other substances that a) naturally accompany it and / or b) accompany it when it is originally produced.

[0150] Locus: As used herein, this term refers to the location(s) of a gene (or equivalent sequence), DNA sequence, or polypeptide-coding sequence, or to a location on a chromosome in the genome of an organism. For example, an "immunoglobulin locus" can refer to the location of an immunoglobulin gene segment (e.g., V, D, J, or C), an immunoglobulin gene segment DNA sequence, or an immunoglobulin gene segment-coding sequence, or to an immunoglobulin gene segment location on a chromosome in the genome of an organism where such a sequence has been identified. An "immunoglobulin locus" can include regulatory elements of an immunoglobulin gene segment, including, but not limited to, an enhancer sequence, a promoter sequence, a 5' regulatory sequence, and / or a 3' regulatory sequence, or an enhancer region, a promoter region, a 5' regulatory region, and / or a 3' regulatory region, or a combination thereof. An "immunoglobulin locus" can include intergenic DNA (e.g., DNA normally present or occurring between gene segments in a wild-type locus). One skilled in the art will appreciate that chromosomes, in some embodiments, contain hundreds or even thousands of genes, and that similar loci may share common physical locations when compared across different species, and such loci may be described as sharing synteny.

[0151] Naturally occurring: As used herein with respect to a biological element (e.g., a nucleic acid sequence), this term means that the biological element would be found in a particular context and / or location in a cell or organism (e.g., an animal) in the absence of manipulation (e.g., genetic engineering). In other words, a sequence that is found in a particular context and / or location in nature is not present in that context and / or location as a result of manipulation (e.g., genetic engineering). For example, a sequence that is naturally found adjacent to a human Jκ1 gene segment at an endogenous human immunoglobulin kappa light chain locus is a sequence that would be found adjacent to a human Jκ1 gene segment at an endogenous human immunoglobulin kappa light chain locus in a human in the absence of genetic engineering. In some embodiments, a sequence can be obtained, obtained, and / or isolated from a location where it is naturally found in a cell or organism. In some embodiments, a cell or organism is not the direct source of a sequence naturally found in that cell or organism. For example, the corresponding sequence in a cell or organism can be identified and then generated or replicated by mechanisms known in the art.

[0152] Non-human animal: As used herein, this term refers to any vertebrate that is not a human. In some embodiments, the non-human animal is a cyclostome, a bony fish, a cartilaginous fish (e.g., a shark or a ray), an amphibian, a reptile, a mammal, or a bird. In some embodiments, the non-human animal is a mammal. In some embodiments, the non-human mammal is a primate, a goat, a sheep, a pig, a dog, a cow, or a rodent. In some embodiments, the non-human animal is a rodent (such as a rat or a mouse).

[0153] Nucleic acid: As used herein, this term refers to any compound and / or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a "nucleic acid" is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester bond. As will be clear from the context, in some embodiments, a "nucleic acid" refers to an individual nucleic acid residue (e.g., a nucleotide and / or a nucleoside). In some embodiments, a "nucleic acid" refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a "nucleic acid" is or comprises RNA. In some embodiments, a "nucleic acid" is or comprises DNA. In some embodiments, a "nucleic acid" is, comprises, or consists of one or more naturally occurring nucleic acid residues. In some embodiments, a "nucleic acid" is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a "nucleic acid" in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a "nucleic acid" is, comprises, or consists of one or more "peptide nucleic acids," which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone. Alternatively or additionally, in some embodiments, a "nucleic acid" has one or more phosphorothioate and / or 5'-N-phosphoramidite linkages rather than phosphodiester linkages. In some embodiments, a "nucleic acid" is, comprises, or consists of one or more naturally occurring nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine).In some embodiments, a "nucleic acid" is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a "nucleic acid" comprises one or more sugars that are modified compared to those found in naturally occurring nucleic acids (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose). In some embodiments, a "nucleic acid" has a nucleotide sequence that encodes a functional gene product (such as an RNA or a polypeptide). In some embodiments, a "nucleic acid" comprises one or more introns. In some embodiments, a "nucleic acid" comprises one or more exons. In some embodiments, a "nucleic acid" is prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis.In some embodiments, the "nucleic acids" may be, for example, but not limited to, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 110, at least 120, at least 130, at least 140, at least 150, at least 160, The nucleic acid may have a length of at least 170, at least 180, at least 190, at least 20, at least 225, at least 250, at least 275, at least 300, at least 325, at least 350, at least 375, at least 400, at least 425, at least 450, at least 475, at least 500, at least 600, at least 700, at least 800, at least 900, at least 1000, at least 1500, at least 2000, at least 2500, at least 3000, at least 3500, at least 4000, at least 4500, at least 5000, or more. In some embodiments, the nucleic acid is single-stranded. In some embodiments, the nucleic acid is double-stranded. In some embodiments, a "nucleic acid" has a nucleotide sequence that includes at least one element that encodes a polypeptide, or that includes at least one element that is the complement of a sequence that encodes a polypeptide. In some embodiments, a "nucleic acid" has enzymatic activity.

[0154] Operably linked: As used herein, this term refers to a juxtaposition of the described elements in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences. "Operably linked" sequences include both expression control sequences contiguous with a gene of interest and expression control sequences that act in trans to control a gene (or sequence of interest) or that act from a remote location to control a gene (or sequence of interest). The term "expression control sequence" includes polynucleotide sequences necessary to affect the expression and processing of coding sequences to which it is ligated. "Expression control sequences" include appropriate transcription initiation, termination, promoter, and enhancer sequences, efficient RNA processing signals (such as splicing and polyadenylation signals), sequences that stabilize cytoplasmic mRNA, sequences that improve translation efficiency (i.e., Kozak consensus sequences), sequences that improve polypeptide stability, and, if desired, sequences that improve polypeptide secretion. The nature of such control sequences will vary depending on the host organism. For example, in prokaryotes, such control sequences generally include a promoter, a ribosomal binding site, and a transcription termination sequence, while in eukaryotes, such control sequences typically include a promoter and a transcription termination sequence. The term "control sequence" is intended to include components essential for expression and processing, and may also include additional components whose presence is advantageous, such as leader sequences and fusion partner sequences.

[0155] Physiological conditions: As used herein, this term refers to the art-understood meaning of the term with respect to the conditions under which cells or organisms survive and / or increase in number. In some embodiments, this term includes external or internal environmental conditions that may occur naturally for a biological or cellular system. In some embodiments, physiological conditions are conditions that occur within the body of a human or non-human animal, particularly conditions that occur at and / or within a surgical site. Physiological conditions typically include, for example, a temperature range of 20-40°C, an atmospheric pressure of 1, a pH of 6-8, a glucose concentration of 1-20 mM, atmospheric oxygen levels, and gravity as experienced on Earth. In some embodiments, conditions in a laboratory are manipulated and / or maintained at physiological conditions. In some embodiments, physiological conditions are those found in an organism.

