High-performance manufactured ABCB5+ mesenchymal stem cells
By isolating and culturing ABCB5+ stem cells under specific conditions, the method produces a highly functional synthetic stem cell population with enhanced therapeutic properties, addressing the limitations of existing methods and expanding their applicability.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- CHILDRENS MEDICAL CENT CORP
- Filing Date
- 2025-12-01
- Publication Date
- 2026-05-15
AI Technical Summary
Existing methods for isolating and culturing mesenchymal stem cells often result in loss of important properties, limiting their therapeutic potential and functional capabilities.
A method for isolating and culturing ABCB5+ stem cells under specific conditions to produce a highly functional synthetic stem cell population, ensuring a high percentage of cells are in vitro descendants of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, maintaining or enhancing their therapeutic properties.
The synthetic stem cells exhibit enhanced functional properties, including increased expression of stem cell markers, anti-inflammatory effects, and pluripotent differentiation capabilities, making them suitable for various therapeutic applications.
Smart Images

Figure 2026079824000014 
Figure 2026079824000015 
Figure 2026079824000016
Abstract
Description
[Technical Field]
[0001] Related applications This application claims the benefits under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 62 / 825,785, titled "HIGHLY FUNCTIONAL MANUFACTURED STEM CELLS," filed on 28 March 2019, and U.S. Provisional Application No. 62 / 826,931, titled "HIGHLY FUNCTIONAL MANUFACTURED STEM CELLS," filed on 29 March 2019, each of which is incorporated herein by reference in its entirety. [Background technology]
[0002] Background of the Invention Although not well defined, self-regenerating adult pluripotent mesenchymal stem cells (MSCs) are present in almost all adult connective tissue, including the dermis[1,2]. Their most important function is to maintain their microenvironment, which is an essential requirement for protecting their own stem cell nature and long-term regenerative capacity, which are essential for tissue homeostasis, repair, and organ maintenance[3].
[0003] ATP-binding cassette subfamily B member 5, short-chain ABCB5, also known as P-glycoprotein ABCB5, is a transmembrane protein (Allikmets, et al., 1996). The ABC superfamily of active transporters, including transporters such as ABCB1 (MDR1), ABCB4 (MDR2 / 3), and ABCG2 (Bcrp1, MXR1), has been suggested to be responsible for drug resistance in cancer patients (Moitra and Dean, 2011). These transporters play a role in normal cell transport, differentiation, and survival functions in non-malignant cell types. These well-known ABC transporters are known to be expressed at high levels in stem cell and precursor cell populations. The efflux capabilities of the fluorescent dyes rhodamine 123 and Hoechst 33342, mediated by these and related ABC transporters, have been utilized for the isolation of subsets of such cells from multiple tissues.
[0004] Recently, ATP expression cassette, subfamily B, member 5 (ABCB5) identified a novel dermal immunomodulatory subgroup that, in addition, expresses MSC markers and exerts an inhibitory effect on effector T cells, while enhancing regulatory T cells in vitro and in vivo [5]. ABCB5 belongs to the group of multidrug-resistant cell membrane anchor proteins and is expressed in ocular corneal margin stem cells, where its absence leads to blindness [6].
[0005] Further structural analysis confirmed that ABCB5 is a novel P-glycoprotein in the ABC transporter superfamily (Frank, et al., 2003). Located on chromosome 7p21-15.3, the designated ABCB5 protein labels CD133-expressing precursor cells in human epithelial melanocytes. The ABCB5 gene contains 19 exons and spans 108 kb of genomic DNA. The estimated 812-amino acid ABCB5 protein has five transmembrane helices flanked by both extracellular and intracellular ATP-binding domains.
[0006] Several characteristics are associated with the P-glycoprotein ABCB5, such as its function as a rhodamine-123 efflux transporter and marker for polyploid precursor cell fusion hybrids, as well as its regulation of membrane potential and cell fusion in skin precursor cells, which contributes to proliferation in culture and differentiation in human skin. In physiological skin precursor cells, ABCB5 hyperpolarizes the membrane and, as a determinant of membrane potential, regulates the tendency of this cell population to remain undifferentiated or to undergo differentiation (Frank, et al., 2005, Frank, et al., 2003). In addition, ABCB5-positive cells have been shown to possess anti-inflammatory, pro-angiogenic, and immunomodulatory properties (Schatton, et al., 2015, Webber, et al., 2017). [Overview of the project]
[0007] Summary of the Invention This demonstrates that a population of ABCB5+ stem cells can be reliably isolated from tissue and processed according to GMP standards to produce highly functional synthetic stem cells.
[0008] In some aspects, compositions comprising a population of synthetic ABCB5+ stem cells are provided, where more than 96% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In some embodiments, more than 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In some embodiments, 100% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0009] In some embodiments, more than 90% of the synthetic stem cells in the population co-express CD90. In other embodiments, the synthetic stem cell population can secrete VEGF under hypoxic conditions, which is measured by ELISA. In other embodiments, the synthetic stem cell population can secrete IL-1RA after co-culture with macrophages polarized to Mi. In other embodiments, the synthetic stem cell population induces decreased secretion of TNF-alpha and IL-12 / IL-23p40, as well as increased secretion of IL-10, in macrophage co-cultures compared to isolated physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In other embodiments, the synthetic stem cell population has pluripotent differentiation potential. In other embodiments, the synthetic stem cell population has the ability to differentiate into cells derived from all three germ layers: endoderm, mesoderm, and ectoderm. In other embodiments, the synthetic stem cell population has the ability to differentiate into corneal epithelium. In other embodiments, the synthetic stem cell population exhibits increased expression of stem cell markers, including SOX2, NANOG, and SOX3, compared to isolated physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In other embodiments, the synthetic stem cell population exhibits decreased expression of mesenchymal stromal cell differentiation markers, including MCAM, CRIG1, and ATXN1, compared to isolated physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In other embodiments, at least 5% of the synthetic stem cell population contains exogenous genes. In other embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the synthetic stem cell population contains exogenous genes. In other embodiments, the exogenous genes are genes encoding proteins selected from the group consisting of tissue-specific homing factors, secretory tissue remodeling proteins, growth factors, cytokines, hormones, and neurotransmitters. In another embodiment, at least 5% of the population of synthetic stem cells contain gene modifications.In other embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the synthetic stem cell population includes gene modifications. In other embodiments, synthetic stem cells are modified by delivering a complex comprising a CRISPR RNA guided nuclease and a gene-targeting gRNA. In yet another embodiment, the modified gene is a gene selected from a group consisting of deletion genes in COL7A or ABCB5+ cells.
[0010] In several aspects, the present invention relates to a method for preparing a cell population by isolating primary cells from skin tissue of a human subject; culturing the primary cells in culture medium until the cells produce enough offspring to reach a mixed cell population with a confluence of more than 60%; collecting the mixed cells; culturing the collected mixed cells; recollecting the collected mixed cells; and culturing the cells through at least five passages until the cell population reaches a state in which at least 99% are manufactured synthetic cells and less than 10% are primary physiologically present skin-derived cells; and by isolating ABCB5-positive cells using an ABCB5+ antibody.
[0011] In some embodiments, the method includes recollecting and culturing cells through at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 passages. In other embodiments, the method includes recollecting and culturing cells until the cell population reaches a state where at least 99.99% are manufactured synthetic cells and less than 0.01% are primary physiologically present skin-derived cells. In other embodiments, the method includes recollecting and culturing cells until the cell population reaches a state where at least 99.9995% are manufactured synthetic cells and less than 0.0005% are primary physiologically present skin-derived cells. In other embodiments, the method includes recollecting and culturing cells until the cell population reaches a state where at least 99.999997% are manufactured synthetic cells and less than 0.000003% are primary physiologically present skin-derived cells. In other embodiments, the isolation step includes ABCB5 antibody conjugated to magnetic beads. In another embodiment, cells are cultured in a culture medium prepared using Ham F-10 as the basal medium. In another embodiment, cell confluence and cellular morphology are evaluated at each cell proliferation step. In another embodiment, the final culture and isolation steps are separated by at least 3 days. In another embodiment, cells are collected using EDTA.
[0012] Methods are provided for inducing tissue development in several respects. The methods involve promoting the differentiation of an isolated population of synthetic ABCB5+ stem cells into differentiated tissues, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0013] In other aspects, the present invention relates to a method for promoting syngeneic transplantation, the method comprising administering an isolated population of synthetic ABCB5+ stem cells to a subject having a syngeneic graft, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0014] In other aspects, the present invention relates to a method for treating peripheral artery occlusive disease (PAOD), comprising administering to a subject having PAOD an isolated population of synthetic ABCB5+ stem cells in an effective dose for treating the disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0015] In other aspects, the present invention relates to a method for treating acute exacerbation of chronic hepatic failure (AOCLF), the method comprising administering to a subject having AOCLF an isolated population of synthetic ABCB5+ stem cells in an effective dose for treating the disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0016] In other aspects, the present invention relates to a method for treating corneal margin stem cell deficiency (LSCD), comprising administering to a subject having LSCD an isolated population of synthetic ABCB5+ stem cells in an effective dose for treating the disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0017] In other aspects, the present invention relates to a method for treating a corneal disease, comprising administering to a subject having a corneal disease an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective amount for treating the disease.
[0018] In other aspects, the present invention relates to a method for treating epidermolysis bullosa (EB), the method comprising administering to a subject having EB an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective amount for treating the disease.
[0019] In other aspects, the present invention relates to a method for wound healing of the skin, comprising contacting a wound with an isolated population of synthetic ABCB5+ stem cells in an effective amount to promote wound healing, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In some embodiments, the isolated population of synthetic ABCB5+ stem cells is seeded on a matrix or scaffold. In other embodiments, the matrix is a polymer mesh or sponge, a polymer hydrogel, or a collagen matrix.
[0020] In other words, the present invention relates to a method for administering to a subject undergoing organ transplantation an effective amount of an isolated population of synthetic ABCB5+ stem cells to promote the survival of an allograft, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0021] In other aspects, the present invention relates to a method for treating an autoimmune disease, comprising administering to a subject having an autoimmune disease an effective amount of an isolated population of synthetic ABCB5+ stem cells for treating the autoimmune disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0022] In other aspects, the present invention relates to a method for treating a liver disease, comprising administering to a subject having a liver disease an effective amount of an isolated population of synthetic ABCB5+ stem cells for treating the liver disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0023] In other aspects, the present invention relates to a method for treating a neurodegenerative disease, the method comprising administering to a subject having a neurodegenerative disease an effective amount of an isolated population of synthetic ABCB5+ stem cells for treating the neurodegenerative disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, and wherein the neurodegenerative disease is related to an immune response against host cells.
[0024] In other aspects, the present invention relates to a method for treating a cardiovascular disease, comprising administering to a subject having a cardiovascular disease an effective amount of an isolated population of synthetic ABCB5+ stem cells for treating the cardiovascular disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, and wherein the cardiovascular disease is related to tissue remodeling.
[0025] In other aspects, the present invention relates to a method for treating kidney disease, comprising administering to a subject having kidney disease an effective amount of an isolated population of synthetic ABCB5+ stem cells for treating the kidney disease, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
[0026] In other aspects, the present invention relates to a method for treating an inflammatory disorder, comprising administering to a subject having an inflammatory disorder an effective amount of an isolated population of synthetic ABCB5+ stem cells for treating the inflammatory disorder, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In some embodiments, the inflammatory disorder is selected from the group consisting of cardiovascular disease, ischemic stroke, Alzheimer's disease, and aging.
[0027] In other aspects, the present invention relates to a method for treating a musculoskeletal disorder, comprising administering to a subject having an inflammatory disorder an effective amount of an isolated population of synthetic ABCB5+ stem cells for treating the musculoskeletal disorder, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells. In some embodiments, the musculoskeletal disorder is hereditary muscular dystrophy. In other embodiments, the population of synthetic stem cells is the synthetic cells described herein.
[0028] In other aspects, the present invention is a method for reprogramming cells by using a population of synthetic stem cells as claimed in any one of claims 1 to 18 as a substrate for pluripotent cell reprogramming. In other respects, the present invention relates to a population of synthetic stem cells as described herein, further comprising an exogenous PAX6 gene.
[0029] The use of a population of stem cells of the present invention for treating any of the disorders described herein, for tissue engineering, or for wound healing is also provided as an aspect of the present invention. Methods are also provided for producing a pharmacopoeia of the stem cell population of the present invention for treating any of the disorders described herein, for tissue engineering, or for wound healing.
[0030] Each limitation of the present invention may encompass a variety of aspects of the present invention. Therefore, it is understood that each limitation of the present invention, including any one element or combination of elements, may be encompassed in each aspect of the present invention. In its application, the present invention is not limited to the details of the structural and compositional arrangements described in the following description or illustrated in the drawings. The present invention can be carried out or implemented in other embodiments and in a variety of ways. Furthermore, the expressions and terminology used herein are for illustrative purposes only and should not be considered limiting. The use of “including,” “comprising,” or “having,” “containing,” “involving” and their variations herein is intended to encompass the items listed thereafter and their equivalents, as well as further items.
[0031] The attached drawings are not intended to be drawn to actual size. In the drawings, identical or nearly identical components represented in various drawings are indicated by similar numbers. For clarity, not all components are marked in all drawings. In the drawings: [Brief explanation of the drawing]
[0032] [Figure 1-1] A flowchart outlining the manufacturing process of synthetic stem cells. [Figure 1-2] A flowchart outlining the manufacturing process of synthetic stem cells.
[0033] [Figure 2A-2B]ABCB5+ MSCs may belong to higher fibroblast lineages rather than lower ones. (2A) Heatmap showing transcriptome profiling of samples (n=3) from ABCB5+ derived MSCs at low (2-3) and high (above 10) passages. Colors reflect the log2 scale of relative expression. (2B) Heatmap showing genes involved in maintaining stem cell characteristics from early and late passaged ABCB5+ derived MSCs. [Figure 2C-2E] ABCB5+MSCs may belong to a higher fibroblast lineage rather than a lower one. (2C) Clear co-localization of ABCB5 and the stem cell marker SSEA-4 was observed in a distinguishable subpopulation of dermal cells. (2D-2E) Micrographs of human skin subjected to double immunofluorescence staining for ABCB5 and two marker proteins of “higher lineage” fibroblasts revealed co-expression of ABCB5 and DPP4 (CD26), and partial co-localization of ABCB5 and PRDM1 (BLIMP1). Scale bar: 50 μm; e = epithelium; d = dermis. Dashed lines depict the transition from the dermis to the epithelium. [Figure 2F-2G] ABCB5+MSCs may belong to a higher fibroblast lineage rather than a lower one. (2F) Co-localization of ABCB5 with the stem cell marker POU5F1(OCT-4). (2G) ABCB5 was not consistently found to be co-expressed with α-smooth muscle actin (α-SMA), a marker for lower fibroblast lineages and myofibroblasts. The nuclei and all studied skin sections were counter-stained with DAPI. Scale bar: 50 μm; e = epithelium; d = dermis. Dashed lines depict the transition from the dermis to the epithelium. [Modes for carrying out the invention]
[0034] Description of the Invention In several respects, the present invention relates to a population of skin-derived ABCB5-positive mesenchymal stem cells produced in vitro. These cells represent a significant advance over isolated primary cell populations of skin-derived ABCB5-positive mesenchymal stem cells. Typically, when primary cells are isolated and cultured in vitro, the cells lose important properties associated with the original primary cells. The present invention has found that, under appropriate conditions, ABCB5+ stem cells isolated from human tissue can be passaged in culture to produce a population of cells that are structurally and functionally distinct from the original primary cells isolated from the tissue. These cells are referred to herein as synthetic or produced ABCB5+ stem cells. These cells are produced in vitro such that almost all cells are in vitro descendants of physiologically present skin-derived ABCB5-positive mesenchymal stem cells that have never existed in the human body. Rather, they are newly produced according to newly established culture methods. These cell populations can be distinguished from the original primary cells in that they are highly functional pluripotent cells with many therapeutic applications.
[0035] When used herein, synthetic ABCB5+ stem cells have one or more of the following properties: • Co-expresses CD90 in >90% of cases; • VEGF can be secreted under hypoxic conditions, and this can be measured by ELISA; • After co-culturing with macrophages polarized to Mi, IL-1RA can be secreted; • In macrophage co-cultures, it induces decreased secretion of TNF-alpha and IL-12 / IL-23p40, and increased secretion of IL-10; • Possesses pluripotent differentiation ability; or • Different gene expression profiles.
[0036] The compositions of the present invention are populations of cells. The term “population of cells,” as used herein, means a composition comprising at least two, e.g., two or more, e.g., one or more synthetic ABCB5+ stem cells, and does not imply any level of purity or presence or absence of other cell types unless otherwise specified. In exemplary embodiments, the population substantially contains no other cell types. In other embodiments, the population comprises at least two cells of a specified cell type, or having a specified function or characteristic, such as those listed above.
