Methods for reducing the risk of cardiovascular events using conjugated antisense compounds targeting apo(a) - Patent Application 20070122997

Abstract

Methods for reducing the risk of cardiovascular events using conjugated antisense compounds that target apo(a) are provided. The present invention relates to a method for reducing the risk of cardiovascular events in patients with established cardiovascular disease using the conjugated antisense compound ISIS 681257 or a salt thereof.

Description

[Technical Field]

[0001] Related Applications This application is filed on January 1, 2018, the contents of each of which are incorporated herein by reference in their entirety. U.S. Provisional Patent Application No. 62 / 758,323, filed January 9, 2019, and The present application is hereby incorporated by reference in its entirety, including the benefit of U.S. Provisional Patent Application No. 62 / 874,459, filed on January 15, 2014, and the like. Claims priority to.

[0002] The present disclosure provides a method for the treatment of cardiovascular disease using conjugated antisense compounds targeting apo(a). The present invention relates to a method for reducing the risk of vascular events, particularly by using conjugated antisense compounds. The compound ISIS 681257 or its salt was used to treat pulmonary embolism in patients with established cardiovascular disease. This is a method to reduce the risk of cardiovascular events in patients with cerebrovascular disease. [Background technology]

[0003] The principle behind antisense technology is that antisense compounds hybridize with target nucleic acids. The objective of this study is to regulate the amount, activity and / or function of a target nucleic acid by forming a target nucleic acid. In this case, the antisense compound results in alteration of the transcription or translation of the target. This can be achieved, for example, by target mRNA degradation or occupancy-based inhibition. One example of RNA target function modulation is hybridization with DNA-like antisense compounds. The RNase H-based degradation of target RNA during transcription. Another example of regulation is RNA interference (RNAi). RNAi is RNA-induced silencing. Antisense-mediated gene silencing through a mechanism that utilizes the RISC (Risk Factor Receptor Complex) An additional example of the regulation of RNA target function is the regulation of the ATPases naturally used by microRNAs. MicroRNAs encode proteins, which are involved in the regulation of the cellular fate of proteins. Antisense compounds are small non-coding RNAs that regulate the expression of RNAs that encode them. Binding to microRNAs is essential for the binding of microRNAs to their messenger RNA targets. MicroRNA mimics prevent the transcription of proteins and thus interfere with the function of microRNAs. Certain antisense compounds can enhance microRNA function by targeting the sequence of pre-mRNA. Regardless of the specific mechanism, sequence specificity is essential for the antisense compounds. as a tool for target validation and gene functionalization, and for understanding disease pathogenesis. This makes them attractive therapeutic approaches for selectively modulating the expression of genes involved in the target gene.

[0004] Antisense technology is an effective method for modulating the expression of one or more specific gene products. are potentially useful tools and therefore uniquely useful in several therapeutic, diagnostic and research applications. Chemically modified nucleosides may be incorporated into antisense compounds. and one or more characteristics such as nuclease resistance, pharmacokinetics, or affinity for the target nucleic acid. In 1998, the antisense compound Vitravene (registered trademark) was developed. Trademark)(fomivirsen;Isis Pharmaceuticals Inc. , Carlsbad, CA) is approved by the U.S. Food and Drug Administration (FDA) It was the first antisense drug to receive marketing authorization and is currently used to treat cytomegalovirus (CMV) in AIDS patients. It is a treatment for cytomegalovirus (CMV)-induced retinitis.

[0005] New chemical modifications improve the potency and efficacy of antisense compounds and allow for oral delivery. The potential for subcutaneous administration has been revealed, reducing the possibility of side effects and improving patient convenience. Chemical modifications that increase the potency of antisense compounds allow for lower doses to be administered. This reduces the potential for toxicity and reduces the overall cost of treatment. Modifications that increase the potency of steroids result in slower clearance from the body, allowing for less frequent dosing. Different types of chemical modifications can be combined into a single compound, further increasing the effectiveness of the compound. It can be optimized.

[0006] Lipoproteins are amphiphilic coatings of proteins, phospholipids, and cholesterol A sphere consisting of a non-polar core of acylglycerol and cholesteryl esters surrounded by Lipoproteins are micelle-like particles with a viscoelastic structure. Based on their functional and physical properties, lipoproteins are classified as milk-derived proteins. Lipid granules, very low density lipoprotein (VLDL), intermediate density lipoprotein (IDL), low Five broad categories of low-density lipoprotein (LDL) and high-density lipoprotein (HDL) Chlorella transports dietary lipids from the intestine to tissues. VLDL, IDL and LDL all transport triacylglycerol and cholesterol from the liver to tissues. HDL transports endogenous cholesterol from tissues to the liver.

[0007] Lipoprotein particles undergo successive metabolic processes and have different properties and compositions. The density of the polyprotein is such that the density of the outer coating is less than that of the inner core. The protein component of lipoproteins is apolipoproteins. At least nine apolipoproteins are known as apolipoproteins in various human lipoproteins. It is distributed in significant amounts in proteins.

[0008] Lipoprotein(a) (Lp(a)) particles were identified approximately 50 years ago and are a single apolipoprotein. Protein B (apoB) is a single protein that forms apolipoprotein(a) (apo(a) ) A very unique LDL particle that is linked to proteins via disulfide bonds The apo(a) protein is composed of the kringle IV type 2 repeat domain. It shares a high degree of homology with plasminogen in the cytoplasm. Circulating Lp(a) levels are The number of kringle IV type 2 variable repeats present in the molecule is inversely proportional to the number of alleles present. Since the genes are co-expressed within an individual, they may present heterozygous plasma isoform profiles. (Kraft et al.,Eur J Hum.Genet,1996;4(2) :74-87). This kringle repeat domain in apo(a) is responsible for its prothrombotic properties. and anti-fibrinolytic properties, potentially promoting the progression of atherosclerosis. It is assumed.

[0009] Apo(a) is transcriptionally regulated by IL-6 and inhibited by IL-6 inhibitors (tocilizumab) A study in patients with rheumatoid arthritis treated with ) showed that plasma levels were 30% decrease (Schultz et al., PLoS One 2010;5:e l4328).

[0010] Apo(a) has been shown to preferentially bind to oxidized phospholipids and enhance vascular inflammation. (Bergmark et al., J Lipid Res 2008;49 :2230-2239;Tsimikas et al.,Circulation.2 009;119(13):1711-1719).

[0011] Furthermore, studies have shown that Lp(a) particles stimulate endothelial permeability and increase plasminogen activators. It can induce the expression of type 1 interferon inhibitor and activate macrophage interleukin-8 secretion. This suggests that Opin Lipidol 2004;15:167-174). Importantly, recently Genetic association studies have shown that Lp(a) is associated with myocardial infarction, stroke, peripheral vascular disease, and abdominal aortic aneurysm. It has been shown to be an independent and risk factor for glaucoma (Rifai et al., Cli n.Chem.2004;50:1364-71;Erqou et al.,JAMA 2009;302:412-23;Kamstrup et al.,Circula tion 2008;117:176-84). Furthermore, recent premature coronary artery disease (PR) In their study of OCARDIS, Clarke et al. al., NEJM (2009) 361; 2518-2528) reported that coronary heart disease and plasma L Furthermore, Solfrizzi et al. et al. reported that elevated serum Lp(a) is associated with an increased risk of Alzheimer's disease (AD). (Solfrizzi et al., J Neural Neu Rosurg Psychiatry 2002,72:732-736). Currently clinical In the field, aspirin is an example of an indirect apo(a) inhibitor for treating cardiovascular disease. Examples include rifametidine, niaspan, mipomersen, anacetrapib, eprotirome, and lomitapide. These increased plasma Lp(a) levels by 18%, 39%, 32%, 36%, and 50%, respectively. Furthermore, apo(a) containing Lp(a) particles were reduced by 43% and 17%. Lp(a) apheresis is used in clinics to reduce the risk of pulmonary embolism.

[0012] To date, there have been several studies to treat cardiovascular disease by directly targeting apo(a) levels. Therapeutic strategies for this disease have been limited. ,022) and antisense oligonucleotides (WO 2005 / 000 201 Brochure; International Publication No. 2003 / 014397 Brochure; International Publication No. 2013 / 177468; U.S. Patent Application Publication No. 20040242516 Specification; U.S. Patent No. 8,138,328 Specification, U.S. Patent No. 8,673,632 Specification and U.S. Patent No. 7,259,150; Merki et al., J Am Coll Cardiol 2011;57:1611-1621; each publication is available in its entirety. Although several therapeutic agents have been developed, none have been approved for commercial use.

[0013] Tsimikas et al.(Lancet.2015 Oct 10;386: 1472-83) is an antisense compound targeting human Apo(a), ISIS Randomization with 494372 (also known as ISIS-APO(a)Rx) The results of a double-blind, placebo-controlled Phase 1 study are disclosed.

[0014] RNAse H-dependent (gapmer) amplicons, including Apo(a)-targeting compounds One chemical modification used to improve the activity of cis-sense compounds in vivo is the addition of GalN. Attachment to a conjugate group such as an Ac cluster. Attachment to a conjugate group is For example, GalN as disclosed in International Publication No. 2014 / 179620 RNAse H-dependent (gapmer) antisense compounds bound to Ac clusters This has been shown to improve in vivo efficacy in non-human subjects, including the use of Prior to this invention, the RNAse H-dependent (gap mutation) binding to GalNAc clusters was -) Antisense compounds have not been tested in humans to achieve target reduction.

[0015] International Publication No. 2014 / 179625 brochure includes ISI 681257 and other GalNAc cluster-linked antisense compounds targeting Apo(a) has disclosed.

[0016] The compound code "ISIS 681257" refers to a compound with the following structure: The code ISIS 681257 includes the compound as well as its salts. [ka]

[0017] The diagram below shows an example of a salt of ISIS 681257. [ka]

[0018] ISIS 681257 has the nucleobase sequence TGCTCCGTTGGTGCTTGTTC (SEQ ID NO: 1), a 5-10-5 gapmer motif and a GalNAc conjugate The modified oligonucleotides include those having the following structure:

[0019] WO 2017 / 079739 provides specific dosages and specific administration regimens. The present application discloses a method of treatment using ISIS 681257 in men. The brochure No. 017 / 079739 describes the effects of ISIS 681257 on the development of steroids in humans. In this case, the effects of Apo(a) mRNA and plasma Lp( a) It is disclosed to be particularly effective in reducing levels of ISIS 6 81257 has the same nucleobase sequence and the same 5-10-5 gapmer motif. However, modified oligonucleotides lacking the GalNAc conjugate, i.e., ISIS It showed a more than 30-fold increase in human activity compared to 494372. 257 produced excellent reductions in Apo(a)mRA and plasma Lp(a) levels and was administered once weekly. It is disclosed that the drug can be effectively administered once a month, once every two months, or once every three months. was done. Summary of the Invention [Problem to be solved by the invention]

[0020] However, chronically elevated plasma Lp(a) levels increase the risk of cardiovascular events. Optimized dosing schemes allow patients to receive only the minimum necessary dose, including those with SIS potently and selectively reduces Apo(a) levels in humans while increasing the exposure of There is an unmet medical need for optimized therapy with 681257. The benefits of such optimized treatment include, for example, reduced treatment costs. reduction, improved patient compliance, reduced amount of medication administered and / or lower dose regimens Potential reduction in risk of potential adverse events via dimen. [Means for solving the problem]

[0021] The present disclosure reduces the risk of cardiovascular events in patients with established cardiovascular disease. The method comprises administering to a patient an oligomeric compound ISIS at a specific dosage at a specific dosage interval. 681257.

[0022] Phase 2B study using ISIS 681257 (Clinical trial NCT03070782) reported that the compound significantly reduced Lp(a) levels in patients with established cardiovascular disease (CVD). and lipoprotein(a) levels, with a safety and tolerability profile was shown to be good.

[0023] The Phase 2 study will evaluate the safety and tolerability of ISIS 681257 and will support the planned Phase 3 study. This multi-phase cardiovascular outcomes trial was designed to determine the appropriate dose. A controlled dose-ranging phase 2 study was conducted in patients with established CVD and elevated Lp(a) levels (above the upper limit of normal). more than three times the baseline mean value of approximately 100 mg / dL [250 nmol / L] A total of 286 patients with pulmonary embolism were included.

[0024] The clinical trials included 20 mg (every 4 weeks), 40 mg (every 4 weeks), 60 mg (every 4 weeks), and 20 mg There were five cohorts: 20 mg (every 2 weeks) and 20 mg (weekly).

[0025] The primary efficacy endpoint was baseline efficacy compared with placebo at the primary analysis time point (6 months). was the percent change in Lp(a) from the line.

[0026] Secondary efficacy endpoints were LDL-C, apoB, OxPL-apoB, and OxPL-ap mean percent change in o(a) and <125 nmol / L (<50 mg / dL) or <7 The number of patients who reached a prespecified threshold of 5 nmol / L (<30 mg / dL) was .

[0027] All patients were treated for at least 6 months, and some patients were treated for up to 1 year.

[0028] The study met all primary and secondary efficacy endpoints analyzed at 6 months.

[0029] Results from this study showed a statistically significant and dose-dependent increase in Lp(a) levels from baseline. shows a continuous decrease.

[0030] [Table 1]

[0031] Approximately 98% of patients in the 20 mg weekly cohort and 60 mg every 4 weeks cohort Approximately 81% of patients achieved clinically significant reductions in Lp(a) levels and reduced the risk of CVD events. The blood glucose level fell below the recommended threshold for HIV testing (less than 50 mg / dL). Treatment with ISIS 681257 reduced LDL-C, apoB, OxPL-apoB, It was associated with a decrease in OxPL-apo(a). Most adverse events were mild. The most common adverse event was injection site reaction (I ISR occurred in 26% of patients, mostly mild, with one patient experiencing an ISR. , suspended due to ISR. There were no safety concerns related to platelet counts, liver function, or kidney function. In this study, platelet counts were 100,000 / mm 3 Patients confirmed to be less than Normal (140,000 / mm 3 The incidence of platelet levels below 100% was higher in the active treatment group than in the control group. (10.5%) and placebo (14.9%). Approximately 90% of patients completed treatment, with discontinuation rates similar to those in the active drug group (12.1%) and placebo group ( 14.9%) were comparable.

[0032] These data suggest that ISIS 681257 may be effective in preventing the progression of pre-existing inflammatory bowel disease by increasing Lp(a) levels. It was shown to significantly reduce Lp(a) in patients with cardiovascular disease. 81257 reduces clinically significant Lp(a) levels in patients with this genetic condition It is the first and only drug to demonstrate a reduction in urinary tract infection and a favorable safety and tolerability profile.

[0033] Based on these results, we will now consider a new 75mg to 85mg dose, e.g., 80mg. The dose of ISIS 681257 provided maximal efficacy with an acceptable safety profile. This monthly dosing regimen was chosen to provide the benefits associated with more frequent administration. This reduces the overall burden on patients and provides better local tolerability.

[0034] The maximum dose evaluated in the Phase 2b study was 20 mg once weekly (QW) (total monthly exposure). The overall monthly exposure was similar, so the 80 mg dose was used once a month (Q The M) dose is expected to provide similar efficacy as the 20 mg QW regimen. The efficacy of ISIS 681257 observed at doses of 40 mg Q4W and 20 mg Q2W was This is supported by the similarity in efficacy between these regimens. The decreases in ISIS 681257 were similar; therefore, the total monthly exposure to ISIS 681257 was approximately 100 mg / kg / day. Regarding safety, the efficacy of 20 mg / month to 20 mg / month was At a dose of 0 mg / week (equivalent to 80 mg / month, total dose 260-1040 mg), There were no changes in safety signals related to ISIS 681257.

[0035] Thus, in a first aspect, the present disclosure provides a method for the treatment of idiopathic cerebrovascular disease in patients with established cardiovascular disease. A method for reducing the risk of cardiovascular events, comprising administering a subcutaneous injection once a month or once every four weeks. Approximately 75 mg to approximately 85 mg of compound ISIS 681257 (the compound itself or its derivatives) can be obtained by a salt) to the patient, said patient being administered a unit dose of the compound prior to the first administration of the compound. and having a plasma Lp(a) concentration of 70 mg / dL or greater.

[0036] Only 75 mg to approximately 85 mg of compound ISIS 6812 once a month or once every four weeks This novel reduced-dose treatment regimen of 57 demonstrated maximum efficacy with an acceptable safety profile. A monthly regimen has also been shown to provide efficacy compared to more frequent dosing. This reduces the overall burden on the patient and provides better local tolerability.

[0037] The maximum dose evaluated in the Phase 2b study was 20 mg once weekly (QW); The dosing schedule is surprising (equivalent to a total monthly exposure of 80 mg). The described 80 mg once monthly (QM) dose has similar efficacy to the 20 mg QW regimen. Equivalence in overall monthly exposure was not necessarily predicted. However, similar efficacy of the compound was observed at doses of 40 mg Q4W and 20 mg Q2W. Phase 2b will examine the overall exposure and Lp(a) levels between these regimens. Therefore, the total monthly exposure to the compound is related to the efficacy of the drug. Second, this total monthly exposure may explain the need to reduce injection frequency from once a week to once a week. This can be reduced to once a month.

[0038] This novel treatment regimen has the potential to reduce treatment costs, improve patient compliance, and Risk of potential adverse events through reduction in the amount of medication given and / or lower dose regimens The present invention provides one or more highly significant improvements in human therapy, such as reduction of risk.

[0039] The present disclosure provides the following non-limiting embodiments.

[0040] In some embodiments, cardiovascular events include major adverse cardiovascular events (MACE), all-cause mortality, Deaths (all causes), coronary heart disease (CHD) deaths, acute myocardial infarction (AMI) deaths , heart failure (HF) death, death due to immediate complications of cardiac surgery, and emergency lower limb circulation for ischemia. The choice is between reconstruction or amputation.

[0041] In some embodiments, a major adverse cardiovascular event (MACE) is defined as a cardiovascular (CV) death, non-CV Selected from fatal myocardial infarction, non-fatal stroke, and emergency coronary revascularization requiring hospitalization In another embodiment, the major adverse cardiovascular event (MACE) is cardiovascular (CV) death. In yet another embodiment, the major adverse cardiovascular event (MACE) is a non-fatal myocardial infarction. In another embodiment, the major adverse cardiovascular event (MACE) is a non-fatal stroke. In another embodiment, a major adverse cardiovascular event (MACE) is an emergency coronary revascularization event requiring hospitalization. It is a construction technique.

[0042] In some embodiments, cardiovascular events include all-cause mortality (death from any cause), coronary heart disease, and stroke. Cardiovascular disease (CHD) deaths, acute myocardial infarction (AMI) deaths, heart failure (HF) deaths, and immediate cardiac surgery deaths The options are death due to complications at the time of surgery and emergency lower limb revascularization or amputation due to ischemia.

[0043] In one embodiment, the cardiovascular event is all-cause mortality (death from any cause).

[0044] In another embodiment, the cardiovascular event is coronary heart disease (CHD) death. Coronary heart disease (CHD) deaths are classified as acute myocardial infarction (AMI) deaths, heart failure (HF) deaths, and cardiac deaths. Includes deaths resulting from immediate complications of surgery.

[0045] In another embodiment, the cardiovascular event is emergency lower limb revascularization or amputation due to ischemia.

[0046] In some embodiments, patients with established cardiovascular disease are those with (i) cryptogenic myocardial infarction (ii) history of ischemic stroke, and (iii) clinically significant symptomatic peripheral arterial The patient has at least one of the following diseases:

[0047] In one embodiment, the history of cryptogenic myocardial infarction is greater than or equal to 3 months and greater than or equal to 10 months at the time of first administration of the compound. It occurred less than a year ago.

[0048] In one embodiment, the history of ischemic stroke is greater than or equal to 3 months and greater than or equal to 10 years at the time of first administration of the compound. The following has occurred before:

[0049] In one embodiment, the history of ischemic stroke is a focal brain injury resulting from an infarction of central nervous system tissue. , acute episodes of spinal cord or retinal dysfunction.

[0050] In one embodiment, clinically significant symptomatic peripheral arterial disease is defined as (i) an above-ankle sigma index of 0.90 or less. brachial pressure index, (ii) during which at least one of lower limb amputation or revascularization for lower limb ischemia was performed Evidenced by absent claudication.

[0051] In some embodiments, the patient has a plasma concentration of 90 mg / dL or greater prior to the first dose of the compound. Lp(a) concentration.

[0052] In some embodiments, the unit dose comprises between 75 mg and 85 mg of the compound.

[0053] In one embodiment, the unit dose contains about 80 mg of the compound. In yet another embodiment, the unit dose comprises 80 mg or less of the compound. Contains compounds.

[0054] In some embodiments, the compound is formulated in a sterile liquid, and each unit dose of the compound contains 1 Contains no more than mL of sterile liquid.

[0055] In one embodiment, each unit dose of the compound contains no more than 0.8 mL of sterile liquid. In this embodiment, each unit dose of the compound contains no more than 0.5 mL of sterile liquid. In another embodiment, each unit dose of the compound does not contain more than 0.4 mL of sterile liquid. In another embodiment, each unit dose of the compound contains no more than 0.25 mL of sterile liquid. In yet another embodiment, each unit dose of the compound contains no more than 0.2 mL of sterile liquid. stomach.

[0056] In one embodiment, the sterile liquid is water. In another embodiment, the sterile liquid is sodium phosphate. In yet another embodiment, the sterile liquid is water containing sodium phosphate buffer. It is water containing a buffer solution and sodium chloride.

[0057] In some embodiments, the mean / median plasma Lp(a) concentration of a patient is measured after the patient has administered the compound. The patient's plasma Lp(a) concentration is measured at the beginning and end of the administration period. In another embodiment, the mean / median plasma Lp ( a) The concentration is determined by measuring the patient's plasma Lp(a) concentration at the beginning and end of the administration period. In yet another embodiment, the mean / median plasma Lp of the patient is reduced by at least 60%. (a) Concentration is measured when the patient's plasma Lp(a) concentration is measured at the beginning and end of the treatment period. , is reduced by at least 70%. In another embodiment, the mean / median plasma Lp(a ) concentrations are measured at the beginning and end of the treatment period, and the patient's plasma Lp(a) concentrations are measured at least once a day. It is reduced by at least 75%.

[0058] In some embodiments, the overall incidence of patients experiencing major adverse cardiovascular events (MACE) is The risk was statistically significant at the end of the treatment period compared with patients who did not receive the compound. is reduced by a certain amount.

[0059] In other embodiments, the following events: (i) cardiovascular (CV) death, non-fatal MI, and non-fatal MI. (ii) a composite of stroke; (iii) coronary heart disease (CHD) death, non-fatal MI, and emergencies requiring hospitalization. (iii) a composite of coronary heart disease (CHD) death, non-fatal MI, and hospitalization A combination of emergency coronary revascularization and emergency lower limb revascularization or amputation for ischemia; and (iv) The overall risk of a patient experiencing one of the proportions of all-cause mortality is is reduced by a statistically significant amount at the end of the treatment period compared to patients who did not receive the treatment.

[0060] In other embodiments, the following events: (i) all-cause mortality, non-fatal MI, and non-fatal stroke (ii) all vascular events: CV death, non-fatal MI, non-fatal stroke, emergency medical attention requiring hospitalization (iii) a composite of acute coronary revascularization and urgent lower limb revascularization or amputation for ischemia; Composite of cause of death, non-fatal MI, non-fatal stroke, and emergency coronary revascularization requiring hospitalization (iv) a composite of fatal and non-fatal stroke; (v) a history of peripheral arterial disease (PAD). (vi) the rate of major adverse limb events (MALE) in patients with unstable angina (vii) the overall risk of a patient experiencing one of the following hospitalization rates for heart failure: , by a statistically significant amount at the end of the treatment period compared with patients who did not receive the compound. and patients had plasma Lp(a) concentrations of 90 mg / dL or greater before the first dose of the compound. Has.

[0061] In one embodiment, a plasma Lp(a) concentration of 70 mg / dL or greater prior to the first administration of the compound is For patients with A significant relative amount is at least 15% for any one of the events. So, the relative risk reduction for any one of the events (i.e., the overall risk reduction) (i) a statistically significant relative amount of 70 mg / dL or more before the first dose of the compound For patients with a plasma Lp(a) concentration of at least 15%, preferably at least 2 0%, more preferably at least 25%; (ii) 90 mg / d before the first dose of the compound; For patients with plasma Lp(a) concentrations of 1000 or more, at least 20%, preferably less than 100%, It is preferably at least 25%, more preferably at least 30%.

