Cell death inducing agent, pharmaceutical composition, and cancer cell detecting agent

Abstract

To provide a cell death-inducing agent capable of inducing cell death of cancer cells based on a new mechanism, a pharmaceutical composition for treating or preventing cancer comprising the cell death-inducing agent, and a cancer cell-detecting agent for detecting cancer cells to which the cell death-inducing agent can be applied.SOLUTION: An agent for inducing apoptosis of cancer cells expressing IFI16, ASC, and Caspase-1, the agent comprising a polynucleotide having at least one repeat unit in a repeat sequence of telomeric DNA.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a cell death inducer, a pharmaceutical composition for treating or preventing cancer, and a cancer cell detection agent for detecting cancer cells to which the cell death inducer can be applied. [Background technology]

[0002] Cancer remains one of the leading causes of death. Common cancer treatments include chemotherapy, radiation therapy, and surgery. However, these conventional treatments have various problems, such as side effects, the possibility of losing some bodily functions, and the risk of cancer recurrence or metastasis. Patent Document 1 reports that antisense nucleic acids against RNA transcripts of dysfunctional telomeric DNA suppress the cell proliferation of ALT-positive cancer cells.

[0003] The inventors previously succeeded in developing a new culture method called the MGS (mixed-glial culture on / in soft substrate) method, which enabled the long-term stable maintenance of primary cultured glial cells, which had previously been technically difficult. Microglia, one type of glial cell, are immune cells in the central nervous system. Microglia are known to induce cell death in cancer cells, but the mechanism by which they induce cell death remains unclear.

[0004] Types of cell death include apoptosis, which is programmed cell death, and necrosis, which is passively or actively controlled. Among necrotic processes, the type of cell death that occurs in immune cells in response to microbial or viral infection is called pyroptosis. The induction pathway of pyroptosis begins with the activation of intracellular proteins that recognize foreign molecules. Known intracellular proteins include NLRC4, NLRP1, NLRP3, NLRP6, NLRP7, NLRP9, NLRP12, CARD8, AIM2, IFI16, and Pyrin. For example, NLRP3 recognizes foreign toxins, NLRC4 recognizes foreign proteins, and IFI16 recognizes foreign DNA. Intracellular proteins that recognize foreign molecules bind to caspase-1 via an adaptor molecule called ASC, forming a complex called the inflammasome. Caspase-1, activated by the formation of the inflammasome, induces pyroptosis. [Prior art documents] [Patent documents]

[0005] [Patent Document 1] Patent No. 7023834 Summary of the Invention [Problem to be solved by the invention]

[0006] The use of conventional anticancer drugs, a common cancer treatment method, has the problem of developing cancers that are resistant to the drugs. Therefore, there is a need to develop cancer treatment drugs based on new mechanisms.

[0007] The present invention has been made in consideration of the above circumstances, and aims to provide a cell death inducer capable of inducing cell death in cancer cells based on a new mechanism, a pharmaceutical composition for treating or preventing cancer containing the cell death inducer, and a cancer cell detection drug for detecting cancer cells to which the cell death inducer can be applied. [Means for solving the problem]

[0008] The present invention includes the following aspects. [1] A cell death inducer for cancer cells expressing IFI16, ASC, and Caspase-1, comprising a polynucleotide having at least one repeat unit in a repeat sequence of telomeric DNA. [2] The repeat sequence has the following nucleotide sequence: (TTAGGG) n , (TAGGGT) n , (AGGGTT) n , (GGGTTA) n , (GGTTAG) n , and (GTTAGG) n It is a repeat sequence represented by either In the nucleotide sequence, n is 1 or more. [1] The cell death inducer described in [1]. [3] The cell death inducer according to any one of [1] and [2], wherein the cell death of cancer cells induced by the cell death inducer is dependent on Caspase-1. [4] The cell death inducer according to [2], wherein in the nucleotide sequence, n is 4 or more. [5] The cell death inducer according to [2], wherein in the nucleotide sequence, n is 5 or more. [6] The cell death inducer according to any one of [1] and [2], A pharmaceutical composition used for treating or preventing cancer having cancer cells that express IFI16, ASC, and Caspase-1. [7] At least one selected from the group consisting of the following (A) to (C): A cancer cell detection agent used to detect cancer cells to which the cell death inducer according to [1] or [2] can be applied: (A) a combination of a reagent for detecting at least one selected from the group consisting of IFI16 protein and mRNA, a reagent for detecting at least one selected from the group consisting of ASC protein and mRNA, and a reagent for detecting at least one selected from the group consisting of Caspase-1 protein and mRNA; (B) a combination of a reagent for detecting a complex containing IFI16 protein and ASC protein and a reagent for detecting at least one selected from the group consisting of Caspase-1 protein and mRNA; and (C) A combination of a reagent for detecting a complex containing an ASC protein and a Caspase-1 protein and a reagent for detecting at least one species selected from the group consisting of an IFI16 protein and mRNA. [8] The reagent for detecting at least one selected from the group consisting of IFI16 protein and mRNA is a substance that specifically binds to the IFI16 protein or mRNA, the reagent for detecting at least one selected from the group consisting of the ASC protein and mRNA is a substance that specifically binds to the ASC protein or mRNA, the reagent for detecting at least one selected from the group consisting of Caspase-1 protein and mRNA is a substance that specifically binds to the Caspase-1 protein or mRNA, the reagent for detecting a complex containing the IFI16 protein and the ASC protein is a substance that specifically binds to an interaction region of the IFI16 protein and the ASC protein in the complex containing the IFI16 protein and the ASC protein; A cancer cell detection drug described in [7], wherein the reagent for detecting a complex containing the ASC protein and the Caspase-1 protein is a specific binding substance for the interaction region of the ASC protein and the Caspase-1 protein in the complex containing the ASC protein and the Caspase-1 protein. [Effects of the Invention]

[0009] According to the present invention, it is possible to provide a cell death inducer capable of inducing cell death in cancer cells based on a new mechanism, a pharmaceutical composition for treating or preventing cancer containing the cell death inducer, and a cancer cell detection drug for detecting cancer cells to which the cell death inducer can be applied. [Brief explanation of the drawings]

[0010] [Figure 1] FIG. 1 is a schematic diagram illustrating the MGS method carried out in the examples. [Figure 2] 1 shows a fluorescence microscope image of PC9 cells (PC9) co-cultured with astrocytes and microglia (mixed-glia) in Experimental Example 1. [Figure 3] 1 shows a fluorescence microscope image of PC9 cells (PC9) and microglia (Microglia) co-cultured in Experimental Example 2. [Figure 4] 1 is a graph showing the relative number of surviving PC9 cells when PC9 cells were cultured alone (Mono), co-cultured with astrocytes (+Astrocyte), or co-cultured with microglia (+Microglia) in Experimental Example 2. [Figure 5] 10 is a graph showing the relative number of surviving PC9 cells when si-RNA-transfected PC9 cells were co-cultured with astrocytes and microglia in Experimental Example 3. [Figure 6] 10 is a graph showing the relative number of surviving PC9 cells when si-RNA-transfected PC9 cells were co-cultured with astrocytes and microglia in Experimental Example 4. [Figure 7] 10 is a graph showing the relative number of surviving PC9 cells when PC9 cells transfected with microglia genomic DNA (Microglia gDNA) or vector DNA (pCX4 vector) were cultured alone in Experimental Example 5. [Figure 8] 10 is an image showing the results of immunoblotting with an anti-IFI16 antibody of PC9-CT cells (PC9) or PC9-IFI16-KO cells (PC9-IFI16-KO) in Experimental Example 6. [Figure 9] 10 is a graph showing the relative number of surviving cells when PC9-CT cells (PC9) or PC9-IFI16-KO cells (PC9-IFI16-KO) into which a telomeric DNA repeat sequence had been introduced were cultured alone in Experimental Example 6. [Figure 10] 10 is an image showing the results of immunoblotting with an anti-IFI16 antibody of MDA-MB-231-CT cells (MDA-MB-231) or MDA-MB-231-IFI16-KO cells (MDA-MB-231-IFI16-KO) in Experimental Example 7. [Figure 11] 10 is a graph showing the relative number of surviving cells when MDA-MB-231-CT cells (MDA-MB-231) or MDA-MB-231-IFI16-KO cells (MDA-MB-231-IFI16-KO) into which a telomeric DNA repeat sequence had been introduced were cultured alone in Experimental Example 7. [Figure 12] 10 is an image showing the results of immunoblotting with an anti-IFI16 antibody of LN229-CT cells (LN229) or LN229-IFI16-KO cells (LN229-IFI16-KO) in Experimental Example 8. [Figure 13] 10 is a graph showing the relative number of surviving cells when LN229-CT cells (LN229) or LN229-IFI16-KO cells (LN229-IFI16-KO) into which a telomeric DNA repeat sequence had been introduced were cultured alone in Experimental Example 8. DETAILED DESCRIPTION OF THE INVENTION

[0011] [Cell death inducers] In one embodiment, the present invention provides a cell death inducer for cancer cells expressing IFI16, ASC, and Caspase-1, the cell death inducer comprising a polynucleotide having at least one repeat unit in a telomeric DNA repeat sequence.

