Modified guide RNA for gene editing

Abstract

This invention provides modified guide RNA (gRNA) with improved in vitro and in vivo activity for gene editing methods. [Solution] A genome editing tool is provided comprising a guide RNA (gRNA) having one or more shortened regions and / or substitutions. The shortened regions or substitutions may promote the synthesis of gRNA with higher yield and / or homogeneity, and / or improve the stability of the gRNA and gRNA / Cas9 complex, and may improve the activity of Cas9 (e.g., SaCas9, SpyCas9, and equivalents) for cleaving target DNA.

Description

[Technical Field]

[0001] This patent application is based on U.S. Provisional Application No. 62 / 946,90, filed on December 11, 2019. Claiming priority in item 5, the contents thereof, for all purposes, are referred to in whole by this specification. It will be incorporated into the book.

[0002] This application includes a sequence listing submitted electronically in ASCII format, which in whole is by reference. This is incorporated herein. The above ASCII copy was created on December 9, 2020. The file name is 01155-0032-00PCT_ST25.txt, and its size is 614. It is 499 bytes.

[0003] This disclosure is part of a prokaryotic immune system that recognizes and cleaves exogenous gene elements. This relates to the field of gene editing using the CRISPR / Cas system. The as system induces site-specific DNA disruption using CRISPR-related protein 9( Cas9 is mediated by a single nuclease called Cas9. Cas9 uses guide RNA (gRNA). It is guided to a specific DNA sequence by a small RNA molecule called a guide RNA. This includes tracrRNA (trRNA) and crisprRNA (crRNA). crRNA containing the guide region covalently fuses with trRNA to form a complete gRNA. Understanding whether a meeting needs to occur, or will occur, to occur, either covalently or noncovalently. Under this, it may also be called gRNA. trRNA and crRNA are single guide RNAs. (sgRNA) contained within, or two separate dual guide RNAs (dgRNAs) It can be contained within various RNA molecules. It can be combined with trRNA and crRNA or sgRNA. The combined Cas9 is called the Cas9 ribonucleoprotein complex (RNP).

[0004] Oligonucleotides, especially RNA, can be cleaved by non-enzymatic cleavage, endonuclease cleavage, or It may be degraded in cells and serum by exonuclease cleavage. Cleotides are combined using modifications at various positions to reduce or prevent such degradation. This can be achieved. Considering the cyclic nature and incomplete yield of oligonucleotide synthesis, For example, to obtain gRNA in higher yield, and / or to The composition contains higher homogeneity and / or fewer incomplete or erroneous products. It is desirable to shorten the gRNA while maintaining or even improving its activity. It prevents such degradation, improves gRNA stability, and enhances gene editing efficiency. Improved methods and compositions for this purpose are particularly desirable for therapeutic applications. [Overview of the project] [Means for solving the problem]

[0005] In some embodiments, one or more shortened regions and / or regions described herein are included. Alternatively, genome editing tools containing guide RNA (gRNA) with substitutions are provided. Shortened regions or substitutions described in the details result in higher yield and / or homogeneity. It can promote the synthesis of gRNA and / or gRNA / Cas9 complexes. Cas9 (e.g., SaCas9, S) is used to improve body stability and cleave target DNA. This may improve the activity of pyCas9 and its equivalents.

[0006] In some embodiments, one or more shortened regions and / or regions described herein are included. or crisprRNA (crRNA) and / or tracrRNA ( A modified crRNA is provided. In some embodiments, modified crRNA and / or modified The ornamental trRNA includes dual guide RNA (dgRNA). In some embodiments, Modified crRNA and / or modified trRNA are single guide RNAs (sgRNAs). This includes. The shortened regions and / or substitutions described herein result in higher yields and It can promote the synthesis of gRNA that is homogeneous and / or gRNA and g To improve the stability of the RNA / Cas9 complex and to cleave target DNA, Cas9 (for example) This can improve the activity of SauCas9, SpyCas9, and equivalents. 100me Compared to r's sgRNA or other short guide RNAs, the synthesis of the guide RNA of this disclosure is This can increase the crude yield of guide RNA. Similarly, it can be measured by the percentage of full-length products. This can increase the purity of the gRNA sample, for example, the crude purity. Compositions that can be obtained at a certain rate and / or containing gRNA have higher homogeneity and / or Alternatively, it may have fewer incomplete or erroneous products. Pure guide RNA For example, see Kanavarioti et al, Sci Rep 9, 101. 9(2019)(doi:10.1038 / s41598-018-37642-z) To achieve this, ion-pair reverse-phase high-performance liquid chromatography (IP-RP-HPLC) and It can be evaluated using ion-exchange HPLC. UV spectroscopy at a wavelength of 260 nm is used. The crude and final purity are determined by the cumulative absorbance of all peaks in the chromatogram. It can be determined by the ratio of the absorbance of the main peak. The synthesis yield is determined as the ratio of the absorbance at 260 nm of the final sample compared to the theoretical absorbance of the input material.

[0007] The following embodiments are included. Embodiment 1 is a guide RNA (gRNA) comprising a 5'-end modification or a 3'-end modification and a conserved portion of the gRNA, wherein the conserved portion is (a) a shortened hairpin 1 region, or a substituted and optionally shortened hairpin 1 region, wherein (i) the shortened hairpin 1 region lacks 6-8 nucleotides, and (A) one or more of positions H1-1, H1-2, or H1-3 are deleted or substituted relative to SEQ ID NO: 400, or (B) one or more of positions H1-6 to H1-10 are substituted relative to SEQ ID NO: 400, or (ii) the shortened hairpin 1 region lacks 9-10 nucleotides including H1-1 and / or H1-12, or (iii) the shortened hairpin 1 region lacks 5-10 nucleotides, and one or more of positions N18, H1-12, or N are substituted relative to SEQ ID NO: 400, or (iv) at least one of the following nucleotide pairs is substituted with Watson-Crick pairing nucleotides in the substituted and optionally shortened hairpin 1, and is H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and H1-9, and the hairpin 1 region optionally comprises (aa) any one or two of H1-5 to H1-8, (bb) the following nucleotide pairs: H1-1 and H1-12 , H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and One, two, or three of H1-9 and / or (cc) hairpin A hairpin region lacking 1 to 8 nucleotides, and / or (b) A shortened upper stem region lacking 1 to 6 nucleotides, The reduced upper stem region, and / or (c)LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, and substitution for sequence number 400 in one or more of H2-14 And the substituted nucleotide is not a pyrimidine followed by adenine, but rather a pyrimidine followed by adenine. Guide RNA (gRNA) containing one or more substitutions that are not present adenines be.

[0008] Embodiment 1.01 is a hairpin 1 region which is a substituted hairpin 1 region and contains 1 nucleotide This is the gRNA described in Embodiment 1, which lacks [the specified element].

[0009] Embodiment 1.02 is a hairpin 1 region which is a replacement hairpin 1 region and has two nucleos This is the gRNA described in Embodiment 1, which lacks tide.

[0010] Embodiment 1.03 is a hairpin 1 region which is a replacement hairpin 1 region and has 3 nucleos This is the gRNA described in Embodiment 1, which lacks tide.

[0011] Embodiment 1.04 is a hairpin 1 region which is a replacement hairpin 1 region and has 4 nucleos This is the gRNA described in Embodiment 1, which lacks tide.

[0012] Embodiment 1.05 is a hairpin 1 region which is a replacement hairpin 1 region and has 5 nucleos This is the gRNA described in Embodiment 1, which lacks tide.

[0013] Embodiment 1.06 is a hairpin 1 region which is a replacement hairpin 1 region and has 6 nucleos This is the gRNA described in Embodiment 1, which lacks tide.

[0014] Embodiment 1.07 is a hairpin 1 region which is a substituted hairpin 1 region and has 7 nucleotides. This is the gRNA described in Embodiment 1, which lacks [the specified element].

[0015] Embodiment 1.08 is a hairpin 1 region which is a replacement hairpin 1 region and has 8 nucleos This is the gRNA described in Embodiment 1, which lacks tide.

[0016] Embodiment 1.09 is a hairpin 1 in which the gRNA is substituted and optionally shortened. H1-1 and H1-12, including, are substituted with Watson-Crick pairing nucleotides. This is the gRNA described in Embodiment 1.

[0017] Embodiment 1.10 is a hairpin 1 in which the gRNA is substituted and optionally shortened. It contains H1-2 and H1-11, which are substituted with Watson-Crick pairing nucleotides. It is a gRNA described in any one of the prior embodiments.

[0018] Embodiment 1.11 is a hairpin 1 in which the gRNA is substituted and optionally shortened. It contains, and H1-3 and H1-10 are substituted with Watson-Crick pairing nucleotides. It is a gRNA described in any one of the prior embodiments.

[0019] Embodiment 1.12 is a hairpin 1 in which the gRNA is substituted and optionally shortened. It contains, and H1-4 and H1-9 are substituted with Watson-Crick pairing nucleotides. It is a gRNA described in any one of the prior embodiments.

[0020] Embodiment 1.13 is one of the preceding embodiments in which positions H1-5 are missing. This is the gRNA described above.

[0021] Embodiment 1.14 is one of the preceding embodiments in which position H1-6 is missing. This is the gRNA described above.

[0022] Embodiment 1.15 is one of the preceding embodiments in which positions H1-7 are missing. This is the gRNA described above.

[0023] Embodiment 1.16 is one of the preceding embodiments in which position H1-8 is missing. This is the gRNA described above.

[0024] Embodiment 1.17 is one in which two of H1-5, H1-6, H1-7, and H1-8 are The deleted gRNA is described in any one of the prior embodiments.

[0025] Embodiment 1.18 is a prior embodiment in which positions H1-1 and H1-12 are omitted. It is a gRNA described in one of the morphological descriptions.

[0026] Embodiment 1.19 is a prior embodiment in which positions H1-2 and H1-11 are omitted. It is a gRNA described in one of the morphological descriptions.

[0027] Embodiment 1.20 is a prior embodiment in which positions H1-3 and H1-10 are omitted. It is a gRNA described in one of the morphological descriptions.

[0028] Embodiment 1.21 is a preceding embodiment in which positions H1-4 and H1-9 are omitted. It is a gRNA described in one of the states.

[0029] Embodiment 1.22 has positions H1-1 and H1-12, and positions H1-2 and H1-11 , positions H1-3 and H1-10, and two of positions H1-4 and H1-9 This is a gRNA described in any one of the prior embodiments, in which a pair is deleted.

[0030] Embodiment 1.23 has positions H1-1 and H1-12, and positions H1-2 and H1-11 , three of the positions H1-3 and H1-10, and positions H1-4 and H1-9 This is a gRNA described in any one of the prior embodiments, in which a pair is deleted.

[0031] Embodiment 2 is described in which position H1-1 is omitted, and is based on any one of the prior embodiments. This is the gRNA shown.

[0032] Embodiment 3 is one of Embodiments 1 to 1.23 in which position H1-1 is replaced. This is the gRNA described in [reference].

[0033] Embodiment 4 is described in which position H1-2 is omitted, and is based on one of the prior embodiments. This is the gRNA shown.

[0034] Embodiment 5 is described in any one of Embodiments 1 to 3, wherein position H1-2 is replaced. This is the gRNA.

[0035] Embodiment 6 is described in which position H1-3 is omitted, and is based on one of the prior embodiments. This is the gRNA shown.

[0036] Embodiment 7 is described in any one of Embodiments 1 to 5, wherein position H1-3 is replaced. This is the gRNA.

[0037] Embodiment 8 is described in which position H1-4 is omitted, and is based on one of the prior embodiments. This is the gRNA shown.

[0038] Embodiment 9 is a modified version of any one of Examples 1 to 7, in which position H1-5 is omitted. It is a gRNA.

[0039] Embodiment 10 is a modified version of any one of the prior embodiments in which position H1-6 is omitted. This is the gRNA described.

[0040] Embodiment 11 is described in any one of Embodiments 1 to 9, wherein position H1-6 is replaced. This is the gRNA shown.

[0041] Embodiment 12 is a modified version of any one of the prior embodiments in which position H1-7 is missing. This is the gRNA described.

[0042] Embodiment 13 is one of Embodiments 1 to 11 in which position H1-7 is replaced. This is the gRNA described.

[0043] Embodiment 14 is a modified version of any one of the prior embodiments in which position H1-8 is missing. This is the gRNA described.

[0044] Embodiment 15 is one of Embodiments 1 to 13 in which position H1-8 is replaced. This is the gRNA described.

[0045] Embodiment 16 is a modified version of any one of the preceding embodiments, in which positions H1-9 are omitted. This is the gRNA described.

[0046] Embodiment 17 is one of Embodiments 1 to 15 in which position H1-9 is replaced. This is the gRNA described.

[0047] Embodiment 18 is one of the prior embodiments in which position H1-10 is missing. This is the gRNA described in [reference].

[0048] Embodiment 19 is one of Embodiments 1 to 17 in which position H1-10 is replaced. This is the gRNA described in [reference].

[0049] Embodiment 20 is one of the prior embodiments in which position H1-11 is missing. This is the gRNA described in [reference].

[0050] Embodiment 21 is one of the prior embodiments in which position H1-12 is missing. This is the gRNA described in [reference].

[0051] Embodiment 22 includes a shortened hairpin 1 region lacking 6 to 8 nucleotides. The gRNA is described in any one of Embodiments 1 to 7.

[0052] Embodiment 23 is a prior embodiment in which the shortened hairpin 1 region has a length of 4 nucleotides. It is a gRNA described in one of the application forms.

[0053] Embodiment 24 is an embodiment of Embodiment 1 in which the shortened hairpin 1 region has a length of 5 nucleotides. It is a gRNA listed in any one of the following 22 entries.

[0054] Embodiment 25 is an embodiment in which the shortened hairpin 1 region has a length of 6 nucleotides, compared to Embodiment 1. It is a gRNA listed in any one of the following 22 entries.

[0055] Embodiment 26 shows that 4, 5, or 6 nucleotides in the shortened hairpin 1 region, The gRNA is one of any one of embodiments 23 to 25, and includes two or fewer substitutions.

[0056] Embodiment 27 shows that 4, 5, or 6 nucleotides in the shortened hairpin 1 region, This is the gRNA according to Embodiment 26, which includes one substitution.

[0057] Embodiment 28 shows that 4, 5, or 6 nucleotides in the shortened hairpin 1 region are non The substitution is the gRNA described in Embodiment 26.

[0058] Embodiment 29 is a prior embodiment in which positions H1-2 to H1-4 are omitted. It is the gRNA described in one of the following.

[0059] Embodiment 30 is a prior embodiment in which positions H1-2 to H1-5 are omitted. It is the gRNA described in one of the following.

[0060] Embodiment 31 is a prior embodiment in which positions H1-9 to H1-11 are omitted. It is the gRNA described in either one of the following.

[0061] Embodiment 32 is a prior embodiment in which positions H1-8 to H1-11 are omitted. It is the gRNA described in either one of the following.

[0062] Embodiment 33 is characterized by the absence of positions H1-2 to H1-4 and H1-9 to H1-11. or gRNA as described in any one of the prior embodiments.

[0063] Embodiment 34 is the g described in Embodiment 33, wherein the shortened hairpin 1 region includes the following It is RNA: (a) Sequence AGAAAAU, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) An array that has one or fewer mismatches with the array in (a).

[0064] Embodiment 35 has positions H1-2 to H1-5 and H1-9 to H1-11 missing. or gRNA as described in any one of Embodiments 1 to 32.

[0065] Embodiment 36 is a modification in which each position of the upper stem region is modified and optionally the upper stem gR according to Embodiment 35, in which each position of the region is modified by 2'-O-methylation. It is NA.

[0066] Embodiment 37 is an embodiment in which the shortened hairpin 1 region includes the following, as in Embodiment 35 or 36 The gRNA is one of the following: (a) Array AAAAU, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) An array that has one or fewer mismatches with the array in (a).

[0067] Embodiment 38 has positions H1-2 to H1-5 and H1-8 to H1-11 missing. or gRNA as described in any one of Embodiments 1 to 32.

[0068] Embodiment 39 is a modification in which each position of the upper stem region is modified and optionally the upper stem gR according to Embodiment 38, in which each position of the region is modified by 2'-O-methylation. It is NA.

[0069] Embodiment 40 includes the following in Embodiment 38 or 39: The gRNA is one of the following: (a) Array AAAU, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) An array that has one or fewer mismatches with the array in (a).

[0070] Embodiment 41 is characterized by the absence of positions H1-1, H1-3 to H1-8, and H1-12. The gRNA present is one of the gRNAs described in any one of Embodiments 1 to 32.

[0071] Embodiment 42 is a modification in which each position of the upper stem region is modified and optionally selected to be the upper stem gR according to Embodiment 41, in which each position of the region is modified by 2'-O-methylation. It is NA.

[0072] Embodiment 43 has a shortened hairpin 1 region, (a) Sequence CAAG, (b) A sequence that has two or fewer mismatches with the sequence in (a), or Embodiment 41 or 4 includes an array having one or fewer mismatches with the array in (c)(a). This is the gRNA described in 2.

[0073] Embodiment 44 is a prior embodiment in which positions H1-1 to H1-8 are omitted. It is the gRNA described in one of the following.

[0074] Embodiment 45 is a prior embodiment in which positions H1-11 to H1-12 are omitted. It is the gRNA listed in one of the following documents.

[0075] Embodiment 46 is one of embodiments 1 to 32 in which positions H1-2 to H1-8 are omitted. It is the gRNA described in one of the following.

[0076] Embodiment 47 has a shortened hairpin 1 region, (a) Array AAAGU, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) gRN of Embodiment 46, which includes a sequence having one or fewer mismatches with the sequence of (a). It is A.

[0077] Embodiment 48 is one of embodiments 1 to 32 in which positions H1-3 to H1-9 are omitted. It is the gRNA described in one of the following.

[0078] Embodiment 49 shows that the shortened hairpin 1 region is (a) Sequence ACAGU, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 48 includes an array having one or fewer mismatches with the array in (a). It is a gRNA.

[0079] Embodiment 50 is any one of the preceding embodiments in which positions H1-7 are replaced by G. This is the gRNA described above.

[0080] Embodiment 51 is any one of the preceding embodiments in which position H1-8 is replaced by C. This is the gRNA described above.

[0081] Embodiment 52 is a modified version of the prior embodiment in which positions H1-7 and H1-8 are replaced. It is the gRNA listed in one of the following documents.

[0082] Embodiment 53 is in which positions H1-7 and H1-8 are replaced by G and C, respectively. It is a gRNA described in any one of the prior embodiments.

[0083] Embodiment 54 is in which positions H1-7 and H1-8 are replaced by G and C, respectively. Furthermore, positions H1-2 to H1-4 and positions H1-9 to H1-11 are missing. The gRNA is described in any one of the embodiments described.

[0084] Embodiment 55 has a shortened hairpin 1 region, (a) Sequence AGAGCU, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 54 includes an array having one or fewer mismatches with the array in (a). It is a gRNA.

[0085] Embodiment 56 is any one of the preceding embodiments in which positions H1-6 are replaced by C. This is the gRNA described above.

[0086] Embodiment 57 is any one of the preceding embodiments in which positions H1-7 are replaced by U. This is the gRNA described above.

[0087] Embodiment 58 is a modified version of the preceding embodiment in which positions H1-6 and H1-7 are replaced. It is the gRNA listed in one of the following documents.

[0088] Embodiment 59 is in which positions H1-6 and H1-7 are replaced by C and U, respectively. It is a gRNA described in any one of the prior embodiments.

[0089] Embodiment 60 is in which positions H1-6 and H1-7 are replaced by C and U, respectively. Furthermore, positions H1-2 to H1-4 and positions H1-9 to H1-11 are missing. The gRNA is described in any one of the embodiments described.

[0090] Embodiment 61 has a shortened hairpin 1 region, (a) Sequence AGCUAU, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 60 includes an array having one or fewer mismatches with the array in (a). It is a gRNA.

[0091] Embodiment 62 is any one of the preceding embodiments in which position H1-1 is replaced by C. This is the gRNA described above.

[0092] Embodiment 63 is any of the preceding embodiments in which positions H1-12 are replaced by G. It is the gRNA described in one of the entries.

[0093] Embodiment 64 is a prior embodiment in which positions H1-1 and H1-12 are replaced. It is a gRNA listed in one of the following.

[0094] Embodiment 65 is in which positions H1-1 and H1-12 are replaced by C and G, respectively. It is a gRNA described in any one of the prior embodiments.

[0095] Embodiment 66 is in which positions H1-1 and H1-12 are replaced by C and G, respectively. The data is missing, with positions H1-2 to H1-4 and H1-9 to H1-11. This is the gRNA described in any one of the prior embodiments.

[0096] Embodiment 67 is a modification in which each position of the upper stem region is modified and optionally selected to be the upper stem gR according to Embodiment 66, in which each position of the region is modified by 2'-O-methylation. It is NA.

[0097] Embodiment 68 has a shortened hairpin 1 region, (a) Sequence CGAAAG, (b) A sequence that has two or fewer mismatches with the sequence in (a), or Embodiment 66 or 6 includes an array having one or fewer mismatches with the array in (c)(a). This is the gRNA described in 7.

[0098] Embodiment 69 provides a shortened hairpin 1 region lacking 9 to 10 nucleotides. This includes gRNA as described in any one of Embodiments 1 to 22.

[0099] Embodiment 70 is an embodiment in which the shortened hairpin 1 region has a length of 2 nucleotides. This is the gRNA described in section 69.

[0100] Embodiment 71 is an embodiment in which the shortened hairpin 1 region has a length of 3 nucleotides. This is the gRNA described in section 69.

[0101] Embodiment 72 is an unsubstituted form in which two or three nucleotides of the shortened hairpin 1 region are This is the gRNA described in Embodiment 70 or 71.

[0102] Embodiment 73 is a prior embodiment in which positions H1-11 to H1-12 are omitted. It is the gRNA listed in one of the following documents.

[0103] Embodiment 74 is characterized by the absence of positions H1-1 to H1-8 and H1-11 to H1-12. The gRNA present is the one described in Embodiment 73.

[0104] Embodiment 75 has a shortened hairpin 1 region, (a) Sequence AA, or (b) The following is described in Embodiment 74, which includes sequences having one or fewer mismatches with the sequence in (a). This is the gRNA.

[0105] Embodiment 76 is an embodiment in which positions H1-1 to H1-9 and H1-12 are omitted. It is a gRNA described in one of the following states: 1-21 or 69-72.

[0106] Embodiment 77 has a shortened hairpin 1 region, (a) Sequence AG, (b) g according to Embodiment 76, which includes an array having one or fewer mismatches with the array of (a). It is RNA.

[0107] Embodiment 78 provides a shortened hairpin 1 region lacking 5 to 10 nucleotides. This includes gRNA as described in any one of Embodiments 1 to 21.

[0108] Embodiment 79 is an embodiment in which the shortened hairpin 1 region has a length of 7 nucleotides. This is the gRNA described in section 78.

[0109] Embodiment 80 is an embodiment of Embodiment 78 or 7, in which positions H1-4 to H1-11 are missing. This is the gRNA described in section 9.

[0110] Embodiment 81 is described in any one of the preceding embodiments in which position N18 is replaced. This is the gRNA shown.

[0111] Embodiment 82 is the gRNA described in Embodiment 81, wherein position N18 is replaced with C. be.

[0112] Embodiment 83 is characterized in that position N18 is replaced by C, and positions H1-4 to H1-11 are missing. This is the gRNA described in Embodiment 82.

[0113] Embodiment 84 shows that the gRNA has a shortened hairpin 1 region at position N18, and at position N Includes segments that include, (a) Sequence CACUUG, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 83 includes an array having one or fewer mismatches with the array in (a). It is a gRNA.

[0114] Embodiment 85 is one of the preceding embodiments in which position H1-12 is replaced. This is the gRNA described in [reference].

[0115] Embodiment 86 is the gRN described in Embodiment 85, in which positions H1-12 are replaced with C. It is A.

[0116] Embodiment 87 is the gRN described in Embodiment 86, in which positions H1-12 are replaced with A. It is A.

[0117] Embodiment 88 is described in any one of the preceding embodiments, wherein position N is replaced. It is a gRNA.

[0118] Embodiment 89 is the gRNA described in Embodiment 88, wherein position N is replaced with A. .

[0119] Embodiment 90 is characterized in that positions H1-12 are replaced by C and position N is replaced by A. , the gRNA described in Embodiment 89.

[0120] Embodiment 91 is such that positions H1-12 are replaced by C, and position N is replaced by A. This is the gRNA described in Embodiment 90, in which positions H1-4 to H1-11 are deleted.

[0121] Embodiment 92 shows that the gRNA has a shortened hairpin 1 region at position N18, and at position N Includes segments that include, (a) Sequence AACUCA, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 91 includes an array having one or fewer mismatches with the array in (a). It is a gRNA.

[0122] Embodiment 93 is in which positions H1-12 are replaced by A, and position N is replaced by A. , the gRNA described in Embodiment 85.

[0123] Embodiment 94 is in which positions H1-12 are replaced by A, and position N is replaced by A. This is the gRNA described in Embodiment 93, in which positions H1-4 to H1-11 are deleted.

[0124] Embodiment 95 shows that the gRNA has a shortened hairpin 1 region at position N18, and at position N Includes segments that include, (a) Sequence AACUAA, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 94 includes an array having one or fewer mismatches with the array in (a). It is a gRNA.

[0125] Embodiment 96 includes a shortened upper stem region, which is one of the preceding embodiments. This is the gRNA described in [reference].

[0126] Embodiment 97 has a shortened upper stem region that lacks 1 to 6 nucleotides. , the gRNA described in Embodiment 96.

[0127] Embodiment 98 is an embodiment in which the shortened upper stem region has a length of 6 nucleotides. This is the gRNA described in 97.

[0128] Embodiment 99 is an embodiment in which the shortened upper stem region has a length of 7 nucleotides. This is the gRNA described in 97.

[0129] Embodiment 100 is an embodiment in which the shortened upper stem region has a length of 8 nucleotides. This is the gRNA described in form 97.

[0130] Embodiment 101 is an embodiment in which the shortened upper stem region has a length of 9 nucleotides. This is the gRNA described in form 97.

[0131] Embodiment 102 is an embodiment in which the shortened upper stem region has a length of 10 nucleotides. This is the gRNA described in morphology 97.

[0132] Embodiment 103 is an embodiment in which the shortened upper stem region has a length of 11 nucleotides. This is the gRNA described in morphology 97.

[0133] Embodiment 104 has 6, 7, 8, 9, 10, or 11 shortened upper stem regions The nucleotides include four or fewer substitutions, as described in any one of embodiments 98 to 103. This is the gRNA.

[0134] Embodiment 105 has 6, 7, 8, 9, 10, or 11 shortened upper stem regions The nucleotides include two or fewer substitutions, as described in any one of Embodiments 98 to 103. This is the gRNA.

[0135] Embodiment 106 has 6, 7, 8, 9, 10, or 11 shortened upper stem regions The nucleotide of is g according to any one of embodiments 98 to 103, which includes one substitution. It is RNA.

[0136] Embodiment 107 has 6, 7, 8, 9, 10, or 11 shortened upper stem regions The nucleotide is unsubstituted, as described in any one of embodiments 98 to 103 of the gRN. It is A.

[0137] Embodiment 108 is a modified version of any one of the prior embodiments in which position US3 is missing. This is the gRNA described.

[0138] Embodiment 109 is a modified version of any one of the prior embodiments in which position US4 is missing. This is the gRNA described.

[0139] Embodiment 110 is a modified version of any one of the prior embodiments in which position US5 is omitted. This is the gRNA described.

[0140] Embodiment 111 is one of the prior embodiments in which position US8 is omitted. This is the gRNA described.

[0141] Embodiment 112 is a modified version of any one of the prior embodiments in which position US9 is omitted. This is the gRNA described.

[0142] Embodiment 113 is one of the prior embodiments in which position US10 is omitted. This is the gRNA described in [reference].

[0143] Embodiment 114 is a modified version of the preceding embodiment, in which positions US4 and US9 are omitted. It is the gRNA described in either one of the following.

[0144] Embodiment 115 is characterized by the absence of positions H1-2 to H1-5 and H1-8 to H1-11. This is the gRNA described in Embodiment 114.

[0145] Embodiment 116 has a shortened upper stem region, (a) Sequence GCUGAAAGGC (SEQ ID NO: 1004), (b) A sequence that has two or fewer mismatches with the sequence in (a), or Embodiment 114 or includes an array having one or fewer mismatches with the array in (c)(a). This is the gRNA described in section 115.

[0146] Embodiment 117 is a modified version of the prior embodiment in which positions US3 and US4 are omitted. It is the gRNA described in either one of the following.

[0147] Embodiment 118 is a prior embodiment in which positions US9 and US10 are omitted. It is the gRNA listed in one of the following documents.

[0148] Embodiment 119 is characterized by the absence of positions US3, US4, US9, and US10. This is the gRNA described in Embodiment 118.

[0149] Embodiment 120 is characterized by the absence of positions H1-2 to H1-5 and H1-8 to H1-11. This is the gRNA described in Embodiment 119.

[0150] Embodiment 121 has a shortened upper stem region, (a) Sequence GCGAAAGC, (b) A sequence that has two or fewer mismatches with the sequence in (a), or Embodiment 119 or includes an array having one or fewer mismatches with the array in (c)(a). This is the gRNA described in 120.

[0151] Embodiment 122 is an embodiment in which positions H1-1 and H1-4 to H1-12 are omitted. This is the gRNA described in morphology 119 or 121.

[0152] Embodiment 123 is characterized by the absence of positions US3, US4, US8, US9, and US10. This is the gRNA described in Embodiment 119.

[0153] Embodiment 124 has a shortened upper stem region, (a) Sequence GCGAGC, (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 123 includes an array having one or fewer mismatches with the array in (a). This is the gRNA.

[0154] Embodiment 125 is characterized by the absence of positions US3, US4, US5, US9, and US10. This is the gRNA described in Embodiment 119.

[0155] Embodiment 126 has a shortened upper stem region, (a) Sequence GCAAAGC (SEQ ID NO: 1005), (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment 125 includes an array having one or fewer mismatches with the array in (a). This is the gRNA.

[0156] Embodiment 127 is an embodiment in which position US3 is optionally replaced with G, as in Embodiment 9. It is a gRNA listed in one of the following entries: 6-107.

[0157] Embodiment 128 has position US4 replaced, and optionally replaced with C. or the gRNA described in any one of embodiments 96-107 or 127.

[0158] Embodiment 129 has position US9 replaced, and optionally replaced with G. or the gRNA described in any one of embodiments 96-107 or 127-128.

[0159] Embodiment 130 has US10 position replaced, and optionally replaced with C. or the gRNA described in any one of embodiments 96-107 or 127-129.

[0160] Embodiment 131 has positions US3 and US10 optionally set to G and C The following is described in any one of embodiments 96-107 or 127-130, which are replaced by the following: This is the gRNA.

[0161] Embodiment 132 is such that positions US4 and US9 are optionally at C and G respectively. , replaced by any one of embodiments 96-107 or 127-131 It is a gRNA.

[0162] Embodiment 133 is in which positions US3 and US10 are replaced by G and C, respectively. Embodiment 132, in which positions US4 and US9 are replaced by C and G, respectively. This is the gRNA described in [reference].

[0163] Embodiment 134 is the gRNA described in Embodiment 133, in which position US5 is deleted. be.

[0164] Embodiment 135 is in which positions US3 and US10 are replaced by G and C, respectively. Positions US4 and US9 are replaced by C and G respectively, and position US8 is missing. The gRNA described in Embodiment 133 or 134 is missing.

[0165] Embodiment 136 is characterized by the absence of positions H1-2 to H1-5 and H1-8 to H1-11. This is the gRNA described in Embodiment 135.

[0166] Embodiment 137 has a shortened upper stem region, (a) Sequence GGCGAAGCGC (Sequence ID 1008), (b) A sequence that has two or fewer mismatches with the sequence in (a), or Embodiment 135 includes the following: (c)(a) arrays having one or fewer mismatches This is the gRNA described in 136.

[0167] Embodiment 138 is in which US3 and US10 are replaced by C and G, respectively. The gRNA is described in any one of embodiments 96-107 or 127-131.

[0168] Embodiment 139 is in which positions US3 and US10 are replaced by C and G, respectively. The gRNA described in Embodiment 138 has deletions at positions US4 and US9. .

[0169] Embodiment 140 has a shortened upper stem region, (a) Sequence GCGGAAACGC (Sequence ID 1006), (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment described in 139 includes an array having one or fewer mismatches with the array in (a). This is the gRNA.

[0170] Embodiment 141 is in which US3 and US10 are replaced with G and C, respectively. Embodiments 96-107 or 127-131 are missing US4 and US9. It is the gRNA described in either one of the following.

[0171] Embodiment 142 has a shortened upper stem region, (a) Sequence GCCGAAAGGC (Sequence ID 1007), (b) A sequence that has two or fewer mismatches with the sequence in (a), or (c) The embodiment described in 141 includes an array having one or fewer mismatches with the array in (a). This is the gRNA.

[0172] Embodiment 143 is one of the preceding embodiments in which position LS6 is replaced. This is the gRNA described.

[0173] Embodiment 144 is one of the preceding embodiments in which position LS7 is replaced. This is the gRNA described.

[0174] Embodiment 145 is one of the preceding embodiments in which position US3 is replaced. This is the gRNA described.

[0175] Embodiment 146 is one of the preceding embodiments in which position US10 is replaced. This is the gRNA described in [reference].

[0176] Embodiment 147 describes one of the preceding embodiments in which position B3 is replaced. This is the gRNA shown.

[0177] Embodiment 148 is the gRNA described in Embodiment 147, wherein position B3 is replaced with G. That is the case.

[0178] Embodiment 149 describes one of the preceding embodiments in which position N7 is replaced. This is the gRNA shown.

[0179] Embodiment 150 is the gRNA described in Embodiment 149, wherein position N7 is replaced with C. That is the case.

[0180] Embodiment 151 is the gRNA described in Embodiment 149, wherein position N7 is replaced with U. That is the case.

[0181] Embodiment 152 is any one of the preceding embodiments in which position N15 is substituted with the gRNA described.

[0182] Embodiment 153 is the gRNA described in Embodiment 152 in which position N15 is substituted with C A.

[0183] <000090​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​

[0191] Embodiment 162 is in which positions US3 and US10 are replaced by G and C, respectively. This is the gRNA described in Embodiment 161.

[0192] Embodiment 163 is a preceding embodiment in which positions H2-2 and H2-14 are replaced. It is a gRNA described in one of the states.

[0193] Embodiment 164 is in which positions H2-2 and H2-14 are replaced by A and U, respectively. This is the gRNA described in Embodiment 163.

[0194] Embodiment 165 is in which positions H2-2 and H2-14 are replaced by G and C, respectively. This is the gRNA described in Embodiment 164.

[0195] Embodiment 166 has positions US3, US10, LS6, LS7, B3, N15, N17, At least 2, 3, 4, 5, 6, 7, or 8 of H2-2 and H2-14 The substituted gRNA is one of the gRNAs described in any one of the preceding embodiments.

[0196] Embodiment 167 has positions US3, US10, LS6, LS7, B3, N15, N17, The gRNA described in Embodiment 166 is one in which H2-2 and H2-14 are substituted. .

[0197] Embodiment 168 is a prior embodiment that meets at least two, three, four, or five of the following conditions. The gRNA is described in any one of the embodiments described: (a) US3 and US10 are replaced with G and C, respectively. (b) Positions LS6 and LS7 are replaced by U and A, respectively. (c) Position B3 is replaced by G, (d) Position N15 is replaced by C, (e) Position N17 is replaced by G, and / or (f) Positions H2-2 and H2-14 are replaced by A and U, respectively.

[0198] Embodiment 169 is a gRNA of an embodiment in which US3 and US10 are replaced by G and C, respectively, LS6 and LS7 are replaced by U and A, respectively, B3 is replaced by G, N15 is replaced by C, N17 is replaced by G, and H2-2 and H2- 14 are replaced by A and U, respectively.

[0199] Embodiment 170 is a gRNA of any one of the preceding embodiments in which positions H1-4 to H1-11 are deleted.

[0200] Embodiment 171 is such that the shortened hairpin 1 region (a) has the sequence ACUU, (b) has a sequence with no more than 2 mismatches with the sequence of (a), or (c) has a sequence with no more than 1 mismatch with the sequence of (a), and is a gRNA of Embodiment 170.

[0201] Embodiment 172 is a gRNA of any one of the preceding embodiments in which position N2 is replaced by C and optionally positions H1-4 to H1-11 are deleted. .

[0202] Embodiment 173 is a gRNA of any one of the preceding embodiments in which positions US1 to US4 and positions US9 to US12 are deleted and optionally positions H1-4 to H1-11 are deleted. ​​​​

[0203] Embodiment 174 is described in Embodiment 173, in which positions H1-2 to H1-11 are omitted. This is the gRNA shown.