[0062] In one embodiment of the above embodiment, the absolute risk reduction ( (i.e., the statistically significant absolute amount by which overall risk is reduced) is determined by: (i) the initial administration of the compound; For patients with a plasma Lp(a) concentration of 70 mg / dL or higher before administration, 0.0%, preferably at least 2.5%; (ii) 90 mg / d before the first dose of the compound; For patients with plasma Lp(a) concentrations of 1.0 or greater, a minimum of 3.0% At least 3.5%.

[0063] In other embodiments, the patient experiences one of the following events or characteristics: (i) 1, 2, 3, 4, or 5 days after initiation of treatment; , 5, 6, 9, 12, 13, 15, 18, 21, 24 and 27 months to choose from Change in Lp(a) from baseline at time of administration (in mg / dL and nmol / L) (ii) extended lipid profile parameters (total cholesterol, LDL-C, apoB (iii) changes in serum cholesterol (HDL-C, non-HDL-C, triglycerides) and hsCRP; (iv) incidence of type 2 diabetes mellitus as assessed by the SF-12 questionnaire and (v) aortic valve replacement (open catheter or transcatheter) or aortic valve stenosis. The time period from the administration of the compound to the first hospitalization for vasoconstriction was showed a statistically significant improvement at the end of the treatment period compared with patients who did not receive the treatment. The subject has a plasma Lp(a) concentration of 90 mg / dL or greater prior to the first dose of the compound.

[0064] In one embodiment, the relative improvement rate (i.e., the statistically significant relative improvement rate of an event or characteristic) is The amount) is at least 15% for any one of the events or characteristics.

[0065] In some embodiments, the administration period is at least 6 months. The administration period is at least one year. In yet another embodiment, the administration period is at least In another embodiment, the administration period is at least 3 years.

[0066] In some embodiments, the patient has a guideline-defined target low-density lipoprotein background to achieve high quality cholesterol (LDL-cholesterol) levels Receive therapy.

[0067] In some embodiments, background therapy includes (i) a statin, (ii) an ezetimibe, and (iii) at least one of a PCSK9 inhibitor.

[0068] In one embodiment, the background therapy includes a statin and the patient receives an initial dose of the compound. Receive the optimal dose of statin before each dose.

[0069] In some embodiments, the patient has a sitting systolic blood pressure (SBP) of less than 180 mmHg and and / or have a diastolic BP (DBP) of less than 110 mmHg.

[0070] In some embodiments, the patient has had niacin in the three month period prior to the first administration of the compound. have not been treated with

[0071] In some embodiments, the patient is diagnosed with heart failure at the time of the first administration of the compound. New York Heart Association (NYHA) Class Not diagnosed with IV.

[0072] In some embodiments, the patient has suffered a hemorrhagic stroke or other major event prior to the first administration of the compound. No history of blood disease.

[0073] In some embodiments, the patient will experience myocardial infarction, cerebral infarction, or stroke within 3 months of the first administration of the compound. Stroke, coronary or lower limb revascularization, major cardiac or non-cardiac surgery, or lipoprotein No apheresis.

[0074] In some embodiments, the patient has a known active infection or major hematological, renal, metabolic, No gastrointestinal or endocrine dysfunction.

[0075] In some embodiments, the patient receives 30 mL / min / 1.73 m prior to the first dose of the compound. 2 have an estimated glomerular filtration rate (eGFR) greater than

[0076] In some embodiments, the patient receives 30 mL / min / 1.73 m prior to the first dose of the compound. 2 and not have an estimated glomerular filtration rate (eGFR) less than 0.

[0077] In some embodiments, the patient is administered a dose of 2x the upper limit of normal (ULN) prior to the first administration of the compound. More than 2-fold increase in aspartate aminotransferase (AST) or alanine aminotransferase Patients with active liver disease or impaired liver function, as defined by serum ALT levels Not yet.

[0078] In some embodiments, the patient is at least 1.5 mg / kg of the upper limit of normal (ULN) before the first dose of the compound. Do not have more than 5 times the total bilirubin.

[0079] The present disclosure provides a method comprising administering ISIS 681257 to a patient in need thereof. In certain embodiments, a patient in need thereof has a blood glucose level of, for example, 30 mg / dL or less. Above, 35 mg / dL or higher, 40 mg / dL or higher, 50 mg / dL or higher, 60 mg / dL or higher Above, 70mg / dL or more, 80mg / dL or more, 90mg / dL or more, 100mg / dL or more, 110mg / dL or more, 120mg / dL or more, 130mg / dL or more, 140m g / dL or more, 150 mg / dL or more, 160 mg / dL or more, 170 mg / dL, 17 5 mg / dL or more, 180 mg / dL or more, 190 mg / dL or more, or 200 mg / dL or more and humans with elevated Apo(a) levels, such as humans with apo(a) levels of Lp(a) can also be expressed as nanomoles per liter. For example, 75 nanomoles Human subjects with ≥ 30 mg / dL or ≥ 100 nmol / L (nmol / L) were randomly assigned to are considered to be at risk for multiple cardiovascular events.

[0080] Unless otherwise specified, all technical and scientific terms used herein are defined by the principles of the present disclosure. It has the same meaning as commonly understood by a person skilled in the art to which it pertains. The singular also includes the plural unless the context clearly indicates otherwise. Although methods and materials similar or equivalent to those described above can be used in the practice or testing of the present disclosure, Suitable methods and materials are described below. All publications mentioned herein are incorporated by reference. All articles, patent applications, patents and other references cited herein are incorporated by reference. No reference is admitted to be prior art to the claimed disclosure. In addition, the materials, methods, and examples are intended as illustrative only. , not intended to be limiting.

[0081] Other features and advantages of the present disclosure will become apparent from the following detailed description and claims. It would be. [Brief explanation of the drawings]

[0082] [Figure 1] Provide an overview of the research design. [Figure 2] 1 shows the statin treatment regimen for the patient. [Figure 3] The study procedures for the primary and secondary endpoints are shown below. DETAILED DESCRIPTION OF THE INVENTION

[0083] The present disclosure reduces the risk of cardiovascular events in patients with established cardiovascular disease. A method comprising administering to a patient, with certain specified limitations, the oligomeric compound ISIS 6812 57.

[0084] Details of the present disclosure are set forth in the accompanying description below. Although any equivalent methods and materials can be used in the practice or testing of this disclosure, exemplary methods and materials are described in detail below. Other features, objects, and advantages of the present disclosure will become apparent from the description and claims. It will be clear that in this specification and the appended claims, exceptions are clearly stated by context. Unless otherwise specified, the singular forms include the plural forms. All technical and scientific terms used herein are understood to be within the meaning of the present invention and are understood to be within the meaning of the present invention. All patents and publications referred to herein have the same meaning as those in the art. are incorporated herein by reference in their entirety.

[0085] Definitions of terms and rules used Unless specific definitions are provided, analytical chemistry, synthetic organic chemistry, and pharmaceuticals as described herein The nomenclature used in connection with chemistry, and the procedures and techniques thereof, are well known in the art and Commonly used. Standard techniques may be used for chemical synthesis and chemical analysis. Certain such techniques and procedures are incorporated herein by reference for any purpose, for example. "Carbohydrate Modifications in Ant" isense Research”Edited by Sangvi and Coo k,American Chemical Society,Washington D .C.,1994;“Remington's Pharmaceutical Sci. ences,”Mack Publishing Co.,Easton,Pa.,21 st edition, 2005; and “Antisense Drug Techno logy,Principles,Strategies,and Applicati ons”Edited by Stanley T. Crooke,CRC Press , Boca Raton, Florida; and Sambrook et al., “M olecular cloning,A laboratory manual,”2n d Edition,Cold Spring Harbor Laboratory Press, 1989. Where permitted, all references made throughout this disclosure Patents, applications, published applications and other publications and other data are incorporated herein by reference in their entireties. It is used in books.

[0086] Unless otherwise indicated, the following terms have the following meanings:

[0087] As used herein, "administration period" refers to the period from when a human subject receives the first dose to the last dose. After the initial treatment period, the patient may continue treatment with the same or a different treatment regimen. Continue dosing the patient after the end of the dosing period so that one or more further dosing periods using For example, a human subject may receive a first dose and a final dose 4 weeks apart. Subsequently, the human subject may then receive six doses in a first administration period of A second dosing period can begin in which the elephant receives doses at regular intervals (e.g., one unit per week). dose, one unit dose per month or one unit dose per quarter).

[0088] As used herein, the term "unit dose" refers to a specific amount of a substance administered to a human at a specific time. amount of oligomeric compound (e.g., a specific amount of oligomeric compound administered to a human in a single subcutaneous injection) As described herein, each unit dose may be part of a multiple dose regimen. Form.

[0089] As used herein, the term "unit dosage form" refers to a dosage form in which each unit dose is presented for administration. "Physical form" means the physical form in which the substance is

[0090] As used herein, the term "sterile liquid" means a liquid suitable for administration to a human subject. In certain embodiments, the sterile liquid is substantially free of viable microorganisms or bacteria. In certain embodiments, the sterile liquid is USP grade water or USP grade ethanol. Contains saline.

[0091] As used herein, "nucleoside" means a compound containing a nucleobase moiety and a sugar moiety. Nucleosides include, but are not limited to, natural nucleosides. Nucleosides include nucleotides (as found in DNA and RNA) and modified nucleosides. The bonds can be linked at the phosphate moiety.

[0092] As used herein, a "chemical modification" refers to a modification of a compound as compared to its naturally occurring counterpart. The chemical modification of oligonucleotides includes nucleoside modification ( sugar moiety modifications and nucleic acid base modifications) and internucleoside linkage modifications With respect to oligonucleotides, chemical modifications do not include differences in nucleobase sequence alone.

[0093] As used herein, "furanosyl" refers to a 5-amino group containing four carbon atoms and one oxygen atom. It means a structure containing a membered ring.

[0094] As used herein, a "natural sugar moiety" refers to a ribonucleotide found in naturally occurring RNA. furanosyl or deoxyribofuranosyl as found in naturally occurring DNA. do.

[0095] As used herein, "sugar moiety" means the natural or modified sugar moiety of a nucleoside. do.

[0096] As used herein, a "modified sugar moiety" means a substituted sugar moiety or a sugar surrogate.

[0097] As used herein, "substituted sugar moiety" means a furanosyl that is not a naturally occurring sugar moiety. The substituted sugar moiety includes furanosides containing substituents at the 2', 3', 5', and / or 4' positions. Certain substituted sugar moieties include, but are not limited to, bicyclic sugar moieties. minutes.

[0098] As used herein, a "2' substituted sugar moiety" includes a substituent other than H or OH at the 2' position. Unless otherwise specified, a 2'-substituted sugar moiety is not a bicyclic sugar moiety. (i.e., the 2'-substituent of the 2'-substituted sugar moiety does not form a bridge to another atom of the furanosyl ring. stomach.)

[0099] As used herein, "MOE" means -OCH2CH2OCH3.

[0100] As used herein, "nucleic acid" refers to a molecule composed of monomeric nucleotides. The acids include ribonucleic acid (RNA), deoxyribonucleic acid (DNA), and single-stranded nucleic acid (ssDN). A), double-stranded nucleic acid (dsDNA), small interfering ribonucleic acid (siRNA), and microRNA A (miRNA) is a nucleic acid that contains any combination of these elements within a single molecule. It may also include.

[0101] As used herein, a "nucleotide" refers to a nucleoside that further includes a phosphate linker. As used herein, "linked nucleosides" means nucleosides that are linked by phosphate bonds. It may or may not be a "linked nucleotide" and therefore includes, but is not limited to, a "linked nucleotide." As used herein, "linked nucleosides" refers to nucleosides that are linked in a contiguous sequence. nucleosides (i.e., there is an additional nucleoside between the linked nucleosides) do not).

[0102] As used herein, a "nucleobase" refers to a base that is linked to a sugar moiety and incorporated into an oligonucleotide. The term "nucleoside" refers to a group of atoms capable of forming a nucleoside that can be incorporated into another oligonucleoside. The nucleobases can be natural or modified. As used herein, a "nucleobase sequence" refers to any sugar, linkage, or nucleobase It refers to the order of consecutive nucleobases, independent of any modification.

[0103] As used herein, the term "unmodified nucleobase" or "natural nucleobase" refers to a base that is present in an RNA or the purine bases adenine (A) and guanine ( G), the pyrimidine bases thymine (T), cytosine (C) (including 5-methyl C) and uracil It means sir (U).

[0104] As used herein, "modified nucleobase" means any nucleobase that is not a naturally occurring nucleobase. Taste.

[0105] As used herein, a "modified nucleoside" refers to a nucleoside that is different from a natural RNA or DNA nucleoside. In comparison, a modified nucleoside refers to a nucleoside that contains at least one chemical modification. , comprising modified sugar moieties and / or modified nucleobases.

[0106] As used herein, a "2'-substituted nucleoside" refers to a nucleoside that has a substituent other than H or OH at the 2'-position. Unless otherwise indicated, a 2'-substituted nucleoside refers to a nucleoside containing a bicyclic Formula nucleoside is not.

[0107] As used herein, "deoxynucleoside" refers to a naturally occurring deoxyribonucleoside ( It refers to a nucleoside containing a 2'-H furanosyl sugar moiety, such as found in DNA. In certain embodiments, the 2'-deoxynucleoside may comprise a modified nucleobase or R It may contain NA nucleobases (e.g., uracil).

[0108] As used herein, an "oligonucleotide" refers to a compound containing multiple linked nucleosides. In certain embodiments, the oligonucleotide comprises one or more unmodified Ribonucleosides (RNA) and / or unmodified deoxyribonucleosides (DNA) and / or containing one or more modified nucleosides.

[0109] As used herein, an "oligonucleoside" refers to a group of oligonucleosides in which any internucleoside linkage is phosphorus. As used herein, oligonucleotide refers to an oligonucleotide that does not contain any atoms. The term "nucleoside" includes oligonucleosides.

[0110] As used herein, a "modified oligonucleotide" refers to an oligonucleotide containing at least one modified nucleotide. The term "oligonucleotide" refers to an oligonucleotide containing at least one modified internucleoside and / or at least one modified internucleoside linkage. Taste.

[0111] As used herein, a "bond" or "linking group" refers to a group that links two or more other groups of atoms together. It means a group of atoms that

[0112] As used herein, an "internucleoside linkage" refers to a bond between consecutive nucleosides in an oligonucleotide. It refers to the covalent bond between cleosides.

[0113] As used herein, a "natural internucleoside linkage" is a 3' to 5' phosphodiester It means bonding.

[0114] As used herein, a "modified internucleoside linkage" refers to a linkage other than a naturally occurring internucleoside linkage. Any internucleoside bond is meant.

[0115] As used herein, a "terminal internucleoside linkage" refers to a terminal internucleoside linkage in an oligonucleotide or its definition. The term "nucleotide" refers to the bond between the last two nucleosides of the defined region.

[0116] As used herein, a "phosphorus linking group" means a linking group that includes a phosphorus atom. Groups include, but are not limited to, groups of the formula: [ka] Included are groups having the formula: R a and R d are each independently O, S, CH2, NH or NJ1, and J1 is C1-C6 alkyl or substituted C1-C6 alkyl; R b is O or S; R c is OH, SH, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkoxy alkoxy, substituted C1-C6 alkoxy, amino or substituted amino.

[0117] Phosphorus linking groups include, but are not limited to, phosphate diester, phosphorothioate, Phosphorodithioates, phosphonates, phosphoramidates, phosphorothioamidates, Thionoalkylphosphonates, phosphotriesters, thionoalkylphosphotriesters and boranophosphates.

[0118] As used herein, a "phosphorus internucleoside linking group" refers to a group that directly links two nucleosides. The term "phosphorus linking group" refers to a phosphorus linking group that bonds to the hydroxyl group.

[0119] As used herein, a "non-internucleoside phosphorus linking group" refers to a group that directly connects two nucleosides. In certain embodiments, the non-internucleoside phosphorus linking group is In certain embodiments, the non-nucleoside is linked to a group other than the nucleoside. The internucleoside phosphorus linking group connects two groups, neither of which is a nucleoside.

[0120] As used herein, a "neutral linking group" means a linking group that is not charged. Groups include, but are not limited to, phosphotriester, methylphosphonate, MMI( -CH2-N(CH3)-O-), amide-3 (-CH2-C(=O)-N(H)-), Amide-4 (-CH2-N(H)-C(=O)-), formacetal (-O-CH2- O-) and thioform acetal (-S-CH2-O-). The bonding groups include siloxane (dialkylsiloxane), carboxylic acid ester, carboxane, Nonionic bonds include amides, sulfides, sulfonates, and amides (e.g., For example, Carbohydrate Modifications in Antisens e Research;YS Sanghvi and PDCook Eds. ACS Symposium Series 580;Chapters 3 and 4, (pp. 40-65). Additional neutral linking groups include mixed Nonionic bonds containing N, O, S and CH2 components are included.

[0121] As used herein, a "neutral internucleoside linking group" refers to a group that directly links two nucleosides. The term "neutral linking group" refers to a linking group that

[0122] As used herein, an "oligomeric compound" is a polymeric structure containing two or more substructures. In certain embodiments, the oligomeric compound comprises an oligonucleotide. In certain embodiments, the oligomeric compound comprises one or more conjugate groups and / or In certain embodiments, the oligomeric compound comprises an oligonucleotide Oligomeric compounds also include naturally occurring nucleic acids. In certain embodiments, the oligomeric compounds are , comprising a backbone of one or more linked monomeric subunits, wherein each linked monomer The mer subunits are directly or indirectly bound to the heterocyclic base moiety. In this embodiment, the oligomeric compound also includes monomeric subunits that are not linked to heterocyclic base moieties. In certain embodiments, the monomeric subunits may comprise a base, thereby providing an abasic site. The bond connecting the sugar moiety or surrogate and the heterocyclic base moiety can be independently modified. In certain embodiments, the linked sugar units may or may not contain a heterocyclic base. can be replaced with mimetics such as monomers in peptide nucleic acids.

[0123] As used herein, a "terminal group" refers to either the 3' or 5' end of an oligonucleotide. In certain embodiments, the term "terminal group" refers to one or more atoms attached to either or both of the terminal groups. is a conjugate group. In certain embodiments, the terminal group is one or more terminal group nuclei. Contains creoside.

[0124] As used herein, a "conjugate" or "conjugate group" refers to an oligonucleotide. Conjugates generally refer to atoms or groups of atoms that are bonded to a hydroxyl group or oligomeric compound. The hydroxyl group is important for pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge, and / or These include, but are not limited to, clearance properties, The compound is modified to alter one or more properties of the compound.

[0125] As used herein, in reference to a conjugate group, the term "conjugate linker" or A "linker" is any atom or group of atoms that (1) connects an oligonucleotide to another conjugate group. or (2) two or more moieties of the conjugate group are covalently linked. The term "conjugated group" refers to the portion of the conjugated group that

[0126] Conjugate groups are shown herein as radicals and are used to provides a linkage for forming a covalent bond to an oligomeric compound such as a nucleotide. In embodiments, the point of attachment on the oligomeric compound is the 3' terminal nucleoside of the oligomeric compound. In certain embodiments, the 3'-oxygen atom of the 3'-hydroxyl group of the oligomer compound The point of attachment on the substrate is the 5'-hydroxyl group of the 5'-terminal nucleoside of the oligomeric compound. In certain embodiments, the '-oxygen atom is an '-oxygen atom. The bond is a cleavable bond. In certain such embodiments, such a cleavable bond The bond may constitute all or part of a cleavable moiety.

[0127] In certain embodiments, the conjugate group comprises a cleavable moiety (e.g., a cleavable bond or cleavable nucleosides) and carbohydrate clusters such as GalNAc cluster moieties Such carbohydrate cluster moieties include a targeting moiety and optionally a conjugate moiety. In certain embodiments, the carbohydrate cluster moiety comprises a ligand. For example, in certain embodiments, carbohydrate clusters are identified by the number and identity of The moiety contains three GalNAc groups and is referred to as "GalNAc3." The cluster moiety (with specific tether, branch and conjugate linker groups) is These are listed in the fine print and are designated by a Roman numeral followed by the subscript "a." Therefore, "GaINac3-l a " has three GalNac groups and a specifically identified tetracycline. A specific carbohydrate cluster portion of a conjugate group having a separator group, a branching group, and a linking group. Such carbohydrate cluster fragments may be fragments of a cleavable bond or a cleavable nucleoside. The oligomeric compound is attached via a cleavable moiety such as a thiol.

[0128] As used herein, a "cleavable moiety" refers to a bond or group that can be split under physiological conditions. In certain embodiments, the cleavable moiety is a cleavable molecule that binds to a cell or intracellular compartment, such as a lysosome. In certain embodiments, the cleavable moiety is cleaved within the fragment. In certain embodiments, the cleavable moiety is one, two, three, or four cleavable moieties. It contains a group of atoms with one, four or five or more cleavable bonds.

[0129] As used herein, "cleavable bond" means any chemical bond that can be split. In certain embodiments, the cleavable bond is an amide, polyamide, ester, ether, Phosphodiester esters (either one or both), phosphate esters, carbamates, disulfides The peptide is selected from among peptides and peptides.

[0130] As used herein, a "carbohydrate cluster" refers to a carbohydrate cluster attached to a scaffold or linker group. refers to a compound having one or more carbohydrate residues attached thereto (e.g., the entire Maier et al., "Synthesis of f Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster fo r Cellular Targeting,”Bioconjugate Chemistry stry, 2003, (14): 18-29 or R as an example of a carbohydrate complex cluster. ensen et al., “Design and Synthesis of No. vel N-Acetylgalactosamine-Terminated Gly colipids for Targeting of Lipoproteins o the Hepatic Asiaglycoprotein Receptor, "J Med. Chem. 2004, (47): 5798-5808."

[0131] As used herein, "single stranded" refers to a stable self-stranded molecule that does not hybridize to its complement. It refers to an oligomeric compound that lacks sufficient self-complementarity to form a duplex.

[0132] As used herein, a "duplex" refers to a set of oligomeric compounds that hybridize to one another. It refers to a single self-complementary oligomeric compound that forms a pair or a hairpin structure. In an embodiment, the double-stranded oligomeric compound comprises a first and a second oligomeric compound.

[0133] As used herein, an "antisense compound" refers to a compound, at least some of which are hybrids. The term "compound" refers to a compound comprising or consisting of an oligonucleotide complementary to a target nucleic acid that can be formed. The antisense activity results in at least one antisense activity.

[0134] As used herein, "antisense activity" refers to the ability of an antisense compound to bind to its target nucleic acid. means any detectable and / or measurable change attributable to hybridization of In certain embodiments, antisense activity is achieved by targeting a nucleic acid transcript (e.g., mRNA). In certain embodiments, the antisense activity includes modulating the amount or activity of a pre-mRNA. This includes regulation of splicing of the

[0135] As used herein, an "RNase H-based antisense compound" refers to an antisense At least part of the antisense activity of an antisense compound is due to the binding of the antisense compound to a target nucleic acid. Attributed to hybridization and subsequent cleavage of the target nucleic acid by RNase H It refers to an antisense compound.

[0136] As used herein, "detect" or "measure" refers to a test or method for detecting or measuring. means that an assay is performed. Such detection and / or measurement may include a value of zero. Therefore, if the detection or measurement test results in no activity (zero activity), In any case, the step of detecting or measuring activity is still performed.

[0137] As used herein, "detectable and / or measurable activity" means a statistically significant, non-zero, This means significant activity.

[0138] As used herein, "essentially unchanged" refers to a compound that is substantially unchanged, especially one that is substantially more changed than another compound. It means that there is little or no change in a particular parameter compared to the other parameters. In certain embodiments, if the change in a parameter is less than 5%, the parameter is considered to be In certain embodiments, the parameter is qualitatively unchanged. If it changes by less than 2-fold, there is essentially no change, whereas if it changes by 10-fold, there is essentially no change. In certain embodiments, antisense activity is a change in the amount of a target nucleic acid. In such embodiments, the amount of non-target nucleic acid is varied if it is significantly less than the target nucleic acid. Although essentially unchanged, the change need not be zero.

[0139] As used herein, "expression" refers to the process by which a gene ultimately results in a protein. Expression includes transcription, post-transcriptional modifications (e.g., splicing, polyadenylation, ' Addition of caps) and translations.