[0012] <Cancer cells> "IFI16" refers to interferon-inducible protein 16. IFI16 is composed of a PYRIN domain and a HIN-200 domain. The HIN-200 domain interacts with DNA, allowing IFI16 to recognize viral and bacterial DNA and function as a DNA sensor during the innate immune response. Examples of the amino acid sequence of human IFI16 include NP_001193496.1, NP_001351796.1, NP_001363516.1, NP_001363517.1, NP_001363518.1, NP_001363520.1, NP_001363521.1, and NP_005522.2. IFI16 is encoded by the IFI16 gene. Examples of the nucleotide sequence of the human IFI16 gene include RefSeq accession numbers NC_000001.11 and NC_060925.1. "ASC" refers to a CARD-containing apoptosis-associated speck-like protein. The CARD is a caspase recruitment domain. ASC is composed of a PYRIN domain and a CARD. ASC acts as an adaptor molecule connecting IFI16 and caspase-1, which will be described later. Examples of the amino acid sequence of human ASC include NP_037390.2 and NP_660183.1. ASC is encoded by the PYCARD gene. Examples of the nucleotide sequence of the human PYCARD gene include RefSeq accession numbers NC_000016.10 and NC_060940.1. "Caspase-1" is a member of the protease family and induces inflammatory cell death. Examples of the amino acid sequence of human caspase-1 include NP_001214.1, NP_001244047.1, NP_001244048.1, NP_150634.1, NP_150635.1, NP_150636.1, and NP_150637.1. Caspase-1 is encoded by the CASP1 gene. Examples of the nucleotide sequence of the human CASP1 gene include RefSeq accession numbers NC_000011.10 and NC_060935.1. The PYRIN domain of IFI16 binds to the PYRIN domain of ASC. The CARD of ASC also binds to the precursor of caspase-1, inducing caspase-1 activation. The complexes formed by the interaction of IFI16 with ASC and the interaction of ASC with caspase-1 further polymerize to form inflammasomes.

[0013] The cell death induced by the cell death inducer of this embodiment is preferably caspase-1-dependent cell death. "Caspase-1-dependent cell death" refers to cell death induced by the action of caspase-1. The caspase-1 precursor undergoes autocleavage during inflammasome formation and is self-activated as caspase-1. Activated caspase-1 induces cell death by cleaving gasdermin D, the precursor of IL-1β, and the precursor of IL-18. Caspase-1-dependent cell death is preferably pyroptosis.

[0014] Cancer cells targeted by the cell death inducer of this embodiment, i.e., cancer cells expressing IFI16, ASC, and Caspase-1, can be detected using the cancer cell detection agent described below.

[0015] <Polynucleotide> The cell death inducer of this embodiment comprises a polynucleotide having at least one repeat unit in the repeat sequence of telomeric DNA.

[0016] Unless otherwise specified, a "nucleotide sequence" is written in a 5' to 3' direction.

[0017] "Telomeric DNA" refers to DNA contained in telomeres. Telomeric DNA is present at the ends of eukaryotic chromosomes and is composed of repeated specific nucleotide sequences. Telomeric DNA is transcribed into RNA that does not encode protein genes and plays roles such as protecting telomeres, forming heterochromatin, and suppressing telomerase.

[0018] The term "telomeric DNA repeat sequence" refers to a nucleotide sequence of telomeric DNA composed of repeats of a specific nucleotide sequence. The specific nucleotide sequence (hereinafter also referred to as "repeat unit") varies depending on the biological species. The repeat unit of mammalian telomeric DNA is the nucleotide sequence TTAGGG. The repeat unit of telomeric DNA in non-mammalian biological species is, for example, the nucleotide sequence TTAGGC in the nematode Caenorhabditis elegans, the nucleotide sequence TTAGG in the insect silkworm, the nucleotide sequence TTTAGGG in the plant Arabidopsis thaliana, and one selected from the group consisting of TG, TGG, and TGGG in budding yeast. The repeat unit in many model organisms is a nucleotide sequence rich in G (guanine) and T (thymine). The repeat unit of telomeric DNA contained in the polynucleotide is preferably the same as the repeat unit of telomeric DNA possessed by the biological species from which the cancer cells to which the cell death inducer is applied are derived. When applying a cell death inducer to human cancer cells, it is preferable to use a mammalian telomeric DNA repeat unit.

[0019] If the repeating unit is the nucleotide sequence TTAGGG, the repeating sequence of telomeric DNA is (TTAGGG) n The n represents the number of repeats of the telomeric DNA repeat unit.

[0020] In the repeat sequence of telomeric DNA, when the specific nucleotide sequence repeated is the nucleotide sequence TTAGGG, the repeat unit may be one selected from the group consisting of TAGGGT, AGGGTT, GGGTTA, GGTTAG, and GTTAGG. That is, the repeat sequence of telomeric DNA is (TTAGGG) n and may be (TAGGGT) n , (AGGGTT) n , (GGGTTA) n , (GGTTAG) n , and (GTTAGG) n It may be one selected from the group consisting of:

[0021] n may be 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 10 or more, or 20 or more, but is preferably 4 or more, and more preferably 5 or more. Also, n may be 50 or less, 100 or less, or 500 or less. The range of n is, for example, 1 to 500, and may be 4 to 100, 4 to 50, or 5 to 50.

[0022] The "polynucleotide having at least one repeat unit in the repeat sequence of telomeric DNA" may be DNA, RNA, or both DNA and RNA, with DNA being preferred. The polynucleotide may also include a nucleotide analog. A nucleotide analog is a compound having a structure similar to that of a nucleotide. Examples of nucleotide analogs include compounds in which one or more of the base, sugar, and phosphate group of a nucleotide are modified. Specific examples of nucleotide analogs include peptide nucleic acid (PNA), phosphate-linked peptide nucleic acid (PHONA), locked nucleic acid (LNA), monophosphoric acid, etc.

[0023] The "polynucleotide having at least one repeat unit in the repeat sequence of telomeric DNA" may be a single-stranded polynucleotide or a double-stranded polynucleotide. When the polynucleotide is a double-stranded polynucleotide and the repeat unit is the nucleotide sequence TTAGGG, the repeat unit is complementarily bound to the nucleotide sequence AATCCC. When the polynucleotide is double-stranded and the repeat sequence is (TTAGGG), n If the repeat sequence is (AATCCC) n are complementary bound.

[0024] A "polynucleotide having at least one repeating unit in the repeating sequence of telomeric DNA" can be obtained by synthesis using a known nucleic acid synthesis method, such as the phosphoramidite method.

[0025] A "polynucleotide having at least one repeat unit in a telomeric DNA repeat sequence" may contain regions of other nucleotide sequences in addition to the region of the repeat unit. The polynucleotide may be prepared from genomic DNA of a species derived from the cancer cells to which the cell death inducer is applied. For example, when the cell death inducer is applied to human cells, the polynucleotide may be prepared from human genomic DNA. Examples of genomic DNA include microglial genomic DNA. The genomic DNA may be sheared by ultrasound.

[0026] The cell death inducer of this embodiment may contain optional components in addition to the "polynucleotide having at least one repeat unit in the repeat sequence of telomeric DNA." Examples of optional components include, but are not limited to, buffers, transfection reagents, preservatives, stabilizers, pH adjusters, etc. Examples of transfection reagents include commercially available DNA transfection reagents such as Lipofectamine® 3000 (ThermoFisher Scientific), HilyMAX (Dojindo Laboratories), and PEI MAX (Polyscience).