[0156] Polypeptide: As used herein, this term refers to any polymeric chain of amino acids. In some embodiments, a polypeptide has an amino acid sequence that occurs in nature. In some embodiments, a polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, a polypeptide has an amino acid sequence that includes portions that occur separately from each other in nature (i.e., portions that originate from two or more different organisms (e.g., human and non-human portions)). In some embodiments, a polypeptide has an amino acid sequence that is engineered in that it is artificially designed and / or generated. In some embodiments, a polypeptide has an amino acid sequence that is encoded by a sequence that does not occur in nature (e.g., a sequence that is engineered in that it is artificially designed and / or generated to encode the polypeptide).

[0157] Recombinant: As used herein, this term refers to a polypeptide that is designed, engineered, prepared, expressed, created, or isolated by recombinant means, such as polypeptides expressed by transfecting a recombinant expression vector into a host cell, polypeptides isolated from a combinatorial library of recombinant human polypeptides (Hoogenboom, H.R., 1997, TIB Tech. 15:62-70; Azzazy, H. and W.E. Highsmith, 2002, Clin. Biochem. 35:425-45; Gavilondo, J.V. and J.W. Larrick, 2002, BioTechniques 29:128-45; Hoogenboom H., and P. Chames, 2000, Immunol. Today 21:371-8, which are incorporated herein by reference in their entireties), antibodies isolated from animals (e.g., mice) that have been genetically engineered to contain human immunoglobulin genes (e.g., Taylor, L.Ed., et al., J.M. Chem. 2000, 12:147-150, 2000; and W.E. Highsmith, 2002, Clin. Biochem. 35:425-45; Gavilondo, J.V. and J.W. Larrick, 2002, BioTechniques 29:128-45; Hoogenboom H., and P. Chames, 2000, Immunol. Today 21:371-8, which are incorporated herein by reference in their entireties), antibodies isolated from animals (e.g., mice) that have been genetically engineered to contain human immunoglobulin genes (e.g., ... al.,1992,Nucl.Acids Res.20:6287-95, Kellermann,SA.and LLGreen,2002,Curr.Opin.Biotechnol.13:593-7,Little,M.et al.,2000,Immunol.Today 21:364-70,Osborn,MJet al.,2013,J.Immunol.190:1481-90,Lee,EC.et al.,2014,Nat.Biotech.32(4):356-63,Macdonald,LEet al.,2014,Proc.Natl.Acad.Sci.USA111(14):5147-52,Murphy,AJet al., 2014, Proc. Natl. Acad. Sci. USA 111(14):5153-8 (each of which is incorporated by reference in its entirety), or a polypeptide prepared, expressed, created, or isolated by any other means in which selected sequence elements are spliced ​​relative to one another. In some embodiments, one or more of such selected sequence elements are found in nature.In some embodiments, one or more of such selected sequence elements are designed in silico. In some embodiments, one or more of such selected sequence elements are obtained by mutagenesis (e.g., performed in vivo or in vitro) of known sequence elements (e.g., from natural or synthetic (e.g., artificial) sources). For example, in some embodiments, the recombinant polypeptide consists of a sequence found in the genome of a source organism of interest (e.g., human, mouse, etc.). In some embodiments, the recombinant polypeptide has an amino acid sequence obtained by mutagenesis (e.g., in vitro or in vivo, e.g., performed in a non-human animal) such that the amino acid sequence of the recombinant polypeptide is a sequence from which the polypeptide sequence originates and which, although related to it, may not naturally occur in the genome of the non-human animal in vivo.

[0158] Reference: As used herein, this term refers to a standard or control substance, animal, cohort, individual, population, sample, sequence, or value to which a substance, animal, cohort, individual, population, sample, sequence, or value of interest is compared. In some embodiments, the reference substance, animal, cohort, individual, population, sample, sequence, or value is tested and / or determined substantially simultaneously with the testing or determination of the substance, animal, cohort, individual, population, sample, sequence, or value of interest. In some embodiments, the reference substance, animal, cohort, individual, population, sample, sequence, or value is a historical reference, and such historical reference is optionally embodied in a real medium. In some embodiments, a reference can refer to a control. "Reference" also includes "reference animal." A "reference animal" may have a modification described herein, a different modification than those described herein, or no modification (i.e., a wild-type animal). Typically, as will be understood by one of skill in the art, the reference substance, animal, cohort, individual, population, sample, sequence, or value is determined or characterized under conditions equivalent to those used to determine or characterize the substance, animal (e.g., mammal), cohort, individual, population, sample, sequence, or value of interest.

[0159] Substitution: As used herein, this term refers to a process in which a "substituted" nucleic acid sequence (e.g., a gene) found in a host locus (e.g., in a genome) is removed from the locus and a different "replacement" nucleic acid is placed in its place. In some embodiments, the substituted nucleic acid sequence and the replacement nucleic acid sequence are equivalent to each other, e.g., in that the sequences are homologous to each other, contain corresponding elements (e.g., protein-coding elements, regulatory elements, etc.), and / or have similar or identical sequences. In some embodiments, the substituted nucleic acid sequence comprises one or more of a promoter, enhancer, splice donor site, splice acceptor site, intron, exon, untranslated region (UTR). In some embodiments, the replacement nucleic acid sequence comprises one or more coding sequences. In some embodiments, the replacement nucleic acid sequence is a homolog or variant (e.g., mutant) of the replaced nucleic acid sequence. In some embodiments, the replacement nucleic acid sequence is an ortholog or homolog of the replaced sequence. In some embodiments, the replacement nucleic acid sequence is or comprises a human nucleic acid sequence. In some embodiments, the substituted nucleic acid sequence is or comprises a rodent sequence (e.g., a mouse or rat sequence), including when the substituted nucleic acid sequence is or comprises a human nucleic acid sequence. In some embodiments, the substituted nucleic acid sequence is or comprises a human sequence, including when the substituted nucleic acid sequence is or comprises a human nucleic acid sequence. In some embodiments, the substituted nucleic acid sequence is a variant or mutant of the substituted sequence (i.e., a sequence that contains one or more sequence differences (e.g., substitutions) compared to the sequence being substituted). The actually introduced nucleic acid sequence may include one or more regulatory sequences (e.g., promoters, enhancers, 5' untranslated regions, or 3' untranslated regions, etc.) that are part of the source nucleic acid sequence used to obtain the actually introduced sequence.For example, in various embodiments, the replacement is one in which a heterologous sequence replaces an endogenous sequence, resulting in production of a gene product from the actually introduced nucleic acid sequence (including the heterologous sequence) but not expression of the endogenous sequence. The replacement has characteristics of the endogenous genomic sequence and comprises a nucleic acid sequence encoding a polypeptide having a similar function to the polypeptide encoded by the endogenous sequence (e.g., the endogenous genomic sequence encodes all or part of a non-human variable region polypeptide and the DNA fragment encodes all or part of one or more human variable region polypeptides). In various embodiments, an endogenous non-human immunoglobulin gene segment or fragment thereof is replaced with a human immunoglobulin gene segment or fragment thereof.