[0037] In some embodiments, synthetic stem cells induce decreased secretion of TNF-alpha and IL-12 / IL-23p40. These properties of the cells are important for their anti-inflammatory function. As a result of these cytokines, the cells are useful for treating numerous inflammatory diseases. In other embodiments, the cells result in increased IL-10 secretion in macrophage cocultures. IL-10 production is important to support the immunotolerogenic function of synthetic stem cells.
[0038] The cells of the present invention also possess pluripotent differentiation ability. In other words, these cells define other capabilities including differentiation into cells derived from all three germ layers, namely: 1. Endoderm (e.g., angiogenesis - e.g., tubulation, CD31 and VEGFR1 expression), 2. Mesoderm (e.g., myogenesis - e.g., spectrin and desmin expression), and 3. Ectoderm (e.g., neurogenesis - e.g., Tuj1 expression).
[0039] Furthermore, cells produced in vitro possess corneal epithelial differentiation ability (e.g., KRT12 expression), which can be used to treat corneal margin stem cell deficiency and other corneal disorders in vivo. Importantly, the presence of KRT12 in this synthetic cell population provides these cells with a unique ability to treat corneal disorders. This factor is often lost in populations of stem cells isolated from human tissues. It has been proposed that KRT12 should be added to these isolated human cells to treat corneal diseases.
[0040] The synthetic cells of the present invention also have a gene expression profile that is distinguishable from primary stem cells isolated from human tissue. As shown in examples including Figure 2 represented herein, the population of synthetic cells (also referred to as ABCB5+ cells isolated from high passages) differs from primary cells (derived from low passage cultures, including native ABCB5+ cells found in vivo). For example, certain stem cell markers, such as SOX2, NANOG, and SOX3, are increased in high passages, while certain mesenchymal stromal cell differentiation markers, such as MCAM, CRIG1, and ATXN1, are decreased. The expression of selected stem cell markers such as EA-4, DPP4 (CD26), PRDM1 (BLIMP1), and POU5F1 (OCT-4) at the protein level in ABCB5+ cells in human skin was confirmed by immunostaining. On the other hand, the expression of α-smooth muscle actin (α-SMA), a marker of a lower fibroblast lineage, differs from that of ABCB5+ cells in human skin. + It was absent in the cells. These data suggest that these late-passage synthetic cells were ABCB5 + This supports the finding that the pluripotency of cells is maintained, and furthermore, that they possess enhanced properties compared to the original cells.
[0041] The method described herein yields a population of highly pure synthetic cells. In some preferred embodiments, 100% of the cells are synthetic and 0% are derived from human tissue. The process of the present invention allows for up to 16 passages, which is equivalent to 25 cell doublings. Thus, the percentage of cells synthesized in vitro at each passage should be at least the following, and can be estimated by the following formula: [1-1 / (2 n ) × 100%, where n is the multiplier for each passage (i.e., 25 for passage 16, or x / 16 × 25 for passage x)
[0042] Regarding the second and third passages, the cell structure begins to change. For example, the gene expression profiling data discussed above and represented in the examples are shown for low passage numbers (2-3). Therefore, a relatively low passage number of 3 (with 3 / 16 × 25 = 4.6875 doublings) will result in at least 96.12% of cells being produced or synthesized in vitro. A high passage number (>10) with at least 10 / 16 × 25 = 15.625 doublings will result in at least 99.998% of cells being produced or synthesized in vitro. The cell population with the highest passage number tested herein (16 passages) with 25 doublings will result in at least 99.999997% of cells being produced or synthesized in vitro. Since stem cells can also divide symmetrically and asymmetrically, highly passaged cells can reach synthetic cells. Typical passages in the process range from 6 passages (9.375 doublings) to 16 passages (25 doublings), i.e., the range of synthetic purity of the product is typically [1-1 / (2 9 .375)] × 100% ~ [1 - 1 / (2 25 )] × 100%, which means 99.85 to 99.999997%.
[0043] Cell manufacturing process Cell preparation and processing are carried out in accordance with GMP-compliant guidelines and standards. The manufacturing process can be carried out in a clean indoor environment. The manufactured cells produced as described herein are cryopreserved and stored in the gas phase of liquid nitrogen (≤-130°C).
[0044] The basic manufacturing process typically involves four steps: tissue procurement; processing of skin tissue; cell proliferation; and isolation of ABCB5-positive cells. Skin tissue may be taken from human surgical specimens, such as abdominoplasty (or other medical intervention that produces excess skin tissue). A general flowchart representing the manufacturing steps required to produce the synthetic stem cells disclosed herein, starting with skin donor tissue (≥10 cm²), is shown in Figure 1. In-process and release controls are colored orange. T25, T75, and T175 refer to the growth area and associated names of the cell culture flasks (cm²). Cryo refers to the cryogenic storage of cells in the gas phase of liquid nitrogen. BC refers to the barcoded cryovial. mCcP refers to the microbiological control of the cell product. In addition, other in-process controls (IPCs) may be utilized, including skin collagenase / TrypZean dissociation [%], cell morphology, inter-passaging time, confluence, cell detachment after TrypZean application, and incubation time.
[0045] ABCB5-positive cells resulting from a single isolation (by magnetic beads coupled with antibodies) are referred to as a "single batch." Single batches resulting from parallel isolation (derived from the same skin tissue and isolated at the same number and time of passages) are pooled (to create a "masterbatch"), and at least 2 × 10⁶ cells are collected. 6The cells, including individual cells / barcoded cryovials (BCs), are cryopreserved. In parallel with the manufacturing process, all steps and the lot numbers of reagents and critical materials used are described in specific batch documentation. A unique BC number, unique batch number, and clear assignment of storage location (in nitrogen tanks) allow for clear assignment of the generated cell batches. These properties are described in the batch documentation, and also in the "storage location list" for the corresponding nitrogen storage tanks.
[0046] Organizational procurement: The starting material is excess skin tissue from surgical procedures such as abdominoplasty or other medical interventions performed at specialized removal centers.
[0047] Treatment of skin tissue Excess subcutaneous fat is removed from the skin, and then its size is determined (skin size ≥ 10cm). 2 (This is necessary). Then, cut this skin into equal sections (each about 2.5 cm). 2). Up to 30 sections can be processed per processing day (the remaining sections are stored in HTS-FRS biopsy transport solution at +2 to +8°C until processing). Each of two sections can be combined, thereby allowing several preparations to be carried out in parallel per processing day. For disinfection, skin sections are incubated at room temperature (RT) first in an aqueous povidone-iodine solution (Braunol®) and then in an alcohol-based povidone-iodine solution (Braunoderm®). Subsequently, for each washing step, the skin tissue is washed three times with PBSCa / Mg, and the skin is dissected using scissors and forceps. The resulting skin sections are further separated using the enzyme collagenase: the skin samples are incubated in a collagenase / PBSCa / Mg / Pen / Strep solution at 37°C for 1.5 to 6 hours (IPC). The digestion efficiency after the incubation period should be higher than 60% (IPC) and is determined visually. The skin-cell solution is filtered, and the remaining skin is further incubated with non-animal recombinant trypsin (TrypZean®; Sigma-Aldrich) at 37°C for 10–60 minutes (IPC). The filtered fraction, as well as the repeatedly filtered TrypZean-treated remaining skin (digestion efficiency: >85%, determined visually) (IPC), are washed by centrifugation (500 × g, RT for 5 minutes). After centrifugation, the supernatant is removed, and the cell pellet is resuspended in stem cell medium (15% FCS, 2 mM L-glutamine, 0.6 ng / ml bFGF / FGF-2, 6 mM HEPES, 2.8 μg / ml hydrocortisone, 10 μg / ml insulin, 1.12 mg / ml glucose, 6.16 ng / ml PMA, 0.5 μg / ml amphotericin, and 1 × Pen / Strep supplemented Ham F10). The cells are pooled and evenly distributed onto C6 cell culture plates up to 30 wells, and incubated in a cell culture incubator (CO2 content: 3.1%, humidity: 90%; temperature: 37°C).
[0048] Cell proliferation (mixed cell culture) A mixed cell culture is defined as an unseparated cell culture consisting of ABCB5-positive and ABCB5-negative cells prior to isolation. The first assessment of cell confluence (determined visually by an experienced worker) is performed 1–4 days (IPC) after culturing primary skin cells in C6 wells. If confluence is <70% (IPC), the culture medium is changed and the cells are cultured further in C6 wells. This procedure is repeated until the cells reach ≥70% confluence (IPC). It should be noted that primary skin cells are kept in culture medium containing antibiotics / antifungal agents only during the initial 4–6 days (IPC). After this initial period, the cells are cultured only in antibiotic-free medium. In addition, the maximum culture time in C6 wells is 16 days (IPC). If the cells do not reach confluence ≥70% (IPC) within this period, they are discarded.
[0049] If the target confluence of ≥70% (IPC) is reached, collect the cells using TrypZean® and culture them in a T25 plate for further proliferation. After 1–4 days (IPC) of subculturing, reassess the cell confluence. If the cell confluence is <70% (IPC), change the medium and incubate the cells further in a T25 container for a total of 7 days (IPC) (discard the cells if the cell confluence is again <70%) (IPC). If the cell confluence reaches ≥70% within 7 days, collect the cells using TrypZean® and culture them in a T75 plate for further proliferation. At this point, take a sample for mycoplasma testing according to 2.6.7.EP (IPC). Further cell proliferation follows the same scheme.
[0050] MK cryopreservation Harvest cells using TrypZean and obtain cell samples for cell counting and determination of viability. Centrifuge the cell suspension and resuspend the cells in cryopreservation medium CS10 containing DMSO (freezing medium containing DMSO). Obtain samples for mycoplasma testing and then transfer the cells into a defined number of barcode-labeled cryotubes (“BC”). The number depends on the determined cell count. At least 8×10 6 cells are required for cryopreservation of MK. Fill at least one BC (more at higher cell numbers) with 5 - 12×10 6 cells (the final cell - CS10 solution volume is 1.5 ml). Additionally, obtain cell samples to test mCcP to determine the sterility of the mixed primary culture.
[0051] Sub - culture Use the remaining 4×T175 flasks to passage the cells into 16×T175 culture flasks. These 16×T175 flasks are used to isolate ABCB5 - positive cells (synthetic stem cells). For the first isolation, the time from the last passage must be 3 - 10 days and the cells must have reached a certain confluence. Generally, for starting further production steps, the confluence should be 40% - 95%.
[0052] For the isolation of ABCB5 - positive cells, use 12 of the 16×T175 flasks. Distribute the cells from the remaining 4×T175 containers into 16×T175 flasks as previously described and grow the cells for the next round of synthetic stem cell isolation until the maximum passage number reaches 16 or the cell morphology changes (e.g., more differentiated cell morphology) or the cells senesce.
[0053] Isolation of ABCB5 - positive cells (synthetic stem cells) <00004• Pooling of single batches from one donor at the same passage number (isolation of cells derived from the same skin tissue in parallel - preparation of a masterbatch)
[0054] Magnetic isolation of ABCB5-positive cells When the cells (in the 16×T175 flask) reach 75%–95% confluence, remove the medium from the 12×T175 flask and wash the cells with PBS. In addition, take samples to determine any possible mycoplasma contamination. For collection, incubate the cells in Versene® (0.02% EDTA in PBS) at 37°C for 20–30 minutes until >90% of the cells dissociate from the culture vessel. Use Versene instead of TrypZean for this process step because TrypZean treatment results in the loss of epitopes required for antibody-based cell isolation. Dilute the cells by adding PBS to the cell suspension, then centrifuge at 500×g for 5 minutes at room temperature. Remove the supernatant and resuspend all cells in a total of 14 ml of HRG (49.5 Vol / % 5% HSA / 49.5 Vol / % Ringer's lactate / 1 Vol / % 40% glucose) solution and transfer to a 50 ml reaction tube. Remove the sample and perform cell counting and vitality determination, and cell cycle analysis (10 6 The cells are then transferred to the Quality Control facility.
[0055] Add 400 μl of antibody-conjugated magnetic beads targeting ABCB5 to the cells and adjust the final volume to 16 ml using HRG. Incubate the antibody-labeled bead-cell mixture at room temperature for 20 minutes using a sample rotator. Add 29 ml of HRG to the solution and incubate the sample on a magnet for 4 minutes to attract the magnetic beads to the container wall. After this incubation period, carefully remove the supernatant, which mainly consists of ABCB5-negative or low-expressing cells. Wash the remaining antibody-bead-cell mixture with 45 ml of HRG solution. Remove the sample (bead-cell mixture) for ABCB5 content determination and transfer it to a quality control chamber (release parameter).
[0056] The remaining solution is incubated on a magnet for a further 4 minutes. After discarding the supernatant, 3 ml of desorption solution (TrypZean) is added to enzymatically remove the antibody-labeled beads from the ABCB5-positive cells. This is possible because the TrypZean treatment results in the nonspecific removal (peptide cleavage) of the antibody-bound epitopes, thus leading to the separation of the antibody-beads from the cells.
[0057] After incubation at 37°C for 3 minutes, add 3 ml of HRG solution to the reaction tube and place it on the magnet again for 6 minutes to allow it to bind to the magnetic beads. Transfer the supernatant containing the separated ABCB5-positive cells to a fresh 15 ml reaction tube. Rinse the 50 ml reaction tube twice by adding 3.5 ml of HRG solution and incubate it with a magnet for 4 minutes. Transfer the supernatant to another fresh 15 ml tube.
[0058] To further purify the ABCB5-positive cells from the remaining beads, hold them on a magnet for 4 minutes. Transfer the supernatant (13 ml of cell suspension) to a new 15 ml reaction tube and centrifuge at 500 × g for 5 minutes at RT. Discard the supernatant, resuspend the cell pellet in 10 ml of HRG solution, incubate again on a magnet for 6 minutes, then transfer the cell suspension to a new 15 ml reaction tube. Take samples of isolated ABCB5-positive cells (IPCs) for mycoplasma testing (release parameters) and cell count determination and transfer to a quality control chamber. Centrifuge the solution at 500 × g for 5 minutes at RT. Before discarding the supernatant, transfer 100 μl (using an endotoxin-free pipette tip) to an endotoxin-free tube to be used for endotoxin determination (release parameters). Carefully remove the remaining supernatant as well.
[0059] Pooling step for preparing a masterbatch A masterbatch (one final batch of synthetic stem cells) consists of a single batch, which is: • Derived from the same starting material (same donor) • Isolated in parallel on the same day at the same passage number. Resuspend a single batch of cell pellets in CryoStor® CS10. The total number of CS10s and associated barcode tubes (BCs) depends on the number of cells available. Fill each BC with 1.5 ml of cell suspension in a CS10.
[0060] The vials are a minimum of 2 × 10 6 Filled with individual cells (2-18 x 10 6 Cells / BCs). Before freezing the BCs, select one BC as the "Analytic BC for QC" (BC number 1), remove the following samples, and transfer it to the quality control facility for analytical testing (release testing): • Cell count and vitality • Viability, co-expression of CD90, bead residue ·Microbiological control of cellular products (mCcP) The BC tubes are frozen to -150°C in a speed-controlled freezer (freezing rate: 1°C / min up to -100°C; 5°C / min up to -150°C), and then transferred to isolation storage tanks until release.
[0061] To perform all three efficacy assays (tubule formation assay, VEGF ELISA, and IL-1RA ELISA), the "BC for analysis for QC" is thawed by the quality control facility, and cell samples for assay testing are obtained. In these cases, the cryopreserved mixed culture (MK) can be thawed and used for further cell generation. Thus, a large number of ABCB5-positive cells can be isolated from a single skin tissue, resulting in a "biobank" for clinical use.
[0062] The synthetic stem cells produced by these methods were determined to have the following specifications: [Table A]
[0063] The analytical procedures used to evaluate these standards are described in more detail below. 1. mCcP (Microbiological control of cell products) The mCcP method is used for sterility testing of the synthetic stem cells produced. Sampling and probing are performed in a clean indoor facility under a laminar flow hood by skilled personnel in the manufacturing department. Incubation and analysis are performed by skilled personnel in the department.
[0064] Instructions: The 1% total final volume of the product is used for the mCcP test. Two 15 μl samples are taken directly from each cryovial (1.5 ml) of each isolated synthetic stem cell batch for the mCcP test. mCcP is performed using the BacT / Alert 3D 60 system (Biomerieux). The BacT / Alert 3D 60 system consists of two modules: one a controller module and the other an incubator module, and has the capability to simultaneously incubate and detect contamination in 60 samples. Bottles containing culture media are placed in the incubator module equipped with a shaking mechanism.
[0065] Use the following culture medium (provided in the bottle): • BPA (aerobic): Supplemented TSB CO2 atmosphere in 40 ml of oxygen • BPN (anaerobic): Supplemented TSB CO2 atmosphere in 40 ml of nitrogen For the mCcP test, transfer 15 μl of the test material into either a BPN or BPA flask.