[0027] The cell death inducer of this embodiment may be liquid or solid. When the cell death inducer is liquid, for example, a polynucleotide (and optional components) having a repeating unit of telomeric DNA is dissolved in a buffer solution or the like. Examples of buffer solutions include phosphate buffer, phosphate-buffered saline (PBS), Tris buffer, citrate buffer, etc. When the cell death inducer is solid, it may be obtained by drying a solution of the polynucleotide (and optional components) having a repeating unit of telomeric DNA as described above. An example of a drying method is freeze-drying.

[0028] The cell death inducer of this embodiment can be used to induce cell death in cancer cells expressing IFI16, ASC, and Caspase-1 both in vitro and in vivo. When used in vivo, the cell death inducer of this embodiment can be administered to a subject to induce cell death in cancer cells expressing IFI16, ASC, and Caspase-1. Alternatively, it can be administered to a subject as a pharmaceutical composition, as described below. Cancer cells targeted for cell death induction are not particularly limited as long as they express IFI16, ASC, and Caspase-1, and can be detected using the cancer cell detection agent described below. Examples of cancer cells expressing IFI16, ASC, and Caspase-1 include, but are not limited to, lung cancer cells, breast cancer cells, melanoma cells, and glioma cells. Among the cancer cells, there are cancer cells that express IFI16, ASC, and Caspase-1, and cancer cells that do not express one or more of IFI16, ASC, and Caspase-1. The cancer cells to which the cell death inducer of this embodiment can be applied can be identified by using a cancer cell detection agent described below.

[0029] The cell death inducer according to this embodiment contains a polynucleotide having a telomeric DNA repeat unit, and is therefore capable of inducing cell death in cancer cells expressing IFI16, ASC, and Caspase 1. The mechanism by which the polynucleotide having a telomeric DNA repeat unit induces cell death is presumed to be as follows. It is known that a portion of telomeric DNA forms a unique higher-order structure called a G-quadruplex (G4). When a G-quadruplex formed by four repeating units of telomeric DNA binds to IFI16, an inflammasome is formed by a complex of IFI16, ASC, and caspase-1, and activated caspase-1 induces pyroptosis.

[0030] [Pharmaceutical composition] In one embodiment, the present invention provides a pharmaceutical composition for treating or preventing cancer in which cancer cells express IFI16, ASC, and Caspase-1, comprising a cell death inducer comprising a polynucleotide having at least one repeat unit in a telomeric DNA repeat sequence.

[0031] Examples of cell death inducers include those mentioned above. The repeat sequence of telomere DNA is (TTAGGG) n , (TAGGGT) n , (AGGGTT) n , (GGGTTA) n , (GGTTAG) n , and (GTTAGG) n n may be one selected from the group consisting of: n may be 1 or more, 2 or more, 3 or more, 4 or more, 5 or more, 10 or more, or 20 or more, but is preferably 4 or more, and more preferably 5 or more. A polynucleotide having a repeating unit of telomeric DNA may contain a region of another nucleotide sequence in addition to the region of the repeating unit.

[0032] The pharmaceutical composition of this embodiment can be administered to a subject to treat or prevent cancer. The cancer to be treated or prevented is not particularly limited as long as it contains cancer cells expressing IFI16, ASC, and Caspase-1, and can be detected using the cancer cell detection agent described below. Examples of cancers containing cancer cells expressing IFI16, ASC, and Caspase-1 include, but are not limited to, lung cancer, breast cancer, melanoma, and glioma. Among these cancers, there are cancers containing cancer cells expressing IFI16, ASC, and Caspase-1, and cancers containing cancer cells that do not express one or more of IFI16, ASC, and Caspase-1. The cancers to which the pharmaceutical composition of this embodiment can be applied can be identified using the cancer cell detection agent described below.

[0033] The target biological species to which the pharmaceutical composition of this embodiment is applied is not particularly limited, as long as it is an organism having cancer that can be detected by the cancer cell detection drug described below. Examples of target biological species include humans and non-human mammals. Non-human mammals include, but are not limited to, primates (monkeys, chimpanzees, gorillas, etc.), rodents (mice, hamsters, rats, etc.), rabbits, dogs, cats, cows, goats, sheep, and horses.

[0034] The pharmaceutical composition of this embodiment may contain at least one pharmaceutically acceptable carrier in addition to the cell death inducer. "Pharmaceutically acceptable carrier" means a carrier that does not inhibit the physiological activity of the active ingredient and is not substantially toxic to the subject to which it is administered. "Not substantially toxic" means that the ingredient is not toxic to the subject to which it is administered at a dose normally used. In the pharmaceutical composition of this embodiment, the pharmaceutically acceptable carrier is a carrier that does not inhibit the function of the cell death inducer and is not substantially toxic to the subject to which it is administered. Pharmaceutically acceptable carriers include all known pharmaceutically acceptable ingredients that are typically considered to be inactive ingredients. Pharmaceutically acceptable carriers are not particularly limited, and examples thereof include solvents, diluents, vehicles, excipients, glidants, binders, granulating agents, dispersing agents, suspending agents, wetting agents, lubricants, disintegrants, solubilizers, stabilizers, emulsifiers, fillers, preservatives (e.g., antioxidants), chelating agents, flavoring agents, sweeteners, thickeners, buffers, coloring agents, etc. One type of pharmaceutically acceptable carrier may be used alone, or two or more types may be used in combination.

[0035] The pharmaceutical composition of this embodiment may further contain optional ingredients in addition to the cell death inducer and a pharmaceutically acceptable carrier. The optional ingredients are not particularly limited, and any ingredient commonly used in the pharmaceutical field can be used without particular limitation. The pharmaceutical composition of this embodiment may also contain active ingredients other than the cell death inducer. Examples of active ingredients include, but are not limited to, vitamins and their derivatives, anti-inflammatory agents, anti-inflammatory agents, blood circulation promoters, stimulants, hormones, irritant alleviators, analgesics, cell activators, plant, animal, and microbial extracts, antipruritics, anti-inflammatory and analgesic agents, antifungals, antihistamines, hypnotics and sedatives, tranquilizers, antihypertensive agents, antihypertensive diuretics, antibiotics, anesthetics, antibacterial substances, antiepileptic drugs, coronary vasodilators, herbal medicines, antipruritics, and keratin softening and peeling agents. The optional ingredients may be used alone or in combination.

[0036] The dosage form of the pharmaceutical composition of this embodiment is not particularly limited and can be any dosage form commonly used for pharmaceutical preparations. The pharmaceutical composition of this embodiment may be an oral formulation or a parenteral formulation. Examples of oral formulations include tablets, coated tablets, pills, powders, granules, capsules, syrups, fine granules, liquids, drops, and emulsions. Examples of parenteral formulations include injections, suppositories, ointments, sprays, topical solutions, ear drops, eye drops, nasal drops, and inhalants. Pharmaceutical compositions of these dosage forms can be formulated according to standard methods (e.g., methods described in the Japanese Pharmacopoeia).

[0037] The administration route of the pharmaceutical composition of this embodiment is not particularly limited, and it can be administered orally or parenterally. The parenteral route includes all administration routes other than oral, such as intravenous, intramuscular, subcutaneous, intranasal, intradermal, ophthalmic, intracerebral, rectal, intravaginal, and intraperitoneal administration. The administration may be local or systemic.

[0038] The pharmaceutical composition of this embodiment can be administered in a therapeutically effective amount of the cell death inducer. The term "therapeutically effective amount" refers to the amount of drug effective for treating or preventing a target disease. For example, a therapeutically effective amount of a cell death inducer can be an amount capable of delaying the onset and / or progression of cancer. The therapeutically effective amount can be determined appropriately based on the patient's symptoms, body weight, age, and sex, as well as the dosage form and administration method of the pharmaceutical composition. For example, the pharmaceutical composition of this embodiment can be administered in a single dose of 0.01 to 1000 mg of the cell death inducer (e.g., a polynucleotide having the nucleotide sequence (TTAGGG)5) per kg of the subject's body weight. The dose may be 0.001 to 1000 mg / kg, 0.01 to 500 mg / kg, 0.1 to 400 mg / kg, or 0.5 to 300 mg / kg.

[0039] The administration interval of the pharmaceutical composition of this embodiment may be appropriately determined depending on the symptoms, body weight, age, sex, etc. of the patient, as well as the dosage form of the pharmaceutical composition, the administration method, etc. The administration interval may be, for example, every few hours, once a day, once every 2 to 3 days, once a week, etc.

[0040] [Cancer cell detection drug] In one embodiment, the present invention provides a cancer cell detection agent used to detect cancer cells to which a cell death inducer comprising a polynucleotide having at least one repeat unit in a telomeric DNA repeat sequence can be applied.