[0140] As used herein, a "target nucleic acid" refers to a nucleic acid to which an antisense compound hybridizes. Antisense refers to a nucleic acid molecule that is intended to produce a desired antisense activity. The oligonucleotides have sufficient complementarity to their target nucleic acids to be capable of binding under physiological conditions. This allows hybridization under

[0141] As used herein, with respect to a nucleobase, "nucleobase complementarity" or "complementarity" refers to the ability of another It refers to a nucleic acid base that can form a base pair with a nucleic acid base. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil ( In certain embodiments, the complementary nucleobase is complementary to the nucleobase U of the target nucleic acid. The term "antisense compound" refers to a nucleobase that can form base pairs with a base of the antisense compound. A nucleic acid base at a specific position in the compound forms a hydrogen bond with a nucleic acid base at a specific position in the target nucleic acid. If possible, the position of the hydrogen bond between the oligonucleotide and the target nucleic acid is determined by the base pair of the nucleic acid. Nucleobases containing certain modifications are considered to be complementary to the corresponding nucleobases. The ability to complement one another may be maintained, and thus nucleobase complementarity is still possible.

[0142] As used herein, with respect to nucleobases, "non-complementary" means that the bases are unable to form hydrogen bonds with each other. This refers to a pair of nucleobases that are not present.

[0143] As used herein, oligomeric compounds (e.g., linked nucleosides, oligonucleosides) With respect to a nucleic acid (nucleotide or nucleic acid), "complementary" refers to a compound that is complementary to another oligomeric compound through nucleobase complementarity. or the ability of such oligomeric compounds or regions thereof to hybridize to Complementary oligomeric compounds must have nucleobase complementarity at each nucleoside. In particular embodiments, complementary The oligomeric compounds or regions are complementary at 70% of the nucleobases (70% complementary). In certain embodiments, the complementary oligomeric compounds or regions are 80% complementary. In some embodiments, complementary oligomeric compounds or regions are 90% complementary. In certain embodiments, complementary oligomeric compounds or regions are 95% complementary. Complementary oligomeric compounds or regions are 100% complementary.

[0144] As used herein, "mismatch" refers to the alignment of a first and second oligomeric compound. When the nucleobase of the first oligomeric compound is substituted with the nucleobase of the second oligomeric compound at the corresponding position, The first and second oligomeric compounds are each independently selected from the group consisting of a nucleotide, ... Or both can be oligonucleotides.

[0145] As used herein, "hybridization" refers to the bonding of complementary oligomeric compounds (e.g., For example, the pairing of an antisense compound and its target nucleic acid. While not all pairing mechanisms are identical, the most common mechanisms of pairing are Watson-Crick, Hoogsteen, or The hydrogen bonds between complementary nucleobases may be reversed Hoogsteen hydrogen bonds.

[0146] As used herein, "specifically hybridizes" means that an oligomeric compound: hybridize to one nucleic acid site with higher affinity than to another nucleic acid site It means the ability to form.

[0147] As used herein, the term "fully complementary" in reference to an oligonucleotide or portion thereof is a sequence in which each nucleobase of an oligonucleotide or a portion thereof is a complementary nucleic acid or a nucleic acid of a continuous portion thereof. This means that the fully complementary region can form base pairs on either strand. Neither does it contain mismatched or unhybridized nucleobases.

[0148] As used herein, "percent complementarity" refers to a sequence that is complementary to an equal length portion of a target nucleic acid. Percent complementarity means the percentage of nucleobases in an oligomeric compound that are The number of nucleobases in an oligomeric compound that are complementary to a nucleobase at a corresponding position in the oligomeric compound is - Calculated by dividing by the total length of the compound.

[0149] As used herein, "percent identity" refers to the percentage of a nucleic acid sequence that is identical to a nucleic acid sequence at a corresponding position in a second nucleic acid. The number of nucleobases in the first nucleic acid that are of the same type (independent of chemical modifications) as the base of the first nucleic acid is It means the number divided by the total number of nucleobases in the acid.

[0150] As used herein, "modulation" refers to the amount or quality of a molecule, function, or activity compared to that prior to modulation. It refers to a change in the quantity or quality of a molecule, function, or activity in a particular case. For example, modulation includes the alteration of gene expression. This includes changes that are either an increase (stimulation or induction) or a decrease (inhibition or reduction) of For example, regulation of expression can involve alterations in splice site selection during pre-mRNA processing. and a change in the absolute or relative amount of a particular splice variant compared to the amount in the absence of regulation. results.

[0151] As used herein, a "chemical motif" refers to a A motif refers to a pattern of chemical modifications. The hydroxyl groups may be defined by modifications at the specific linking groups of the hydroxyl groups.

[0152] As used herein, a "nucleoside motif" refers to an oligonucleotide or region thereof. The nucleoside modification pattern in such an oligonucleotide may be modified or unmodified. Unless otherwise indicated, nucleosides only The motifs described herein are intended to be nucleoside motifs. Therefore, in such cases, the bond is not restricted.

[0153] As used herein, a "sugar motif" refers to a sugar motif in an oligonucleotide or region thereof. It means a pattern of modification.

[0154] As used herein, a "binding motif" refers to a binding motif in an oligonucleotide or region thereof. The nucleosides of such oligonucleotides are Unless otherwise indicated, the present specification describes bonds only. The calligraphic motif is intended to be a connecting motif. The nucleoside is not limited.

[0155] As used herein, a "nucleobase modification motif" refers to a nucleic acid sequence along an oligonucleotide. Unless otherwise indicated, a nucleobase modification motif refers to a pattern of base modifications. Independent of acid-base sequence.

[0156] As used herein, a "sequence motif" refers to a sequence along an oligonucleotide or portion thereof. Unless otherwise indicated, a sequence motif refers to a pattern of nucleic acid bases arranged in a chemical It is independent of chemical modifications and therefore can be used in any combination of chemical modifications, including the absence of chemical modifications. It may have a

[0157] As used herein, with respect to a nucleoside or "type" of nucleoside, "a modification" is used. "Type" refers to the chemical modification of a nucleoside and includes modified and unmodified nucleosides. Therefore, unless otherwise indicated, a "nucleoside having a first type of modification" is It may be an unmodified nucleoside.

[0158] As used herein, "differently modified" refers to compounds that are different from one another, including the absence of modification. means different chemical modifications or chemical substituents. Thus, for example, MOE nucleosides and and unmodified DNA nucleosides are "different" even though the DNA nucleosides are unmodified. Similarly, both DNA and RNA are naturally occurring unmodified nucleotides. Even the same nucleoside is "differently modified". Those containing acid and base groups are not differentially modified. For example, 2'-OMe modified sugars and unmodified Nucleosides containing modified adenine nucleobases and 2'-OMe modified sugars and unmodified thymine nucleobases The nucleosides containing the group are not modified differently.

[0159] As used herein, "same type of modification" refers to compounds that are identical to each other, including the absence of the modification. Thus, for example, two unmodified DNA nucleosides can be Even if the NA nucleoside is unmodified, it has the same type of modification. Such nucleosides may contain different nucleobases.

[0160] As used herein, a "distinct region" refers to any adjacent chemical modification or model of chemical modification. The chief is an oligonucleotide containing at least one difference that allows the distinct regions to be distinguished from one another. It means a portion of a nucleotide.

[0161] As used herein, a "pharmaceutically acceptable carrier or diluent" refers to a compound that is suitable for use in administration to an animal. In certain embodiments, a pharmaceutically acceptable carrier or The diluent is sterile saline. In certain embodiments, such sterile saline is , pharmaceutical grade saline solution.

[0162] As used herein, the term "metabolic disorder" refers to the inability to use food to produce energy. A disease or disorder characterized primarily by dysregulation of metabolism, a complex series of chemical reactions related to breakdown It means the state.

[0163] As used herein, the term "cardiovascular disorder" refers to a condition characterized primarily by impaired function of the heart or blood vessels. means a disease or condition that is a symptom of

[0164] As used herein, a "prodrug" refers to a compound that, when administered to a subject, is metabolized to an active or Inactive or less active forms of a compound form a more active compound (e.g., a drug) means.

[0165] As used herein, the "SF-12" refers to a widely used and validated general health questionnaire. It refers to a measure of related quality of life (HRQOL), which is available across age groups, disease states, and treatment types. It encompasses general health concepts that are considered to be related to the body. The measurement includes 12 items and is a total Physical health (1 item), physical function (2 items), role limitations due to physical health (2 items), and Role of physical pain (1 item), vitality (1 item), social functioning (1 item), and emotional problems The SF-12 has eight domains: disability (2 items), mental health (2 items), and disability (2 items). There are two composite summary scores derived based on the individual domains of: Physical Component Summary (PCS) · Mental Dimensions Summary (MCS).

[0166] As used herein, unless otherwise indicated or modified, the term "double-stranded" refers to a The term refers to two distinct oligomeric compounds that hybridize to one another. A suitable double-stranded compound has sufficient structural integrity to maintain hybridization under physiologically relevant conditions. As long as there is sufficient complementarity, one or more non-hybridized strands may be present at one or both ends of one or both strands. Lid-forming nucleosides (overhangs) and / or one or more internal non-hybrid It may have lid-forming nucleosides (mismatches).

[0167] As used herein, a "5' target site" refers to the 5' terminal nucleotide of a particular antisense compound. A nucleotide refers to the nucleotide of a target nucleic acid that is complementary to a nucleotide.

[0168] As used herein, "about" means within ±10% of a value. If it says "may increase by approximately 50%," the marker should increase by 45% to 55%. It is suggested that

[0169] As used herein, "administered simultaneously" means that both pharmacological effects are delivered to the patient at the same time. Co-administration refers to the simultaneous administration of two drugs in any manner that results in a significant improvement in the efficacy of both drugs. are administered in a single pharmaceutical composition, in the same dosage form or by the same route of administration. The effects of both drugs do not need to be apparent at the same time. They may overlap over time and need not be simultaneous.

[0170] As used herein, "administer" or "administration" means providing a pharmaceutical agent to an individual. These include, but are not limited to, administration by a healthcare professional and self-administration. Administration of a pharmaceutical to an individual may be continuous, chronic, short-term, or intermittent. It can be parenteral or oral.

[0171] As used herein, an "agent" is an agent that can provide a therapeutic benefit when administered to an animal. "First Agent" means a therapeutic compound of the present invention. For example, One agent can be an antisense oligonucleotide that targets apo(a). A "second agent" is a second therapeutic compound of the invention (e.g., a second agent that targets apo(a)). antisense oligonucleotides of apo(a) and / or non-apo(a) therapeutic compounds .

[0172] As used herein, "improvement" or "improve" or "improving" refers to the improvement of the associated The severity of the indicators refers to the reduction of at least one indicator, sign, or symptom of a disease, disorder, or condition. The intensity can be determined by subjective or objective measures known to those skilled in the art.

[0173] As used herein, "apo(a)" refers to any gene encoding apo(a). It refers to a nucleic acid or protein sequence. For example, in certain embodiments, The DNA sequence encoding apo(a), the DNA encoding apo(a) (intro) RNA sequences transcribed from genomic DNA (including nucleotides and exons), apo The mRNA sequence encoding (a) or the peptide sequence encoding apo(a) are listed. can be done.

[0174] As used herein, "apo(a) nucleic acid" refers to any nucleic acid encoding apo(a). For example, in one embodiment, an apo(a) nucleic acid is an apo(a) The DNA sequence encoding apo(a) (introns and exons) RNA sequences transcribed from genomic DNA containing apo(a) and Examples of mRNA sequences include those that encode

[0175] As used herein, "apo(a) mRNA" refers to a gene encoding the apo(a) protein. This refers to mRNA that is converted into

[0176] As used herein, "apo(a) protein" refers to any protein encoding Apo(a). The term "protein sequence" refers to any protein sequence.

[0177] As used herein, an "apo(a)-specific inhibitor" refers to an apo(a) nucleic acid and / or It refers to any agent that can specifically inhibit the expression of apo(a) protein. (a) Specific inhibitors include those that inhibit the expression of apo(a) nucleic acid and / or apo(a) protein. Nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and and other agents. In certain embodiments, apo(a) nucleic acid expression and / or apo(a) (a) By specifically regulating protein expression, apo(a)-specific inhibitors This may affect other components of the lipid transport system, including the flow component. In vivo, apo(a)-specific inhibitors may affect other molecular processes in animals. do.

[0178] As used herein, the "optimal dose of a statin" refers to the amount of blood cholesterol l to Reduce Atherosclerotic Cardiovascular American College of Cardiology (ACH) Guidelines for the Treatment of Adults at Risk College of Cardiology (ACC) / American Heart Association Adapted from American Heart Association (AHA) guidelines (Stone, Neil J. et al., "2013 ACC / A HA Guideline on the Treatment of Blood C holesterol to Reduce Atherosclerotic Car diovascular Risk in Adults,A Report of t he American College of Cardiology / America a Heart Association Task Force on Practice ice Guidelines,”Circulation,June 24,2014 , see S1-S45).

[0179] As used herein, "atherosclerosis" refers to the condition affecting the large and medium-sized arteries. It refers to the hardening of the arteries and is characterized by the presence of fatty deposits. It is called "loam" or "plaque" and is made up of mainly cholesterol and other fats, calcium, and scar tissue. It is made up of scar tissue and damages the inner walls of the arteries.

[0180] As used herein, "coronary heart disease (CHD)" refers to the small arteries that supply blood and oxygen to the heart. It refers to the narrowing of blood vessels, which is often the result of atherosclerosis.

[0181] As used herein, "diabetes mellitus" or "diabetes" refers to a condition characterized by insufficient levels of insulin. or characterized by metabolic disorders and abnormally high blood sugar (hyperglycemia) due to decreased insulin sensitivity. It is a syndrome characterized by excessive urine production (polyuria) due to hyperglycemia, an increase in urine volume, and Excessive thirst and increased fluid intake (polydipsia) as compensation for the increased blood pressure, hypertension of the optics of the eye, Sugar-related blurred vision, unexplained weight loss and lethargy.

[0182] As used herein, "diabetic dyslipidemia" or "type 2 diabetes with dyslipidemia" means , type 2 diabetes, low HDL-C, elevated triglycerides (TG), and small, dense LDs It refers to a condition characterized by elevated L particles.

[0183] As used herein, a "diluent" is a substance that lacks pharmacological activity but is pharmaceutically necessary or It refers to the components in the desired composition. For example, the diluent in the composition to be injected may be, for example, It may be a liquid such as saline.

[0184] As used herein, "dyslipidemia" refers to an overproduction or over-production of lipids and / or lipoproteins. Dyslipidemia refers to disorders of lipid and / or lipoprotein metabolism, including deficiency. Lipids such as chylomicrons, cholesterol and triglycerides, and low-density lipoproteins It can be manifested by elevated lipoproteins such as low-density lipoprotein (LDL) cholesterol.

[0185] As used herein, a "dose" refers to a given amount of a substance provided in a single administration or within a specified period of time. In certain embodiments, a dose refers to one, two or more bottles of a pharmaceutical agent. For example, in certain embodiments, subcutaneous administration is desired. However, the desired dose may require an amount that cannot be easily accommodated in a single injection and therefore may require two or more injections. In certain embodiments, the pharmaceutical agent can be administered by prolonged or continuous administration. Doses are given in 100 mg of drug per hour, day, week, or month. Doses may also be described as mg / kg or g / kg.

[0186] As used herein, an "effective amount" or a "therapeutically effective amount" refers to an amount of a drug that is effective in an individual in need thereof. An effective amount means an amount of active pharmaceutical agent sufficient to achieve a desired physiological result through therapeutic administration. the health and physical condition of the individual to be treated, the taxonomic group of the individual to be treated, the composition formulation, the individual It may vary between individuals depending on the person's assessment of their condition and other relevant factors.

[0187] As used herein, "fully complementary" or "100% complementary" refers to a nucleic acid that is complementary to a first nucleic acid. Each nucleobase of the base sequence has a nucleobase complementary to a second nucleobase sequence of a second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound and the second The nucleic acid is a target nucleic acid.

[0188] As used herein, "glucose" refers to a substance that is supplied to cells as an energy source and an inflammatory intermediate. "Plasma glucose" refers to the glucose present in plasma. vinegar.

[0189] As used herein, "high density lipoprotein-C" or "HDL-C" refers to high density lipoprotein C (HDL-C). HDL- refers to cholesterol associated with lipoprotein particles. The concentration of serum HDL-C is typically quantified in mg / dL or nmol / L. "C" and "plasma HDL-C" refer to HDL-C in serum and plasma, respectively.

[0190] As used herein, "HMG-CoA reductase inhibitor" includes atorvastatin, rosiglitastatin, and the like. Vastatin, fluvastatin, lovastatin, pravastatin, and simvastatin It refers to agents that act through the inhibition of the enzyme HMG-CoA reductase.

[0191] As used herein, "hypercholesterolemia" refers to high cholesterol in adults. National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and Treatment cholesterol or circulating (plasma) cholesterol, LD It refers to a condition characterized by elevated L-cholesterol and VLDL-cholesterol ( See Arch. Int. Med. (1988) 148, 36-39).

[0192] As used herein, "hyperlipidemia" or "hyperlipidemia" Hyperlipemia is characterized by elevated serum or circulating (plasma) lipids. This condition manifests as an abnormally high concentration of fat. The lipid fraction in the circulating blood is: Cholesterol, low density lipoproteins, very low density lipoproteins, chylomicrons and The Fredrickson classification of hyperlipidemia is based on electrophoresis or ultracentrifugation. Patterns of TG- and cholesterol-rich lipoprotein particles measured by separation It is based on the idea that the primary causes of hyperlipidemia, such as hypertriglyceridemia, Commonly used (Fredrickson and Lee, Circulation ,1965,31:321-327;Fredrickson et al.,New Eng J Med, 1967, 276(1):34-42).

[0193] As used herein, "hypertriglyceridemia" refers to elevated triglyceride levels. Its etiology can be primary (genetic causes) or secondary (diabetes) , metabolic syndrome / insulin resistance, obesity, lack of exercise, smoking, excessive alcohol other underlying causes such as high blood pressure, high carbohydrate diet, etc. Both are combined (Yuan et al., CMAJ, 2007, 176:1 113-1120).

[0194] As used herein, "identifying an animal with a metabolic or cardiovascular disease" or "selecting an animal with a metabolic or cardiovascular disease" refers to "to be susceptible to or have a metabolic disease, cardiovascular disease, or metabolic syndrome" means Identifying or selecting subjects diagnosed with hypercholesterolemia, hyperglycemia, hyperlipidemia hypertriglyceridemia, hypertension, increased insulin resistance, decreased insulin sensitivity excess body weight and / or excess body fat content or any combination thereof. Any condition including, but not limited to, metabolic disorders, cardiovascular disease, or metabolic syndrome Such identification includes, but is not limited to, identifying or selecting a subject having a condition. Although not intended to be used for clinical purposes, measuring serum or circulating (plasma) cholesterol is Measuring circulating (plasma) glucose, measuring serum or circulating (plasma) triglycerides measuring blood pressure, measuring body fat content, measuring weight, etc. This may be accomplished by any method, including routine clinical testing or evaluation.

[0195] As used herein, "improved cardiovascular outcomes" refers to a reduction in the incidence of adverse cardiovascular events or their Examples of adverse cardiovascular events include, but are not limited to, death, These include reinfarction, stroke, cardiogenic shock, pulmonary edema, cardiac arrest, and atrial arrhythmias.

[0196] As used herein, "increasing HDL" or "elevating HDL" refers to the increase in HDL levels after administration of a compound. the HDL levels of animals after administration of at least one compound of the present invention compared to animals without the compound. This means that HDL levels will increase.

[0197] As used herein, an "individual," "patient," or "subject" refers to a person selected for treatment or therapy. It means the selected person.

[0198] As used herein, an "individual in need thereof" is an individual selected for treatment or therapy. It also refers to a human or non-human animal in need of such treatment or therapy.

[0199] As used herein, the terms "induce," "inhibit," "enhance," "elevate," "Increase," "decrease," "reduce," etc., indicate the quantitative difference between two states. For example, "an amount effective to inhibit the activity or expression of apo(a)" refers to the amount of apo(a) The level of apo(a) activity or expression in the sample is compared to that in the untreated sample. o(a) means that the level of activity or expression of o(a) is different from that of o(a). Such terms include, for example, It applies to the level of expression and the level of activity.

[0200] "Decrease," "reduce," "reduce," "diminish," or "inhibit" All of the terms are used herein to generally mean a statistically significant reduction. However, for the avoidance of doubt, the words "reduce", "reduce", "reduce" or "reduced" shall not be used. "Reduce" or "inhibit" means to reduce, e.g., by at least about 10% compared to a baseline level. or at least about 15%, or at least about 20%, or at least about 25% , or at least about 30%, or at least about 35%, or at least about 4 A decrease of at least 10% (i.e., baseline), such as 0%, or a decrease of at least about 50% (absent level compared to sample) or any decrease of 10-50% compared to the reference level means.

[0201] As used herein, an "inflammatory condition" refers to a disease, condition, syndrome, or other illness that results in inflammation. For example, rheumatoid arthritis and liver fibrosis are inflammatory conditions. Examples include sepsis, myocardial ischemia / reperfusion injury, adult respiratory distress syndrome, nephritis, and graft rejection. inflammatory bowel disease, multiple sclerosis, arteriosclerosis, atherosclerosis, and vasculitis. can be done.

[0202] As used herein, "inhibiting expression or activity" refers to inhibiting the expression or activity of an RNA or protein. refers to a reduction or blocking of activity and does not necessarily indicate complete elimination of expression or activity.

[0203] As used herein, "insulin resistance" refers to the inability of normal amounts of insulin to penetrate the body's fat, muscle, and blood vessels. and is defined as a condition in which there is insufficient blood to produce a normal insulin response from liver cells. Insulin resistance in adipocytes leads to the hydrolysis of stored triglycerides, Increases plasma free fatty acids. Muscle insulin resistance reduces glucose uptake. whereas hepatic insulin resistance reduces glucose storage, both of which have adverse effects on blood glucose levels. It plays a role in increasing blood sugar levels. It is a factor in preventing high blood sugar levels due to insulin resistance and high blood sugar levels. Low plasma levels often lead to metabolic syndrome and type 2 diabetes.

[0204] As used herein, "insulin sensitivity" refers to how effectively an individual uses glucose. Individuals with high insulin sensitivity are able to process glucose more efficiently. whereas individuals with low insulin sensitivity do not process glucose as effectively. do not have.

[0205] As used herein, "lipid-lowering" refers to the reduction of one or more lipids (e.g., L "Lipid elevation" refers to a decrease in lipids (e.g., HDL, VLDL) in a subject. Lipid lowering or lipid elevation may occur over time with one or more doses. Therefore, this can occur.

[0206] As used herein, "lipid-lowering therapy" or "lipid-lowering agent" refers to one or more It refers to a therapeutic regimen provided to a subject to reduce multiple lipids. In the subjects, apo(a), CETP, apoB, total cholesterol, LDL- C, VLDL-C, IDL-C, non-HDL-C, triglycerides, small dense LDL particles and Lp(a). Examples include, but are not limited to, apoB inhibitors, statins, fibrinogens, and steroids. These include acetaminophen and MTP inhibitors.

[0207] As used herein, "lipoproteins" such as VLDL, LDL, and HDL are those found in serum Lipid transport refers to a group of proteins found in plasma and lymph, which are important in lipid transport. The chemical composition of proteins differs; for example, HDL has a higher ratio of protein to lipids. VLDL, on the other hand, has a lower protein to lipid ratio.

[0208] As used herein, "Lp(a)" refers to apo(a) and apoB-containing LDL-like particles. Apo(a) is linked to apoB by a disulfide bond.

[0209] As used herein, "low-density lipoprotein-cholesterol (LDL-C)" refers to: It refers to cholesterol carried in low-density lipoprotein particles. The concentration of LDL-C in blood is typically quantified in mg / dL or nmol / L. "Serum LDL-C" and "plasma LDL-C" refer to LDL-C in serum and plasma, respectively. Taste.

[0210] As used herein, a "major risk factor" refers to a condition that puts a person at high risk for a particular disease or condition. In certain embodiments, major risk factors for coronary heart disease include: Without limitation, smoking, high blood pressure, high LDL, low HDL-C, family history of coronary heart disease, These include age and other factors disclosed herein.

[0211] As used herein, "metabolic disorder" or "metabolic disease" refers to a condition characterized by an alteration or impairment of metabolic function. "Metabolic" and "metabolism" are terms well known in the art and generally refer to conditions that are symptomatic of Metabolic disorders include the full range of biochemical processes occurring in the body. Although not recommended for use in patients with hyperglycemia, pre-diabetes, diabetes (type 1 and type 2), obesity, insulin resistance, These include dyslipidemia due to phosphorus resistance, metabolic syndrome, and type 2 diabetes.

[0212] As used herein, "metabolic syndrome" refers to a combination of lipid and non-lipid cardiovascular risk factors of metabolic origin. In certain embodiments, metabolic syndrome refers to a condition characterized by a clustering of: It is identified by the presence of any three of the following factors: >102 cm in men or >8 cm in women Waist circumference greater than 8 cm; serum triglycerides at least 150 mg / dL; 40 mg for men HDL-C less than 130 / 85 mm and a fasting blood glucose level of at least 110 mg / dL. These determinants are clinically It can be easily measured in clinical practice (JAMA, 2001, 285:2486-2497).