[0160] Substantially: As used herein, this term refers to a qualitative state in which a desired characteristic or property is exhibited to a complete or nearly complete extent or degree. Those skilled in the art of biology will understand that biological and chemical phenomena rarely, if ever, proceed to completion and / or perfection or achieve or avoid absolute results. Thus, the term "substantially" is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.

[0161] Substantial similarity: As used herein, this term refers to a comparison between amino acid sequences or nucleic acid sequences. As one of ordinary skill in the art would understand, two sequences are generally considered "substantially similar" if they contain similar residues (e.g., amino acids or nucleotides) in corresponding positions. As understood in the art, similar residues can be identical residues (see also substantial identity, below), while similar residues can also be non-identical residues with roughly equivalent structural and / or functional characteristics. For example, as is well known to those of ordinary skill in the art, certain amino acids are typically classified as "hydrophobic" or "hydrophilic" amino acids and / or as having "polar" or "non-polar" side chains. Substitution of one amino acid for another of the same type can often be considered a "conservative" substitution. The following table summarizes exemplary amino acid classifications: [Table 3] [Table 4]

[0162] As is well known in the art, amino acid or nucleic acid sequences can be compared using any of a variety of algorithms, including those available in commercial computer programs (such as BLASTN for nucleotide sequences, and BLASTP, gapped BLAST, and PSI-BLAST for amino acid sequences). Examples of such programs are described in Altschul, S.F. et al., 1990, J. Mol. Biol., 215(3):403-10; Altschul, S.F. et al., 1996, Meth. Enzymol. 266:460-80; Altschul, S.F. et al., 1997, Nucleic Acids Res., 25:3389-402; Baxevanis, A.D. and B.F.F. Feuilletette (eds.) Bioinformatics: A Practical Guide to the Analysis of of Genes and Proteins, Wiley, 1998, and Misener et al. (eds.) Bioinformatics Methods and Protocols, Methods in Molecular Biology, Vol. 132, Humana Press, 1998 (these publications are incorporated herein by reference in their entireties). In addition to identifying similar sequences, the above-mentioned programs typically also provide an indication of the degree of similarity. In some embodiments, two sequences are considered to be substantially similar if the similarity (e.g., identity or conservative substitutions) over the relevant residue stretch of their corresponding residues is, for example, but not limited to, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more. In some embodiments, the relevant stretch is a complete sequence (e.g., the sequence of a gene, gene segment, sequence encoding a domain, polypeptide, or domain). In some embodiments, the relevant section has at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or more residues. In some embodiments, the relevant section has at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, or more residues. In some embodiments, the relevant section comprises contiguous residues along the complete sequence. In some embodiments, the relevant section comprises non-contiguous residues along the complete sequence, such as non-contiguous residues that are grouped together by folding of the polypeptide or portion thereof to form a conformation.

[0163] Substantial identity: As used herein, this term refers to a comparison between amino acid sequences or nucleic acid sequences. As one skilled in the art would understand, two sequences are generally considered to be "substantially identical" if they contain identical residues (e.g., amino acids or nucleotides) at corresponding positions. As is well known in the art, amino acid or nucleic acid sequences can be compared using any of a variety of algorithms, including those available in commercial computer programs (such as BLASTN for nucleotide sequences, and BLASTP, gapped BLAST, and PSI-BLAST for amino acid sequences). Examples of such programs are Altschul, S. F. et al., 1990, J. Mol. Biol., 215(3):403-10; Altschul, S. F. et al., 1996, Meth. Enzymol. 266:460-80; Altschul, S. F. et al., 1997, Nucleic Acids Res., 25:3389-402; Baxevanis, A. D. and B. F. F. Feuilletette (eds.) Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Wiley, 1998; and Misener et al. (eds.) Bioinformatics Methods and Protocols, Methods in Molecular Biology, Vol. 132, Humana Press, 1998 (each of which is incorporated herein by reference in its entirety). In addition to identifying identical sequences, the above-mentioned programs typically also provide an indication of the degree of identity. In some embodiments, two sequences are considered to be substantially identical if their corresponding residues over a relevant residue stretch are at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more percent identical. In some embodiments, the relevant residue stretch is a complete sequence. In some embodiments, the number of residues in the relevant residue stretch is, for example, but not limited to, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, or more.

[0164] Targeting construct or targeting vector: As used herein, this term refers to a polynucleotide molecule containing a targeting region. The targeting region comprises a sequence identical or substantially identical to a sequence in a target cell, tissue, or animal, providing for integration of the targeting construct into a location within the genome of that cell, tissue, or animal via homologous recombination. Targeting regions that use site-specific recombinase recognition sites (e.g., loxP or Frt sites) for targeting are also included; such targeting regions are described herein. In some embodiments, the targeting constructs described herein further comprise a specific nucleic acid sequence or gene of interest, a selectable marker, a control sequence, and / or a regulatory sequence, as well as other nucleic acid sequences that enable recombination mediated by the exogenous introduction of proteins that support or promote recombination involving such sequences. In some embodiments, the targeting constructs described herein further comprise all or a portion of a gene of interest, which is a heterologous gene encoding all or a portion of a polypeptide having a similar function to a protein encoded by an endogenous sequence. In some embodiments, the targeting construct described herein further comprises all or a portion of a humanized gene of interest, wherein the humanized gene of interest encodes all or a portion of a polypeptide having a similar function to the polypeptide encoded by the endogenous sequence. In some embodiments, the targeting construct (or targeting vector) may comprise an artificially engineered nucleic acid sequence. For example, in some embodiments, a targeting construct (or targeting vector) can be constructed to comprise an engineered or recombinant polynucleotide comprising two or more sequences that are not naturally linked together in that order but have been artificially engineered to be directly linked to each other in the engineered or recombinant polynucleotide.

[0165] Transgene or transgene construct: As used herein, these terms refer to a nucleic acid sequence (e.g., encoding all or part of a polypeptide of interest) that has been artificially introduced into a cell, such as by the methods described herein. A transgene can be partially or entirely heterologous, i.e., foreign, to the genetically engineered animal or genetically engineered cell into which it is introduced. A transgene can include one or more transcriptional regulatory sequences and any other nucleic acid (such as introns or promoters) that may be required for expression of a selected nucleic acid sequence.