[0041] The cancer cell detection agent of this embodiment is used for a biological sample. Examples of the biological sample include cells and their lysates. The biological sample is preferably a biological sample containing cancer cells. Examples of preferred biological samples include a biopsy sample of cancer tissue.

[0042] The species from which the biological sample is derived is not particularly limited, and examples include humans and non-human mammals. Non-human mammals include, but are not limited to, primates (monkeys, chimpanzees, gorillas, etc.), rodents (mice, hamsters, rats, etc.), rabbits, dogs, cats, cows, goats, sheep, horses, etc. The subject from which the biological sample is derived is preferably a subject with cancer.

[0043] The biological sample may be pretreated by adding it to a known buffer, or may be used as is after collection from a living body.

[0044] Cancer cells to which cell death inducers can be applied are those that express IFI16, ASC, and Caspase-1. Examples of cancer cells that express IFI16, ASC, and Caspase-1 include the cancer cells exemplified above. Among these cancer cells, there are cancer cells that express IFI16, ASC, and Caspase-1, and cancer cells that do not express one or more of IFI16, ASC, and Caspase-1.

[0045] The cancer cell detecting agent in this embodiment includes at least one selected from the group consisting of the following (A) to (C): (A) A combination of a reagent for detecting at least one species selected from the group consisting of IFI16 protein and mRNA, a reagent for detecting at least one species selected from the group consisting of ASC protein and mRNA, and a reagent for detecting at least one species selected from the group consisting of Caspase-1 protein and mRNA. (B) A combination of a reagent for detecting a complex containing IFI16 protein and ASC protein and a reagent for detecting at least one species selected from the group consisting of Caspase-1 protein and mRNA. (C) A combination of a reagent for detecting a complex containing an ASC protein and a Caspase-1 protein and a reagent for detecting at least one species selected from the group consisting of an IFI16 protein and mRNA.

[0046] Examples of IFI16 mRNA include mRNA transcribed from the above-mentioned IFI16 gene. Examples of ASC mRNA include mRNA transcribed from the above-mentioned PYCARD gene. Examples of Caspase-1 mRNA include mRNA transcribed from the above-mentioned CASP1 gene.

[0047] Reagents for detecting at least one selected from the group consisting of IFI16 protein and mRNA include substances that specifically bind to IFI16 protein or mRNA. Reagents for detecting at least one selected from the group consisting of ASC protein and mRNA include substances that specifically bind to ASC protein or mRNA. Reagents for detecting at least one selected from the group consisting of Caspase-1 protein and mRNA include substances that specifically bind to Caspase-1 protein or mRNA. Reagents for detecting a complex containing IFI16 protein and ASC protein include substances that specifically bind to the interaction region of IFI16 protein and ASC protein in a complex containing IFI16 protein and ASC protein.Reagents for detecting a complex containing ASC protein and Caspase-1 protein include substances that specifically bind to the interaction region of ASC protein and Caspase-1 protein in a complex containing ASC protein and Caspase-1 protein.

[0048] "Specific binding substance" means a substance that has specific binding affinity for a particular substance. A specific binding substance for substance A is a substance that has high binding affinity for substance A but low binding affinity for other substances. Binding affinity can be defined by ka (rate constant for antibody binding from the antibody-antigen complex), kD (dissociation constant), and KD (kD / ka). When a specific binding substance binds to a target, the binding affinity (KD) is 10 -8mol / L or less, and -13 mol / L or more 10 -9 It is more preferable that the concentration is mol / L or less. Examples of substances that specifically bind to proteins include antibodies and aptamers. Examples of substances that specifically bind to mRNA include nucleic acids that contain a nucleotide sequence complementary to a part of the mRNA.

[0049] The antibody does not necessarily have to be an intact antibody, but may be an antibody fragment that retains its antigen-binding ability. Examples of antibody fragments include, but are not limited to, Fab, F(ab')2, variable region fragments (Fv), disulfide-linked Fv, single-chain Fv (scFv), sc(Fv)2, diabodies, multispecific antibodies, and polymers thereof. The antibody may be polyclonal or monoclonal. Among these, monoclonal antibodies are preferred because of their high specificity and excellent quantitation. The antibody may also be a modified antibody such as a chimeric antibody. The antibody may be commercially available or may be prepared by known methods such as immunizing animals with antigens, hybridoma methods, phage display methods, or recombinant DNA methods.

[0050] An aptamer is a substance that has specific binding ability to a target substance, and examples thereof include peptide aptamers and nucleic acid aptamers. Peptide aptamers can be selected, for example, by the two-hybrid method using yeast. Nucleic acid aptamers can be selected, for example, by the systematic evolution of ligand by exponential enrichment (SELEX) method.

[0051] Examples of nucleic acids containing a nucleotide sequence complementary to a portion of the mRNA include primers and probes. The nucleic acids can be obtained by synthesis using known nucleic acid synthesis methods. Examples of nucleic acid synthesis methods include those exemplified above.

[0052] The cancer detecting agent in this embodiment preferably contains at least one selected from the group consisting of the following (A') to (C'): (A') A combination of a substance that specifically binds to IFI16 protein or mRNA, a substance that specifically binds to ASC protein or mRNA, and a substance that specifically binds to Caspase-1 protein or mRNA. (B') A combination of a substance that specifically binds to the interaction region of IFI16 protein and ASC protein in a complex containing IFI16 protein and ASC protein, and a substance that specifically binds to Caspase-1 protein or mRNA. (C') A combination of a substance that specifically binds to the interaction region of ASC protein and Caspase-1 protein in a complex containing ASC protein and Caspase-1 protein, and a substance that specifically binds to IFI16 protein or mRNA.

[0053] The specific binding substance may be immobilized on a support. The support can be appropriately selected depending on the cancer cell detection drug of this embodiment. Examples of the support include well plates (e.g., 96-well microplates, etc.), membranes (e.g., nitrocellulose membranes, polyvinylidene fluoride membranes, etc.), slide glasses, magnetic beads, latex particles, etc.

[0054] When the specific binding substance is immobilized on a support, the cancer cell detecting drug of this embodiment may contain a specific binding substance that binds to the specific binding substance immobilized on the support. In this case, the specific binding substance immobilized on the support is referred to as a primary specific binding substance, and the specific binding substance that binds to the primary specific binding substance is referred to as a secondary specific binding substance. In other words, the cancer cell detecting drug of this embodiment may contain a secondary specific binding substance. For example, when the cancer cell detecting agent of this embodiment contains an anti-IFI16 antibody (primary antibody) immobilized on a support, it may further contain an antibody (secondary antibody) that binds to the primary antibody.

[0055] The specific binding substance may be labeled. The labeling substance used for labeling is not particularly limited, and any known labeling substance may be used. Examples of labeling substances include enzyme labels such as peroxidase (e.g., horseradish peroxidase) and alkaline phosphatase; fluorescent labels such as carboxyfluorescein (FAM), 6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein (JOE), fluorescein isothiocyanate (FITC), tetrachlorofluorescein (TET), 5'-hexachloro-fluorescein-CE phosphoramidite (HEX), Cy3, Cy5, Alexa568, and Alexa647; radioisotope labels such as iodine-125; electrochemiluminescent labels such as ruthenium complexes; biotin; and metal nanoparticles. Labeling of specific binding substances can be carried out by selecting an appropriate known method depending on the type of labeling substance. When biotin is used as the labeling substance, the cancer cell detecting agent of this embodiment may further contain labeled avidin. Examples of the labeling substance for avidin include the labeling substances listed above other than biotin. When the cancer cell detecting agent of this embodiment contains a secondary specific binding substance, the secondary specific binding substance is preferably labeled.

[0056] The cancer cell detection agent of this embodiment may contain other elements in addition to the specific binding substance, such as a detection reagent for the labeled substance, buffers, a support, etc.

[0057] The detection reagent for the labeled substance is a reagent for detecting the labeled substance used to label the primary specific binding substance or the secondary specific binding substance. For example, when the labeled substance is an enzyme label, the detection reagent contains a substrate for the enzyme. For example, when the enzyme label is peroxidase, examples of the detection reagent include TMB (3,3',5,5'-tetramethylbenzidine), OPD (o-phenylenediamine dihydrochloride), and ABTS (2,2'-azino-di-[3-ethyl-benzothiazoline-6 ​​sulfonic acid] diammonium salt). When the enzyme label is alkaline phosphatase, examples of the detection reagent include pNPP (p-nitrophenylphosphate).