[0213] "Parenteral administration" means administration by injection or infusion. Parenteral administration includes subcutaneous administration. administered intravenously, intramuscularly, intraarterially, intraperitoneally or intrathecally, e.g., intravenously or intraventricularly Administration may be continuous, chronic, short-term, or intermittent. It is possible.

[0214] As used herein, a "pharmaceutical product" is a compound that provides a therapeutic benefit when administered to an individual. For example, in certain embodiments, an antisense oligonucleotide that targets apo(a) is used. The ance oligonucleotide is a pharmaceutical agent.

[0215] As used herein, a "pharmaceutical composition" or "composition" refers to a substance suitable for administration to an individual. For example, a pharmaceutical composition refers to a mixture of one or more active agents and, for example, sterile water. and a pharmaceutical carrier such as a solution.

[0216] As used herein, "pharmaceutically acceptable derivatives" includes solvates, hydrates, esters, and derivatives thereof. esters, prodrugs, polymorphs, isomers, isotopically labeled variants, pharmaceutically acceptable salts and other derivatives known in the art.

[0217] As used herein, "pharmaceutically acceptable salts" refers to salts that are physiologically and and pharmaceutically acceptable salts, i.e., salts which retain the desired biological activity of the parent compound and do not "Pharmaceutically acceptable salt" or "salt" means a salt that does not have any undesirable toxicological effects. The term includes pharmaceutically acceptable non-toxic compounds, including inorganic or organic acids and bases. The term "pharmaceutically acceptable salts" as used herein includes salts prepared from acids or bases of the compounds described herein. "Pharmaceutically acceptable salts" can be prepared by methods well known in the art. For a view, see Stahl and Wermuth, Handbook of P harmaceutical salts:Properties,Selection and Use(Wiley-VCH, Weinheim, Germany, 2002 ). Sodium salts of antisense oligonucleotides are useful and Thus, in one embodiment, the compounds described herein are The compounds described are in the form of sodium salts.

[0218] As used herein, a "portion" refers to a defined number of contiguous (i.e., linked) sequences of a nucleic acid. In certain embodiments, a portion refers to a defined number of consecutive nucleobases of a target nucleic acid. In certain embodiments, the moiety is a nucleobase that is a defined number of nucleotides in the antisense compound. It is a sequence of nucleic acid bases.

[0219] As used herein, "prevent" or "preventing" refers to an action that lasts from a few minutes to an indefinite period. Delaying or preventing the onset or occurrence of a disease, disorder or condition for a period of time Prevent also means reducing the risk of developing a disease, disorder or condition. do.

[0220] As used herein, "elevate" means to increase the amount. For example, blood Increasing plasma HDL levels means increasing the amount of HDL in the plasma.

[0221] As used herein, "reduce" means to reduce to a smaller degree, size, amount, or number. For example, reducing plasma triglyceride levels means This means reducing the amount of triglycerides.

[0222] As used herein, a "region" or "target region" refers to a region having at least one identifiable structure. A target region is defined as a portion of a target nucleic acid that has a function or property. For example, a target region can be a 3' U TR, 5'UTR, exon, intron, exon / intron junction, coding region, It may include a translation initiation region, a translation termination region, or other defined nucleic acid region. Structurally defined regions are obtained by accession number from sequence databases such as NCBI. and such information is incorporated herein by reference. In other words, a target region is a region extending from the 5' target site of one target segment within the target region to the 5' target site of another target segment within the target region. The target segment may include the sequence up to the 3' target site of the target segment.

[0223] As used herein, a "second agent" or "second therapeutic agent" refers to a drug in combination with a "first agent." The second therapeutic agent refers to a drug that can be used in combination with the first therapeutic agent. However, antisense oligonucleotides targeting apo(a) or apoB are included. The second agent may be an anti-apo(a) antibody, an apo(a) peptide inhibitor, or a cholesterol inhibitor. These may also include hypocalcemia, hypolipidemic, hypoglycemic and anti-inflammatory agents.

[0224] As used herein, a "segment" is defined as a smaller subportion of a region within a nucleic acid. For example, a "target segment" may be a segment to which one or more antisense molecules are directed. "5' target site" means the sequence of nucleotides of a target nucleic acid to which a compound is targeted. The "3' target site" refers to the 5' terminal nucleotide of a target segment. Alternatively, the "start site" refers to the 5'-end nucleotide of the target segment. A "stop site" may refer to the 3'-terminal nucleotide of a target segment. A target segment begins at the "start site" of one sequence and ends at the "stop site" of another sequence. " may end with

[0225] As used herein, a "statin" refers to a drug that inhibits the activity of HMG-CoA reductase. means.

[0226] As used herein, "subcutaneous administration" means administration just below the skin.

[0227] As used herein, "subject" means a human selected for treatment or therapy. .

[0228] As used herein, a "symptom of a cardiovascular disease or disorder" refers to a condition resulting from a cardiovascular disease or disorder. , and the phenomena accompanying it and serving as indicators of it. For example, angina; chest pain; Sharpness; palpitations; weakness; dizziness; nausea; sweating; tachycardia; bradycardia; arrhythmia; atrial fibrillation; swelling of the legs; Anosis; fatigue; fainting; facial numbness; numbness in the limbs; muscle claudication or cramps; abdominal distension or fever are symptoms of cardiovascular disease or disorders.

[0229] As used herein, "target" or "targeted" refers to a molecule that specifically interacts with a target nucleic acid. The process of designing and selecting antisense compounds that hybridize to induce a desired effect. It means s.

[0230] As used herein, a "therapeutically effective amount" refers to the amount of a pharmaceutical agent that provides a therapeutic benefit to an individual. means.

[0231] As used herein, "therapeutic lifestyle changes" refers to the reduction of fat / adipose tissue mass and / or cholesterol. This refers to dietary and lifestyle changes aimed at lowering sterol levels. These changes may reduce the risk of developing heart disease and include changes in total daily calories, total fat, saturated fat, and polyunsaturated fat. Unsaturated fat, monounsaturated fat, carbohydrates, protein, cholesterol, insoluble dietary fiber Recommendations such as dietary intake and physical activity may be included.

[0232] As used herein, "treat" or "treating" refers to the modification of a disease, disorder, or condition. "Aging" refers to administering a compound described herein to produce a reduction or improvement in a patient's condition.

[0233] As used herein, "prevent" or "preventing" refers to the prevention of a disease, It refers to inhibiting or delaying one or more symptoms of a disorder or condition. In certain embodiments, administration of ISIS 681257 to a subject is to treat one or more cardiovascular disorders. For example, administration of ISIS 681257 to a subject may prevent a number of symptoms associated with cardiovascular disorders. inhibit or delay one or more symptoms of the disease.

[0234] As used herein, a "triglyceride" or "TG" refers to a compound consisting of three fatty acid molecules. It refers to lipids or neutral fats consisting of glycerol bound to carbohydrates.

[0235] As used herein, "type 2 diabetes" ("type 2 diabetes mellitus," "diabetes mellitus, type 2," "Non-insulin dependent diabetes mellitus," "NIDDM," "obesity-related diabetes mellitus," or "adult-onset diabetes mellitus" Diabetes mellitus (also known as "diabetes") is primarily caused by insulin resistance, relative insulin deficiency, and It is a metabolic disorder characterized by high blood sugar and hyperglycemia.

[0236] Chemical Nomenclature, Terminology and Conventions Unless otherwise specified, in all formulas and groups, conventional definitions of terms prevail. Conventional stable valences are presumed and achieved.

[0237] The articles "a" and "an" are used in this disclosure to describe the grammatical purpose of the articles. It is used to refer to one or more (e.g., at least one) of a word. The term "element" means one element or more than one element.

[0238] Unless otherwise stated, the term "and / or" is used in this disclosure to mean either "and" or " It is used to mean either "or."

[0239] Specific Embodiments Various embodiments of the present invention are described herein. The specified features of each embodiment are: Other specified features of other embodiments may be combined to provide further embodiments. It will be recognized that.

[0240] In a first aspect, the present disclosure provides a method for predicting cardiovascular events in patients with established cardiovascular disease. A method for reducing the risk of steroid use, in which approximately 75 mg to approximately 85 mg is administered by subcutaneous injection once a month. The method includes administering to a patient a unit dose containing 100 mg of the compound ISIS 681257 or a salt thereof. and the patient had a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of the compound. To do, to relate to a method.

[0241] In some embodiments, cardiovascular events include major adverse cardiovascular events (MACE), all-cause mortality, Deaths (all causes), coronary heart disease (CHD) deaths, acute myocardial infarction (AMI) deaths , heart failure (HF) death, death due to immediate complications of cardiac surgery, and emergency lower limb circulation for ischemia. The choice is between reconstruction or amputation.

[0242] In some embodiments, a major adverse cardiovascular event (MACE) is defined as a cardiovascular (CV) death, non-CV Selected from fatal myocardial infarction, non-fatal stroke, and emergency coronary revascularization requiring hospitalization In another embodiment, the major adverse cardiovascular event (MACE) is cardiovascular (CV) death. In yet another embodiment, the major adverse cardiovascular event (MACE) is a non-fatal myocardial infarction. In another embodiment, the major adverse cardiovascular event (MACE) is a non-fatal stroke. In another embodiment, a major adverse cardiovascular event (MACE) is an emergency coronary revascularization event requiring hospitalization. It is a construction technique.

[0243] In some embodiments, cardiovascular events include all-cause mortality (death from any cause), coronary heart disease, and stroke. Cardiovascular disease (CHD) deaths, acute myocardial infarction (AMI) deaths, heart failure (HF) deaths, and immediate cardiac surgery deaths The options are death due to complications at the time of surgery and emergency lower limb revascularization or amputation due to ischemia.

[0244] In one embodiment, the cardiovascular event is all-cause mortality (death from any cause).

[0245] In another embodiment, the cardiovascular event is coronary heart disease (CHD) death. Coronary heart disease (CHD) deaths are classified as acute myocardial infarction (AMI) deaths, heart failure (HF) deaths, and cardiac deaths. Includes deaths resulting from immediate complications of surgery.

[0246] In another embodiment, the cardiovascular event is emergency lower limb revascularization or amputation due to ischemia.

[0247] In some embodiments, patients with established cardiovascular disease are those with (i) cryptogenic myocardial infarction (ii) history of ischemic stroke, and (iii) clinically significant symptomatic peripheral arterial The patient has at least one of the following diseases:

[0248] In one embodiment, the history of cryptogenic myocardial infarction is greater than or equal to 3 months and greater than or equal to 10 months at the time of first administration of the compound. It occurred less than a year ago.

[0249] In one embodiment, the history of ischemic stroke is greater than or equal to 3 months and greater than or equal to 10 years at the time of first administration of the compound. The following has occurred before:

[0250] In one embodiment, the history of ischemic stroke is a focal brain injury resulting from an infarction of central nervous system tissue. , acute episodes of spinal cord or retinal dysfunction.

[0251] In one embodiment, clinically significant symptomatic peripheral arterial disease is defined as (i) an above-ankle sigma index of 0.90 or less. and (ii) at least one of lower limb amputation or revascularization for lower limb ischemia. This is evidenced by intermittent claudication.

[0252] In some embodiments, the patient has a plasma concentration of 90 mg / dL or greater prior to the first dose of the compound. Lp(a) concentration.

[0253] In some embodiments, the compound is formulated in a sterile liquid, and each unit dose of the compound contains 1 Contains no more than mL of sterile liquid.

[0254] In one embodiment, each unit dose of the compound contains no more than 0.8 mL of sterile liquid. In this embodiment, each unit dose of the compound contains no more than 0.5 mL of sterile liquid. In another embodiment, each unit dose of the compound does not contain more than 0.4 mL of sterile liquid. In another embodiment, each unit dose of the compound contains no more than 0.25 mL of sterile liquid. In yet another embodiment, each unit dose of the compound contains no more than 0.2 mL of sterile liquid. stomach.

[0255] In one embodiment, the sterile liquid is water. In another embodiment, the sterile liquid is sodium phosphate. In yet another embodiment, the sterile liquid is water containing sodium phosphate buffer. It is water containing a buffer solution and sodium chloride.

[0256] In some embodiments, the mean / median plasma Lp(a) concentration of the patients is measured at the beginning and end of the administration period. When the patient's plasma Lp(a) concentration is measured at the end of the study, it is reduced by at least 50%. In another embodiment, the mean / median plasma Lp(a) concentration of the patients is measured at the beginning and end of the administration period. At the end of the treatment, the patient's plasma Lp(a) concentration is measured and is reduced by at least 60%. In yet another embodiment, the mean / median plasma Lp(a) concentration of the patients is measured at the start of the administration period and At the end of the study, the patient's plasma Lp(a) concentration is measured and reduced by at least 70%. In another embodiment, the mean / median plasma Lp(a) concentrations of the patients are measured at the beginning and end of the administration period. Sometimes the patient's plasma Lp(a) concentration, when measured, is reduced by at least 75%.

[0257] In some embodiments, the mean / median plasma Lp(a) concentration of the patients is greater than or equal to the mean / median plasma Lp(a) concentration at the start of the administration period. When the patient's plasma Lp(a) concentration was measured at the end of the study, approximately 30%, approximately 35%, and approximately 40% %, approx. 45%, approx. 50%, approx. 55%, approx. 60%, approx. 65%, approx. 70%, approx. 75%, approx. 80 %, about 85% or about 90%.

[0258] In some embodiments, the mean / median plasma Lp(a) concentration of the patients is measured at the beginning and end of the administration period. At least about 40% to about 50% of patients' plasma Lp(a) concentrations are measured at the end of the study. In another embodiment, the mean / median plasma Lp(a) concentration in the patients is reduced by 0.05% over the course of the administration period. When the patient's plasma Lp(a) concentration is measured at the start and end of the study, In another embodiment, the mean / median plasma Lp(a) concentration in patients is reduced by about 55%. When the patient's plasma Lp(a) concentration is measured at the beginning and end of the administration period, it is at least about In yet another embodiment, the mean / median plasma Lp of the patient is reduced by between 50% and about 60%. (a) Concentration is measured when the patient's plasma Lp(a) concentration is measured at the beginning and end of the treatment period. In yet another embodiment, the average patient Median plasma Lp(a) concentration is the plasma Lp(a) concentration of a patient at the beginning and end of the treatment period. In another embodiment, the patient's blood pressure is reduced by at least about 60% to about 70% when measured. The mean / median plasma Lp(a) concentrations of patients were determined at the beginning and end of the treatment period. ) concentration is measured, is reduced by at least about 65% to about 75%. In the study, the mean / median plasma Lp(a) concentration of patients was measured at the beginning and end of the treatment period. When Lp(a) concentrations are measured, they are reduced by at least about 70% to about 85%.

[0259] In some embodiments, the overall incidence of patients experiencing major adverse cardiovascular events (MACE) is The risk was statistically significant at the end of the treatment period compared with patients who did not receive the compound. is reduced by a certain amount.

[0260] In other embodiments, the following events: (i) cardiovascular (CV) death, non-fatal MI, and non-fatal MI. (ii) a composite of stroke; (iii) coronary heart disease (CHD) death, non-fatal MI, and emergencies requiring hospitalization. (iii) a composite of coronary heart disease (CHD) death, non-fatal MI, and hospitalization A combination of emergency coronary revascularization and emergency lower limb revascularization or amputation for ischemia; and (iv) The overall risk of a patient experiencing one of the proportions of all-cause mortality is is reduced by a statistically significant amount at the end of the treatment period compared to patients who did not receive the treatment.

[0261] In one embodiment thereof, the following events: cardiovascular (CV) death, non-fatal MI, and non-fatal stroke. The overall risk of patients experiencing a compound in the , is reduced by a statistically significant amount at the end of the administration period.

[0262] In one embodiment thereof, the following events: coronary heart disease (CHD) death, non-fatal MI and hospitalization. The overall risk of a patient experiencing a combined emergency coronary revascularization procedure requiring a compound is reduced by a statistically significant amount at the end of the treatment period compared to patients who did not receive the treatment.

[0263] In one embodiment thereof, the following events are considered: coronary heart disease (CHD) death, non-fatal MI, hospitalization. The patient underwent a combination of emergency coronary revascularization and emergency lower limb revascularization or amputation due to ischemia. The overall risk for patients with steroid use was significantly higher at the end of the treatment period compared with patients who did not receive the compound. At the end of the experiment, the results are reduced by a statistically significant amount.

[0264] In one embodiment thereof, the overall risk of a patient experiencing the following events: all-cause mortality rate was statistically significant at the end of the treatment period compared with patients who did not receive the compound. This reduces the

[0265] In other embodiments, the following events: (i) all-cause mortality, non-fatal MI, and non-fatal stroke (ii) all vascular events: CV death, non-fatal MI, non-fatal stroke, emergency medical attention requiring hospitalization (iii) a composite of acute coronary revascularization and urgent lower limb revascularization or amputation for ischemia; Composite of cause of death, non-fatal MI, non-fatal stroke, and emergency coronary revascularization requiring hospitalization (iv) a composite of fatal and non-fatal stroke; (v) a history of peripheral arterial disease (PAD). (vi) the rate of major adverse limb events (MALE) in patients with unstable angina (vii) the overall risk of patients experiencing one of the following events for hospitalization due to heart failure: The patients had a statistically significant improvement at the end of the treatment period compared with patients who did not receive the compound. The patient will have a plasma Lp(a) of 90 mg / dL or greater before the first dose of the compound. It has a concentration.

[0266] In one embodiment thereof, the combination of the following events: all-cause mortality, non-fatal MI, and non-fatal stroke. experience any of the following symptoms: have a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose of the compound; The overall risk for patients receiving the compound was significantly higher at the end of the treatment period compared with patients who did not receive the compound. Sometimes the reduction is statistically significant.

[0267] In one embodiment thereof, the following events: all vascular events: CV death, non-fatal MI, non-fatal stroke Emergency coronary revascularization requiring hospitalization and emergency lower limb revascularization or amputation due to ischemia Patients who experience the compound and have a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose of the compound The overall risk for patients with steroid use was significantly higher at the end of the treatment period compared with patients who did not receive the compound. At the end of the experiment, the results are reduced by a statistically significant amount.

[0268] In one embodiment thereof, the following events are prevented: all-cause mortality, non-fatal MI, non-fatal stroke, and inpatient admission. The patient had undergone emergency coronary revascularization requiring hospitalization. The patient received 90 mg / kg of the compound before the first dose. The overall risk for patients with plasma Lp(a) concentrations of ≥ 1000 dL was significantly higher than for those not receiving the compound. The risk of developing rheumatoid arthritis is reduced by a statistically significant amount at the end of the treatment period compared to patients who received rheumatoid arthritis.

[0269] In one embodiment thereof, the compound is a compound that experiences the following events: a combination of fatal and non-fatal stroke. The overall risk of patients with plasma Lp(a) concentrations of 90 mg / dL or higher before the first dose of the drug was The patients had a statistically significant improvement at the end of the treatment period compared with patients who did not receive the compound. The amount is reduced.

[0270] In one embodiment thereof, the following events: in patients with a history of peripheral arterial disease (PAD) The rate of major adverse limb events (MALEs) experienced by patients receiving 90 mg / day of the compound before the first dose was The overall risk for patients with plasma Lp(a) concentrations of ≥ 1000 dL was significantly higher than for those not receiving the compound. The risk of developing rheumatoid arthritis is reduced by a statistically significant amount at the end of the treatment period compared to patients who received rheumatoid arthritis.

[0271] In one embodiment thereof, the compound experiences the following events: hospitalization rate for unstable angina Overall risk in patients with plasma Lp(a) concentrations of 90 mg / dL or higher before the first dose was statistically significant at the end of the treatment period compared with patients who did not receive the compound. This reduces the

[0272] In one embodiment thereof, the first dose of the compound experiencing the following events: hospitalization rate for heart failure; The overall risk for patients with pre-administration plasma Lp(a) concentrations of 90 mg / dL or higher was A statistically significant reduction at the end of the treatment period compared to patients who did not receive the compound will be done.

[0273] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In another embodiment, at least 15% of any one of the events The relative risk reduction of (i) plasma Lp( a) For patients with a concentration of at least 15%, preferably at least 20%, (ii) a blood serum concentration of 90 mg / dL or greater prior to the first dose of the compound; For patients with plasma Lp(a) concentrations of at least 20%, preferably at least 25% %, more preferably at least 30%.

[0274] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is About 10%, about 15%, about 20%, about 25%, about 30%, about 35%, or about 40% %.

[0275] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In another embodiment, the compound is administered at a dose of about 7 to about 20% of the total amount of the compound. For patients with plasma Lp(a) concentrations of ≥ 0 mg / dL, The relative risk reduction for each event is approximately 15% to 25%. In some embodiments, the patient has a plasma Lp(a) concentration of 70 mg / dL or greater prior to the first administration of the compound. For patients with steroid use, the relative risk reduction for any one event is approximately 20% to 30%. In another embodiment, the plasma Lp is 70 mg / dL or greater before the first dose of the compound. (a) For patients with a concentration, the relative risk reduction for any one event is In another embodiment, the concentration is about 25% to about 35%. For patients with plasma Lp(a) concentrations of ≥ 100 mg / kg, the relative risk of any one event was The reduction rate of the scratches is about 30% to about 40%.

[0276] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In another embodiment, the compound is administered at a dose of about 7 to about 15% of the total amount of the compound. For patients with plasma Lp(a) concentrations of ≥ 0 mg / dL, The relative risk reduction rate for each event is approximately 15% to 20%. In some embodiments, the patient has a plasma Lp(a) concentration of 70 mg / dL or greater prior to the first administration of the compound. For patients with steroid use, the relative risk reduction for any one event is approximately 20% to 20%. In another embodiment, the plasma Lp is 70 mg / dL or greater before the first dose of the compound. (a) For patients with a concentration, the relative risk reduction for any one event is In another embodiment, the concentration is about 25% to about 30%. For patients with plasma Lp(a) concentrations of ≥ 100 mg / kg, the relative risk of any one event was In another embodiment, the risk reduction rate is about 30% to about 35%. For patients with plasma Lp(a) concentrations of 70 mg / dL or higher, any one event The relative risk reduction rate for this is approximately 35% to 40%.

[0277] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In another embodiment, the compound is administered at a dose of 70 mg / d before the first dose. For patients with plasma Lp(a) concentrations of ≥ 1, the relative risk of any one event The risk reduction is about 15% for any one of the events. For patients with a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of the drug, The relative risk reduction for any one event is approximately 20% for any one event. In another embodiment, the plasma Lp(a) is 70 mg / dL or greater before the first dose of the compound. For patients with α-glucose serotonin (GSS) concentrations, the relative risk reduction for any one event is approximately 2. In another embodiment, the plasma Lp is 70 mg / dL or greater before the first dose of the compound. (a) For patients with a concentration, the relative risk reduction for any one event is In another embodiment, the plasma concentration is 70 mg / dL or greater prior to the first dose of the compound. Relative risk reduction for any one event for patients with Lp(a) levels is approximately 35% for any one of the events.

[0278] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In another embodiment, the compound is administered at least 7 times prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of ≥ 0 mg / dL, The relative risk reduction for each event is at least about 15% for any one of the events. In some embodiments, the patient has a plasma Lp(a) concentration of 70 mg / dL or greater prior to the first administration of the compound. For patients with steroid use, the relative risk reduction for any one event is In another embodiment, the compound is administered at least 7 days prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of ≥ 0 mg / dL, In another embodiment, the relative risk reduction for the initial administration of the compound is at least about 25%. For patients with a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose, The relative risk reduction for one event is at least about 30%. The study was conducted on patients with a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of the compound. In this case, the relative risk reduction for any one event is at least about 35%.

[0279] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In another embodiment, the compound is administered at least 70% of the time before the first administration of the compound. For patients with plasma Lp(a) concentrations of ≥ 100 mg / dL, The relative risk reduction for any one of the events is at least 15%. In some embodiments, the patient has a plasma Lp(a) concentration of 70 mg / dL or greater prior to the first administration of the compound. For a patient, the relative risk reduction for any one event is In another embodiment, the compound is administered at 70 mg prior to the first dose. For patients with plasma Lp(a) concentrations of ≥ 1 / dL, The relative risk reduction is at least 25%. In another embodiment, the first dose of the compound For patients with a previous plasma Lp(a) concentration of 70 mg / dL or higher, one of the following The relative risk reduction for elephants is at least 30%. For patients with a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of The relative risk reduction for any one event is at least 35%.