[0166] Genetically modified or engineered non-human animal: These terms are used interchangeably herein and refer to any non-naturally occurring non-human animal in which one or more of its cells contain a heterologous nucleic acid and / or a heterologous gene encoding all or a portion of a polypeptide of interest. For example, in some embodiments, a "genetically modified non-human animal" or a "genetically engineered non-human animal" refers to a non-human animal that contains a transgene or transgene construct described herein. In some embodiments, the heterologous nucleic acid and / or the heterologous gene is introduced into the cell directly or indirectly by introduction into a progenitor cell, deliberate genetic manipulation (such as microinjection), or infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding techniques, but rather covers the introduction of a recombinant DNA molecule(s). This molecule may be integrated into a chromosome or may be extrachromosomally replicating DNA. The phrase "genetically modified non-human animal" or "genetically engineered non-human animal" refers to an animal that is heterozygous or homozygous for a heterologous nucleic acid and / or a heterologous gene, and / or that has one or more copies of a heterologous nucleic acid and / or a heterologous gene.

[0167] Vector: As used herein, this term refers to a nucleic acid molecule capable of transporting another nucleic acid associated therewith. In certain embodiments, a vector is capable of extrachromosomally replicating and / or expressing nucleic acids linked thereto in a host cell (such as a eukaryotic cell and / or a prokaryotic cell). Vectors capable of directing the expression of genes to which they are operably linked are referred to herein as "expression vectors."

[0168] Wild-type: As used herein, this term refers to an entity having a structure and / or activity found in nature under a "normal" state or situation (as opposed to a mutant, diseased state, altered state, etc.). Those skilled in the art will appreciate that wild-type genes and polypeptides often exist in multiple alternative forms (e.g., alleles).

[0169] Detailed Description The present disclosure provides, inter alia, engineered non-human animals having heterologous genetic material encoding human Vλ domains, the heterologous genetic material including human Vλ and Jλ gene sequences (i.e., gene segments), and other human sequences that properly rearrange (e.g., recombination signal sequences (RSSs)) and express antibodies having Igλ light chains comprising human and non-human portions, or antibodies having fully human Igλ light chains. For example, in various embodiments, when human gene segments are present in the genome of an engineered non-human animal, corresponding recombination signal sequence(s) may also be present (e.g., Vλ gene segments associated with Vλ RSSs, Jλ gene segments associated with Jλ RSSs, Vκ gene segments associated with Vκ RSSs, Jκ gene segments associated with Jκ RSSs, etc.). In various embodiments, the engineered non-human animals provided comprise heterologous genetic material inserted in a manner such that antibodies comprising light chains having human Vλ domains and non-human Cλ domains or human Cλ domains are expressed in the antibody repertoire of the non-human animal. Additionally, the provided engineered non-human animals comprise heterologous genetic material inserted into the germline genome of the non-human animal from an engineered Igκ light chain locus that comprises human Igλ gene sequences and non-human Igλ gene sequences (e.g., gene segments), and in some embodiments, human Igκ light chain sequences, in a manner that results in expression of antibodies comprising light chains having a human Vλ domain and a non-human Cλ domain or a human Cλ domain.

[0170] While not wishing to be bound by any particular theory, it is contemplated that the non-human animals described herein provide improved in vivo systems that exploit the expression of antibodies comprising human Vλ domains for producing therapeutic antibodies. It is also contemplated that, in some embodiments, alternative engineered forms of light chain loci (e.g., Igκ light chain loci) containing heterologous genetic material for the development of human antibody-based therapeutics (e.g., human monoclonal antibodies, multispecific binding agents, scFvs, fusion polypeptides, etc.) against disease targets associated with biased antibody responses (e.g., antibody responses characterized by a predominantly high proportion of either κ or λ light chains) can be obtained from the non-human animals described herein. Thus, the provided non-human animals are particularly useful for the development of human antibodies and human antibody-based molecules (e.g., multispecific binding agents, scFvs, fusion polypeptides, etc.) against targets (e.g., viruses) that exhibit concomitant poor immunogenicity due, in part, to biased antibody repertoires and / or antibody responses.

[0171] This disclosure describes, inter alia, an immunoglobulin κ light chain locus comprising one or more human Vλ gene segments, one or more human Jλ gene segments, and a Cλ gene, such a locus being referred to as the "lambda-in-kappa" locus or "LiK."

[0172] Specifically, the present disclosure describes the generation of non-human animals (e.g., rodents) having a germline genome comprising an engineered Igκ light chain locus, characterized in some embodiments by the introduction of a plurality of human Vλ gene segments and a human Jλ gene segment such that the plurality of human Vλ gene segments and the human Jλ gene segment are operably linked to a non-human Cλ gene or a human Cλ gene, and the non-human Cλ gene or human Cλ gene is introduced in place of a non-human Cκ gene. As described herein, the generation of such an engineered Igκ light chain locus results in the expression of an antibody from the engineered Igκ light chain locus in the germline genome of the non-human animal, the antibody comprising a light chain comprising a human Vλ domain and a non-human Cλ domain or a human Cλ domain. In some embodiments, the germline genome of the provided non-human animal comprises an Igκ light chain locus comprising a human Igλ light chain sequence. In some embodiments, the germline genome of a provided non-human animal comprises (i) an Igκ light chain locus comprising a human Igλ light chain sequence, and (ii)(a) an Igκ light chain locus comprising a human Igλ light chain sequence, or (ii)(b) an Igκ light chain locus comprising a human Igκ light chain sequence. In some embodiments, the germline genome of a provided non-human animal comprises an Igκ light chain locus described herein, and further comprises (i) a humanized IgH locus, or (ii) a humanized IgH locus and a functionally silenced or otherwise non-functional endogenous Igλ light chain locus. The provided non-human animal expresses an antibody repertoire comprising an Igλ light chain comprising a human Vλ domain, as described herein.

[0173] In some embodiments, the non-human animals described herein comprise a human Igλ light chain sequence within an Igκ light chain locus. In some embodiments, the non-human animals described herein comprise a human Igλ light chain sequence and a non-human Igλ light chain sequence within an Igκ light chain locus. In some embodiments, the non-human animals described herein comprise a human Igλ light chain sequence and a human Igκ light chain sequence within an Igκ light chain locus. In some embodiments, the non-human animals described herein comprise a human Igλ light chain sequence, a human Igκ light chain sequence, and a murine Igκ light chain sequence, and / or a murine Igλ light chain sequence within an Igκ light chain locus. In some embodiments, the non-human animals described herein comprise a human Igλ light chain sequence, a non-human Igλ light chain sequence, a human Igκ light chain sequence, a non-human Igκ light chain sequence, or a combination thereof within an Igκ light chain locus. In many of the non-human animal embodiments described herein, the non-human sequences are or include murine sequences (eg, mouse or rat).