[0058] Examples of buffers include buffers used in binding reactions of specific binding substances and buffers used in reactions for detecting labeled substances that bind to specific binding substances. Specific examples of buffers include blocking buffers and washing buffers. These buffers can be any buffers commonly used in immunoassays and the like, without any particular limitations.

[0059] The support is used to immobilize the specific binding substance. Examples of the support include those exemplified above.

[0060] The cancer cell detecting agent in this embodiment may be liquid or solid.

[0061] When the cancer cell detecting agent of this embodiment contains at least one selected from the group consisting of (A') to (C') above, the expression levels of IFI16, ASC, and Caspase-1 in cancer cells can be calculated based on the amount of the specific binding substance bound to the target, thereby predicting the efficacy of treatment with a cell death inducer in a cancer patient from whom the biological sample was derived. In other words, the cancer cell detecting agent of this embodiment can also be considered a companion diagnostic agent for the above-mentioned cancer cell death inducer.

[0062] When the specific binding substance is an antibody, the protein or protein complex to be quantified can be quantified using sandwich ELISA (Enzyme-Linked ImmunoSorbent Assay) or chemiluminescent enzyme immunoassay (CLEIA), for example. When the specific binding substance is a primer, the mRNA to be quantified can be quantified using quantitative RT-PCR, etc. The expression level of the mRNA to be measured may be standardized using the expression level of a housekeeping gene (β-tubulin, GAPDH, etc.) whose expression level is constant. When the specific binding substance is a probe, the mRNA to be quantified can be quantified using Northern blotting, RNA microarrays, or the like.

[0063] When the cancer cell detection drug of this embodiment contains the above (A'), it can quantify the amounts of IFI16 protein or mRNA, ASC protein or mRNA, and Caspase-1 protein or mRNA in cancer cells. The quantified values ​​can be used as the expression levels of IFI16, ASC, and Caspase-1. If all of these expression levels exceed a predetermined reference value, the cancer cells contained in the biological sample used can be determined to be cancer cells expressing IFI16, ASC, and Caspase-1 (cancer cells that are subject to the application of a cell death inducer; hereinafter referred to as "sensitive cancer cells"). On the other hand, if one or more of the expression levels of IFI16, ASC, and Caspase-1 are below a predetermined reference value, the cancer cells contained in the biological sample used can be determined to be cancer cells that do not express IFI16, ASC, and Caspase-1 (cancer cells that are not subject to the application of a cell death inducer; hereinafter referred to as "insensitive cancer cells"). When the cancer cell detection drug of this embodiment contains the above (B'), it can quantify the amount of the complex containing IFI16 protein and ASC protein, and the amount of Caspase-1 protein or mRNA. The quantified values ​​can be used as the expression level of the complex containing IFI16 and ASC, and the expression level of Caspase-1. If both of these expression levels exceed a predetermined reference value, it can be determined that the cancer cells contained in the biological sample used are sensitive cancer cells. On the other hand, if one or more of the expression levels selected from the group consisting of the expression level of the complex containing IFI16 protein and ASC protein, and the expression level of Caspase-1 are below a predetermined reference value, it can be determined that the cancer cells contained in the biological sample used are non-sensitive cancer cells. When the cancer cell detection drug of this embodiment contains the above-mentioned (C'), it is possible to quantify the amount of the complex containing ASC protein and Caspase-1 protein, and the amount of IFI16 protein or mRNA. The quantified values ​​can be used as the expression level of the complex containing ASC and Caspase-1, and the expression level of IFI16. If both of these expression levels exceed a predetermined reference value, it can be determined that the cancer cells contained in the biological sample used are sensitive cancer cells. On the other hand, if one or more of the expression levels selected from the group consisting of the expression level of the complex containing ASC protein and Caspase-1 protein, and the expression level of IFI16 are below a predetermined reference value, it can be determined that the cancer cells contained in the biological sample used are non-sensitive cancer cells. A subject from which a biological sample containing sensitive cancer cells is derived can be evaluated or predicted as having a high probability of being efficacious in cancer treatment with a cell death inducer, whereas a subject from which a biological sample not containing sensitive cancer cells is derived can be evaluated or predicted as having a low probability of being efficacious in cancer treatment with a cell death inducer.

[0064] The above-mentioned reference value is a reference value for distinguishing between the above-mentioned sensitive cancer cells and non-sensitive cancer cells.

[0065] The reference value can be calculated, for example, using a group of cancer cells in which cell death is induced using the above-mentioned cancer cell death inducer (hereinafter referred to as the "cell death-induced group") and a group of cancer cells in which cell death is not induced (hereinafter referred to as the "cell death-uninduced group"). In the cell death-induced group and the cell death-uninduced group, the expression levels of IFI16, ASC, and Caspase-1, the expression levels of the IFI16 and ASC complex, and Caspase-1, or the expression levels of IFI16 and the ASC and Caspase-1 complex, may be measured using a cancer cell detection agent selected from the group consisting of (A') to (C') above, and a cutoff value for distinguishing between the cell death-induced group and the cell death-uninduced group may be calculated using a statistical method. This cutoff value can be used as the reference value.

[0066] As a statistical method, for example, a known method such as ROC analysis can be used. [Example]

[0067] The present invention will be described below with reference to examples, but the present invention is not limited to the following examples.

[0068] [Experimental Method] Experimental Examples 1 to 8 were carried out according to the experimental methods described below.

[0069] (Establishment of cell lines) Firefly luciferase (Luc) and red fluorescent protein (mCherry) were transfected into PC9 (human lung cancer cell line), MDA-MB-231 (human breast cancer cell line), and LN229 (human glioma cell line) cells to establish PC9-Luc-mCherry cell lines, MDA-MB-231-Luc-mCherry cell lines, and LN229-Luc-mCherry cell lines, respectively. Luc and mCherry were transfected using the pCX4 retroviral vector (Akagi et al., PNAS 100(23), 13567-13572(2003)).

[0070] <Establishment and culture of IFI16-KO cell lines> IFI16-KO cell lines were established from the PC9-Luc-mCherry, MDA-MB-231-Luc-mCherry, and LN229-Luc-mCherry cell lines using gRNA CRISPR / Cas9 All-in-One Lentivector (pLenti U6, Applied Biological Materials). The established cell lines were PC9-IFI16-KO, MDA-MB-231-IFI16-KO, and LN229-IFI16-KO, respectively. The nucleotide sequence set forth in SEQ ID NO: 1 was used as the guide sequence for the guide RNA used to establish the IFI16-KO cell lines. TATACCAACGCTTGAAGACC (SEQ ID NO: 1)

[0071] Control cell lines were established from the PC9-Luc-mCherry cell line, the MDA-MB-231-Luc-mCherry cell line, and the LN229-Luc-mCherry cell line using gRNA CRISPR / Cas9 All-in-One Lentivector with the nucleotide sequence set forth in SEQ ID NO: 2 as the guide RNA guide sequence. The established cell lines were the PC9-CT cell line, the MDA-MB-231-CT cell line, and the LN229-CT cell line, respectively. GCACTCACATCGCTACATCA (SEQ ID NO: 2)

[0072] Cancer cell lines (PC9-Luc-mCherry, MDA-MB-231-Luc-mCherry, LN229-Luc-mCherry, PC9-IFI16-KO, MDA-MB-231-IFI16-KO, LN229-IFI16-KO, PC9-CT, MDA-MB-231-CT, and LN229-CT) were cultured in Dulbecco's Modified Eagle's Medium (DMEM) with high glucose (WAKO) supplemented with 10% FBS and 1% PenStrep (GIBCO). Culture was performed at 37°C in a 5% CO environment.

[0073] (Establishment and passage of mixed glial cells using the MGS method) Figure 1 shows a schematic diagram of the MGS method. Using the MGS method, which allows for the long-term stable maintenance of primary cultured glial cells, we established a mixed cell line of astrocytes and microglia (hereinafter referred to as "mixed glial cells"). During the establishment, gentleMACS TM Dissociator (Miltenyi Biotec) and the NTDK-P enzyme mix from the Neura Tissue Dissociation Kit (P) (NTDK-P) (Miltenyi Biotec) were used. The procedure for establishing mixed glial cells is described in detail below.