[0066] Due to the very small sample size, dilute it with NaCl-peptone buffer solution to a volume of 4 ml. For the mCcP test, inject 4 ml of sample solution (containing 15 μl of cells / CS10 solution) into BPA and BPN bottles using a sterile syringe. If the pH changes due to an increase in CO2 produced by microorganisms, a specialized liquid emulsion sensor (LES) at the bottom of each culture bottle will visibly change color (from gray to yellow). The BacT / ALERT® 3D device measures and analyzes the color change every 10 minutes. If growth is detected, the system will issue an audible and visual warning, and the sample data will be recorded.
[0067] A highly sensitive procedure allows for accurate documentation within 7 days. After this time, all negative probes are seeded onto solid culture media. Furthermore, all positive samples are generally seeded onto solid culture media at the time of detection.
[0068] Planned progress for sampling For planned sampling, the calculation of sample size for mCcP is based on the total batch volume rather than the cryovial volume, and the total sample volume is obtained from a single dedicated unit. At least 1% of the total final volume of the product will be used for the mCcP test. This means that for the mCcP test, either 100 μl (total product volume ≤ 10 ml) or 1% of the total product volume (volume > 10 ml) will be taken directly from the "Analytical BC for QC" (BC number 1) of the synthetic stem cell batch.
[0069] Dilute small sample sizes to a volume of 4 ml with NaCl-peptone buffer solution (following the instructions). For the mCcP test, inject 4 ml of sample solution (containing 100 μl to 300 μl cells / CS10 solution) into BPA and BPN bottles using a sterile syringe. After the incubation period, no microbial growth may be detected. If this tolerance is met, the product then satisfies the "no growth" requirement of the standard parameter "microbial growth of cell products".
[0070] 2. Mycoplasma test For mycoplasma testing of the resulting synthetic stem cells, qPCR is performed. For quantitative real-time PCR-based mycoplasma testing, the Microsart® ATMP Mycoplasma Kit (Minerva Biolabs) is used, which has been validated by the manufacturer (Minerva Biolabs) for detection limits, specificity, and robustness for cultured cells and autologous cell grafts for all listed mycoplasma species. Mycoplasma detection is based on amplification and detection of highly conserved RNA-operons, specifically the 16S rRNA coding region, within the mycoplasma genome.
[0071] For performing mycoplasma qPCR, we will use the StepOne® real-time PCR system manufactured by Life Technologies. For mycoplasma testing, after isolating ABCB5-positive cells, obtain a 200 μl cell suspension during the final washing step on a magnet, then pool the cells and cryopreserve them. After centrifugation of the sample (13000 rpm, 15 minutes), suspend the pellet in 200 μl of Tris buffer.
[0072] The sample is spiked with internal control DNA, and genomic DNA is isolated using the Microsart® AMP extraction kit. Ten μl of the isolated DNA is used for qPCR, which is performed in a 48-well plate. The qPCR includes not only positive and negative controls (provided by the Microsart® ATMP Mycoplasma Kit), but also the internally isolated control, as well as 10 CFUTM sensitivity standards for the Mycoplasma species Mycoplasma orale (MO), Mycoplasma fermentans (MF), and Mycoplasma pneumoniae (MP) as standards for sensitivity.
[0073] The qPCR results will be analyzed. Negative controls must have a Ct- value of ≥40, while positive controls and susceptibility standards must have a Ct- value of <40. Samples obtained from the process are mycoplasma positive if the Ct- value is <40, and mycoplasma negative if the Ct- value is ≥40.
[0074] In the tested cell suspension, mycoplasma DNA amplification does not need to be detectable (detection limit 10 CFU / ml). If this tolerance is met (for all single batches of the masterbatch), the product then satisfies the specification parameter "mycoplasma" requirement "undetectable, <10 CFU / ml".
[0075] 3. Endotoxin levels For the quantitative determination of endotoxin levels, a chromogenic LAL test is used. This is a quantitative photometric method. Measurements are performed using Endosafe®-PTS® and matching LAL cartridges (both manufactured by Charles River Laboratories). The Endosafe®-PTS cartridge is FDA-approved as an LAL test method for in-process control of pharmacological products and end-control of products. Endotoxin testing is performed at an incubation temperature of 37°C ± 1°C, as recommended by the lysate manufacturer. Each cartridge contains specified amounts of FDA-approved LAL reagent, chromogenic substrate, and endotoxin standard control (CSE).
[0076] After isolating ABCB5-positive cells, separating them from antibody-bead complexes, and centrifuging the cells, 100 μl of supernatant is obtained for endotoxin testing and diluted 1:10 with LAL reagent water (LRW-water). For each measurement, 25 μl of sample is pipetted into each of the four sample reservoirs of the LAL-cartridge (inserted in Endosafe®-PTS®). The PTS® reader mixes the sample with LAL reagent (sample channel) or with LAL reagent and positive control (spike channel) in each of the two channels. After incubation and addition of chromogenic substrate, the optical density of each well is analyzed kinetically and measured based on an internal batch-specific standard curve.
[0077] The duplication of decisions is evaluated by calculating the variation in response time between two measurements. If the variation in response time between the duplication of measurements is less than 25 percent, the endotoxin measurement is considered valid. In accordance with this specification, the measured samples must achieve an endotoxin level of ≤2 EU / ml (for all single batches of the masterbatch).
[0078] 4. Cell count and cell vitality Automated methods for cell counting and determining cell vitality are employed by using flow cytometry. Flow cytometry (BD Accuri™ C6 flow cytometer) provides a rapid and reliable method for quantifying live cells in cell suspension. One method for assessing cell vitality is to use dye exclusion. Live cells have a complete membrane, which excludes various dyes that readily penetrate the damaged, permeable membrane of non-live cells.
[0079] Propidium iodide (PI) is a membrane-impermeable dye that is generally excluded from living cells but can penetrate the cell membranes of dying or dead cells. It binds to double-stranded DNA by being inserted between base pairs. PI is excited at 488 nm, has a relatively large Stokes shift, and emits light at a maximum wavelength of 617 nm. Cell counting and vitality determination are performed after the isolation of synthetic stem cells, immediately before their cryopreservation.
[0080] For analysis, 10 μl of cell suspension is pipetted from the cryovial into a 1.5 ml reaction tube (containing 80 μl of Versene) and handed over to the quality control department. After adding 10 μl of PI solution (1 mg / ml), the total volume is adjusted to 500 μl with Versene, and measurements are performed using a BD Accuri™ C6 flow cytometer according to the operating instructions. Each measurement is performed using 55 μl of sample solution. Cell counts and vitality are calculated and recorded in the test report. The specified acceptable threshold for cellular vitality is ≥90%. The specified acceptable threshold for the cell count in each batch of isolated synthetic stem cells is 2 × 10⁻⁶. 6 ~18×10 6 It is a cell / cryovial.
[0081] 5. Cellular Viability An automated method for determining cell viability is performed using flow cytometry. To determine viability, cells are stained with calcein-AM (calcein acetoxymethyl ester). Calcein AM is a non-fluorescent, hydrophobic compound that readily penetrates intact living cells. After entering the cell, intracellular esterases cleave the acetoxymethyl (AM) ester group to produce calcein. Calcein is a hydrophilic, highly fluorescent compound that is well retained in the cytoplasm.
[0082] Apoptotic cells with damaged cell membranes and dead cells do not retain calcein. Calcein is optimally excited at 495 nm and has a peak emission at 515 nm. For isolated ABCB5-positive cells (synthetic stem cells), cell viability is measured immediately before cell cryopreservation. Unlike cell vitality determination by PI, which only distinguishes living cells from dead cells, the cell viability rate provides information about the actual metabolic activity of the isolated cells.
[0083] For measurement, 100 μl of cell suspension (in cryopreserved medium CS10) is taken from the cryotube, transferred to a 1.5 ml reaction tube containing 1 ml of Versene (0.02% EDTA), and handed over to the quality control department. The sample can be stored at 2–8°C for up to 2 hours. For sample preparation, cells are centrifuged (5 minutes, 1500 rpm), the supernatant is removed, and the cell pellet is resuspended in 200 μl of Versene. After adding 2 μl of calcein-AM (1:200 dilution, fc0, 1 μM) (and 1 μl of CD90 antibody), the sample is incubated at 37°C for 30 minutes, followed by a washing step with 1 ml of Versene, centrifugation (5 minutes, 1500 rpm), and resuspending of the pellet in 200 μl of Versene. Cell viability is measured using a BD Accuri™ C6 flow cytometer. Viability will be calculated using the detected calcein fluorescence and described in the test report. The specified acceptable threshold for cellular viability is ≥90%.
[0084] 6. CD-90 Surface Marker To confirm that isolated ABCB5+ cells are indeed stem cells, the expression of the mesenchymal stem cell marker, the surface protein CD90, is analyzed by flow cytometry (BD Accuri™ C6 flow cytometer). For CD90 detection, an Alexa Fluor® 647-conjugated antibody oriented to CD90 is used. The Alexa Fluor® 647 dye is a bright near-infrared fluorescent dye highly suitable for flow cytometry applications and is ideally excited to 594 nm or 633 nm laser beams. For favorable signal generation in imaging and flow cytometry, the Alexa Fluor® 647 dye is pH insensitive over a wide molar concentration range. Due to the differing excitation and emission wavelengths of Alexa Fluor® 647 and calcein (see viability testing), parallel flow cytometry analysis of Alexa Fluor® 647 CD90 and calcein-AP can be performed.
[0085] For measurement, 100 μl of cell suspension (in cryopreserved medium CS10) is taken from the cryotube, transferred to a 1.5 ml reaction tube containing 1 ml of Versene (0.02% EDTA), and handed over to the quality control department. The sample can be stored at 2-8°C for up to 2 hours. For sample preparation, cells are centrifuged (5 minutes, 1500 rpm), the supernatant is removed, and the cell pellet is resuspended in 200 μl of Versene. After adding 1 μl of CD90-Alexa Fluor® 647 antibody (1:200) and 2 μl of calcein-AM (1:200 dilution, fc0, 1 μM), the sample is incubated at 37°C for 30 minutes, followed by a washing step with 1 ml of Versene, centrifugation (5 minutes, 1500 rpm), and resuspending of the pellet in 200 μl of Versene. CD90 expression will be measured using a BD Accuri™ C6 flow cytometer. CD90+ cells will be detected by their high Alexa Fluor® 647 fluorescence, and their content will be calculated and reported in the test report. The identified acceptable criterion is ≥90% CD90-positive cells.
[0086] 7. Bead residue To check whether the isolated synthetic stem cells were effectively and completely separated from the ABCB5 antibody-beads by the desorption solution, the cells are tested against the bead residue. This analytical method is also performed in parallel with viability and CD90 expression testing by flow cytometry.
[0087] Isolated ABCB5-positive cells are treated with TrypZean. The enzymatic activity of TrypZean causes complete cleavage of the mAb binding site on the extracellular loop of the ABCB5 protein. Insufficient bead detachment or cell washing may result in residual beads in isolated synthetic stem cells, which must be analyzed.
[0088] BD Accuri™ C6 is used for visualization / detection of residual beads by flow cytometry. Before the first analysis, a gate is set up in the FSC / SSA-Dot Plot using cell-free ABCB5-bead solution to visualize bead residue. Since it is not possible to rule out the possibility of cells also being counted / detected in the gate, the analysis is combined with calcein staining for viability testing. For the analysis, only events present in the bead gate that are calcein-negative are considered. Therefore, live cells are excluded from the analysis, and only beads are counted.
[0089] Sample preparation and measurement using the BD Accuri™ C6 flow cytometer should be performed according to the operating instructions, as already described in "Cell Viability" and "CD90-Surface Markers." The percentage of residual beads should be calculated and recorded in the test report. The identified acceptable threshold is ≤0.5% residual beads in synthetic stem cells.
[0090] 8. Determination of ABCB5 content After the isolation of synthetic stem cells, the actual content of ABCB5-positive cells is determined by flow cytometry. ABCB5-positive cells are detected using donkey α-mouse Alexa-647 antibody. This secondary antibody is oriented towards monoclonal α-ABCB5 antibody. In addition, this secondary antibody is coupled to Alexa-647, a fluorescent dye that enables detection by flow cytometry. Therefore, the emitted fluorescence directly correlates with the number of bound antibodies, but does not correlate with the actual amount of antibody bound to ABCB5-positive cells, as free / unbound bead-antibody complexes are also detected. To obtain the actual number of ABCB5-positive cells, further staining with calcein-AM is performed, which allows for differentiation between cells (live) and bead-antibody complexes (non-live). Free bead-antibody complexes are excluded by considering only calcein-positive events for analysis.
[0091] Desorption of magnetic beads from cells by TrypZean results in the loss of ABCB5 protein on the cell surface; therefore, detection of ABCB5 by antibody is impossible after desorption. Accordingly, 200 μl of sample is obtained for content determination after magnetic bead addition, incubation, and magnetic separation, but before the addition of TrypZean. Cells still bound to beads coupled with magnetic antibodies are transferred to the quality control facility and used directly for analysis or stored at 2–8°C for up to 2 hours. After centrifugation, cells are resuspended in 200 μl of secondary antibody solution (donkey α-mouse Alexa 647, diluted 1:500 with Versene) and 7 μl of calcein-AM, and incubated at 37°C for 20–30 minutes. Cells are centrifuged, washed with Versene, and finally resuspended in 200 μl of Versene for analysis.
[0092] ABCB5 content is measured using a BD Accuri™ C6 flow cytometer according to the operating instructions. Unbound bead-antibody complexes are excluded from the analysis by gating only cells with high calcein fluorescence. The percentage of ABCB5-positive cells is calculated from the Alexa-647 fluorescence of the secondary antibody. The specified acceptable threshold for the content of ABCB5-positive cells after isolation of synthetic stem cells is ≥90% (for each single batch of the masterbatch).
[0093] 9. Efficacy Assay 1: Angiogenic Differentiation (Tube Formation Assay) One important criterion for the release of synthetic stem cells is the cell's ability to undergo transdifferentiation. During this process, the synthetic stem cells are tested to see if they can undergo angiogenic differentiation. Differentiation ability is tested using the so-called tubular formation assay, one of the most widely used in vitro assays to measure angiogenesis. This rapid assay tests the ability of cells to construct three-dimensional structures (tubular formation) in the presence of the extracellular matrix.
[0094] For testing all three types of efficacy assays, use the defined "Analytical BC for QC" and melt it. The differentiation assay will be performed according to the operating instructions. For the tube formation assay, use 1 × 10⁶ 5 and 1.5 × 10 5 Individual cells are seeded (in stem cell medium) into two wells of a 24-well plate (coated with ECM matrix) and incubated in a CO2 incubator for 19–22 hours. Photographs are taken under a microscope (40x magnification) and saved for analysis. The identified acceptance criterion for the efficacy assay is tube formation for at least one of the two tested cell concentrations (quantitative analysis).
[0095] 10. Efficacy Assay 2: VEGF secretion after hypoxia VEGF secretion after hypoxic culture of isolated cells serves as a second efficacy assay. This method tests the ability of ABCB5-positive cells to enhance angiogenesis via paracrine factors. For the test, use the defined "Analytical BC for QC" and melt it. For the assay, 3 × 10 5 Individual cells are seeded in a cell culture dish (35 × 10 mm) (in stem cell medium) and cultured at 37°C for 48 hours (±2 hours) under hypoxic conditions (1% O2 in a hypoxic chamber). The supernatant is collected and used for VEGF ELISA. The identified acceptable threshold, based on validation data, is >46.9 pg / ml of VEGF in the cell supernatant after hypoxic culture.
[0096] 11. Efficacy Assay 3: IL-1RA secretion after co-culture with macrophages polarized to M1. Determining IL-1RA secretion after co-culture with M1-polarized macrophages and stimulating an inflammatory environment should demonstrate the immunomodulatory capacity of ABCB5-positive cells.
[0097] At the start of the assay, THP-1 cells are differentiated into macrophages (Mφ) by adding PMA (150 nmol / ml) to the cell culture medium. After 48 hours, the macrophages are co-cultured with ABCB5-positive cells (synthetic stem cells). Therefore, they are thawed using the defined "BC for analysis for QC". 2 × 10⁶ cells are thawed in two wells of a 24-well plate. 4 A number of ABCB5-positive cells, 1 x 10 5 The macrophages are co-cultured for 48 hours. In one well, the environment is stimulated by adding 50 IU / ml of IFN-g at the start of co-culture. After 24 hours of co-culture, the stimulation is repeated by adding 20 ng / ml of LPS and again 50 IU / ml of IFN-g. Two days after co-culture, the supernatant is collected and used for IL-1RA ELISA. The identified acceptable threshold, based on validation data, is the secretion of IL-1RA >125 pg / ml after co-culture with macrophages (and stimulation of an inflammatory environment).