[0174] In some embodiments, the Igκ light chain sequence and / or the Igλ light chain sequence comprises intergenic DNA of human and / or murine origin. In some embodiments, the Igκ light chain sequence and / or the Igλ light chain sequence comprises engineered intergenic DNA based on a source sequence of human or murine origin. In some embodiments, the intergenic DNA is at the same immunoglobulin locus as the immunoglobulin locus into which the intergenic DNA is actually introduced, inserted, positioned, or engineered (e.g., Igκ intergenic DNA is included at an Igκ light chain locus). In some embodiments, the intergenic DNA is at a different immunoglobulin locus from the immunoglobulin locus into which the intergenic DNA is actually introduced, inserted, positioned, or engineered (e.g., Igλ intergenic DNA is included at an Igκ light chain locus). In some specific embodiments, the non-human animals described herein comprise an engineered Igκ light chain locus comprising intergenic DNA comprising Igκ light chain sequence(s), Igλ light chain sequence(s), and / or combinations thereof.

[0175] In various embodiments, the humanized immunoglobulin heavy chain locus comprises at least one human V operably linked to a non-human immunoglobulin heavy chain constant region (e.g., an endogenous non-human immunoglobulin heavy chain constant region comprising one or more immunoglobulin heavy chain constant region genes (e.g., IgM, IgD, IgG, IgE, IgA, etc.)). H gene segment, at least one human D H gene segment, and at least one human J H gene segments (e.g., multiple human V operably linked to non-human immunoglobulin heavy chain constant regions) H Gene segment, human D H Gene segments and human J H In some embodiments, the non-human animals provided have a germline genome that includes one or more of the immunoglobulin loci shown in the figures. Such engineered non-human animals provide a source of human antibodies and human antibody fragments, as well as an improved in vivo system suitable for utilizing human Vλ sequences to generate human therapeutic antibodies.

[0176] As described in the Examples section below, each human heavy chain variable region gene segment (i.e., V H , D H , and J H ) and at least one of a plurality of human heavy chain variable region gene segments (i.e., Vλ and Jλ for the endogenous kappa locus) H , D H , and J H) and human light chain variable region gene segments (e.g., Vλ and Jλ for the endogenous kappa locus) at their endogenous immunoglobulin loci in place of non-human variable region gene segments, with human non-coding intergenic DNA between these human variable region gene segments. Such intergenic DNA includes, for example, promoters, leader sequences, and recombination signal sequences that enable proper recombination and expression of the human gene segments under conditions that result in the variable domains of antibodies. Those of skill in the art will understand that non-human immunoglobulin loci also include such non-coding intergenic DNA. Those of skill in the art will understand, upon reading this disclosure, that the use of other human or non-human intergenic DNA in the construction of such loci will also result in the expression of human variable domains under conditions that result in the antibody being generated in the non-human animal. All that is required for such analogous loci to achieve expression of antibodies containing human variable domains is that they contain the human coding sequences (i.e., exons) of the desired human gene segments.

[0177] The following sections detail certain specific embodiments of various aspects, each of which may be applicable to any aspect or embodiment described herein. The sections are not intended to be limiting.

[0178] Antibody repertoires in non-human animals Immunoglobulins (also called antibodies) are large (approximately 150 kD) Y-shaped glycoproteins produced by B cells of the host immune system to neutralize pathogens (e.g., viruses, bacteria, etc.). Each immunoglobulin (Ig) is composed of two identical heavy chains and two identical light chains, each of which has two structural components: a variable domain and a constant domain. While the heavy and light chain variable regions of antibodies produced by different B cells are different, all antibodies produced by a single B cell or B cell clone have the same heavy and light chain variable regions. The heavy and light chain variable regions of each antibody together constitute the antigen-binding region (or antigen-binding site). Immunoglobulins exist in different types, called isotypes or classes, based on the heavy chain constant region (or heavy chain constant domain) they contain. All antibodies of the same isotype have the same heavy chain constant region, but antibodies of different isotypes have different heavy chain constant regions. The table below summarizes the nine antibody isotypes in mice and humans. [Table 5]

[0179] Other isotypes have been identified in other species. Because different isotypes have different structural characteristics, they confer specific biological properties to antibodies, and the locations (cells, tissues, etc.) in an animal's body where isotypes are found vary. B cells initially produce IgM and IgD, which have identical antigen-binding domains. Upon activation, B cells switch to a different isotype through a process called class switching. During this process, the constant regions of the antibodies produced by B cells change, but the variable regions remain the same, thereby preserving the antigen specificity of the original antibody (B cell).

[0180] Two separate loci (Igκ and Igλ) contain gene segments that, upon rearrangement, encode the light chains of antibodies and exhibit both allelic and isotypic exclusion. + B cells and λ +The expression ratio of Ig λ to B cells varies between species. For example, the ratio observed in humans is approximately 60:40 (κ:λ). The ratio observed in mice and rats is 95:5 (κ:λ). Interestingly, the observed κ:λ ratio in cats (5:95) is the opposite of that observed in mice and rats. Several studies have been conducted to elucidate the possible reasons behind these observed ratios, and both the complexity of the locus (i.e., the number of gene segments, specifically the number of V gene segments) and the efficiency of gene segment rearrangement have been proposed as rationales. The human Ig λ light chain locus spans 1,000 kb and contains approximately 70 Vλ gene segments (29-33 functional) and seven Jλ-Cλ gene segment pairs (4-5 functional pairs) organized into three clusters (see, e.g., Figure 1 in U.S. Pat. No. 9,006,511, which is incorporated herein by reference in its entirety). The majority of Vλ regions observed in the expressed antibody repertoire are encoded by gene segments contained within the most proximal cluster, designated Cluster A. The mouse Igλ light chain locus is significantly different compared to the human locus, with some strains containing only a few Vλ and Jλ gene segments grouped into two distinct gene clusters (see, e.g., Figure 2 of U.S. Pat. No. 9,006,511, which is incorporated herein by reference in its entirety).