[0204] Embodiment 175 is a prior embodiment in which positions H1-1 to H1-12 are omitted. It is the gRNA listed in one of the following documents.

[0205] Embodiment 176 is a prior to which positions US2-US4 and US9-US11 are missing. The gRNA is described in any one of the embodiments described.

[0206] Embodiment 177 is described in Embodiment 176, in which positions H1-2 to H1-11 are omitted. This is the gRNA shown.

[0207] Embodiment 178 is an embodiment in which positions H1-1 and H1-4 to H1-12 are omitted. This is the gRNA described in morphology 176.

[0208] Embodiment 179 is an actual embodiment in which positions US3-US5 and US8-US10 are missing. This is the gRNA described in one of the application forms 1 to 175.

[0209] Embodiment 180 is an actual embodiment in which positions US3-US4 and US7-US10 are omitted. This is the gRNA described in one of the application forms 1 to 175.

[0210] Embodiment 181 is one of embodiments 1 to 175 in which positions US3 to US10 are omitted. It is the gRNA described in one of the following.

[0211] Embodiment 182 is an actual embodiment in which positions US2-US5 and US8-US11 are omitted. This is the gRNA described in one of the application forms 1 to 175.

[0212] Embodiment 183 is an actual embodiment in which positions US2-US6 and US8-US11 are missing. This is the gRNA described in one of the application forms 1 to 175.

[0213] Embodiment 184 is a modified version of Embodiments 1 to 175, in which positions US2 to US11 are omitted. It is the gRNA described in either one of the following.

[0214] Embodiment 185 is an actual embodiment in which positions US1-US5 and US8-US12 are missing. This is the gRNA described in one of the application forms 1 to 175.

[0215] Embodiment 186 is an actual embodiment in which positions US1-US5 and US7-US12 are missing. This is the gRNA described in one of the application forms 1 to 175.

[0216] Embodiment 187 is one of the preceding embodiments in which position H2-15 is missing. This is the gRNA described above.

[0217] Embodiment 188 is an embodiment in which positions H2-14 and H2-15 are missing. This is the gRNA described in 7.

[0218] Embodiment 189 is characterized by the absence of position N6, and by optional selection, positions H1-4 to H1-11 This is the gRNA described in any one of the prior embodiments, which is missing the specified part.

[0219] Embodiment 190 has position LS6 replaced, and optionally replaced with C. or the gRNA described in any one of the prior embodiments.

[0220] Embodiment 191 has position B3 replaced, and optionally replaced with C. This is the gRNA described in any one of the prior embodiments.

[0221] Embodiment 192 is a substitution where position N1 is replaced by C, optionally. This is the gRNA described in any one of the prior embodiments.

[0222] Embodiment 193 has position N7 replaced, and optionally replaced with G. This is the gRNA described in any one of the prior embodiments.

[0223] Embodiment 194 has position N15 replaced, and optionally replaced with G. or the gRNA described in any one of the prior embodiments.

[0224] Embodiment 195 is in which position N17 is replaced with a nonpyrimidine, and G is optionally used. It is a gRNA described in any one of the prior embodiments, which is substituted with [the specified character].

[0225] Embodiment 196 is one of the preceding embodiments in which the gRNA is sgRNA. This is the gRNA described in [reference].

[0226] Embodiment 197 is an embodiment of Embodiments 1-1 in which the gRNA is crRNA or dgRNA. It is one of the gRNAs listed in any of the 95.

[0227] Embodiment 198 is a gRNA that includes a 5' terminal modification, as described in any of the preceding embodiments. This is the gRNA described above.

[0228] Embodiment 199 is a gRNA that includes a 3' terminal modification, as described in any of the preceding embodiments. This is the gRNA described above.

[0229] Embodiment 200 is a prior embodiment in which the gRNA includes 5' terminal modifications and 3' terminal modifications. It is a gRNA described in one of the application forms.

[0230] Embodiment 201 is a gRNA that includes a 3' tail, one of the preceding embodiments. This is the gRNA described in [reference].

[0231] Embodiment 202 has a 3' tail that is approximately 1-2, 1-3, 1-4, 1-5, 1-7, 1- 10, at least 1-5, at least 1-3, at least 1-4, at least 1-5, few Contains at least 1-5, at least 1-7, or at least 1-10 nucleotides , the gRNA described in Embodiment 201.

[0232] Embodiment 203 has a 3' tail that is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 This is the gRNA described in Embodiment 202, which contains [number] nucleotides.

[0233] Embodiment 204 is one of the preceding embodiments in which the gRNA does not contain a 3' tail. It is the gRNA described in one of the entries.

[0234] Embodiment 205 includes modification in the hairpin region, and is one of the preceding embodiments. This is the gRNA described above.

[0235] Embodiment 206 includes 3'-end modification and modification in the hairpin region, compared to previous embodiments. It is a gRNA described in one of the application forms.

[0236] Embodiment 207 includes 3'-end modification, modification in the hairpin region, and 5'-end modification. This includes, or is a gRNA described in any one of the prior embodiments.

[0237] Embodiment 208 includes modifications at the 5' end and modifications in the hairpin region, compared to previous embodiments. It is a gRNA described in one of the application forms.

[0238] Embodiment 209 is described in any one of the prior embodiments, further including a guide region. This is the gRNA.

[0239] Embodiment 210 is an embodiment in which the 3' and / or 5' end modification is a protective end modification, for example, 2' -O-methyl(2'-OMe) modified nucleotide, 2'-O-(2-methoxyethyl)( 2'-O-moe) modified nucleotides, 2'-fluoro(2'-F) modified nucleotides, Internucleotide phosphorothioate (PS) bonds, inverted debasic modified nucleotides, The preceding embodiment includes a modified nucleotide selected from a combination thereof. It is the gRNA described in either one of the following.

[0240] Embodiment 211 is a modification in the hairpin region, where 2'-O-methyl(2'-Ome) Modified nucleotides, 2'-fluoro(2'-F) modified nucleotides, internucleotide phosphate Modified nucleotides selected from holothioate (PS) bonds or combinations thereof. The gRNA is one of the gRNAs described in any one of the prior embodiments, including the one described above.

[0241] Embodiment 212 is a 3' and / or 5' terminal modification, where 2'-O-methyl(2'-O One of the preceding embodiments includes or further includes a modified nucleotide (me) This is the gRNA described.

[0242] Embodiment 213 has a 3' and / or 5' terminal modification, which is 2'-fluoro(2'-F) The preceding embodiment, which includes or further includes a modified nucleotide, as described in any one of the preceding embodiments. It is a gRNA.

[0243] Embodiment 214 is an internucleotide phosphorothiocyanate modification of the 3' and / or 5' terminal. One of the preceding embodiments, which includes or further includes an ethode (PS) bond. This is the gRNA.

[0244] Embodiment 215 is an inverted debase-modified nucleo with 3' and / or 5' terminal modifications. gRNA as described in any one of the prior embodiments, comprising or further comprising tide ru.

[0245] Embodiment 216 is a modification in the hairpin region, where 2'-O-methyl (2'-Ome) The preceding embodiment, which includes or further includes a modified nucleotide, as described in any one of the preceding embodiments. It is a gRNA.

[0246] Embodiment 217 is a modification in the hairpin region, which is a 2'-fluoro(2'-F) modification. gRN as described in any one of the prior embodiments, comprising or further comprising a creotide It is A.

[0247] Embodiment 218 has a 3' terminal modification, i. The last nucleotides of any one of the following: 7, 6, 5, 4, 3, 2, or 1 The above modifications, ii. One modified nucleotide, iii. Two modified nucleotides, iv. Three modified nucleotides, v. 4 modified nucleotides, vi. 5 modified nucleotides, vii. Six modified nucleotides, and viii. A prior embodiment comprising any of the seven modified nucleotides It is the gRNA described in one of the following.

[0248] Embodiment 219 has a 3'-terminal modification, i. Internucleotide phosphorothioate (PS) bonding, ii. 2'-Ome modified nucleotides, iii. 2'-O-moe modified nucleotides, iv. 2'-F modified nucleotide, v. Inverted debasic modified nucleotides, and vi. (i.) ~ (v.) includes one or more combinations of the above. The gRNA is described in any one of the embodiments described.

[0249] Embodiment 220 is a gRNA which is as follows: i. Internucleotide phosphorothioate (PS) bonding, ii. 2'-Ome modified nucleotides, iii. 2'-O-moe modified nucleotides, iv. 2'-F modified nucleotide, v. Inverted debasic modified nucleotides, and vi. 3' containing one or more combinations of (i.) ~ (v.) The gRNA is described in any one of the prior embodiments, including a tail.

[0250] Embodiment 221 is a case where gRNA is i. PS bonds between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, ii. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or 18 PS bonds between nucleotides, iii. Approximately 1-3, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 Nu Cleotide-to-creotide PS bond, iv. About 1~3, 1~5, 1~6, 1~7, 1~8, 1~9, 1~10, 1~12, 1 ~14, 1~16, 1~18, or 1~20 nucleotide-to-nucleotide PS bonds, and v. Any of the preceding embodiments, which include one or more PS bonds between each nucleotide. It is the gRNA described in one of the documents.

[0251] Embodiment 222 is a 3'-terminal modification comprising at least one PS bond, and furthermore: i. There is one PS bond, and the bond is between the last nucleotide and the second to last nucleo Between Chido, ii. Two PS bonds exist between the last three nucleotides. iii. A PS bond exists between one or more of the last four nucleotides. ru, iv. A PS bond exists between one or more of the last five nucleotides. , and v. Of the last 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides One or more of the following are precedents: PS bonds exist between any one of them. It is a gRNA described in one of the states.

[0252] Embodiment 223 has a 3'-terminal modification of at least one 2'-OMe, 2'-O-mo Embodiment 222 further comprises e, inverted debase, or 2'-F modified nucleotide. This is the gRNA described.

[0253] Embodiment 224 has a 3' terminal modification, i. One or more modifications among the last 1 to 7 nucleotides, wherein the modification is a PS bond. Combined, inverted debasic nucleotides, 2'-Ome, 2'-O-moe, 2'-F, or The combination of those modifiers, ii. 2'-Ome, 2'-O-moe, 2'-F, or combinations thereof Modification of the last nucleotide, as well as the adjacent nucleotide and / or 3' tail. Optionally, one or two PS bonds to the first nucleotide, iii. 2'-Ome, 2'-O-moe, 2'-F, or combinations thereof Modification of the last and / or second-to-last nucleotide by, and optionally by and one or more PS bonds, iv. 2'-Ome, 2'-O-moe, 2'-F, or combinations thereof The last, second to last, and / or third to last nucleotide modification, Furthermore, by arbitrary selection, one or more PS bonds, v. 2'-Ome, 2'-O-moe, 2'-F, or combinations thereof Last, second to last, third to last, and / or fourth to last Nukureochi Modification of the do, and by optional choice, one or more PS bonds, vi. 2'-Ome, 2'-O-moe, 2'-F, or combinations thereof The last, second to last, third to last, fourth to last, and / or last Modification of the fifth nucleotide, and optionally, the inclusion of one or more PS bonds. The gRNA is described in any one of the embodiments described.

[0254] Embodiment 225 is an sgRNA which includes a 3' tail and has a 3' tail Any of the preceding embodiments, which include modifications to one or more of the nucleotides present. It is the gRNA described in one of the documents.

[0255] Embodiment 226 is a fully modified version of the g described in Embodiment 225, where the 3' tail is fully modified. It is RNA.

[0256] Embodiment 227 includes a gRNA with a shortened hairpin 1 region, and the gRNA is small The gRNA described in Embodiment 225 includes modifications of H2-1 to H2-12.

[0257] Embodiment 228 is a case where gRNA is i. Any of the following sequence numbers: 101-190, 301-394, or 795-798 A 3' terminal modification shown in one of the following ways, ii. (i) 2'-OMe modified nucleotide at the last nucleotide of the conserved region of gRNA Rheotide, (ii) Three consecutive 2'O nucleotides immediately 5' of the 2'-OMe modified nucleotide -moe modified nucleotides, and the last three nuclei of the conserved region of (iii) gRNA Three consecutive PS bonds between ocids, iii. (i) Five consecutive 2'-OMe modified nucleotides from the 3' end of the 3' end (ii) Three PS bonds between the last three nucleotides of the conserved region of gRNA. , iv. Inverted debase-modified nucleo at the last nucleotide of the conserved region of gRNA Chido, v.(i) Inverted debase-modified nucleotide at the last nucleotide of the conserved region of gRNA 3 nucleotides in the last 3 nucleotides of the conserved region of (ii) gRNA A sequence of 2'-OMe modified nucleotides, vi. (i) Fifteen consecutive 2'-OMe modified nucleos from the 3' end of the 3' end (ii) Five consecutive 2'- from the 5' end of the 2'-OMe modified nucleotide F-modified nucleotides, and (iii) the last three nucleotides of the conserved region of gRNA. Three PS bonds in between, vii. (i) Alternating nucleotides in the last 20 nucleotides of the conserved region of gRNA '-OMe modified nucleotides and 2'-F modified nucleotides, as well as (ii)gRN Three PS bonds between the last three nucleotides of the conserved region of A, viii. (i) Two or three consecutive 2'-OMe modified nucleotides, and (i i) Three PS bonds between the last three nucleotides of the conserved region of gRNA, Between the last nucleotide and the last adjacent nucleotide in the conserved region of ix.gRNA One PS bond, and x. 15 or 20 consecutive 2'-OMe modified nucleotides, and (ii) gR Any one of the three PS bonds between the last three nucleotides in the conserved region of NA The gRNA is described in any one of the prior embodiments, including the one described above.

[0258] Embodiment 229 has a 5'-terminus modification, i. Modification of one or more nucleotides 1-7 in the guide region. ii. One modified nucleotide, iii. Two modified nucleotides, iv. Three modified nucleotides, v. 4 modified nucleotides, vi. 5 modified nucleotides, vii. Six modified nucleotides, and viii. A preceding implementation containing one or more of the seven modified nucleotides It is a gRNA described in one of the states.

[0259] Embodiment 230 has a 5'-terminus modification of 1-7, 1-5, 1-4, 1-3, or 1-2 gRNA as described in any one of the prior embodiments, comprising the modification of nucleotides ru.

[0260] Embodiment 231 has a 5'-terminus modification, i. Internucleotide phosphorothioate (PS) bonding, ii. 2'-OMe modified nucleotides, iii. 2'-O-moe modified nucleotides, iv. 2'-F modified nucleotide, v. Inverted debasic modified nucleotides, vi. Deoxyribonucleotide, vii. Inosine, and viii. Choose one or more combinations of (i.) to (vii.) This includes, or is a gRNA described in any one of the prior embodiments.

[0261] Embodiment 232 has a 5'-terminus modification, i. PS bonds between nucleotides 1, 2, 3, 4, 5, 6, and / or 7, and teeth ii. Approximately 1-2, 1-3, 1-4, 1-5, 1-6, or 1-7 nucleotides The gRNA is described in any one of the prior embodiments, including interPS binding.

[0262] Embodiment 233 is an sgRNA with at least one P-terminal modification at its 5' end. Includes an S bond, i. There is one PS bond, and the bond is between nucleotides 1 and 2 of the guide region. , ii. Two PS bonds are present, and the bond is between nucleotides 1 and 2 of the guide region. Between 2 and 3, iii. Between nucleotides 1 and 2, 2 and 3, and 3 and 4 in the guide region One or more of the following PS bonds exist: iv. Between nucleotides 1 and 2, between 2 and 3, between 3 and 4, and A PS bond exists between 4 and 5, v. Between nucleotides 1 and 2, between 2 and 3, between 3 and 4, between 4 and 5 in the guide region A PS bond exists between and between 5 and 6, vi. Between nucleotides 1 and 2, 2 and 3, 3 and 4, and 4 and 5 in the guide region A PS bond exists between 5 and 6, between 5 and 6, and between 6 and 7. to do, or vii. Between nucleotides 1 and 2, between 2 and 3, between 3 and 4, and between 4 and One or more of the following: between 5, between 5 and 6, between 6 and 7, and between 7 and 8 This is a gRNA described in any one of the prior embodiments, wherein a PS bond is present.

[0263] Embodiment 234 has a 5'-terminal modification, which is at least one 2'-OMe, 2'-O-mo Embodiment 233 further comprises e, inverted debase, or 2'-F modified nucleotide. This is the gRNA described.

[0264] Embodiment 235 is an embodiment in which sgRNA is i. Modification of one or more nucleotides 1-7 in the variable region, wherein the modification is a PS bond. Combined, inverted debasalized nucleotide, 2'-OMe, 2'-O-moe, 2'-F, 2'- H (deoxyribonucleotide), inosine, and / or combinations thereof Modification, ii. 2'-OMe, 2'-O-moe, 2'-F, 2'-H, inosine, or so The modification of the first nucleotide of the guide region by these combinations, and the adjacent nucleotide Selective PS binding to Otid, iii. 2'-OMe, 2'-O-moe, 2'-F, 2'-H, inosine, or The first and / or second nucleotides of the variable region are modified by their combinations. Decoration, and optionally, one or more PS bonds, iv. 2'-OMe, 2'-O-moe, 2'-F, 2'-H, inosine, or so The first, second, and / or third nucleos of the variable region resulting from these combinations Modification of cydops, and optionally, one or more PS bonds, v.2'-OMe, 2'-O-moe, 2'-F, 2'-H, inosine, or that The first, second, third, and / or fourth Nu of the variable region obtained by the combination of these Cleotide modification, and optionally, one or more PS bonds, vi. 2'-OMe, 2'-O-moe, 2'-F, 2'-H, inosine, or so The first, second, third, fourth, and / or variable regions based on these combinations Modification of the fifth nucleotide, and optionally, the inclusion of one or more PS bonds. The gRNA is described in any one of the embodiments described.

[0265] Embodiment 236 is an example in which sgRNA is i. 5 shown in any one of sequence numbers 101-190 or 795-798 'Terminal modification, ii. 2'-OMe modified nucleonucleotides 1, 2, and 3 in the guide region Chido, iii. 2'-OMe modification nuclei at nucleotides 1, 2, and 3 in the guide region Otide, and between nucleotides 1 and 2, between 2 and 3, and between 3 and PS bond between 4, iv. 2'-OMe modified nucleotides in guide regions 1, 2, 3, 4, and 5 , v. 2'-OMe modification at nucleotides 1, 2, 3, 4, and 5 in the guide region Cleotide, and between nucleotides 1 and 2, 2 and 3, and 3 and 4 in the guide region PS bond between 4 and 5, and between 5 and 6, vi. 2'O-moe modification nuclei at nucleotides 1, 2, and 3 in the guide region Ochido, vii. 2'O-moe modification nucleotides in nucleotides 1, 2, and 3 of the guide region The rheotide, and between nucleotides 1 and 2, 2 and 3, and 3 in the guide region. PS bond between 4, viii. Inverted debasic modified nucleotide at nucleotide 1 in the guide region, ix. Inverted debasic modified nucleotide at nucleotide 1 in the guide region, and In the guide region, nucleotides 1, 2, and 3 are 2'-OMe modified nucleotides. x. Inverted debase-modified nucleotide at nucleotide 1 in the guide region, guide region 2'-OMe modified nucleotides in nucleotides 1, 2, and 3 of the region, as well as Between nucleotides 1 and 2 in the mutation region, between 2 and 3, between 3 and 4, between 4 and 5, and Any of the preceding embodiments, which include one or more of the PS bonds between 5 and 6 It is the gRNA described in one of the documents.

[0266] Embodiment 237 is a preceding embodiment in which the upper stem region includes at least one modification. It is a gRNA described in one of the states.

[0267] Embodiment 238 is an modification of the upper stem, i. One or more modifications from US1 to US12 in the upper stem region. ii. At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 in the upper stem region , modification of 11 or all 12 nucleotides, iii. Approximately 1-2, 1-3, 1-4, 1-5, 1-6, 1-7 in the upper stem region , any of the following modifications: 1-8, 1-9, 1-10, or 1-12 nucleotides The gRNA is one or more of the gRNAs described in any one of the prior embodiments.

[0268] Embodiment 239 is an modification of the upper stem, i. 2'-OMe modified nucleotide, ii. 2'-O-moe modified nucleotides, iii. 2'-F modified nucleotides, and iv. Includes one or more combinations of (i) to (iii). , the gRNA described in Embodiment 238.

[0269] Embodiment 240 is a 5' terminal modification, i. 5 shown in any one of sequence numbers 101-190 or 795-798 'Terminal modification, ii. 2'-OMe modification nucleotides at nucleotides 1, 2, and 3 in the variable region D, iii. 2'-OMe modified nucleonucleotides 1, 2, and 3 in the variable region The nucleotides in the variable region, as well as between nucleotides 1 and 2, between 2 and 3, and between 3 and 4 PS bond between them, iv. 2'-OMe modification at nucleotides 1, 2, 3, 4, and 5 in the variable region Cleotide, v. 2'-OMe modification nucleotides at nucleotides 1, 2, 3, 4, and 5 in the variable region The rheotide, and between nucleotides 1 and 2, 2 and 3, and 3 and 4 in the variable region. , PS bonds between 4 and 5, and between 5 and 6, vi. 2'O-moe modified nucleonucleotides 1, 2, and 3 in the variable region Chido, vii. 2'O-moe modification nuclei in nucleotides 1, 2, and 3 of the variable region Otide, and between nucleotides 1 and 2, 2 and 3, and 3 and 4 in the variable region PS bond, viii. Inverted debase-modified nucleotide at nucleotide 1 in the variable region, ix. Inverted debasic modified nucleotides in nucleotide 1 of the variable region, and 2'-OMe modified nucleotides in nucleotides 1, 2, and 3 of the variable region, Bini x. Inverted debase-modified nucleotide at nucleotide 1 in the variable region, variable region 2'-OMe modified nucleotides in nucleotides 1, 2, and 3, and variable regions Between nucleotides 1 and 2, between 2 and 3, between 3 and 4, between 4 and 5, and 5 One of the preceding embodiments includes one or more PS bonds between and 6. This is the gRNA described above.

[0270] Embodiment 241 is a case where gRNA is i. Any of the following sequence numbers: 101-190, 301-395, or 795-798 A 3' terminal modification shown in one of the following ways, ii. (i) 2' at the last nucleotide of the conserved region of sgRNA or gRNA -OMe-modified nucleotide, (ii) the three nucleotides immediately 5' of the 2'-OMe-modified nucleotide (iii) the following consecutive 2'O-moe modified nucleotides, and (iii) the last three nucleotides Three consecutive PS bonds between the dots, iii. (i) Five consecutive 2'-OMe modified nucleotides, and (ii) the last Three PS bonds between three nucleotides, iv. Reversal of the last nucleotide in the conserved region of sgRNA or gRNA. Base-modified nucleotide, v.(i) Invert the last nucleotide of the conserved region of sgRNA or gRNA. (ii) the debasicized nucleotide, and the end of the conserved region of sgRNA or gRNA. Three consecutive 2'-OMe modified nucleotides in three nucleotides, vi. (i) 15 consecutive 2'-OMe modified nucleotides, (ii) 2'-OMe Five consecutive 2'-F modified nucleotides immediately 5' of the modified nucleotide, and (i ii) Three PS bonds between the last three nucleotides, vii.(i) The last 20 nucleotides of the conserved region of sgRNA or gRNA Alternating 2'-OMe modified nucleotides and 2'-F modified nucleotides, and (ii) The three PS bonds between the last three nucleotides, viii. (i) Two or three consecutive 2'-OMe modified nucleotides, and (i i) Three PS bonds between the last three nucleotides, ix. One PS bond between the last nucleotide and the last adjacent nucleotide, if Bini x. 15 or 20 consecutive 2'-OMe modified nucleotides, and (ii) last A preceding element containing one or more of the three PS bonds between the three nucleotides It is a gRNA described in one of the application forms.

[0271] Embodiment 242 is sequence numbers 1-90, 201-290, 401-490, or 60 One nucleotide sequence from 1 to 690 and at least 99, 98, 97, 9 6, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity gRNA as described in any one of the prior embodiments, comprising a nucleotide sequence ru.

[0272] Embodiment 243 corresponds to Sequence IDs 101-190, 301-394, 501-594, and It is one nucleotide sequence from 701 to 798 and at least 99, 98, 9 7, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% It contains a nucleotide sequence that is uniform and corresponds to the nucleotide of the reference sequence identifier in Table 1A. The modifications at each nucleotide of the gRNA are the same as the modifications shown in the reference sequence identifier in Table 1A. The gRNA described in any one of the prior embodiments is identical or equivalent to the gRNA described in that embodiment.

[0273] Embodiment 244 is sequence numbers 1-90, 201-290, 401-490, or 60 This is a guide RNA containing one of the values ​​from 1 to 690.

[0274] Embodiment 245 includes the modifications in Table 1A, including sequence numbers 101-190, 301-394, This is a guide RNA containing either 501-594 or 701-798.

[0275] Embodiment 246 includes a prior modification of the YA portion of at least one guide region YA site. The gRNA is described in any one of the embodiments.

[0276] Embodiment 247 is a guide region YA site that is not 5' end modified. The gRNA is one of the prior embodiments and includes the YA modification.

[0277] Embodiment 248 includes YA modification in one or more guide region YA sites, The YA region is located at nucleotide 8 from the 5' end of the 5' end, or after it. It is a gRNA described in one of the prior embodiments.

[0278] Embodiment 249 includes YA modification at one or more guide region YA sites, and gRNA but, i. Modification in one or more H1-1 and H2-1, ii. YA modification in YA sites of guide regions 1, 2, 3, 4, or 5, iii. YA modification in the YA site of guide region 1, 2, 3, 4, or 5 Modification of at least one guide region YA site is different from any 5' terminal modification of sgRNA. naru, YA modification, iv. YA modification in one or more guide region YA sites, where the guide region YA site However, the 8th nucleotide from the 5' end of the 5' end or the YA modification thereafter, v. YA modification in one or more guide region YA sites, wherein the guide region YA site is , 5' terminals of the 5' end, 6' terminal, 7' terminal, 8' terminal, 9 terminal of the filtrate from the 5' end, Or YA modifications located within the terminal, vi. YA modification in one or more guide region YA sites, where the guide region YA site However, the nucleotides 17, 16, 15, 14, 13, 12, and 11 at the 3' end of the guide region , YA modification within 10 or 9 nucleotides, vii. YA modification in the YA site of the guide region other than 5' terminal modification. viii. YA modification in two or more guide region YA sites, wherein the guide region YA The site is the 8th nucleotide from the 5' end of the 5' end or a subsequent YA modification. , ix. YA modification in two or more guide region YA sites, wherein two guide region Y Site A is the 5' end of the 5' terminal, and the 5' terminals of the nucleotide 5, 6, 7, and 8. YA modifications located within the 9-terminus or 10-terminus, x. YA modification in two or more guide region YA sites, wherein the guide region YA site is , nucleotides 17, 16, 15, 14, 13, 12, 11 of the 3' terminal nucleotides of the guide region YA modifications within 10 or 9 nucleotides, YA modifications in two or more guide region YA sites other than xi.5' terminal modifications, and xii. Includes one or more YA modifications in two or more guide region YA sites, Modification of the YA region of the guide region is at least one nu located 5' to the YA region of the guide region. gRNA as described in any one of the prior embodiments, including modifications that do not contain a creotide be.

[0279] Embodiment 250 includes YA modification, where the modification is 2'-fluoro, 2'-H, 2'-OM e, ENA, UNA, inosine, or PS, one of the prior embodiments This is the gRNA described.

[0280] Embodiment 251 includes YA modification, the modification alters the structure of the dinucleotide motif. As described in any one of the preceding embodiments, which reduces RNA endonuclease activity. This is the gRNA.

[0281] Embodiment 252 includes YA modification, and the modification is recognized by RNase or Either of the preceding embodiments prevents cleavage and / or stabilizes the RNA structure. It is the gRNA described in one of the entries.

[0282] Embodiment 253 includes YA modification, and the modification is i. 2'-O-alkyl, 2'-F, 2'-moe, 2'-F arabinose, and 2 Ribose modification selected from -H (deoxyribose), ii. Bicyclic ribose analogs such as LNA, BNA, and ENA, iii. Unlocked nucleic acid modification, iv. Base modifications such as inosine, pseudouridine, and 5'-methylcytosine, Bini v. Containing one or more nucleoside-linking modifications such as phosphorothioates, This is the gRNA described in any one of the prior embodiments.

[0283] Embodiment 254 includes YA modification in one or more storage region YA sites, compared to a previous embodiment. It is a gRNA described in one of the application forms.

[0284] Embodiment 255 is in one or more of the storage regions YA parts 2, 3, 4, and 10 The gRNA is one of the prior embodiments and includes the YA modification.

[0285] Embodiment 256 involves YA modification in one or more of the storage regions YA sites 1 and 8. This includes, or is a gRNA described in any one of the prior embodiments.

[0286] Embodiment 257 includes YA modification of the storage region YA portion 1, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0287] Embodiment 258 includes YA modification of the storage region YA portion 2, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0288] Embodiment 259 includes YA modification of the storage region YA portion 3, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0289] Embodiment 260 includes YA modification of the storage region YA portion 4, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0290] Embodiment 261 includes YA modification of the storage region YA portion 5, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0291] Embodiment 262 includes YA modification of the storage region YA portion 6, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0292] Embodiment 263 includes YA modification of the storage region YA portion 7, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0293] Embodiment 264 includes YA modification of the storage region YA portion 8, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0294] Embodiment 265 includes YA modification of the storage region YA portion 9, which is any of the preceding embodiments. It is the gRNA described in one of the documents.

[0295] Embodiment 266 includes YA modification of the storage region YA portion 10, which is one of the earlier embodiments. It is the gRNA described in one of the following.

[0296] Embodiment 267 is, i. YA modifications of YA sites 2, 3, 4, and 10 in the conserved region. ii. YA modification of YA sites 2, 3, and 4 in the preserved region. iii. YA modifications of YA sites 2, 3, and 10 in the preserved region. iv. YA modification of YA sites 2, 4, and 10 in the preserved region. v. YA modification of YA sites 3, 4, and 10 in the preserved region. vi. YA modification of YA sites 2 and 10 in the preserved region. vii. YA modification of YA sites 2 and 4 in the preserved region. viii. YA modification of YA sites 2 and 3 in the conserved region. ix. YA modification of YA sites 3 and 4 in the preserved region. x. YA modification of YA sites 3 and 10 in the preserved region. xi. YA modification of YA sites 4 and 10 in the preserved region. xii. YA modification of YA sites 1 and 5 in the conserved region. xiii. YA modification of YA sites 1 and 6 in the conserved region. xiv. YA modifications of YA sites 1 and 7 in the conserved region. xv. YA modification of YA sites 1 and 8 in the conserved region. xvi. YA modifications of YA sites 1 and 9 in the preserved region. xvii. YA modifications of YA sites 8 and 5 in the preserved region. xviii. YA modification of YA sites 8 and 6 in the conserved region. xix. YA modifications of YA sites 8 and 7 in the conserved region, and xx. Containing one or more YA modifications of YA sites 8 and 9 in the preserved region, xxi. By arbitrary selection, the sgRNA is located in the conserved region YA sites 2, 3, 4, and / or is a gRNA as described in any one of the prior embodiments, further comprising 10 YA modifications. ru.

[0297] Embodiment 268 has at least one modified YA site, optionally with a 2'-OMe modification. Any of the preceding embodiments, including 2'-OMe modification at the YA site of the pyrimidine. It is the gRNA described in one of the documents.

[0298] Embodiment 269 is an optional modification in which at least one modified YA site is 2'-fluoromodified. This includes the 2'-fluoro modification of the pyrimidine at the YA site, as in the previous embodiment. It is the gRNA described in either one of the following.

[0299] Embodiment 270 is a modification in which at least one modified YA site is modified by PS modification, and optionally by YA g according to any one of the prior embodiments, including PS modification in the pyrimidine site It is RNA.

[0300] Embodiment 271 is a gRNA in which the following nucleotides 1, 2, 3, 4, 6, 7, 8, 9 , at least 1, 2, 3, 4, 5 of 10, 11, 13, 14, 17, and 18, Guide regions containing 6, 7, 8, 9, 10, 11, 12, 13, or all of the modifications. The region includes, and by choice, the modifications are 2'-OMe, 2'-fluoro, 2'-H, and inosyl g as described in any one of the preceding embodiments, which is a phosphorothioate modification. It is RNA.

[0301] Embodiment 272 is a gRNA in which nucleotides 1, 2, 3, 4, 6, 7, 8, 9, 10 Includes guide regions with modifications in 11, 13, 14, 17, and 18, optional. The modifications are 2'-OMe, 2'-fluoro, 2'-H, inosine, or phosphor The gRNA is thioate-modified, as described in any one of the preceding embodiments.

[0302] Embodiment 273 is a 2'-OMe modification at the nucleotides 6-11 and 13. This is a gRNA according to embodiment 271 or 272 that is not present in the guide region.

[0303] Embodiment 274 is a 2'-fluoro modification of nucleotides 1-7, 15, 16, and 19 Not present in the guide region at the end, described in any one of embodiments 271 to 273 This is the gRNA shown.

[0304] Embodiment 275 is a phosphorothioate modification of nucleotides 4, 5, 11-14, 1 In 7 and 18 gRNAs described in any one of embodiments 271 to 274 that are not present in the guide region ru.

[0305] Embodiment 276 is an embodiment in which the guide region includes an unmodified nucleotide 20, as in Embodiments 271~ It is one of the gRNAs listed in 275.

[0306] Embodiment 277 is an embodiment in which the guide region consists of 20 nucleotides, as in Embodiments 271~ It is one of the 276 gRNAs listed.

[0307] Embodiment 278 is a guide region in which the YA portion and nucleo of nucleotides 5-6 gRNA according to any one of embodiments 271 to 277, including modification at tide 5 be.

[0308] Embodiment 279 is a guide region in which the YA portion and nucleus of nucleotides 12-13 gR according to any one of embodiments 271 to 278, including modification in rheotide 12 It is NA.

[0309] Embodiment 280 is a guide region in which the YA portion and nucleus of nucleotides 15-16 gR according to any one of embodiments 271 to 279, including modification in rheotide 15 It is NA.

[0310] Embodiment 281 is a guide region in which the YA portion and nucleus of nucleotides 16-17 gR according to any one of embodiments 271 to 280, including modification in rheotide 16 It is NA.

[0311] Embodiment 282 is a guide region in which the YA portion and nucleotides in nucleotides 19-20 gR according to any one of Embodiments 271 to 281, including modification in rheotide 19 It is NA.

[0312] Embodiment 283 is a guide region in which the YA site is not included in nucleotides 5-6. Cleotide 5 is unmodified in any of embodiments 271-277 or 279-282. It is the gRNA described in one of the documents.

[0313] Embodiment 284 is a guide region that does not include the YA site at nucleotides 12-13. In embodiments 271-278 or 280-283, nucleotide 12 is unmodified. It is the gRNA listed in one of the following documents.

[0314] Embodiment 285 is a guide region that does not include the YA site in nucleotides 15-16. In embodiments 271-279 or 281-284, nucleotide 15 is unmodified. It is the gRNA listed in one of the following documents.

[0315] Embodiment 286 is a guide region that does not include the YA site in nucleotides 16-17. In embodiments 271-280 or 282-285, nucleotide 16 is unmodified. It is the gRNA listed in one of the following documents.

[0316] Embodiment 287 is a guide region that does not include the YA site in nucleotides 19-20. In embodiments 271-281 or 283-286, nucleotide 19 is unmodified. It is the gRNA listed in one of the following documents.

[0317] Embodiment 288 is a gRNA, which is as follows: i. 2'-OMe and phosphorothioate modifications at nucleotide 1, ii. 2'-OMe and phosphorothioate modifications in nucleotide 2, iii. 2'-OMe and phosphorothioate modifications in nucleotide 3, iv. 2'-OMe modification at nucleotide 4, v. Phosphothioate modification at nucleotide 6, vi. Phosphothioate modification in nucleotide 7, vii. 2'-fluoro and phosphorothioate modifications in nucleotide 8, viii. 2'-Fluoro and phosphorothioate modifications in nucleotide 9, ix. 2'-fluoro and phosphorothioate modifications at nucleotide 10, 2'-fluoro modification at x.nucleotide 11, xi. 2'-fluoro modification at nucleotide 13, xii. 2'-fluoro modification at nucleotide 14, xiii. 2'-fluoro modification at nucleotide 17, and xiv. Guide containing one or more 2'-fluoro modifications at nucleotide 18 The gRNA described in any one of embodiments 271 to 287, including the region.

[0318] Embodiment 289 is an embodiment in which the guide region includes each of the modifications described in the preceding embodiments. The gRNA is described in any one of Embodiments 271 to 288.