[0098] The synthetic ABCB5+ stem cells of the present invention can be used for many different therapeutic purposes. For example, the synthetic cells can be used for wound healing of allogeneic skin grafts, allografting, peripheral artery occlusive disease (PAOD), acute exacerbation of chronic hepatic failure (AOCLF), epidermolysis bullosa (EB), and many other diseases. For example, based on the newly demonstrated KRT12+ corneal differentiation ability, they can be used for the treatment of corneal margin stem cell deficiency (LSCD) and other corneal disorders (similar to corneal margin ABCB5+ stem cells already in clinical trials as allogeneic grafts, but with the advantage that in LSCD or corneal disorders, isolation from patient skin allows ABCB5+ skin stem cells to be used as patient-autologous allogeneic grafts, thus avoiding graft rejection).
[0099] As outlined in the paper Dinarello et al. Nat Rev Drug Discov. 2012, the treatment of inflammatory and immune-induced disorders that involve IL-1 beta and are responsive to IL-1RA, or disorders driven by TNF-alpha (e.g., rheumatoid arthritis) or IL-12 / IL-23p40 (e.g., psoriasis), or diseases accepted by IL-10 / regulatory T cell treatment (e.g., graft rejection) is also intended. The potential applications for inflammation-driven disease processes are very large, including, for example, cardiovascular disease, ischemic stroke, Alzheimer's disease, and aging. Similarly, immune disorders such as graft rejection or graft-versus-host disease should be treated with this cell therapy.
[0100] Further treatment of diseases based on the neurogenic and myogenic differentiation capabilities of this synthetic cell preparation would include stroke or other CNS disorders that rely on tissue repair for improvement, or musculoskeletal disorders that rely on muscle repair, such as hereditary muscular dystrophy.
[0101] The cell composition is also intended to be useful in further improvements to ABCB5+ stem cells, including, for example, the introduction of tissue-specific homing factors that target them to specific tissues, secreted molecules involved in tissue remodeling, and gene transfers that induce the expression of growth factors, cytokines, hormones, and neurotransmitters that may be dysregulated in patients. In addition, the correct gene may be introduced to enable stem cell-based repair of genetic disorders in which a specific gene is deficient (e.g., COL7A in RDEB). Alternatively, the deficient gene in ABCB5+ stem cells may be corrected by various gene editing techniques before transplantation into syngeneic patients.
[0102] In addition, these cells may be used as a composition for pluripotent cell reprogramming or for precursor genes. For example, the inventors have found that these cells are ABCB5 -We demonstrated that these cells are more easily reprogrammed into iPSCs than regular cells. Furthermore, overexpression of PAX6 in these cells can further improve their corneal differentiation ability, as has been shown for other skin precursors.
[0103] Due to their ability to implant and release wound-healing-promoting factors, there is a deep interest in advanced MSC-based therapies for patients with acute and chronic wounds. To date, 1–2% of the population in developed countries suffers from non-healing wounds, and the incidence of chronic wounds is estimated to increase due to the global rise in obese and diabetic elderly populations [4]. One major hurdle that still hinders successful implementation in the clinical deployment of large-scale MSC-based therapies is the absence of cell surface markers that would ensure the enrichment and proliferation of MSCs for reproducible paracrine efficacy and potency.
[0104] Although etiologically different, chronic wounds share the common characteristic of persistently large numbers of overactivated pro-inflammatory M1 macrophages [7, 8], with enhanced release of TNFα and other pro-inflammatory cytokines. These pro-inflammatory cytokines, along with proteases and reactive oxygen species, lead to tissue destruction and the establishment of senescence programs in resident wound site fibroblasts, thereby perpetuating the non-healing state of these wounds. Iron accumulation was previously identified in macrophages present in chronic venous lower extremity ulcers as a result of persistent extravasation of red blood cells at the wound site due to elevated blood pressure and venous valve insufficiency. Iron-overloaded macrophages in these wounds are unable to switch from their pro-inflammatory M1 state to the anti-inflammatory M2 macrophages necessary for tissue remodeling and repair [7]. M2 macrophages, in contrast to their M1 counterparts, exhibit lower release of inflammatory cytokines and produce growth factors and metabolites that stimulate tissue repair and wound healing [9]. Conversely, effector molecules such as TNFα and IL-1β are released, particularly by M1 macrophages, maintaining a vicious cycle of M1 macrophage autosecretion and steady activation, thereby effectively locking the wound into a state of persistent inflammation and non-healing [7, 8].
[0105] ABCB5 is used to counteract persistent inflammation and switch dominant M1 macrophages to tissue-repair-promoting M2 macrophages, which are a necessary condition for the healing of chronic wounds. + We focused particularly on the involvement of the paracrine mechanism used by the originating MSCs.
[0106] To rule out the effects of any transplantation or cell fusion, we closely mirror the main pathogenic aspect of unrestricted M1 macrophage activation in human chronic wounds.[7] Human ABCB5 to chronic wounds in an iron-overload mouse model + A xenograft model using locally injected MSCs was intentionally employed. The clinical-grade approved ABCB5 model was used. +Using MSC preparations, which exhibit demonstrated clonal triseries differentiation ability, enhanced clonal proliferation, and in vitro TNFα inhibitory activity as a useful predictor for successful treatment of chronic wounds in vivo. ABCB5 injected during iron-overloaded wounds. + Derived MSCs were found to enhance the release of paracrine IL-1 receptor antagonists (IL-1RAs), and in fact, to switch the dominant M1 pro-inflammatory macrophage phenotype, which is excessively increased in chronic iron-overloaded mouse wounds, to anti-inflammatory M2 macrophages, thereby promoting overall wound healing. + The causal role of paracrine release of IL-1RA from MSCs is that injection of human recombinant IL-1RA promoted wound healing, while IL-1RA silenced ABCB5 + This was supported by the finding that injection of derived MSCs did not promote wound healing. Notably, these data were supported by humanized NOD-skid IL2rγ. null In (NSG) mice, the shift from human pro-inflammatory M1 to anti-inflammatory M2 macrophages was reproduced, along with marker-rich ABCB5 for long-term patient benefit. + This further paved the way for a successful replacement of MSC treatment in clinical practice.
[0107] Synthetic ABCB5+ stem cells are preferably isolated. “Isolated synthetic ABCB5+ stem cells,” as used herein, refers to a preparation of cells placed under conditions different from their natural environment. The term “isolated” does not preclude the subsequent use of these cells in combination with or in mixtures of other cells, or in an in vivo environment.
[0108] Synthetic ABCB5+ stem cells may be prepared as a substantially pure preparation. The term “substantially pure” means that the preparation substantially contains no cells other than ABCB5-positive stem cells. For example, ABCB5 cells should constitute at least 70 percent of the total cells present, with a larger percentage, e.g., at least 85, 90, 95, or 99 percent, being preferable. The cells may be packaged in a finished pharmaceutical container, such as an injection vial, ampoule, or infusion bag, together with any other desired components, e.g., agents for preserving cells or reducing bacterial growth. The composition should be in unit dose form.
[0109] Synthetic ABCB5+ stem cells are useful in several ways for treating immune-mediated diseases. Immune-mediated diseases are diseases associated with adverse immune responses, i.e., those that cause tissue damage. These diseases include, but are not limited to, transplantation, autoimmune diseases, cardiovascular diseases, liver diseases, kidney diseases, and neurodegenerative diseases.
[0110] It has been found that synthetic ABCB5+ stem cells can be used in transplantation to restore the immune system's response, such as reducing or eliminating the immune response to an antigen. Transplantation is the act or process of transferring tissue or organs from one body or part of a body to another. Synthetic ABCB5+ stem cells may be autologous (derived from the same host) or non-autologous, such as allogeneic or syngeneic cells to the host. Non-autologous cells originate from a person other than the patient or organ donor. Alternatively, synthetic ABCB5+ stem cells may be obtained from a source that is heterogeneous to the host.
[0111] Allogeneic cells refer to genetically distinct cells that belong to the same species as the host or donor, or are derived from it. Therefore, allogeneic human mesenchymal stem cells are mesenchymal stem cells obtained from a human other than the intended recipient of synthetic ABCB5+ stem cells or organ donors. Homogeneous cells refer to genetically identical or closely related cells that are immunologically compatible with the host or donor, i.e., cells from individuals or tissues with the same genotype. Heterogeneous cells refer to cells that originate from or are derived from an organism of a different species from the host or donor.
[0112] Therefore, synthetic ABCB5+ stem cells are used to suppress or restore the immune response to a graft (tissue, organ, cells, etc.) by administering synthetic ABCB5+ stem cells to the graft recipient in an effective amount to suppress or restore the immune response to the graft.
[0113] Therefore, the method can be achieved by contacting the donor tissue recipient with synthetic ABCB5+ stem cells. Synthetic ABCB5+ stem cells can be administered to the recipient before, simultaneously with, or after the graft. When the stem cells are administered before the graft, they should typically be administered up to 14 days before surgery, and preferably up to 7 days before. The administration may then be repeated periodically (e.g., once a week).
[0114] Synthetic ABCB5+ stem cells can also be administered to the recipient as part of a graft. For example, synthetic ABCB5+ stem cells may be perfused into an organ or tissue before transplantation, or the tissue may be transplanted and then treated during surgery.
[0115] Treatment to reduce the severity of graft rejection episodes in patients who have received grafts, or to eliminate graft rejection episodes, can also be achieved by administering ABCB5+ stem cells to the recipient of donor tissue synthesis after the donor tissue has been transplanted during the recipient's life.
[0116] Reducing the immune response of donor tissue, organ, or cells to the recipient, i.e., the graft-versus-host response, can be achieved by treating the donor tissue, organ, or cells with synthetic ABCB5+ stem cells ex vivo before transplantation into the recipient tissue, organ, or cells. Synthetic ABCB5+ stem cells reduce the responsiveness of T cells in the graft that can later be activated against the recipient's antigen-presenting cells, thereby allowing the graft to be introduced into the recipient's (host's) body without, or with reduced, the occurrence of a harmful response of the graft to the host. Thus, so-called "graft-versus-host" disease can be prevented.
[0117] Synthetic ABCB5+ stem cells may be obtained from a recipient or donor, for example, before transplantation. Synthetic ABCB5+ stem cells may be isolated and cryopreserved until needed. Synthetic ABCB5+ stem cells may also be cultured to the desired quantity and stored until needed. Alternatively, they may be obtained immediately before use.
[0118] Synthetic ABCB5+ stem cells are administered to the recipient in an effective amount to reduce or eliminate an ongoing adverse immune response induced against the host by the donor graft. Presentation of synthetic ABCB5+ stem cells to a host experiencing an adverse immune response induced by the graft inhibits the ongoing response, prevents T cell restimulation, and thereby reduces or eliminates the adverse response by activated T cells against host tissue.
[0119] As part of the transplantation procedure, synthetic ABCB5+ stem cells may be modified to express molecules such as cell death-inducing molecules to enhance their protective effect. As described in more detail below, dermal synthetic ABCB5+ stem cells can be manipulated to produce proteins using exogenously added nucleic acids. For example, synthetic ABCB5+ stem cells can be used to deliver molecules to the immune system that induce apoptosis of active T cells carrying receptors for those molecules. This results in a deficiency of active T lymphocytes and suppression of an undesirable immune response to the graft. Therefore, dermal synthetic ABCB5+ stem cells may be modified to express cell death molecules. In a preferred embodiment of the method described herein, synthetic ABCB5+ stem cells express the cell death molecule Fas ligand or TRAIL ligand.
[0120] In all cases, an effective dose of cells (i.e., a sufficient number to prolong the survival of the allograft) should be administered to the patient. The number of cells administered is generally 1 × 10⁶. 7 ~1 × 10 10 It should be within the range of 1 × 10, and in most cases, 1 × 10 8 ~5×10 9 It should be so. The actual dosage and administration schedule will be determined on a case-by-case basis by the attending physician, taking into account factors such as the patient's age, weight, and physical condition, using methods that are standard in the field of clinical medicine. If the patient shows signs of graft rejection, the dosage and / or frequency of administration may be increased. The cells will usually be administered by intravenous injection or infusion, but methods such as transplanting the cells near the organ transplant site may also be used.
[0121] Synthetic ABCB5+ stem cells can be administered to transplant patients as a standalone immunomodulator or as part of a treatment plan that also includes other immunomodulators. For example, patients may also be administered: monoclonal antibodies or other compounds that block the interaction between CD40 and CD40L; inhibitors of lymphocyte activation and subsequent proliferation such as cyclosporine, tacrolimus, and rapamycin; or immunosuppressants that act by other mechanisms such as methotrexate, azathioprine, and cyclophosphamide, or anti-inflammatory compounds (e.g., corticosteroids such as dexamethasone and prednisolone).
[0122] The dermal synthetic ABCB5+ stem cells of the present invention are also useful for treating and preventing autoimmune diseases. Autoimmune diseases are a class of diseases in which the subject's own antibodies react against host tissue, or immune effector T cells are autoreactive to endogenous self-peptides, causing tissue destruction. Thus, the immune response is initiated against the subject's own antigens, which are referred to as autoantigens. Autoimmune diseases include, but are not limited to, rheumatoid arthritis, Crohn's disease, multiple sclerosis, systemic lupus erythematosus (SLE), autoimmune encephalomyelitis, myasthenia gravis (MG), Hashimoto's thyroiditis, Goodpasture syndrome, pemphigus (e.g., pemphigus vulgaris), Graves' disease, autoimmune hemolytic anemia, autoimmune thrombocytopenic purpura, scleroderma due to anti-collagen antibodies, mixed connective tissue disease, polymyositis, pernicious anemia, idiopathic Addison's disease, autoimmune-related infertility, glomerulonephritis (e.g., crescentic glomerulonephritis, proliferative glomerulonephritis), bullous pemphigoid, Sjögren's syndrome, insulin resistance, and autoimmune diabetes. “Autoantigen” as used herein refers to antigens of normal host tissue. Normal host tissue does not include cancer cells.
[0123] One example of an autoimmune disease is anti-glomerular basement membrane (GBM) disease. GBM disease arises from an autoimmune response directed against the non-collagenous domain 1 (3(IV)NC1) of the third chain of type IV collagen, leading to rapid, progressive glomerulonephritis (GN) and ultimately renal failure in affected patients. The efficacy of dermal synthetic ABCB5+ stem cells in a GBM model has been demonstrated, as described in the following example. Autoreactive antibodies that recognize 3(IV)NC1 are considered a characteristic feature of the disease. In addition, 3(IV)NC1 autoreactive T helper (Th)1-mediated cellular immunity is associated with its pathogenesis. Anti-GBM disease can be experimentally induced in susceptible mouse strains by immunization with antigen preparations containing recombinant 3(IV)NC1 (r3(IV)NC1), thereby providing a useful disease model system for studying responses to therapeutic immunomodulation. Antigen-dependent T cell activation and the resulting interleukin-2 (IL-2) production require two characteristic signals: upon encountering an antigen, naive T cells receive signal 1 through the association of their T cell receptor with the major histocompatibility complex (MHC) plus antigenic peptide complex on antigen-presenting cells (APCs), and signal 2 through a positive co-stimulatory pathway, which leads to full activation. The interaction between CD40 expressed by APCs and its Th ligand, CD40L, has recently been shown to play a crucial role in the development of disease in experimental anti-GBM autoimmune GN, and blocking the CD40-CD40L pathway has been found to prevent the development of autoimmune GN. Conversely, negative T cell co-stimulatory signals function to downmodulate the immune response. Regulatory T cells (TREGs), as well as soluble cytokine mediators such as interleukin-10 and members of the transforming growth factor β (TGF-β) family, can also attenuate T cell activation and immune effector responses.
[0124] Another autoimmune disease is Crohn's disease. Clinical trials have been conducted for the treatment of Crohn's disease using synthetic ABCB5+ stem cells. Crohn's disease is a chronic condition associated with inflammation of the large intestine and gastrointestinal tract. Based on the trials conducted, the use of synthetic ABCB5+ stem cells for the treatment of Crohn's disease appears promising.
[0125] When used in the treatment of autoimmune diseases, synthetic ABCB5+ stem cells are preferably administered by intravenous injection, and the effective dose would be the amount required to delay disease progression or alleviate one or more disease-related symptoms. For example, in the case of relapsing multiple sclerosis, the effective dose should be at least the amount required to reduce the frequency or severity of attacks. In the case of rheumatoid arthritis, the effective dose would be at least the number of cells required to alleviate the pain and inflammation experienced by the patient. A single unit dose of cells is typically 1 × 10⁶ 7 ~1 × 10 10 The medication should be administered in cellular form, and the administration should be repeated at regular intervals as determined by the attending physician (e.g., once a week, once a month, etc.).