[0280] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rates are approximately 10%, 15%, 20%, 25%, and 30% for any one of the events. %, about 35% or about 40%.

[0281] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In yet another embodiment, the compound is administered at a dose of about 10 to about 20% of the total amount of the compound. For patients with plasma Lp(a) concentrations of 90 mg / dL or higher, the relative risk reduction ( The statistically significant relative amount by which the overall risk is reduced is approximately 15 to 25%. In another embodiment, the plasma Lp(a) concentration is 90 mg / dL or greater before the first dose of the compound. For patients with a high risk of In yet another embodiment, the initial amount of the compound (a relative amount that is practically significant) is about 20 to about 30%. The relative risk was assessed for patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose. The risk reduction (i.e., the statistically significant relative amount by which the overall risk is reduced) ranges from about 25 to about In another embodiment, the plasma L concentration is 90 mg / dL or greater before the first dose of the compound. For patients with p(a) concentrations, the relative risk reduction (i.e., overall risk reduction) The statistically significant relative amount (amount that is statistically significant) is about 30 to about 40%.

[0282] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In yet another embodiment, the compound is administered at a dose of about 10 to about 15% of the total amount of the compound. For patients with plasma Lp(a) concentrations of 90 mg / dL or higher, the relative risk reduction ( The statistically significant relative amount by which the overall risk is reduced is approximately 15 to 20%. In another embodiment, the plasma Lp(a) concentration is 90 mg / dL or greater before the first dose of the compound. For patients with a high risk of In yet another embodiment, the initial amount of the compound (a relative amount that is practically significant) is about 20 to about 25%. The relative risk was assessed for patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose. The risk reduction (i.e., the statistically significant relative amount by which the overall risk is reduced) ranges from about 25 to about In another embodiment, the plasma L concentration is 90 mg / dL or greater before the first dose of the compound. For patients with p(a) concentrations, the relative risk reduction (i.e., overall risk reduction) In another embodiment, the relative amount of the compound (a statistically significant amount) is about 30 to about 35%. For patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose of The risk reduction factor (i.e., the statistically significant relative amount by which the overall risk is reduced) is approximately 35 ~About 40%.

[0283] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In yet another embodiment, the compound is administered 90 minutes prior to the first administration. For patients with plasma Lp(a) concentrations of ≥ 1000 mg / dL, the relative risk reduction (i.e. The overall risk reduction (a statistically significant relative amount) is about 20%. In this study, patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose of the compound were The relative risk reduction (i.e., the statistically significant relative amount by which the overall risk is reduced) In yet another embodiment, the dose is 90 mg / d before the first dose of the compound. For patients with plasma Lp(a) concentrations of ≥ 1, the relative risk reduction (i.e., overall In another embodiment, the statistically significant relative amount by which the risk is reduced is about 30%. Patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose of the compound , the relative risk reduction (i.e., the statistically significant relative amount by which the overall risk is reduced) is It is about 35%.

[0284] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In yet another embodiment, at least about 15% of the compound is administered Relative risk reduction for patients with a prior plasma Lp(a) concentration of 90 mg / dL or higher (i.e., a statistically significant relative amount by which the overall risk is reduced) is at least about 20% In another embodiment, the plasma Lp(a) is 90 mg / dL or greater before the first administration of the compound. ) concentrations, the relative risk reduction (i.e., the overall risk reduction) In yet another embodiment, the relative amount (statistically significant) is at least about 25%. Patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose of the drug were The relative risk reduction (i.e., the statistically significant relative amount by which the overall risk is reduced) is small. In another embodiment, the concentration of the compound is at least about 90 mg / dL or higher before the first dose of the compound. The relative risk reduction (i.e., overall risk) for patients with a plasma Lp(a) concentration of The statistically significant relative amount by which the marker is reduced is at least about 35%.

[0285] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound The relative risk was lower for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rate (i.e., the statistically significant relative amount by which the overall risk is reduced) is In yet another embodiment, the compound is administered at least 15% of the time before the first administration of the compound. For patients with plasma Lp(a) concentrations of 90 mg / dL or higher, the relative risk reduction ( The statistically significant relative amount by which the overall risk is reduced is at least 20%. In another embodiment, the plasma Lp(a) concentration is 90 mg / dL or greater before the first dose of the compound. For patients with a high risk of In yet another embodiment, the initial amount of the compound (a relative amount that is meaningfully significant) is at least 25%. The relative risk was assessed for patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose. The risk reduction (i.e., the statistically significant relative amount by which the overall risk is reduced) is at least In another embodiment, the plasma L concentration is 90 mg / dL or greater before the first dose of the compound. For patients with p(a) concentrations, the relative risk reduction (i.e., overall risk reduction) The statistically significant relative amount (as measured by the quantification) is at least 35%.

[0286] In one embodiment of any one of the above embodiments relating to a risk reduction rate, any of the events Absolute risk reduction (i.e., statistically significant reduction in overall risk) for one (absolute dose) is defined as (i) a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of the compound; (ii) at least 2.0%, preferably at least 2.5% of patients with For patients with a plasma Lp(a) concentration of 90 mg / dL or higher before the first dose of the compound, It is at least 3.0%, preferably at least 3.5%.

[0287] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is Approximately 1.5%, approximately 1.8%, approximately 2.0%, approximately 2.2%, approximately 2.5%, approximately 2.8% %, approximately 3.0%, approximately 3.2%, approximately 3.5%, approximately 3.8%, approximately 4.0%, approximately 4.2%, approximately 4 0.5%, about 4.8% or about 5.0%.

[0288] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is At least about 1.5%, about 1.8%, about 2.0%, about 2.2%, about 2.5% for one ,approximately 2.8%,approximately 3.0%,approximately 3.2%,approximately 3.5%,approximately 3.8%,approximately 4.0%,approximately 4. 2%, about 4.5%, about 4.8% or about 5.0%.

[0289] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In another embodiment, the compound is administered at a dose of about 1.5% to about 2.5% of the total amount of the compound. For patients with plasma Lp(a) concentrations of 70 mg / dL or higher, the absolute risk reduction ( The statistically significant absolute amount by which the overall risk is reduced is In yet another embodiment, the concentration is about 2.0% to about 3.0% before the first administration of the compound. For patients with plasma Lp(a) concentrations of 70 mg / dL or higher, the absolute risk reduction ( The statistically significant absolute amount by which the overall risk is reduced is In another embodiment, the compound is administered in an amount of about 70 to about 300 mg / kg of water prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of ≥ 100 mg / dL, the absolute risk reduction (i.e., The statistically significant absolute amount by which the overall risk is reduced is In another embodiment, the compound is administered at a dose of 70 mg / mL prior to the first administration. For patients with plasma Lp(a) concentrations of ≥ 1000 dL, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is approximately 3. In yet another embodiment, the compound is administered at a dose of 70 mg / mL prior to the first dose. For patients with plasma Lp(a) concentrations of ≥ 1000 dL, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is approximately 4. 0% to approximately 5.0%.

[0290] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In another embodiment, the compound is administered at a dose of about 1.5% to about 2.0% prior to the first administration. For patients with plasma Lp(a) concentrations of 70 mg / dL or higher, the absolute risk reduction ( The statistically significant absolute amount by which the overall risk is reduced is In yet another embodiment, the concentration is about 2.0% to about 2.5% before the first administration of the compound. For patients with plasma Lp(a) concentrations of 70 mg / dL or higher, the absolute risk reduction ( The statistically significant absolute amount by which the overall risk is reduced is In another embodiment, the compound is administered in an amount of about 70 to about 3.0% of the total amount of the compound. For patients with plasma Lp(a) concentrations of ≥ 100 mg / dL, the absolute risk reduction (i.e., The statistically significant absolute amount by which the overall risk is reduced is In another embodiment, the compound is administered at a dose of 70 mg / kg or more prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of ≥ 1000 dL, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is approximately 3. In yet another embodiment, the compound is administered at a dose of 70 mg / mL prior to the first administration. For patients with plasma Lp(a) concentrations of ≥ 1000 dL, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is approximately 4. In another embodiment, the concentration is 70 mg / dL or more prior to the first administration of the compound. For patients with plasma Lp(a) concentrations above 100, the absolute risk reduction (i.e., overall risk) The statistically significant absolute amount of risk reduction is approximately 4.5% to 1.5% for any one of the events. It is approximately 5.0%.

[0291] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In another embodiment, the compound is administered at a dose of 70 mg / mL prior to the first dose. For patients with plasma Lp(a) concentrations of ≥ 1000 dL, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is approximately 2. In yet another embodiment, the patient has a blood glucose level of 70 mg / dL or greater prior to the first dose of the compound. For patients with plasma Lp(a) concentrations, the absolute risk reduction (i.e., overall risk) The statistically significant absolute amount of reduction is approximately 2.5% for any one of the events. In another embodiment, a plasma Lp(a) concentration of 70 mg / dL or greater prior to the first dose of the compound is For patients with HIV, the absolute risk reduction (i.e., the statistically significant reduction in overall risk) In another embodiment, the significant absolute amount is about 3.0% for any one of the events. Patients with a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of the compound , the absolute risk reduction (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In yet another embodiment, the initial Absolute risk for patients with a plasma Lp(a) concentration of 70 mg / dL or higher before administration The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is The rate is about 4.5% per one.

[0292] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In another embodiment, the compound is administered at least about 1.8% of the time before the first administration of the compound. For patients with plasma Lp(a) concentrations of 70 mg / dL or higher, the absolute risk reduction ( The statistically significant absolute amount by which the overall risk is reduced is In yet another embodiment, the compound is administered at least 7 days prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of 0 mg / dL or higher, the absolute risk reduction (i.e., The statistically significant absolute amount by which the overall risk is reduced is In another embodiment, the compound is administered at a dose of 70 mg / mL prior to the first dose. For patients with plasma Lp(a) concentrations of ≥ 1000 dL, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is In another embodiment, the concentration is 70 mg / dL or higher before the first dose of the compound. Absolute risk reduction (i.e., overall risk) for patients with plasma Lp(a) concentrations of The statistically significant absolute amount by which the risk is reduced is at least about 3% for any one of the events. In yet another embodiment, the blood glucose level is 70 mg / dL or higher prior to the first dose of the compound. For patients with plasma Lp(a) concentrations, the absolute risk reduction (i.e., overall risk The absolute amount by which the reduction is statistically significant is at least about 4 for any one of the events. It is 5%.

[0293] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 70 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In another embodiment, the compound is administered at least 7 days prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of 0 mg / dL or higher, the absolute risk reduction (i.e., The statistically significant absolute amount by which the overall risk is reduced is In yet another embodiment, the compound is administered at least 70 minutes prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of ≥ 1000 mg / dL, the absolute risk reduction (i.e. The absolute amount by which the overall risk is reduced (a statistically significant amount) is In another embodiment, the concentration is at least 70 mg / dL prior to the first dose of the compound. For patients with plasma Lp(a) concentrations above 100, the absolute risk reduction (i.e., overall risk) The statistically significant absolute amount of risk reduction is at least 3% for any one of the events. In another embodiment, the plasma L concentration is 70 mg / dL or greater prior to the first dose of the compound. For patients with p(a) concentrations, the absolute risk reduction (i.e., overall risk reduction) The absolute amount of statistical significance (absolute amount of statistical significance) must be at least 3.5% for any one of the events. In yet another embodiment, the patient has a plasma Lp( a) Absolute risk reduction (i.e., overall risk reduction) for patients with The absolute statistically significant difference (absolute difference) is at least 4.5% for any one of the events.

[0294] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In yet another embodiment, the initial administration of the compound is at least about 2.8%. Absolute risk reduction for patients with pre-treatment plasma Lp(a) concentrations of 90 mg / dL or higher The rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In another embodiment, the compound is administered at least about 9 times prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of 0 mg / dL or higher, the absolute risk reduction (i.e., The statistically significant absolute amount by which the overall risk is reduced is In yet another embodiment, the compound is administered at least about 90 minutes prior to the first administration. For patients with plasma Lp(a) concentrations of ≥ 100 mg / dL, the absolute risk reduction (i.e., The statistically significant absolute amount by which the overall risk is reduced is In another embodiment, the compound is administered at a dose of 90 mg / d or more prior to the first dose of the compound. For patients with plasma Lp(a) concentrations of ≥ 1 μg, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is is also about 4.5%.

[0295] In one embodiment of any one of the above embodiments relating to a percentage risk reduction, the initial dose of the compound Absolute risk reduction was observed for patients with a pre-administration plasma Lp(a) concentration of 90 mg / dL or higher. The reduction rate (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In yet another embodiment, at least 2.8% of the compound is administered at the first dose. Absolute risk reduction for patients with a prior plasma Lp(a) concentration of 90 mg / dL or higher (i.e., the statistically significant absolute amount by which the overall risk is reduced) is In another embodiment, the compound is administered at a concentration of at least 3.0% by weight for 90 minutes prior to the first administration of the compound. For patients with plasma Lp(a) concentrations of ≥ 1000 mg / dL, the absolute risk reduction (i.e. The absolute amount by which the overall risk is reduced (a statistically significant amount) is In yet another embodiment, the compound is administered at 90 mg / mL prior to the first dose. For patients with plasma Lp(a) concentrations of ≥ 1000 dL, the absolute risk reduction (i.e., overall The statistically significant absolute amount by which the risk is reduced is In another embodiment, the blood glucose level is 90 mg / dL or higher before the first dose of the compound. For patients with plasma Lp(a) concentrations, the absolute risk reduction (i.e., overall risk The statistically significant absolute amount by which the %.

[0296] In other embodiments, the patient is at least 1 year after the start of treatment, or at least 2 years after the start of treatment, or at least 3 years after the start of treatment, or at least 4 years after the start of treatment, or at least 5 years after the start of treatment, or at least 6 years after the start of treatment, or at least 7 years after the start of treatment, or at least 8 years after the start of treatment, or at least 9 years after the start of treatment, or at least 10 years after the start of treatment, From baseline to specified time points at 13, 15, 18, 21, 24, and 27 months (ii) changes in Lp(a) (in mg / dL and nmol / L); (iii) extended lipid profile parameters (total cholesterol, LDL-C, apoB, HDL-C, non-HDL-C, (iii) changes in serum triglycerides and hsCRP, and (iv) incidence of new-onset type 2 diabetes mellitus. (iv) survival rate, (iv) quality of life assessed by the SF-12 questionnaire, and (v) aortic valve replacement. First occurrence of surgery (open or transcatheter) or hospitalization for aortic stenosis Time to any one of the events or characteristics compared to patients who did not receive the compound and showed a statistically significant improvement at the end of the treatment period, and patients were significantly better than those at the time of the first dose of the compound. Previous plasma Lp(a) concentration of 90 mg / dL or greater.

[0297] In one embodiment thereof, the plasma Lp(a) concentration is 90 mg / dL or greater prior to the first administration of the compound. Patients with grade 1, 2, 3, 4, 5, 6, 9, 12, 13, 15, and 18 Changes in Lp(a) from baseline at specified time points after 21, 24, and 27 months The events or characteristics of the phenotype (in mg / dL and nmol / L) were compared with those of patients who did not receive the compound. show a statistically significant improvement at the end of the treatment period compared to those who

[0298] In one embodiment thereof, the plasma Lp(a) concentration is 90 mg / dL or greater prior to the first administration of the compound. Patients with DMARDs were assessed using extended lipid profile parameters (total cholesterol, LDL-C, apoB, HDL-C, non-HDL-C, triglycerides) and changes in hsCRP The characteristics were statistically significantly different at the end of the treatment period compared with patients who did not receive the compound. Shows significant improvement.

[0299] In one embodiment thereof, the plasma Lp(a) concentration is 90 mg / dL or greater prior to the first administration of the compound. Patients with diabetes mellitus who have received the compound have a significant effect on the incidence or characteristics of new-onset type 2 diabetes mellitus. Patients show a statistically significant improvement at the end of the treatment period compared to patients who did not receive the treatment.

[0300] In one embodiment thereof, the plasma Lp(a) concentration is 90 mg / dL or greater prior to the first administration of the compound. Patients with cerebrovascular disease responded to quality of life events or characteristics assessed by the SF-12 questionnaire. showed a statistically significant improvement at the end of the treatment period compared with patients who did not receive the compound. show.

[0301] In one embodiment thereof, the plasma Lp(a) concentration is 90 mg / dL or greater prior to the first administration of the compound. Patients with this condition should undergo aortic valve replacement (open catheter or transcatheter) or aortic valve replacement. The event or characteristic of time to first hospitalization for stenosis was compared between patients who did not receive the compound and those who did not receive the compound. patients who received the drug showed a statistically significant improvement at the end of the treatment period compared with patients who did not.

[0302] In one embodiment, the relative improvement rate (i.e., the statistically significant improvement in an event or characteristic) is The relative amount) is at least 15% for any one of the events or characteristics.

[0303] The above regarding the relative improvement rate (i.e., the statistically significant relative amount by which the event or characteristic is improved) In one embodiment of any one of the embodiments, the concentration of the compound is 90 mg / dL or greater prior to the first administration of the compound. For patients with a plasma Lp(a) concentration of at least 1 5%. In yet another embodiment, the relative improvement (i.e., the improvement in the event or characteristic) is A statistically significant relative amount was determined by plasma Lp(a) of 90 mg / dL or more before the first dose of the compound. ) concentration. In another embodiment, the relative improvement rate ( (i.e., a statistically significant relative amount by which an event or characteristic is improved) is measured before the first administration of the compound. At least 25% of patients have plasma Lp(a) concentrations of 90 mg / dL or greater In yet another embodiment, the relative improvement rate (i.e., the statistically significant improvement in an event or characteristic) is measured. (significant relative amount) was determined by measuring plasma Lp(a) concentrations of 90 mg / dL or higher before the first dose of the compound. In another embodiment, the relative improvement rate (i.e., the event rate) is at least 30% for patients who: The statistically significant relative amount of improvement in the outcome or characteristic was measured by administering 90 mg / mL of the compound before the first dose. At least 35% of patients have plasma Lp(a) concentrations of ≥ 1000 dL.

[0304] In some embodiments, the administration period is at least 6 months. The administration period is at least one year. In yet another embodiment, the administration period is at least In another embodiment, the administration period is at least 3 years.

[0305] In some embodiments, the patient has a guideline-defined target low-density lipoprotein background to achieve high quality cholesterol (LDL-cholesterol) levels Receive therapy.

[0306] In some embodiments, background therapy includes (i) a statin, (ii) an ezetimibe, and (iii) at least one of a PCSK9 inhibitor.

[0307] In one embodiment, the background therapy includes a statin and the patient receives an initial dose of the compound. Receive the optimal dose of statin before each dose.

[0308] In some embodiments, the patient has a sitting systolic blood pressure (SBP) of less than 180 mmHg and and / or have a diastolic BP (DBP) of less than 110 mmHg.

[0309] In some embodiments, the patient has had niacin in the three month period prior to the first administration of the compound. have not been treated with

[0310] In some embodiments, the patient is diagnosed with heart failure at the time of the first administration of the compound. Not diagnosed with New York Heart Association (NYHA) class IV.

[0311] In some embodiments, the patient has suffered a hemorrhagic stroke or other major event prior to the first administration of the compound. No history of blood disease.

[0312] In some embodiments, the patient will experience myocardial infarction, cerebral infarction, or stroke within 3 months of the first administration of the compound. Stroke, coronary or lower limb revascularization, major cardiac or non-cardiac surgery, or lipoprotein No apheresis.

[0313] In some embodiments, the patient has a known active infection or major hematological, renal, metabolic, No gastrointestinal or endocrine dysfunction.

[0314] In some embodiments, the patient receives 30 mL / min / 1.73 m prior to the first dose of the compound. 2 have an estimated glomerular filtration rate (eGFR) greater than

[0315] In some embodiments, the patient receives 30 mL / min / 1.73 m prior to the first dose of the compound. 2 and not have an estimated glomerular filtration rate (eGFR) less than 0.

[0316] In some embodiments, the patient is administered a dose of 2x the upper limit of normal (ULN) prior to the first administration of the compound. More than 2-fold increase in aspartate aminotransferase (AST) or alanine aminotransferase Patients with active liver disease or impaired liver function, as defined by serum ALT levels Not yet.

[0317] In some embodiments, the patient is at least 1.5 mg / kg of the upper limit of normal (ULN) before the first dose of the compound. Do not have more than 5 times the total bilirubin.

[0318] The present disclosure provides a method for treating, preventing, or ameliorating a disease, disorder, or condition as described herein. Also provided is a kit for the preparation of a pharmaceutical composition comprising: (i) ISIS 681257; and optionally ( ii) comprises a second agent or therapy described herein.

[0319] The kits of the present invention can be used to treat the diseases, Further, instructions for using the kit to treat, prevent, or ameliorate a disorder or condition may be provided. It may be included in.

[0320] Apo(a) therapeutic indications The present disclosure provides a method for targeting apo(a) nucleic acids to regulate expression of apo(a) in a subject. Methods of using ISIS 681257, a conjugated antisense compound that inhibits When administered to humans, ISIS 681257 inhibits the expression of apo(a). To decrease.

[0321] In certain embodiments, the present invention provides a pharmaceutical composition for treating a subject comprising ISIS. In certain embodiments, the individual is a person who has an apo(a)-associated In certain embodiments, the individual has an Lp(a)-associated disease. In embodiments, the individual has an inflammatory, cardiovascular and / or metabolic disease, disorder or condition. In certain embodiments, the subject is diagnosed with an inflammatory, cardiovascular and / or metabolic disease, disorder or condition. It has the following shape.

[0322] In certain embodiments, cardiovascular diseases, disorders or conditions (CVD) include, but are not limited to: Although not considered a common cause, there is an increased risk of Lp(a)-related CVD and recurrence with elevated Lp(a). Cardiovascular events, aortic stenosis (e.g., high Lp(a)-associated calcific aortic stenosis), cardiac Aneurysms (e.g. abdominal aortic aneurysms), angina pectoris, arrhythmias, atherosclerosis, cerebrovascular disease , coronary artery disease, coronary heart disease (CHD), acute myocardial infarction (AMI), chronic CHD, arteries Hypertension (HT), cerebrovascular stroke, dyslipidemia, hypercholesterolemia, hyperlipidemia, hypertension blood pressure, hypertriglyceridemia, myocardial infarction, peripheral vascular disease (e.g., peripheral arterial disease), stroke Examples include:

[0323] In certain embodiments, cardiovascular events include, but are not limited to, major Adverse cardiovascular events (MACE) (e.g., cardiovascular death, nonfatal myocardial infarction, nonfatal stroke, and and emergency coronary revascularization requiring hospitalization), death from any cause, coronary heart disease ( Death from acute myocardial infarction (CHD), death from acute myocardial infarction (AMI), death from heart failure (HF), and immediate complications of cardiac surgery These include death due to ischemia and emergency lower limb revascularization or amputation due to ischemia.

[0324] In certain embodiments, ISIS 681257 is used to treat the physiology of a cardiovascular disease, disorder or condition. For example, ISIS 681257 may be administered to a human and reduced levels of Lp(a), LDL, and cholesterol compared to untreated subjects. In certain embodiments, modulation of physiological markers or phenotypes is achieved by ISIS 6812. This may be related to the inhibition of apo(a) by 57.

[0325] In certain embodiments, the physiological marker of a cardiovascular disease, disorder or condition is quantifiable. For example, Lp(a), LDL or cholesterol levels can be measured, e.g., by standard These markers can be measured and quantified by lipid tests. In this state, approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or 99% or any two of these values The marker may be reduced in a range defined by one of the following:

[0326] Also provided herein are methods for treating cardiovascular disease, disorders or is a method for preventing, treating, or ameliorating symptoms associated with a medical condition. The method is for reducing the incidence of symptoms associated with a cardiovascular disease, disorder or condition. In certain embodiments, provided are methods for reducing the severity of symptoms associated with a cardiovascular disease, disorder or condition. In such an embodiment, the method comprises the steps of: to an individual in need thereof.

[0327] Cardiovascular diseases, disorders or conditions can be characterized by a number of physical symptoms. Any symptom known to one of skill in the art to be associated with a disease, disorder, or condition described herein. In certain embodiments, the compounds and methods may prevent, treat, ameliorate, or otherwise modulate Symptoms include, but are not limited to, angina, chest pain, shortness of breath, palpitations, weakness, and eye Dizziness, nausea, sweating, tachycardia, bradycardia, arrhythmia, atrial fibrillation, swelling of the lower extremities, cyanosis, fatigue, fainting numbness in the face, numbness in the limbs, muscle claudication or cramps, abdominal distension, or fever It could be either.