[0074] Brain tissue was extracted from euthanized C57BL / 6 neonatal mice (P1-3, mixed sex). The excised brain tissue was placed in a C-tube containing the NTDK-P enzyme mix and analyzed using gentleMACS TM Physical and chemical dispersion was performed under the control of the Dissociator program "gentleMACS Program 37C_NTDK_1." The dispersed cells were suspended in 13 mL of DMEM and centrifuged at 300×g for 5 minutes to collect the cells. The collected cells were resuspended in DMEM supplemented with 10% FBS and 1% PenStrep (WAKO) and plated on a 150 mm culture dish coated with type I collagen gel (Thermo Scientific TM Nunc TM The cells were seeded onto EasYDishes (Thermo Scientific). Type I collagen gel was prepared using Cellmatrix Type IA (Nitta Gelatin Co., Ltd.) and neutralized on ice to a final concentration of 1.2 mg / ml. 10 ml of type I collagen gel was used to coat the culture dishes.

[0075] When subculturing MGS, the following procedures were carried out. When the cells reached confluence, or as needed for the experiment, the type I collagen gel in the 150 mm culture dish was dissolved with collagenase type IV (GIBCO) and centrifuged (300 × g, 5 min) to collect the cells. The collected cells were dispersed using Accumax (INNOVATIVE Cell Technologies Inc.), suspended in DMEM, and centrifuged again (300 × g, 5 min). The collected cells were resuspended in DMEM and diluted to 5 x 10 5 cells / ml were seeded onto new 150-mm culture dishes coated with type I collagen gel.

[0076] The seeded cells were cultured in DMEM at 37°C in a 5% CO2 environment. After two weeks of culture, only astrocytes and microglia were observed on the culture dish.

[0077] In this experiment, brain tissue was removed from mice expressing green fluorescent protein (GFP) (C57BL / 6-CAG-EGFP) as needed, and mixed glial cells stably expressing GFP (GFP-expressing mixed glial cells) were established.

[0078] (Isolation of microglia and astrocytes) Microglia were isolated from the cells collected during the MGS method described above. The microglia isolation procedure is described in detail below.

[0079] Brain tissue was extracted from euthanized C57BL / 6 neonatal mice (P1-3, mixed sex). The excised brain tissue was placed in a C-tube containing the NTDK-P enzyme mix and analyzed using gentleMACS TM Physical and chemical dispersion was performed using the Dissociator program "gentleMACS Program 37C_NTDK_1." The dispersed cells were suspended in 13 mL of DMEM and centrifuged at 300×g for 5 minutes to collect the cells. The collected cells were resuspended in DMEM supplemented with 10% FBS and 1% PenStrep (WAKO) and seeded onto 150 mm culture dishes coated with type I collagen gel. Cellmatrix Type IA was used for the type I collagen gel, which was neutralized on ice to a final concentration of 1.2 mg / ml. 10 ml of type I collagen gel was used to coat the culture dishes. When the cells reached confluence, or as needed for the experiment, the type I collagen gel in the 150 mm culture dish was dissolved with collagenase type IV (GIBCO) and the cells were collected by centrifugation (300 × g, 5 min). The collected cells were dispersed using Accumax, suspended in DMEM, and centrifuged again (300 × g, 5 min). The collected cells were suspended in 1 ml of PBS and diluted to 5 × 10 6 The cell suspension was adjusted to a concentration of 1000 cells / ml. The prepared cell suspension was transferred to a 2 ml tube and centrifuged (300×g, 5 minutes) to collect the cells. The collected cells were resuspended in 0.5% BSA / PBS to a total volume of 90 μL. 10 μL of CD11b Microbeads (human and mouse) (product number: 130-049-601, Miltenyi) was added to the cell suspension and allowed to stand at 4°C for 15 minutes. To the cell suspension that had been left standing, 1.8 ml of 0.5% BSA / PBS was added, and the mixture was centrifuged at 300×g at 4° C. for 10 minutes to collect the cells. The collected cells were resuspended in 500 μl of 0.5% BSA / PBS. The cell suspension was transferred to an LS column (Miltenyi) and subjected to separation and extraction using the MACS (Magnetic Cell Sorting) method. The 0.5% BSA / PBS containing CD11b-positive cells was centrifuged at 300 × g for 5 minutes to collect the CD11b-positive cells. CD11b-positive cells represent microglia.

[0080] Astrocytes were isolated according to the procedure described above, except that 10 μl of ACSA-2 Microbeads (Anti-ACSA-2 MicroBead Kit, mouse, Miltenyi Biotec) was added instead of CD11b Microbeads. ACSA-2-positive cells indicate astrocytes.

[0081] In this experiment, microglia stably expressing GFP (GFP-expressing microglia) and astrocytes stably expressing GFP (GFP-expressing astrocytes) were isolated from the GFP-expressing mixed glial cells as needed using the procedure described above.

[0082] The collected microglia or astrocytes were used in the "co-culture of cancer cells and glial cells" described below.

[0083] (Co-culture of cancer cells and glial cells) Cancer cells (one selected from the group consisting of PC9-Luc-mCherry cells, MDA-MB-231-Luc-mCherry cells, LN229-Luc-mCherry cells, PC9-IFI16-KO cells, MDA-MB-231-IFI16-KO cells, LN229-IFI16-KO cells, PC9-CT cells, MDA-MB-231-CT cells, and LN229-CT cells) and glial cells (one selected from the group consisting of mixed glial cells, microglia, GFP-expressing mixed glial cells, GFP-expressing microglia, and GFP-expressing astrocytes) were mixed at a ratio of 1:15 (1.0 × 10 4 cancer cells and 1.5 × 10 5 The cells were mixed with 100 μl of type I collagen gel and seeded onto a 35 mm glass bottom dish (Matsunami Glass Industry Co., Ltd.). Once the collagen gel had solidified, DMEM supplemented with 10% FBS was added to initiate co-culture. The cells were cultured at 37°C in a 5% CO2 environment.

[0084] (Immunoblotting) Protein lysates were obtained from the cell suspensions. Protein lysates were processed according to standard procedures and separated by polyacrylamide gel electrophoresis (SDS-PAGE) followed by immunoblotting. SDS-PAGE was performed using a precast SDS-polyacrylamide gel (4-15% Mini-PROTEAN TGX Precast Gel, BioRad) and a Trans-Blot Turbo transfer system (BioRad). The primary antibody used for immunoblotting was anti-IFI16 antibody [EPR11767(B)] (product number ab169788, Abcam), and the secondary antibody was IRDye 680RD Donkey-anti-Rabbit Antibody IgG (product number 926-68073, LI-COR). As a control, the primary antibody was Monoclonal Anti-β-Tubulin I (product number T7816, SIGMA) and the secondary antibody was IRDye 800CW Donkey Anti-Mouse IgG (H+L) (product number: 926-32212, LI-COR). Fluorescence was detected using the Odyssey Imager system (LI-COR) for immunoblotting.

[0085] (Calculation of the relative number of viable cancer cells by IVIS) 1.0×10 4 Cancer cells (one type selected from the group consisting of PC9-Luc-mCherry cells, MDA-MB-231-Luc-mCherry cells, LN229-Luc-mCherry cells, PC9-IFI16-KO cells, MDA-MB-231-IFI16-KO cells, LN229-IFI16-KO cells, PC9-CT cells, MDA-MB-231-CT cells, and LN229-CT cells) were cultured alone in 100 μl of collagen gel, or co-cultured with glial cells (one type selected from the group consisting of microglia, GFP-expressing microglia, and GFP-expressing astrocytes) at a ratio of 1:15 (1.0 × 10 4 cancer cells and 1.5 × 10 5The cells were co-cultured with 100 μl of glial cells in a collagen gel in a 96-well plate (IsoPlate-96 TC, PerkinElmer). 72 hours after the start of culture, D-luciferin (D-luciferin potassium salt, WAKO) was added to a final concentration of 150 mg / ml, and the relative number of surviving cancer cells was calculated using IVIS Lumina LT (PerkinElmer).