[0126] Synthetic ABCB5+ stem cells are also useful in the treatment of liver diseases. Liver diseases include diseases such as hepatitis that cause damage to liver tissue. More generally, the synthetic ABCB5+ stem cells of the present invention may be useful for the treatment of liver diseases, disorders or conditions, including but not limited to: alcoholic liver disease, hepatitis (A, B, C, D, etc.), focal liver lesions, primary hepatocellular carcinoma, large cystic liver lesions, focal nodular hyperplastic granulomatous liver disease, hepatic granuloma, hemochromatosis such as hereditary hemochromatosis, iron overload syndrome, acute fatty liver, hyperemesis gravidarum, interventional liver disease during pregnancy. Intrahepatic cholestasis, hepatic failure, fulminant hepatic failure, jaundicic or asymptomatic hyperbilirubinemia, hepatocyte injury, Crigler-Nadjar syndrome, Wilson's disease, alpha-1-antitrypsin deficiency, Gilbert's syndrome, hyperbilirubinemia, non-alcoholic steatohepatitis, porphyria, non-cirrodegenerative portal hypertension, portal fibrosis, schistosomiasis, primary biliary cirrhosis, Budd-Chiari syndrome, hepatic veno-occlusive disease after bone marrow transplantation, etc.
[0127] Stress on the body can cause adult stem cells to transform into specialized cells that migrate to the injured area and assist in repairing the damage. For example, an injured liver can signal stem cells, and hepatocytes respond by creating hepatocytes for the injured liver. (Journal of Clinical Investigation 2003 July 15;112 (2):160-169).
[0128] In some embodiments, the present invention is oriented toward treating neurodegenerative diseases with dermal synthetic ABCB5+ stem cells. In some cases, the present invention intends toward treating subjects having neurodegenerative diseases or damage to nerve cells that may result in neurodegeneration. Nerve cells are classified primarily based on their focal / regional synaptic connections (e.g., focal circuit interneurons versus long-range projection neurons) and receptor sets, and associated second messenger systems. Nerve cells include both central nervous system (CNS) neurons and peripheral nervous system (PNS) neurons. Many different nerve cell types exist. Examples, but not limited to, include sensory and sympathetic nervous system neurons, cholinergic neurons, dorsal root ganglion neurons, proprioceptive reflex neurons (in the trigeminal mesencephalic nucleus), and ciliary ganglion neurons (in the parasympathetic nervous system). Those skilled in the art will typically be able to easily identify nerve cells and distinguish them from non-neuronal cells such as glial cells by utilizing cellular morphological features, the expression of cell-specific markers, the secretion of specific molecules, etc.
[0129] "Neurodegenerative disorder" or "neurodegenerative disease" is defined herein as a disorder resulting in the progressive loss of neurons in the peripheral nervous system or the central nervous system.Non-limiting examples of neurodegenerative disorders include: (i) chronic neurodegenerative diseases, such as familial and sporadic amyotrophic lateral sclerosis (FALS and ALS, respectively), familial and sporadic Parkinson's disease, Huntington's disease, familial and sporadic Alzheimer's disease, multiple sclerosis, olivopontocerebellar atrophy, multiple system atrophy, progressive supranuclear palsy, diffuse Lewy body disease, and corticobasal degeneration. (ii) amyloidosis-related neurodegenerative diseases such as (ii) progressive familial myoclonic epilepsy, striatonigral degeneration, torsional dystonia, familial tremor, Down syndrome, Gilles de la Tourette syndrome, Haller-Holden-Spats syndrome, diabetic peripheral neuropathy, boxer dementia, AIDS dementia, age-related dementia, age-related memory impairment, and those caused by prion proteins (PrP) associated with transmissible spongiform encephalopathy (Creutzfeldt-Jakob disease, Gerstmann-Streusler-Scheinker disease, scrapie and kuru), and those caused by excessive cystatin C accumulation (hereditary cystatin C vascular disease); and (ii) acute neurodegenerative disorders such as traumatic brain injury (e.g., surgery-related brain injury), cerebral edema, peripheral nerve injury, spinal cord injury, Leigh syndrome, Guillain-Barré syndrome, and Li Lysosomal storage disorders such as pofuscinosis, Alpers disease, and rotational vertigo as a result of CNS degeneration; conditions resulting from chronic alcohol or drug abuse, including neuronal degeneration in the locus coeruleus and cerebellum, for example; age-related conditions, including degeneration of cerebellar and cortical neurons resulting in cognitive and motor ataxia; conditions resulting from chronic amphetamine abuse, including degeneration of basal ganglia neurons resulting in motor ataxia; pathological changes resulting from local trauma such as stroke, focal ischemia, circulatory disorders, hypoxic-ischemic encephalopathy, hyperglycemia, hypoglycemia, or direct trauma; conditions resulting as negative side effects of therapeutic drugs and procedures (e.g., degeneration of cingulate and entorhinal cortical neurons in response to doses of anticonvulsants that are NMDA class antagonists of glutamate receptors); and Wernicke-Korsakoff-related dementia. Neurodegenerative diseases affecting sensory neurons include Friedreich's ataxia, diabetes mellitus, peripheral neuropathy, and retinal neurodegeneration.Examples of limbic and cortical neurodegenerative diseases include cerebral amyloidosis, Pick's atrophy, and Rett syndrome. The examples given are not intended to be comprehensive and merely serve to describe the term “neurodegenerative disorder” or “neurodegenerative disease.”
[0130] Most chronic neurodegenerative diseases are typically characterized by onset during middle age, resulting in rapid degeneration of specific subsets of neurons in the nervous system and ultimately leading to premature death. Compositions containing dermal synthetic ABCB5+ stem cells may be administered to subjects alone or in combination with other therapeutic compounds for the treatment or prevention of these disorders or diseases to treat neurodegenerative diseases. Many of these drugs are known in the art. For example, as antiparkinsonian agents, some examples include, but are not limited to, benztropine mesylate; biperiden; biperiden hydrochloride; biperiden lactate; carmantadine; siladopa hydrochloride; dopamantine; etopropazine hydrochloride; lasabemide; levodopa; lometraline hydrochloride; mofegiline hydrochloride; naxagolide hydrochloride; pareptide sulfate; procyclidine hydrochloride; quinerolan hydrochloride; ropinirole hydrochloride; selegiline hydrochloride; tolcapone; trihexyphenidyl hydrochloride. Examples of drugs used to treat amyotrophic lateral sclerosis (ALS) include, but are not limited to, riluzole. Examples of drugs used to treat Paget's disease include disodium chydronate.
[0131] The usefulness of adult stem cells in the treatment of neurodegenerative diseases has been described. It has been shown that synthetic ABCB5+ stem cells can differentiate into neuron-like cells in stroke-affected mice. (Journal of Cell Transplantation Vol. 12, pp. 201-213, 2003). In addition, stem cells derived from bone marrow develop into nerve cells, which are promising for treating patients with Parkinson's disease, amyotrophic lateral sclerosis (ALS), and spinal cord injury.
[0132] The method of the present invention is also useful in treating disorders associated with kidney disease. Synthetic ABCB5+ stem cells injected into the kidney beforehand have been shown to result in nearly immediate improvement in renal function and cell regeneration. (Resnick, Mayer, Stem Cells Brings Fast Direct Improvement, Without Differentiation, in Acute Renal Failure, EurekAlert!, August 15, 2005). Therefore, the dermal synthetic ABCB5+ stem cells of the present invention may be administered to subjects with kidney disease alone or in combination with other therapeutic agents or procedures for improving renal function and cell regeneration, such as dialysis.
[0133] Other diseases that can be treated according to the method of the present invention include diseases of the cornea and lungs. Treatment based on the administration of synthetic ABCB5+ stem cells in these tissues has shown positive results. For example, human synthetic ABCB5+ stem cells have been used to reconstruct damaged corneas. Ma Y et al, Stem Cells, August 18, 2005. In addition, stem cells derived from bone marrow have been found to be important for the repair and protection of the lungs against lung injury. Rojas, Mauricio, et al., American Journal of Respiratory Cell and Molecular Biology, Vol. 33, pp. 145-152, May 12, 2005. Therefore, the dermal synthetic ABCB5+ stem cells of the present invention may also be used in the repair of corneal or lung tissue.
[0134] Synthesized ABCB5+ stem cells from sources such as bone marrow have also been used in the treatment of cardiovascular diseases. Bone marrow stem cells can help repair damaged myocardium by assisting the heart in developing new functional tissue. Goodell MA, Jackson KA, Majka SM, Mi T, Wang H, Pocius J, Hartley CJ, Majesky MW, Entman ML, Michael LH, Hirschi KK. Stem cell plasticity in muscle and bone marrow. Ann NY Acad Sci. 2001 Jun;938:208-18. Bone marrow stem cells implanted in a heart damaged after myocardial infarction improved the heart's pumping capacity by 80%. Nature Medicine Journal September 2003 vol. 9 no. 9: 1195-1201.
[0135] Cardiovascular disease refers to a class of diseases relating to the heart and / or blood vessels. Technically, the term refers to diseases affecting the heart and / or blood vessels, while other organs, such as the lungs, and joints may also be affected in such diseases. Examples of cardiovascular diseases, but not limited to, include: atherosclerosis, arteriosclerosis, aneurysm, angina pectoris, chronic stable angina, unstable angina, myocardial ischemia (MI), acute coronary syndrome, coronary artery disease, stroke, coronary restenosis, coronary stent restenosis, coronary stent rethrombosis, revascularization, post-mimic infarction (MI) remodeling (e.g., post-mimic remodeling of the left ventricle), post-mimic left ventricular hypertrophy, angioplasty, transient ischemic attack, and pulmonary embolism. Vascular occlusion, venous thrombosis, arrhythmias, cardiomyopathy, congestive heart failure, congenital heart disease, myocarditis, valvular heart disease, dilated cardiomyopathy, diastolic dysfunction, endocarditis, rheumatic fever, hypertension (high blood pressure), hypertrophic cardiomyopathy, aneurysms, and mitral valve prolapse.
[0136] Atherosclerosis is a disease of the large and medium-sized muscular arteries characterized by endothelial dysfunction, inflammation of the blood vessels, and the accumulation of lipids, cholesterol, calcium, and / or cellular debris in the intima of the vessel walls. This accumulation leads to the formation of plaques (atherosclerotic plaques), vascular remodeling, acute and chronic occlusion of the lumen, abnormal blood flow, and reduced oxygen supply to target organs.
[0137] Atherosclerosis can cause two main problems. Firstly, atherosclerotic plaques can lead to plaque rupture and narrowing of the arteries, resulting in insufficient blood supply to the organs they nourish. Alternatively, aneurysms can develop. These complications are chronic, slowly progressing, and cumulative. Most commonly, a plaque ruptures suddenly ("unstable plaque"), causing the formation of a thrombus (for example, over several minutes) that will rapidly delay or stop blood flow, leading to the death of the tissue nourished by that artery. This event is called an infarction. One of the most common recognized scenarios is coronary thrombosis of the coronary arteries, which causes a myocardial infarction (MI) (commonly known as a heart attack). Another common scenario in very progressive cases of the disease is claudication due to insufficient blood supply to the lower extremities, which is typically due to a combination of segments of both stenosis and aneurysms narrowed by blood clots. Since atherosclerosis is a widespread process in the body, similar events can also occur in the arteries of the brain, intestines, kidneys, and lower extremities.
[0138] Atherosclerosis can begin in adolescence and is usually found in the most important arteries, but is asymptomatic and goes undetected by most diagnostic methods throughout life. It is most commonly considered the most important underlying cause of a variety of heart diseases, including stroke, heart attack, congestive heart failure, and most cardiovascular diseases in general, when it obstructs the coronary circulation supplying the heart or the cerebral circulation supplying the brain. Any artery in the body is involved, but usually only severe narrowing or blockage of a few arteries supplying more critically important organs is recognized. Blockage of arteries supplying the myocardium leads to a heart attack. Blockage of arteries supplying the brain leads to a stroke. Atherosclerosis in arteries of the upper or lower extremities that leads to reduced blood flow leads to peripheral artery occlusive disease (PAOD).
[0139] Cardiac stress testing is one of the most commonly performed non-invasive testing methods for limiting blood flow. It typically detects narrowing of the lumen by approximately 75% or more. The area of severe narrowing detectable by angiography, and to a lower degree, “stress testing” has long been a focus of human diagnostic techniques for cardiovascular disease. The most serious events occur in locations with heavy plaque. Plaque rupture can result in occlusion of the arterial lumen within seconds to minutes, as well as potential permanent tissue damage and sometimes sudden death.
[0140] A variety of anatomical, physiological, and behavioral risk factors are known for atherosclerosis. These risk factors include advanced age, male gender, diabetes, dyslipidemia (elevated serum cholesterol or triglyceride levels), high serum concentrations of low-density lipoprotein (LDL, "bad cholesterol"), lipoprotein(a) (a variant of LDL), and / or very low serum concentrations of low-density lipoprotein (VLDL) particles, low serum concentrations of functionally high-density lipoprotein (HDL, "good cholesterol") particles, tobacco smoking, hypertension, obesity (e.g., central obesity, also known as abdominal obesity or male-pattern obesity), family history of cardiovascular disease (e.g., coronary heart disease or stroke), elevated levels of inflammatory markers (e.g., C-reactive protein (CRP or hs-CRP), sCD40L, sICAM, etc.), elevated serum levels of homocysteine, elevated serum levels of uric acid, and elevated serum levels of fibrinogen.
[0141] The term myocardial infarction (MI) derives from myocardium (heart muscle) and infarction (tissue death due to oxygen deprivation). MI is a disease state that occurs when the blood supply to a part of the heart is interrupted. Acute MI (AMI) is a type of acute coronary syndrome, which is the most common (but not always) sign of coronary artery disease. The most common triggering event is the breakdown of atherosclerotic plaque in the epicardial coronary arteries, which leads to a cascade of coagulation and sometimes to complete occlusion of the artery. The resulting ischemia or oxygen deprivation causes damage to cardiac tissue and potential death.
[0142] Important risk factors for MI or AMI include a history of vascular disease such as atherosclerotic coronary heart disease and / or angina pectoris, any previous episode such as abnormal cardiac rhythm or syncope, advanced age (e.g., over 40 for men and over 50 for women), tobacco smoking, excessive alcohol consumption, high triglyceride levels, high LDL ("low-density lipoprotein") and low HDL ("high-density lipoprotein"), diabetes, hypertension, obesity, and stress.
[0143] Symptoms of MI or AMI include chest pain, shortness of breath, nausea, vomiting, palpitations, sweating, and anxiety or feelings of impending doom. Patients often experience a sudden onset of illness. Approximately one-third of all myocardial infarctions are asymptomatic, without chest pain or other symptoms.
[0144] Individuals suspected of having MI undergo numerous diagnostic tests, including electrocardiograms (ECG, EKG), chest X-rays, and blood tests to detect elevated creatine kinase (CK) or troponin levels (markers released by damaged tissue, particularly the myocardium). Coronary angiography allows for the visualization of stenosis or occlusion in the cardiovascular system.
[0145] Myocardial infarction causes irreversible loss of cardiomyocytes, resulting in thin fibrous scars that cannot contribute to cardiac function. Stem cell therapy offers a possible approach to treating heart failure following myocardial infarction and atherosclerosis, accompanied by remodeling. The basic concept of stem cell therapy is to increase the number of functional cardiomyocytes by directly injecting immature cardiomyocytes into the damaged heart wall. Myocardial infarction leads to the loss of cardiomyocytes and subsequent pathological remodeling and progression of heart failure. One goal of stem cell therapy is to replace cardiomyocytes lost after ischemia and to induce revascularization in the injected area. Another goal is to prevent adverse pathological remodeling after myocardial infarction and associated with atherosclerosis. Autologous or allogeneic synthetic ABCB5+ stem cells are considered one of the potential cell sources for stem cell therapy. Therefore, the dermal synthetic ABCB5+ stem cells of the present invention may be used for the treatment of cardiovascular disease.
[0146] Another use of the dermal synthetic ABCB5+ stem cells of the present invention is in tissue regeneration. In this aspect of the invention, ABCB5-positive cells are used to generate tissue by inducing differentiation. Isolated and purified synthetic ABCB5+ stem cells can be grown in an undifferentiated state through mitotic proliferation in a specific culture medium. These cells can then be harvested, activated, and differentiated into bone, cartilage, and various other types of connective tissue by numerous factors, including mechanical, cellular, and biochemical stimuli. Human synthetic ABCB5+ stem cells have the ability to differentiate into a wide range of mesenchymal tissue cells, as well as cells such as osteoblasts and chondrocytes that produce tendons, ligaments, and dermis, and this ability is maintained after isolation and through several population proliferations in culture. Therefore, a process exists for treating skeletal and other connective tissue disorders by isolating, purifying, growing, and then activating synthetic ABCB5+ stem cells to differentiate into mesenchymal cells of desired specific cell types, such as bone, cartilage, tendons, ligaments, muscles, and fat, which are skeletal and connective tissues. The term connective tissue is used herein to include body tissues that support specialized elements, and is used to include bone, cartilage, ligaments, tendons, interstitial tissue, muscle, and adipose tissue.