[0328] In certain embodiments, metabolic diseases, disorders or conditions include, but are not limited to: However, hyperglycemia, prediabetes, diabetes (type I and type II), obesity, insulin resistance, These include metabolic syndrome and diabetic dyslipidemia.

[0329] In certain embodiments, ISIS 681257 is used to treat a physiological metabolic disease, disorder or condition. For example, administration of ISIS 681257 to humans may modulate markers or phenotypes. Reduced glucose and insulin resistance levels in these subjects compared to treated subjects. In certain embodiments, modulation of a physiological marker or phenotype may be achieved by ISIS 681. This may be related to the inhibition of apo(a) by 257.

[0330] In certain embodiments, the physiological marker of a metabolic disease, disorder, or condition is quantifiable. For example, glucose levels or insulin resistance may be measured using standard methods known in the art. Such markers can be measured and quantified by various tests. So, about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 6 5, 70, 75, 80, 85, 90, 95 or 99% or any two of these values In another example, insulin sensitivity can be reduced by a marker in the range defined by: Such markers can be measured and quantified by standard tests known in the art. In certain embodiments, the marker is about 5, 10, 15, 20, 25, 30, 3 5, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95 or younger can be increased by 99% or a range defined by any two of these values.

[0331] Also provided herein are methods for treating a metabolic disease, disorder or In certain embodiments, a method for preventing, treating, or ameliorating symptoms associated with a medical condition is provided. Contemplated is a method of reducing the incidence of symptoms associated with a metabolic disease, disorder or condition. In certain embodiments, provided are methods for assessing the severity of symptoms associated with a metabolic disease, disorder, or condition. In such embodiments, the method comprises treating ISIS 681257. The present invention includes administering a therapeutically effective amount to an individual in need thereof.

[0332] A metabolic disease, disorder or condition may be characterized by a number of physical symptoms. Any condition known to one of skill in the art to be associated with a disorder or condition may be used in combination with the compounds described herein. The compounds and methods may prevent, treat, ameliorate, or otherwise modulate the disease. Symptoms include, but are not limited to, excessive urine production (polyuria), excessive thirst, and Increased fluid intake (polydipsia), blurred vision, unexplained weight loss, and lethargy could be.

[0333] In certain embodiments, inflammatory diseases, disorders or conditions include, but are not limited to: Although there is no evidence of an increased risk of Lp(a)-related CVD, recurrent cardiovascular events associated with elevated Lp(a) Epilepsy, aortic stenosis (e.g., high Lp(a)-associated calcific aortic stenosis), coronary artery disease (C AD), Alzheimer's disease, and thromboembolic diseases, disorders, or conditions. Embolic diseases, disorders or conditions include, but are not limited to, stroke, hemorrhage, These include thrombosis, myocardial infarction and peripheral vascular disease.

[0334] In certain embodiments, ISIS 681257 inhibits the physiology of an inflammatory disease, disorder or condition. For example, administration of ISIS 681257 to a human may result in: Reduced levels of inflammatory cytokines or other inflammatory markers compared to untreated subjects In certain embodiments, modulation of a physiological marker or phenotype may be achieved by ISIS 681. This may be related to the inhibition of apo(a) by 257.

[0335] In certain embodiments, the physiological marker of an inflammatory disease, disorder, or condition is quantifiable. For example, cytokine levels can be measured by standard tests known in the art. For such markers, in certain embodiments, at least Approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 9 The marker may be reduced by 9% or by a range defined by any two of these values.

[0336] Also provided herein are methods for treating an inflammatory disease, disorder or condition in a subject in need thereof. is a method for preventing, treating, or ameliorating symptoms associated with a medical condition. Provided is a method for reducing the incidence of symptoms associated with an inflammatory disease, disorder, or condition. In certain embodiments, provided are methods for reducing the severity of symptoms associated with an inflammatory disease, disorder, or condition. In such an embodiment, the method comprises the steps of: to an individual in need thereof.

[0337] In certain embodiments, a therapeutically effective amount of one or more pharmaceutical compositions described herein is administered. and (c) administering to an individual a dose of apo(a)-associated In certain embodiments, the individual has elevated apo(a) levels. In some embodiments, a therapeutically effective amount of one or more pharmaceutical compositions described herein is administered. Methods for treating an individual having an Lp(a)-associated disease, disorder, or condition are provided, including administering to the individual a dose of an Lp(a)-associated drug. In certain embodiments, the individual has elevated Lp(a) levels. In the present invention, the individual has an inflammatory, cardiovascular and / or metabolic disease, disorder or condition. In one embodiment, administration of a therapeutically effective amount of ISIS 681257 is effective in treating apo(a) or L In certain embodiments, a therapeutically effective amount of ISIS is administered in a manner consistent with the present invention, including monitoring p(a) levels. Administration of 681257 may improve markers of inflammatory, cardiovascular, and / or metabolic disease or apoE (a) involves monitoring other disease processes associated with the expression of ISIS 68125 7. Individual response to administration of ISIS 681257 is determined. is used by physicians to determine the amount and duration of therapeutic intervention with ISIS 681257. It is possible.

[0338] In certain embodiments, the administration of ISIS 681257 is at least about 15%, 20% , 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% , 75%, 80%, 85%, 90%, 95%, or 99%, or any two of these values In certain embodiments, the reduction in apo(a) expression is in the range defined by one of: Apo(a) expression is at least 100 mg / dL, 90 mg / dL, or 80 mg / dL or more, 70mg / dL or more, 60mg / dL or more, 50mg / dL or more, 40mg / dL or more, 30 mg / dL or more, 20 mg / dL or more, or 10 mg / dL or more do.

[0339] In certain embodiments, the administration of ISIS 681257 is at least about 15%, 20% , 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% , 75%, 80%, 85%, 90%, 95%, or 99%, or any two of these values In certain embodiments, Lp(a) expression is reduced to a range defined by one of the following: p(a) expression is at least 200 mg / dL, 190 mg / dL, or 180 mg / dL or more, 175mg / dL or more, 170mg / dL or more, 160mg / dL or more, 1 50mg / dL or more, 140mg / dL or more, 130mg / dL or more, 120mg / dL or more, 110mg / dL or more, 100mg / dL or more, 90mg / dL or more, 80mg / dL or more, 70mg / dL or more, 60mg / dL or more, 55mg / dL or more, 50mg / dL or more, 45 mg / dL or more, 40 mg / dL or more, 35 mg / dL or more, 30 mg / dL or more, 25mg / dL or more, 20mg / dL or more, 15mg / dL or more, or 10mg / dL or more.

[0340] In a particular embodiment, the present invention provides a method for the preparation of a medicament using ISIS 681257. In certain embodiments, the pharmaceutical composition comprising ISIS 681257 is suffer from or are at risk of suffering from an inflammatory, cardiovascular and / or metabolic disease, disorder or condition It is used in the preparation of medicines for treating pancreatic patients.

[0341] Apo(a)-treated population Certain subjects with high Lp(a) levels are at significant risk for a variety of diseases (L ippi et al.,Clinica Chimica Acta,2011,41 2:797-801; Solfrizz et al.). For example, 75 nanomoles / liter Subjects with Lp(a) levels of ≥ 30 mg / dL or ≥ 30 nmol / L were randomly assigned to Many subjects with high Lp(a) levels are thought to be at increased risk for various diseases. In this study, current treatments are unable to reduce Lp(a) levels to a safe level. O(a) plays an important role in the formation of Lp(a), thus reducing apo(a). This can reduce Lp(a) and prevent, treat or ameliorate Lp(a)-related respiratory diseases.

[0342] In certain embodiments, treatment with the compounds and methods disclosed herein results in elevated a Indicated for humans with po(a) and / or Lp(a) levels. In embodiments, the human has a blood cholesterol level of 10 mg / dL or more, 20 mg / dL or more, 30 mg / dL or more, 40mg / dL or more, 50mg / dL or more, 60mg / dL or more, 70mg / dL or more, Apo(a) levels of 80 mg / dL or higher, 90 mg / dL or higher, or 100 mg / dL or higher It has a

[0343] In certain embodiments, the human has a blood cholesterol level of 70 mg / dL or higher, 80 mg / dL or higher, 90 mg / dL or higher, dL or more, 100 mg / dL or more, 110 mg / dL or more, 120 mg / dL or more, 13 0mg / dL or more, 140mg / dL or more, 150mg / dL or more, 160mg / dL or more Above, 170mg / dL or higher, 175mg / dL or higher, 180mg / dL or higher, 190mg / dL or higher or have an Lp(a) level of 200 mg / dL or higher.

[0344] In certain embodiments, the human has an apo(a) level above the upper normal limit, e.g., For humans, the following are recommended: 30 mg / dL or more, 35 mg / dL or more, 40 mg / dL or more, and 50 mg / dL or more. L or more, 60mg / dL or more, 70mg / dL or more, 80mg / dL or more, 90mg / d L or more, 100mg / dL or more, 110mg / dL or more, 120mg / dL or more, 130 mg / dL or more, 140 mg / dL or more, 150 mg / dL or more, 160 mg / dL or more , 170mg / dL, 175mg / dL or more, 180mg / dL or more, 190mg / dL or have an apo(a) level of 200 mg / dL or higher.

[0345] In certain embodiments, the human patient is administered 70 mg of the compound prior to the first administration (i.e., prior to the start of treatment). Have an Lp(a) level of ≥ 100 mg / dL.

[0346] In certain embodiments, the human patient is receiving LDL-cholesterol-lowering therapy, such as Can: - Optimal for meeting target LDL-C levels according to local practice / guidelines LDL-C lowering therapy, or - The highest tolerated dose of statins and / or other optimized LDL-lowering therapy (e.g., ezetimibe) steroids, cholesterol absorption inhibitors, fibrates, PCSK9 inhibitors), or - Alternative optimized LDL-lowering therapy (e.g., azepam) according to local practice / guidelines timib, cholesterol absorption inhibitors, fibrates, PCSK9 inhibitors).

[0347] In certain embodiments, the human patient has established cardiovascular disease. Disease is defined as one of three conditions: 1. Occurred more than 3 months and less than 10 years prior to the screening visit and documented as follows: History of cryptogenic myocardial infarction (not due to PCI or CABG): (i) Acute cardiac MI (hospital record): At least one value is greater than 99 percentile of the upper reference limit (URL). Elevation of cardiac biomarkers (preferably cardiac troponin) above the centrile level and / or Requires descent and recording of at least one of the following: Symptoms of ischemia, b. ECG changes suggestive of acute myocardial ischemia (new ST-T changes or new LBBB; ST and T wave changes, see Appendix 2). c. The occurrence of pathological Q waves (see Appendix 2 for the definition of pathological Q waves), d. New loss of viable myocardium or new regional wall motion abnormalities in a pattern consistent with an ischemic etiology pictorial evidence, e. Identification of coronary thrombus by angiography, including intracoronary imaging; (ii) Previous MI (no complete hospital record of acute event): Any of the following: Record required: a. Pathological Q waves in the absence of non-ischemic causes, with or without symptoms, b. Images of lost areas of viable myocardium that are thinned and unable to contract in the absence of a non-ischemic cause. Evidence according to 2. Screening patients, as documented by CT scan, MRI, or other visualization method Ischemic stroke (caused by infarction of central nervous system tissue) that occurred more than 3 months but less than 10 years prior to the examination History of acute episodes of focal brain, spinal cord, or retinal dysfunction resulting from transient ischemic attack or embolic stroke (not of atherosclerotic origin) is not a qualifying event. 3. Intermittent claudication with ankle-brachial index of 0.90 or less and / or limb ischemia Clinically significant symptomatic peripheral arterial disease evidenced by amputation or revascularization. Thromboangiitis is not a qualifying event.

[0348] Specific Apo(a) dosing regimens In certain embodiments, about 75 to about 85 mg of ISIS 681257 is administered as defined herein. As defined, it is administered once a month to a human subject in need thereof.

[0349] In certain embodiments, about 75 to about 85 mg of ISIS 681257 is administered as defined herein. As defined, it is administered once every four weeks to a human subject in need thereof.

[0350] In a specific embodiment, about 80 mg of ISIS 681257 is It is administered once a month to a human subject in need thereof.

[0351] In a specific embodiment, about 80 mg of ISIS 681257 is It is administered once every four weeks to a human subject in need thereof.

[0352] In certain embodiments, the above amounts of ISIS 681257 are is administered to a human subject in need thereof for an administration period.

[0353] In certain embodiments, the administration period is at least 6 months. The duration is at least 1 year. In yet another embodiment, the administration period is at least 2 years. In another embodiment, the administration period is 3 years. In another embodiment, the administration period is At least four years.

[0354] In a specific embodiment, 80 mg of ISIS 681257 is administered over a defined dosing period. In another embodiment, the compound is administered to a human subject in need thereof every four weeks for a period of 80 minutes. g ISIS 681257, as defined, every 4 weeks for at least 6 months. In another embodiment, 80 mg of ISIS 6812 is administered to a human subject in need thereof. 57 is administered to human subjects in need thereof every 4 weeks for at least 1 year, as defined. In another embodiment, 80 mg of ISIS 681257 is administered as defined above. It is administered every four weeks for at least two years to a human subject in need thereof. 80 mg of ISIS 681257 was administered every 4 weeks for at least 3 years as defined In another embodiment, 80 mg of ISIS is administered to a human subject in need thereof. 681257 is administered to humans who require it as defined every 4 weeks for at least 4 years. is administered to the subject.

[0355] In a specific embodiment, 80 mg of ISIS 681257 is administered over a defined dosing period. In another embodiment, the compound is administered to a human subject in need thereof once a month for a period of 80 mg of ISIS 681257 once a month for at least 6 months, as defined In another embodiment, 80 mg of ISIS 68 is administered to a human subject in need thereof. 1257 is administered to humans who require it once a month for at least one year, as defined. In another embodiment, 80 mg of ISIS 681257 is administered to an elephant. The drug is administered to a human subject in need thereof once a month for at least two years, as described in another study. In one embodiment, 80 mg of ISIS 681257 is administered at least once a month as defined. In another embodiment, 80 mg of ISIS 681257 requires that as defined, it be done once a month for at least four years. The compound is administered to a human subject in need thereof.

[0356] Specific Treatments and Dosage Regimens In certain embodiments, the present disclosure provides a method for preventing cardiovascular events in patients with established cardiovascular disease. A method for reducing the risk of rheumatoid arthritis, comprising administering approximately 75 mg to approximately 8 mg of rheumatoid arthritis by subcutaneous injection once a month. administering to the patient a unit dose containing 5 mg of the compound ISIS 681257, The patient had a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of the compound and cardiac Vascular events were major adverse cardiovascular events (MACE), all-cause mortality, and coronary heart disease (CHD) mortality. , acute myocardial infarction (AMI) death, heart failure (HF) death, death due to immediate complications of cardiac surgery, and and emergency lower limb revascularization for ischemia or amputation.

[0357] In another embodiment, the present disclosure provides a method for the treatment of cardiovascular events in patients with established cardiovascular disease. A method for reducing the risk of mg of the compound ISIS 681257, Patients must have a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of the compound and be established Patients with identified cardiovascular disease were classified as having (i) a history of cryptogenic myocardial infarction, (ii) an ischemic stroke, or and (iii) patients with at least one of the following: clinically significant symptomatic peripheral arterial disease It relates to a person and a method.

[0358] In another embodiment, the present disclosure provides a method for the treatment of cardiovascular events in patients with established cardiovascular disease. A method for reducing the risk of administering to a patient a unit dose containing 10 mg of the compound ISIS 681257, Patients were required to have a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of the compound and to have a cardiac vasculitis. Cardiovascular events were major adverse cardiovascular events (MACE), all-cause mortality, coronary heart disease (CHD) mortality, Deaths due to acute myocardial infarction (AMI), heart failure (HF), and deaths due to immediate complications of cardiac surgery Patients undergoing emergency lower limb revascularization or amputation for ischemia; those with established cardiovascular disease Patients were required to have (i) a history of cryptogenic myocardial infarction, (ii) a history of ischemic stroke, and (iii) clinical The present invention relates to a method for treating a patient with at least one clinically significant symptomatic peripheral arterial disease.

[0359] In another embodiment, the present disclosure provides a method for the treatment of cardiovascular events in patients with established cardiovascular disease. A method for reducing the risk of administering to a patient a unit dose containing 10 mg of the compound ISIS 681257, Patients were required to have a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of the compound and to have a cardiac vasculitis. Cardiovascular events were major adverse cardiovascular events (MACE), all-cause mortality, coronary heart disease (CHD) mortality, Death from acute myocardial infarction (AMI), death from heart failure (HF), death from immediate complications of cardiac surgery, and death from ischemia emergency lower limb revascularization or amputation for hemorrhage; patients with established cardiovascular disease Participants were required to have (i) a history of cryptogenic myocardial infarction, (ii) a history of ischemic stroke, and (iii) clinical The present invention relates to a method for treating peripheral arterial disease, wherein the patient is a patient having at least one of the following:

[0360] In another embodiment, the present disclosure provides a method for the treatment of cardiovascular events in patients with established cardiovascular disease. 20. A method for reducing the risk of steroid use comprising administering about 80 mg of a compound by subcutaneous injection once a month. administering to a patient a unit dose comprising ISIS 681257, wherein the patient The patient had a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of the drug, and the cardiovascular events were primarily Major adverse cardiovascular events (MACE), all-cause mortality, coronary heart disease (CHD) mortality, acute myocardial infarction (AMI) death, heart failure (HF) death, death due to immediate complications of cardiac surgery, and emergency acute lower limb revascularization or amputation; patients with established cardiovascular disease are (i) (ii) a history of cryptogenic myocardial infarction, (ii) a history of ischemic stroke, and (iii) clinically significant symptoms The method relates to a patient having at least one of the following: symptomatic peripheral arterial disease;

[0361] In another embodiment, the present disclosure provides a method for the treatment of cardiovascular events in patients with established cardiovascular disease. 20. A method for reducing the risk of steroid use comprising administering about 80 mg of a compound by subcutaneous injection once a month. administering to a patient a unit dose comprising ISIS 681257, wherein the patient The patient had a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of the drug, and the cardiovascular events were primarily Major adverse cardiovascular events (MACE), all-cause mortality, coronary heart disease (CHD) mortality, acute myocardial infarction (AMI) death, heart failure (HF) death, death due to immediate complications of cardiac surgery, and emergency acute lower limb revascularization or amputation; patients with established cardiovascular disease are (i) (ii) a history of cryptogenic myocardial infarction, (iii) a history of ischemic stroke, or (iv) clinically significant symptoms. Patients with at least one of the following: peripheral arterial disease; relative risk for any one event The risk reduction rate is defined as: (i) a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of the compound; For patients with a ≥ 15%, preferably at least 20%, more preferably (ii) a plasma Lp of 90 mg / dL or greater before the first dose of the compound (a) For patients with a concentration of at least 20%, preferably at least 25%, More preferably, the ratio is at least 30%.

[0362] In another embodiment, the present disclosure provides a method for the treatment of cardiovascular events in patients with established cardiovascular disease. A method for reducing the risk of steroid use, comprising administering 80 mg or less of a compound by subcutaneous injection once a month. The method comprises administering to a patient a unit dose containing the compound ISIS 681257, wherein the patient is The patient had a plasma Lp(a) concentration of 70 mg / dL or higher before the first dose of the compound, and the cardiovascular event was Major adverse cardiovascular events (MACE), all-cause mortality, coronary heart disease (CHD) death, acute myocardial infarction Death from acute myocardial infarction (AMI), death from heart failure (HF), death from immediate complications of cardiac surgery, death from ischemia Emergency lower limb revascularization or amputation; patients with established cardiovascular disease (i (ii) a history of ischemic stroke; and (iii) a clinically significant The method relates to a patient having at least one of the following: symptomatic peripheral arterial disease;

[0363] In certain embodiments, the patient is at a guideline-defined target low-density lipoprotein concentration. Background therapy to achieve low cholesterol (LDL-cholesterol) levels Patients must have a sitting systolic blood pressure (SBP) of less than 180 mmHg and / or a blood pressure of less than 110 mmHg. Patients must have a diastolic blood pressure (DBP) of less than 100 mg / kg for a period of 3 months prior to the first administration of the compound. had not previously been treated with niacin; patients had heart failure syndrome at the time of first administration of the compound. Patients were not diagnosed with York Heart Association (NYHA) Class IV disease; patients received their first dose of the compound. Patients must have no history of hemorrhagic stroke or other major bleeding prior to the first dose of the compound. Myocardial infarction, stroke, coronary artery or lower limb revascularization, major cardiac or Patients had no noncardiac surgery or lipoprotein apheresis; patients had no known active no infectious diseases or major hematological, renal, metabolic, gastrointestinal or endocrine dysfunction; Patients were administered 30 mL / min / 1.73 m before the first dose of the compound. 2 Estimated glomerular filtration rate exceeding Patients had an eGFR of 30 mL / min / 1.73 m before the first dose of compound. 2 Not yet Patients do not have an estimated glomerular filtration rate (eGFR) of less than 1% or less than 1% of the normal range; patients must be at least 1% of the normal range before the first dose of compound. , aspartate aminotransferase (AST) levels greater than twice the upper limit of normal (ULN) ) or activity defined as alanine aminotransferase (ALT) serum levels No liver disease or liver dysfunction; or patients have an upper limit of normal ( Total bilirubin >1.5 times the ULN or a combination thereof be.

[0364] Certain Pharmaceutical Compositions In certain embodiments, the present disclosure provides pharmaceutical compositions comprising one or more antisense compounds. In certain embodiments, such pharmaceutical compositions comprise a suitable pharmaceutically acceptable In certain embodiments, the pharmaceutical composition comprises a diluent or carrier, such as sterile saline and one or more In certain embodiments, such pharmaceutical compositions comprise a plurality of antisense compounds. In certain embodiments, the composition comprises a bacterial saline solution and one or more antisense compounds. In certain embodiments, the pharmaceutical composition is , one or more antisense compounds, and sterile water. The composition consists of one or more antisense compounds and sterile water. The sterile saline solution is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises one or more In certain embodiments, the antisense compound comprises a number of antisense compounds and phosphate buffered saline (PBS). The pharmaceutical composition may comprise one or more antisense compounds and sterile phosphate buffered saline (PBS). In certain embodiments, the sterile saline is pharmaceutical grade PBS.

[0365] In certain embodiments, the sterile liquid is water. In other embodiments, the sterile liquid is phosphoric acid. In another embodiment, the sterile liquid is sodium phosphate buffered water. The buffer is water containing sodium chloride.

[0366] In certain embodiments, the compound is formulated in 1.3 mL or less of a sterile liquid. In another embodiment, the compound is formulated in 1.2 mL or less of a sterile liquid. In another embodiment, the compound is formulated in 1.0 mL or less of a sterile liquid. In another embodiment, the compound is formulated in 0.8 mL or less of a sterile liquid. In another embodiment, the compound is formulated in 0.5 mL or less of a sterile liquid. In another embodiment, the compound is formulated in 0.4 mL or less of a sterile liquid. In yet another embodiment, the compound is formulated in 0.25 mL or less of a sterile liquid. In another embodiment, the compound is formulated in 0.1 mL or less of a sterile liquid. In yet another embodiment, the compound is formulated in a sterile liquid in an amount of 0.05 mL or less. It is mixed into the sterile liquid below.

[0367] In certain embodiments, the compound is formulated in about 1.3 mL of sterile liquid. In another embodiment, the compound is formulated in about 1.2 mL of sterile liquid. In another embodiment, the compound is formulated in about 1.0 mL of sterile liquid. In another embodiment, the compound is formulated in about 0.8 mL of sterile liquid. In another embodiment, the compound is formulated in about 0.5 mL of sterile liquid. In one embodiment, the compound is formulated in about 0.4 mL of sterile liquid. In yet another embodiment, the compound is formulated in about 0.25 mL of sterile liquid. Formulated in 0.2 mL of sterile liquid.

[0368] In certain embodiments, the antisense compounds are administered in a manner similar to that described above for preparing pharmaceutical compositions or formulations. It may be mixed with pharmaceutically acceptable active and / or inactive substances. Compositions and methods for the treatment of rheumatoid arthritis include, but are not limited to, those that are suitable for various conditions, including the route of administration, the extent of disease, or the severity of the disease. It depends on several criteria, including the dose administered.

[0369] In certain embodiments, the pharmaceutical compositions provided herein contain one or more modified oligonucleotides. In certain such embodiments, the excipients include a nucleotide and one or more excipients. Contains water, salt solution, alcohol, polyethylene glycol, gelatin, lactose, amylase, Magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose and polyvinylpyrrolidone.