[0319] Embodiment 290 has the following guide region: i. When nucleotides 5 and 6 form the YA site, the 2' in nucleotide 5 -OMe modification, ii. When nucleotides 12 and 13 form the YA site, nucleotide 12 keru 2'-OMe modification, iii. When nucleotides 15 and 16 form the YA site, nucleotide 15 Phosphothioate modification in iv. When nucleotides 16 and 17 form the YA site, nucleotide 16 Phosphothioate modification, and v. When nucleotides 19 and 20 form the YA site, in nucleotide 19 at least one, two, or three of the following phosphorothioates or 2'-fluoro modifications, The gRNA is described in any one of embodiments 271 to 289, including four of the above.

[0320] Embodiment 291 has a guide region where the YA site in nucleotides 5-6 and nucleotides One of embodiments 271 to 290, which includes a 2'-OMe modification in rheotide 5. This is the gRNA described.

[0321] Embodiment 292 has a guide region where the YA site in nucleotides 12-13 and Any of Embodiments 271 to 291, including a 2'-OMe modification at nucleotide 12. It is the gRNA described in one of the entries.

[0322] Embodiment 293 has a guide region at the YA site in nucleotides 15-16, and Embodiments 271-292 include phosphorothioate modification at nucleotide 15. It is the gRNA described in either one of the following.

[0323] Embodiment 294 has a guide region at the YA site in nucleotides 16-17, and Embodiments 271 to 293 include phosphorothioate modification at nucleotide 16. It is the gRNA described in either one of the following.

[0324] Embodiment 295 has a guide region at the YA site in nucleotides 19-20, and Embodiments 271 to 294 include phosphorothioate modification at nucleotide 19. It is the gRNA described in either one of the following.

[0325] Embodiment 296 includes a guide region containing a 2'-fluoro modification at nucleotide 19. The gRNA is described in any one of embodiments 271 to 295.

[0326] Embodiment 297 is a guide region that includes an unmodified nucleotide 15 or a nucleo Any of embodiments 271 to 296, which include only phosphorothioate modification in Tide 15. It is the gRNA described in one of the documents.

[0327] Embodiment 298 is a guide region that includes an unmodified nucleotide 16 or a nucleo Any of embodiments 271 to 297, which include only phosphorothioate modification at Tide 16. It is the gRNA described in one of the documents.

[0328] Embodiment 299 is, i. YA modification in guide region YA sites 1, 2, 3, 4, or 5, ii. YA modification in the YA site of guide region 1, 2, 3, 4, or 5 Modification of at least one guide region YA site is different from any 5' terminal modification of sgRNA. naru, YA modification, iii. Nucleotide 8 from the 5' end of the 5' end, or one or more nucleotides thereafter YA modification in the YA region of the guide area, iv. Nucleidones from the 5' end of the 5' terminal: terminals 5, 6, 7, 8, and 9 YA modification in one or more guide region YA sites at the terminal or within the terminal 10, v. Nucleotides 17, 16, 15, 14, 13, 12, 1 at the 3' end of the guide region In one or more guide region YA sites within 1, 10, or 9 nucleotides YA modification, vi.YA modification in the YA site of the guide region other than 5' terminal modification, or vii. YA modification in the YA region of the guide region, wherein the modification of the YA region of the guide region is Modifications that do not include at least one nucleotide located at the 5' end of the guide region YA site. The gRNA is one of the prior embodiments, comprising YA modification.

[0329] Embodiment 300 is, i. Nucleotide 8 from the 5' end of the 5' end or two or more nucleotides following it YA morphology in the YA region ii. nucleotides from the 5' end of the 5' end: nucleotides 5, 6, 7, 8, and 9 YA modification in two or more guide region YA sites within the terminal or terminal 10, iii. Nucleotides 17, 16, 15, 14, 13, and 12 at the 3' end of the guide region , in two or more guide region YA sites within 11, 10, or 9 nucleotides YA modification, iv. YA modifications in two or more guide region YA sites other than 5' terminal modifications, or v. YA modification in two or more guide region YA sites, wherein the guide region YA site The modification does not include at least one nucleotide located at the 5' end of the guide region YA site. Includes i-modification, YA-modification, This is the gRNA described in Embodiment 300.

[0330] Embodiment 301 is, i. Nucleotide 8 from the 5' end of the 5' end or three or more nucleotides following it YA morphology in the YA region ii. nucleotides from the 5' end of the 5' end: nucleotides 5, 6, 7, 8, and 9 YA modification in three or more guide region YA sites within the terminal or 10 terminal, iii. Nucleotides 17, 16, 15, 14, 13, and 12 at the 3' end of the guide region , in 11, 10, or 9 nucleotides, in 3 or more guide regions (YA sites) YA modification, iv. YA modifications in three or more guide region YA sites other than 5' terminal modifications, or v. YA modification in three or more guide region YA sites, where The modification does not include at least one nucleotide located at the 5' end of the guide region YA site. Includes i-modification, YA-modification, This is the gRNA described in Embodiment 300.

[0331] Embodiment 302 has nucleotides 8-11, 13-14 from the 5' end of the 5' terminal, and at least 1, 2, 3, 4, 5, 6, 7, or 8 of the 17-18 nuclei Otide is a gRNA according to any one of embodiments 299 to 301, which includes YA modification. be.

[0332] Embodiment 303 has nucleotides 8-11, 13-14 from the 5' end of the 5' portion. and at least 1, 2, 3, 4, 5, 6, 7, or 8 of the 17-18 nuclei Embodiment 30, in which the ocide comprises 2'-fluoro, 2'-H, 2'-OMe, or PS. This is the gRNA described in 2.

[0333] Embodiment 304 is the gRNA described in Embodiment 303, wherein the modification is 2'-fluoro. That is the case.

[0334] Embodiment 305 is described in Embodiment 303, wherein the modification is 2'-OMe or 2'-H. This is the gRNA shown.

[0335] Embodiment 306 is the gRNA described in Embodiment 303, wherein the modification is PS.

[0336] Embodiment 307 is a 5' terminal with at least nucleotides 6 to 10 from the 5' end. Each of the 1, 2, 3, 4, or 5 modifiers includes YA modifications, and by any choice, the modifier is 2'- Embodiments 299-3, comprising fluoro, 2'-H, 2'-OMe, inosine, or PS. It is a gRNA listed in any one of the 06 entries.

[0337] Embodiment 308 is the gRNA described in Embodiment 307, wherein the modification is PS.

[0338] Embodiment 309 is an embodiment of Embodiment 307 in which the modification is 2'-fluoro or 2'-H. This is the gRNA described.

[0339] Embodiment 310 is the gRNA described in Embodiment 307, wherein the modification is 2'-OMe. be.

[0340] Embodiment 311 is as follows: i. Nucleotides 8-11, 13-14, and 17-1 from the 5' end of the 5' terminal 1, 2, 3, 4, 5, 6, 7, or 8 YA modifications out of 8, and the YA modifications are , optionally 2'-fluoro modification, and nucleotides 6-10 from the 5' end YA modifications, which are modifications other than 2'-fluoro in one or more of these compounds. ii. Nucleotides 8-11, 13-14, and 17- from the 5' end of the 5' terminal 18 YA modifications other than PS in one or more of the 18, and from the 5' end of the 5' end The YA modifications of nucleotides 6-10 are 1, 2, 3, 4, or 5, and By choice, the modifier is a PS modifier, or a YA modifier. iii. Nucleotides 8-11, 13-14, and 17 from the 5' end of the 5' terminal 1, 2, 3, 4, 5, 6, 7, or 8 YA modifications in ~18, YA modification The ornament can be optionally modified with 2'-fluoropolymerization, as well as nucleation from the 5' end of the 5' terminal. Modifications other than 2'-fluoro in Otido 6-10, such as YA modifications. iv. Nucleotides 8-11, 13-14, and 17- from the 5' end of the 5' terminal YA modifications other than PS in each of the 18, and nucleos from the 5' end of the 5' end. 1, 2, 3, 4, or 5 YA modifications in Chido 6-10, where the modification is arbitrary. Depending on the selection, it is PS modification, YA modification, Nucleotides 8-11, 13-14, and 17-1 from the 5' end of the 5' portion of the v.5' end. 8 is a YA modification of 1, 2, 3, 4, 5, 6, 7, or 8, and the YA modification is , optionally 2'-fluoro modification, and nucleotypic modification from the 5' end of the 5' end. One or more PS modifications in any one of the 6-10, YA modifications, vi. Nucleotides 8-11, 13-14, and 17- from the 5' end of the 5' terminal At least one 2'-fluoro modification in any one of the 18, and 5' 1, 2, 3, 4, or 5 of the nucleotides 6-10 from the 5' end of the terminal portion YA modification, and the modification is a PS modification by arbitrary choice, YA modification, vii. Nucleotides 8-11, 13-14, and 17 from the 5' end of the 5' terminal 1, 2, 3, 4, 5, 6, 7, or 8 of the 18 YA modifications, YA modification The ornament can be optionally modified with 2'-fluoropolymerization, as well as nucleation from the 5' end of the 5' terminal. The PS modifiers in each of Ochido 6-10 are the YA modifiers, or viii. Nucleotides 8-11, 13-14, and 1 from the 5' end of the 5' terminal 2'-fluoromodifications in each of 7-18, as well as nucleations from the 5' end of the 5' end. 1, 2, 3, 4, or 5 of the 6-10 Ochido modifications, and the modification is as Embodiment 29 includes one or more of the YA modifications that are PS modifications by selection. It is one of the gRNAs listed in 9-310.

[0341] Embodiment 312 is, i. Nucleotides 4-20 from the 5' end of the 5' terminal contain the 2'-OMe modification. Modified YA site 1 and modified YA site 2 including 2'-fluoro modification or PS modification Including at least two, three, or four modified YA sites, ii. Nucleotides 4-20 from the 5' end of the 5' terminal contain 2'-fluoromodifications. The first modification YA site and the second modification YA site including the 2'-OMe modification or PS modification. Including the position, and including at least 2, 3, or 4 modified YA sites, iii. Nucleotides 4-20 from the 5' end of the 5' terminal contain PS modification. Modified YA site and second modified YA including 2'-OMe modification or 2'-fluoro modification Including a site, including at least two, three, or four modified YA sites, iv. Nucleotides 4-20 from the 5' end of the 5' terminal contain YA modifications, Each contains two, three, or four modified YA sites. Nucleotides 4-20 from the 5' end of the 5' terminal of v. contain the 2'-OMe modification. Includes a modified YA site 1, a second modified YA site including a 2'-fluoro modification, and a PS modification. Including a third modified YA site, including at least three or four modified YA sites, vi. Nucleotides 4-20 from the 5' end of the 5' terminal contain 2'-OMe modifications. First modified YA site, second modified YA site including 2'-fluoro modification, 2'-fluoro modification A third modification YA site including ornamentation, and a fourth modification YA site including PS modification, at least Both contain 3 or 4 modified YA sites, vii. Nucleotides 4-20 from the 5' end of the 5' terminal contain YA modifications, with a small number of them. It contains at least 3 or 4 modified YA sites, viii. Nucleotides 4-20 from the 5' end of the 5' terminal undergo 2'-OMe modification. Includes a first modified YA site, a second modified YA site including a 2'-fluoro modification, and a PS modification. At least 4 modified YA sites, including a third modified YA site and a fourth modified YA site including a PS modification. It contains one modification YA site, or Nucleotides 4-40 from the 5' end of the ix' terminal contain YA modifications, Each gRN according to any one of embodiments 299 to 311 includes four modified YA sites. It is A.

[0342] Embodiment 313 has nucleotides 4-20 from the 5' end of the 5' terminal, at least A gRNA according to any one of Embodiments 299 to 312, containing five modified YA sites be.

[0343] Embodiment 314 has at least five modified YA sites, including a fifth modified YA site with PS modification. Including the site, optionally, the third modified YA site includes a 2'-fluoro modification. It is a gRNA described in one of morphologies 299-313.

[0344] Embodiment 315 has at least five modified YA sites, first, second, and (where applicable) Embodiment 299) The third, fourth, and fifth are arranged in the direction from 5' to 3'. It is a gRNA listed in any one of the following 314 entries.

[0345] Embodiment 316 has at least five modified YA sites, first, second, and (where applicable) Embodiment 299 in which the third, fourth, and fifth are not arranged in the 5' to 3' direction. It is a gRNA listed in any one of the following 315 entries.

[0346] Embodiment 317 is a molecule in which nucleotides 4-20 from the 5' end of the 5' terminal are deoxyri It contains at least 2, 3, 4, or 5 modified YA sites, including bonucleotides, and optional By selection, the deoxyribonucleotide is a pyrimidine at the YA site, as in Embodiment 29. It is one of the gRNAs listed in 9-316.

[0347] Embodiment 318 is, i. At least 1, 2, and 3 of the nucleotides 8-11 from the 5' end of the 5' end. , or four of them are 2'-fluoromodifications by choice, including YA modifications, ii. Nucleotides 8-11, 13, 14, 17 from the 5' end of the 5' terminal, and At least one, two, three, four, five, six, seven, or eight of the 18 include YA modifications. , by optional selection, if the YA modification is present at nucleotides 8-11, then 2'-OMe And if present at nucleotides 13, 14, 17, or 18, then 2'-fluorinated It is Ro, iii. At least one of nucleotides 17 and 18 from the 5' end of the 5' terminal One or both of these modifications are 2'-fluoromodifications by choice, including YA modifications. iv. At least one of nucleotides 17 and 18 from the 5' end of the 5' terminal Either one or both are 2'-fluoro modifications, or they contain YA modifications, teeth Of the nucleotides 4-14, 17, and 18 from the 5' end of the 5' terminal, At the very least, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13, Embodiments 299 to 317 include YA modifications, which are optionally 2'-fluoro modifications. It is the gRNA listed in one of the following documents.

[0348] Embodiment 319 is a 5' terminal with at least nucleotides 4-10 from the 5' end. 1, 2, 3, 4, 5, or 6 of these are 2'-OMe modifications, YA The gRNA is one of any one of embodiments 299 to 318, including modifications.

[0349] Embodiment 320 is an optional configuration in which nucleotides 4-10 from the 5' end of the 5' terminal are Any one of embodiments 299 to 319, including a YA modification which is more 2'-OMe modified. This is the gRNA described in [reference].

[0350] Embodiment 321 is, i. At least one of nucleotides 1-3 from the 5' end of the 5' end is optional. Selectively, it includes a 2'-OMe modification, and a 5' protective end modification. ii. At least two of nucleotides 1-3 from the 5' end of the 5' end are By selective selection, it includes a 5' protective end modification, which is a 2'-OMe modification, or iii. Each of nucleotides 1-3 from the 5' end of the 5' end is selected by arbitrary choice. Any one of embodiments 299 to 320, including a 5' protective end modification which is an '-OMe modification'. This is the gRNA described above.

[0351] Embodiment 322 has 11, 13, 14, 17 and nucle from the 5' end of the 5' end. At least one, two, three, four, or five of the Otid 18 are selected by choice, 2'-F A ruolo modification, including a 5'-terminal modification, is described in any one of Embodiments 299 to 321. This is the gRNA.

[0352] Embodiment 323 is such that the nucleotide 15 from the 5' end of the 5' terminal is unmodified. , or modified solely by phosphorothioate, any of embodiments 299 to 322 It is the gRNA described in one of the following.

[0353] Embodiment 324 is such that nucleotide 16 from the 5' end is unmodified or phospho One of embodiments 299 to 323 is modified solely by a holothioate. This is the gRNA shown.

[0354] Embodiment 325 is such that nucleotide 3 from the 5' end of the 5' terminal is unmodified, Or any of embodiments 299 to 324, which are modified solely by phosphorothioates. It is the gRNA described in one of the documents.

[0355] Embodiment 326 includes a prior embodiment that involves YA modification or substitution of the storage region YA portion 1. It is a gRNA described in one of the states.

[0356] Embodiment 327 includes a prior embodiment that involves YA modification or substitution of the YA portion 2 of the storage region. It is a gRNA described in one of the states.

[0357] Embodiment 328 includes a prior embodiment that involves YA modification or substitution of the YA portion 3 of the storage region. It is a gRNA described in one of the states.

[0358] Embodiment 329 includes YA modification or substitution of the storage region YA portion 4, which is a preceding embodiment. It is a gRNA described in one of the states.

[0359] Embodiment 330 includes YA modification or substitution of the storage region YA portion 5, which is a preceding embodiment. It is a gRNA described in one of the states.

[0360] Embodiment 331 is a preceding embodiment that includes YA modification or substitution of the storage region YA portion 6. It is a gRNA described in one of the states.

[0361] Embodiment 332 includes YA modification or substitution of the storage region YA portion 7, which is a preceding embodiment. It is a gRNA described in one of the states.

[0362] Embodiment 333 includes a prior embodiment that involves YA modification or substitution of the storage region YA portion 8. It is a gRNA described in one of the states.

[0363] Embodiment 334 includes YA modification or substitution of the storage region YA portion 9, which is a preceding embodiment. It is a gRNA described in one of the states.

[0364] Embodiment 335 includes a prior implementation that involves YA modification or substitution of the YA portion 10 of the storage region. It is a gRNA described in one of the morphological descriptions.

[0365] Embodiment 336 is, i. YA modifications of YA sites 2, 3, 4, and 10 in the conserved region. ii. YA modification of YA sites 2, 3, and 4 in the preserved region. iii. YA modifications of YA sites 2, 3, and 10 in the preserved region. iv. YA modification of YA sites 2, 4, and 10 in the preserved region. v. YA modification of YA sites 3, 4, and 10 in the preserved region. vi. YA modification of YA sites 2 and 10 in the preserved region. vii. YA modification of YA sites 2 and 4 in the preserved region. viii. YA modification of YA sites 2 and 3 in the conserved region. ix. YA modification of YA sites 3 and 4 in the preserved region. x. YA modification of YA sites 3 and 10 in the preserved region, or xi. Embodiments 326 to 335, including YA modification of YA sites 4 and 10 in the storage region. It is the gRNA described in either one of the following.

[0366] Embodiment 337 is, i. YA modification of YA sites 1 and 5 in the conserved region. ii. YA modification of YA sites 1 and 6 in the preserved region. iii. YA modification of YA sites 1 and 7 in the preserved region. iv. YA modification of YA sites 1 and 8 in the preserved region. v. YA modification of YA sites 1 and 9 in the conserved region. vi. YA modification of YA sites 8 and 5 in the preserved region. vii. YA modification of YA sites 8 and 6 in the preserved region. viii. YA modification of YA sites 8 and 7 in the preserved region, or ix. Containing YA modifications of YA sites 8 and 9 in the preserved region, Through optional selection, sgRNA undergoes YA modifications at conserved YA sites 2, 3, 4, and 10. The gRNA described in any one of embodiments 326 to 336 further includes the gRNA described in any one of embodiments 326 to 336.

[0367] Embodiment 338 has at least one modified YA site, optionally with a 2'-OMe modification. Embodiments 299-337, which include 2'-OMe modification at the YA site of the pyrimidine It is the gRNA listed in one of the following documents.

[0368] Embodiment 339 has at least one modified YA site which is optionally 2'-fluoromodified. Embodiments 299-33 include 2'-fluoro modification of the pyrimidine at the YA site. It is a gRNA listed in any one of the eight items.

[0369] Embodiment 340 is a modified YA site in which at least one modified YA site is modified by PS modification, optionally by YA One of embodiments 299 to 339 describes the PS modification in the pyrimidine site. This is the gRNA shown.

[0370] Embodiment 341 has at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 modifications The YA site undergoes 2'-OMe modification, and by optional selection, 2'-O is added to the pyrimidine at the YA site. The gRNA is one of any one of embodiments 299 to 340, which includes Me modification.

[0371] Embodiment 342 has at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 modifications The YA site undergoes 2'-fluoro modification, and optionally, the YA site in the pyrimidine undergoes 2'- The gRNA is one of any one of embodiments 299 to 341, including fluoromodification.

[0372] Embodiment 343 has at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 modifications The YA site includes PS modification, and optionally includes PS modification in the pyrimidine at the YA site. The gRNA is described in any one of embodiments 299 to 342.

[0373] Embodiment 344 has at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 modifications The YA site undergoes ribose modification at the 2' position, and optionally, the pyrimidine at the YA site undergoes modification. It includes a ribose modification, and optionally includes 2'-Oalkyl, 2'-H, and 2'- gRNA according to any one of embodiments 299 to 343, selected from fluoromodifications That is the case.

[0374] Embodiment 345 is, i. Conservation regions YA sites 1 and 8 are modified by 2'-fluoromodification, or by optional modification of the YA sites. Including 2'-fluoro modification in pyrimidines, ii. Preservation areas YA sites 5 and 6, 5 and 7, 5 and 9, 6 and 7, 6 and 9, 5, 6, and 7, 5, 6, and 9, 6, 7, and 9, or 5, 6, 7, 9 is modified by 2'-OMe, and by optional selection, 2'-OMe is added to the pyrimidine at the YA site. Includes e-modification, iii. The conserved region YA site 1 contains 2'-fluoro modification, and the conserved region YA site 5 and 6, 5 and 7, 5 and 9, 6 and 7, 6 and 9, 5, 6, and 7, 5, 6, And 9, 6, 7, and 9, or 5, 6, 7, and 9, 2'-OMe modification, By selective selection, the YA site of the pyrimidine contains the 2'-OMe modification. iv. The conserved region YA site 8 contains a 2'-fluoro modification, and the conserved region YA site 5 and 6, 5 and 7, 5 and 9, 6 and 7, 6 and 9, 5, 6, and 7, 5, 6, o And 9, 6, 7, and 9, or 5, 6, 7, and 9, modified by 2'-OMe, optional. Selection includes 2'-OMe modification in the pyrimidine at the YA site. v. The conserved region YA site 1 contains 2'-fluoro modification in the pyrimidine of the YA site. , YA areas 5 and 6, 5 and 7, 5 and 9, 6 and 7, 6 and 9, 5, 6, o and 7, 5, 6, and 9, 6, 7, and 9, or 5, 6, 7, and 9, 2' -OMe modification, optionally including 2'-OMe modification at the YA site of the pyrimidine, vi. The conserved region YA site 8 contains 2'-fluoromodification in the pyrimidine of the YA site. Mi, YA areas 5 and 6, 5 and 7, 5 and 9, 6 and 7, 6 and 9, 5, 6, and 7, 5, 6, and 9, 6, 7, and 9, or 5, 6, 7, and 9, 2 '-OMe modification, optionally including 2'-OMe modification at the YA site of the pyrimidine. , vii. Conservation region YA sites 1 and 8 include 2'-fluoro modification, and conservation region YA part Ranks 5 and 6, 5 and 7, 5 and 9, 6 and 7, 6 and 9, 5, 6 and 7, 5, 6, and 9, 6, 7, and 9, or 5, 6, 7, and 9, 2'-OMe Modification, or optional modification, including 2'-OMe modification at the YA site of the pyrimidine, viii. Preservation regions YA sites 1 and 8 are 2'-full pyrimidines of the YA sites. Includes ORO modification, preserved areas YA sites 5 and 6, 5 and 7, 5 and 9, 6 and 7, 6 and 9, 5, 6 and 7, 5, 6 and 9, 6, 7 and 9, or 5, 6 ,7 and 9 are 2'-OMe modified, optionally at the pyrimidine site of the YA site. gRNA as described in any one of embodiments 299 to 344, including the '-OMe modification'. .

[0375] Embodiment 346 is an embodiment in which the storage regions YA sites 7 and 9 are optionally modified with 2'-OMe. The gRNA is one of any one of embodiments 299 to 345, which includes YA modification. ru.

[0376] Embodiment 347 has storage regions YA parts 5, 6, 7, and 9 optionally selected as 2'- g according to any one of embodiments 299 to 346, which includes YA modification, which is OMe modification. It is RNA.

[0377] Embodiment 348 is an embodiment in which the conserved region YA site 8 includes a 2'-fluoro modification, as in Embodiment 29. It is one of the gRNAs listed in 9-347.

[0378] Embodiment 349 is an embodiment in which the conserved region YA site 8 includes deoxyribonucleotide modification. This is the gRNA described in one of the application forms 299-348.

[0379] Embodiment 350 is in which the conserved region YA site 8 is eliminated by base substitution, and optionally Furthermore, the base substitution eliminates uracil at YA site 8, and by optional selection, the base substitution is performed. g according to any one of embodiments 299 to 349, which is a substitution of uracil with guanine. It is RNA.

[0380] Embodiment 351 is an embodiment in which the conserved region YA site 1 includes a 2'-fluoro modification, as in Embodiment 29. It is one of the gRNAs listed in 9-350.

[0381] Embodiment 352 is an embodiment in which the storage region YA portion 1 includes PS modification, as in Embodiments 299-351. It is a gRNA listed in one of the following.

[0382] Embodiment 353 includes LS5, LS7, LS8, LS9, LS10, LS11, and L One, two, three, four, five, six, or seven of S12 include modifiers, and by any choice, Embodiments 299-35, in which the modification is a 2'-fluoro and / or 2'-OMe modification. It is the gRNA listed in one of the two items.

[0383] Embodiment 354 is an embodiment in which modifications in LS5, LS7, LS9, and LS11 are present. In this case, it includes 2'-fluoro modification, and optionally LS5, LS7, LS9, and Each of LS11 includes a 2'-fluoro modification, one of any one of embodiments 299 to 353. This is the gRNA described in [reference].

[0384] Embodiment 355 is an embodiment in which modifications in LS8, LS10, and LS12 exist. , including the 2'-OMe modification, and each of LS8, LS10, and LS12 is 2'-OMe The gRNA is one of any one of embodiments 299 to 354, including modifications.

[0385] Embodiment 356 is N2, N3, N4, N5, N6, N7, N10, N11, N16, And 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of N17 are optional. The modification is 2'-OMe, and includes any one of the modifications in any one of embodiments 299 to 355. This is the gRNA described.

[0386] Embodiment 357 includes modification of H2-2, and optionally H2 is otherwise unmodified. The ornament is a gRNA described in any one of embodiments 299 to 356.

[0387] Embodiment 358 is an embodiment of Embodiments 299-357 in which H2-2 includes the 2'-OMe modification. It is the gRNA listed in one of the following documents.

[0388] Embodiment 359 includes modifications to US3, US9, and US12, which are optionally modified by , US is otherwise unqualified, as described in any one of embodiments 299 to 358 It is RNA.

[0389] Embodiment 360 is an embodiment in which US3, US9, and US12 include a 2'-OMe modification. This is the gRNA described in one of the application forms 299-359.

[0390] Embodiment 361 is a molecule in which nucleotides 6-10 from the 5' end of the 5' terminal are PS modified. Includes nucleotides 8-11, 13, 14, 17, and 1 from the 5' end of the 5' terminal. 8 is a gR according to any one of embodiments 299 to 360, which includes a 2'-fluoro modification. It is NA.

[0391] Embodiment 362 includes a 2'-fluoro modification in each guide region YA portion, and optionally Therefore, the implementation form excludes nucleotides 15 and / or 16 from the 5' end of the 5' terminal. It is a gRNA described in one of the following states 299-361.

[0392] Embodiment 363 shows that nucleotides 4, 8, and 11 from the 5' end of the 5' terminal are It includes YA modification, and optionally, nucleotide 4 includes 2'-OMe modification, nucleotide Otide 8 and 11 include 2'-fluoro modification, any of embodiments 299 to 362. It is the gRNA described in one of the entries.

[0393] Embodiment 364 is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more modified YA sites are located at the pyrimidine position of the YA site. The gRNA is one of any one of embodiments 299 to 363, including modifications.

[0394] Embodiment 365 has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified storage regions Embodiment 364 describes a region YA site that includes YA modification at the pyrimidine position of the YA site. This is the gRNA shown.

[0395] Embodiment 366 is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more modified YA sites, YA modification at the adenine position of the YA site The gRNA is one of any one of embodiments 299 to 365, including ornamentation.

[0396] Embodiment 367 has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 modified storage regions Embodiment 366 includes a YA site modification at the adenine position of the YA site. This is the gRNA described.

[0397] Embodiment 368 is, i. Modification of H1-1, ii. Modification of H2-1, or iii. Any one of embodiments 299 to 367, including modifications of H1-1 and H2-1 This is the gRNA described above.

[0398] Embodiment 369 is an embodiment in which H1-1 and / or H2-1 include a 2'-OMe modification. This is the gRNA described in application form 368.

[0399] Embodiment 370 is a configuration in which H1-1 and / or H2-1 include a 2'-fluoro modification. This is the gRNA described in Embodiment 369.

[0400] Embodiment 371 is an embodiment in which H1-1 and / or H2-1 include PS modification, This is the gRNA described in section 70.

[0401] Embodiment 372 includes a modification in B3, and optionally B6 is 2'-OMe Embodiments 299 to 371 either do not include the modification or include the modification other than 2'-OMe. It is the gRNA described in either one of the following.

[0402] Embodiment 373 includes a modification in B4, and optionally B6 is 2'-OMe Embodiments 299 to 372 either do not include the modification or include the modification other than 2'-OMe. It is the gRNA described in either one of the following.

[0403] Embodiment 374 includes a modification in B5, and optionally B6 is 2'-OMe Embodiments 299 to 373 either do not include the modification or include the modification other than 2'-OMe. It is the gRNA described in either one of the following.

[0404] Embodiment 375 includes a modification in LS10, optionally wherein LS10 is 2' gRNA according to any one of Embodiments 299 to 374, including modifications other than fluoro-. That is the case.

[0405] Embodiment 376 is any one of Embodiments 299 to 375, including the modification in N2. This is the gRNA described in [reference].

[0406] Embodiment 377 is any one of Embodiments 299 to 376, including the modification in N3. This is the gRNA described in [reference].

[0407] Embodiment 378 is any one of Embodiments 299 to 377, including the modification in N4. This is the gRNA described in [reference].

[0408] Embodiment 379 is any one of Embodiments 299 to 378, including the modification in N5. This is the gRNA described in [reference].

[0409] Embodiment 380 is any one of Embodiments 299 to 379, including the modification in N6. This is the gRNA described in [reference].

[0410] Embodiment 381 is any one of Embodiments 299 to 380, including the modification in N7. This is the gRNA described in [reference].

[0411] Embodiment 382 includes the modification in N10, and any one of Embodiments 299 to 381 This is the gRNA described above.

[0412] Embodiment 383 includes the modification in N11, and any one of Embodiments 299 to 382 This is the gRNA described above.

[0413] Embodiment 384 is, i. Nucleotide 8 from the 5' end of the 5' terminal does not contain 2'-fluoromodification. ii. The nucleotide 9 at the 5' end of the 5' terminal does not contain 2'-fluoromodification. , iii. Nucleotide 10 from the 5' end of the 5' terminal contains a 2'-fluoro modification. do not have, iv. Nucleotide 11 from the 5' end of the 5' terminal does not contain 2'-fluoro modification. stomach, v. Nucleotide 13 from the 5' end of the 5' terminal does not contain 2'-fluoromodification. , vi. Nucleotide 14 from the 5' end of the 5' terminal does not contain 2'-fluoro modification. stomach, vii. Nucleotide 17 from the 5' end of the 5' terminal contains a 2'-fluoro modification. not, and / or viii. Nucleotide 18 from the 5' end of the 5' terminal contains a 2'-fluoro modification. It is not a gRNA, but one of the gRNAs described in any one of embodiments 299 to 383.

[0414] Embodiment 385 is, i. Nucleotide 6 from the 5' end of the 5' terminal does not contain 2'-fluoromodification. ii. Nucleotide 7 from the 5' end of the 5' terminal does not contain 2'-fluoromodification. , iii. The nucleotide 8 from the 5' end of the 5' terminal does not contain a 2'-fluoro modification. stomach, iv. The nucleotide 9 at the 5' end of the 5' terminal does not contain 2'-fluoromodification. , and / or v. Nucleotide 10 from the 5' end of the 5' terminal does not contain 2'-fluoromodification. or the gRNA described in any one of embodiments 299 to 384.

[0415] Embodiment 386 is, i. Nucleotide 6 from the 5' end of the 5' terminal does not contain a phosphorothioate bond. stomach, ii. Nucleotide 7 from the 5' end of the 5' terminal contains a phosphorothioate bond. do not have, iii. Nucleotide 8 from the 5' end of the 5' end contains a phosphorothioate bond. No, iv. Nucleotide 9 from the 5' end of the 5' terminal contains a phosphorothioate bond. not, and / or The nucleotide 10 from the 5' end of the 5' terminal contains a phosphorothioate bond. None, it is the gRNA described in any one of embodiments 299 to 385.

[0416] Embodiment 387 is, i. Nucleotide 7 from the 5' end of the 5' terminal does not contain the 2'-OMe modification. ii. Nucleotide 8 from the 5' end of the 5' terminal does not contain the 2'-OMe modification. iii. The nucleotide 9 at the 5' end of the 5' terminal does not contain the 2'-OMe modification. , and / or iv. Nucleotide 10 from the 5' end of the 5' terminal does not contain 2'-OMe modification. or the gRNA described in any one of embodiments 299 to 386.

[0417] Embodiment 388 is a nucleotide 20 from the 5' end of the 5' terminal that is modified by 2'-OMe This is a gRNA described in any one of embodiments 299 to 387, without any embellishments.

[0418] Embodiment 389 is a guide RNA in which nucleotides 1-1 from the 5' end of the 5' end It contains a 2'-fluoro modification in one or more of 1 and 13-20, and 5' Embodiments in which nucleotide 12 from the 5' end of the terminal portion does not contain 2'-fluoro modification. It is one of the gRNAs listed between 299 and 388.

[0419] Embodiment 390 is a guide RNA in which nucleotides 1-2 from the 5' end of the 5' end Includes one or more 2'-fluoro modifications among 0, i. Nucleotide 11 from the 5' end of the 5' terminal does not contain 2'-fluoromodification. , ii. Nucleotide 12 from the 5' end of the 5' terminal does not contain 2'-fluoro modification. stomach, iii. Nucleotide 13 from the 5' end of the 5' terminal contains a 2'-fluoro modification. do not have, iv. Nucleotide 14 from the 5' end of the 5' terminal does not contain 2'-fluoro modification. stomach, Nucleotide 17 from the 5' end of the 5' terminal does not contain 2'-fluoromodification. , and / or vi. Nucleotide 18 from the 5' end of the 5' terminal does not contain a 2'-fluoro modification. i. is the gRNA described in any one of embodiments 299 to 389.

[0420] Embodiment 391 is, i.B2 does not include the 2'-OMe modification. ii. B3 does not contain the 2'-OMe modification. iii. B4 does not contain the 2'-OMe modification, and / or iv.B5 is any one of embodiments 299 to 390, which does not include the 2'-OMe modification. This is the gRNA described in [reference].

[0421] Embodiment 392 is, i.LS1 does not contain the 2'-OMe modification. ii. LS8 does not contain the 2'-OMe modification, and / or iii. Any of embodiments 299 to 391 in which LS10 does not contain the 2'-OMe modification It is the gRNA described in one of the documents.

[0422] Embodiment 393 is, i.N2 does not contain the 2'-OMe modification. ii. N3 does not contain the 2'-OMe modification. iii. N4 does not contain the 2'-OMe modification. iv.N5 does not contain the 2'-OMe modification. v.N6 does not contain the 2'-OMe modification. vi.N7 does not include the 2'-OMe modification. vii.N10 does not include the 2'-OMe modification. viii.N11 does not contain the 2'-OMe modification. ix.N16 does not contain the 2'-OMe modification, and / or x.N17 is any one of embodiments 299 to 392, which does not include the 2'-OMe modification. This is the gRNA described in [reference].

[0423] Embodiment 394 is, i.H1-2 does not contain a phosphorothioate bond. ii. H1-3 does not contain a phosphorothioate bond. iii. H1-4 does not contain phosphorothioate bonds. iv.H1-5 does not contain phosphorothioate bonds. v.H1-6 does not contain phosphorothioate bonds. vi.H1-7 does not contain a phosphorothioate bond. vii.H1-8 does not contain a phosphorothioate bond. viii. H1-9 does not contain phosphorothioate bonds. ix.H1-10 does not contain a phosphorothioate bond. x.H2-1 does not contain a phosphorothioate bond. xi.H2-2 does not contain a phosphorothioate bond. xii.H2-3 does not contain a phosphorothioate bond. xiii.H2-4 does not contain a phosphorothioate bond. xiv.H2-5 does not contain a phosphorothioate bond. xv.H2-6 does not contain a phosphorothioate bond. xvi.H2-7 does not contain a phosphorothioate bond. xvii.H2-8 does not contain a phosphorothioate bond. xviii.H2-9 does not contain a phosphorothioate bond. xix.H2-10 does not contain a phosphorothioate bond. xx.H2-11 does not contain phosphorothioate bonds. xxi.H2-12 does not contain a phosphorothioate bond. xxii.H2-13 does not contain phosphorothioate bonds. xxiii.H2-14 does not contain a phosphorothioate bond, and / or xxiv.H2-15 does not contain a phosphorothioate bond, Embodiments 299-39 It is the gRNA listed in one of the three items.