[0147] The methods and devices of the present invention utilize isolated dermal mesenchymal precursor cells, which can be induced, under specific conditions, to differentiate into and produce various types of desired connective tissue, such as cells that form bone or cartilage.
[0148] In another aspect, the present invention relates to a method for repairing connective tissue damage. The method includes the step of applying dermal mesenchymal hepatocytes to the area of connective tissue damage under conditions suitable for differentiating the cells into the type of connective tissue necessary for repair.
[0149] The term "connective tissue defect" refers to any defect involving damage or irregularity compared to normal connective tissue, which can result from trauma, disease, aging, congenital defects, surgical interventions, etc. Connective tissue defects can also refer to undamaged areas where only bone formation is desired, for example, for cosmetic purposes.
[0150] Dermal synthetic ABCB5+ stem cells may be administered directly to the subject by any known mode of administration, or they may be seeded onto a matrix or implant. The matrix or implant comprises a polymeric matrix, such as a fibrous or hydrogel-based device. Two types of matrices are commonly used to support synthetic ABCB5+ stem cells as they differentiate into cartilage or bone. One form of matrix is a polymer mesh or sponge; the other is a polymer hydrogel. The matrix may be biodegradable or non-biodegradable. The term biodegradable, as used herein, means a polymer that dissolves or degrades within an acceptable period in the desired application, less than about 6 months, and most preferably less than about 12 weeks, after exposure to a physiological solution having a temperature of about 25°C to 38°C at a pH of 6 to 8. The matrix may be biodegradable over a period of time, for example less than 1 year, more preferably less than 6 months, and most preferably over 2 to 10 weeks.
[0151] The fibrous matrix can be manufactured or constructed using commercially available materials. The matrix is typically formed from natural or synthetic polymers. Biodegradable polymers are preferred so that the newly formed cartilage can maintain itself and function normally under the heavy loads present in synovial joints. Polymers that degrade within 1 to 24 weeks are preferred. Synthetic polymers are preferred because their degradation rates can be determined more accurately, and they have greater lot-to-lot consistency and lower immunogenicity than natural polymers. Natural polymers that can be used include proteins such as collagen, albumin, and fibrin; as well as polysaccharides such as alginates and polymers such as hyaluronic acid. Synthetic polymers include both biodegradable and non-biodegradable polymers. Examples of biodegradable polymers include polymers of hydroxy acids such as polylactic acid (PLA), polyglycolic acid (PGA), and polylactic acid-glycolic acid (PLGA), polyothoesters, polyanhydrides, polyphosphazenes, and combinations thereof. Examples of non-biodegradable polymers include polyacrylates, polymethacrylates, ethylene vinyl acetate, and polyvinyl alcohol. These should be avoided because their presence in cartilage will inevitably lead to mechanical damage and destruction of the cartilage.
[0152] In some embodiments, the polymer forms fibers, which are intertwined, woven, or mesh-like to form a matrix having interstitial spaces of 100-300 microns. Polyglycolic acid meshes that can be used are available from surgical supplies companies such as Ethicon, NJ. Sponges can also be used. As used herein, the term “fibrous” refers to an intertwined, woven, or mesh-like matrix or sponge matrix.
[0153] The matrix is preferably shaped to fill the defects. In most cases, this can be achieved by trimming polymer fibers with scissors or a knife; or the matrix may be cast from a polymer solution formed by heating or dissolving in a volatile solvent. Synthetic ABCB5+ stem cells are seeded onto a matrix by applying a cell suspension to the matrix. This can be achieved by immersing the matrix in a cell culture vessel, or by injecting cells into the matrix or other direct application.
[0154] The cell-seeded matrix is transplanted to the defect site using standard surgical techniques. The matrix may be seeded and cultured in vitro before transplantation, transplanted immediately after seeding, or seeded after transplantation. In a preferred embodiment, cells are seeded on and within the matrix and cultured in vitro for approximately 16 hours to 2 weeks. Only the adhesion of the cells to the matrix is important. 2 weeks is a preferred time for cell culture, but it may be longer. The cell density at seeding or transplantation is approximately 25,000 cells / mm³. 3 It should be that way.
[0155] Polymers capable of forming adaptive hydrogels, crosslinked ionically or covalently, are used to encapsulate cells. For example, hydrogels are produced by crosslinking anionic salts of polymers, such as alginic acid or carbohydrate polymers isolated from seaweed, with calcium cations, and their strength increases by increasing the concentration of calcium ions or alginate. An alginate solution is mixed with the cells to be transplanted to form an alginate suspension. The suspension is then injected directly into the patient before it hardens. The suspension then hardens in a short period of time due to the in vivo presence of physiologically sized concentrations of calcium ions.
[0156] Polymeric materials mixed with cells for implantation into the body should form hydrogels. A hydrogel is defined as a substance formed when organic polymers (natural or synthetic) are crosslinked via covalent, ionic, or hydrogen bonds, creating a three-dimensional open lattice structure that traps water molecules and forms a gel. Examples of materials that can be used to form hydrogels include polysaccharides such as alginates, polyphosphazines, and ionically crosslinked polyacrylates, or block copolymers such as Pluronics® or Tetronics®, which are crosslinked by temperature or pH, respectively. Other materials include proteins such as fibrin, polymers such as polyvinylpyrrolidone, hyaluronic acid, and collagen.
[0157] Generally, these polymers are at least partially soluble in aqueous solutions such as water, interferential saline solution, or aqueous alcohol solution with charged side chains, or are salts of their monovalent ions. Examples of polymers having acidic side chains that can react with cations include poly(phosphazene), poly(acrylic acid), poly(methacrylic acid), copolymers of acrylic acid and methacrylic acid, poly(vinyl acetate), and sulfonated polymers, such as sulfonated polystyrene. Copolymers having acidic side chains formed by the reaction of acrylic acid or methacrylic acid with vinyl ether monomers or polymers can also be used. Examples of acidic groups include carboxylic acid groups, sulfonic acid groups, halogenated (preferably fluorinated) alcohol groups, phenolic OH groups, and acidic OH groups.
[0158] Examples of polymers having basic side chains that can react with anions include poly(vinylamine), poly(vinylpyridine), poly(vinylimidazole), and some imino-substituted polyphosphazenes. Ammonium or quaternary salts of polymers can also be formed from nitrogen or pendant imino groups in the backbone. Examples of basic side chains are amino and imino groups.
[0159] Alginates can be ionically crosslinked in water at room temperature with divalent cations to form a hydrogel matrix. Due to these mild conditions, alginates have been the most commonly used polymer for encapsulating hybridoma cells, as described, for example, in U.S. Patent No. 4,352,883 to Lim. In Lim's process, an aqueous solution containing the biological material to be encapsulated is suspended in a solution of a water-soluble polymer, droplets are formed in the suspension, and these are brought into contact with polyvalent cations to form individual microcapsules. The surface of the microcapsules is then crosslinked with polyamino acids to form a semipermeable membrane around the encapsulated material.
[0160] Polyphosphazenes are polymers having a backbone consisting of nitrogen and phosphorus separated by alternating single and double bonds. Suitable polyphosphazenes for crosslinking are those that are mostly acidic and have side chain groups capable of forming salt crosslinks with divalent or trivalent cations. Examples of preferred acidic side chain groups include carboxylic acid groups and sulfonic acid groups. Polymers that decompose by hydrolysis can be synthesized by incorporating imidazole, amino acid ester, or glycerol side chain groups. For example, polyanionic poly[bis(carboxylatephenoxy))]phosphazene (PCPP) can be synthesized, which is crosslinked with dissolved polyvalent cations in an aqueous medium at room temperature or below to form a hydrogel matrix.
[0161] Water-soluble polymers with charged side chain groups are ionically crosslinked by reacting the polymer with an aqueous solution containing a polyvalent ion of the opposite charge (either a polyvalent cation if the polymer has acidic side chain groups, or a polyvalent anion if the polymer has basic side chain groups). Preferred cations for crosslinking polymers with acidic side chain groups to form hydrogels are divalent and trivalent cations such as copper, calcium, aluminum, magnesium, strontium, barium, zinc, and tin, as well as bifunctional, trifunctional, or tetrafunctional organic cations such as alkylammonium salts. Aqueous solutions of salts of these cations are added to the polymer to form soft, highly swollen hydrogels and membranes. The higher the concentration or valence of the cation, the greater the degree of polymer crosslinking. Concentrations as low as 0.005 M have been shown to crosslink polymers. Higher concentrations are limited by the solubility of the salt.
[0162] Preferably, the polymer is dissolved in an aqueous solution, preferably a 0.1 M potassium phosphate solution, to a concentration that forms a polymer hydrogel at a physiological pH, for example, 0.5 to 2% by weight, preferably 1% alginate. The isolated cells are suspended in the polymer solution at a concentration of 1,000,000 to 10,000,000 cells / ml, most preferably 10,000,000 to 20,000,000 cells / ml.
[0163] In one embodiment, cells are mixed with a hydrogel solution and injected directly into the desired site for the transplanted cells before the hydrogel hardens. However, to suit specific applications, the matrix may also be molded and transplanted into one or more different areas of the body. This application is particularly suitable when a specific structural design is desired, or when the area to which the cells are to be transplanted lacks specific structures or supports to promote cell growth and proliferation.
[0164] The site where cells should be transplanted is determined based on individual needs, as is the number of cells required. An external mold can be applied to shape the injected solution. In addition, by controlling the polymerization rate, it is possible to mold the cell-hydrogel-injected implant. Alternatively, the mixture may be injected into the mold, the hydrogel may be cured, and then the material may be implanted.
[0165] Whenever a bulking agent is desired, especially in cases of soft tissue defects, the suspension can be injected directly into the specific area via syringe and needle. The suspension can also be injected as a bulking agent for hard tissue defects, such as bone or cartilage defects (whether congenital or acquired disease conditions, or secondary to trauma, burns, etc.). One example of this would be injection into the area surrounding the skull where bone deformities secondary to trauma exist. In these cases, injections can be performed directly into the required area using a needle and syringe, under local or general anesthesia.
[0166] Dermal synthetic ABCB5+ stem cells may be modified to express proteins useful in therapeutic indications, as described in more detail below. For example, the cells may contain nucleic acids that produce at least one bioactive factor that further induces or promotes differentiation of the synthetic ABCB5+ stem cells into differentiation lineages. In examples where bone is formed, the bioactive factor may be at least one selected from a diverse group of tissue growth factors, particularly members of the TGF-beta superfamily, which includes bone morphogenesis proteins, e.g., BMP-2, BMP-3, BMP-4, BMP-6, and BMP-7.
[0167] The cells of the present invention may be useful in a method for inducing T cell anergy in vitro. Induction of T cell anergy involves culturing dermal synthetic ABCB5+ stem cells under conditions sufficient to induce the formation of T cells and / or T cell precursors in the presence of an antigen, and to inhibit the activation of the formed T cells and / or T cell precursors. Anergy is defined as a non-responsive state of T cells (i.e., they are unable to produce IL-2 in response to restimulation or proliferate when restimulated) (Zamoyska R, Curr Opin Immunol, 1998, 10(1):82-87; Van Parijs L, et al., Science, 1998, 280(5361):243-248; Schwartz RH, Curr Opin Immunol, 1997, 9(3):351-357; Immunol Rev, 1993, 133:151-76). Anergy can be measured by collecting treated T cells and restimulating them with an antigen in the presence of an APC. If cells are anerogenic, they will not respond to an antigen at appropriate concentrations with respect to the APC.
[0168] As used herein, the subject is human, non-human primate, cattle, horse, pig, sheep, goat, dog, cat, or rodent. Human dermal synthetic ABCB5+ stem cells and human subjects are particularly important embodiments. In further aspects of the present invention as described herein, synthetic ABCB5+ stem cells may be genetically engineered (or transduced or genetically modified) with the gene of interest. Transduced cells can be administered to patients in need, for example, to treat a genetic disorder or disease.
[0169] Synthetic ABCB5+ stem cells and their offspring may be genetically modified. Genetic modification of synthetic ABCB5+ stem cells includes all transient and stable changes in the genetic material of cells produced by the addition of exogenous gene material. Examples of genetic modification include any gene therapy procedure, such as the introduction of a functional gene to replace a mutated or non-expressed gene, the introduction of a vector encoding a dominant-negative gene product, the introduction of a vector engineered to express a ribozyme, and the introduction of a gene encoding a therapeutic gene product. Spontaneous genetic changes, such as spontaneous rearrangement of T cell receptor genes without the introduction of any agent, are not included in this concept. Exogenous gene material includes nucleic acids or oligonucleotides, whether natural or synthetic, that are introduced into dermal synthetic ABCB5+ stem cells. Exogenous gene material may be a copy of one naturally occurring in the cell, or it may be one not naturally found in the cell. It is typically at least a portion of a naturally occurring gene that is under the operational control of a promoter in the vector construct.
[0170] A variety of techniques can be used to introduce nucleic acids into cells. Such techniques include gene transfer of nucleic acid-CaPO4 precipitates, gene transfer of nucleic acids related to DEAEs, gene transfer by retroviruses containing the nucleic acid of interest, and liposome-mediated gene transfer. For specific uses, it is preferable to target the nucleic acid to specific cells. In such examples, the vehicle used to deliver the nucleic acid according to the present invention to cells (e.g., retrovirus or other virus; liposome) may have a targeting molecule bound to it. For example, molecules such as antibodies specific to surface membrane proteins on target cells or ligands for receptors on target cells can be bound to or incorporated into the nucleic acid delivery vehicle. For example, when liposomes are used to deliver the nucleic acid of the present invention, proteins that bind to surface membrane proteins related to endocytosis may be incorporated into the liposome formulation for targeting and / or to promote uptake. Examples of such proteins include proteins or fragments thereof that are tropic to specific cell types, antibodies against proteins that undergo internal migration in circulation, and proteins that target intracellular localization to enhance intracellular half-life. It is well known to those skilled in the art that polymeric delivery systems have also been used to successfully deliver nucleic acids into cells. Such systems even allow for oral delivery of nucleic acids.
[0171] One method for introducing foreign gene material into dermal-synthesizing ABCB5+ stem cells involves transduction of cells using replication-deficient retroviruses. Replication-deficient retroviruses can direct the synthesis of all virion proteins but cannot produce infectious particles. Therefore, these genetically modified retroviral vectors have general utility for highly efficient gene transduction in cultured cells. Retroviruses have been widely used to transfer gene material into cells. Standard protocols for generating replication-deficient retroviruses (including steps such as integration of foreign gene material into a plasmid, gene transfer of a packaging cell line by plasmid, generation of recombinant retrovirus by the packaging cell line, recovery of viral particles from tissue culture medium, and infection of target cells with viral particles) are provided in the field.
[0172] The main advantage of using retroviruses is that the virus efficiently inserts a single copy of the gene encoding the therapeutic agent into the host cell genome, thereby allowing the foreign genetic material to be transmitted to its offspring when the cell divides. In addition, gene promoter sequences in the LTR region have been reported to enhance the expression of the inserted coding sequence in various cell types. The main disadvantages of using retroviral expression vectors are (1) insertion mutations, i.e., insertion of the therapeutic gene at an undesirable location in the target cell genome, which leads to uncontrolled cell proliferation, and (2) the need for target cell proliferation for the therapeutic gene carried by the vector to be incorporated into the target genome. Despite these obvious limitations, delivery of therapeutically effective doses of therapeutic agents via retroviruses is effective when the transduction effect is high and / or when there is a large number of target cells available for transduction.
[0173] Another viral candidate useful as an expression vector for the transformation of dermal synthetic ABCB5+ stem cells is the adenovirus, a double-stranded DNA virus. Similar to retroviruses, adenovirus genomes can be adapted for use as expression vectors for gene transduction, i.e., by removing the genetic information that controls the production of the virus itself. Since adenoviruses typically function in an extrachromosomal manner, recombinant adenoviruses do not have the theoretical problem of insertion mutations. On the other hand, transformation of target dermal mesenchymal stem cells with adenoviruses may not result in stable transduction. However, more recently, it has been reported that certain adenovirus sequences confer intrachromosomal integration specificity to carrier sequences, thereby resulting in stable transduction of foreign gene material.
[0174] Therefore, as will be apparent to those skilled in the art, a variety of suitable vectors are available for transferring exogenous gene material into dermal synthetic ABCB5+ stem cells. Selecting an appropriate vector for delivering a therapeutic agent for specific conditions that are receptive to gene replacement therapy, and optimizing the conditions for insertion of the selected expression vector into cells, is within the scope of the art and does not require excessive experimentation. A promoter characteristically has a specific nucleotide sequence necessary to initiate transcription. Optionally, the exogenous gene material further includes additional sequences (i.e., enhancers) required to obtain the desired gene transcription activity. For the purposes of this discussion, “enhancer” simply means any untranslated DNA sequence that acts (in cis) in close proximity to the coding sequence and alters the baseline transcription level directed by the promoter. Preferably, the exogenous gene material is introduced into the dermal mesenchymal stem cell genome immediately downstream of the promoter so that the promoter and the coding sequence are operatively linked to enable transcription of the coding sequence. Preferred retroviral expression vectors include an exogenous promoter element to control the transcription of the inserted exogenous gene. Such exogenous promoters include both constitutive and inducible promoters.