[0086] (siRNA) The siRNAs used in this experiment are as follows: si-Ctrl (nucleotide sequence set forth in SEQ ID NO: 3) (Dharmacon product, Horizon), si-CASP1 (nucleotide sequence set forth in SEQ ID NO: 4) (ThermoFisher Scientific), si-CASP2 (nucleotide sequence set forth in SEQ ID NO: 5) (ThermoFisher Scientific), si-CASP3 (nucleotide sequence set forth in SEQ ID NO: 6) (ThermoFisher Scientific), si-CASP7 (nucleotide sequence set forth in SEQ ID NO: 7) (ThermoFisher Scientific), si-NLRP3 (Stealth siRNA HSS132811, ThermoFisher Scientific), si-NLRC4 (Stealth siRNA HSS126850, ThermoFisher Scientific), si-IFI16 (nucleotide sequence set forth in SEQ ID NO: 8) (ThermoFisher Scientific), si-AIM2 (Stealth siRNA HSS114049, ThermoFisher Scientific), and si-ASC (Stealth siRNA HSS147064, ThermoFisher Scientific). The nucleotide sequence synthesized by the manufacturer is shown below. si-Ctrl:UGGUUUACAUGUCGACUAA (SEQ ID NO: 3) si-CASP1: GGAAGACUCAUUGAACAUA (SEQ ID NO: 4) si-CASP2: CAGCUGUUGUUGAGCGAAU (SEQ ID NO: 5) si-CASP3: GGCAUAUGCAUAAUAAUUA (SEQ ID NO: 6) si-CASP7:GCAUCAUCAUAAACAACAA (SEQ ID NO: 7) si-IFI16:CCAAAAGGAUUGAUUAGAA (SEQ ID NO: 8)

[0087] [Experimental Example 1] (Induction of PC9 cell death by mixed glial cells) According to the experimental method described above, PC9-Luc-mCherry cells were co-cultured with GFP-expressing mixed glial cells. 24 hours after the start of culturing, images were taken every 10 minutes for 72 hours using a Ti2 confocal microscope (Nikon) attached with a Dragonfly spinning disk (ANDOR) with a 60x objective lens.

[0088] Figure 2 shows fluorescence images of PC9-Luc-mCherry cells co-cultured with GFP-expressing mixed glial cells at 0 and 58 hours after the start of co-culture. The scale bar is 20 μm. The middle row shows an image of GFP-expressing mixed glial cells (GFP-detected image), the bottom row shows an image of PC9-Luc-mCherry cells (mCherry-detected image), and the top row shows a merged image of the GFP-detected image in the middle row and the mCherry-detected image in the bottom row. 58 hours after the start of co-culture, the PC9-Luc-mCherry cells were observed to have degraded and become smaller. This suggests that mixed glial cells induce cell death in PC9 cells.

[0089] [Experimental Example 2] (Microglia induce cell death in PC9 cells) According to the above experimental method, we performed monoculture of PC9-Luc-mCherry cells, coculture of PC9-Luc-mCherry cells with GFP-expressing microglia, and coculture of PC9-Luc-mCherry cells with GFP-expressing astrocytes. After 24 hours of incubation, images were taken every 10 minutes for 72 hours using a Ti2 confocal microscope attached to a Dragonfly spinning disk with a 60x objective lens attached to the incubator.

[0090] Figure 3 shows fluorescence images of PC9-Luc-mCherry cells and GFP-expressing microglia 0 and 58 hours after the start of co-culture. The scale bar is 20 μm. The middle row shows an image of GFP-expressing microglia (GFP-detected image), the bottom row shows an image of PC9-Luc-mCherry cells (mCherry-detected image), and the top row shows a merged image of the GFP-detected image in the middle row and the mCherry-detected image in the bottom row. In the bottom row, PC9-Luc-mCherry cells are shown in white. 58 hours after the start of co-culture, the PC9-Luc-mCherry cells were observed to have degraded and become smaller. This suggests that microglia induce cell death in PC9 cells.

[0091] Figure 4 shows the relative number of viable PC9-Luc-mCherry cells calculated using the method described above (n = 3). From left to right, the graphs show PC9-Luc-mCherry cells cultured alone (Mono), PC9-Luc-mCherry cells cocultured with GFP-expressing astrocytes (+Astrocyte), and PC9-Luc-mCherry cells cocultured with GFP-expressing microglia (+Microglia). The coculture of PC9-Luc-mCherry cells with GFP-expressing microglia significantly reduced the relative number of viable PC9-Luc-mCherry cells compared to PC9-Luc-mCherry cells cultured alone. This indicates that, among the mixed glial cells, microglia induce cell death in PC9 cells. p values ​​were calculated using a t-test.

[0092] [Experimental Example 3] Caspase-1-dependent induction of PC9 cell death by microglia PC9-Luc-mCherry cells were transfected with siRNA (si-Ctrl, si-CASP1, si-CASP2, si-CASP3, si-CASP7, or one selected from the group consisting of si-CASP3 and si-CASP7) using RNAi MAX (ThermoFisher Scientific). Forty-eight hours after siRNA transfection, we began monoculture of siRNA-transfected PC9-Luc-mCherry cells and coculture of siRNA-transfected PC9-Luc-mCherry cells with mixed glial cells, according to the experimental method described above.

[0093] Figure 5 shows the relative number of viable PC9-Luc-mCherry cells cultured according to the method described above (n = 2 or 3). The siRNAs transfected into PC9-Luc-mCherry cells were, from left to right, si-Ctrl, si-CASP1, si-CASP2, si-CASP3, si-CASP7, si-CASP3, and si-CASP7. When si-CASP1-transfected PC9-Luc-mCherry cells were cocultured with mixed glial cells (+Mixed-glia), the relative number of viable PC9-Luc-mCherry cells was significantly higher than when si-Ctrl was transfected. Caspase-1 expression was suppressed in si-CASP1-transfected cells. These results demonstrate that microglia-mediated cell death induction in PC9 cells is caspase-1-dependent. p values ​​were calculated using a t-test.

[0094] [Experimental Example 4] Microglia induce PC9 cell death via IFI16- or ASC-dependent pathways PC9-Luc-mCherry cells were transfected with siRNA (si-Ctrl, si-NLRP3, si-NLRC4, si-IFI16, si-AIM2, and si-ASC) using RNAi MAX. Forty-eight hours after siRNA transfection, we began monoculture of siRNA-transfected PC9-Luc-mCherry cells and coculture of siRNA-transfected PC9-Luc-mCherry cells with mixed glial cells, according to the experimental method described above.

[0095] Figure 6 shows the relative number of viable PC9-Luc-mCherry cells cultured according to the method described above (n = 2 or 3). The siRNAs transfected into PC9-Luc-mCherry cells were, from left to right, si-Ctrl, si-NLRP3, si-NLRC4, si-IFI16, si-AIM2, and si-ASC. When si-IFI16-transfected PC9-Luc-mCherry cells were cocultured with mixed glial cells (+Mixed-glia), the relative number of viable PC9-Luc-mCherry cells was significantly higher than when si-Ctrl was transfected. Furthermore, when si-ASC-transfected PC9-Luc-mCherry cells were cocultured with mixed glial cells (+Mixed-glia), the relative number of viable PC9-Luc-mCherry cells was significantly higher than when si-Ctrl was transfected. In cells transfected with si-IFI16, IFI16 expression was downregulated, and in cells transfected with si-ASC, ASC expression was downregulated. These results demonstrate that microglia-induced cell death in PC9 cells is IFI16- and ASC-dependent. p values ​​were calculated using a t-test.

[0096] [Experimental Example 5] (PC9 cell death induced by microglia-derived DNA) PC9-Luc-mCherry cells were transfected with sonicated DNA (microglial genomic DNA or pCX4 retroviral vector) using Lipofectamine 3000 (ThermoFisher Scientific). Forty-eight hours after DNA transfection, the DNA-transfected PC9-Luc-mCherry cells were cultured alone according to the experimental method described above.

[0097] Figure 7 is a graph showing the relative number of viable PC9-Luc-mCherry cells cultured according to the method described above (n = 2 or 3). The leftmost (Ctrl) represents the control. The DNA introduced into PC9-Luc-mCherry cells is microglial genomic DNA (in the center, Microglia gDNA (sonicated)) and pCX4 retroviral vector (in the rightmost, pCX4 vector (sonicated)). The relative number of viable PC9-Luc-mCherry cells introduced with microglial genomic DNA was significantly reduced compared to the control. This demonstrates that microglial-derived DNA induces cell death in PC9 cells. p values ​​were calculated using a t-test.

[0098] [Experimental Example 6] IFI16-dependent induction of PC9 cell death by telomeric DNA repeats The PC9-CT cell line and the PC9-IFI16-KO cell line were established according to the method described above.

[0099] Figure 8 shows the results of immunoblotting using protein lysates obtained from PC9-CT cell suspensions or PC9-IFI16-KO cell suspensions. Immunoblotting was performed as described above. The results confirmed that IFI16 was not expressed in PC9-IFI16-KO cells.