[0424] Embodiment 395 is an embodiment in which storage regions YA parts 1, 5, 6, 7, and 9 are optionally selected as 2 The YA modification, which is an '-OMe modification, is included, and the conserved region YA site 8 is optionally 2'- gRN according to any one of embodiments 299 to 394, which includes a ruolo modification. It is A.

[0425] Embodiment 396 is as follows: i. Nucleotide 4 from the 5' end of the 5' terminal contains a 2'-OMe modification. ii. Nucleotides 6-10 from the 5' end of the 5' terminal contain PS modification. iii. Nucleotides 8-11, 13, 14, 17 from the 5' end of the 5' end, and 18 contains a 2'-fluoro modification, iv. LS5, LS7, LS9, and LS11 contain 2'-fluoro modifications. v.LS8, LS10, and LS12 include the 2'-OMe modification. vi.N2, N3, N4, N5, N6, N7, N10, N11, N16, and N17 However, it includes the 2'-OMe modification, and vii.N14 contains one or more of the following preceding conditions: The gRNA is described in any one of the embodiments.

[0426] Embodiment 397 describes a modification of the pyrimidine site of the YA site by at least one YA modification. This includes the gRNA described in any one of embodiments 299 to 396.

[0427] Embodiment 398 includes at least one YA modification that includes modification of the adenine position of the YA site. The gRNA is described in any one of embodiments 299 to 397.

[0428] Embodiment 399 includes at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 YA The site includes YA modification at the pyrimidine position of the YA site, as in Embodiments 299-398. It is the gRNA listed in one of the following documents.

[0429] Embodiment 400 has at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 YA The site includes YA modification at the adenine position of the YA site, as in Embodiments 299 to 399. It is the gRNA described in either one of the following.

[0430] Embodiment 401 is an embodiment in which at least one YA modification includes a 2'-OMe modification. It is one of the gRNAs listed in 299-400.

[0431] Embodiment 402 has at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 YA The site includes a 2'-OMe modification, as described in any one of embodiments 299 to 401 of the gR It is NA.

[0432] Embodiment 403 is a modification where each modified preservation region YA site is modified at the pyrimidine position of the YA site. The gRNA is one of any one of embodiments 299 to 402, including ornamentation.

[0433] Embodiment 404 is a modified guide region YA portion, or a modified preservation region and guide region Embodiments 299-403 include modifications at the pyrimidine position of the YA region. It is a gRNA listed in one of the following.

[0434] Embodiment 405 is a modification in each modification-preserved region YA site, where the adenine position of the YA site is modified The gRNA is one of any one of embodiments 299 to 404, including the above.

[0435] Embodiment 406 is a modified guide region YA portion, or a modified preservation region and guide region The region YA site includes modifications at the adenine position of the YA site, as in Embodiments 299-405. It is the gRNA listed in one of the following documents.

[0436] Embodiment 407 is an sgRNA that includes modifications in LS5, as in Embodiments 299-4. It is a gRNA listed in any one of the 06 entries.

[0437] Embodiment 408 is an sgRNA that includes modifications in LS7, as in Embodiments 299-4. It is a gRNA listed in any one of the 07 items.

[0438] Embodiment 409 is an sgRNA containing modifications in LS9, and optionally, L If S9 is modified and LS5, LS7, and LS12 are not modified, then the modification of LS9 is gRNA other than 2'-fluoro, as described in any one of embodiments 299 to 408 be.

[0439] Embodiment 410 is an sgRNA that includes modifications at LS12, and optionally, If LS12 is modified and LS9 is not modified, then the modification of LS12 is other than 2'-OMe. It is a gRNA described in any one of embodiments 299 to 409.

[0440] Embodiment 411 is an sgRN containing at least one YA modification that stabilizes the secondary structure. A is, and optionally, the secondary structure is the lower stem, in embodiments 299 to 410. It is the gRNA described in either one of the following.

[0441] Embodiment 412 includes at least one modification of LS8 and / or LS11. It is an sgRNA, and by optional selection, modifications to LS8 and / or LS11 are secondary. The gRNA described in any one of embodiments 299 to 411 stabilizes the structure.

[0442] Embodiment 413 is, i.ENA, ii. LNA, or iii. Including YA modifications that stabilize a secondary structure selected from bicyclic ribose modifications, The gRNA is described in any one of embodiments 299 to 412.

[0443] Embodiment 414 is an sgRNA that includes modification at N6, as in Embodiments 299-41. It is the gRNA listed in one of the three items.

[0444] Embodiment 415 is an sgRNA that includes modification at N14, as in Embodiments 299-4. It is a gRNA listed in one of the 14 items.

[0445] Embodiment 416 is an sgRNA that includes modifications at N17, and optionally, N If 17 is modified and N6 and N14 are not modified, then the modification of N17 is 2'-fluor. It is described in any one of embodiments 299 to 415, other than b and other than 2'-OMe. This is the gRNA.

[0446] Embodiment 417 is one in which at least one of nucleotides 1 to 3 from the 5' end of the 5' end is One, two, or three of them contain deoxyribonucleotides, and by optional selection, the 5' end Nucleotides 1-3 from the 5' end of the part include PS modification, as in Embodiments 299-416. It is the gRNA listed in one of the following documents.

[0447] Embodiment 418 is an sgRNA, and the nucleus from the 3' end of the 3' end At least one, two, or three of rheotides 1-3 are deoxyribonucleotides Including, and by choice, nucleotides 2-3 from the 3' end of the 3' terminal undergo PS modification. This includes gRNA as described in any one of embodiments 299 to 417.

[0448] Embodiment 419 is an sgRNA, and the nucleus from the 3' end of the 3' end Rheotide 4 includes PS modification, and optionally, the nucleo from the 3' end of the 3' end The g of 4, which includes a 2'-OMe modification, as described in any one of embodiments 299 to 418. It is RNA.

[0449] Embodiment 420 is an sgRNA, and hairpin 2 is a deoxyribonucleated Contains leotide, and optionally includes hairpin 1 and hairpin 2, numbers 1, 2, 3, 4, and 5. All or nearly all of 6, 7, 8, 9, or 10 nucleotides are deoxyri It is a bonucleotide, or a gRNA as described in any one of embodiments 299 to 419. .

[0450] Embodiment 421 is an sgRNA, and hairpin 1 and hairpin 2 are Containing deoxyribonucleotides, optionally one of hairpin 1 and one of hairpin 2, The number of nucleotides is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13. All or almost all of the embodiments of 299-420 are deoxyribonucleotides. It is the gRNA listed in one of the following documents.

[0451] Embodiment 422 is an sgRNA, and the sgRNA starts from the beginning of hairpin 1. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 up to the 3' end All or nearly all of the nucleotides are deoxyribonucleotides, and any Through selection, nucleotides 1-3 from the 3' end of the 3' terminal become deoxyribonucleo The gRNA is a cytoplasm, as described in any one of embodiments 299 to 421.

[0452] Embodiment 423 is an sgRNA in which the gRNA is a deoxyribonucleated nucleotide. The gRNA is a gRNA containing a rheotide, as described in any one of embodiments 299 to 422.

[0453] Embodiment 424 is an sgRNA, and 1, 2, 3, 4, 5, 6, 7, 8 , 9 or 10 nucleotides of the upper stem, all or almost all of them, deoxyri The gRNA is a bonucleotide, as described in any one of embodiments 299 to 423. .

[0454] Embodiment 425 is a 5' terminal in which at least one of nucleotides 1 to 3 from the 5' end is Also, 1, 2, or 3 include ENA, and optionally, from the 5' end of the 5' end. Nucleotides 1-3 are described in any one of Embodiments 299-424, including PS modification. This is the gRNA.

[0455] Embodiment 426 is an sgRNA, and the nucleus from the 3' end of the 3' end At least one, two, or three of leotide 2-4 contain ENA, and are selected as Furthermore, nucleotides 2-3 from the 3' end of the 3' terminal include PS modification, in Embodiment 29 It is one of the gRNAs listed in 9-425.

[0456] Embodiment 427 is a 5' terminal in which at least one of nucleotides 1 to 3 from the 5' end is Also, 1, 2, or 3 include UNA, and optionally, from the 5' end of the 5' end Nucleotides 1-3 are described in any one of Embodiments 299-426, including PS modification. This is the gRNA.

[0457] Embodiment 428 is an sgRNA, and the nucleus from the 3' end of the 3' end At least one, two, or three of leotide 2-4 contain ENA, and are selected as Furthermore, nucleotides 2-3 from the 3' end of the 3' terminal include PS modification, in Embodiment 29 It is one of the gRNAs listed in 9-427.

[0458] Embodiment 429 is an sgRNA, and the nucleus from the 3' end of the 3' end Rheotide 4 includes PS modification, and optionally, the nucleo from the 3' end of the 3' end The g of 4, which includes a 2'-OMe modification, as described in any one of embodiments 299 to 428. It is RNA.

[0459] Embodiment 430 demonstrates that the modification significantly alters the ability of the guide to cleave the target nucleic acid. gRNA according to any one of embodiments 299 to 429, which reduces gRNA degradation without It is A.

[0460] Embodiment 431 includes YA modification, where the modification is 2'-fluoro, 2'-H, 2'-O- One of embodiments 299 to 430, including Me, ENA, UNA, or PS. This is the gRNA shown.

[0461] Embodiment 432 includes YA modification, in which the modification alters the structure of the dinucleotide motif. One of embodiments 299 to 431 reduces RNA endonuclease activity. This is the gRNA described in [reference].

[0462] Embodiment 433 includes YA modification, and the modification is recognized by RNase or This prevents cleavage and / or stabilizes the RNA structure, as in embodiments 299 to 432. It is the gRNA described in one of the following.

[0463] Embodiment 434 includes YA modification, and the modification is i. 2'-O-alkyl, 2'-F, 2'-moe, 2'-F arabinose, and 2 Ribose modification selected from -H (deoxyribose), ii. Bicyclic ribose analogs such as LNA, BNA, and ENA, iii. Unlocked nucleic acid modification, iv. Base modifications such as inosine, pseudouridine, and 5'-methylcytosine, Bini v. Containing one or more nucleoside-linking modifications such as phosphorothioates, The gRNA is described in any one of embodiments 299 to 433.

[0464] Embodiment 435 includes a guide region in which the gRNA includes a modification at nucleotide 5. By arbitrary selection, the guide region is determined by the 2'-OMe modification at nucleotides 1-4, nucleus Phosphothioate modifications in rheotides 1-3 and 6-10, and / or nuclei The preceding 2'-F modification is included in rheotides 8-11, 13, 14, 17, and 18. The gRNA is described in any one of the embodiments.

[0465] Embodiment 436 includes a guide region in which the gRNA includes a modification at nucleotide 12. Furthermore, by arbitrary selection, the guide region is determined by the 2'-OMe modification at nucleotides 1-4, Phosphothioate modifications in cleotides 1-3 and 6-10, and / or nu Preceding 2'-F modifications in creotides 8-11, 13, 14, 17, and 18 The gRNA is described in any one of the embodiments.

[0466] Embodiment 437 is a gRNA in which nucleotide 5 and / or nucleotide 12 Includes a guide region containing a 2'-OMe modification, and optionally the guide region is null 2'-OMe modification in nucleotides 1-4, and nucleotides 1-3 and 6-10. Scholothioate modification, and / or nucleotides 8-11, 13, 14, 17, gRN as described in any one of the prior embodiments, including the 2'-F modification in 18. It is A.

[0467] Embodiment 438 is a gRNA in which nucleotide 5 and / or nucleotide 12 Includes a guide region containing a 2'-F modification, and optionally the guide region is nucleoti 2'-OMe modification at nucleotides 1-4, and phospho at nucleotides 1-3 and 6-10. Rothioate modifications, as well as / or nucleotides 8-11, 13, 14, 17, and gRNA as described in any one of the prior embodiments, including the 2'-F modification in 18 be.

[0468] Embodiment 439 is a gRNA in which nucleotide 5 and / or nucleotide 12 Includes a guide region containing a 2'-H modification, and optionally the guide region is nucleoti 2'-OMe modification at nucleotides 1-4, and phospho at nucleotides 1-3 and 6-10. Rothioate modifications, as well as / or nucleotides 8-11, 13, 14, 17, and gRNA as described in any one of the prior embodiments, including the 2'-F modification in 18 be.

[0469] Embodiment 440 is a gRNA in which the nucleo at nucleotide 5 and / or 12 The tide includes a guide region containing phosphorothioate modification, and optionally the guide region , 2'-OMe modification in nucleotides 1-4, and in nucleotides 1-3 and 6-10 Phosphothioate modifications in and / or 8-11, 13, 14, 17, The nucleotide in 18 includes a 2'-F modification, as described in any one of the prior embodiments. This is the gRNA shown.

[0470] Embodiment 441 is a case where gRNA is i. Nucleotides 8-10, ii. Nucleotides 8 and 9, iii. Nucleotides 8 and 10, or iv. Includes a guide region, including modifications in nucleotides 9 and 10, By arbitrary selection, the guide region is determined by the 2'-OMe modification at nucleotides 1-4, nucleus Phosphothioate modifications in rheotides 1-3 and 6-7, and / or nuclei Prior implementations including 2'-F modifications in Otid 11, 13, 14, 17, and 18 It is a gRNA described in one of the morphological descriptions.

[0471] Embodiment 442 is a case where gRNA is i. Nucleotides 8-10, ii. Nucleotides 8 and 9, iii. Nucleotides 8 and 10, iv. Nucleotides 9 and 10, or Includes a guide region containing a 2'-F modification at nucleotide 8, By arbitrary selection, the guide region is determined by the 2'-OMe modification at nucleotides 1-4, nucleus Phosphothioate modifications in rheotides 1-3 and 6-7, and / or nuclei Prior implementations including 2'-F modifications in Otid 11, 13, 14, 17, and 18 It is a gRNA described in one of the morphological descriptions.

[0472] Embodiment 443 is a case where gRNA is i. Nucleotides 8-10, ii. Nucleotides 8 and 9, iii. Nucleotides 8 and 10, iv. Nucleotides 9 and 10, or Includes a guide region containing a 2'-F modification at nucleotide 8, Nucleotides 8-10 do not contain phosphorothioate modifications and are optionally used as guides. The region is characterized by 2'-OMe modification at nucleotides 1-4, and nucleotides 1-3 and 6- Phosphothioate modification at 7, and / or nucleotides 11, 13, 14, As described in any one of the preceding embodiments, including the 2'-F modification in 17 and 18. This is the gRNA.

[0473] Embodiment 444 shows that the gRNA has 2'-F modifications at nucleotides 8-10, and to i. Phosphothioate modification at 1, 2, or 3 nucleotides 8-10. ii. Phosphothioate modification at nucleotide 8, iii. Phosphothioate modification at nucleotide 9, iv. Phosphothioate modification at nucleotide 10, v. Phosphothioate modification at nucleotides 8 and 9, vi. Phosphothioate modifications at nucleotides 8 and 10, vii. Phosphothioate modification at nucleotides 9 and 10, or viii. Guide region containing phosphorothioate modifications at nucleotides 8-10 Includes, By arbitrary selection, the guide region is determined by the 2'-OMe modification at nucleotides 1-4, nucleus Phosphothioate modifications in rheotides 1-3 and 6-7, and / or nuclei Prior implementations including 2'-F modifications in Otid 11, 13, 14, 17, and 18 It is a gRNA described in one of the morphological descriptions.

[0474] Embodiment 445 is a case where gRNA is i. 2'-F or phosphorothioate modification at nucleotides 5 and 6, ii. 2'-F modification in nucleotides 5 and 6, iii. Phosphothioate modifications in nucleotides 5 and 6, iv. 2'-F modification in nucleotide 5 and phosphorotropy in nucleotide 6 Oeh modification, or v. 2'-F modification in nucleotide 6 and phosphorothiocyanate in nucleotide 5 Includes guide region, which includes etote modification. By arbitrary selection, the guide region is determined by the 2'-OMe modification at nucleotides 1-4, nucleus Phosphothioate modifications in rheotides 1-3 and 7-10, and / or nuclei The preceding 2'-F modification is included in rheotides 8-11, 13, 14, 17, and 18. The gRNA is described in any one of the embodiments.

[0475] Embodiment 446 is a gRNA in which at least 1, 2, 3, 4 of nucleotides 6-11 Includes guide regions containing 5 or 6 2'-F modifications, and optionally the guide regions , 2'-OMe modification in nucleotides 1-4, phosphoro in nucleotides 1-3 Thioate modification, and / or in nucleotides 13, 14, 17, and 18 The gRNA is one of the prior embodiments, including a 2'-F modification.

[0476] Embodiment 447 is a gRNA in which at least one of nucleotides 1-4 and 6-11 Also includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 2'-F modifications. The guide region includes a nucleotide 1-3 phosphorus region, and by arbitrary selection, the guide region is selected to include a phosphorus region. Oate modification, and / or nucleotides 13, 14, 17, and 18 The gRNA described in any one of the prior embodiments includes the '-F modification.

[0477] Embodiment 448 is a gRNA in which the gRNA contains a 2'-F modification at nucleotides 6-11. The id region is included, and by option, the guide region is 2'-O at nucleotides 1-4. Me modification, phosphorothioate modification at nucleotides 1-3, and / or nuclei The preceding embodiment includes the 2'-F modification in ocides 13, 14, 17, and 18. It is the gRNA listed in one of the following documents.

[0478] Embodiment 449 is a gRNA in which the gRNA contains 2'-F modifications at nucleotides 1-4. The guide region includes a guide region, and optionally, the guide region is located between nucleotides 1-3 and 6-10. Phosphothioate modifications, and / or nucleotides 6-11, 13, 14, 1 The 2'-F modification in 7 and 18, as described in any one of the preceding embodiments. It is a gRNA.

[0479] Embodiment 450 is a gRNA in which the gRNA includes a 2'-F modification at nucleotide 9, It includes a guide region in ochide 9 that does not contain phosphorothioate modification, and optionally The guide region is the 2'-OMe modification at nucleotides 1-4, and nucleotides 1-3 and 6- Phosphothioate modifications in leotide 8 and 10, and / or nucleothioate modifications. The preceding 2'-F modification is included in 8, 10, 11, 13, 14, 17, and 18. The gRNA is described in any one of the embodiments.

[0480] Embodiment 451 is a gRNA in which nucleotides 8-11, 13, 14, 17, and 1 It does not contain at least one, two, three, four, five, six, seven, or eight 2'-F modifications out of eight. The guide region includes a guide region, and optionally the guide region is located at 2' in nucleotides 1-4. -OMe modification, and / or phosphorus at nucleotides 1-3 and 6-10 The gRNA is one of the prior embodiments, including Oate modification.

[0481] Embodiment 452 is a gRNA in which nucleotides 8-11, 13, 14, 17, and 1 The guide region in 8 does not include the 2'-F modification, and optionally the guide region is selected. 2'-OMe modification in nucleotides 1-4, and / or nucleotides 1-3 Any one of the preceding embodiments, including the phosphorothioate modification in 6-10 This is the gRNA described.

[0482] Embodiment 453 is a gRNA in which a small portion of nucleotides 9, 11, 13, and 14 are present. Includes a guide region containing at least 1, 2, 3, or 4 2'-OMe modifications, optional. Therefore, the guide region is responsible for the 2'-OMe modification in nucleotides 1-4, and / or This includes a preceding phosphorothioate modification at nucleotides 1-3 and 6-10. The gRNA is described in any one of the embodiments.

[0483] Embodiment 454 is a gRNA in which nucleotides 9, 11, 13, and 14 are 2 'Includes a guide region containing the -OMe modification, and optionally the guide region is a nucleotide 2'-OMe modification at nucleotides 1-4, and / or nucleotides 1-3 and 6-10 gR as described in any one of the prior embodiments, including phosphorothioate modification in It is NA.

[0484] Embodiment 455 is a gRNA in which one or both of nucleotides 8 and nucleotide 10 It includes a guide region containing phosphorothioate modification, and optionally the guide region is nucleated 2'-OMe modification in rheotides 1-4, and nucleotides 1-3 and 6-7 Scholothioate modification, and / or nucleotides 8-11, 13, 14, 17, gRN as described in any one of the prior embodiments, including the 2'-F modification in 18. It is A.

[0485] Embodiment 456 uses the following nucleotides 1, 2, 3, 4, 6, 7, 8, 9, 10, 11 , at least 1, 2, 3, 4, 5, 6, 7, 8 of 13, 14, 17, and 18, Includes guide areas with 9, 10, 11, 12, 13, or all of the modifications, By selective selection, the modification is either 2'-OMe, 2'-fluoro, or phosphorothioate modification. This is the gRNA described in any one of the prior embodiments.

[0486] Embodiment 457 has gRNAs 1, 2, 3, 4, 6, 7, 8, 9, 10, 11, 13 , including guide regions with modifications in nucleotides 14, 17, and 18, optional Therefore, the modification is a 2'-OMe, 2'-fluoro, or phosphorothioate modification. or the gRNA described in any one of the prior embodiments.

[0487] Embodiment 458 is a 2'-OMe modification at the nucleotides 6-11 and 13. It is a gRNA described in any one of the prior embodiments that is not present in the guide region.

[0488] Embodiment 459 is a 2'-fluoro modification of nucleotides 1-7, 15, 16, and g described in any one of the prior embodiments is not present in the guide region at the end of 19. It is RNA.

[0489] Embodiment 460 is a phosphorothioate modification of nucleotides 4, 5, 11-14, 1 In 7 and 18 It is a gRNA described in any one of the prior embodiments that is not present in the guide region.

[0490] Embodiment 461 is a prior embodiment in which the guide region includes an unmodified nucleotide 20. It is a gRNA listed in one of the following.

[0491] Embodiment 462 is a prior embodiment in which the guide region consists of 20 nucleotides. It is a gRNA listed in one of the following.

[0492] Embodiment 463 has a guide region where the YA site and nucleus in nucleotides 5-6 The gRNA described in any one of the prior embodiments, including modification at ochide 5. .

[0493] Embodiment 464 has a guide region where the YA site and nucleotides 12-13 are located. The gRNA described in any one of the prior embodiments, comprising modification of cleotide 12. .

[0494] Embodiment 465 has a guide region where the YA site and nucleotides 15-16 are located. The gRNA described in any one of the prior embodiments, comprising modification of cleotide 15. .

[0495] Embodiment 466 is a guide region in which the YA site and nucleotides 16-17 are located. The gRNA described in any one of the prior embodiments, comprising modification of creotide 16. .

[0496] Embodiment 467 has a guide region where the YA site and nucleotides 19-20 are located. The gRNA described in any one of the prior embodiments, comprising modification of creotide 19. .

[0497] Embodiment 468 is a guide region in which nucleotides 5-6 do not contain the YA site, and nucleo Tide 5 is an unmodified gRNA as described in any one of the preceding embodiments.

[0498] Embodiment 469 is a guide region in which nucleotides 12-13 do not contain the YA site, Rheotide 12 is an unmodified gRNA as described in any one of the prior embodiments. ru.

[0499] Embodiment 470 is a guide region in which nucleotides 15-16 do not contain the YA site, Rheotide 15 is an unmodified gRNA as described in any one of the prior embodiments. ru.

[0500] Embodiment 471 is a guide region in which nucleotides 16-17 do not contain the YA site, Rheotide 16 is an unmodified gRNA as described in any one of the prior embodiments. ru.

[0501] Embodiment 472 is a guide region in which nucleotides 19-20 do not contain the YA site, Rheotide 19 is an unmodified gRNA as described in any one of the prior embodiments. ru.

[0502] Embodiment 473 is a gRNA, which is as follows: i. 2'-OMe and phosphorothioate modifications at nucleotide 1, ii. 2'-OMe and phosphorothioate modifications in nucleotide 2, iii. 2'-OMe and phosphorothioate modifications in nucleotide 3, iv. 2'-OMe modification at nucleotide 4, v. Phosphothioate modification at nucleotide 6, vi. Phosphothioate modification in nucleotide 7, vii. 2'-fluoro and phosphorothioate modifications in nucleotide 8, viii. 2'-Fluoro and phosphorothioate modifications in nucleotide 9, ix. 2'-fluoro and phosphorothioate modifications at nucleotide 10, 2'-fluoro modification at x.nucleotide 11, xi. 2'-fluoro modification at nucleotide 13, xii. 2'-fluoro modification at nucleotide 14, xiii. 2'-fluoro modification at nucleotide 17, and xiv. At least 1, 2, and 3 of the 2'-fluoro modifications at nucleotide 18 Guide areas containing 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or all of them This is a gRNA described in any one of the prior embodiments, including the following:

[0503] Embodiment 474 is a prior art in which the guide region includes each of the modifications described in the previous embodiment. The gRNA is described in any one of the embodiments.

[0504] Embodiment 475 has the following guide region: i. When nucleotides 5 and 6 form the YA site, the 2' in nucleotide 5 -OMe modification, ii. When nucleotides 12 and 13 form the YA site, nucleotide 12 keru 2'-OMe modification, iii. When nucleotides 15 and 16 form the YA site, nucleotide 15 Phosphothioate or 2'-H modification in iv. When nucleotides 16 and 17 form the YA site, nucleotide 16 Phosphothioate modification, and v. When nucleotides 19 and 20 form the YA site, in nucleotide 19 at least one, two, or three of the following phosphorothioates or 2'-fluoro modifications, The gRNA is described in any one of the prior embodiments, including four.

[0505] Embodiment 476 has a guide region where the YA site and nucleus in nucleotides 5-6 g as described in any one of the preceding embodiments, including the 2'-OMe modification in ochide 5. It is RNA.

[0506] Embodiment 477 is a guide region in which the YA site and nucleotides 12-13 are located. One of the preceding embodiments includes a 2'-OMe modification in creotide 12. This is the gRNA shown.

[0507] Embodiment 478 has a guide region at the YA site in nucleotides 15-16, and Any of the preceding embodiments, including phosphorothioate modification at nucleotide 15 It is the gRNA described in one of the entries.

[0508] Embodiment 479 has a guide region at the YA site in nucleotides 16-17, and Any of the preceding embodiments, including phosphorothioate modification at nucleotide 16 It is the gRNA described in one of the entries.

[0509] Embodiment 480 has a guide region at the YA site in nucleotides 19-20, and Any of the preceding embodiments, including phosphorothioate modification at nucleotide 19 It is the gRNA described in one of the entries.

[0510] Embodiment 481 includes a guide region containing a 2'-fluoro modification at nucleotide 19. The gRNA is described in any one of the preceding embodiments.

[0511] Embodiment 482 is a guide region that includes an unmodified nucleotide 15 or a nucleo Any one of the prior embodiments, comprising only phosphorothioate modification at Tide 15 This is the gRNA described in [reference].

[0512] Embodiment 483 is a guide region in which the guide region contains an unmodified nucleotide 16 or a nucleo Any one of the prior embodiments, comprising only phosphorothioate modification at Tide 16 This is the gRNA described in [reference].

[0513] Embodiment 484 is an LNP group containing the gRNA described in any one of the prior embodiments. It is a finished product.

[0514] Embodiment 485 is any of Embodiments 1 to 483 associated with lipid nanoparticles (LNPs). It is a composition containing the gRNA described in one of the following.

[0515] Embodiment 486 further comprises a nuclease or mRNA encoding a nuclease. Including the gRNA described in Embodiment 452 or 453 or any of Embodiments 1 to 483 The composition is one of the descriptions provided.

[0516] Embodiment 487 is described in Embodiment 486, wherein the nuclease is a Cas protein. It is a composition of [the following].

[0517] Embodiment 488 is the combination described in Embodiment 487, wherein the Cas protein is Cas9. It is a finished product.

[0518] Embodiment 489 is a case where Cas9 is S.pyogenes Cas9 or S.aure The composition is US Cas9, as described in Embodiment 488.

[0519] Embodiment 490 is an embodiment in which the nuclease is nicasse or dCas, as in Embodiment 48. The composition is one of the compositions described in 5 to 489.

[0520] Embodiment 491 is any of Embodiments 485 to 490, in which the nuclease is modified. It is one of the compositions described in the document.

[0521] Embodiment 492 is an embodiment in which a modified nuclease includes a nuclear localization signal (NLS). This is the composition described in Form 491.

[0522] Embodiment 493 includes mRNA encoding a nuclease, as described in Embodiments 484-49. The composition is as described in any one of the two.

[0523] Embodiment 494 is an mRNA that is sequence numbers 1099-1127 or 1129-114 The composition according to Embodiment 493, comprising any one of the six sequences.

[0524] Embodiment 495 is a gRNA or embodiment described in any one of Embodiments 1 to 483. A composition according to any one of Forms 484 to 494, and a pharmaceutically acceptable carrier. It is a pharmaceutical product.

[0525] Embodiment 496 is a Cas protein or a nucleic acid encoding a Cas protein, and The following: i. gRNA described in any one of Embodiments 1 to 483, ii. The composition described in any one of Embodiments 484 to 494, and iii. To deliver one or more of the pharmaceutical formulations of Embodiment 495 to cells. This includes methods for modifying target DNA.

[0526] Embodiment 497 describes the method described in Embodiment 496, wherein the method results in a gene insertion or deletion. This is the method of installation.

[0527] Embodiment 498 further comprises delivering a template to a cell, wherein at least a portion of the template is , at or near the Cas protein-induced double-strand break site, target D This is a method according to embodiment 496 or embodiment 497, which is incorporated into NA.

[0528] Embodiment 499 is an implementation for use in the preparation of pharmaceuticals for treating diseases or disorders. gRNA described in any one of Forms 1 to 483, the composition of Embodiments 484 to 494, The other is the pharmaceutical preparation described in Embodiment 495.

[0529] Embodiment 500 is an embodiment of Embodiment 1 in the manufacture of a pharmaceutical product for treating a disease or disorder. gRNA described in any one of ~483, the compositions of Embodiments 484~494, or This is the use of the pharmaceutical preparation described in Application Form 495.

[0530] Embodiment A1.5'-end modification or 3'-end modification, and including a conserved portion of the gRNA. A guide RNA (gRNA) in which the conserved portion is (a) A shortened hairpin area, or a hair that has been replaced and optionally shortened In the pin 1 region, (i) The following: H1-1 and H1-12, H1-2 and H1-11, H1-3 and and H1-10, and / or fewer of the nucleotide pairs of H1-4 and H1-9 At least one of the hairpins 1 that has been replaced and shortened by optional means is a Watson-C It is substituted with a lick-pairing nucleotide, and the hairpin 1 region is optionally selected. (aa) One or two of the following from H1-5 to H1-8, (bb) Below: H1-1 and H1-12, H1-2 and H1-11, H1-3 and of the nucleotide pairs of H1-10 and / or H1-4 and H1-9 One, two, or three, and / or (cc) Hairpin 1 region lacks 1 to 8 nucleotides, or (ii) The shortened hairpin 1 region consists of 6 to 8 nucleotides, preferably 6 It lacks a nucleotide, (A) One or more of H1-1, H1-2, or position H1-3 are sequence numbers 400 is deleted or substituted, and / or (B) One or more of positions H1-6 to H1-10 are placed relative to sequence number 400. It has been replaced, or (iii) The shortened hairpin 1 region contains 5 to 10 nucleotides, preferably 5 It is missing approximately 6 nucleotides, at position N18, H1-12, or one of n. The above is the substitution for sequence number 400, and / or (b) A shortened upper stem region, wherein the shortened upper stem region comprises 1 to 6 It lacks nucleotides and has a shortened upper stem region of 6, 7, 8, 9, 10, or Eleven nucleotides, including four or fewer substitutions relative to sequence number 400, are abbreviated. The stem region, and / or (c)LS6, LS7, US3, US10, B3, N7, N15, N17, H2-2, A substitution for sequence number 400 in one or more of H2-14. But the substituted nucleotide is not a pyrimidine followed by adenine, and pyrimidine is Substitutions that are not the preceding adenine, and / or (d) Upper stem region, wherein the modification of the upper stem is US1~U in the upper stem region Includes one or more modifications to any of S12, including one or more of the upper stem regions. , guide RNA (gRNA).

[0531] Embodiment A2. The gRNA according to Embodiment A1, wherein position H1-1 is deleted.

[0532] Embodiment A3. The gRNA according to Embodiment A1, wherein position H1-1 is substituted.

[0533] Embodiment A4. Position H1-2 is missing, in any one of Embodiments A1 to A3. The gRNA described.

[0534] Embodiment A5. One of Embodiments A1 to A3 in which position H1-2 is replaced. The gRNA described.

[0535] Embodiment A6. Any one of Embodiments A1 to A5, in which position H1-3 is missing. The gRNA described.

[0536] Embodiment A7. In any one of Embodiments A1 to A5, position H1-3 is replaced. The gRNA described.

[0537] Embodiment A8. Position H1-4 is missing, in any one of Embodiments A1 to A7. The gRNA described.

[0538] Embodiment A9. Positions H1-5 are missing, in any one of Embodiments A1 to A7. The gRNA described.

[0539] Embodiment A10. Any one of Embodiments A1 to A9, in which position H1-6 is missing. The gRNA described above.

[0540] Embodiment A11. Any one of Embodiments A1 to A9, in which position H1-6 is replaced. The gRNA described above.

[0541] Embodiment A12. Any one of Embodiments A1 to A11 in which position H1-7 is missing. gRNA described in [the text].

[0542] Embodiment A13. Any one of Embodiments A1 to A11, in which position H1-7 is replaced. gRNA described in [the text].

[0543] Embodiment A14. Any one of Embodiments A1 to A13, in which position H1-8 is missing. gRNA described in [the text].

[0544] Embodiment A15. Any one of Embodiments A1 to A13, in which position H1-8 is replaced. gRNA described in [the text].

[0545] Embodiment A16. Any one of Embodiments A1 to A15, in which position H1-9 is missing. gRNA described in [the text].

[0546] Embodiment A17. Any one of Embodiments A1 to A15, in which position H1-9 is replaced. gRNA described in [the text].

[0547] Embodiment A18. Any of Embodiments A1 to A17, in which position H1-10 is missing. gRNA listed in one entry.

[0548] Embodiment A19. Any of Embodiments A1 to A17, in which position H1-10 is replaced. gRNA listed in one entry.

[0549] Embodiment A20. Any of Embodiments A1 to A19, in which position H1-11 is missing. gRNA listed in one entry.

[0550] Embodiment A21. Any of Embodiments A1 to A20, in which position H1-12 is missing. gRNA listed in one document.

[0551] Embodiment A22. Embodiments A1-A2, in which positions H1-11 to H1-12 are missing. gRNA listed in any one of the items in 1.

[0552] Embodiment A23. Positions H1-7 are replaced by G and / or H1-8 is placed at C. The gRNA described in any one of embodiments A1 to A22, which has been replaced.

[0553] Embodiment A24.H1-6 and / or position H1-7 are replaced, Embodiment A gRNA listed in one of the following categories: 1 to A23.

[0554] Embodiment A25. Positions H1-6 are replaced by C and / or position H1-7 is U gRNA as described in any one of embodiments A1 to A24, which is replaced by [the specified b].

[0555] Embodiment A26. Embodiment in which positions H1-1 and / or H1-12 are replaced. gRNA listed in any one of A1 to A25.

[0556] Embodiment A27. Position H1-1 is replaced by C and / or position H1-12 gRNA as described in any one of embodiments A1 to A26, which is substituted with G.

[0557] Embodiment A28. Any one of Embodiments A1 to A27, in which position N18 is replaced. The gRNA described above.

[0558] Embodiment A29. The gRNA described in Embodiment A28, wherein position N18 is replaced with C. .

[0559] Embodiment A30. Any of Embodiments A1 to A29, in which position H1-12 is replaced. gRNA listed in one entry.

[0560] Embodiment A31. In Embodiment A30, position H1-12 is replaced with C or A. The gRNA described.

[0561] Embodiment A32. The same as any one of Embodiments A1 to A31, in which position n is replaced. gRNA.

[0562] Embodiment A33. The gRNA according to Embodiment A32, wherein position n is replaced with A.

[0563] Embodiment A34. Includes a shortened upper stem region, wherein the shortened upper stem region is 1 gR according to any one of embodiments A1 to A33, lacking ~6 nucleotides NA.

[0564] Embodiment A35. gRNA is sgRNA, one of Embodiments A1 to A34 gRNA described in [the text].

[0565] Embodiment A36. gRNA includes a 5' terminal modification, one of Embodiments A1 to A35. gRNA listed in one entry.

[0566] Embodiment A37. gRNA includes a 3' terminal modification, one of Embodiments A1 to A36. gRNA listed in one entry.