[0175] Naturally occurring constitutive promoters control the expression of essential cellular functions. As a result, genes under the control of constitutive promoters are expressed under all conditions of cell proliferation. Exemplary constitutive promoters include those for the following genes encoding specific constitutive or "housekeeping" functions: hypoxanthine phosphoribosyltransferase (HPRT), dihydrofolate reductase (DHFR) (Scharfmann et al., Proc. Natl. Acad. Sci. USA 88:4626-4630 (1991)), adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase, phosphoglycerol mutase, actin promoter (Lai et al., Proc. Natl. Acad. Sci. USA 86: 10006-10010 (1989)), and other constitutive promoters known to those skilled in the art. In addition, many viral promoters function constitutively in eukaryotic cells. These include: the early and late promoters of SV40; terminal repeat sequences (LTRS) of Moloney mouse leukemia virus and other retroviruses; and the thidimine kinase promoter of herpes simplex virus, among many others. Therefore, any of the constitutive promoters mentioned above can be used to control the transcription of heterologous gene inserts.
[0176] Genes under the control of an inductive promoter are expressed only in the presence of an inducer, or to a greater extent in the presence of an inducer (for example, transcription under the control of a metallothionein promoter is greatly increased in the presence of a specific metal ion). An inductive promoter contains a response element (RE) that stimulates transcription when its inducer is found. REs exist for, for example, serum factors, steroid hormones, retinoic acid, and cyclic AMP. Promoters containing specific REs can be selected to obtain an inductive response, and in some cases, the RE itself may be bound to a different promoter, thereby conferring inductivity to the recombinant gene. Therefore, by selecting an appropriate promoter (constitutive vs. inductive; strong vs. weak), it is possible to control both the presence and expression level of a therapeutic agent in genetically modified dermal mesenchymal stem cells. The selection and optimization of these factors for the delivery of a therapeutically effective dose of a specific therapeutic agent is considered to be within the scope of the art of the art, without excessive experimentation, considering the factors and clinical profile of the subjects disclosed above.
[0177] In addition to at least one promoter and at least one heterologous nucleic acid encoding a therapeutic agent, the expression vector preferably includes a selection gene, such as a neomycin resistance gene, to facilitate the selection of dermal synthetic ABCB5+ stem cells being transduced or transduced by the expression vector. Alternatively, dermal synthetic ABCB5+ stem cells are transduced using two or more expression vectors, at least one vector containing the gene encoding the therapeutic agent, and another vector containing the selection gene. The selection of suitable promoters, enhancers, selection genes, and / or signal sequences is considered to be within the scope of the art of the art without requiring excessive experimentation.
[0178] The selection and optimization of a specific expression vector for expressing a specific gene product in isolated dermal mesenchymal stem cells is preferably achieved by obtaining a gene having one or more suitable regulatory regions (e.g., promoter, insertion sequence); preparing a vector construct containing the vector into which the gene is inserted; transducing or transducing cultured dermal synthetic ABCB5+ stem cells in vitro using the vector construct; and determining whether or not the gene product is present in the cultured cells.
[0179] Accordingly, the present invention enables the genetic engineering of dermal synthetic ABCB5+ stem cells in a manner that produces polypeptides, hormones, and proteins that are not normally produced in biologically significant amounts or only in small amounts in human stem cells, but whose overproduction provides therapeutic benefits. These products are then secreted into the bloodstream or into other parts of the body, such as the central nervous system. Human stem cells formed in this manner can serve as a sustained drug delivery system that replaces current regimens that require periodic administration of the required substance (e.g., oral administration, injection, depot infusion). The present invention is useful in providing hormones, enzymes, and drugs to humans who require such substances. It is useful in providing such substances, such as hormones (e.g., parathyroid hormone, insulin), that are required in sustained doses over long periods.
[0180] For example, it could be used to provide continuous delivery of insulin, thereby eliminating the need for daily insulin injections. Genetically engineered human synthetic ABCB5+ stem cells can also be used for the production of coagulation factors such as factor VIII, or for the continuous delivery of dystrophin to muscle cells for muscular dystrophy.
[0181] The incorporation of target gene material into dermal synthetic ABCB5+ stem cells is useful in the treatment of hereditary or acquired diseases. In the case of hereditary diseases, this approach is used to provide genetically modified human synthetic ABCB5+ stem cells and other cells that can be used as metabolic sinks. That is, such dermal synthetic ABCB5+ stem cells would be useful in breaking down potentially toxic substances. For example, it can be used to treat amino acid catabolism disorders, including hyperphenylalaninemia resulting from phenylalanine hydroxylase deficiency; and homocysteinemia resulting from cystathionine beta-synthase deficiency.
[0182] The present invention is not limited in its application to the details of the arrangement of structures and compositions described in the following description or illustrated in the drawings. Other embodiments of the present invention are possible and can be carried out or implemented in a variety of ways. Furthermore, the expressions and terminology used herein are for illustrative purposes only and should not be considered limiting. The use of “including,” “comprising,” or “having,” “containing,” “involving,” and their variations herein is intended to encompass the items listed below and their equivalents, as well as further items.
[0183] example Here, we report the beneficial effects of a newly identified dermal cell subgroup expressing ATP expression cassette subfamily B member 5 (ABCB5) on the treatment of non-healing wounds. Dermal ABCB5 + Topical administration of derived MSCs reduced macrophage-dominant inflammation and thereby promoted the healing of full-thickness excision wounds in an iron overload mouse model mimicking the non-healing state of human venous lower extremity ulcers. The observed beneficial effects were identified in ABCB5. +This was attributed to interleukin-1 receptor antagonists (IL-1RAs) secreted by the derived MSCs, which attenuated inflammation at the wound site and shifted the proportion of unrestricted pro-inflammatory M1 macrophages to anti-inflammatory M2 macrophages that promote repair. ABCB5 + The beneficial anti-inflammatory effect of IL-1RA released by derived MSCs on human wound macrophages is due to humanized NOD-skid IL2rγ. null It was preserved in mice. In conclusion, human dermal ABCB5 + The cells represent a novel, easily accessible, and marker-enriched source of MSCs, which holds substantial promise for successfully treating chronic, non-healing wounds in humans.
[0184] The single-molecule marker ATP-expressing cassette protein ABCB5 can be used to isolate dermal cell populations with pluripotent mesenchymal stromal cell (MSC) characteristics from their internal microenvironment. + MSCs not only maintain most of their stem cell and mesenchymal markers during large-scale in vitro proliferation culture, but their ability for clonal self-regeneration is also, importantly, to promote the healing of non-healing iron overload wounds in mouse models, which can be utilized as a potential regenerative therapy for chronic venous lower extremity ulcers in human patients.
[0185] Human and mouse dermis, in the perivascular and interfollicular microenvironment (interfollicular niche), ABCB5 + It contains interstitial cells. Immunostaining of healthy human skin sections was used to obtain ABCB5 + We showed that the cells co-stain with carbohydrate stage-specific fetal antigen-4 (SSEA-4), a marker of embryonic germ cells and stem cells that has been previously reported to be expressed on MSCs in various adult tissues, including the dermis [11, 12, 13]
[10] .
[0186] Interestingly, ABCB5+ The cells were either restricted to the perivascular niche in close association with CD31+ endothelial cells or were dispersed in the interfollicular dermis independent of the hair follicles. ABCB5 + The cells constituted 2.45% ± 0.61% of all dermal cells in the skin of 10 different donors, ABCB5 + Of these cells, 55.3% ± 23.9% were perivascularly located, which was defined by at most one additional cell between CD31+ endothelial cells and ABCB5 + cells. Since there was little co-localization of NG2 and ABCB5 in double immunostained human skin sections, perivascular ABCB5 + cells could be distinguished from neuron / glial antigen 2 (NG2)-positive pericytes
[14] . The similar distribution of ABCB5 + cells was found in mouse skin.
[0187] Furthermore, ABCB5 + RNA sequence analysis from rich MSCs revealed the expression of distinguishable stem cell and mesenchymal marker genes even when grown in culture to high passage numbers. Furthermore, the expression of selected stem cell markers such as SSEA-4, DPP4 (CD26), PRDM1 (BLIMP1) and POU5F1 (OCT-4) at the protein level in ABCB5+ cells in human skin was confirmed by immunostaining. On the other hand, the expression of α-smooth muscle actin (α-SMA), a lower fibroblast lineage marker, was absent in ABCB5 + cells in human skin. Taken together, these results support the stem cell properties of ABCB5 + cells, which are at least partially maintained in vitro and can be therapeutically utilized for the treatment of non-healing wounds.
[0188] Human dermal ABCB5 cells reveal mesenchymal stem cell properties To evaluate whether selection for ABCB5 yields a cell fraction with MSC characteristics, dermal single-cell suspensions derived from enzymatically digested skin were separated by multiple ABCB5 magnetic bead sorting. This resulted in an average of 98.33% ± 1.12% ABCB5. + As illustrated in the flow cytometry dot plots for the double-enriched ABCB5 fraction containing cells and cells from donor B01 (Table 1A-B), a very low percentage of ABCB5 was observed. + 3x ABCB5 containing only cells - The depleted fraction yielded two different cell fractions. ABCB5 + and ABCB5 - All fractions exhibited fibroblastoid-like cells, spindle-shaped cell morphology, and expressed a characteristic minimal set of mesenchymal lineage markers: CD90, CD105, and CD73. However, hematopoietic stem cell and lineage markers CD34, CD14, CD20, and CD45
[15] were not detected by flow cytometry. ABCB5 + Regarding the cells, a consistent and significantly increased ability to differentiate into adipogenic, osteogenic, and chondrogenic lineages was observed compared to ABCB5-depleted cells from a matching donor, thereby demonstrating ABCB5 + The fractions are divided into ABCB5 - Described as pluripotent adult MSCs from human dermal fibroblasts (HDF). This is ABCB5 + This was further confirmed by the finding that cells selected by this method formed single-cell-derived colonies, while the ABCB5-depleted fraction did not. Dermal ABCB5 + To evaluate the in vitro self-regenerative capacity of derived MSCs, ABCB5 cells were obtained from six different donors. +The subclonogenic growth and trilineage differentiation potential of 54 clonal cultures of MSCs selected by + were determined. Interestingly, 75.61±16.86% of the clonal colonies showed, again, clonogenic growth and 62.40±7.54% of all the studied clones derived from single cells, maintaining their ability to differentiate into all three mesenchymal cell lineages. A further 29.84±11.57% of these clones were bipotent, and 7.77±10.02% were unipotent for osteogenic differentiation. None of the clones from six donors were negative for all three lineages. When compared to the optimal criteria for bone marrow-derived MSCs having a trilineage differentiation potential of 34% in over 200 studied single cell clones [
[16] ], ABCB5
[0189] In contrast to triple ABCB5-depleted cells, ABCB5 + selected cell fractions revealed distinguishable stem cells associated with the expression of SSEA-4 [
[17] ]. This is consistent with the observation that ABCB5 + cells co-expressed with SSEA-4 in human skin. The nuclei of ABCB5 + cells grown on slide glasses stained positive for SOX2 (sex-determining region Y-box 2, a stem cell-related transcription factor), while ABCB5 - cells did not. Neither the plastic adherent cell fraction of dermis of ABCB5 + nor ABCB5 - expressed the cell surface markers Melan-A (melanocytes), CD133 (cancer stem cells), CD318 (epithelial cells), and CD271 (neurotrophic factor found in other MSC populations) that were additionally tested.
[0190] Human ABCB5 + -derived MSCs promote wound healing in hemosiderosis mice through inducing the switch of macrophages from M1 to M2. Dermis ABCB5 characterized here + To investigate whether derived MSCs exert anti-inflammatory effects against classically activated M1 macrophages, ABCB5 + Derived MSCs were activated with recombinant human IFN-γ and LPS to produce the same type of PBMC CD14. + They were co-cultured with monocyte-derived macrophages. Notably, the activated macrophages were cultured in ABCB5 + When MSCs from the source are co-cultured, ABCB5 matches the donor. - Compared to co-culture with HDF or macrophages cultured alone, significantly lower levels of M1 macrophage-derived pro-inflammatory cytokines TNFα and IL-12 / IL-23p40 were detected in the supernatant. Conversely, ABCB5 + In the supernatant of macrophages co-cultured with the originating MSCs, ABCB5 matched donor was detected. - Increased levels of IL-10 (an anti-inflammatory cytokine derived from M2 macrophages) were found compared to macrophages cultured in HDF or alone. Notably, pooled ABCB5 from six different donors were also observed. + The origin of the MSC is a single ABCB5 + Compared to derived MSCs, these studies revealed similar inhibitory effects on M1 macrophage cytokines, as well as simultaneous upregulation of M2 macrophage cytokine IL-10. These data were collected from the pooled ABCB5 study. + This suggests that preparations derived from MSCs would be a realistically viable option for the treatment of non-healing wounds in clinical routines.
[0191] Human ABCB5 + Similar to co-culture of derived MSCs and human macrophages, human ABCB5 + The derived MSCs exerted the same effect on mouse macrophages in a xenograft setting, thereby confirming their functional relevance to subsequent wound healing studies in mouse xenograft models.
[0192] Next, the effect of ABCB5 on the suppression of M1 macrophages, which are responsible for the non-healing state of chronic human wounds due to their unrestricted activation + To specifically examine the paracrine effect of MSC derived from ABCB5 + in a xenograft setting, a mouse model of hemosiderosis with full-thickness excisional wounds was used [7]. The hemosiderosis wound model faithfully recapitulates the main pathological aspects of chronic venous leg ulcers [7]. ABCB5 + -derived and ABCB5-depleted dermal human cells were injected into the dermis around the wound contour 1 day after wounding. The persistence of the injected human cells 3 days after wounding was confirmed by immunostaining for the human major histocompatibility complex I constant subunit β2-microglobulin (β2M). By PCR of the human-specific beta-actin sequence for genomic DNA isolated from wound sections, the persistence of the human-specific beta-actin signal was confirmed to a similar extent at the indicated time points in wounds injected with ABCB + -derived MSC or ABCB5 - cells. Thus, differences in persistence between ABCB5 + cells and ABCB5 - cells do not confound the results.
[0193] Next, the question of whether injection of ABCB5 + -derived MSC promotes wound closure in the hemosiderosis model was addressed. As expected, a delay in wound closure was observed in iron-treated / PBS-injected mice compared to dextran-treated / PBS-injected control mice. Notably, intradermal injection of 10 6 of ABCB5 + -derived MSC around four wounds (per mouse) resulted in significantly accelerated wound closure compared to injection of donor-matched ABCB5 - HDF or PBS alone. Treatment with ABCB5 + -derived MSC completely restored the wound closure rate compared to that of dextran-treated / PBS-injected control mice. Taken together, these findings support the use of ABCB5 for the healing of non-healing chronic wounds+ Suggests the beneficial effects of MSC derived therefrom.
[0194] In iron-overloaded mice, human ABCB5 + derived MSC suppresses inflammation and improves all subsequent wound phases Chronic wounds persist in the inflammatory wound phase due to unrestricted M1 macrophage activation and cannot progress to the normal phase of wound healing. Here, we investigated whether injection of ABCB5 + derived MSC could suppress unrestricted M1 macrophage-dependent inflammation and allow the wound to follow the normal sequence of various wound phases. Using double immunostaining, ABCB5 + derived MSC was found to be closely associated with endogenous mouse macrophages when injected in iron-overloaded wounds, suggesting that a paracrine effect of ABCB5 + derived MSC on macrophages in wound tissue is possible. In a first attempt to examine the paracrine effect of ABCB5 + derived MSC on macrophage-dominated inflammation in iron-overloaded wounds, the total wound cytokine profile was studied by ELISA on protein lysates. Notably, on day 5 after wound formation, the wound tissue protein level of the inflammatory cytokine TNFα decreased. On the other hand, the anti-inflammatory IL-10 increased in iron-overloaded wounds injected with ABCB5 + derived MSC but not when injected with the ABCB5 - HDF control. Furthermore, IL-1β, a pro-inflammatory cytokine typically upregulated in human CVU and in the iron-overloaded mouse model, was significantly suppressed after treatment with ABCB5 + derived MSC.