[0370] In certain embodiments, the pharmaceutical compositions provided herein comprise a delivery system. Examples of systems include, but are not limited to, liposomes and emulsions. Certain delivery systems include those containing hydrophobic compounds. In certain embodiments, dimethyl sulfoxide and the like are useful for preparing pharmaceutical compositions of the invention. Which particular organic solvent is used?

[0371] In certain embodiments, the pharmaceutical compositions are administered by injection (e.g., intravenously, subcutaneously, intramuscularly, etc.). In certain such embodiments, the pharmaceutical composition comprises a carrier. , aqueous solutions such as water, or physiological solutions such as Hanks' solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other components are included (e.g., solubility In certain embodiments, the injectable suspension The formulation is prepared using appropriate liquid carriers, suspending agents, etc. Specific Pharmaceutical Compositions for Injection The compound may be presented in unit dosage form, for example, in ampoules or in multi-dose containers. The pharmaceutical compositions for this purpose may be suspensions, solutions or emulsions in oily or aqueous vehicles, It may contain formulating agents such as suspending agents, stabilizers and / or dispersing agents. Use in injectable pharmaceutical compositions Specific solvents suitable for this purpose include, but are not limited to, lipophilic solvents and sesame fatty oils such as oils, synthetic fatty acid esters such as ethyl oleate or triglycerides, and Aqueous injection suspensions may contain sodium carboxymethylcellulose, sodium phosphate, etc. It may contain substances that increase the viscosity of the suspension, such as sorbitol or dextran. Alternatively, such suspensions may increase the solubility of pharmaceutical agents, allowing for the preparation of highly concentrated solutions. The composition may also contain suitable stabilizers or agents.

[0372] In certain embodiments, the present disclosure is directed to pharmaceutical compositions comprising the oligonucleotides of the present disclosure. Suitable routes of administration include parenteral (e.g., intravenous, intramuscular) , intramedullary and subcutaneous).

[0373] Compounds used All of the above-described embodiments of the treatment method according to the present invention are equally applicable to : a compound as defined herein for the manufacture of a medicament for use according to the present invention. Use of ISIS 681257 or the compound ISIS 681257 defined herein Use of a pharmaceutical composition comprising - the use of the compound ISIS 681257 as defined herein in accordance with the present invention or Use of a pharmaceutical composition comprising the compound ISIS 681257 as defined herein, the compound ISIS 68125 as defined herein for use in accordance with the present invention 7 or a pharmaceutical composition comprising the compound ISIS 681257 as defined herein.

[0374] Methods for reducing the risk of cardiovascular events, particularly in patients with established cardiovascular disease and administering about 75 mg to about 85 mg by subcutaneous injection once a month or once every four weeks. administering to said patient a unit dose comprising the compound ISIS 681257, The subject has a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of the compound. All the above-mentioned embodiments relating to are equally applicable to the following. - Approximately 75 mg to approximately 85 mg of the compound by subcutaneous injection once a month or once every four weeks administering to said patient a unit dose comprising ISIS 681257, said patient Established patients with a plasma Lp(a) concentration of 70 mg / dL or greater before the first dose of compound A method as defined herein for reducing the risk of a cardiovascular event in a patient with cardiovascular disease. Use of the compound ISIS 681257 as defined herein or the compound ISIS 6 as defined herein. a pharmaceutical composition comprising 81257; - Established medications once a month or once every four weeks to reduce the risk of cardiovascular events The drug is administered to a patient with cardiovascular disease, and the patient is administered 70 minutes prior to the first administration of the compound. about 75 mg to about 85 mg of compound ISIS having a plasma Lp(a) concentration of 1000 mg or more. 681257 in the form of a unit dose for subcutaneous injection. or the use of the compound ISIS 681257 as defined herein. Use of pharmaceutical compositions containing IS 681257, - Established medications once a month or once every four weeks to reduce the risk of cardiovascular events The drug is administered to a patient with cardiovascular disease, and the patient is administered 70 minutes prior to the first administration of the compound. about 75 mg to about 85 mg of compound ISIS having a plasma Lp(a) concentration of 1000 mg or more. 681257 for use as a medicament in the form of a unit dose for subcutaneous injection. the compound ISIS 681257 as defined herein or the compound IS as defined herein a pharmaceutical composition comprising IS 681257, - Established medications once a month or once every four weeks to reduce the risk of cardiovascular events The drug is administered to a patient with cardiovascular disease, and the patient is administered 70 minutes prior to the first administration of the compound. about 75 mg to about 85 mg of compound ISIS having a plasma Lp(a) concentration of 1000 mg or more. 681257 as defined herein in a unit dose form for subcutaneous injection. Use of the compound ISIS 681257 as defined herein or the compound ISIS as defined herein. Use of a pharmaceutical composition containing 681257.

[0375] Non-Limiting Disclosure and Incorporation by Reference Certain compounds, compositions and methods described herein are specifically directed to certain embodiments. While described, the following examples serve only to illustrate the compounds described herein. The present application is not intended to be limiting and should not be construed as limiting the scope of the present invention. Each of the references, GenBank accession numbers, etc. is incorporated herein by reference in its entirety. will be done.

[0376] In the sequence listing accompanying this application, each sequence is designated as "RNA" or "DN" as appropriate. Although these sequences are labeled "A", in reality, these sequences may be modified with any combination of chemical modifications. Those skilled in the art will recognize the terms "RNA" or "DNA" to describe modified oligonucleotides. It will be readily understood that names such as 2'-OH are sometimes arbitrary. Oligonucleotides containing nucleosides containing sugar moieties and thymine bases have modified sugars DNA (2'-OH instead of the natural 2'-H of DNA) or modified bases (natural It may be described as RNA with thymine instead of uracil (methylated uracil).

[0377] Thus, the present invention includes, but is not limited to, those in the Sequence Listing. The nucleic acid sequences provided herein include, but are not limited to, nucleic acids with modified nucleobases. Contains any combination of natural or modified RNA and / or DNA, not limited to the above. By way of further example and without limitation, nucleic acids having nucleobases Oligonucleotides having the sequence "ATCGATCG", whether modified or not, compounds containing RNA bases, such as those having the sequence "AUCGAUCG," regardless of Some have DNA bases and some RNA bases such as "AUCGATCG". , as well as "AT me CGAUCG” (in the formula, me C is a cytosine containing a methyl group at the 5-position Examples of oligonucleotides include those with other modified bases such as α- and β-nucleotides (representing the α- and β-nucleotides). Any oligonucleotide having such a nucleic acid base sequence, without limitation Includes. [Example]

[0378] This disclosure is not intended to be limited in scope or spirit to the specific procedures described herein. This is further illustrated by the following examples, which should not be construed as limiting the scope of the invention. are provided to illustrate embodiments of the present invention and are not intended to limit the scope of the present disclosure. It should be understood that any deviation from the spirit of this disclosure and / or the scope of the appended claims is unacceptable. Various other embodiments, modifications and equivalents may suggest themselves to those skilled in the art without the need for further explanation. It should be further understood that the number of times ...

[0379] Example 1: ISIS 68 on major cardiovascular events in patients with established cardiovascular disease A randomized, double-blind, placebo-controlled study evaluating the effect of 1257 on lipoprotein(a) lowering Multi-institutional collaborative research List of abbreviations

[0380] [Table 2]

[0381] [Table 3]

[0382] Glossary

[0383] [Table 4]

[0384] [Table 5]

[0385] the purpose This study involves the treatment of patients with ISIS 681257 at a dose of 80 mg subcutaneously once monthly (QM). Therapy for cardiovascular risk reduction in patients with established CVD and elevated Lp(a) Receive treatment for CV risk factors other than Lp(a) according to local guidelines In patients with established CVD and elevated Lp(a), MACE, i.e. The risk of CV death, non-fatal myocardial infarction (MI), non-fatal stroke, and emergency coronary revascularization This is a pivotal Phase 3 trial designed to test the hypothesis that steroid therapy significantly reduces .

[0386] Objectives and evaluation items Summary: The primary objective of this study was to determine: 1) patients with established CVD (Lp(a) of 70 mg / dL or greater); ) the entire study population with CVD, and / or 2) established CVD (≥ 90 mg / dL) In the subpopulation with Lp, the extended MACE (cardiovascular death, non-fatal MI, non-fatal stroke) compared with placebo in reducing the risk of coronary revascularization (medical and emergency coronary revascularization requiring hospitalization) The objective of this study is to demonstrate the superiority of TQJ230 in the overall study population and subpopulations (90 mg / Secondary objectives in the NIH (≥ 1000 mg / kg) study were (i) CV death, non-fatal MI, and non-fatal stroke (MA); Demonstrate the superiority of TQJ230 compared to placebo in reducing the risk of CE complications (ii) coronary heart disease (CHD) outcomes (CHD death, non-fatal MI, and Compared with placebo, it reduces the combined risk of emergency coronary revascularization requiring hospitalization To demonstrate the superiority of TQJ230, and (iii) to evaluate the rate of all-cause mortality. is.

[0387] Based on the same scientific hypothesis, the study included: The other subpopulation is expected to be at higher risk, i.e., 90 mg / In patients with Lp(a) levels above 300 dL, two primary objectives are set: Successful achievement of the objectives requires the satisfaction of one or both of two primary objectives: A Clinical Endpoint Committee (CEC) will adjudicate all primary and secondary endpoints. The definitions of endpoints are contained in the CEC Charter and Endpoint Procedures, and are assigned to the CEC and the investigator, respectively. provided to the physician.

[0388] Primary objectives and endpoints: In the entire study population with established CVD and (Lp(a) ≥ 70 mg / dL) In this study, the extended MACE (cardiovascular death, non-fatal MI, non-fatal stroke, and emergency coronary events requiring hospitalization) ISIS 681257 compared with placebo in reducing the risk of arterial revascularization Demonstrate the superiority of the IVF therapy. Evaluation item: Patients with elevated Lp(a) of 70 mg / dL or more In this study population, the extended MACE (cardiovascular death, non-fatal MI, non-fatal stroke, and hospitalization) To evaluate the time to the first occurrence of confirmed CEC (requiring emergency coronary revascularization) and / or In the subpopulation with established CVD and Lp(a) ≥ 90 mg / dL, extended MA CE (cardiovascular death, nonfatal MI, nonfatal stroke, and emergency coronary revascularization requiring hospitalization) Demonstrated superiority of ISIS 681257 compared to placebo in reducing the risk of Endpoint: In a target population of patients with elevated Lp(a) ≥ 90 mg / dL The CEC confirmed extended MACE (cardiovascular death, non-fatal MI, non-fatal stroke, and admission) To assess the time to first occurrence of emergency coronary revascularization requiring hospitalization.

[0389] Secondary objectives and endpoints: In the overall study population and subpopulations (≥90 mg / dL): Profit in reducing the risk of the MACE composite of CV death, non-fatal MI, and non-fatal stroke Demonstrate superiority of ISIS 681257 compared to placebo. Endpoint: Confirmed by CEC The composite endpoint of MACE (CV death, non-fatal MI, and non-fatal stroke) was first observed. The time it takes to do this.

[0390] Coronary heart disease (CHD) outcomes (mortality, non-fatal MI, and emergency hospitalization due to CHD) ISIS 68 compared with placebo in reducing the combined risk of acute coronary revascularization Demonstrate the superiority of 1257. Evaluation items: Composite CHD evaluation items confirmed by CEC (CH Time to first occurrence of death, non-fatal MI, or emergency coronary revascularization requiring hospitalization .

[0391] The proportion of all-cause mortality will be assessed.

[0392] Endpoints: The CEC ascertained all causes of death from randomization to the end of the study.

[0393] Exploratory objectives and evaluation items: In the overall study population and subpopulations (≥90 mg / dL): Placebo in reducing the combined risk of all-cause mortality, nonfatal MI, and nonfatal stroke To evaluate ISIS 681257 in comparison with the 2016 FDA-approved ... Time to first occurrence of a composite of stroke and nonfatal stroke.

[0394] Composite of all vascular events (CV death, non-fatal MI, non-fatal stroke, emergency coronary artery disease requiring hospitalization) revascularization and emergency lower limb revascularization or amputation for ischemia) compared with placebo ISIS 681257 will be evaluated based on the following endpoints: total vascular events (CV death, non-fatal MI, Non-fatal stroke, emergency coronary revascularization requiring hospitalization, and emergency lower limb revascularization for ischemia Time to first occurrence of a composite endpoint (surgery or amputation).

[0395] All-cause mortality, non-fatal MI, non-fatal stroke, and emergency coronary revascularization requiring hospitalization ISIS 681257 will be evaluated compared to placebo for the composite endpoint. Eyes: all-cause mortality, non-fatal MI, non-fatal stroke, and emergency coronary revascularization requiring hospitalization Time to first occurrence of the composite endpoint.

[0396] Compared with placebo in reducing the risk of a composite of fatal and non-fatal stroke Evaluate SIS 681257. Endpoint: CEC-confirmed fatal and non-fatal stroke. The time until the first occurrence of Naka.

[0397] Major Adverse Limb Events (MALE) in Patients with a History of Peripheral Arterial Disease (PAD) The ratio was evaluated. Evaluation items: acute limb ischemia, limb amputation due to ischemia, or emergency Time to first lower extremity revascularization.

[0398] To evaluate the rate of hospitalization for unstable angina. Outcome: First hospitalization for unstable angina. The time it takes for this to occur.

[0399] To evaluate the rate of hospitalization due to heart failure. Outcome: Time to first hospitalization due to heart failure. Time at.

[0400] Changes in Lp(a) from baseline to the selected time point were assessed. Changes in Lp(a).

[0401] Changes in extended lipid profile parameters and hsCRP will be evaluated. Total cholesterol, LDL-C, apoB, and HDL-C from baseline at the time of administration , changes in non-HDL-C, triglycerides and hsCRP.

[0402] To assess the incidence of new-onset type 2 diabetes mellitus. Outcome: Diagnosis of type 2 diabetes mellitus Time until.

[0403] Assess quality of life. Outcome: Health and well-being from baseline at specified time points. Change in degree (SF-12 questionnaire).

[0404] Explore pharmacokinetics and immunogenicity in a subset of patients. Endpoint: ISIS 6 81257Drug exposure and antidrug antibody formation.

[0405] To evaluate the effects of ISIS 681257 on clinical endpoints in patients with aortic stenosis. Price items: Aortic valve surgery (percutaneous balloon aortic valvuloplasty, surgical (open heart) aortic valve (AV) ) replacement, transfemoral transcatheter AV replacement, transapical / transaortic AV replacement, valve-in-valve, Other) or time to first hospitalization for aortic stenosis.

[0406] research design This includes a history of myocardial infarction, ischemic stroke, or symptomatic peripheral arterial disease (PAD) and In subjects with established CVD as evidenced by elevated Lp(a) levels, A randomized, double-blind study comparing 80 mg of scQM ISIS 681257 with placebo This is a blinded, parallel-group, placebo-controlled, multicenter study. Approximately 30% of randomized subjects were randomized. The goal is to have had the index myocardial infarction at least 3 months prior to the procedure and within approximately 12 months. The study will involve a screening period of approximately two weeks, followed by a follow-up period of approximately four to one weeks. It consists of a 2-week period of CV risk factor therapy optimization, followed by a double-blind treatment period if necessary. The minimum follow-up period for the double-blind period was required to be 2.5 years, and the overall study duration was The estimated treatment duration is approximately 4.25 years, during which 993 primary endpoint events are expected to accumulate. The study will close when 993 major CV events have been accumulated or all subjects have reached at least 2. and 5 years of follow-up, whichever was later (see Figure 1).

[0407] Screening and post-screening randomization At study visits after the screening visit, subject eligibility and CV risk factors (e.g., blood to assess the need for optimization of treatment for hypertension, LDL cholesterol, and type 2 diabetes Meet the eligibility criteria and follow local practice / guidelines to treat LDL-cholesterol and Subjects who do not require further optimization of treatment for CV risk factors and / or other CV risk factors will be randomized. i.e., proceed directly to the Day 1 visit.

[0408] CV risk factor optimization (if necessary) and randomization of chemotherapy LDL-cholesterol (LDL-C) treatment and / or Only subjects who need further optimization of treatment for other CV risk factors are considered to be at risk for CV risk factors. Additional visits should be completed during the CV Risk Factor Therapy Optimization period. At each visit, subjects are required to undergo lifestyle changes according to international or equivalent local recommendations. Adhere to changes. Treatment of CV risk factors should be in line with local practice / guidelines. is optimized based on

[0409] Subjects will return to the site for a routine visit in approximately 4 weeks. Evaluate the efficacy and safety / tolerability of the treatments selected. can be adjusted as needed.

[0410] Treatment of CV risk factors should be further optimized according to local practices / guidelines Subjects who are not enrolled and meet the eligibility criteria may proceed to randomization (Visit Day 1). If further optimization of CV risk factor treatment is deemed necessary, patients should Complete the visit.

[0411] Approximately 4 weeks later, subjects return for another study visit: - Follow local practice / guidelines if further optimization of CV risk factor treatment is required Subjects who meet the eligibility criteria may proceed to randomization (visit Day 1). If further optimization of CV risk factor treatment is deemed necessary, The period of optimization will be extended by an additional 4 weeks, bringing the total treatment optimization to approximately 12 weeks. After completing the additional visit, eligible subjects will proceed to randomization (Day 1 visit).

[0412] Double-blind treatment period Eligible subjects will be approximately 18 months or older after screening or the "CV risk factor treatment optimization" period. 80 mg self-administered or administered by caregiver or facility personnel every 30 days Patients will be randomized to receive subcutaneous injections of ISIS 681257 QM or placebo. Stratification based on Lp(a) levels above or below 90 mg / dL at time of screening and geographic region was At the time of randomization, subjects will be included in the evaluation schedule for efficacy, safety, and other study-related evaluations. Follow the rules.

[0413] The following dose adjustments to LDL-C-lowering therapy may be made during the double-blind period: Interruption, dose reduction, or discontinuation of LDL-C lowering therapy should be avoided if there are adverse events necessitating such a change. This can be done in the following cases. Increased dose or addition of other LDL-C lowering therapy: Lipid assessments were blinded after the randomization visit. However, if LDL-C exceeds the pre-defined algorithm threshold, If the value is elevated from the initial examination (or earlier if this value is missing), This threshold algorithm alerts the investigator and allows for adjustment of LDL therapy. The terms and conditions of the study are provided and defined in the study protocol. The facility staff and all healthcare professionals involved in the care and management of the subjects were contacted at randomization (Day 1). A lipid panel should not be obtained between the time of the initial examination and the completion of the study. In such cases, all reasonable steps must be taken to prevent test subjects from learning of the results.

[0414] In addition, other risk factors for atherosclerotic disease, such as hypertension and diabetes mellitus, are also associated with increased risk of They should be optimally treated during the double-blind period according to local practice / guidelines. Concomitant CV risk reduction and IL-6 inhibition unless events necessitate dose adjustment The therapeutic dose of the agent must be stable.

[0415] Target population Approximately 7,680 patients (male and female) aged 18 to 80 years who met the eligibility criteria were randomized. To become.

[0416] Inclusion and Exclusion Criteria Key inclusion criteria: Lp(a) ≥ 70 mg / dL at screening Optimal LDL-cholesterol lowering treatment Optimal treatment of other CV risk factors Myocardial infarction: ≥3 months but ≤10 years prior to screening, and / or Ischemic stroke: ≥3 months but ≤10 years prior to screening, and / or Clinically significant symptomatic peripheral arterial disease

[0417] Main exclusion criteria: Uncontrolled hypertension Heart failure New York Heart Association (NYHA) Class IV History of malignant tumors of any organ system History of hemorrhagic stroke or other major bleeding Platelet count less than 140,000 per μL Active liver disease or liver dysfunction Serious kidney disease Pregnant or breastfeeding women

[0418] Detailed inclusion criteria To be eligible for this study, subjects must meet all of the following criteria: 1. Informed consent must be obtained before any evaluation is conducted. 2. Men and women aged 18 to 80 3. Lp(a) ≥ 70 mg / dL measured in a central laboratory at the time of screening 4. LDL-cholesterol-lowering therapy at the time of randomization, including: Subjects will be assessed to meet target LDL-C levels according to local practice / guidelines. should be receiving optimal LDL-C-lowering therapy, or Subjects meet target LDL-C levels according to local practice / guidelines If not, the highest tolerated dose of statins and / or other optimized LDL-lowering therapy (e.g., steroids) should be considered. treated with cerebrospinal fluid (e.g., cerebrospinal fluid ... Must be present or If the subject has contraindications or does not tolerate statin therapy, consult local practice / guidelines. In accordance with other optimized LDL-lowering therapies (e.g., ezetimibe, cholesterol absorption inhibitors) Patients must be currently being treated with anticoagulants (anticoagulants, fibrates, PCSK9 inhibitors). 5. At the time of the randomization visit, subjects must be monitored for other CV risk factors according to local practice / guidelines. It needs to be optimally treated. 6. Established CV disease is defined as any of the following three conditions: 1) Occurred more than 3 months and less than 10 years prior to the screening visit and documented as follows: History of cryptogenic myocardial infarction (not due to PCI or CABG) (Thygesen et al., “Fourth Universal Definition of M yocardial Infarction”,Circulation,p.e618 -e651,2018): Acute cardiac MI (hospitalization record): at least one value is above the 99th percentile of the upper reference limit (URL) Elevation and / or decrease of cardiac biomarkers (preferably cardiac troponin) above IL values and at least one record of the following: Symptoms of ischemia, ECG changes suggestive of acute myocardial ischemia (new ST-T changes or new LBBB; ST and (See Appendix 2 for changes in pulmonary circulation and T waves) the occurrence of pathological Q waves (see Appendix 2 for the definition of pathological Q waves), New loss of viable myocardium or new regional wall motion abnormalities in a pattern consistent with an ischemic etiology Evidence from images, - Identification of coronary artery thrombus by angiography, including intracoronary imaging; Previous MI (no complete hospital record of acute event): requires documentation of one of the following: do: Pathological Q waves in the absence of non-ischemic causes, with or without symptoms (pathological Q waves) For definitions, see Appendix 2), Imaging of lost areas of viable myocardium that are thinned and unable to contract in the absence of non-ischemic causes Evidence that 2) Screening patients, as documented by CT scan, MRI, or other visualization method Ischemic stroke (caused by infarction of central nervous system tissue) that occurred more than 3 months but less than 10 years prior to the examination History of acute episodes of focal brain, spinal cord, or visual dysfunction resulting from transient ischemic attack or embolic stroke (not of atherosclerotic origin) is not a qualifying event. 3) Intermittent claudication with ankle-brachial index of 0.90 or less and / or limb ischemia Clinically significant symptomatic peripheral arterial disease evidenced by amputation or revascularization. Thromboangiitis is not a qualifying event.