[0567] Embodiment A38. gRNA includes 5' terminal modification and 3' terminal modification, Embodiment A1 gRNA listed in any one of the ~A37 cells.

[0568] Embodiment A39. gRNA includes a 3' tail, one of any one of Embodiments A1-A38. gRNA described in [the text].

[0569] Embodiment A40.3': 1-2, 1-3, 1-4, 1-5, 1-7, 1-10 tails nucleotides or 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides gRNA according to Embodiment A39, including the d.

[0570] Embodiment A41. gRNA that does not contain a 3' tail, any of Embodiments A1 to A38 The gRNA listed in one of the documents.

[0571] Embodiment A42. Any of Embodiments A1 to A41, including modification in the hairpin region. gRNA listed in one entry.

[0572] Embodiment A43. The gRNA according to Embodiment A42, further comprising a 3'-terminus modification.

[0573] Embodiment A44. The embodiment described in Embodiment A42 further includes 3'-terminal modifications and 5'-terminal modifications. gRNA.

[0574] Embodiment A45. The gRNA according to Embodiment A42, further comprising a 5' terminal modification.

[0575] Embodiment A46. A description of any one of Embodiments A1 to A45, further including a guide area. gRNA.

[0576] Embodiment A47. The guide region is 17, 18, 19, or 20 nucleotides long. , the gRNA described in Embodiment A46.

[0577] Embodiment A48.3' and / or 5' end modification is a protective end modification, optionally by , 2'-O-methyl(2'-OMe) modified nucleotide, 2'-O-(2-methoxyethyl (2'-O-moe) modified nucleotide, 2'-fluoro(2'-F) modified nucleotide Tide, internucleotide phosphorothioate (PS) bond, inverted debase-modified nucleothio Embodiments A1~ include modified nucleotides selected from or a combination thereof. gRNA listed in any one of the A47 entries.

[0578] Embodiment A49. Modification in the hairpin region is 2'-O-methyl(2'-Ome) modification Modified nucleotides, 2'-fluoro(2'-F) modified nucleotides, internucleotide phospho Modified nucleotides selected from rothioate (PS) bonds or combinations thereof. gRNA as described in any one of embodiments A1 to A48, including the gRNA described in any one of embodiments A1 to A48.

[0579] Embodiment A50.3' and / or 5' terminal modification is 2'-O-methyl(2'-Om e) Any one of Embodiments A1 to A49, comprising or further comprising a modified nucleotide. The gRNA described above.

[0580] Embodiment A51.3' and / or 5' terminal modification is 2'-fluoro(2'-F) modification One of Embodiments A1 to A50, which includes or further includes decorative nucleotides. gRNA.

[0581] Embodiment A52.3' and / or 5' terminal modifications are internucleotide phosphorothiocyanate One of embodiments A1 to A51 includes or further includes a stenograph (PS) bond. gRNA.

[0582] Embodiment A53.3' and / or 5' terminal modification is an inverted debase-modified nucleoty gRNA according to any one of embodiments A1 to A52, comprising or further comprising.

[0583] Embodiment A54. Modification in the hairpin region is 2'-O-methyl(2'-Ome) modification. Each of embodiments A1 to A53 includes or further includes decorative nucleotides. gRNA.

[0584] Embodiment A55. Modification in the hairpin region is 2'-fluoro(2'-F) modified nucleus gR according to any one of Embodiments A1 to A54, comprising or further comprising a rheotide NA.

[0585] Embodiment A56.sgRNA includes a 3' tail, and the 3' tail is present in the 3' tail. Embodiments A1 to A55 include any one or more modifications of the nucleotides. The gRNA listed in one of the following.

[0586] Embodiment A57.3' tail is fully modified, as described in Embodiment A56. NA.

[0587] Embodiment A58. Embodiments A1-A, in which the upper stem region includes at least one modification. gRNA listed in any one of the 57 items.

[0588] Embodiment A59. Modification of the upper stem, i. One or more modifications from US1 to US12 in the upper stem region, call ii. At least 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 in the upper stem region Containing one or more of the following nucleotide modifications: 0, 11, or all 12 nucleotides, gRNA as described in Embodiment A58.

[0589] Embodiment A60. Modification of the upper stem, i. 2'-OMe modified nucleotide, ii. 2'-O-moe modified nucleotides, iii. 2'-F modified nucleotides, and iv. Includes one or more combinations of (i.) to (iii.) Hmm, the gRNA described in Embodiment A59.

[0590] Embodiment A61. Sequence IDs 1-98, 201-294, 401-494, 601-69 8, or any one nucleotide sequence from 801 to 875 and at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 7 One of embodiments A1 to A60 contains a nucleotide sequence having 0% identity. The gRNA described.

[0591] Embodiment A62. Sequence IDs: 101-198, 301-394, 501-594, 70 One nucleotide sequence from 1 to 798 or 901 to 975 and at least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, Or containing nucleotide sequences with 70% identity, and the nucleotides of the reference sequence identifiers in Table 1A The modifications at each nucleotide of the gRNA corresponding to the rheotide are the reference sequence identifiers in Table 1A. The modification described in any one of Embodiments A1 to A61 is identical or equivalent to the modification shown in [reference]. gRNA.

[0592] Embodiment A63. Sequence IDs 1-98, 201-294, 401-494, 601-69 A guide RNA containing either 8 or one of the numbers 801-875.

[0593] Embodiment A64. Sequence IDs 101-198, 301-394, 5, including modifications of Table 1A. A guide RNA containing one of the following: 01-594, 701-798, or 901-975.

[0594] Embodiment A65. Embodiments A1-A, which include YA modification of one or more guide region YA parts. gRNA listed in any one of the 64.

[0595] Embodiment A66. Includes YA modification, wherein the modification is 2'-fluoro, 2'-H, 2'-OMe Any of Embodiments A1 to A65, including ENA, UNA, inosine, or PS modification. gRNA listed in one entry.

[0596] Embodiment A67. Embodiment A1, which includes YA modification in one or more storage region YA sites. gRNA listed in any one of the ~A66 sections.

[0597] Embodiment A68. At least one modified YA site is (i) 2'-OMe modification, optional 2'-OMe modification of pyrimidine at the YA site, (ii) 2'-Fluoro modification, optional modification of the pyrimidine at the YA site Modification, and / or (iii) PS modification, optionally including PS modification of the pyrimidine at the YA site, in practice form gRNA described in one of the states A1 to A67.

[0598] Embodiment A69. LNP containing the gRNA described in any one of Embodiments A1 to A68 composition.

[0599] Embodiment A70. Any of Embodiments A1 to A68 associated with lipid nanoparticles (LNPs). A composition containing the gRNA described in one of the following.

[0600] Embodiment A71. Further comprising a nuclease or mRNA encoding a nuclease , gRNA described in any one of embodiments A1 to A68 or embodiment A69 or A composition comprising the composition described in A70.

[0601] Embodiment A72. The embodiment described in Embodiment A71, wherein the nuclease is a Cas protein. composition.

[0602] Embodiment A73. The composition according to Embodiment A72, wherein the Cas protein is Cas9. thing.

[0603] Embodiment A74.Cas9 is S.pyogenes Cas9 or S.aureu The composition according to embodiment A73, wherein s Cas9.

[0604] Embodiment A75. Embodiment A71, in which the nuclease is nicasse or dCas. A composition as described in any one of the following ~A74.

[0605] Embodiment A76. Any of Embodiments A71 to A75, in which the nuclease is modified. The composition described in one.

[0606] Embodiment A77. The modified nuclease includes a nuclear localization signal (NLS), The composition described in A76.

[0607] Embodiment A78. Embodiments A71-A77, comprising mRNA encoding a nuclease. A composition as described in any one of the following.

[0608] Embodiment A79. mRNA is sequence numbers 1099-1127 or 1129-1146 The composition according to Embodiment A78, comprising any one of the following sequences.

[0609] Embodiment A80. gRNA or embodiment described in any one of Embodiments A1 to A68 A composition comprising any one of A69 to A79 and a pharmaceutically acceptable carrier, Pharmaceutical preparations.

[0610] Embodiment A81. A method for modifying target DNA, wherein Cas protein or Cas Nucleic acids that code for proteins, and i. gRNA described in any one of embodiments A1 to A68, ii. The composition described in any one of Embodiments A69 to A79, and iii. Delivering one or more of the pharmaceutical formulations of Embodiment A80 to cells. A method for modifying target DNA, including [specific component / method].

[0611] Embodiment A82. A method which results in an insertion or deletion in a gene, as in Embodiment A81. Method of description.

[0612] Embodiment A83 further comprises delivering a template to a cell, wherein at least a portion of the template is Target DN at or near the double-strand break site induced by the Cas protein The method described in implementation A81 or A82, which is incorporated into A.

[0613] Embodiment A84. For use in the preparation of pharmaceuticals for the treatment of a disease or disorder, gRNA described in any one of morphologies A1 to A68, and the set described in embodiments A69 to A79. A product, or a pharmaceutical formulation as described in Embodiment A80.

[0614] Embodiment A85. Embodiment A1 in the manufacture of a pharmaceutical product for treating a disease or disorder. gRNA as described in any one of ~A68, the composition as described in Embodiments A69~A79, Or use of the pharmaceutical preparation described in Embodiment A80. [Brief explanation of the drawing]

[0615] [Figure 1A]An exemplary sgRNA (SEQ ID NO: 801, methylation not shown) in a possible secondary structure having labels indicating the individual nucleotides of the conserved region of the sgRNA, including the lower stem, bulge, upper stem, nexus (whose nucleotides can be designated N1-N18 in the 5'-3' direction, respectively), and hairpin regions including hairpin 1 and hairpin 2. The nucleotides between hairpin 1 and hairpin 2 are labeled with n. A guide region may be present on the sgRNA and is shown in this figure as "(N)x" before the conserved region of the sgRNA. [Figure 1B] This shows an exemplary sgRNA constant region sequence in a possible secondary structure (SEQ ID NO: 802), which includes a guide sequence of 20 nucleotides represented as N20. [Figure 1C] Ten conserved YA regions in an exemplary sgRNA sequence (SEQ ID NO: 801, methylation not shown) are labeled with numbers 1 to 10. The numbers 25, 45, 50, 56, 64, 67, and 83 indicate the pyrimidine positions of YA regions 1, 5, 6, 7, 8, 9, and 10 in the sgRNA having a guide region indicated as (N)x, where x is, for example, 20 by choice. [Figure 2] This shows the editing frequency of a series of deletions in the indicated guide in primary cynomolgus monkey hepatocytes (PCH). [Figure 3A] This shows dose-response curves for edited % results from experiments in which short guides were delivered in vitro to primary cynomolgus monkey hepatocytes (PCH) using lipofection. [Figure 3B] This shows dose-response curves for edited % results from experiments in which short guides were delivered in vitro to primary cynomolgus monkey hepatocytes (PCH) using lipofection. [Figure 4A] This shows edited dose-response curves for experiments in which short guides were delivered in vitro to primary mouse hepatocytes (PMH) using LNPs. [Figure 4B] This shows edited dose-response curves for experiments in which short guides were delivered in vitro to primary mouse hepatocytes (PMH) using LNPs. [Figure 5A]The edited dose-response curves show the results of experiments in which short guides using LNPs were delivered in vitro to primary cynomolgus monkey hepatocytes (PCH). [Figure 5B] The edited dose-response curves show the results of experiments in which short guides using LNPs were delivered in vitro to primary cynomolgus monkey hepatocytes (PCH). [Figure 5C] This shows dose-response curves for edited % results from experiments in which short guides were delivered in vitro to primary mouse hepatocytes (PMH) using LNPs. [Figure 5D] This shows dose-response curves for edited % results from experiments in which short guides were delivered in vitro to primary mouse hepatocytes (PMH) using LNPs. [Figure 5E] This shows dose-response curves for edited % results from experiments in which short guides using LNPs were delivered in vitro to primary cynomolgus monkey hepatocytes (PCH). [Figure 5F] This shows dose-response curves for edited % results from experiments in which short guides using LNPs were delivered in vitro to primary cynomolgus monkey hepatocytes (PCH). [Figure 6A] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 6B] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 7A] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 7B] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 8A] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 8B] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 9A] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 9B] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 10A] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 10B] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 11A] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 11B] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 12A] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Figure 12B] The in vivo edited % and serum TTR results for the guide shown are presented, respectively. [Modes for carrying out the invention]

[0616] Modified guide RNA (gRNA) for use in gene editing methods is provided herein. The sequences of the manipulated and tested gRNAs are shown in Table 1A.

[0617] Certain of the gRNAs provided herein are intended for use in gene editing methods. This is a modified dual guide RNA (dgRNA). The dgRN was manipulated and tested. The sequence of A is shown in Table 1. Certain dgRNAs are crRNAs and / or t It has specific modifications at the YA site in dgRNA, including modifications in rRNA.

[0618] Certain of the gRNAs provided herein are intended for use in gene editing methods. This is a modified single guide RNA (sgRNA). The sgRNAs that were manipulated and tested were... The columns are shown in Table 1. Certain sgRNAs are defined as having the crRNA portion of the sgRNA and / or modifications in the trRNA portion of sgRNA, including modifications in the YA region of sgRNA. It has a specific modifier.

[0619] This disclosure applies in vitro (e.g., in ex vivo therapy or other uses of gene-edited cells) Cells cultured in vitro for use (or cells in a human or other subject, e.g.) These are used to alter the genome of target nucleic acids (for use in in vivo therapy). Further provides the use of gRNA (e.g., sgRNA, dgRNA, or crRNA). do. [Table 1A] JPEG2026048746000003.jpg224149JPEG2026048746000004.jpg224149JPEG2026048746000005.jpg224146JPEG2026048746000006.jpg225147JPEG2026048746000007.jpg223146JPEG2026048746000008.jpg225151JPEG2026048746000009.jpg225152JPEG2026048746000010.jpg220151JPEG2026048746000011.jpg224147JPEG2026048746000012.jpg219150JPEG2026048746000013.jpg225149JPEG2026048746000014.jpg221149JPEG2026048746000015.jpg223151JPEG2026048746000016.jpg225149JPEG2026048746000017.jpg225146JPEG2026048746000018.jpg223148JPEG2026048746000019.jpg224147JPEG2026048746000020.jpg224146JPEG2026048746000021.jpg225147JPEG2026048746000022.jpg225148JPEG2026048746000023.jpg224145JPEG2026048746000024.jpg227149JPEG2026048746000025.jpg226151JPEG2026048746000026.jpg221155JPEG2026048746000027.jpg226151JPEG2026048746000028.jpg226147JPEG2026048746000029.jpg225148JPEG2026048746000030.jpg224150JPEG2026048746000031.jpg226149JPEG2026048746000032.jpg228149JPEG2026048746000033.jpg226149JPEG2026048746000034.jpg229149JPEG2026048746000035.jpg225152JPEG2026048746000036.jpg224154JPEG2026048746000037.jpg227151JPEG2026 048746000038.jpg230147JPEG2026048746000039.jpg227153JPEG2026048746000040.jpg22 4151JPEG2026048746000041.jpg229151JPEG2026048746000042.jpg226151JPEG202604874 6000043.jpg222157JPEG2026048746000044.jpg224156JPEG2026048746000045.jpg229154.

[0620] In Table 1A, (N) x The symbol represents x consecutive nucleotides, where x is 5, 6, 7. , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25. (mN*)3 is any base, 2'-OMe, and three consecutive nucleotides, each having a 3'PS bond to the adjacent nucleotide. Represents "do". N 17 and N 20 These are 17 and 20 consecutive N(any Nu) This represents a creotide. The "C-" added to the guide identification number indicates that the conserved portion of the sgRNA is not present. show.

[0621] Nucleotide modifications are shown in Table 1A below: m: 2'-OMe; *: PS bond; f :2'-Fluoro;(invd):Inverted debase;moe:2'-moe;e:ENA d: Deoxyribonucleotide (T is always a deoxyribonucleotide) Also note);x:UNA. Therefore, for example, mA is 2'-O-methyladeno xA represents a UNA nucleotide having an adenine nucleic acid base, and eA represents an adenine nucleic acid base. ENA represents a nucleotide containing a denine nucleic acid base, where dA is adenosine deoxyribonuclear It represents creotide. [Table 1B] JPEG2026048746000047.jpg224147JPEG2026048746000048.jpg222147JPEG2026048746000049.jpg223145JPEG2026048746000050.jpg224148JPEG2026048746000051.jpg226149JPEG2026048746000052.jpg223148JPEG2026048746000053.jpg223147JPEG2026048746000054.jpg226148JPEG2026048746000055.jpg222147JPEG2026048746000056.jpg227146JPEG2026048746000057.jpg222146JPEG2026048746000058.jpg225147JPEG2026048746000059.jpg224148JPEG2026048746000060.jpg225149JPEG2026048746000061.jpg224146JPEG2026048746000062.jpg224146JPEG2026048746000063.jpg223148JPEG2026048746000064.jpg225150JPEG2026048746000065.jpg225149JPEG2026048746000066.jpg223149JPEG2026048746000067.jpg232148JPEG2026048746000068.jpg225147JPEG2026048746000069.jpg225148JPEG2026048746000070.jpg223151JPEG2026048746000071.jpg225146JPEG2026048746000072.jpg224147JPEG2026048746000073.jpg224147JPEG2026048746000074.jpg223151JPEG2026048746000075.jpg221147JPEG2026048746000076.jpg224146JPEG2026048746000077.jpg224145JPEG2026048746000078.jpg224146JPEG2026048746000079.jpg225145JPEG2026048746000080.jpg222148JPEG2026048746000081.jpg231149JPEG2026048746000082.jpg225147JPEG2026048746000083.jpg223148JPEG2026048746000084.jpg224147JPEG2026048746000085.jpg221146JPEG2026048746000086.jpg222145JPEG2026048746000087.jpg222148JPEG2026048746000088.jpg224146JPEG2026048746000089.jpg226147JPEG2026048746000090.jpg221145JPEG2026048746000091.jpg226145JPEG2026048746000092.jpg223147JPEG2026048746000093.jpg221145JPEG2026048746000094.jpg226148JPEG2026048746000095.jpg225148JPEG2026048746000096.jpg226149JPEG2026048746000097.jpg224148JPEG2026048746000098.jpg223146JPEG2026048746000099.jpg225148JPEG2026048746000100.jpg226144JPEG2026048746000101.jpg230150JPEG2026048746000102.jpg226147JPEG2026048746000103.jpg222146JPEG2026048746000104.jpg228152JPEG2026048746000105.jpg223151JPEG2026048746000106.jpg223148JPEG2026048746000107.jpg223148JPEG2026048746000108.jpg225147JPEG2026048746000109.jpg226150JPEG2026048746000110.jpg222145JPEG2026048746000111.jpg225149JPEG2026048746000112.jpg224145JPEG2026048746000113.jpg224148JPEG2026048746000114.jpg226148JPEG2026048746000115.jpg22 5146JPEG2026048746000116.jpg221145JPEG2026048746000117.jpg227150JPEG2026048746000118.jpg232146.

[0622] The sgRNA specification may be provided with one or more preceding zeros immediately after the G. This does not affect the meaning of the designation. Therefore, for example, G000282, G0 282, G00282, and G282 refer to the same sgRNA. Similarly, crRNA The designation of and / or trRNA is preceded by one or more preceding characters immediately after the CR or TR, respectively. It may be provided using zero, which does not affect the meaning of the specification. For example, CR000100, CR00100, CR0100, and CR100 are , referring to the same crRNA, TR000200, TR00200, TR0200, and T R200 refers to the same trRNA.

[0623] For sequence numbers 201-294 and 301-394, the guide region is not indicated, and the rest The positions corresponding to the region are given for sequence numbers 1-90 and 101-190. In comparison, the sequence numbers 1-90, 695-698, 101-190, and The length of the guide array in 795-798 is reduced by the same amount (usually not necessarily 20). Yes. For sequence numbers 401-494 and 501-594, the spacer is 3+x This represents the length, and the positions corresponding to the remaining areas are, respectively, sequence numbers 1-90 and 101-190. , and compared with those given for 795-798, respectively, SEQ ID NOs. 1-9 Only the length of the guide arrays 0, 695-698, 101-190, and 795-798 ( Typically, the number decreases (not necessarily 20) and increases by 3+x.

[0624] definition In this specification, the terms "editing efficiency," "editing percentage," or "editing percentage" are used in a different sense. "Tent" is the target value relative to the total number of sequence reads after cleavage by Cas RNP. This is the total number of sequence reads that contain nucleotide insertions or deletions in a target region.

[0625] As used herein, “region” refers to a conserved group of nucleic acid. It can also be called a "domain" or "rune". The region of sgRNA is, for example, Briner AE et al., Molecular Cell 56:333-339(201 As described in 4), it has certain functions such as inducing the endonuclease activity of RNP. This is possible. Exemplary sgRNA regions are shown in Table 3.

[0626] As used herein, a "hairpin" is a structure in which a nucleic acid chain is folded and base pairs with another section of the same chain. This describes the double strands of nucleic acid produced when forming a hairpin. A hairpin is a loop or U-shaped It can form a structure that includes. In some embodiments, the hairpin is composed of RNA loops. It is possible. A hairpin is a single molecule that involves folding or wrinkling. It can be formed by two complementary sequences in nucleic acid molecule binding. Several implementations In this context, a hairpin includes a stem or stem-loop structure. The "hairpin region" refers to hairpin 1 and hairpin 2, as well as the conserved portion of sgRNA. This refers to the "n" between hairpin 1 and hairpin 2.

[0627] As used herein, “ribonucleoprotein” (RNP) or “RNP complex” refers to, for example, For example, sgRNA is described in conjunction with nucleases such as Cas proteins. In the application morphology, RNPs are Cas9 and gRNA (e.g., sgRNA, dgRNA, etc.) It includes (or crRNA).

[0628] As used herein, a “stem-loop” terminates in a loop of unpaired nucleic acid. Secondary nucleotides that form a base-paired "stem" Let's explain the structure. When two regions of the same nucleic acid chain are read in opposite directions, there is a small difference in the sequence. A stem can be formed if it is not present but partially complementary. "Pu" is a base pair that does not contain (i.e., is not complementary to) a stem that can capp a stem. This explains the region of a creotide. "Tetraloop" describes a loop of four nucleotides. When used herein, the upper stem of sgRNA may include a tetraloop.

[0629] With respect to polynucleotides, the terms "substituted" or "substituted" as used herein refer to the Watts This refers to the modification of nucleic acid bases that alters the preferred base for Sonn-Crick pair formation. If a particular region of RNA is "unsubstituted" as used herein, the sequence of the region is GA SpyCas9 sgRNAs that have only matching and matching (i.e., no mismatches) It can be aligned to the corresponding conserved portion sequence of (SEQ ID NO: 400), and the base is wa The same preferred standard partner base (A, C, G, or) for Toson-Crick pair formation. If it has T / U, it is considered a match.

[0630] "Guide RNA," "gRNA," and "guide" refer to crRNA (CRISPR (also known as RNA), or a combination of crRNA and trRNA (tra (Also known as crRNA) Used interchangeably in this specification crRNA and trRNA are single-stranded RNA molecules (single guide RNA, sgR). It can associate as NA, or as two separate RNA molecules (dual guide RNA, d It can associate with gRNA. "Guide RNA" or "gRNA" refers to each type. trRNA is either a naturally occurring sequence or a modified or altered sequence compared to a naturally occurring sequence. This can be a diverse trRNA sequence. The guide RNA is as described herein. It may contain modified RNA.

[0631] In some embodiments, gRNA (e.g., sgRNA) is, for example, sgRNA Regarding (however, applicable to all guide RNAs in this specification) Brin er AE et al.,Molecular Cell 56:333-339(2 As in 014), it may be referred to as a "spacer" or "spacer area". It includes a "guide region". The guide region or spacer region is also called a "variable region" or "ga It is sometimes referred to as the "targeting domain" or "targeting domain." Several implementations In this state, the "guide region" is located at its 5' end, immediately before the "sgRNA conserved region". In some embodiments, the sgRNA is shortened. An example is the "sgRNA storage region". Table 2 shows the "minutes". In some embodiments, the "guide region" is the crRNA It contains a series of nucleotides at the 5' end. In some embodiments, the guide region is It includes one or more YA sites ("guide region YA sites"). In some embodiments, the guide The guide region is located at a given nucleotide position relative to the end of the guide region from the 5' end. Includes one or more YA sites. The range of such locations is, for example, "5' end of 5' end". These are called the 5-terminus, 6-terminus, 7-terminus, 8-terminus, 9-terminus, or 10-terminus from the 5-terminus, and the 5-terminus In this context, "terminus," etc., refers to most of the 3' nucleotides in the guide region. (Similarly) Expressions such as "the nucleotide 21 end of gRNA" refer to the 5' end of the gRNA. The range from the 21st nucleotide to the last nucleotide at the 3' end of the gRNA (This refers to the area.) Furthermore, for example, six nuclei from the 5' end of a particular sgRNA segment. The nucleotide that is the ocid is the sixth nucleotide of that segment, or the 5' end. "Nucleotide 6" from, for example, XXXXXN, where N is the 6th from the 5' end. It is a nucleotide. A nucleotide located "before" or "after" the 6 nucleotides from the 5' end. The rheotide range begins at the 6th nucleotide and continues down the chain toward the 3' end. Similarly, for example, a nucleotide that is the 5 nucleotides from the 3' end of a chain is the 3' end of a chain. The fifth nucleotide when counting from the end, for example, NXXXX. Guide region The position or range of the number inside is determined from the 5' end unless a different reference point is specified. This refers to the position where the nucleotide is located; for example, "nucleotide 5" in the guide region is the 5th nucleotide from the 5' end. It is a nucleotide of the eye.

[0632] In some embodiments, the gRNA is the corresponding or marker of the gRNA described herein. It contains nucleotides that "match the modification pattern" of the defined nucleotide. This means that nucleotides that match the modification pattern have matching nucleic acid bases at their respective positions. Regardless of whether or not, the nucleoty at the corresponding position of the gRNA described herein It has the same modifications as D (e.g., phosphorothioate, 2'-fluoro, 2'-OMe, etc.) This means that, for example, in the first gRNA, nucleotides 5 and 6 are If it has 2'-OMe and phosphorothioate modifications, this gRNA has a 5-position and Whether the nucleic acid base at position 6 is the same or different in the first and second gRNAs However, 2'-OMe and phosphorothioe remain at nucleotides 5 and 6, respectively. The second gRNA, which also has nucleotide modifications, exhibits the same modification pattern at nucleotides 5 and 6. It possesses. However, it is present in nucleotide 6, but not in nucleotide 7, which is 2'- OMe modification occurs at nucleotide 7, but not at nucleotide 6. Thus, the modification patterns in nucleotides 6 and 7 are not the same. Similarly, according to this specification, Modification patterns that match at least 75% of the gRNA modification patterns described are: At least 75% of the creotides have the same modifications as the corresponding gRNAs described herein. It means having. The corresponding positions are determined by pairwise or structural alignment. It can be decided.

[0633] S. pyogenes Cas9 (also known as "spyCas9" or "spCas9") The "conserved region" of )) is shown in Table 2. The first row shows the nucleotide numbering. The second row shows the array (for example, array index 400), and the third row shows the region.

[0634] As used herein, the “shortened” region in gRNA is defined as the conservation shown in Table 2. Compared to the corresponding region in the remaining portion, g lacks at least one nucleotide. It is a region within the conserved part of RNA. Similarly, with respect to sgRNA, "shortened" means Furthermore, the conserved region contains fewer nucleotides than the sgRNA conserved region shown in Table 2. This means that, in any situation, "shortened" refers to the gRNA production process. This does not imply any specific limitations on the method or technique. So, the gRNA contains a shortened hairpin 1 region, (i) shortened hairpin 1 region However, it lacks 6 to 8 nucleotides, and (A)H1-1, H1-2, or position H One or more of 1-3 are deleted or substituted for sequence number 400, and / or (B) one or more of positions H1-6 to 1-10 are placed relative to sequence number 400 (ii) The hairpin 1 region has been replaced or shortened, H1-1 and / or It is missing 9-10 nucleotides including H1-12, or (iii) shortened The hairpin region lacks 5 to 10 nucleotides, at position N18, H1-1 One or more of 2 or N are substituted for sequence number 400 (see Table 2). (See image). In some embodiments, non-spyCas9 gRNA has 6-8 nucleotides. Includes a shortened hairpin 1 region lacking a do, for example, pairwise or structurally aligned. Determined by the comment, H1-1, H1-2, or H1- in sequence number 400 One or more positions corresponding to 3 are missing or replaced, for example, pairwise or structural Alignment determines H1-6 to H1-10 in sequence number 400 One or more corresponding positions are replaced. In some embodiments, non-spyCas9 gRNAs are determined, for example, by pairwise or structural alignment, SEQ ID NOs. 9-1 containing nucleotides corresponding to H1-1 and / or H1-12 in 400 Includes a shortened hairpin 1 region lacking 0 nucleotides. Several embodiments So, non-spyCas9 gRNA is shortened, lacking 5-10 nucleotides. Includes a hairpin 1 region, determined, for example, by pairwise or structural alignment. If one or more positions in sequence number 400 correspond to N18, H1-12, or N It is substituted. In some embodiments, the gRNA includes a shortened upper stem region. Furthermore, the shortened upper stem region lacks 1 to 6 nucleotides.

[0635] As used herein, “YA site” means 5'-pyrimidine-adenine-3'-dinu This refers to a creotide. For clarification, in the original sequence modified by modifying the base... The "YA site" remains, regardless of the absence of the literal YA dinucleotide, The (modified) YA region in the resulting sequence is considered to be sg. It is located within the conserved region of RNA. The "guide region YA site" is located within the guide region of sgRNA. It is located in sgRNA. The unmodified YA site is an RNase-A-like endonucleus. For example, it may be susceptible to cleavage by RNase A. In some embodiments, The gRNA contains approximately 10 YA sites in its conserved region. In some embodiments, s gRNA contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 Y-cells within its conserved region. Includes area A. An example of the conserved area YA is shown in Figure 1B. The guide area is any number of Y Since it can be any sequence including site A, an exemplary guide region YA is shown in Figure 1C. In some embodiments, the sgRNA is located at the YA site shown in Figure 1C. Includes 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, sgRNA is found at the following positions or subsets, 1, 2, 3, 4, 5, 6, 7 , including 8, 9, or 10 YA sites. LS5-LS6, US3-US4, US9~ US10, US12-B3, LS7-LS8, LS12-N1, N6-N7, N14-N 15, N17-N18, and H2-2~H2-3. In some embodiments, YA portion. This is determined, for example, by pairwise or structural alignment, for example, sequence number For No. 400, LS6, LS7, US3, US10, B3, N7, N15, N17, H Substitutions include one or more of 2-2 and H2-14, and substitutional nucleos Tide is neither a pyrimidine followed by adenine, nor an adenidine with a pyrimidine preceding it. Not either (therefore, the substitution site is not part of the YA site). Several embodiments Therefore, the YA site contains modifications, which are at least one nucleotide within the YA site. This means that the pyrimidine (py) at the YA site is modified. In some embodiments, the pyrimidine (py) at the YA site is modified. The limidine position (also called the limidine position) is a modification (the internucleoside linkage immediately 3' of the sugar in the pyrimidine). Includes modifications that alter the bond. In some embodiments, adenine (A) of the YA site The denine position (also called the denine position) is a modification (the nucleoside linkage immediately 3' of the sugar in adenine). (including modifications that alter the position of the YA site) The adenine position includes modifications. In some embodiments, the gR described herein The NA guide region or gRNA-conserved region contains one or more YA sites ("guide region YA sites"). or includes “storage region YA site”). In some embodiments, the cr described herein RNA or trRNA contains one or more YA sites.

[0636] As discussed herein, the nucleotides described for spyCas9 gRNA The position of the nucleotide corresponding to the sequence is determined by pairwise or structural alignment. It may be identified in other gRNAs with structural similarity. This is useful when molecules share similar structures despite significant sequence variations. For example, spyCas9 and Staphylococcus aureus Cas 9 ("SaCas9") has a different sequence but exhibits significant structural alignment. For example, Nishimasu et al., Cell 162(5):1113-1 See Figure 2(F) in 126(2015). Structural alignment was performed using spyCas9. The conserved region of sgRNA (e.g., sequence number 400) is at positions H1-1, H1-2, or H1-3, positions H1-6~H1-10, position H1-12, or position N18 or N Which nucleotide in saCas9 or other sgRNA corresponds to which specific position? It can be used for identification (see Table 2).

[0637] Structural alignment involves (i) using the known structure of the second sequence to determine the structure of the first sequence. (ii) Modeling, or (ii) comparing the structures of the first and second sequences, both of which are known. This allows for the identification of corresponding residues across two (or more) sequences. , as well as the residue in the first sequence that is in the position most similar to the target residue in the second sequence. This involves determining the position of the corresponding residue in the stacked structure (e.g., polynucleotide). In rheotides, the 1st position of the nucleic acid base or the 1' carbon of the pentose ring, or in polypeptides, the α Minimizing the distance between carbon atoms (for example, which pair of positions have the minimum mean two for alignment) It is identified in several algorithms based on whether it provides a multiplier deviation. In non-spyCas9 gRNA, the position corresponding to the position described for Cas9 gRNA is When identifying the location, the spyCas9 gRNA may be a "second" sequence. Non-spyCas9 gRNAs do not have a known structure that is available, but they do have a known structure. If it is more closely associated with another non-spyCas9 gRNA, then closely associated non-spyC We modeled the desired non-spyCas9 gRNA using the known structure of as9 gRNA. Next, the model is compared to the spyCas9 gRNA structure to identify the desired non-spyC Identifying the desired corresponding residue in the as9 gRNA may be the most effective approach. There is a wide range of literature on protein structural modeling and alignment, and representative The disclosures include US6859736, US8738343, and Aslam et al. .,Electronic Journal of Biotechnology 20 This includes references in (2016) 9-13. Structure based on known related structures. For a discussion of the modeling, see, for example, Bordoli et al., Nature. Refer to Protocols 4(2009)1-13 and the references cited therein. Regarding illumination. Regarding nucleic acid alignment, see Nishimasu et al., Cel. See also Figure 2(F) in l 162(5):1113-1126(2015).

[0638] As used herein, “target sequence” refers to a guide region that allows a nuclease to cleave. This refers to the sequence of nucleic acids to induce. In some embodiments, the spyCas9 protein is used to induce Nucleotides present in the id region can guide the target sequence via the guide region. In some embodiments, the sgRNA does not include a spacer region.

[0639] As used herein, "5' end" refers to the first nucleus of gRNA (dgRNA). Otide (typically the 5' end of the crRNA of dgRNA), and the 5' position is another nu It is not bound to the creotide.

[0640] As used herein, "5'-terminus modification" refers to one to approximately seven modifications at the 5' end. gRNA containing a guide region having modifications in one or more of its nucleotides Then, by arbitrary selection, the first nucleotide (from the 5' end) of the gRNA is modified. It refers to gRNA.

[0641] As used herein, "3' end" means that the 3' position is bonded to another nucleotide. It refers to the terminal or terminal nucleotide of gRNA, not the terminal nucleotide. In some embodiments, 3 The end is located at the 3' tail. In some embodiments, the 3' end is the conserved portion of the gRNA. It's in minutes.

[0642] As used herein, "3'-terminus modification" refers to the modification of one to approximately seven nuclei at the 3' end. gRNA having modifications in one or more creotides, which can be optionally selected The last nucleotide of the gRNA (i.e., the nucleotide closest to the 3' end) is modified. This refers to gRNA. If a 3' tail is present, 1 to approximately 7 nucleotides are located on the 3' tail. It can be found within the sgRNA. If the 3' tail is absent, 1 to approximately 7 nucleotides are present in the sgRNA. It may be located within the storage portion.

[0643] "Last," "Second to last," "Third to last," etc., in a given sequence, each This refers to the nucleotide closest to the 3' end, the second from the 3' end, the third from the 3' end, and so on. For example, in sequence 5'-AAACTG-3', the last, second to last, and last The third nucleotides are G, T, and C, respectively. The term "nucleotide" refers to the last, second-to-last, and third-to-last nucleotides. More generally, "the last N nucleotides" refers to the last to the Nth nucleotides. This refers to the nucleotide (including the one at the 3' end). "The third nucleotide from the 3' end of the 3' end." This is equivalent to the "last third nucleotide". Similarly, the "3 from the 5' end of the 5' end" The "third nucleotide" is equal to the "third nucleotide at the 5' end".