[0181] Much of the development of therapeutic antibodies to treat various human diseases has focused on the creation of engineered non-human animal strains (specifically, engineered rodent strains) that carry different amounts of genetic material corresponding to human immunoglobulin genes in their genomes (as reviewed, e.g., in Bruggemann, M. et al., 2015, Arch. Immunol. Ther. Exp. 63:101-8, which is incorporated herein by reference in its entirety).Early attempts to create such genetically engineered rodent strains focused on incorporating portions of human immunoglobulin loci so that recombination of gene segments could be self-supported, resulting in the production of fully human heavy and / or light chains while inactivating the endogenous immunoglobulin loci (e.g., Bruggemann, M. et al., 1989, Proc. Nat. Acad. Sci. USA 86:67-09-13; Bruggemann, M. et al., 1991, Eur. J. Immunol. 21:1323-6; Taylor, L. D. et al., 1992, Nucl. Acids Res. 20:6287-6295; Davies, N. P. et al., 1993, Biotechnol. 11:911-4; Green, L. L. et al., 1994, Biotechnol. 11:911-4). al.,1994,Nat.Genet.7:13-21,Lonberg,N.et al.,1994,Nature 368:856-9,Taylor,LDet al.,1994,Int.Immunol.6:579-91,Wagner,SDet al., 1994, Eur. J. Immunol. 24:2672-81, Fishwild, DMet al., 1996, Nat. al., 1997, Nat. Genet. 15:146-56, Green, LLet al., 1998, J. Exp. Med. 188: 483-95, Xian, J. et al., 1998, Transgenics 2:333-43; Little, M. et al., 2000, Immunol. Today 21:364-70; Kellermann, SA and LL Green, 2002, Cur. Opin. Biotechnol. 13:593-7 (each of which is incorporated by reference in its entirety).Specifically, attempts have been made to incorporate human Ig λ light chain sequences (see, e.g., U.S. Patent Application Publication Nos. 2002 / 0088016A1, 2003 / 0217373A1, and 2011 / 0236378A1; U.S. Patent Nos. 6,998,514 and 7,435,871; Nicholson, IC et al., 1999, J. Immunol. 163:6898-906; Popov, AV et al., 1999, J. Exp. Med. 189(10):1611-19, each of which is incorporated herein by reference in its entirety). These efforts have focused on randomly integrating yeast artificial chromosomes containing human Vλ, Jλ, and Cλ sequences, thereby creating mouse strains that express fully human Igλ light chains (i.e., human Vλ and Cλ domains). More recent efforts have used a similar strategy, using constructs containing human Vλ, Jλ, and Cλ sequences (Osborn, MJ et al., 2013, J. Immunol. 190:1481-90; Lee, EC. et al., 2014, Nat. Biotech. 32(4):356-63, each of which is incorporated herein by reference in its entirety).

[0182] Still other attempts have involved the specific insertion of human Vλ and Jλ gene segments into endogenous rodent Ig light chain loci (κ and λ) such that the human Vλ and Jλ gene segments are operably linked to endogenous Ig light chain constant region genes (see, e.g., U.S. Patent Nos. 9,006,511, 9,012,717, 9,029,628, 9,035,128, 9,066,502, 9,150,662, and 9,163,092, all of which are incorporated by reference in their entireties.) In such animals, all of the human Vλ gene segments from cluster A and cluster B, along with one or four human Jλ gene segments, were inserted into the endogenous Igκ and Igλ light chain loci. As a result, several different human Vλ and Jλ gene segments were shown to rearrange appropriately in both engineered rodent Ig light chain loci to form functional light chains expressed in the rodent antibody repertoire, with the light chains comprising human Vλ domains in association with either endogenous Cκ and Cλ regions (see, e.g., Table 7 and Figures 11-13 of U.S. Pat. No. 9,006,511, which is incorporated herein by reference in its entirety). Specifically, mice harboring engineered Igκ light chain loci harboring human Vλ and Jλ gene segments were shown to have a ratio of human lambda to endogenous lambda (as measured by the ratio of IgCκ to IgCλ) in the splenic compartment of approximately 1:1 (see, e.g., Table 4 of U.S. Pat. No. 9,006,511, which is incorporated herein by reference in its entirety). Indeed, in both engineered mouse strains (i.e., engineered Igκ light chain loci or engineered Igλ light chain loci), it was shown that human Vλ domains can be expressed from endogenous Ig light chain loci in rodents, which normally exhibit a large bias in light chain expression (see above).The present disclosure provides the recognition that generating alternative engineered Ig light chain locus structures can maximize the utilization of human Vλ and Jλ gene segments in antibody repertoires against therapeutic targets in non-human animals, particularly when compared to non-human animals (e.g., mice and rats) that contain Igλ light chain loci that lack the complexity and robust quality typically associated with human Igλ light chain loci (i.e., loci found in human cells). Such alternative engineered Ig light chain locus structures provide the ability to generate unique antibody repertoires resulting from their design.

[0183] The present disclosure provides examples of successful production of non-human animals that contain in their germline genome an engineered endogenous Igκ light chain locus, comprising a non-human Igλ light chain constant region gene inserted in place of the non-human Igκ light chain constant region gene at the endogenous Igκ light chain locus, or multiple human Vλ gene segments and human Jλ gene segments operably linked to a human Igλ light chain constant region gene. Specifically, the present disclosure demonstrates successful production of (1) engineered non-human animals that express antibodies having human variable regions and non-human constant regions, the antibodies comprising light chains comprising human Vλ domains and non-human Cλ domains, and (2) engineered non-human animals that express antibodies having human variable regions and human constant regions, the antibodies comprising light chains comprising human Vλ domains and human Cλ domains. As shown in the specific examples herein, expression of such light chains is achieved by inserting the multiple human Vλ gene segments and human Jλ gene segments into the endogenous Igκ light chain locus (or allele). In some embodiments, the provided non-human animals are engineered such that expression of the endogenous Ig λ light chain variable region is inactivated (eg, by gene deletion).

[0184] In some embodiments, the provided non-human animals are engineered such that expression of an endogenous Igκ light chain variable region is inactivated (e.g., by substitution or replacement). In some embodiments, the provided non-human animals are engineered such that the non-human animal expresses a human Igλ light chain variable region from an engineered endogenous Igκ light chain locus and expresses a human Igκ light chain variable region from an engineered endogenous Igκ light chain locus. Thus, the present disclosure encompasses, at least in some embodiments, developing improved in vivo systems for producing human antibodies by providing engineered non-human animals that contain an alternatively engineered Igκ light chain locus, from which an antibody repertoire comprising a human Vλ domain and a non-human Cλ domain or a human Cλ domain is expressed.

[0185] Nucleic Acid Constructs Typically, a polynucleotide molecule comprising a human Igλ light chain sequence (e.g., a human Vλ gene segment and a human Jλ gene segment) or portion(s) thereof is ligated to (e.g., inserted into) a vector (preferably a DNA vector) for replicating the polynucleotide molecule in a host cell.

[0186] Human Ig λ light chain sequences can be cloned directly from known sequences or sources (e.g., libraries) or synthesized from germline sequences designed in silico based on published sequences available from GenBank or other publicly available databases (e.g., IMGT). Alternatively, immunoglobulin DNA sequences of interest (e.g., human Vλ and Jλ sequences, and combinations thereof) can be obtained from bacterial artificial chromosome (BAC) libraries. BAC libraries can contain inserts of 100-150 kb in size, with the capacity to carry inserts as large as 300 kb (Shizuya, et al., 1992, Proc. Natl. Acad. Sci., USA 89:8794-8797; Swiatek, et al., 1993, Genes and Development 7:2071-2084; Kim, et al., 2001). al., 1996, Genomics 34 213-218 (the entireties of which are incorporated herein by reference). For example, human BAC libraries containing inserts with an average size of 164 to 196 kb have been described (Osoegawa, K. et al., 2001, Genome Res. 11(3):483-96; Osoegawa, K. et al., 1998, Genomics 52:1-8, Article No. GE985423 (each of which is incorporated herein by reference in its entirety). Human and mouse genomic BAC libraries have been constructed and are commercially available (e.g., ThermoFisher). In addition to immunoglobulin DNA sequences, genomic BAC libraries can also serve as a source of transcriptional regulatory regions.