[0100] PC9-CT cells and PC9-IFI16-KO cells were transfected with single-stranded DNA nucleotide sequence: (TTACCC)5 (SEQ ID NO: 9), nucleotide sequence: (TTAGGG)5 (SEQ ID NO: 10), and nucleotide sequence: (TTAGGG). 10 (SEQ ID NO: 11), and the nucleotide sequence: (TTAGGG) 20 (one selected from the group consisting of SEQ ID NO: 12) was transfected using Lipofectamine 3000. Forty-eight hours after DNA transfection, we began culturing PC9-CT cells or PC9-IFI16-KO cells transfected with DNA, or PC9-CT cells or PC9-IFI16-KO cells not transfected with DNA (controls), according to the experimental method described above.

[0101] Figure 9 is a graph showing the relative number of viable cells (n=2) cultured according to the above method. Nucleotide sequence: (TTAGGG)5, Nucleotide sequence: (TTAGGG) 10 , or the nucleotide sequence: (TTAGGG) 20 When single-stranded DNA of the nucleotide sequence (TTACCC)5 was introduced, the relative number of viable cells was reduced in PC9-CT cells compared to unintroduced PC9-CT cells, but not in PC9-IFI16-KO cells compared to unintroduced PC9-IFI16-KO cells. Furthermore, the relative number of viable cells was not reduced in PC9-CT cells or PC9-IFI16-KO cells transfected with single-stranded DNA of the nucleotide sequence (TTACCC)5 compared to unintroduced cells. The nucleotide sequence (TTAGGG)5, the nucleotide sequence (TTAGGG) 10 , and the nucleotide sequence: (TTAGGG) 20 is a repeat sequence in telomeric DNA. These results demonstrate that the repeat sequence in telomeric DNA induces cell death in PC9 cells in an IFI16-dependent manner.

[0102] [Experimental Example 7] IFI16-dependent induction of MDA-MB-231 cell death by telomeric DNA repeats The MDA-MB-231-CT cell line and the MDA-MB-231-IFI16-KO cell line were established according to the method described above.

[0103] Figure 10 shows the results of immunoblotting using protein lysates from MDA-MB-231-CT cell suspensions or MDA-MB-231-IFI16-KO cell suspensions. Immunoblotting was performed as described above. The results confirmed that IFI16 was not expressed in MDA-MB-231-IFI16-KO cells.

[0104] MDA-MB-231-CT cells and MDA-MB-231-IFI16-KO cells were transfected with single-stranded DNA (nucleotide sequence: (TTAGGG)5 or nucleotide sequence: (TTACCC)5) using Lipofectamine 3000. Forty-eight hours after DNA transfection, we began culturing MDA-MB-231-CT cells or MDA-MB-231-IFI16-KO cells transfected with DNA, or MDA-MB-231-CT cells or MDA-MB-231-IFI16-KO cells not transfected with DNA (controls), according to the experimental method described above.

[0105] Figure 11 is a graph showing the relative number of viable cells (n = 1) after culturing using the method described above. When single-stranded DNA with the nucleotide sequence (TTAGGG)5 was introduced, the relative number of viable cells was reduced in MDA-MB-231-CT cells compared to unintroduced MDA-MB-231-CT cells. However, the relative number of viable cells in MDA-MB-231-IFI16-KO cells was not reduced compared to unintroduced MDA-MB-231-IFI16-KO cells. Furthermore, the relative number of viable cells in MDA-MB-231-CT cells and MDA-MB-231-IFI16-KO cells transfected with single-stranded DNA with the nucleotide sequence (TTACCC)5 was not reduced compared to unintroduced cells. These results demonstrate that the repeated sequences in telomeric DNA induce cell death in MDA-MB-231 cells in an IFI16-dependent manner.

[0106] [Experimental Example 8] IFI16-dependent induction of LN229 cell death by telomeric DNA repeats The LN229-CT cell line and the LN229-IFI16-KO cell line were established according to the method described above.

[0107] Figure 12 shows the results of immunoblotting using protein lysates from LN229-CT cell suspensions or LN229-IFI16-KO cell suspensions. Immunoblotting was performed as described above. The results confirmed that IFI16 was not expressed in LN229-IFI16-KO cells.

[0108] LN229-CT cells and LN229-IFI16-KO cells were transfected with single-stranded DNA (nucleotide sequence: (TTAGGG)5 or nucleotide sequence: (TTACCC)5) using Lipofectamine 3000. Forty-eight hours after DNA transfection, we began monoculture of DNA-transfected LN229-CT cells or LN229-IFI16-KO cells, or LN229-CT cells or LN229-IFI16-KO cells without DNA transfection (controls), according to the experimental method described above.

[0109] Figure 13 is a graph showing the results of calculations of the relative number of viable cells performed according to the above-described method (n = 1). When single-stranded DNA with the nucleotide sequence (TTAGGG)5 was introduced, the relative number of viable cells was reduced in LN229-CT cells compared to LN229-CT cells without DNA introduction, whereas the relative number of viable cells was not reduced in LN229-IFI16-KO cells compared to LN229-IFI16-KO cells without DNA introduction. Furthermore, the relative number of viable cells was not reduced in LN229-CT cells and LN229-IFI16-KO cells with single-stranded DNA with the nucleotide sequence (TTACCC)5 compared to LN229-IFI16-KO cells without DNA introduction. These results demonstrate that the repetitive sequence in telomeric DNA induces cell death in LN229 cells in an IFI16-dependent manner. [Industrial Applicability]

[0110] According to the present invention, there are provided a cell death inducer, a pharmaceutical composition for treating or preventing cancer, and a cancer cell detection agent for detecting cancer cells to which the cell death inducer can be applied.

Claims

1. A cell death inducer for cancer cells expressing IFI16, ASC, and Caspase-1, the cell death inducer comprising a polynucleotide having at least one repeat unit in a repeat sequence of telomeric DNA.

2. The repeat sequence has the following nucleotide sequence: (TTAGGG) ｎ , (TAGGGT) ｎ , (AGGGTT) ｎ , (GGGTTA) ｎ , (GGTTAG) ｎ , and (GTTAGG) ｎ It is a repeat sequence represented by either In the nucleotide sequence, n is 1 or more. The cell death inducer according to claim 1 .

3. The cell death inducer according to claim 1 or 2, wherein the cell death of cancer cells induced by the cell death inducer is dependent on Caspase-1.

4. The cell death inducer according to claim 2 , wherein in the nucleotide sequence, n is 4 or more.

5. The cell death inducer according to claim 2 , wherein in the nucleotide sequence, n is 5 or more.

6. The cell death inducer according to claim 1 or 2, A pharmaceutical composition used to treat or prevent cancer having cancer cells that express IFI16, ASC, and Caspase-1.

7. It contains at least one selected from the group consisting of the following (A) to (C): A cancer cell detection agent used for detecting cancer cells to which the cell death inducer according to claim 1 or 2 can be applied: (A) a combination of a reagent for detecting at least one selected from the group consisting of IFI16 protein and mRNA, a reagent for detecting at least one selected from the group consisting of ASC protein and mRNA, and a reagent for detecting at least one selected from the group consisting of Caspase-1 protein and mRNA; (B) a combination of a reagent for detecting a complex containing IFI16 protein and ASC protein and a reagent for detecting at least one selected from the group consisting of Caspase-1 protein and mRNA; and (C) A combination of a reagent for detecting a complex containing ASC protein and Caspase-1 protein and a reagent for detecting at least one member selected from the group consisting of IFI16 protein and mRNA.

8. the reagent for detecting at least one selected from the group consisting of IFI16 protein and mRNA is a substance that specifically binds to the IFI16 protein or mRNA, the reagent for detecting at least one selected from the group consisting of ASC protein and mRNA is a substance that specifically binds to the ASC protein or mRNA, the reagent for detecting at least one selected from the group consisting of the Caspase-1 protein and mRNA is a substance that specifically binds to the Caspase-1 protein or mRNA; the reagent for detecting a complex containing the IFI16 protein and the ASC protein is a substance that specifically binds to an interaction region of the IFI16 protein and the ASC protein in the complex containing the IFI16 protein and the ASC protein; The cancer cell detection drug according to claim 7, wherein the reagent for detecting the complex containing the ASC protein and the Caspase-1 protein is a substance that specifically binds to the interaction region of the ASC protein and the Caspase-1 protein in the complex containing the ASC protein and the Caspase-1 protein.

Images