[0644] As used herein, "protective end modification" (protective 5' end modification or protective 3' end modification) (Decoration etc.) reduces the degradation of sgRNA, for example, exonuclease degradation of sgRNA. This refers to modifications of one or more nucleotides within the last seven nucleotides. Several implementation forms In this state, protective end modifications occur in at least two of the seven nucleotides at the end of the sgRNA. or includes modifications of at least three nucleotides. In some embodiments, the modifications are Sulfrothioate bond, 2' modification, e.g., 2'-OMe or 2'-fluoro, 2' -Includes H(DNA), ENA, UNA, or combinations thereof. Several implementation forms In this state, modifications include phosphorothioate bonds and 2'-OMe modifications. In the application form, at least three terminal nucleotides are linked, for example, by phosphorothioate bonds. Alternatively, it is modified by a combination of phosphorothioate bonds and 2'-OMe modifications. Modifications that reduce exonuclease degradation, as known to those skilled in the art, are included.

[0645] In some embodiments, the "3' tail" containing 1 to about 20 nucleotides is This is followed by the conserved portion of the sgRNA at the 3' end.

[0646] As used herein, "RNA guide DNA binder" refers to an RNA and DNA binder. Polypeptides or polypeptide complexes having synactivation, or such complexes This refers to the DNA-binding subunit, and its DNA-binding activity is sequence-specific, and is linked to the RNA sequence. It depends on [something]. An example of an RNA guide DNA binding agent is Cas cleava This includes nickase (se) / and its inactivated forms (dCas DNA binding agents). The "Cas nuclease," also referred to as the "Cas protein" in this specification, This includes Cas cribase, Cas nickase, and dCas DNA binding agents. as CRISPR / Nickase and dCas DNA binding agents include type III CRISPR The Csm or Cmr complex, Cas10, Csm1, or its Cmr2 subunit T, the cascade complex of type I CRISPR systems, its Cas3 subunit and class 2 Contains Cas nuclease. When used herein, "Class 2 Cas nuclease" "-ase" refers to RNA-guided DNA such as Cas9 nuclease or Cpf1 nuclease. It is a single-chain polypeptide with A-binding activity. Class 2Cas nucleases include RN A-guided DNA cribase or nickase activity further possesses class 2 Cas criba ZE and Class 2 Cas NICK ZE (e.g., H840A, D10A, or N863A) Variants, as well as Class 2d in which cribase / nickase activity is inactivated. It contains a Cas DNA binding agent. Class 2 Cas nucleases include, for example, Cas9 , Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R (661A, Q695A, Q926A variants), HypaCas9 (e.g., N692) A, M694A, Q695A, H698A variants), eSPCas9(1.0)(example) For example, K810A, K1003A, R1060A variant), and eSPCas9 ( 1.1) (e.g., K848A, K1003A, R1060A variants) proteins, This includes the Cpf1 protein, Zetsche et al. Cell, 163:1-13 (2015) is homologous to Cas9, and RuvC-like Nu Contains the crease domain. Zetsche's Cpf1 sequence is the whole of them by reference. This is incorporated. For example, see tables S1 and S3 of Zetsche. "Cas9" is, Spy Cas9, the Cas9 variants listed herein, and their equivalents It includes, for example, Makarova et al., Nat Rev Microb iol,13(11):722-36(2015), Shmakov et al.,M See olecular Cell, 60:385-397 (2015).

[0647] When used herein, the alignment of the first sequence with respect to the second sequence, If it is shown that more than X% of the positions of the second sequence are matched by the first sequence. The first sequence is considered to "contain a sequence that has at least X% identity with the second sequence." For example, sequence AAGA contains a sequence that is 100% identical to sequence AAG, The reason is that the alignment matches at all three positions of the second arrangement. This is because it gives 100% identity in that respect. The difference between RNA and DNA (generally, The exchange of uridine (or vice versa), and nucleosynium such as modified uridine. The presence of analogues indicates the presence of related nucleotides (thymidine, uridine, or modified uridine, etc.). ) for all of the same complements (e.g., thymidine, uridine, or modified uridine) Adenosine; another example is cytosine and 5-methylcytosine, both of which are complementary. As long as it has guanosine or modified guanosine as a body, between polynucleotides It does not contribute to the difference in identity or complementarity. Therefore, for example, if X is any of the modifiers Dins, for example, pseudouridine, N1-methylpseudridine, or 5-methoxy The uridine sequence 5'-AXG is completely complementary to the same sequence (5'-CAU). In this respect, it is considered 100% identical to AUG. Exemplary alignment The algorithm is well known in the field of the Smith-Waterman method and This is the Needleman-Wunsch algorithm. A person skilled in the art will be able to align... For a given pair of arrays, what algorithm and parameter settings are appropriate? They will understand that it is cut. Generally, similar lengths and expected identity are ami Regarding ano acids, more than 50% of the sequence, or nucleotides, more than 75% of the sequence. Needlem, provided by EBI on the www.ebi.ac.uk web server. Needl using the default settings of the an-Wunsch algorithm interface The eman-Wunsch algorithm is generally appropriate.

[0648] "mRNA" is RNA or modified RNA that can be translated into polypeptides. (i.e., as a substrate for translation by ribosomes and aminoacylated tRNA) (Can function) Refers to polynucleotides containing an open reading frame. mRNA is used herein for the purpose of defining ribose residues or their analogues, e.g., 2'- It may contain a phosphate sugar skeleton including a methoxyribose residue. In this context, the sugar in the nucleic acid phosphate sugar backbone is a ribose residue, a 2'-methoxyribose residue, or It essentially consists of combinations of these. Generally, mRNA is essentially composed of a substantial amount of thymidine residues. (For example, 0 residues or 30, 20, 10, 5, 4, 3, or less than 2 thymids) n residues; or 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1% It does not contain mRNA (thymidine content of less than 0.5%, 0.2%, or 0.1%). It may contain modified uridines in some or all of its uridine positions.

[0649] As used herein, the “minimum uridine content” of a given ORF means (a) all (b) Use the smallest uridine codon at the given position and the same amino acid sequence as the given ORF This is the uridine content of ORF, which is the minimum uridine code for a given amino acid. n is the codon with the least amount of uridine (the codon for phenylalanine) (Except for the ones that are usually 0 or 1, the smallest uridine codon has 2 uridines). Ornamental uridine residues are considered equivalent to uridine for the purpose of evaluating the minimum uridine content.

[0650] As used herein, the "minimum uridine dinucleotide content" of a given ORF is: (a) Use the smallest uridine codon at all positions (as described above), (b) given The smallest possible uridine dinucleotide of ORF that codes for the same amino acid sequence as ORF ( This is the UU content. The uridine dinucleotide (UU) content is the UU dinucleotide content in ORF. As a count of rheotides, or occupied by uridine in uridine dinucleotides As a proportion of a position, it can be expressed in absolute terms based on that proportion (for example, AUUAU has two of its five positions occupied by uridine in the uridine dinucleotide. (Because it is occupied, the uridine dinucleotide content is 40%). Modified uridine residue The group is considered equivalent to uridine for the purpose of evaluating the minimum uridine dinucleotide content. It will be done.

[0651] When used in this specification, the "minimum A" of a given open reading frame (ORF) "Denine content" is determined by (a) using the smallest adenine codon at all positions, and (b) at This is the adenine content of an ORF that encodes the same amino acid sequence as the given ORF. The smallest adenine codon of lysine is the codon with the least amount of adenine (lysine). Except for the codon for asparagine, the minimum adenine is typically 0 or 1. (The incodon has two adenines). Modified adenine residues are used to evaluate the minimum adenine content. It is considered equivalent to adenine for the purpose of [specific purpose].

[0652] When used in this specification, the "minimum A" of a given open reading frame (ORF) "Denin dinucleotide content" means (a) the smallest adenine codon at all positions (As described above), (b) an ORF that encodes the same amino acid sequence as the given ORF This is the minimum possible adenine dinucleotide (AA) content. A) The content is expressed as the count of AA dinucleotides in ORF, or as adenine dinucleotides As the proportion of the position occupied by adenine in rheotide, the absolute usage is based on the proportion. It can be expressed in words (for example, UAAUA has two of the five positions as Adeni Because it is dominated by the adenine dinucleotide, it contains adenine dinucleotide. The amount is 40%). Modified adenine residues are used to evaluate the minimum adenine dinucleotide content. It is considered equivalent to adenine for the purpose of [specific purpose].

[0653] As used herein, “subject” refers to any member of the animal kingdom. In the application form, "target" refers to a human being. In some embodiments, "target" refers to a non-human animal. It refers to an object. In some embodiments, “object” refers to a primate. The subjects include mammals, birds, reptiles, amphibians, fish, insects, and / or worms. , but not limited to these. In certain embodiments, the non-human subject is a mammal (e.g., Rodents, mice, rats, rabbits, monkeys, dogs, cats, sheep, cattle, primates, and In some embodiments, the subject is a transgenic animal, a genital. Genetically engineered animals and / or clones. A particular embodiment of the present invention In terms of form, the subject is an adult, adolescent, or infant. In some embodiments, the term " The terms "individual" or "patient" are used and are intended to be interchangeable with "subject."

[0654] Types of modifications described herein Guide RNAs that include modifications at various positions (e.g., sgRNA, dgRNA, and crRNA) is disclosed herein. In some embodiments, gRNA including modifications The position is modified by one or more of the following types of modifications:

[0655] 2'-O-methyl modification Modified sugars have oligonucleotide binding affinity to the complementary chain, double-chain formation, and nucleation. Nucleotide puckering is a physical property that affects interaction with enzymes. It is thought to control (puckering). Therefore, substitutions on the sugar ring are thought to control this The three-dimensional structure and puckering of these sugars can be altered. For example, 2'-O-methyl(2' -OMe) modification increases oligonucleotide binding affinity and nuclease stability. It is possible to do so, but as shown in the examples, at a given position in the oligonucleotide The effect of any given modification must be determined empirically.

[0656] The terms "mA", "mC", "mU", or "mG" are modified by 2'-OMe. It can be used to represent a nucleotide.

[0657] Ribonucleotides and modified 2'-O-methylribonucleotides are described as follows: It is possible. [ka]

[0658] 2'-O-(2-methoxyethyl) modification In some embodiments, the modification is 2'-O-(2-methoxyethyl)(2'-Om It may be (oe). The modified 2'-O-moe ribonucleotide can be described as follows: ru. [ka]

[0659] The terms "moeA", "moeC", "moeU", or "moeG" are: It can be used to represent nucleotides modified with 2'-O-moe.

[0660] 2'-Fluoromodification Another chemical modification that has been shown to affect nucleotide sugar rings is halogen substitution. Yes, for example, a 2'-fluoro(2'-F) substitution on a nucleotide sugar ring is an oligonucleotide. This can increase oxide binding affinity and nuclease stability.

[0661] In this application, the terms "fA", "fC", "fU", or "fG" are defined as 2' It can be used to represent nucleotides substituted with -F.

[0662] Ribonucleotides without 2'-F substitutions, and ribonucleos with 2'-F substitutions. Chido can be described as follows: [ka]

[0663] Phosphothioate modification A phosphorothioate (PS) linkage or bond is a sulfur Yellow indicates, for example, one non-crosslinked phosphate oxygen in a phosphodiester bond between nucleotides. This refers to a changeable bond. It's a place where oligonucleotides are generated using phosphorothioates. Compound and modified oligonucleotides can also be called S-oligonucleotides.

[0664] The asterisk "*" may be used to indicate PS modification. In this application, the terms A*, C*, U*, and Alternatively, G* is used to connect to an adjacent (e.g., 3') nucleotide via a PS bond. It can represent a creotide. Throughout this application, the PS modification is a phosphorus of the 3' carbon. They are grouped by the nucleotides bound to the thioate, and therefore the PS modification is at position 1. The fact that the phosphorothioate is located at the 3' carbon and second nucleus of nucleotide 1 This indicates that it is bonded to the 5' carbon of ocide. Therefore, the YA part When a position is indicated as "PS modified," the PS bond is between Y and A or adjacent to A. It is located between the nucleotides.

[0665] In this application, the terms "mA*", "mC*", "mU*", or "mG*" are defined as 2'- A PS bond that is replaced with OMe and may also be referred to as a "PS bond". (linkage) indicates a nucleotide that is linked to an adjacent (e.g., 3') nucleotide. It can be used for the purpose of. In this application, the terms "fA*", "fC*", "fU*", or " fG*, substituted with 2'-F, and connected to the adjacent (e.g., 3') nucleotide by a PS bond. Can be used to indicate linked nucleotides. PS linkage or bond Equivalents of the bond are encompassed by the embodiments described herein.

[0666] The diagram below shows the substitution of S- atoms for non-crosslinked phosphate oxygen, replacing the phosphodiester bond. PS bonds are formed: [ka]

[0667] Inverted debasement modification Debasic nucleotides refer to nucleotides that lack a nitrogenous base. The following diagram shows a nucleotide lacking a base. The debased portion is debased (in this case, shown as depurine). The debased portion is also depyriminated. This could be a din site, and the description of the debase site typically refers to the Watson-Crick base pair. Furthermore, a depurine site refers to a site lacking a nitrogenous base, and is typically a pyrimidine site. Describe an oligonucleotide that has a site (where it will form a base pair), and the base is furan. At the 1' position of the ring, another site (for example, a ribose or deoxyribose site) is formed. To obtain the desired result, it may be substituted with a hydroxyl group or hydrogen as shown below. [ka]

[0668] An inverted base refers to a base that has a linkage that is the reverse of the usual 5' to 3' linkage. That is, either a 5' to 5' link or a 3' to 3' link. For example, [ka]

[0669] Debasic nucleotides can be linked to inverted nucleotides. For example, debasic nuclei Otide may be attached to the terminal 5' nucleotide via a 5'-to-5' bond, or Debasic nucleotides may also be attached to the terminal 3' nucleotide via a 3'-to-3' bond. i. A debasalized nucleotide with either the terminal 5' or 3' nucleotide is It may also be referred to as an inverted debasement end cap. In this application, the term "invd" means , showing an inverted debasic nucleotide bond.

[0670] Deoxyribonucleotide Deoxyribonucleotides (where the sugar is located at the 2'-deoxy position) are nucleotides where the sugar is located at the 2' position. It is modified from standard RNA by proton substitution at the hydroxyl group. Therefore, in the context of gRNA, it is considered a modification. Unless otherwise indicated, unmodified RN Deoxyribonucleotide modification at the position of U in A also involves replacing the U nucleic acid base with T. It can include the ability to obtain.

[0671] Bicyclic ribose analogs Exemplary bicyclic ribose analogs include locked nucleic acid (LNA), ENA, and cross-linked nucleic acid (BN). A), or including another LNA-like modification. In some examples, the biring ribose analog is ri It has 2' and 4' positions connected via a linker. The linker is of formula -X-(CH2 )n -This may also be the case, where n is 1 or 2, and X is O, NR, or S. R is H or C 1-3 Alkyl, for example, methyl. Bicyclic ribose analogs Examples include LNAs containing a 2'-O-CH2-4' bicyclic structure (oxy-LNA). (See WO98 / 39352 and WO99 / 14226), 2'-NH-CH2 -4', or 2'-N(CH3)-CH2-4'(amino-LNA)(Singh e t al., J.Org.Chem.63:10035-10039(1998), Si ngh et al.,J.Org.Chem.63:6078-6079(1998) ), and 2'-S-CH2-4'(thio-LNA)(Singh et al. , J.Org.Chem.63:6078-6079(1998), Kumar et al. al.,Biorg.Med.Chem.Lett.8:2219-2222(1998 ))

[0672] ENA ENA modification refers to nucleotides that include 2'-O,4'-C-ethylene modification. An illustrative structure of a nucleotide is shown below, with wavy lines indicating connections to adjacent nucleotides. In some cases, if the 3' terminal nucleotide is an ENA nucleotide, the 3' position This indicates the terminal position, based on the understanding that it may contain hydroxyl rather than phosphate. ENA For further discussion of nucleotides, see, for example, Koizumi et al., Nu See Cleic Acids Res. 31:3267-3273 (2003). . [ka]

[0673] UNA UNA or unlocked nucleic acid modifications include nuclei containing 2',3'-seco-RNA modifications. This refers to an ocidal nucleotide, where the 2' and 3' carbon atoms are not directly bonded to each other. An exemplary structure is shown below. The wavy lines indicate connections to or replacement of adjacent phosphates. This indicates the (or possibly terminal) position of the UNA nucleotide. Further consideration of UNA nucleotides For example, see Snead et al., Molecular Therapy 2 See :e103,doi:10.1038 / mtna.2013.36(2013) thing. [ka]

[0674] Base modification Base modification includes isomerization (as in pseudouridine) of the structure of nucleic acid bases or This is any modification that alters the binding to the skeleton. In some embodiments, the base modification is Contains nosine. In some embodiments, the modification is, for example, the cleavage site by RNase By hindering recognition and / or accessibility of the cleavage site by RNase By stabilizing RNA structures (e.g., secondary structures) that reduce RNA enzymes, It contains base modifications that reduce donuclease activity. It can stabilize the RNA structure. Exemplary base modifications are pseudouridine and 5-methylcytosine. Peacoc Refer to k et al., J Org Chem. 76:7295-7300 (2011). Regarding illumination. In some embodiments, the base modification is, for example, to the Watson-Crick base pair. This is due to an increase in hydrogen bonds, the formation of non-canonical base pairs, or the creation of mismatched base pairs. This allows us to increase or decrease the melting temperature (Tm) of nucleic acids.

[0675] The above modifications and their equivalents are included within the scope of the embodiments described herein. .

[0676] YA modification Modifications at the YA site (also called YA modifications) involve modifications of nucleoside bonds and bases. Modification of (pyrimidine or adenine), e.g., by chemical modification, substitution or other means Modifications and / or sugar modifications (e.g., 2'-O-alkyl, 2'-F, 2'-moe (These are compounds at the 2' position, such as 2'-F arabinose and 2'-H (deoxyribose)) It is possible. In some embodiments, "YA modification" is, for example, modification of the YA site by RNase. By preventing recognition or cleavage, and / or the cleavage site to RNase By stabilizing RNA structures (e.g., secondary structures) that reduce access, RNA The role of altering the structure of the dinucleotide motif in order to reduce endonuclease activity. This is a modification of meaning. Peacock et al., J Org Chem. 76:729 5-7300(2011), Behlke, Oligonucleotides 18: 305-320(2008), Ku et al.,Adv.Drug Deliver y Reviews 104:16-28(2016), Ghidini et al. See Chem.Commun., 2013, 49, 9036. Peacock et al., Belhke, Ku, and Ghidini are suitable examples of YA modification. Provides a specific modification. Modifications known to those skilled in the art for reducing endonucleotide degradation are provided. It is included. An exemplary 2' that affects the 2' hydroxyl group involved in RNase cleavage. Ribose modifications include 2'-H and 2'-O-alkyl (including 2'-O-Me). The bicyclic ribose analog UNA of the residue at the YA site, and the ligation between modified nucleosides. Modifications such as these may be YA modifications. Exemplary bases that can stabilize RNA structure The modifications are pseudouridine and 5-methylcytosine. In some embodiments, At least one nucleotide of the YA site is modified. In some embodiments, The pyrimidine at the YA site (also called the "pyrimidine site") is modified (the sugar of the pyrimidine) Modifications that alter the nucleoside linkage immediately at the 3' end, modifications of pyrimidine bases, and ribo Includes modifications, for example, at its 2' position. In some embodiments, the YA portion The adenine (also called the "adenine position") is modified (just 3' on the pyrimidine sugar side). Modifications that alter nucleoside linkages, pyrimidine base modifications, and ribose modifications, for example (including modifications at the 2' position). In some embodiments, the pyrimidine at the YA site. and adenine include modifications. In some embodiments, YA modifications are RNA endogenous It reduces Clease activity.

[0677] The above modifications and their equivalents are included within the scope of the embodiments described herein. .

[0678] Guide RNA (gRNA) containing a shortened region and / or substitutions In some embodiments, the gRNAs provided herein (e.g., sgRNA, dgR) NA (or crRNA) contains a conserved portion including a hairpin region, and the hairpin region is 6 ~8 nucleotides, 9-10 nucleotides, or 5-10 nucleotides It is lacking. In some embodiments, the gRNA is S. pyogenes Cas9( It is derived from "spyCas9" or a spyCas9 equivalent. In some embodiments, The gRNA is not derived from S. pyogenes Cas9 ("non-spyCas9"). In some embodiments, 6 to 8 nucleotides, 9 to 10 nucleotides or It consists of 5 to 10 nucleotides in a sequence.

[0679] In some embodiments, the hairpin regions are 5, 6, 7, 8, 9, 10, 11, or It lacks 12 nucleotides. In some embodiments, the hairpin 1 region is 5, It is missing 6, 7, 8, 9, 10, 11, or 12 nucleotides. Some fruits In the application configuration, the hairpin 2 area has 5, 6, 7, 8, 9, 10, 11, or 12 nuclei It lacks rheotide. In some embodiments, the hairpin regions are 5, 6, 7, 8, 9 , lacking 10, 11, or 12 conserved nucleotides. In some embodiments, Hairpin 1 area contains 5, 6, 7, 8, 9, 10, 11, or 12 storage nucleotids. It lacks a do. In some embodiments, the hairpin 2 region is 5, 6, 7, 8, 9, 1 It lacks 0, 11, or 12 conserved nucleotides. In some embodiments, 6 ~8 missing nucleotides, 9-10 missing nucleotides, or 5-1 The missing nucleotides are located within hairpin 1. In some embodiments, 6~ 8 missing nucleotides, 9-10 missing nucleotides, or 5-10 The missing nucleotides are located within hairpin 2. In some embodiments, 6-8 1 missing nucleotides, 9-10 missing nucleotides, or 5-10 The missing nucleotides are located in hairpin 1 and hairpin 2. Several implementations In this state, there are nucleotides missing 6-8, nucleotides missing 9-10, and The missing 5-10 nucleotides are located within hairpin 1 or hairpin 2. In some embodiments, 6 to 8 nucleotides are missing, and 9 to 10 nucleotides are missing. Cleotides, or nucleotides lacking 5-10, are consecutive, and hairpin 1 and hairpin The interval between n2 includes "N". In some embodiments, there are 5 to 10 or 6 to 10 missing The nucleotides include the "N" between hairpin 1 and hairpin 2. In the application pattern, 5-10 or 6-10 missing nucleotides are consecutive, like a hairpin It extends to at least a portion of 1. In some embodiments, 5 to 10 or 6 to 10 missing The nucleotides are continuous and extend to at least part of hairpin 2. Several implementations In this state, there are nucleotides missing 6-8, nucleotides missing 9-10, and Alternatively, 5 to 10 missing nucleotides are consecutive, and at least part of hairpin 1 and It extends to a portion of hairpin 2. In some embodiments, 6 to 8 nucleotides are missing. , nucleotides missing 9-10 or nucleotides missing 5-10 The extension continues to at least a portion of hairpin 1 and the "N" between hairpin 1 and hairpin 2. In some embodiments, 5 to 10 missing nucleotides are represented by Sequence ID No. 400. Contains or consists of nucleotides 54-58, 54-61, or 53-60. .

[0680] In some embodiments, the gRNA is a substituted and optionally shortened hairpin It includes a region and at least one of the following nucleotide pairs is substituted and optional In the shortened hairpin 1, the Watson-Crick pair forming nucleotides are substituted. Currently: H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1 -10, and / or H1-4 and H1-9. "Watson-Crick pair forming nuclei "Ochido" includes Watson, which has AT, AU, TA, UA, CG, and GC pairs. Any pair that can form a click base pair, as well as the preference for the same base pairing. Includes pairs containing any of the modified forms of the aforementioned nucleotides. Several implementations In this state, hairpin 1 region lacks one or two of H1-5 to H1-8. In some embodiments, the hairpin 1 region is one of the following nucleotide pairs. Missing one, two, or three: H1-1 and H1-12, H1-2 and H1- 11, H1-3 and H1-10, and / or H1-4 and H1-9. Some In this embodiment, hairpin 1 region lacks 1 to 8 nucleotides. In any of the embodiments described above, the missing nucleotide is Watson-Crick. Pair-forming nucleotides (H1-1 and H1-12, H1-2 and H1-11, H1-3 and H1-10, and / or H1-4 and H1-9) replaced by one or more Nucleotide pairing may be the mechanism for forming base pairs in gRNA.

[0681] In some embodiments, the gRNA lacks at least one nucleotide. Abbreviations of a sub-segment, for example, those shown in Table 1C or elsewhere in this specification. It further includes one of the upper stem regions shown in the numbered embodiments above. This includes, but is not limited to, the combinations shown in Table 1A of the sequences specified herein. It can be combined with any of the shortened or replaced hairpin 1 regions described. [Table 1C] JPEG2026048746000128.jpg234155JPEG2026048746000129.jpg234156JPEG2026048746000130.jpg234155JPEG202 6048746000131.jpg237155JPEG2026048746000132.jpg236159JPEG2026048746000133.jpg234155JPEG2026048746 000134.jpg235157JPEG2026048746000135.jpg232153JPEG2026048746000136.jpg234156JPEG2026048746000137. jpg236155JPEG2026048746000138.jpg237160JPEG2026048746000139.jpg235156JPEG2026048746000140.jpg23615 8JPEG2026048746000141.jpg234156JPEG2026048746000142.jpg235157JPEG2026048746000143.jpg233156JPEG20 26048746000144.jpg235155JPEG2026048746000145.jpg232155JPEG2026048746000146.jpg237156JPEG2026048746 000147.jpg236159JPEG2026048746000148.jpg234158JPEG2026048746000149.jpg235156JPEG2026048746000150. jpg235157JPEG2026048746000151.jpg236156JPEG2026048746000152.jpg234156JPEG2026048746000153.jpg82156

[0682] In Table 1C, if US3, US4, US9, and US10 are replaced, These are GC or CG base pairs (US3 pairs with US10 and US4 pairs with US9). They can be replaced by (forming), for example, US3, US4, US9, and US10, respectively These can be replaced with G, C, G, and C. Similarly, US3 and US10 can be replaced. If present, they are placed in GC or CG base pairs (US3 pairs with US10). They can be interchanged, for example, US3 and US10 can be G and C, or C and G, respectively. It can be replaced with.

[0683] In some embodiments, the gRNA described herein further comprises a nexus region. Furthermore, the nexus region lacks at least one nucleotide. Several embodiments So, gRNA has at least 2, 3, 4, 5, 6, 7, 8, 9 in its nexus region. Or it lacks 10 nucleotides. In some embodiments, the gRNA is nec At least 1-2, 1-3, 1-4 nucleotides and 1-5 nucleotides in the SUS region Rheotide, 1-6 nucleotides, 1-10 nucleotides, or 1-15 nucleotides It lacks a creotide. In some embodiments, the gRNA is located in the nexus region. It is missing each nucleotide.

[0684] In some embodiments, the gRNA further includes a guide region. So, the guide region is the first 1-10, 11, 12, 13 at the 5' end of the gRNA. Contains 14, 15, 16, 17, 18, 19, or 20 nucleotides. In some embodiments, the guide region contains 20 nucleotides. In some embodiments, The guide region is at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 or more It contains nucleotides. In some embodiments, the guide region contains 17 nucleotides It includes. In some embodiments, the guide region includes 18 nucleotides. How many In that embodiment, the guide region contains 19 nucleotides.

[0685] In some embodiments, the selection of a guide region is used to target a gene for editing. Determined based on the column. For example, in some embodiments, the gRNA is the gene of interest. It includes a guide region that is complementary to the target sequence.

[0686] In some embodiments, the target sequence in the gene of interest is located in the guide region of the gRNA. They may be complementary. In some embodiments, the guide region of the gRNA and the gene of interest are located in the gRNA. The degree of complementarity or identity between the corresponding target sequence and the target sequence is approximately 50%, 55%, and 6%. 0%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 9 It may be 8%, 99%, or 100%. In some embodiments, the gRNA guide The target sequences of the region and the gene of interest may be 100% complementary or identical. Other implementations Morphologically, the guide region of the gRNA and the target region of the gene of interest are at least one micron It may include smatches. For example, the guide region of the gRNA and the target sequence of the gene of interest are It may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches in the target sequence. The total length is at least approximately 17, 18, 19, 20 or more base pairs. In that embodiment, the guide region of the gRNA and the target region of the gene of interest are 1 to 6 The guide array may contain mismatches, and there are at least about 17, 18, 19, 20 or more. The above nucleotides are included. In some embodiments, the guide region of the gRNA and the target The target region of the gene may contain 1, 2, 3, 4, 5, or 6 mismatches, and guide The sequence contains approximately 20 nucleotides. The 5' end is not considered a guide region. In other words, it contains nucleotides that do not function to guide the Cas9 protein to the target nucleic acid. It is visible.

[0687] In some embodiments, the gRNA undergoes 5' or 3' terminal modifications, and shortening. It contains a conserved portion of the gRNA including a hairpin 1 region, (i) The shortened hairpin 1 region lacks 6-8 nucleotides, and (A) One or more of the following values ​​are assigned to sequence number 400: It is either deleted or replaced, and / or (B) one of the positions H1-6 to H1-10 If there are two or more, they are either substituted for sequence number 400, or (ii) The shortened hairpin 1 region includes 9 H1-1 and / or H1-12. It is missing ~10 nucleotides, or (iii) The shortened hairpin 1 region lacks 5 to 10 nucleotides, One or more of the following are substituted for sequence number 400: N18 and N are the 5' and 3' sides immediately behind hairpin 1 in Table 2, respectively. It refers to creotide.

[0688] In some embodiments, the gRNA includes a 5' terminal modification or a 3' terminal modification, and gR The NA-conserved portion includes a shortened upper stem region, and the shortened upper stem region is 1 It is missing approximately 6 nucleotides.

[0689] In some embodiments, the gRNA includes a 5' terminal modification or a 3' terminal modification, and gR The NA storage section includes LS6, LS7, US3, US10, B3, N7, N15, N17, In one or more of H2-2 and H2-14, for sequence number 400 Substitutions are included. The substituted nucleotide is neither a pyrimidine followed by adenine nor pyrimidine. It's not adenine, which is preceded by din.

[0690] In some embodiments, the gRNA includes a 5' terminal modification or a 3' terminal modification, and gR The preserved portion of NA includes one or more of (a), (b), and (c) above.

[0691] In some embodiments, the conserved portion of the gRNA described herein is the nexus region. , further comprising one or more deletions or substitutions in the lower stem region or bulge region.

[0692] In some embodiments, the gRNA is located in the following hairpin 1 region (H1-H12): Includes one or more of the following deletions.

[0693] Shortened hairpin 1 area In some embodiments, the conserved portion of the gRNA described herein is (a) 6-8 It includes a shortened hairpin 1 region lacking nucleotides. In some embodiments, The conserved portion of the gRNA described herein is (a) lacking 6 to 8 nucleotides. A shortened hairpin region, and one or more missing parts in the shortened hairpin region. This includes loss or replacement. In some embodiments, the hairpin 1 region has 6 to 8 nucleos It lacks a cyd, and one or more of the positions H1-1, H1-2, or H1-3 are in the array. Number 400 is deleted or replaced. In some embodiments, position H1-1 It is missing. In some embodiments, position H1-1 is replaced. In one embodiment, position H1-2 is omitted. In some embodiments, position H1- 2 is replaced. In some embodiments, positions H1-3 are deleted. In that embodiment, positions H1-3 are replaced.

[0694] In some embodiments, the shortened hairpin 1 region lacks 6 to 8 nucleotides. And one or more of the positions H1-6 to H1-10 are replaced for sequence number 400. In some embodiments, positions H1-6 are substituted. In some embodiments, positions H1-7 are replaced. In some embodiments, positions H1-8 are placed It is replaced. In some embodiments, positions H1-9 are replaced. In the implementation configuration, position H1-10 has been replaced.

[0695] In some embodiments, the shortened hairpin 1 region has a length of 4 nucleotides. In some embodiments, the shortened hairpin region has a length of 5 nucleotides. In some embodiments, the shortened hairpin region has a length of 6 nucleotides. In one embodiment, the 4, 5, or 6 nucleotides in the shortened hairpin 1 region are Includes two or fewer substitutions. In further embodiments, shortened hairpin 1 regions 4, 5, Or six nucleotides contain one or fewer substitutions. In further embodiments, shortened Four, five, or six nucleotides in the hairpin 1 region are unsubstituted.

[0696] In some embodiments, position H1-1 is omitted. In some embodiments, Position H1-1 is replaced. In some embodiments, position H1-2 is omitted. In some embodiments, positions H1-2 are substituted. In some embodiments, Positions H1-3 are missing. In some embodiments, positions H1-3 are replaced. In some embodiments, positions H1-4 are omitted. In some embodiments, positions H1-4 are replaced. In some embodiments, positions H1-5 are omitted. In some embodiments, positions H1-5 are replaced. In this case, positions H1-6 are missing. In some embodiments, positions H1-6 are replaced. In some embodiments, positions H1-7 are omitted. In this state, positions H1-7 are replaced. In some embodiments, positions H1-8 are missing. In some embodiments, positions H1-8 are substituted. In some embodiments, positions H1-9 are omitted. It has been replaced. In some embodiments, positions H1-10 are omitted. In some embodiments, position H1-10 is replaced. 11 is missing. In some embodiments, position H1-11 is substituted. In some embodiments, positions H1-12 are omitted. Position H1-12 has been replaced.

[0697] In some embodiments, positions H1-1 to H1-2 are omitted. In the morphology, positions H1-1 to H1-3 are omitted. In some embodiments, position H Lines 1-1 to H1-4 are missing. In some embodiments, positions H1-1 to H1-5 The elements are missing. In some embodiments, positions H1-1 to H1-6 are missing. In some embodiments, positions H1-1 to H1-7 are omitted. In the morphology, positions H1-1 to H1-8 are omitted. In some embodiments, position H 1-1 to H1-9 are missing. In some embodiments, positions H1-1 to H1-1 A zero is missing.

[0698] In some embodiments, positions H1-2 to H1-3 are omitted. In the morphology, positions H1-2 to H1-4 are omitted. In some embodiments, position H Lines 1-2 to H1-5 are missing. In some embodiments, positions H1-2 to H1-6 Some are missing. In some embodiments, positions H1-2 to H1-7 are missing. In some embodiments, positions H1-2 to H1-8 are omitted. In the morphology, positions H1-2 to H1-9 are omitted. In some embodiments, position H 1-2~H1-10 are missing. In some embodiments, positions H1-2~H1- Number 11 is missing.

[0699] In some embodiments, positions H1-3 to H1-4 are omitted. In the morphology, positions H1-3 to H1-5 are omitted. In some embodiments, position H Lines 1-3 to H1-6 are missing. In some embodiments, positions H1-3 to H1-7 The elements are missing. In some embodiments, positions H1-3 to H1-8 are missing. In some embodiments, positions H1-3 to H1-9 are omitted. In the morphology, positions H1-3 to H1-10 are omitted. In some embodiments, position H1-3 to H1-11 are missing. In some embodiments, positions H1-3 to H1 -12 is missing.

[0700] In some embodiments, positions H1-4 to H1-5 are omitted. In the morphology, positions H1-4 to H1-6 are omitted. In some embodiments, position H Lines 1-4 to H1-7 are missing. In some embodiments, positions H1-4 to H1-8 Some are missing. In some embodiments, positions H1-4 to H1-9 are missing. In some embodiments, positions H1-4 to H1-10 are omitted. In the configuration, positions H1-4 to H1-11 are omitted. In some embodiments, Sections H1-4 to H1-12 are missing.

[0701] In some embodiments, positions H1-5 to H1-6 are omitted. In the morphology, positions H1-5 to H1-7 are omitted. In some embodiments, position H Lines 1-5 to H1-8 are missing. In some embodiments, positions H1-5 to H1-9 The elements are missing. In some embodiments, positions H1-5 to H1-10 are missing. In some embodiments, positions H1-5 to H1-11 are omitted. In this embodiment, positions H1-5 to H1-12 are omitted.

[0702] In some embodiments, positions H1-6 to H1-7 are omitted. In the morphology, positions H1-6 to H1-8 are omitted. In some embodiments, position H Lines 1-6 to H1-9 are missing. In some embodiments, positions H1-6 to H1-1 0 is missing. In some embodiments, positions H1-6 to H1-11 are missing. In some embodiments, positions H1-6 to H1-12 are omitted.

[0703] In some embodiments, positions H1-7 to H1-8 are omitted. In the morphology, positions H1-7 to H1-9 are omitted. In some embodiments, position H 1-7~H1-10 are missing. In some embodiments, positions H1-7~H1- 11 is missing. In some embodiments, positions H1-7 to H1-12 are missing. It is.

[0704] In some embodiments, positions H1-8 to H1-9 are omitted. In the morphology, positions H1-8 to H1-10 are omitted. In some embodiments, position H1-8 to H1-11 are missing. In some embodiments, positions H1-8 to H1 -12 is missing.

[0705] In some embodiments, positions H1-9 to H1-10 are omitted. In the configuration, positions H1-9 to H1-11 are omitted. In some embodiments, Sections H1-9 to H1-12 are missing.