[0419] Detailed exclusion criteria Subjects meeting any of the following criteria are not eligible for this study: 1. Sitting systolic blood pressure (SBP) of 160 mmHg or greater at screening and / or or diastolic blood pressure (DBP) of 100 mmHg or more (3 in each evaluation of SBP and DBP) Uncontrolled hypertension, defined as a mean of 24 blood pressure measurements. 2. Treatment with niacin (including multivitamins) in the 3 months prior to screening Niacin contained in 3. A stable dose of a PCSK9 inhibitor (evolocumab, aliquot) less than 12 weeks prior to randomization Treatment with rocumab 4. Currently receiving lipoprotein apheresis treatment or already undergoing lipoprotein apheresis during the study Plan to start protein apheresis 5. Within 3 months of screening and between screening and randomization visit (Day 1) Between: myocardial infarction, stroke, coronary or lower limb revascularization, major cardiac or non-cardiac surgery. Elephants may be re-screened 3 months after the relevant event / action. 6. Cardiac, cerebrovascular, or peripheral arterial surgery or coronary artery revascularization after the randomization visit (Day 1) The operation is planned or anticipated 7. Heart failure at screening or randomization visit (Day 1) New York Heart Association (NYHA) Class IV 8. History of hemorrhagic stroke or other major bleeding or between the screening visit and the randomization visit If it occurs 9. Life expectancy less than 5 years at the screening or randomization visit (Day 1) Predicted severe non-CV complications 10. Investigator's judgment at the screening visit or randomization visit (Day 1) known active serious infection or significant hematologic, metabolic, gastrointestinal, or endocrine system disease due to dysfunction (e.g., poorly controlled thyroid dysfunction or poorly controlled diabetes mellitus) 11. Any cancer within the past 5 years or at screening, regardless of evidence of local recurrence or metastasis. Any organ system treated or untreated between the screening visit and the randomization visit (Day 1) History of malignant tumors (localized basal cell carcinoma or squamous cell carcinoma of the skin or in situ cervical carcinoma) (Excluding . 12. Confirmed by a second central laboratory test before the randomization visit (Day 1) Platelet count less than 140,000 per μL from central laboratory testing at presentation 13. Confirmed by a second central laboratory test before the randomization visit (Day 1) eGFR ≤ 30 mL / min / 1.73 m2 from a central laboratory test at the time of presentation; or dialysis Patients receiving 14. Confirmed by a second central laboratory test before the randomization visit (Day 1) Urinary protein-creatinine greater than 500 mg / g (50 mg / mmol) at presentation PCR test, significant glomerular disease (IgA nephropathy, diabetic nephropathy, systemic lupus erythematosus) (including, but not limited to, rheumatoid arthritis, lupus erythematosus, etc.) 15. Screening confirmed by a second central laboratory test prior to the randomization visit (Day 1) AST or ALT ≥2x ULN from central laboratory testing at the time of the screening visit Active liver disease or liver dysfunction as defined 16. Central clinical trial confirmed by a second central laboratory test before the randomization visit (Day 1). Total bilirubin ≥ 1.5 times ULN from the time of clinical screening 17. Positive HIV or Hepatitis C screening from central laboratory at screening visit or Hepatitis B surface antigen test 18. The investigator determines that the patient is unsuitable for enrollment or the patient is unable to participate in the study. or during or after the screening visit that may interfere with the completion of the Any other illness between the time of the test and the randomization visit (Day 1) 19. Treatment with oligonucleotide or siRNA within 9 months of screening The therapeutic exception is GalNac oligonucleotide or GalNac siRNA, Used when approved by the authorities and permitted for use in the study by the sponsor It is possible. 20. History of hypersensitivity to the investigational drugs or their excipients or drugs of a similar chemical class 21. Any other condition within 5 half-lives or 30 days of the screening visit, whichever is longer. Use of the investigational drug 22. Unwillingness or inability to comply with study procedures and drug administration (injections) and schedules Unable to do something (e.g., physical or cognitive incapacity) 23. Pregnant or lactating women 24. Subjects who are physiologically capable of becoming pregnant unless they are using highly effective contraception while receiving the study drug. Women of childbearing potential, defined as any woman who is pregnant or has had a childbearing capacity. Such methods include: Can be: Complete abstinence (if this is consistent with the subject's preferred normal lifestyle). Abstinence (e.g., calendar, ovulatory, symptomatic, postovulatory methods) and withdrawal are acceptable forms of contraception. This is not a good way Female sterilization (with or without hysterectomy) at least 6 weeks prior to receiving study treatment underwent surgical bilateral oophorectomy, total hysterectomy, or bilateral tubal ligation. Ovariectomy only , only if the woman's reproductive status is confirmed by follow-up hormone level assessment. Male sterilization (at least 6 months prior to screening). and the vasectomized male partner must be the only partner Oral, (estrogen and progesterone), injected, or implanted hormonal contraception; or Placement of an intrauterine device (IUD) or intrauterine system (IUS) or equivalent effectiveness ( Other forms of hormonal contraception with a failure rate of <1%, such as the hormonal vaginal ring or transdermal Use of the Lumon contraceptive method If using oral contraceptives, women must be stable on the same pill for at least 3 months before receiving study treatment. It must be.

[0420] have an appropriate clinical profile (e.g., age, appropriate history of vasomotor symptoms) and Women who have experienced natural (spontaneous) amenorrhea for months or have had a surgical procedure at least 6 weeks prior Bilateral oophorectomy (with or without hysterectomy), total hysterectomy, or bilateral tubal ligation Women who undergo oophorectomy are considered postmenopausal and of no childbearing potential. Only if the woman's reproductive status is confirmed by hormone level assessment will childbearing be possible. It is considered to be

[0421] If local regulations deviate from the above methods of contraception to prevent pregnancy, local regulations shall apply. This will be used and documented in the Informed Consent Form (ICF).

[0422] treatment Subjects received 80 mg scQM of the compound ISIS 681257 or placebo subcutaneously. Patients will be randomized 1:1 to receive injections. Injections will be self-administered or administered by a caregiver once a month. The compound ISIS 681257 was administered subcutaneously, and needle tip protection (NSD) was used for the syringe. For details on how the injections are administered, see below. Prescribing and administering the study treatment Instructions for use.

[0423] The test drugs and control drugs used in this study are shown in Table 1 below.

[0424] [Table 6]

[0425] Treatment duration The study duration is expected to be approximately 4.25 years, with a minimum follow-up period of approximately 2.5 years (mortality or withdrawal of consent); during this period, the required number of confirmed primary endpoint events will be accumulated. The study will end when 993 major CV events have been accumulated or when all subjects have or at least 2.5 years of follow-up, whichever is later. Interruption of study drug for safety reasons and / or at the discretion of the investigator or subject Subjects will continue to be followed unless they withdraw their informed consent.

[0426] Other treatments All medications, procedures, and significant non-pharmacological treatments used by subjects in the 3 months prior to randomization were Previous / concomitant medications / significant non-medicinal medications, independent of whether these are continued during the study. Each concomitant medication should be recorded on the electronic case report form (eCRF) page for the medication or procedure. , should be evaluated individually against all exclusion criteria.

[0427] All medications, procedures, and significant non-pharmacological treatments (e.g., steroids) administered after the subject was enrolled in the study Physical therapy, lifestyle advice, blood transfusions, etc.) must also be recorded on the corresponding eCRF page. New concomitant medications should be evaluated against prohibited substances before initiation. Medications and antiplatelet drug dosages should be recorded throughout the study.

[0428] If in doubt, the investigator should review the data before randomizing the subject or allowing the initiation of a new medication. If a subject is already enrolled, you must contact the Novartis medical monitor before enrolling. If so, contact Novartis to determine whether the subject should continue on the drug trial. .

[0429] Subjects participating in a clinical trial or their caregivers should be aware of any risk factors that may cause thrombocytopenia and / or bleeding. Potential concomitant therapy (e.g., heparin, oral anticoagulants, direct thrombin inhibitors, factor Xa inhibitors) The blood samples were collected to ensure that the blood sugar levels (e.g., blood sugar inhibitors and niacin) were appropriately administered and the subjects were carefully monitored. The potential risk of thrombocytopenia should be communicated to healthcare professionals not involved in this study. Recommended. A target card containing information about potential bleeding risks will be provided at the randomization visit. It will be provided to the subject at time (Day 1).

[0430] Prohibited drugs The use of the treatments presented in Table 2 below is not permitted.

[0431] [Table 7]

[0432] Dose Escalation and Modification Dose Escalation and Modifications - Discontinuation of investigational treatment is not permitted unless there is a safety reason. do not have.

[0433] screening Screening activities begin only after the patient signs the Informed Consent Form (ICF) Rescreening must be performed from the time of the first screening visit. One time is permitted within six months.

[0434] If the safety laboratory evaluation at screening is outside the scope specified in the exclusion criteria, The evaluation required by the If so, the subject is not eligible for the study.

[0435] Demographic / other baseline characteristics of subjects Patient demographic and baseline characteristics data will be collected for all subjects. Based on age, sex, race, ethnicity, patient referral source, relevant family and personal medical history / disclosure Current medical conditions (record diagnoses, not symptoms, if possible) before signing consent ) and relevant laboratory tests at the time of screening.

[0436] If the investigator determines that a test abnormality occurred before the informed consent was signed, have the discretion to record abnormal laboratory findings on the medical history eCRF.

[0437] Effectiveness Efficacy will be assessed by the Clinical Endpoint Committee on CV death, non-fatal myocardial infarction, and non-fatal stroke. , evaluated by emergency coronary revascularization requiring hospitalization.

[0438] The effectiveness evaluations are listed below along with an evaluation schedule detailing when each evaluation will be performed. Specified below. Efficacy Assessment 1 - An independent CEC blinded to treatment allocation will assess the primary and secondary outcomes. All clinical events that comprise the composite endpoint will be reviewed and adjudicated. Efficacy evaluation 2 - Efficacy biomarkers Lp(a), hsCRP, ApoB and total cholesterol Sterols, LDL-cholesterol, non-HDL-cholesterol, HDL-cholesterol The changes from baseline in the study endpoints of steroids and triglycerides will be evaluated. After the first day, Lp(a) and total lipids (total cholesterol, LDL-cholesterol, Regarding the results of non-HDL cholesterol, HDL cholesterol and triglycerides Therefore, subjects, research staff, those performing the assessments, and the CTT must be blinded. do.

[0439] Increase in LDL-C from randomization value beyond a pre-defined algorithm threshold If a random value is missing, the most recent value measured in the central laboratory before randomization If the level of HIV infection increases from 100% to 100%, the investigator will be alerted by the central laboratory. The investigators involved in the conduct of the trial and all site staff and medical personnel involved in the care and management of the subjects Employees should refrain from obtaining lipid panels between randomization (Day 1) and study completion. When obtaining a lipid panel, every reasonable effort should be made to conceal the results from the test subject. Appropriate measures must be taken.

[0440] safety Primary safety assessments included monitoring for adverse events, physical examination, laboratory evaluations, and ECG measurements. This includes the following:

[0441] At the screening visit (first visit), a complete physical examination is performed, and at subsequent visits At the time of the study visit, only a brief physical examination was performed, and at the remaining study visits, only a brief physical examination was performed. cormorant.

[0442] Additional evaluation Clinical Outcome Assessment (COA) Health and well-being of enrolled subjects during the double-blind treatment period were assessed using the SF-12 questionnaire. The SF-12 v2 is assessed using the same 8-point scale as the SF-36. It covers four health areas and asks significantly fewer questions, making it more accessible for patients with chronic conditions. It will be a practical research tool.

[0443] The absolute values ​​and changes from baseline of the domain-specific scores and the two summary scores were: The scores are summarized descriptively by visit and treatment. Also, the baseline scores after BL for the two summary scores are Between-treatment analyses are also provided based on statistical models of change from baseline.

[0444] The above analyses will be conducted on FAS patients for whom SF-12 data were collected.

[0445] Biomarkers Blood samples to assess Lp(a) will be collected at specific study visits. Other blood biomarkers used for titration are hsCRP and apoB.

[0446] Data analysis The primary efficacy variable (time to first occurrence of the primary endpoint event) was determined by treatment, region, and Subpopulation indicators (baseline Lp(a) levels less than or equal to 90 mg / dL) and subpopulation Analysis was performed using a Cox proportional hazards model with the interaction term of treatment by group index as a factor. The two primary endpoint hypotheses were based on weighted regression analysis according to the principles of Glimm et al. The test is performed using the FT test.

[0447] Secondary endpoints will be analyzed using the same Cox regression model as the primary analysis model.

[0448] The estimated hazard ratios for the full and subpopulations from these Cox regression models and the corresponding Two-sided confidence intervals and p-values ​​are provided separately.

[0449] MACE composite (CV death, non-fatal MI, and non-fatal stroke) in the total population and subpopulations and Coronary composite (death due to CHD events, non-fatal MI, and emergency coronary revascularization requiring hospitalization) The primary and secondary endpoints were tested using a closed multiple testing procedure to limit type I error. Included.

[0450] The type I error rate for the entire study was kept to 2.5% (one-sided). The one-sided alpha level was 2.45% after accounting for the alphas used in the two interim efficacy analyses .

[0451] Hypotheses for all-cause mortality in the full population and subpopulations were tested separately with a perfect alpha (one-sided 2.5%). Efficacy analysis will be performed on the full analysis set (FAS).

[0452] detail: Analysis of primary endpoints The primary objective of the study was to assess the risk of extended major adverse cardiovascular events (cardiovascular death, non-fatal MI, non-fatal MI). compared with placebo in reducing fatal stroke and emergency coronary revascularization requiring hospitalization Unless otherwise stated, the event All analyses of time to outcome were based on adjudicated events occurring during the double-blind treatment period of the study. .

[0453] The primary patient population to which the proposed analysis applies is all subjects in the FAS (total population) and and subjects (subpopulation) in the FAS with baseline Lp(a) levels ≥ 90 mg / dL. The primary endpoint, defined below, will be the same outcome as study discontinuation or death from non-CV causes. The cause-specific hazard ratio is estimated by assuming that the events occurring at the time are random. The period of use is until the occurrence of the event of interest or otherwise until the censoring time, regardless of compliance. Use available tracking data. The analysis set on which the analysis is based is the full analysis set (F AS).

[0454] In this patient population, estimates of interest were based on the inclusion criteria, including the effect of region. Established CV disease and Lp(a) ≥ 70 mg / dL (total study population) and / or major M in subjects with Lp(a) ≥ 90 mg / dL (subpopulation of interest) The endpoints of interest and all supporting data for the proposed estimates regarding reduction in ACE rates were included. Details are provided below for the proposed evaluation of the benefits of treatment in the target population and subpopulations of interest. are.

[0455] Primary endpoint definition The primary efficacy variables were cardiovascular death, nonfatal MI, nonfatal stroke, and emergency coronary events requiring hospitalization. The most common outcome was the expansion of major adverse cardiovascular events (MACE), a composite endpoint consisting of arterial revascularization. The independent CEC is the time to first occurrence of a clinical outcome that constitutes the composite primary endpoint. Events will be reviewed and adjudicated on a blinded basis.

[0456] Time to event will be calculated as the number of days from randomization to the start of the primary endpoint. Data on subjects who do not reach the primary endpoint by the end date indicates that the trial is at risk. Terminate on the latest known date.

[0457] Statistical models, hypotheses and analytical methods The two primary statistical null hypotheses to be tested are: H 10 :λ 12 / λ 11 ≧1 vs. H 1a :λ 12 / λ 11 <1(1) H 20 :λ 22 / λ 21 ≧1 vs H 2a :λ 22 / λ 21 <1(2) In the formula, λ11, λ 12 and λ 21 , λ 22 was initially identified by the CEC, and The hazard of expanded MACE in the ISIS 681257 and placebo groups in the subpopulations was calculated as follows: Each is shown below.

[0458] The primary efficacy variable was treatment, region, and subpopulation indicators (baseline < or ≥ 90 mg / dL). The factors were the line Lp(a) level and the interaction term between treatment and subpopulation indicators. The analysis was performed using a proportional hazards model. t al.,“An approach to confirmatory testi of subpopulations in clinical trials, Biom J., p.897-913, 2015) Using a net test approach, two main hypotheses are tested: The model can be expressed as follows: λ(t)=λ0(t) * exp(β1*x1+β2*x2+β3*x3+β4*x1*x 3) (3) where λ(t) is the hazard at time t, λ0(t) is the baseline hazard, and x i (i=1, 2, 3) is a covariate. More specifically, x1 is the treatment group indicator, x2 is the regional indicator, x3 is the subpopulation indicator (Lp(a) less than or equal to 90 mg / dL) and and x1*x3 are the interaction terms of treatment by subpopulation indicators. The model is such that β1+β4 Log hazard ratios for ISIS 681257 versus placebo in subpopulations, β1 + wβ4 = overall The parameters were calculated to be the log hazard ratio of ISIS 681257 to placebo in the target population. where w is the proportion of patients in the subpopulation with Lp(a) ≥ 90 mg / dL. be.

[0459] In model (3), the two main hypotheses (1) and (2) can be expressed equally as follows: . H 10 :β1+wβ4≧0 vs H 1a :β1+wβ4<0(4) H 20 :β1+β4≧0 vs H 2a :β1+β4<0(5)

[0460] As shown in Glimm et al. (2015), two hypotheses (4) and (5 The two test statistics derived from model (3) of (2) are asymptotically bivariate normal. Based on these two test statistics, the Dunnett test critical value and the correction factors for the two main hypotheses are calculated. Calculate the one-sided p-value. The type I error for the entire study is limited to 2.5% (one-sided). Final analysis The one-sided significance level α used in the interim analysis was determined based on the interim analysis plan, taking into account the α used in the interim analysis. After that, the rate will be set at 2.45%.

[0461] The assay procedure is shown in Figure 3 and outlined in the following steps: First, equal weights were assigned to each of the two main hypotheses (H10 and H20). A weighted Dunnett's test will be performed to compare the primary endpoint between the entire population and the subpopulations. Correlation is used and test statistics are derived from the primary analytical model as described above. If one primary hypothesis is rejected, part of its significance level is passed on to another primary hypothesis. On the other hand, the remaining α is calculated from the same population according to the predetermined weights as shown in the graph. This will be propagated to the family of secondary endpoints. Within a family of secondary endpoints (H1i or H2i), weighted Simes tests were performed. Use established procedures. If both secondary hypotheses are rejected in the full population, α is propagated to the primary endpoint in the subpopulation. The reverse is true for the propagation of α from H2i to H10 (see Figure 3). Secondary (H1i or H2i) nodes are related to the first two secondary endpoints in the overall population and in the subpopulations. Represents a family of related null hypotheses. Secondary outcomes of all-cause mortality in the total population and subpopulations Items are not included in the multiple testing procedure.

[0462] If at least one of the two main hypotheses is rejected in the above test procedure, the test is considered successful. It can be argued that

[0463] Estimated hazard ratios for the total population and subpopulations from Cox regression models (3) and corresponding untreated controls Adjustment and two-sided confidence intervals will be provided separately. The primary analysis will use FAS.

[0464] Analysis of secondary endpoints Secondary endpoints There were three secondary endpoints defined, and for each of these three secondary endpoints, There are six secondary hypotheses that are tested in the whole population and in subpopulations: Time to first occurrence of the composite endpoint of MACE confirmed by CEC: CV death, non-fatal Fatal MI and non-fatal stroke - H11 and H21 are associated with the overall population and subpopulations This is a secondary hypothesis. Time to first occurrence of a composite CHD outcome identified by the CEC: CHD death; Non-fatal MI, emergency coronary revascularization requiring hospitalization - H12 and H22 are for the whole population and and related secondary hypotheses in subpopulations. Time from randomization to all-cause mortality at the end of the study - H13 and H23 are These are secondary hypotheses related to populations and subpopulations.

[0465] All secondary endpoints were analyzed using the same Cox regression model as the primary analysis model above. The estimated hazard ratios for the full and subpopulations from these Cox regression models were analyzed using FAS. and the corresponding two-sided confidence intervals and p-values ​​are provided separately.

[0466] As mentioned above, the secondary hypotheses H1i (including H11 and H12) and H2i (including H21 and H The two families (including 22) are included in the multiple testing procedure presented in Figure 3. The weighted S The next step is to use the Λmes test to identify the two families within each family (H1i or H2i). We separately test the secondary hypotheses of First, from the above Cox regression model for two secondary endpoints in one family, Two nominal p-values ​​(e.g., p11 and coronary p12 for MACE in the total population) p12) for the cardiac composite endpoint was compared with the α given to this family as specified in Figure 3. If both nominal p-values ​​are less than or equal to this limiting α, then both The secondary hypothesis is rejected, otherwise continue. Using predefined weights of 0.8 and 0.2, we calculated the individual nominal p-values. The p-value of MACE is 80% or less of the local α. If the p-value of the coronary composite endpoint is greater than 2 of local α, the null hypothesis of MACE is rejected. If it is less than or equal to 0%, the null hypothesis for the coronary composite endpoint is rejected.

[0467] The hypotheses corresponding to all-cause mortality for the total population and subpopulations (H13 and H23) were tested using a multiple testing procedure. The Kaplan-Meier regressions by treatment are not included in the analysis and are tested separately with a full alpha (one-sided 2.5%). Plots are provided separately for each secondary endpoint in the overall population and subpopulations. Composite secondary endpoint The components of the secondary composite will also be analyzed separately using the same Cox regression model as the primary analysis. The frequency and percentage of patients who achieved the endpoints will be provided by treatment group in the FAS. Composite secondary endpoints based on physician-reported events and their components were also analyzed. It is presented.

[0468] Case Count Primary endpoint The following sample size estimates are for ISIS 681 after adjusting for the planned interim efficacy analysis. Based on a 1:1 randomization between 257 and placebo and a one-sided significance level of 0.0245. The calculation was performed in two steps. First, for the primary endpoint of MACE, all subjects were included. A traditional log-rank test was used for the main hypotheses in the population at a one-sided significance level of 0.01225. The calculations were performed using the Bonferroni α split (assuming a more conservative split between the two main hypotheses). (This is the case.)

[0469] Hazard ratio for the first 12 months after randomization was 0.90, and then 12 months later, The distribution is constant at 0.764, which favors the ISIS 681257 group and follows a piecewise exponential distribution. Under this assumption, 993 primary endpoint MA The incidence of CE events (i.e., 993 subjects with MACE events during the double-blind period) was 0.01 A one-sided alpha level of 225 provides a power of approximately 88%.

[0470] The annualized primary endpoint MACE event rate in the placebo group was 4.6% and the enrollment period was 1 0.5 years, maximum follow-up was 4.25 years, and the primary endpoint was loss to follow-up or non-cardiovascular death. Assuming a cumulative censoring rate of 10%, 993 primary endpoint MACE events were obtained. A caseload of 7,680 people would be needed to achieve this.

[0471] The assumption of a 4.6% annual event rate for the primary composite endpoint event was based on the FOURIER Based on experimental data (Sabatine et al., “Evolocumab a nd Clinical Outcomes in Patients with Ca rdiovascular Disease”, N.Engl.J.Med., p.17 13-1722, 2017). The hazard ratio for the first 12 months after randomization was 0.90. However, assuming that the hazard ratio after 12 months is constant at 0.764, the enrollment period is 1.5 years, and the maximum The long follow-up period of 4.25 years corresponds to a hazard ratio of 0.805 for the entire double-blind period. (i.e., a 19.5% hazard ratio for ISIS 681257 compared with placebo) decrease).

[0472] The power of the overall study and the two primary hypotheses was then assessed using the testing procedures described above. 3 is the number of cases (7,680) calculated in step 1 above and the number of events for the primary endpoint (993) The potential true magnitude of the effect of TQJ230 compared with placebo assumed in the first two columns. The power of the study at a one-sided alpha of 2.45% is shown, considering various scenarios of statistical significance. .

[0473] [Table 8]

[0474] The annualized primary endpoint event rate in the placebo group was 4.6% in the overall study population and 4.6% in the Lp(a ) was 5.06% for subjects with Lp(a) of 90 mg / dL or more, and 5.06% for subjects with Lp(a) of less than 90 mg / dL. So we assumed it was 4.14%.

[0475] Calculations were performed using the software package R (version 3.4.3).

[0476] The required number of events must be achieved within an acceptable time period and to maintain the target power of the study. The primary endpoint was determined so that the number of subjects randomized and the length of follow-up period could be adjusted accordingly. Event rates will be monitored in a blinded manner. The last randomized subject will be followed for a minimum of 2.5 years. Given the intent of the study protocol to ensure that It is expected that the number of elephants may be larger than the number of events derived in the case size calculation.

[0477] equivalent Those skilled in the art will be able to, using no more than routine experimentation, identify and / or modify the particular embodiments specifically described herein. Many equivalents of the following will be recognized or identified. It is intended to be encompassed by the claims.

Claims

1. A pharmaceutical composition comprising a compound or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable diluent or carrier, for reducing the risk of cardiovascular death, non-fatal myocardial infarction, non-fatal stroke, or emergency coronary revascularization, The pharmaceutical composition comprises 75 mg to 85 mg of the compound or a pharmaceutically acceptable salt thereof. The compound has the following structure: 【Chemistry 1】 The aforementioned pharmaceutical composition is formulated for monthly subcutaneous administration to human patients, and When the pharmaceutical composition is administered to human patients with cardiovascular disease and elevated Lp(a) levels, the overall risk of cardiovascular death, non-fatal myocardial infarction, non-fatal stroke, and emergency coronary revascularization is reduced by a statistically significant amount compared to human patients who did not receive the pharmaceutical composition, where the statistically significant reduction in the overall risk is at least 5%. The aforementioned pharmaceutical composition.

2. The pharmaceutical composition according to claim 1, wherein the pharmaceutical composition comprises 80 mg of the compound.

3. The pharmaceutical composition according to claim 1, wherein the patient has an elevated Lp(a) level of 70 mg / dL or more prior to the first administration of the compound.

4. The pharmaceutical composition according to claim 1, wherein the compound is in the form of a sodium salt.

5. The pharmaceutical composition according to claim 4, wherein the compound has the following structure: 【Chemistry 2】

6. The pharmaceutical composition according to claim 1, wherein the statistically significant relative amount that reduces the overall risk is at least 10%.

7. The pharmaceutical composition according to claim 1, wherein the statistically significant relative amount that reduces the overall risk is at least 15%.

8. The pharmaceutical composition according to claim 5, wherein the statistically significant relative amount that reduces the overall risk is at least 10%.

9. The pharmaceutical composition according to claim 5, wherein the statistically significant relative amount that reduces the overall risk is at least 15%.

Images