[0187] Alternatively, immunoglobulin DNA sequences can be isolated, cloned, and / or introduced from yeast artificial chromosomes (YACs). For example, the nucleotide sequence of the human Ig λ light chain locus has been determined (see, e.g., Dunham, I. et al., 1999, Nature 402:489-95, which is incorporated herein by reference in its entirety). Furthermore, YACs have previously been used to assemble human Ig λ light chain locus transgenes (see, e.g., Popov, A. V. et al., 1996, Gene 177:195-201; Popov, A. V. et al., 1999, J. Exp. Med. 189(10):1611-19, each of which is incorporated herein by reference in its entirety). The entire Ig λ light chain locus (human or rodent) can be cloned and contained within several YACs. If multiple YACs are used and contain overlapping regions of similarity, the YACs can be recombined in a yeast host strain to generate a single construct representing the entire locus or a desired portion of the locus (e.g., the region targeted by a targeting vector). Additional modifications to the YAC arms can be made by adding mammalian selection cassettes that are incorporated to aid in the introduction of the construct into embryonic stem cells or embryos by methods known in the art and / or described herein.

[0188] The DNA and amino acid sequences of human Igλ light chain gene segments for use in constructing the engineered Igκ light chain loci described herein can be obtained from public databases (e.g., GenBank, IMGT, etc.) and / or published antibody sequences. In some embodiments, a nucleic acid construct comprising a human Igλ light chain gene segment comprises a J region (i.e., a genomic sequence comprising multiple light chain J gene segments) that includes the coding sequence of a human Jλ gene segment with its corresponding 12 RSSs, with the 12 RSSs disposed among the non-coding intergenic DNA that typically accompanies the coding sequence of a human Jκ gene segment with its corresponding 23 RSSs.

[0189] In some embodiments, such sequences may be referred to as engineered light chain J regions. In some specific embodiments, a nucleic acid construct comprising a human Igλ light chain gene segment comprises a human Vλ sequence and a human Jλ sequence operably linked to a human Igλ light chain constant region (Cλ) gene or a non-human Igλ light chain constant region (Cλ) gene. In some specific embodiments, a nucleic acid construct comprising a human Igλ light chain gene segment comprises a human Vλ sequence and a human Jλ sequence operably linked to one or more non-human Igκ light chain enhancer regions (or enhancer sequences). In some specific embodiments, a nucleic acid construct comprising a human Igλ light chain gene segment comprises a human Vλ sequence and a human Jλ sequence operably linked to a non-human Cλ region gene or a human Cλ region gene and a non-human Igκ light chain enhancer region (or enhancer sequence).

[0190] In some embodiments, the nucleic acid construct comprising a human Vλ sequence and a human Jλ sequence further comprises intergenic DNA of human and / or murine origin, hi some embodiments, the intergenic DNA is or comprises a murine non-coding Igκ light chain sequence, a human non-coding Igκ light chain sequence, a murine non-coding Igλ light chain sequence, a human non-coding Igλ light chain sequence, or a combination thereof.

[0191] Nucleic acid constructs can be prepared using methods known in the art. For example, nucleic acid constructs can be prepared as part of a larger plasmid. This allows for efficient cloning and selection of correct constructs in a manner known in the art. Nucleic acid constructs containing all or part of a human Ig λ light chain sequence as described herein can be located between restriction enzyme sites on a plasmid, allowing them to be isolated from other plasmid sequences for integration into a desired non-human animal.

[0192] Various methods are known in the art for preparing nucleic acid constructs (e.g., plasmids) and for transforming host organisms. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Principles of Gene Manipulation: An Introduction to Genetic Manipulation, 5th Ed., ed. By See Old, R.W. and S.B. Primrose, Blackwell Science, Inc., 1994 and Molecular Cloning: A Laboratory Manual, 2nd Ed., ed. by Sambrook, J. et al., Cold Spring Harbor Laboratory Press: 1989 (each of which is incorporated herein by reference in its entirety).

[0193] Targeting Vector A targeting vector can be used to introduce a nucleic acid construct into a target locus in a genome. Such a targeting vector includes a nucleic acid construct and homology arms flanking the nucleic acid construct. Those skilled in the art will recognize a variety of options and features generally applicable to the design, construction, and / or use of targeting vectors. For example, a targeting vector can be linear or circular, and can be single-stranded or double-stranded. A targeting vector can be deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). For ease of reference, homology arms are referred to herein as 5' (i.e., upstream) and 3' (i.e., downstream) homology arms. This terminology refers to the relative position of the homology arms to the nucleic acid construct within the targeting vector. The 5' and 3' homology arms correspond to regions within the target locus or to regions within another targeting vector; these regions are referred to herein as the "5' target sequence" and "3' target sequence," respectively. In some embodiments, the homology arms may also function as 5' or 3' target sequences.

[0194] In some embodiments, the methods described herein use two, three, or four or more targeting vectors capable of recombining with each other. In various embodiments, the targeting vectors are large targeting vectors (LTVECs) described elsewhere herein. In such embodiments, the first targeting vector, the second targeting vector, and the third targeting vector each comprise a 5' homology arm and a 3' homology arm. The 3' homology arm of the first targeting vector comprises a sequence that overlaps with the 5' homology arm of the second targeting vector (i.e., an overlapping sequence), thereby enabling homologous recombination between the first LTVEC and the second LTVEC.

[0195] In the case of a dual targeting method, the 5' homology arm of the first targeting vector and the 3' homology arm of the second targeting vector may resemble corresponding segments (i.e., target sequences) within the target genome locus, thereby promoting homologous recombination between the first targeting vector and the second targeting vector and the corresponding segments of the genome to modify the target genome locus.

[0196] In the triple targeting method, the 3' homology arm of the second targeting vector may contain a sequence that overlaps with the 5' homology arm of the third targeting vector (i.e., overlapping sequence), thereby enabling homologous recombination between the second LTVEC and the third LTVEC. The 5' homology arm of the first targeting vector and the 3' homology arm of the third targeting vector are similar to corresponding segments (i.e., target sequences) within the target genome locus, thereby promoting homologous recombination between the first targeting vector and the third targeting vector and corresponding segments of the genome to modify the target genome locus.