[0706] In some embodiments, positions H1-10 to H1-11 are omitted. In this embodiment, positions H1-10 to H1-12 are omitted.

[0707] In some embodiments, positions H1-11 to H1-12 are omitted.

[0708] In some embodiments, positions H1-2 to H1-4 and H1-9 to H1-11 are missing. In some embodiments, the shortened hairpin 1 region is (a) array AGA AAU, (b) a sequence having two or fewer mismatches with the sequence in (a), or (c) (a) includes sequences that have one or fewer mismatches with respect to the sequence.

[0709] In some embodiments, positions H1-2 to H1-5 and H1-9 to H1-11 are missing. In further embodiments, each position in the upper stem region is modified. In that embodiment, the upper stem region is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and The 11th position is modified. In some embodiments, the 1st, 2nd, 3rd, and 4th positions in the upper stem region are modified. All except the 5th or 6th position are qualified. In some embodiments, the upper stem At least 20%, 30%, 40%, 50%, 60%, 70%, 80% of the region's location, 90% are modified. By choice, in any of the embodiments described above, the upper part Each modification site in the TEM region is modified by 2'-O-methylation. Further implementations In this state, the shortened hairpin 1 region is (a) sequence AAAAAU, (b) sequence (a) In contrast, sequences with two or fewer mismatches, or sequences of (c)(a) with one or fewer mismatches. Includes sequences with mismatches.

[0710] In some embodiments, positions H1-2 to H1-5 and H1-8 to H1-11 are missing. In further embodiments, each position in the upper stem region is modified. Depending on the selection, each position in the upper stem region is modified by 2'-O-methylation. In the following embodiments, the shortened hairpin 1 region is (a) array AAAU, (b) (a) For the sequence of (c)(a), a sequence has two or fewer mismatches, or for the sequence of (c)(a) Includes sequences with one or fewer mismatches.

[0711] In some embodiments, positions H1-1, H1-3 to H1-8, and H-12 are missing. In further embodiments, each position in the upper stem region is modified. Optional By selection, each position in the upper stem region is modified by 2'-O-methylation. In further embodiments, the shortened hairpin 1 region is (a) array CAAG, (b) (a For the sequence of (c)(a), a sequence has two or fewer mismatches, or for the sequence of (c)(a) Includes sequences with one or fewer mismatches.

[0712] In some embodiments, positions H1-2 to H1-8 are omitted. Further embodiments In this state, each position in the upper stem region is modified. By arbitrary selection, the upper stem region Each position is modified by 2'-O-methylation. In further embodiments, shortened The hairpin region is such that (a) there are no more than 2 instances of the sequence AAAGU, and (b) there are no more than 2 instances of the sequence in (a). A sequence having a mismatch, or a sequence of (c)(a) with one or fewer mismatches Includes the array it contains.

[0713] In some embodiments, positions H1-3 to H1-9 are omitted. Further embodiments In this state, each position in the upper stem region is modified. By arbitrary selection, the upper stem region Each position is modified by 2'-O-methylation. In further embodiments, shortened The resulting hairpin region is (a) sequence ACAGU, and (b) sequence (a) has 2 or fewer occurrences. A sequence having a mismatch, or a sequence of (c)(a) with one or fewer mismatches Includes the array it contains.

[0714] In some embodiments, positions H1-7 are replaced by G. In some embodiments, positions H1-8 are replaced by C. Positions H1-8 are replaced positions. In some embodiments, H1-7 and H1 -8 is replaced by G and C, respectively. In some embodiments, positions H1-7 And positions H1-8 are replaced by G and C respectively, and positions H1-2 to H1-4 And H1-9~H1-11 are deleted. In further embodiments, shortened hair The pin 1 region consists of (a) the sequence AGAGCU, and (b) two or fewer mismatches relative to the sequence in (a). A sequence having a match, or a sequence having one or fewer mismatches for the sequence of (c)(a) Includes columns.

[0715] In some embodiments, positions H1-6 are replaced by G. In some embodiments, positions H1-7 are replaced by U. Positions H1-7 are replaced positions. In some embodiments, H1-6 and position H1-7 are replaced with G and U, respectively. In some embodiments, position H1 -6 and positions H1-7 are replaced by G and C, respectively, and positions H1-2~H1 -4 and H1-9 to H1-11 are deleted. In further embodiments, shortened Hairpin 1 region (a) sequence AGCUAU, (b) 2 or fewer mins for sequence (a) A sequence having a smatch, or (c)(a) having one or fewer mismatches Includes an array.

[0716] In some embodiments, position H1-1 is replaced by C. In some embodiments, positions H1-12 are replaced by G. Positions H1-12 are the replaced positions. In some embodiments, position H1-1 H1-12 are replaced with C and G, respectively. In some embodiments, Positions H1-1 and H1-12 are replaced by C and G, respectively, and position H1-2~ H1-4 and H1-9~H1-11 are deleted. In further embodiments, the upper part Each position in the stem region is modified. By choice, each position in the upper stem region is 2 Modified by -O-methylation. In further embodiments, shortened hairpin One region contains (a) the sequence CGAAAG, and (b) two or fewer mismatches with the sequence in (a). A sequence having, or a sequence having one or fewer mismatches with respect to the sequence (c)(a) include.

[0717] In some embodiments, the shortened hairpin 1 region contains 9 to 10 nucleotides It is lacking. In some embodiments, the shortened hairpin 1 region is 2 nucleotides long. It has. In some embodiments, the shortened hairpin 1 region has a length of 3 nucleotides. It has. In a further embodiment, two or three nucleotids in the shortened hairpin 1 region "Do" is a non-substitution.

[0718] In some embodiments, position H1-1 is omitted. In some embodiments, Positions H1-12 are missing. In some embodiments, positions H1-11 to H1-1 2 is missing. In further embodiments, positions H1-1 to H1-8 and H1-11 ~H1-12 is missing. In a further embodiment, the shortened hairpin 1 region is (a) Sequence AA, (b) Sequence containing one or fewer mismatches with sequence (a).

[0719] In some embodiments, positions H1-11 to H1-9 are omitted. Further implementation Morphologically, the shortened hairpin 1 region consists of (a) sequence AG, and (b) sequence (a) and one or more Includes the following sequence with mismatch.

[0720] In some embodiments, the shortened hairpin 1 region contains 5 to 10 nucleotides It is missing. In some embodiments, the shortened hairpin 1 region has 5 to 10 nuclei It lacks rheotide, and one or more of the following positions are N18, H1-12, or N , which is substituted for SEQ ID NO: 400. In some embodiments, the shortened hairpin The n1 region has a length of 2 nucleotides. In some embodiments, a shortened hairpin Each region has a length of 3 nucleotides. In some embodiments, a shortened hairpin 1 The region has a length of 4 nucleotides. In some embodiments, a shortened hairpin region The region has a length of 5 nucleotides. In some embodiments, the hairpin region is shortened. It has a length of 6 nucleotides. In some embodiments, the shortened hairpin 1 region is , having a length of 7 nucleotides. In further embodiments, positions H1-4 to H1-11 are deleted. It is being done.

[0721] In some embodiments, the conserved portion of the gRNA described herein is 5 to 10 A shortened hairpin region lacking nucleotides, wherein one or more nucleotides It further includes a hairpin 1 region, which is missing.

[0722] In some embodiments, position N18 is replaced. In further embodiments, position N18 is replaced with C. In a further embodiment, position N18 is replaced with C. In a further embodiment, the gRNA is located at position H1-4 to H1-11. The segment includes a segment with position N18, a shortened hairpin 1 region, and position N. (a) The sequence CACUUG, (b) The sequence (a) has two or fewer mismatches. The array includes, or an array that has one or fewer mismatches with the array of (c)(a). .

[0723] In some embodiments, positions H1-12 are substituted. In a further embodiment, positions H1-12 are replaced by C. It is replaced. In some embodiments, position N is replaced. Further embodiments In this embodiment, position N is replaced by A. In a further embodiment, positions H1-12 are replaced by C. In a further embodiment, positions N are replaced by A. It is replaced by, position N is replaced by A, and positions H1-4 to H1-11 are deleted. In further embodiments, the gRNA has a shortened hairpin 1 region at position N18. and a segment including position N, the segment is (a) sequence AACUCA, (b) (a) A sequence having two or fewer mismatches with the sequence (a), or (c) A sequence with In contrast, it includes sequences with one or fewer mismatches.

[0724] In some embodiments, positions H1-12 are replaced by A, and position N is replaced by A. In a further embodiment, positions H1-12 are replaced by A, and position N is replaced by A. It has been replaced, and positions H1-4 to H1-11 are deleted. In further embodiments, The gRNA has a segment containing position N18, a shortened hairpin 1 region, and position N. The segment contains (a) the sequence AACUAA, and (b) two or fewer instances of the sequence (a). A sequence with a mismatch, or a sequence of (c)(a) with one or fewer mismatches Includes an array.

[0725] Shortened upper stem region In some embodiments, the conserved portion of the gRNA described herein is shortened. This is the stem region. In some embodiments, the shortened upper stem region is 1 to 6 It lacks the nucleotide. In some embodiments, the upper stem region is a loop (for example) If it contains a tetraloop, the length of the upper stem region includes the nucleotides in the loop. In some embodiments, the shortened upper stem region has a length of 6 nucleotides. In some embodiments, the shortened upper stem region has a length of 7 nucleotides. In some embodiments, the shortened upper stem region has a length of 8 nucleotides. In one embodiment, the shortened upper stem region has a length of 9 nucleotides. In this embodiment, the shortened upper stem region has a length of 10 nucleotides. In this embodiment, the shortened upper stem region has a length of 11 nucleotides. In the embodiment, 6, 7, 8, 9, 10, or 11 nuclei in the shortened upper stem region Rheotide includes four or fewer substitutions, two or fewer substitutions, or one substitution. Further implementation Morphologically, it consists of 6, 7, 8, 9, 10, or 11 nucleos in the shortened upper stem region. Tide is unsubstituted.

[0726] In some embodiments, the positions US3, US4, US5, US8, US9, or US One or more of the 10 are missing. In some embodiments, position US3 is missing. In some embodiments, position US4 is omitted. In this case, position US5 is omitted. In some embodiments, position US8 is omitted. In some embodiments, position US9 is omitted. In some embodiments , position US10 is deleted. In sequences such as sequence number 400, US6, US7 If US6, US7, and US8 are A residues, then any of them Note that one deletion is equivalent.

[0727] In some embodiments, positions US4 and US9 are omitted. Further embodiments In this state, positions H1-2 to H1-5 and H1-8 to H1-11 are missing. In one embodiment, the shortened upper stem region is (a) array GCUGAAAGGC (array (b) A sequence having two or fewer mismatches with the sequence of (a), or (c )(a) includes sequences that have one or fewer mismatches.

[0728] In some embodiments, positions US3 and US4 are omitted. In some embodiments, positions US9 and US10 are omitted. US3, US4, US9, and US10 are missing.

[0729] In some embodiments, g has a shortened upper stem region as described herein. The conserved portion of the RNA further includes the shortened hairpin region 1. In further embodiments, Positions H1-2 to H1-5 and H1-8 to H1-11 are missing. Further implementations In this configuration, positions H1-2 to H1-5 and H-12 are missing. In further embodiments... The shortened upper stem region is (a) sequence GCGAAAGC, (b) sequence of (a) In contrast, sequences with two or fewer mismatches, or sequences of (c)(a) with one or fewer mismatches. Includes an array having a mismatch. In a further embodiment, positions H1 and H1-4~H Tracks 1-12 are missing.

[0730] In some embodiments, positions US3, US4, US8, US9, and US10 are missing. It is lost. In a further embodiment, the shortened upper stem region is (a) sequence GCG AAGC, (b) A sequence having two or fewer mismatches with the sequence of (a), or (c )(a) contains sequences that have one or fewer mismatches with respect to the sequence.

[0731] In some embodiments, positions US3, US4, US5, US9, and US10 are missing. It is lost. In a further embodiment, the shortened upper stem region is (a) array GCA AAGC((Sequence ID 1005), (b) has two or fewer mismatches with the sequence of (a) Includes an array, or an array that has one or fewer mismatches with the array of (c)(a).

[0732] In some embodiments, position US3 is replaced, and optionally replaced by G. In some embodiments, position US4 is replaced and optionally placed at C. It is replaced. In some embodiments, position US9 is replaced by optional It is replaced by G. In some embodiments, position US10 is replaced, and optional It is replaced with C by the selection.

[0733] In some embodiments, positions US3 and US10 are replaced by optional These are replaced by G and C respectively. In some embodiments, positions US4 and U S9 has been replaced, and has been optionally replaced with C and G respectively.

[0734] In some embodiments, positions US3 and US10 are replaced by G and C, respectively. It is written that positions US4 and US9 are replaced with C and G, respectively. In some embodiments, position US5 is omitted. In some embodiments, position US3 is omitted. US10 and US4 are replaced by G and C respectively, and US4 and US9 are replaced by They are replaced with C and G respectively, and position US8 is deleted. US6, US7, U Since each S8 contains A, by arbitrary selection, instead of the missing position US8, position US One of 6 or US7 may be missing. In some embodiments, positions H1-2~ H1-5 and positions H1-8 to H1-11 are missing. In further embodiments, short The contracted upper stem region is (a) sequence GGCGAAGCGC, (b) sequence of (a) In contrast, sequences with two or fewer mismatches, or sequences of (c)(a) with one or fewer mismatches. Includes sequences with mismatches.

[0735] In some embodiments, positions US3 and US10 are replaced by C and G, respectively. In some embodiments, positions US3 and US10 are C and G, respectively. It is replaced by and positions US4 and US9 are deleted. In some embodiments, The shortened upper stem region is (a) sequence GCGGAAACGC (sequence number 1006) (b) A sequence having two or fewer mismatches with the sequence of (a), or (c) (a) Includes arrays that have one or fewer mismatches with the given array.

[0736] In some embodiments, positions US3 and US10 are replaced by G and C, respectively. In some embodiments, positions US4 and US9 are omitted. The upper stem region is (a) sequence GCCGAAAGGC (sequence number 1007), (b) (a) A sequence having two or fewer mismatches with the sequence (a), or (c) A sequence with In contrast, it includes sequences with one or fewer mismatches.

[0737] Replacement and modification of the YA site In some embodiments, the conserved portion of the gRNA described herein is LS6, LS 7, US3, US10, B3, N7, N15, N17, H2-2, and H2-14 One or more of the substituents have substitution relative to SEQ ID NO: 400. D is neither a pyrimidine followed by adenine, nor is it an adenidine with a pyrimidine preceding it. There isn't any.

[0738] In some embodiments, positions LS6, LS7, US3, US10, B3, N7, N1 One of the following is substituted: 5, N17, H2-2, and H2-14. In the embodiment, position LS6 is replaced. In some embodiments, position LS7 is replaced. In some embodiments, position US3 is replaced. In this state, position US10 is replaced. In some embodiments, position B3 is replaced. It is replaced by G by optional selection. In some embodiments, position N7 is replaced It is configured and optionally replaced with C or U. In some embodiments, Position N15 has been replaced, and can be optionally replaced with C or U. In this embodiment, position N17 is replaced, and optionally replaced with G. In some embodiments, position H2-2 is replaced. H-14 has been replaced.

[0739] In some embodiments, positions LS6, LS7, US3, US10, B3, N7, N1 Two of the following positions are substituted: 5, N17, H2-2, and H2-14. How many? In that embodiment, positions LS6 and LS7 are replaced, and optionally each U and A are replaced. In some embodiments, positions US3 and US10 are placed They are replaced, and are optionally substituted with G and C respectively. Several implementation forms In this state, positions H2-2 and H2-14 are replaced, and A is selected as desired. It is replaced by U. In some embodiments, positions H2-2 and H2-14 are placed They have been replaced, and have been optionally substituted with G and C respectively.

[0740] In some embodiments, positions US3, US10, LS6, LS7, B3, N15, N 17, H2-2, and H2-14 positions, at least 2, 3, 4, 5, 6, 7, Or 8 are replaced. In some embodiments, positions US3, US10, LS6, LS7, B3, N15, N17, H2-2, and H2-14 have been replaced.

[0741] In some embodiments, at least two, three, four, five, or all of the following may be present. apply: (a) Positions US3 and US10 are replaced by G and C, respectively. (b) Positions LS6 and LS7 are replaced by U and A, respectively. (c) Position B3 is replaced by G. (d) Position N15 is replaced by C. (e) Position N17 is replaced by G, and / or (f) Positions H2-2 and H2-14 are replaced with A and U, respectively.

[0742] In some embodiments, the conserved portion of the gRNA described herein is described herein. It has both a shortened upper stem region and a shortened hairpin 1 region.

[0743] In some embodiments, positions H1-4 to H1-11 are omitted. Further implementation Morphologically, the shortened hairpin 1 region is (a) sequence ACUU, (b) sequence (a) and sequences with 2 or fewer mismatches, or sequences of (c)(a) with 1 or fewer mismatches Includes sequences with mismatches.

[0744] In some embodiments, position N2 is replaced by C. In some embodiments, Positions US1-US4 and US9-US12 are missing. Position H is selected at random. Sections 1-2 to H1-11 are missing. Positions H1-4 to H1-11 are missing by arbitrary selection. It has been lost.

[0745] In some embodiments, positions US2-US4 and US9-US11 are omitted. In further embodiments, positions H1-2 to H1-11 are omitted, or positions H1-1 and H1-4 to H1-12 are deleted.

[0746] In some embodiments, the conserved portion of the gRNA described herein is described herein. The shortened upper stem region and hairpin 1 region cut (i.e., position H1-1 Includes both (where H1-12 is missing).

[0747] In some embodiments, the conserved portion of the gRNA described herein is the upper stem region. The region further includes one or more of the following deletions: In some embodiments, position U S3-US5 and US8-US10 are missing. In some embodiments, position US3-US4 and US7-US10 are missing. In further embodiments, position US3 to US10 are missing. In further embodiments, positions US2 to US5 and Positions US8-US11 are missing. In further embodiments, positions US2-US6 are missing. Positions US8-US11 are missing. In further embodiments, positions US2-US 11 is missing. In further embodiments, positions US1 to US5 and position US8- US12 is missing. In further embodiments, positions US1 to US5 and position US 7-US12 is missing.

[0748] In some embodiments, the conserved portion of the gRNA described herein is shortened. Further includes the Apin 2 region. In some embodiments, position H2-15 is deleted. In some embodiments, positions H2-14 and H2-15 are omitted.

[0749] In some embodiments, the conserved portion of the gRNA described herein is the nexus region. , further comprising one or more deletions or substitutions in the lower stem region or bulge region. In some embodiments, position N6 is omitted, and by optional selection, positions H1-4~H1- 11 is missing. In some embodiments, position LS6 is replaced, and optional It is replaced by C depending on the choice. In some embodiments, position B3 is replaced, It is replaced by C by selection. In some embodiments, position N1 is replaced. , optionally replaced by C. In some embodiments, position N7 is replaced Furthermore, it is optionally replaced with G. In some embodiments, position N15 is replaced. It is and is optionally replaced with G. In some embodiments, position N17 It is substituted with a non-pyrimidine, and optionally substituted with G.

[0750] Modification guide RNA (gRNA) In some embodiments, the gRNAs described herein are modified. The terms "modified" or "modified" in the context of gRNA as described above are, for example, (a) Terminal modifications, for example, 5' terminal modifications including 5' or 3' protective terminal modifications or (b) Nucleic acid base (or "base") modification, including 3'-terminus modification, (b) substitution or removal of a base, (c) Sugar modifications including modifications at the 2', 3', and / or 4' positions, (d) Nucleo (e) Modification of interside bonds, and modifications of phosphodiester bonds and / or ribose sugars. The above modifications include skeletal modifications, which may include substitutions. Nucleotide modifications involve modifications of the phosphodiester bond immediately 3' on the sugar side of the nucleotide. or substitution. For example, between the first and second sugars from the 5' end, a phospho Nucleic acids containing thioates are considered to have a modification at position 1. "Modified gRNA" The term "nucleotide phosphate" is used in all terms described and illustrated in detail herein. A compound containing a base, sugar, and one or more of the phosphodiester bond or skeletal parts. This refers to gRNAs that have structural modifications.

[0751] Table 1 shows exemplary modification patterns. Additional exemplary patterns are discussed below.

[0752] Modification of the guide region and / or YA site In some embodiments, the gRNAs are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, This includes modifications at YA sites 11, 12, 13, 14, 15, 16, or higher. In some embodiments, the pyrimidine at the YA site is modified (immediately 3' of the sugar portion of the pyrimidine). This includes modifications that alter the internucleoside linkages. In some embodiments, YA The adenine in the region is modified (a modification that alters the nucleoside linkage immediately 3' of the sugar in adenine). Includes (including ornaments). In some embodiments, the pyrimidine and adenine of the YA site are This includes modifications such as modifications of sugars, bases, or nucleoside linkages. YA modifications are described herein. It can be any of the types of modifications listed. In some embodiments, the YA modification is a phosphating modification. Contains one or more of the following: holothioate, 2'-OMe, or 2'-fluoro. In that embodiment, the YA modification is phosphorothioate, 2'-OMe, 2'-H, inosyl Includes pyrimidine modifications containing one or more of the following: n, or 2'-fluoro. In terms of application morphology, YA modification is a bicyclic ribot within an RNA double-stranded region containing one or more YA sites. Includes a s-analog (e.g., LNA, BNA, or ENA). In some embodiments, YA modification is a bicyclic ribose analog (e.g., L) within the RNA double-stranded region containing the YA site. It includes NA, BNA, or ENA, and the YA modification is distal to the YA site.

[0753] Modification of the guide region, including modification of the YA site. In some embodiments, the guide region may include 1, 2, 3, 4, or 5 YA modifications. or more YA regions ("guide region YA region") are included. In some embodiments, , from the 5' end of the 5' end to the 5, 6, 7, 8, 9, or 10 end One or more YA sites located at the 5' end of the guide region (e.g., "5-terminus") That is, the nucleotides that make up the 3' end of the guide region contain YA modifications. In that embodiment, the 5' end of the 5' end is followed by the 5' end, 6' end, 7' end, 8' end, and 9' end. or two or more YA sites located at the 10-terminus contain YA modifications. Several implementation forms In this state, from the 5' end of the 5' end to the 5 end, 6 end, 7 end, 8 end, 9 end, or 1 Three or more YA sites located at the 0 end contain YA modifications. In some embodiments, 5 'Terminal 5' From terminal 5, terminal 6, terminal 7, terminal 8, terminal 9, or terminal 10 Four or more YA sites are located and include YA modifications. In some embodiments, the 5' end Five points located at the 5' end, 5' end, 6' end, 7' end, 8' end, 9' end, or 10' end. The above YA regions include YA modifications. The modification guide region YA region includes YA modifications.

[0754] In some embodiments, the modified guide region YA portion is located at the 3' end of the guide region 17, 16, 15, 14, 13, 12, 11, 10, or 9 nucleotides of Otide It is located within the YA modification guide region, which is the nucleotide at the 3' end of the guide region. If it is located within 10 nucleotides and the guide region is 20 nucleotides long, then the modified nucleotide The modified nucleotides in the YA region of the id are located at positions 11 to 20. In this embodiment, the YA modification is performed from the 3' terminal nucleotide of the guide region to the 20 nucleotide of the YA site. , 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5 It is located within 4, 3, 2, or 1 nucleotide. In some embodiments, YA The modifications are performed on nucleotides 20, 19, 18, 17, 16, and 15 from the 3' end of the guide region. , 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 Nuk It is located in Leotid.

[0755] In some embodiments, the modified guide region YA portion is located at the 5' end of the 5' end. It is the 4th, 5th, 6th, 7th, 8th, 9th, 10th, or 11th creotide, or one of the subsequent ones.

[0756] In some embodiments, the modification guide region YA site is not a 5' terminal modification. For example... The gRNA may include the 5' terminal modifications described herein, and the modification guide region The YA region may further be included. Alternatively, the gRNA may have an unmodified 5' end and a modified gRNA. The guide region YA site may be included. Alternatively, the gRNA may have a modified 5' end and a non- The modification guide region may include the YA region.

[0757] In some embodiments, the modified guide region YA portion is located on the 5' side of the guide region YA portion. Includes modifications that do not include at least one nucleotide located at that position. For example, nucleotide 1 ~3 contains a phosphorothioate, nucleotide 4 contains only the 2'-OMe modification, nucleo If rheotide 5 is a pyrimidine at the YA site and contains a phosphorothioate, then the modification guide The YA region is located at least one position at 5' of the guide region YA (nucleotide 4). It contains modifications (phosphothioates) that do not include nucleotides. Another example is nucleo Nucleotides 1-3 contain phosphorothioates, and nucleotide 4 is a pyrimidine at the YA site. If 2'-OMe is included, the modified guide region YA site is located at 5' of the guide region YA site. Modifications that do not include at least one nucleotide (any of nucleotides 1-3) Contains (2'-OMe). This condition also applies to unmodified nucleotides in the modification guide region YA. This is always satisfied when it is located at position 5'.

[0758] In some embodiments, the modified guide region YA portion is described with respect to the above YA portion. Includes modifiers.

[0759] Additional embodiments of guide region modification, including guide region YA site modification, are outlined above, and Furthermore, we consider gRNAs that include modifications, including those at the YA site described above, and other modifications as described herein. The gRNA guide region is described in this specification, including the section marked with an asterisk. It may be modified according to any embodiment including the modification guide region described. Any embodiment described herein may be combined with any of the prior embodiments to the extent feasible. It is possible.

[0760] Modification of the YA region in the preserved area The storage regions YA parts 1-10 are shown in Figure 1C. In some embodiments, 1, 2, 3, 4 , 5, 6, 7, 8, 9, or 10 conserved region YA sites include modifications.

[0761] In some embodiments, the preserved region YA site 1, 8, or 1 and 8 undergoes YA modification. Includes. In some embodiments, the storage regions YA parts 1, 2, 3, 4, and 10 are YA Includes modifications. In some embodiments, YA parts 2, 3, 4, 8, and 10 are YA modified. Includes decoration. In some embodiments, the storage areas YA portions 1, 2, 3, and 10 are YA Includes modifications. In some embodiments, YA sites 2, 3, 8, and 10 have YA modifications. Includes. In some embodiments, YA sites 1, 2, 3, 4, 8, and 10 are YA modified. Includes. In some embodiments, 1, 2, 3, 4, 5, 6, 7, or 8 additional storage The YA region contains YA modifications.

[0762] In some embodiments, storage areas 1, 2, 3, or 4 are YA sites 2, 3, 4, And 10 include YA modifications. In some embodiments, 1, 2, 3, 4, 5, 6, 7, Alternatively, eight additional conserved regions (YA sites) include YA modifications.

[0763] In some embodiments, the modified preservation region YA portion is described with respect to the above YA portion. Includes the modifier.

[0764] Further embodiments of the modification of the YA site in the preserved region are shown in the summary above. Other parts of this disclosure Any embodiment described herein may be combined with any of the prior embodiments to the extent feasible. It is possible.

[0765] Modification of terminal nucleotides In some embodiments, the 5' and / or 3' terminal regions of the gRNA are modified. Yes, they are.

[0766] 3' end region modification In some embodiments, 1, 2, 3, 4, 5, 6, or 7 in the 3' terminal region The nucleotides are modified. Overall, this modification is called a "3'-end modification." In some embodiments, the terminal (i.e., last) 1 in the 3' terminal region , 2, 3, 4, 5, 6, or 7 nucleotides contain two or more modifications. In this embodiment, terminal (i.e., last) 1, 2, 3, 4, 5 in the 3' terminal region At least one of the 6 or 7 nucleotides is modified. In the embodiment, terminal (i.e., last) 1, 2, 3, 4, 5 in the 3' terminal region, At least two of the six or seven nucleotides are modified. In the application morphology, the terminal (i.e., last) 1, 2, 3, 4, 5 in the 3' terminal region, At least three of the six or seven nucleotides are modified. In the application form, the modification includes PS bonds. In some embodiments, the modification of the 3' terminal region is , 3' protective end modification. In some embodiments, the 3' end modification is a 3' protective end modification. Includes decorations.

[0767] In some embodiments, the 3'-terminal modification is a 2'-O-methyl (2'-O-Me) modification. Nucleotides, 2'-O-(2-methoxyethyl)(2'-O-moe) modified nucleotypes D, 2'-fluoro(2'-F) modified nucleotide, internucleotide phosphorothioate (PS) A selection of (PS)-bound, inverted debasicized nucleotides, or a combination thereof. It contains modified nucleotides.

[0768] In some embodiments, the 3'-terminal modification is a 2'-O-methyl (2'-O-Me) modification. Contains or contains nucleotides.

[0769] In some embodiments, the 3'-terminal modification is a 2'-fluoro(2'-F) modified nucleo Contains or contains tides.

[0770] In some embodiments, the 3' terminal modification involves internucleotide phosphorothioate (PS) ) Includes a bond.

[0771] In some embodiments, the 3' terminal modification includes an inverted debasitized nucleotide. Or further include.

[0772] In some embodiments, the 3' terminal modification is the last 7, 6, 5, 4, 3, 2, or 1 Contains one or more modifications among the nucleotides. In the embodiment, the 3' terminal modification includes one modified nucleotide or more. In some embodiments, the 3' terminal modification includes two modified nucleotides or further In some embodiments, the 3' terminal modification includes three modified nucleotides. This further includes: In some embodiments, the 3' terminal modification includes four modified nucleotides. In some embodiments, the 3' terminal modification is a 5-modification nucleo. Contains or further contains cydo. In some embodiments, the 3' terminal modification is 6 modifications. It contains or further contains nucleotides. In some embodiments, the 3' terminal modification is 7 It contains or contains one modified nucleotide.

[0773] In some embodiments, the 3' terminal modification is of 1 to 7 or 1 to 5 nucleotides. Includes or further includes modifications.

[0774] In some embodiments, 3' terminal modification involves 1, 2, 3 at the 3' end of the gRNA. It may include or may contain 4, 5, 6, or 7 nucleotide modifications.

[0775] In some embodiments, the 3' terminal modification is approximately 1-3 at the 3' end of the gRNA. It includes or contains modifications of up to 5, 1 to 6, or 1 to 7 nucleotides.

[0776] In some embodiments, the 3' terminal modification involves internucleotide phosphorothioate (PS) ) bond, 2'-O-Me modified nucleotide, 2'-O-moe modified nucleotide, 2'- F-modified nucleotides, inverted debasic modified nucleotides, and combinations thereof It includes one or more of the following:

[0777] In some embodiments, the 3' terminal modification is 1, 2, 3, 4, 5, 6, or 7 Nu Includes or further includes intercleotide PS bonds.

[0778] In some embodiments, the 3'-terminal modification is at least one 2'-O-Me, 2'- Contains or further contains O-moe, inverted debase, or 2'-F modified nucleotides nothing. In some embodiments, the 3'-terminus modification includes one PS bond or more. The bond is between the last nucleotide and the second to last nucleotide. In the embodiment, the 3' terminal modification includes two PS bonds between the last three nucleotides. or further include. In some embodiments, the 3' terminal modification is the last four nucleotides It contains or includes four PS bonds between the dots.

[0779] In some embodiments, the 3' terminal modification is one of the last four nucleotides. or containing or further containing PS bonds between one or more. In some embodiments, 3' end End modifications involve PS bonds between one or more of the last five nucleotides. or further include. In some embodiments, the 3' terminal modification is the last 2, 3, 4, 5, It contains a PS bond between one or more of the 6 or 7 nucleotides or It also includes.

[0780] In some embodiments, the 3' terminal modification is one of the last 1 to 7 nucleotides. It contains one or more modifications, and the modifications include PS bonds, inverted debase nucleotides. These are D, 2'-OMe, 2'-O-moe, 2'-F, or a combination thereof.

[0781] In some embodiments, the 3'-terminus modification is 2'-OMe, 2'-O-moe, 2'- Modification of the last nucleotide by F, or a combination thereof, and optionally by and one or the nucleotide adjacent to the 3' tail and / or the first nucleotide It contains two or more PS bonds.

[0782] In some embodiments, the 3'-terminus modification is 2'-OMe, 2'-O-moe, 2'- F, or any combination thereof, is the last and / or second to last nucleotide. Modifications, and optionally, the compound may contain one or more PS bonds.

[0783] In some embodiments, the 3'-terminus modification is 2'-OMe, 2'-O-moe, 2'- F, or any combination thereof, the last, second to last, and / or third to last. Modification of the nth nucleotide, and optionally, the inclusion of one or more PS bonds. This also includes.

[0784] In some embodiments, the 3'-terminus modification is 2'-OMe, 2'-O-moe, 2'- F, or the last, second to last, third to last, and / Alternatively, modification of the fourth nucleotide from the end, and optionally, one or more PS Includes or further includes bonding.

[0785] In some embodiments, the 3'-terminus modification is 2'-OMe, 2'-O-moe, 2'- F, or any combination thereof, means last, second to last, third to last, last Modification of the fourth and / or last-to-last fifth nucleotide, and optionally by , containing one or more PS bonds.

[0786] In some embodiments, gRNAs with 3' terminal modifications may include a 3' tail or Furthermore, the 3' tail contains any one of the nucleotides present in the 3' tail. Includes the above modifications. In some embodiments, the 3' tail is fully modified. In that embodiment, the 3' tail is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1-2 , 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, or 1-10 Nuk It contains rheotides, and optionally, one or more of these nucleotides are modified. It is on display.

[0787] In some embodiments, a gRNA is provided that includes a 3' terminal modification, The 3' end shown in any one of sequence numbers 101-190 or 795-798 Modifications are included. In some embodiments, gRNAs are provided that include 3' protective end modifications.

[0788] In some embodiments, a gRNA is provided that includes a 3' terminal modification, (i) 2'-OMe modified nucleotide at the last nucleotide of the conserved region of gRNA (ii) Three consecutive 2'O-moe nucleotides immediately 5' of the 2'-OMe modified nucleotide (iii) Modified nucleotides, and three consecutive PS between the last three nucleotides Includes bonding.

[0789] In some embodiments, a gRNA is provided that includes a 3' terminal modification, (i) The five nucleotides from the conserved region of the sgRNA or the last nucleotide of the conserved region of the gRNA (ii) consecutive 2'-OMe modified nucleotides, and between the last three nucleotides It contains three PS bonds.

[0790] In some embodiments, a gRNA is provided that includes a 3' terminal modification, The conserved region of sgRNA or the inverted last nucleotide of the conserved region of gRNA Contains debasitized nucleotides.

[0791] In some embodiments, a gRNA is provided that includes a 3' terminal modification, (i) Inverted debase modification nucleotypic nucleotide at the last nucleotide of the conserved region of gRNA (ii) the last three nucleotides of the gRNA or the conserved region of the gRNA It contains three consecutive 2'-OMe modified nucleotides.

[0792] In some embodiments, (i) 15 from the last nucleotide of the conserved region of the gRNA (ii) consecutive 2'-OMe modified nucleotides (iii) the last three consecutive 2'-F modified nucleotides immediately to the 5' side, and A gRNA containing three PS bonds between nucleotides is provided.

[0793] In some embodiments, (i) the last 20 nucleotides of the conserved region of the gRNA In the case of alternating 2'-OMe modified nucleotides and 2'-F modified nucleotides, (ii) gRNA containing three PS bonds between the last three nucleotides is provided. ru.

[0794] In some embodiments, a gRNA is provided that includes a 3' terminal modification, (i) 2 or 3 consecutive 2'-OMe modified nucleotides, and (ii) the last 3 It contains three PS bonds between the nucleotides.

[0795] In some embodiments, a gRNA is provided that includes a 3' terminal modification, It contains one PS bond between the last nucleotide and the last adjacent nucleotide.

[0796] In some embodiments, (i) 15 or 20 consecutive 2'-OMe modified nuclei (ii) gRNA containing ocid, and (ii) three PS bonds between the last three nucleotides. It will be provided.

[0797] In some embodiments, the gRNA includes 5' and 3' terminal modifications.

[0798] 3' tail In some embodiments, the gRNA is followed by a conserved portion of the gRNA, and the gRNA The storage portion includes a 3' end portion, which is located on the 3' side and includes a 3' tail. In some embodiments, The 3' tail has 1 to approximately 20 nucleotides, 1 to approximately 15 nucleotides, and 1 to approximately 1 0 nucleotides, 1 to approximately 5 nucleotides, 1 to approximately 4 nucleotides, 1 to approximately 3 It contains nucleotides and 1 to about 2 nucleotides. In some embodiments, The 3' tail contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides. In some embodiments, the 3' tail is 1, 2, 3, 4, 5, 6, 7, 8, 9, It contains 10 nucleotides. In some embodiments, the 3' tail contains 1 nucleotide. It contains a rheotide. In some embodiments, the 3' tail contains two nucleotides. In some embodiments, the 3' tail contains three nucleotides. In this state, the 3' tail contains 4 nucleotides. In some embodiments, the 3' tail The values ​​are approximately 1-2, 1-3, 1-4, 1-5, 1-7, 1-10, at least 1-5, and less At least 1-3, at least 1-4, at least 1-5, at least 1-5, at least 1 It contains ~7, or at least 1 to 10 nucleotides.

[0799] In some embodiments, the 3' tail contains 1 to 20 nucleotides and gRNA. It follows the 3' end of the conserved portion.

[0800] In some embodiments, the 3' tail is modified with protective end modifications, internucleotide phosphorothiocyanate Ethol (PS) bond, 2'-OMe modified nucleotide, 2'-O-moe modified nucleotide D, 2'-F modified nucleotides, inverted debasalized nucleotides, and combinations thereof Includes one or more of the combinations.

[0801] In some embodiments, the 3' tail is one or more internucleotide phosphorothioates Includes or further includes a (PS) bond. In some embodiments, the 3' tail is 1 Containing or further containing one or more 2'-OMe modified nucleotides. Several embodiments So, the 3' tail contains one or more 2'-O-moe modified nucleotides or further It includes. In some embodiments, the 3' tail is one or more 2'-F modified nucleotides. Includes or further includes. In some embodiments, the 3' tail has one or more inverted It contains or further contains a debasitized nucleotide. In some embodiments, the 3' nucleotide The code includes or further includes one or more protective end modifications. In some embodiments, The 3' tail has an internucleotide phosphorothioate (PS) bond and a 2'-OMe modified nucleus. Rheotide, 2'-O-moe modified nucleotide, 2'-F modified nucleotide, and inversion It contains or further contains one or more combinations of debasitized nucleotides.

[0802] In some embodiments, the gRNA does not contain a 3' tail.

[0803] 5' end region modification In some embodiments, the 5' terminal region is modified, for example, the first 1 of the gRNA. Two, three, four, five, six, or seven nucleotides are modified. Throughout, this The modification may be referred to as a "5' terminal modification." In some embodiments, the first of the 5' terminal region The 1st, 2nd, 3rd, 4th, 5th, 6th, or 7th nucleotides contain two or more modifications. In the Tsuka embodiment, at the end of the 5' end, the terminal part (i.e., the first) 1, 2, At least one of three, four, five, six, or seven nucleotides is modified. In some embodiments, 1, 2, 3, 4, 5, 6, or 7 in the 5' terminal region At least two of the terminal nucleotides are modified. In some embodiments, This refers to the 1, 2, 3, 4, 5, 6, or 7 terminal nucleotides in the 5' terminal region. At least three of these are modified. In some embodiments, the 5'-terminus modification is This is a 5' protective end modification.

[0804] In some embodiments, both the 5' and 3' terminal regions of the gRNA (e.g., the terminal) The other side is modified. In some embodiments, only the 5' terminal region of the gRNA is modified. In some embodiments, the 3' end region of the conserved portion of the gRNA (plus or Only the -3' tail is modified.

[0805] In some embodiments, the gRNA has the first seven cells in the 5' terminal region of the gRNA. This includes modifications at 1, 2, 3, 4, 5, 6, or 7 of the nucleotides. In one embodiment, the gRNA has seven terminal nucleotides in the 3' terminal region. Includes modifications in 1, 2, 3, 4, 5, 6, or 7 of the following embodiments. So, of the first four nucleotides in the 5' terminal region, 2, 3, or 4 , and / or 2, 3 of the 4 terminal nucleotides in the 3' terminal region, Or four are modified. In some embodiments, the first in the 5' terminal region Two, three, or four of the four nucleotides are phosphorothioate (PS) linked. They are joined together.

[0806] In some embodiments, the 5' and / or 3' terminal modifications are 2'-O-methyl (2'-O-Me) or 2'-O-(2-methoxyethyl)(2'-O-moe) Includes decoration. In some embodiments, the modification is 2'-fluoro(2'-) to the nucleotide. F) Contains modified nucleotides. In some embodiments, the modification is internucleotide phospho It contains a rothioate (PS) bond. In some embodiments, the modification is an inverted debased nucleus. Contains a creotide. In some embodiments, the modification includes a protective end modification. In the embodiment, the modifications are protective end modifications, 2'-O-Me, 2'-O-moe, and 2'-full. Oro(2'-F), internucleotide phosphorothioate (PS) bond, and inverted detachment. It includes two or more modifications selected from the base nucleotide. In some embodiments, equivalent It includes modifications.

[0807] In some embodiments, the gRNA has the first 1, 2, 3, 4, 5 at its 5' end. , containing one or more phosphorothioate (PS) bonds between 6 or 7 nucleotides In some embodiments, the gRNA has the last 1, 2, 3, 4, 5 at its 3' end. , comprising one or more PS bonds between 6 or 7 nucleotides. In some embodiments, gRNA has the last 1, 2, 3, 4, 5, 6, or 7 nuclei at its 3' end. Between rheotides, and the first 1, 2, 3, 4, 5, 6 from the 5' end of the 5' end, or The seven nucleotides each contain one or more PS bonds. In some embodiments, P In addition to the S bond, the 5' and 3' terminal nucleotides are 2'-O-Me and 2'-Om It may contain oe or 2'-F modified nucleotides.

[0808] In some embodiments, the gRNA includes 5' terminal modifications, for example, the end of the guide region. The first nucleotide is modified. In some embodiments, the gRNA has a 5' end modification. The nucleotide in the guide region includes a 5' protective end modification.

[0809] In some embodiments, the 5'-terminus modification is a 2'-O-methyl (2'-O-Me) modification. Nucleotides, 2'-O-(2-methoxyethyl)(2'-O-moe) modified nucleotypes D, 2'-fluoro(2'-F) modified nucleotide, internucleotide phosphorothioate (PS) A selection of (PS)-bound, inverted debasicized nucleotides, or a combination thereof. It contains modified nucleotides.

[0810] In some embodiments, the 5'-terminus modification is a 2'-O-methyl (2'-O-Me) modification. Contains or contains nucleotides.

[0811] In some embodiments, the 5'-terminus modification is a 2'-fluoro(2'-F) modified nucleo Contains or contains tides.

[0812] In some embodiments, the 5' terminal modification involves internucleotide phosphorothioate (PS) ) Includes a bond.

[0813] In some embodiments, the 5' terminal modification includes an inverted debasalized nucleotide. Or further include.

[0814] In some embodiments, the 5' terminal modification involves nucleotide 1 of the guide region of the gRNA. It includes or further includes one or more of the seven modifications. In some embodiments A 5' terminal modification may contain one modified nucleotide or more. In the application form, the 5' terminal modification contains two or more modified nucleotides. In some embodiments, the 5' terminal modification includes three modified nucleotides or more In some embodiments, the 5' terminal modification may consist of four modified nucleotides or Furthermore, in some embodiments, the 5' terminal modification includes five modified nucleotides. or further include. In some embodiments, the 5' terminal modification is a six-modification nucleoty It includes or further includes the 'do'. In some embodiments, the 5' terminal modification is the seven modification nu Contains or further contains creotides.

[0815] In some embodiments, the 5' terminal modification is 1-7, 1-5, 1-4, 1-3, or It contains or includes one or two nucleotide modifications.

[0816] In some embodiments, the 5'-terminus modification is 1, 2, 3, 4, 5, 6 from the 5'-terminus. or comprising or further comprising seven nucleotide modifications. In some embodiments, 5'-terminus modifications consist of approximately 1-3, 1-4, 1-5, 1-6, or 1-7 segments from the 5' end. Includes or further includes nucleotide modifications.

[0817] In some embodiments, the 5' terminal modification involves the first nucleus at the 5' end of the gRNA. This includes or further includes modifications in the rheotide. In some embodiments, 5' end modification Does the modification include modifications at the first and second nucleotides from the 5' end of the gRNA? or further include. In some embodiments, the 5' terminal modification is from the 5' end of the gRNA. Including or further including modifications at the first, second, and third nucleotides. In some embodiments, the 5' end modification is performed on the 1st, 2nd, and 3rd ends of the 5' end of the gRNA. Includes or includes modifications at the 1st and 4th nucleotides. In terms of application morphology, 5' end modifications occur at the 1st, 2nd, 3rd, and 4th positions from the 5' end of the gRNA. , and including or including modifications at the fifth nucleotide. Some implementations Morphologically, 5' terminal modifications are the 1st, 2nd, 3rd, and 4th modifications from the 5' end of the gRNA. , including or including modifications at the 5th and 6th nucleotides. In that embodiment, the 5' end modification is the first, second, and third from the 5' end of the gRNA. , including modifications at the 4th, 5th, 6th, and 7th nucleotides or It also includes.

[0818] In some embodiments, the 5' terminal modification involves internucleotide phosphorothioate (PS) ) bond, and / or 2'-O-Me modified nucleotide, and / or 2'-O -moe-modified nucleotides, and / or 2'-F-modified nucleotides, and / or This may include inverted debasicized nucleotides, and / or combinations thereof. It also includes.

[0819] In some embodiments, the 5' terminal modification is at least 1, 2, 3, 4, 5, 6, and It contains 7 / 7 internucleotide PS bonds. In some embodiments, the 5' end is modified. The ornament consists of approximately 1-2, 1-3, 1-4, 1-5, 1-6, or 1-7 nucleotides between P It contains or further contains S bonds.

[0820] In some embodiments, the 5' terminal modification includes at least one PS bond or Furthermore, if one PS bond is present, the bond is between nucleotides 1 and 2 of the guide region. It is located between these two points.

[0821] In some embodiments, the 5'-terminus modification includes at least two PS bonds or Furthermore, the binding is between nucleotides 1 and 2, and between 2 and 3 in the guide region. ru.

[0822] In some embodiments, the 5' terminal modification is between nucleotides 1 and 2, and between nucleotides 2 and 3. , and further including one or more PS bonds between 3 and 4.

[0823] In some embodiments, the 5' terminal modification is between nucleotides 1 and 2 of the guide region. PS bonds are formed between 2 and 3, between 3 and 4, and between 4 and 5, or in one or more of these pairs. Includes or further includes.

[0824] In some embodiments, the 5' terminal modification is between nucleotides 1 and 2 of the guide region. One or more of the following: between 2 and 3, between 3 and 4, between 4 and 5, and between 5 and 6 Includes or further includes PS bonds.

[0825] In some embodiments, the 5' terminal modification is between nucleotides 1 and 2 of the guide region. Between 2 and 3, between 3 and 4, between 4 and 5, between 5 and 6, and between 7 and 8 It contains one or more PS bonds.

[0826] In some embodiments, the 5' terminal modification is one of the nucleotides 1-7 of the guide region. Contains one or more modifications, the modifications being PS bonds, inverted debasic nucleos Chido, 2'-O-Me, 2'-O-moe, 2'-F, and / or combinations thereof That is so.

[0827] In some embodiments, the 5'-terminus modification is 2'-O-Me, 2'-O-moe, 2' -F, or a combination thereof, modification of the first nucleotide of the guide region, and This includes or further includes optional PS bonding to an adjacent nucleotide.

[0828] In some embodiments, the 5'-terminus modification is 2'-O-Me, 2'-O-moe, 2' -F, or a combination thereof, for the first and / or second guide region Modification of nucleotides, and by optional selection, between the first and second nucleotides or containing one or more PS bonds between the second and third nucleotides or further It is included in.

[0829] In some embodiments, the 5'-terminus modification is 2'-O-Me, 2'-O-moe, 2' -F, or combinations thereof, for the first, second, and / or third variable region. Modification of the nucleotides in the eye, and by optional selection, between the 1st and 2nd nucleotides , between the second and third nucleotides, and / or between the third and fourth nucleotides It contains one or more PS bonds in between.

[0830] In some embodiments, the 5'-terminus modification is 2'-O-Me, 2'-O-moe, 2' -F, or combinations thereof, for the first, second, third, and / ma of the variable regions. Alternatively, modification of the fourth nucleotide, as well as optional modification of the first and second nucleotides Between the nucleotides, between the 2nd and 3rd nucleotides, between the 3rd and 4th nucleotides, and / or containing one or more PS bonds between the 4th and 5th nucleotides or It also includes.

[0831] In some embodiments, the 5'-terminus modification is 2'-O-Me, 2'-O-moe, 2' -F, or combinations thereof for the first, second, third, fourth, and so on of the variable region. and / or modification of the 5th nucleotide, as well as optionally, the 1st and 2nd Between nucleotides, between the 2nd and 3rd nucleotides, between the 3rd and 4th nucleotides Between the 4th and 5th nucleotides, and / or between the 5th and 6th nucleotides The term contains one or more PS bonds between the dots.

[0832] In some embodiments, a gRNA is provided that includes a 5' terminal modification, The 5' end shown in any one of the sequence numbers 101-190 or 795-798 Includes modifications.

[0833] In some embodiments, the sgRNA includes 5' end modifications, including a 5' protective end modification. In some embodiments, a gRNA is provided that includes a 5' terminal modification, Includes 2'-OMe modified nucleotides at nucleotides 1, 2, and 3 in the guide region. nothing.

[0834] In some embodiments, a gRNA is provided that includes a 5' terminal modification, 2'-OMe modified nucleotides in nucleotides 1, 2, and 3 of the guide region, Furthermore, P between nucleotides 1 and 2, 2 and 3, and 3 and 4 in the guide region. Contains S bonds.

[0835] In some embodiments, a gRNA is provided that includes a 5' terminal modification, Nucleotides with 2'-OMe modification at nucleotides 1, 2, 3, 4, and nucleotide 5 in the guide region Contains citrate.

[0836] In some embodiments, a gRNA is provided that includes a 5' terminal modification, 2'-OMe modified nucleotides in guide regions 1, 2, 3, 4, and 5, and Between nucleotides 1 and 2, 2 and 3, 3 and 4, and 4 and 5 in the guide region , and includes a PS bond between 5 and 6.

[0837] In some embodiments, a gRNA is provided that includes a 5' terminal modification, The 2'O-moe modified nucleotides in nucleotides 1, 2, and 3 of the guide region include.

[0838] In some embodiments, a gRNA is provided that includes a 5' terminal modification, 2'O-moe modified nucleotides in guide regions 1, 2, and 3, and guide Includes PS bonds between nucleotides 1 and 2, 2 and 3, and 3 and 4 in the region. nothing.

[0839] In some embodiments, a gRNA is provided that includes a 5' terminal modification, The guide region contains an inverted debase-modified nucleotide at nucleotide 1.

[0840] In some embodiments, a gRNA is provided that includes a 5' terminal modification, Inverted debasic modified nucleotide at nucleotide 1 in the guide region, and guide The region contains 2'-OMe modified nucleotides at nucleotides 1, 2, and 3.

[0841] In some embodiments, a gRNA is provided that includes a 5' terminal modification, Inverted debasalized nucleotide in nucleotide 1 of the guide region, Nu of the guide region 2'-OMe modified nucleotides in creotides 1, 2, and 3, as well as the guide region Between nucleotides 1 and 2, between 2 and 3, between 3 and 4, between 4 and 5, and between 5 and Includes a PS bond with 6.

[0842] In some embodiments, gRNAs are provided that include 5'-terminal modifications and 3'-terminal modifications. In some embodiments, the gRNA has modified nuclei at its 5' and 3' ends. Otide, and modified nucleotides in one or more other regions as listed in Table 3. .

[0843] In some embodiments, sgRNA is not repaired at the 5' or 3' end. Includes decorat...

Claims

1. A guide RNA (gRNA) which is a short single guide RNA (short-sgRNA) containing a guide region and a conserved portion of the sgRNA, wherein the conserved portion is located from 5' to 3' as follows: i) The lower stem region, which consists of nucleotides LS1 to LS6, corresponding to positions 1 to 6 of sequence number 400. ii) The bulge region portion corresponding to nucleotides B1-B2 at positions 7-8 of sequence number 400, iii) The upper stem region, which consists of nucleotides US1 to US12, corresponding to positions 9 to 20 of sequence number 400. iv) The bulge region portion corresponding to nucleotides B3-B6 at positions 21-24 of sequence number 400, v) The lower stem region, which consists of nucleotides LS7 to LS12, corresponding to positions 25 to 30 of sequence number 400. vi) Nexus regions corresponding to nucleotides N1-N18 at positions 31-48 of sequence number 400, and vii) Hairpin area Includes, The aforementioned hairpin region moves from 5' to 3' as follows: (a) A hairpin 1 region corresponding to positions 49 to 60 of sequence number 400, wherein the hairpin 1 region lacks 6 to 8 nucleotides from H1-1 to H1-12, and one or more of positions H1-1, H1-2, or H1-3 are deleted. (b) A nucleotide corresponding to position 61 of sequence number 400, and (c) Hairpin 2 regions corresponding to nucleotides H2-1 to H2-15 at positions 62 to 76 of sequence number 400 Includes, The short-sgRNA includes a 5' terminal modification or a 3' terminal modification. The aforementioned guide RNA (gRNA).

2. The gRNA described in claim 1 is as follows: a) Position H1-1 is missing or replaced, b) Position H1-2 is deleted or replaced, c) Positions H1-3 are deleted or replaced. d) Positions H1-4 are missing. e) Positions H1-5 are missing. f) Positions H1-6 are missing or replaced. g) Positions H1-7 are deleted or replaced. h) Positions H1-8 are deleted or replaced. i) Positions H1-9 are deleted or replaced, j) Position H1-10 is missing or replaced. k) Position H1-11 is missing. l) Position H1-12 is missing. m) Positions H1-11 and H1-12 are missing, n) A combination of two or more of the above a) to m).

3. The gRNA according to claim 1 or 2, which is as follows: a) Positions H1-7 are replaced by G. b) Positions H1-8 are replaced by C. c) Positions H1-6 are replaced by C. d) Positions H1-7 are replaced by U. e) Position H1-1 is replaced by C. f) Positions H1-12 are replaced by G. g) Position N18 is replaced, h) Position N18 is replaced by C. i) Position H1-12 is replaced, j) Positions H1-12 are replaced by C or A. k) Position n is replaced, l) Position n is replaced by A, m) A combination of two or more of the above a) to l).

4. The gRNA according to any one of claims 1 to 3, wherein the upper stem region lacks 1 to 6 nucleotides from US1 to US12.

5. The gRNA according to any one of claims 1 to 4, wherein the hairpin 1 region lacks six nucleotides from among H1-1 to H1-12.

6. The gRNA according to any one of claims 1 to 5, wherein one, two, or three of the Watson-Crick pairing nucleotides H1-1 and H1-12, H1-3 and H1-10, or H1-4 and H1-9 are deleted.

7. The gRNA according to any one of claims 1 to 6, wherein Watson-Crick pairing nucleotides: H1-1 and H1-12, H1-3 and H1-10, and H1-4 and H1-9 are deleted.

8. The gRNA according to any one of claims 1 to 7, wherein the hairpin 1 region includes a loop containing at least H1-5, H1-6, H1-7, and H1-8.

9. The gRNA according to any one of claims 1 to 8, wherein one or more of H1-5, H1-6, H1-7, and H1-8 are substituted.

10. The hairpin 1 region comprises the following sequence, the gRNA according to any one of claims 1 to 9: (i) A sequence selected from any one of AGAGCU, AGAAAU, CGAAAG, AAAAAU, AAAGU, ACAGU, CAAG, or AAAAU, (ii) An array having two or fewer mismatches for any one of the arrays selected from (i), or (iii) An array that has one or fewer mismatches for any one of the arrays selected from (i).

11. The gRNA according to claim 10, wherein the hairpin 1 region includes a sequence selected from any one of AGAGCU, AGAAAU, CGAAAG, AAAAU, AAAGU, ACAGU, CAAG, or AAAU.

12. The gRNA according to claim 10, wherein the hairpin 1 region consists of a sequence selected from any one of AGAGCU, AGAAAU, CGAAAG, AAAAU, AAAGU, ACAGU, CAAG, or AAAU.

13. The gRNA according to claim 10, wherein the hairpin 1 region includes the sequence CGAAAG.

14. The gRNA according to claim 10, wherein the hairpin 1 region consists of the sequence CGAAAG, and the gRNA further includes modifications in the hairpin 1 region, wherein the modifications in the hairpin 1 region include modified nucleotides selected from 2'-O-methyl (2'-Ome) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) bonds, or combinations thereof.

15. The gRNA according to any one of claims 1 to 14, wherein the gRNA includes a 3' tail.

16. The gRNA according to claim 15, wherein the 3' tail contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides.

17. The gRNA according to any one of claims 1 to 14, wherein the gRNA does not include a 3' tail.

18. The gRNA according to any one of claims 1 to 17, comprising modification in the hairpin region.

19. The gRNA according to any one of claims 1 to 18, wherein the guide region is 17, 18, 19, or 20 nucleotides long.

20. The gRNA according to any one of claims 1 to 19, wherein the 3' or 5' terminal modification comprises a modified nucleotide selected from a 2'-O-methyl (2'-Ome) modified nucleotide, a 2'-O-(2-methoxyethyl) (2'-O-moe) modified nucleotide, a 2'-fluoro (2'-F) modified nucleotide, an internucleotide phosphorothioate (PS) bond, an inverted debasitized modified nucleotide, or a combination thereof.

21. The gRNA according to any one of claims 1 to 20, comprising modifications in the hairpin region, wherein the modifications in the hairpin region include modified nucleotides selected from 2'-O-methyl (2'-Ome) modified nucleotides, 2'-fluoro (2'-F) modified nucleotides, internucleotide phosphorothioate (PS) bonds, or combinations thereof.

22. The gRNA according to any one of claims 1 to 21, wherein the 3' and / or 5' terminal modification includes a 2'-O-methyl (2'-Ome) modified nucleotide, an internucleotide phosphorothioate (PS) bond, or a combination thereof.

23. The gRNA according to any one of claims 1 to 22, comprising the modification in the hairpin region, wherein the modification in the hairpin region comprises a 2'-O-methyl (2'-Ome) modified nucleotide.

24. The gRNA according to any one of claims 1 to 16 or 18 to 23, wherein the gRNA includes a 3' tail, and the 3' tail includes one or more modifications from among the nucleotides present in the 3' tail.

25. The gRNA according to claim 24, wherein the 3' tail is completely modified.

26. The gRNA according to claim 25, wherein the 3' tail contains uridine.

27. The gRNA according to claim 26, wherein the 3'-uridine is modified with a phosphorothioate (PS) bond.

28. The gRNA according to any one of claims 1 to 27, wherein the upper stem region includes at least one modification.

29. The gRNA according to claim 28, wherein the modification of the upper stem includes one or more of the following: (a) one or more modifications of US1 to US12 in the upper stem region, (b) Modification of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or all 12 nucleotides in the upper stem region.

30. The gRNA according to claim 29, wherein the modification of the upper stem includes one or more of the following: (a) 2'-Ome modified nucleotide, (b) 2'-O-moe modified nucleotide, (c) 2'-F modified nucleotide, and (d) One or more combinations of (a) to (c).

31. gRNA according to any one of claims 1 to 30, comprising any one of the following nucleotide sequences: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence ID 281); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence ID 681); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAGCUGGCACCGAGUCGGUGC (Sequence ID 5); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGGUGC (Sequence ID 6); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence number 7); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAAUGGCACCGAGUCGGUGC (Sequence number 8); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAGUGGCACCGAGUCGGUGC (Sequence ID 9); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACAGUGGCACCGAGUCGGUGC (Sequence ID 10); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACAAGGGCACCGAGUCGGUGC (Sequence No. 11); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGGUGC (Sequence ID 12); ACACAAAUACCAGUCCAGCGGUUUUAGAGCGAAAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGGUGC (Sequence ID 90); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAGCUGGCACCGAGUCGGUGC (Sequence ID 205); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGGUGC (Sequence ID 206); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAAUGGCACCGAGUCGGUGC (Sequence ID 208); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAGUGGCACCGAGUCGGUGC (Sequence ID 209); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACAGUGGCACCGAGUCGGUGC (Sequence ID 210); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACAAGGGCACCGAGUCGGUGC (Sequence ID 211); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGGUGC (Sequence ID 212); GUUUUAGAGCGAAAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGGUGC (Sequence ID 290); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAGCUGGCACCGAGUCGGUGC (Sequence ID 605); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGGUGC (Sequence ID 606); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAAUGGCACCGAGUCGGUGC (Sequence ID 608); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAGUGGCACCGAGUCGGUGC (Sequence ID 609); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACAGUGGCACCGAGUCGGUGC (Sequence ID 610); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACAAGGGCACCGAGUCGGUGC (Sequence ID 611); N 20 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGGUGC (Sequence ID 612); N 20 GUUUUAGAGCGAAAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGGUGC (SEQ ID NO: 690); ACGCAAAUAUCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence number 809); GCCGAGUCUGGAGAGCUGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence ID 813); UGCUCUGUAAGCUUACCCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence ID 814); ACACAAAUACCAGUCCAGCGGUUUUCGAGCUAGAAAUAGCAAGUGAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence ID 852); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUGAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGGUGC (Sequence ID 853); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUGAUCACGAAAGGGCACCGAGUCGGUGC (Sequence ID 855); ACACAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCCCGAAAGGGCACCGAGUCGGUGC (Sequence ID 857); or ACACAAAUACCAGUCCAGCGGUUUUCGAGCUAGAAAUAGCAAGUGAAAAUGAGGCUAGUCCGUGAUCCCGAAAGGGCACCGAGUCGGUGC (Sequence ID 859).

32. The gRNA according to any one of claims 1 to 31, comprising one of the following modified nucleotide sequences: GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (SEQ ID NO: 381); (mN*) 3 N 17 GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 781); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAGCUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 105); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 106); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 107); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 108); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAGUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 109); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACAGUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 110); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 111); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 112); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 181); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmGmAmAmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 190); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAGCUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 305); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 306); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 307); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 308); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAGUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 309); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACAGUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 310); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 311); GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 312); GUUUUAGAmGmCmGmAmAmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 390); GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmCmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 391); GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 393); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAGCUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 705); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 706); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 707); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 708); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAGUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 709); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACAGUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 710); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 711); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 712); (mN*) 3 N 17 GUUUUAGAmGmCmGmAmAmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAAGAAAUGGCACCGAGUCGG*mU*mG*mC (Sequence ID 790); (mN*) 3 N 17 GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmCmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 791); (mN*) 3 N 17 GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 793); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmCmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 795); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 797); mA*mC*mG*CAAAUAUCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 909); mA*mC*mG*CAAAUAUCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmCmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 911); mG*mC*mC*GAGUCUGGAGAGCUGCAGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence code 913); mU*mG*mC*UCUGUAAGCUUACCCAGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence code 914); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACmGmAmAmAmGmGGCACCGAGUCGG*mU*mG*mC (Sequence ID 921); mA*mC*mA*CAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAGUUAAAAAUAGGCUAGUCCGUUAUCACGAAAGGmGmCmAmCmCmGmGmGmUmCmGmGmG*mCU* (922); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUAAAU*AAG*G*C*UmAGUCmCGUUA*UCA*C*GAAAGGmmCCUCCGAGUCGG*m (923); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmUmAmGmCmAA*G*UUAAAA U*AAG*G*C*UMAGUCmCGUUA*UCA*C*mGmAmAmGmGmGmCmCmCmGmAmGmUmCmGmG*mU*mG*mC (924); mA*mC*ACAA*AUACC*AGUCCAGCGGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAAUAA G*G*C*UmAGUCmCGUUA*UCA*C*mGmAmAmGmGmGmCmGmCmCmGmGmGmCmGmG*mU*mG*mC (925); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUA AAAU*AAGGCUAGUCCGUUAUCA*C*mGmAmAmGmGmGmCmGmGmG*mU*mG*mC (926); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUAAA AU*AAG*G*C*UmAGUCmCGUUA*UCACmGmAmAmGmGmGmCmCmCmGmGmGmCmGmG*mU*mG*mC (927); mA*mC*ACAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 928); mA*mC*mA*CAA*AUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 929); mA*mC*mA*CAAAUACC*AGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 930); mA*mC*mA*CAAAUACCAGUCCAGCGmGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 931); mA*mC*mA*CAAAUACCAGUCCAGCGGU*UUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 932); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAG*AmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 933); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGA*mGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 934); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCmAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 935); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAA*GUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 936); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAG*UUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 937); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAU*AAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 938); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG*GCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 939); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGG*CUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 940); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGC*UAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 941); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUmAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 942); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCmCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 943); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUA*UCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 944); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCA*CGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 945); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAC*GAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 946); mA*mC*ACAA*AUACC*AGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (SEQ ID NO: 947); mA*mC*mA*CAAAUACCAGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUAAAAU*AAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 948); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAG*G*C*UmAGUCmCGUUA*UCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 949); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCA*C*GAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 950); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUCGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUGAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 951); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUGAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 952); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUAAAAU*GAG*G*C*UmAGUCmCGUUA*UCA*C*mGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (SEQ ID NO. 953); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUGAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 954); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUAAAAU*AAG*G*C*UmAGUCmCGUGA*UCA*C*mGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (SEQ ID NO. 955); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCCCGAAAGGGCACCGAGUCGG*mU*mG*mC (enclosure 956); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUAAAA U*AAG*G*C*UmAGUCmCGUUA*UCC*C*mGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Directorate 957); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUCGAmGmCmUmAmGmAmAmUmAmGmCAAGUGAAAAUGAGGCUAGUCCGUGAUCCCGAAAGGGCACCGAGUCGG*mU*mG*mC (enclosure 958); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUCG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UGAAAA U*GAG*G*C*UmAGUCmCGUGA*UCC*C*mGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Directorate 959); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUU*AG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UU*AAAA U*AAG*G*C*UmAGUCmCGUU*A*UC*A*C*mGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Directorate 960); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACmGmAmAmAmGGGCACCGAGUCGG*mU*mG*mC (enclosure 962); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGmGmCmAmCmCmGfAfGfUfCmGmG*mU*mG*mC (Knowledge 963); mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGmGmCmAmCmCmGAGUCmGmG*mU*mG*mC (Chapter 964); mA*mC*mCAAAUACCAGUCCAGCGmGUUUUAGAmGmCmUmAmGmAmAmAmAmGmCmAAGUUAAAAUAAGGCUmAGUCmCGUUAUCACmGmAmAmAmGG*mGmCmAmCmCmGAGUCmGmG*mU*mG*mC (Directorate 965); mA*mC*fAfCAfA*AfUfAfCfC*AfGUCCfAfGCfGmGU*UUUAG*fA*mGmCmUmAmGmAmAmAmUmAmGmCmAfA*G*UUfAAfA AfU*fAfAfG*fG*fC*fUmAGUCmCfGUUA*fUfCA*C*fG*mAmAmAmGfG*mGmCmAmCmCmGfA*fG*fUfCmGmGmU*mG*mC (Directorate 966); mA*mC*ACAA*AUACC*AGUCCAGCGmGU*UUUAG*A*mGmCmUmAmGmAmAmAmUmAmGmCmAA*G*UUAA AAU*AAG*G*C*UmAGUCmCGUUA*UCA*C*G*mAmAmAmGG*mGmCmAmCmCmGA*G*UCmGmGmU*mG*mC (Directorate 967); mA*mC*fAfCAfAAfUfAfCfCAfGUCCfAfGCfGmGU*UUUAG*fAmGmCmUmAmGmAmAmAmAmGmCmAfAG*UUfAA fAAfUfAfAfGfGfCfUmAGUCmCfGUUA*fUfCA*C*fGmAmAmAmGfGmGmCmAmCmCmGfAfGfUfCmGmGmU*mG*mC (Directorate 968); mA*mC*ACAAAUACCAGUCCAGCGmGU*UUUAG*fA*mGmCmUmAmGmAmAmAmAmAmGmCmAfA*G*UUfAAfAAfU*fA fAfG*fG*fC*fUmAGUCmCfGUGA*fUfCA*C*fG*mAmAmAmGfG*mGmCmAmCmCmGfA*fG*fUfCmGmGmU*mG*mC (Directorate 969); mA*mC*fAfCAfA*AfUfAfCfC*AfGUCCfAfGCfGmGU*UUUfAfG*fA*mGmCmUmAmGmAmAmAmUmAmGmCmAfA*fG*fUfUfAAfA fAfU*fAfAfG*fG*fC*fUmAGfUCmCfGfUUfA*fUfCfA*fC*fG*mAmAmAmGfG*mGmCmAmCmCmGfA*fG*fUfCmGmGmU*mG*mC (SEQ ID NO. 970); mA*mC*mA*mCAA*A*fU*fA*fC*fCAfGfUCC*fAfGCGmGUUUfUAGmAmGmCmUmAmGmAmAmUmAmGmCmAmAGUfUmAfAmAfAmUAmAmGmGmCmUmAGUmCmCGUfUAmUmCAmCmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 971); mA*mC*mA*mCAA*A*fU*fA*fC*fCAfGfUCC*fAfGCGGUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 972); mA*mC*mA*mCAAAfU*ACfCAfGUCC*AGCGmGUUUfUAGmAmGmCmUmAmGmAmAmAmUmAmGmCmAmAGUfUAAAAmUAAGGCmUAGUCCGUfUAUmCACGAAAGGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 973); mA*mC*mA*mCAAAfU*ACfCAfGUCC*AGCGmGUUUUAmGmAmGCmUAmGmAmAmAmUAmGCmAmAGUfUAAAAmUAAGGCmUAGUCCGUfUA*mUmCA*CmGmAmAmAmGmGGmCAmCCGfAfGfUCmGG*mU*mG*mC (Sequence ID 974); or mA*mC*mA*CAAAUACCAGUCCAGCGGUUUUAGAmGCmUAmGmAmAmAmUAmGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGmCAmCCGfAfGfUCmGG*mU*mG*mC (Sequence ID 975); (Here, (mN*) 3 The symbols represent three consecutive nucleotides, each having an arbitrary base, 2'-O-Me, and a 3'-phosphorothioate (PS) bond to the next nucleotide, where m represents a nucleotide modified with 2'-O-Me, f represents a nucleotide modified with 2'-F, and * represents a nucleotide linked to the next nucleotide by a PS bond.

33. The gRNA according to any one of claims 1 to 32, comprising any of the following modified nucleotide sequences: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (SEQ ID NO: 307); GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 381); GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmCmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 391); GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 393); (mN*) 3 N 17 GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 707); (mN*) 3 N 17 GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACGAAAGGGCACCGAGUCGG*mU*mG*mC (Sequence ID 781); (mN*) 3 N 17 GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmCmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 791); or (mN*) 3 N 17 GUUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCACmGmAmAmAmGmGmGmCmAmCmCmGmAmGmUmCmGmG*mU*mG*mC (Sequence ID 793); (Here, (mN*) 3 The symbols represent three consecutive nucleotides, each having an arbitrary base, 2'-O-Me, and a 3'-phosphorothioate (PS) bond to the next nucleotide, where m represents a nucleotide modified with 2'-O-Me, and * represents a nucleotide linked to the next nucleotide by a PS bond.

34. A composition comprising the gRNA according to any one of claims 1 to 33, further comprising lipid nanoparticles (LNPs).

35. A composition comprising the gRNA according to any one of claims 1 to 33, further comprising the S. pyogenes Cas9 protein or a nucleic acid encoding the Cas9 protein, or the composition according to claim 34.

36. The composition according to claim 35, wherein the Cas9 protein is nickase or dCas.

37. The composition according to any one of claims 35 to 36, wherein the Cas9 protein is modified.

38. The composition according to claim 37, wherein the modified Cas9 protein comprises a nuclear localization signal (NLS).

39. The composition according to any one of claims 35 to 38, comprising a nucleic acid encoding the Cas9 protein, wherein the nucleic acid encoding the Cas9 protein comprises one of the sequences 1099 to 1127 or 1129 to 1146.

40. A composition comprising the gRNA described in any one of claims 1 to 33 or the composition described in any one of claims 34 to 39, and a pharmaceutically acceptable carrier.

41. An in vitro or ex vivo method for modifying target DNA, S. pyogenes Cas9 protein or nucleic acid encoding S. pyogenes Cas9 protein, as well as the following: i. The gRNA according to any one of claims 1 to 33, ii. The composition according to any one of claims 34 to 39, and iii. The composition according to claim 40 This includes delivering one or more of the following to cells in vitro or ex vivo: The aforementioned method.

42. The method according to claim 41, wherein the method results in an insertion or deletion in a gene.

43. The method according to claim 41 or 42, further comprising delivering a template to the cells, wherein at least a portion of the template is incorporated into target DNA at or near a double-strand break site induced by the Cas9 protein.

44. A gRNA according to any one of claims 1 to 33, a composition according to any one of claims 34 to 39, or a composition according to claim 40, for use in modifying target DNA within an cell or object.

45. A gRNA according to any one of claims 1 to 33, a composition according to any one of claims 34 to 39, or a composition according to claim 40, for use in the manufacture of a pharmaceutical product for treating a disease or disorder.

Images