[0197] A homology arm and a target sequence, or two homology arms, "correspond" or "corresponding" to one another when these two regions share a sufficient level of sequence identity with each other to serve as substrates for a homologous recombination reaction. The sequence identity between a given target sequence and the corresponding homology arm (i.e., overlapping sequence) found in a targeting vector, or the sequence identity between two homology arms, can be any degree of sequence identity that allows homologous recombination to occur. By way of example only, the amount of sequence identity shared by a homology arm of a targeting vector (or a fragment thereof) and a target sequence of another targeting vector or a target sequence of a target genomic locus (or a fragment thereof) can be, for example, but not limited to, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, such that homologous recombination occurs between these sequences.

[0198] Furthermore, the corresponding region of similarity (e.g., identity) between the homology arm and the corresponding target sequence can be of any length sufficient to promote homologous recombination at the target genomic locus. For example, a given homology arm and / or corresponding target sequence may be, for example, but not limited to, about 5-10 kb, about 5-15 kb, about 5-20 kb, about 5-25 kb, about 5-30 kb, about 5-35 kb, about 5-40 kb, about 5-45 kb, about 5-50 kb, about 5-55 kb, about 5-60 kb, about 5-65 kb, about 5-70 kb, about 5-75 kb, about 5-80 kb, about 5-85 kb, about 5-90 kb, about 5-95 kb, about 5-100 kb, about 5-110 kb, about 5-120 kb, about 5-130 kb, about 5-140 kb, about 5-150 kb, about 5-160 kb, about 5-170 kb, about 5-180 kb, about 5-190 kb, about 5-200 kb, about 5-210 kb, about 5-220 kb, about 5-240 kb, about 5-250 kb, about 5-260 kb, about 5-270 kb, about 5-280 kb, about 5-300 kb, about 5-310 kb, about 5-320 kb, about 5-330 kb, about 5-340 kb, about 5-350 kb, about 5-360 kb, about 5-370 kb, about 5-380 kb, about 5-3 The homology arms may contain corresponding regions of similarity (such as those described elsewhere herein) of 90 kb, about 5-95 kb, about 5-100 kb, about 100-200 kb, or about 200-300 kb in length, such that the homology arms have sufficient similarity to undergo homologous recombination with corresponding target sequence(s) within the target genomic locus of the cell or with corresponding target sequence(s) within another targeting vector. In some embodiments, a given homology arm and / or corresponding target sequence may be, for example, but not limited to, about 10 to 100 kb, about 15 to 100 kb, about 20 to 100 kb, about 25 to 100 kb, about 30 to 100 kb, about 35 to 100 kb, about 40 to 100 kb, about 45 to 100 kb, about 50 to 100 kb, about 55 to 100 kb, about 60 to 100 kb, about 65 to 100 kb, about 70 to 100 kb , about 75-100 kb, about 80-100 kb, about 85-100 kb, about 90-100 kb, or about 95-100 kb in length (such as those described elsewhere herein), such that the homology arms have sufficient similarity to undergo homologous recombination with corresponding target sequence(s) within a target genomic locus of the cell or with corresponding target sequence(s) within another targeting vector.

[0199] The overlap sequence between the 3' homology arm of a first targeting vector and the 5' homology arm of a second targeting vector, or the overlap sequence between the 3' homology arm of a second targeting vector and the 5' homology arm of a third targeting vector, can be of any length sufficient to promote homologous recombination between the targeting vectors. For example, a given overlap sequence of a homology arm may comprise a corresponding overlap region of a length of about 1 to 5 kb, about 5 to 10 kb, about 5 to 15 kb, about 5 to 20 kb, about 5 to 25 kb, about 5 to 30 kb, about 5 to 35 kb, about 5 to 40 kb, about 5 to 45 kb, about 5 to 50 kb, about 5 to 55 kb, about 5 to 60 kb, about 5 to 65 kb, about 5 to 70 kb, about 5 to 75 kb, about 5 to 80 kb, about 5 to 85 kb, about 5 to 90 kb, about 5 to 95 kb, about 5 to 100 kb, about 100 to 200 kb, or about 200 to 300 kb, such that the overlap sequence of the homology arm has sufficient similarity to undergo homologous recombination with a corresponding overlap sequence in another targeting vector. In some embodiments, a given overlap sequence of homology arms is about 1 to 100 kb, about 5 to 100 kb, about 10 to 100 kb, about 15 to 100 kb, about 20 to 100 kb, about 25 to 100 kb, about 30 to 100 kb, about 35 to 100 kb, about 40 to 100 kb, about 45 to 100 kb, about 50 to 100 kb, about 55 to 100 kb, about 60 to 100 kb, or about 65 to 100 kb. The overlap region may comprise an overlap region of about 100 kb, about 65-100 kb, about 70-100 kb, about 75-100 kb, about 80-100 kb, about 85-100 kb, about 90-100 kb, or about 95-100 kb in length, such that the overlap sequences of the homology arms are sufficiently similar to undergo homologous recombination with corresponding overlap sequences in another targeting vector. In some embodiments, the overlap sequence is 1-5 kb (inclusive). In some embodiments, the overlap sequence is about 1 kb to about 70 kb (inclusive). In some embodiments, the overlap sequence is about 10 kb to about 70 kb (inclusive). In some embodiments, the overlap sequence is about 10 kb to about 50 kb (inclusive).In some embodiments, the overlap sequence is at least 10 kb, hi some embodiments, the overlap sequence is at least 20 kb. For example, the overlapping sequence may be about 1 kb to about 5 kb (inclusive), about 5 kb to about 10 kb (inclusive), about 10 kb to about 15 kb (inclusive), about 15 kb to about 20 kb (inclusive), about 20 kb to about 25 kb (inclusive), about 25 kb to about 30 kb (inclusive), about 30 kb to about 35 kb (inclusive), about 35 kb to about 40 kb (inclusive), about 40 kb to about 45 kb (inclusive), about 45 kb to about 50 kb (inclusive), about 50 kb to about 60 kb (inclusive), about 60 kb to about 70 kb (inclusive), about 70 kb to about 80 kb (inclusive), It may be about 80 kb to about 90 kb (inclusive), about 90 kb to about 100 kb (inclusive), about 100 kb to about 120 kb (inclusive), about 120 kb to about 140 kb (inclusive), about 140 kb to about 160 kb (inclusive), about 160 kb to about 180 kb (inclusive), about 180 kb to about 200 kb (inclusive), about 200 kb to about 220 kb (inclusive), about 220 kb to about 240 kb (inclusive), about 240 kb to about 260 kb (inclusive), about 260 kb to about 280 kb (inclusive), or about 280 kb to about 300 kb (inclusive). By way of example only, the overlap sequence can be from about 20 kb to about 60 kb, inclusive. Alternatively, the overlap sequence can be at least 1 kb, at least 5 kb, at least 10 kb, ...

Claims

[Claim 1] The invention as described in the drawings.

Images