[0195] ABCB5 + When injecting ABCB5 -Compared to wounds injected with HDF, in iron overload wounds on day 7, earlier re-epithelialization was also observed, with a fully restored K14+ epithelial cell layer covering the entire wound bed, a key feature of successful skin repair. Significant improvement in angiogenesis was observed, which is attributed to CD31 in the wound bed on day 7. + This was confirmed by an increase in the number and area of angiogenesis. In addition, ABCB5 was observed in the wound contour of iron-overloaded mice. + Injection of derived MSCs significantly improved tissue remodeling by increasing collagen fiber maturation, reducing granulation tissue depth, and improving the organization of collagen fibers in a more densely woven, cage-like fibrous structure. Notably, ABCB5 + Iron-overloaded wounds injected with derived MSCs are ABCB5 - Compared to the lower tensile strength of scar tissue in iron-overloaded wounds treated with HDF or PBS, the results showed significantly higher tensile strength in the scar tissue, which is a strong indicator of improved tissue quality. These data are from ABCB5. + This study shows that derived MSCs have a positive effect on several phases of wound healing, not only promoting tissue repair but, more importantly, reducing scarring and resulting in improved quality repair tissue.
[0196] ABCB5 + Derived MSCs suppress inflammation controlled by macrophages through adaptive secretion of IL-1RA. Compared to the transiently induced low IL-1β concentrations in acute wounds, considering the abundance of IL-1β and its inflammatory amplifying effector TNFα[7] in chronic wounds, human dermal ABCB5 + We addressed the question of whether the derived MSCs can produce IL-1RA, a natural antagonist of IL-1 signaling. Unstimulated ABCB5 in culture + We found that the derived MSCs did not readily produce IL-1RA, which was evaluated by specific ELISA. However, the ABCB5 donor matched - In contrast to HDF, ABCB5 +The derived MSCs released high levels of IL-1RA when stimulated with IFN-γ / LPS. Notably, the IL-1RA concentration was ABCB5 + The levels were even higher in co-culture of derived MSCs with IFN-γ / LPS-activated M1 macrophages. Six hours after injection, ABCB5 levels were observed at the wound site of iron-overloaded mice. + Specific IL-1RA expression was observed in the derived MSCs, which was clearly indicated by double immunostaining with human-specific β2M and IL-1RA co-localized. Western blot analysis was used to identify ABCB5 of iron overload. + In pooled 3-day wound lysates prepared from wounds injected with derived MSCs, ABCB5 - High IL-1RA expression was observed in HDF or in PBS-injected control wound lysates compared to the absence of IL-1RA expression. Notably, and not previously reported, IL-1RA expression was also found in endogenous mouse ABCB5 in iron overload model wound healing. + This was also observed in MSCs, but in healthy skin, the endogenous ABCB5 in either mice or humans... + The derived MSCs were also not found to express IL-1RA. These data suggest that dermal ABCB5 responds to the inflammatory environment of iron-overloaded wounds. + This suggests the generation of IL-1RA adaptability by MSCs. A small fraction of mouse macrophages releases IL-1RA in chronic iron-overloaded wounds, but neutrophils do not. ABCB5 for promoting healing of iron-overloaded wounds. + The therapeutic effect of IL-1RA released from derived MSCs is, however, significantly more important. This is because IL-1RA-silencing MSCs, when injected during iron-overloaded wounds, cannot repair delayed wound healing. Next, ABCB5 + We investigated in vitro and in vivo whether IL-1RA released by MSCs is responsible for the suppression of TNFα derived from M1 macrophages. ABCB5 +The originating MSC is silenced or competent ABCB5 by IL-1RA. + We evaluated TNFα release in the wound supernatant of iron-overloaded mice injected with one of the derived MSCs. Notably, ABCB5 + Silencing IL-1RA in the source MSCs at least partially suppressed TNFα repression in co-culture with either human or mouse macrophages. As expected, scrambled control siRNA was used with transfected IL-1RA-competent control ABCB5. + Derived MSCs revealed their complete inhibitory effect on TNFα release from activated macrophages in vitro. Surprisingly, IL-1RA into the wound contour of iron-overloaded mice was silenced by ABCB5. + Intradermal injection of derived MSCs resulted in a complete loss of wound closure promotion. In contrast, scrambled siRNA was transfected into IL-1RA-competent ABCB5. + MSCs maintained their ability to promote wound healing in vivo at the indicated time point. IL-1RA silenced ABCB5 + The loss of MSC's ability to promote healing of iron-overloaded wounds was associated with the reversal of TNFα and IL-1β inhibition, as well as the upmodulation of IL-10. These data were obtained after stimulation at the wound site in ABCB5 + Adaptively released IL-1RA from MSCs suppresses not only IL-1 signaling but also the downstream effector TNFα, and importantly, induces anti-inflammatory IL-10. ABCB5 at the wound site. +The idea that IL-1RA released from derived MSCs suppresses unrestricted M1 activation and improves wound healing is further supported by the finding that intradermal injection of recombinant human IL-1RA around iron-overloaded wounds also promotes wound closure. In contrast, injection of recombinant IL-1RA into acute wounds did not promote healing. TSG-6 was also found to be expressed in ABCB5 human MSCs in iron-overloaded wounds. However, injection of recombinant TSG-6 into iron-overloaded wounds did not result in improved wound closure. The results suggest that IL-1RA does indeed play a central role in iron-overloaded wounds, while recombinant human TSG-6 alone is not sufficient to promote healing in iron-overloaded situations. This suggests that different types of wounds reveal distinct requirements for therapeutic promotion of their healing.
[0197] ABCB5 + Derived MSCs disrupt M1 macrophage retention in wounds of iron-overloaded mice. ABCB5 + To further support the hypothesis that wound treatment with derived MSCs would interrupt the long-term persistence of M1 macrophages in wounds of iron-overloaded mice in an IL-1RA-dependent manner, a series of double immunostaining was performed on wound sections on day 5. Indeed, F4 / 80+ macrophages expressing TNFα were found to be ABCB5 + Derived MSCs were virtually absent in iron-overloaded wounds injected. In stark contrast, many TNFα+F4 / 80+ double-positive macrophages were silenced by IL-1RA in ABCB5 + Following injection of derived MSCs, residual MSCs remained in the periphery of the wound, similar to that observed in acute healing control mice pre-treated with dextran. These data were referenced in ABCB5. + The derived MSCs show that in vivo, they suppress the production of TNFα released by wound macrophages in an IL-1RA-dependent manner. Interestingly, CD206 + F4 / 80 + Wound-healing promoting M2 macrophages are ABCB5 +In wounds injected with derived MSCs, it is thought that they are concentrated in an IL-1RA-dependent manner 5 days after wound formation. In fact, ABCB5 + Immunophenotyping of single-cell preparations of wounds injected with derived MSCs on day 5 quantitatively confirmed IL-1RA-dependent switching of inflammatory M1 macrophages to pro-wound healing M2 macrophages, which is defined by a distinguishable set of surface markers. Therefore, F4 / 80 + In wound macrophages, ABCB5 + Following injection of derived MSCs, M1 activation markers, including cytokines (TNFα, IL-12 / IL-23p40) and inducible nitric oxide synthase (NOS2), were downregulated, while M2 activation markers such as mannose receptor CD206, β-glycandectin-1, and arginase-1 (ARG1) were upregulated. This M1-to-M2 shift was observed in ABCB5 transfected with scrambled siRNA. + While this was maintained in the originating MSCs, ABCB5 cells were genetically modified with IL-1RA siRNA. + After injecting derived MSCs, it was almost completely suppressed. In summary, these results are for ABCB5 + This study aims to clarify the causal role of IL-1RA secreted by MSCs in suppressing the retention of M1 macrophages in chronic wounds.
[0198] ABCB5 + The MSC-dependent macrophage shift from M1 to M2 is conserved in humanized NSG mice. Humanized NSG mice using PBMCs represent a highly suitable preclinical model for investigating the effects of in vivo therapeutic interventions on human hematopoietic lineage-derived cells
[18] . This model can be used individually to study the ABCB5 phenotype of human-derived M1 / M2 wound macrophage in NSG iron-overload mice. + The effects of injection of derived MSCs were evaluated. For this purpose, full-thickness wounds were induced in NSG mice humanized with PBMCs, and then human allogeneic ABCB5 was injected. + Originating MSC, donor matched ABCB5- HDF, or either with PBS alone, was intradermally injected into the wound contour. Consistent with the above findings, ABCB5 + Injection of derived MSCs results in PBS and ABCB5 - Compared to HDF injection, enhanced full-thickness wound closure was observed in PBMC-humanized NSG mice. Co-immunostaining of wounds on day 5 with human-specific anti-CD68 and either anti-CD206 or anti-TNFα showed ABCB5 + In wound beds injected with derived MSCs, a greater number of CD68+CD206+ human M2 macrophages were observed compared to wounds injected with PBS. Notably, the number of CD68+TNFα+ pro-inflammatory macrophages was higher in ABCB5. + In the source MSCs, the number of M1 and M2 macrophages was reduced compared to wounds injected with PBS. To confirm the number of human CD68+ M1 and M2 macrophages at the wound site, single-cell suspensions derived from wound tissue on day 5 were analyzed by multicolor flow cytometry. The ratio of CD68+ human macrophages expressing the M2 macrophage marker to human M1 was compared with the ratio of cells expressing both Dectin-1 / IL-12p40 and CD206 / TNFα in ABCB5. + In wound tissue treated with derived MSCs, the number of ABCB5 cells increased compared to PBS. These data support the comparison of ABCB5 cells with human wound macrophages. + The beneficial anti-inflammatory effects of IL-1RA released from derived MSCs are linked to humanized NOD-skid IL2rγ. null This indicates that the data was preserved in mice.
[0199] Consideration This specification reports that a newly defined population of dermal cells possessing the characteristics of MSCs can be successfully isolated from its internal microenvironment with high purity and uniformity using a single marker, P-glycoprotein ABCB5. Isolated ABCB5 +MSC subgroups reliably maintain the ability of clonal autoregeneration and clonal trisequence differentiation in vitro. A key previously unreported finding is the newly described ABCB5 in chronic iron overload wounds. + Injection of lineage-derived MSCs around the wound (via paracrine IL-1RA release) converts pro-inflammatory M1 macrophages with unrestricted activation into anti-inflammatory, pro-wound-healing M2 macrophages, thereby promoting impaired wound healing in vivo (summarized in diagrams). This constitutes a major preclinical breakthrough at the forefront of MSC-based therapies in translational medicine, which has previously suffered from the therapeutic application of a less characterized MSC population with inconsistent efficacy and potency (due to the absence of appropriate selection markers)
[19] .
[0200] The advantage of isolating and growing MSCs from skin with high uniformity depends on the fact that ABCB5 is exclusively expressed in MSCs but not in other cells in the skin. Using a comprehensive transcriptomics approach, dermal ABCB5 with a characteristic cell surface expression profile of MSCs is obtained. + The presence of cells is confirmed herein [1, 15], and further pluripotency and co-expression with stem cell markers are reported herein (10-13). The evidence is also ABCB5 + Rich MSCs (even when grown in culture to high passages) are at least partially stem cell-like, and contain endogenous ABCB5 in the skin. + RNA sequence analysis also provides evidence that it maintains the expression of MSCs and mesenchymal markers in cells. However, endogenous ABCB5 + It is unclear whether MSCs and their derivatives are related to the previously characterized fibroblast lineages [20, 21]. In fact, ABCB5 +Expression of several mouse superior lineage markers tracking the PDGFα fibroblast lineage has been found in derived MSCs, such as Prdm1 / Blimp-1, a B lymphocyte maturation marker, and CD26 / Dpp4, a dipeptidyl peptidase that cleaves dipeptides from peptides such as growth factors, chemokines, neuropeptides, and vasoactive peptides
[20] . However, ABCB5 + No co-expression of cells with αSMA+, a lower-level pro-scarring fibroblast lineage marker in skin, was found.
[20] These data are based on ABCB5 as used herein. + This suggests that the derived MSCs may share some expression characteristics with higher-order fibroblast lineages that reduce scarring. Regarding their expression profiles, see ABCB5. + The relationship between the originating MSCs and the Engrailed-1 fibroblast lineage cannot be ruled out.
[21]
[0201] Regardless of its precise relationship with fibroblast lineage, the primary intention was to use ABCB5 as a single marker for the enrichment of MSCs from the skin and to utilize this for MSC-based treatment in difficult-to-treat wounds. In virtually all studied phases of iron-overloaded wounds, an impressive rescue of impaired wound healing was indeed achieved with injected ABCB5. + The enhanced release of IL-1RA from the derived MSCs actively shifted dominant, undesirable M1 macrophages to pro-wound healing M2 macrophages. This finding is particularly clinically interesting given the shared pathogenic role of unrestricted activation of pro-inflammatory M1 macrophages that leads to impaired wound healing in chronic wounds that are difficult to treat in humans [7, 8, 22]. Evidence from several lines supports this finding.
[0202] Firstly, ABCB5 +Injection of derived MSCs enhances the repair of impaired wound healing in iron-overloaded mice, while injection of ABCB5-depleted dermal cells does not. In the wound bed of iron-overloaded mice, M2 macrophages are ABCB5-depleted. + Secondly, ABCB5 was more abundant after injection of derived MSCs compared to the numerous excessly activated M1 macrophages found after injection of either PBS or ABCB5-depleted dermal cell fractions in iron-overloaded wounds. + The development of M2 macrophages in the wound bed of iron-overloaded wounds injected with derived MSCs was associated with an increase in anti-inflammatory IL-10, a typical M2 cytokine that suppresses inflammation. Simultaneously, a decrease in the classical M1 macrophage cytokines TNFα, IL-1, IL-12, and IL-23 was observed, which are important in recruiting and activating bactericidal M1 macrophages only during the initial wound healing phase
[23] . Thirdly, the aforementioned data suggest that under M1 macrophage depletion conditions, iron-overloaded wounds exhibit a complete reversal to M2 macrophages with improved wound healing, similar to non-ferrous-overloaded wounds [7].
[0203] The following scenario is the most likely explanation for why IL-1RA can significantly reduce TNFα (apart from IL-1β): In iron-overload mouse wound models, TNFα and IL-1β concentrations increase to a higher degree, and both cytokines drive the activation of inflammatory cells, particularly macrophages. Both IL-1β and TNFα can activate NFκB [24, 25], which itself transactivates target genes such as IL-1β, IL-6, and TNFα, among other pro-inflammatory cytokines and chemokines. As a result, when IL-1RA neutralizes high levels of IL-1β, the vicious cycle of NFκB activation is significantly reduced, and the activation and expression of target genes such as IL-1β and TNFα are expected to be lower overall. Since IL-1β exerts its effects primarily through the induction of IL-6 [24, 26], IL-1RA most likely influences overall IL-6 concentration, and consequently, NFκB activation and downstream target genes. Of course, other driver cytokines other than IL-1β and TNFα cannot be ruled out. What can be concluded from the data is ABCB5 + This suggests that IL-1RA released from MSCs plays a causal role in the rebalancing of the adversarial microenvironment in chronic iron overload wounds.
[0204] The inflammasome, a multiprotein complex, may be responsible for enhanced IL-1β release in iron-overloaded wound models. Indeed, both iron and bacterial components contaminating chronic wounds promote inflammasome hyperactivation [27, 28]. The role of the inflammasome in acute and chronic tissue injury is complex and far from fully understood. Transient activation of the inflammasome during physiological wound healing is essential for harmonizing the inflammatory response in defense against microbial invasion and for effectively removing tissue debris
[28] . Inflammasome-dependent IL-1β maturation occurs via caspase-1 cleavage of the propeptide, which is required to recruit and activate neutrophils and macrophages at the site of injury. Inhibition of this inflammasome-dependent IL-1β maturation step in caspase-1-deficient mice reveals delayed wound healing
[29] . Unrestricted activation of IL-1β in mice lacking the IL-1 receptor antagonist IL-1RA results in a fibrous response in lung tissue in a model of Chlamydia pneumoniae infection
[30] . Similar to these data, persistent inflammasome-dependent IL-1β activation in diabetic mice also correlates with delayed wound healing of skin wounds
[31] , which can be restored to near-complete normal healing by suppressing the inflammasome
[32] . The findings, combined with the above reports, suggest that balanced inflammasome activation is crucial for harmonious tissue repair, and that disruption of this balance will impair wound healing.
[0205] Descriptive evidence has been reported that MSCs attenuate a single aspect of macrophage activation in vitro [33, 34, 35, 36, 37] and even in acute wound models [33, 36, 37, 38]. However, a thorough characterization of the M1-to-M2 macrophage switching, or the causative paracrine mechanism, is lacking. Therefore, this approach is aimed at the healing of chronic wounds. +This highlights the usefulness of a more complete evaluation of the paracrine effects of derived MSCs and aided in identifying IL-1RA as a key effector molecule responsible for the rigorous switching from pro-inflammatory, harmful M1 macrophages to anti-inflammatory M2 macrophages.
[0206] ABCB5 + Data on the paracrine effect of IL-1RA released from MSCs are consistent with previous findings
[39] . In this regard, IL-1RA knockout mice showed delayed wound healing of acute wounds
[39] . Furthermore, improved healing has been reported in mice with targeted deficiency of the IL-1 receptor (IL-1R), or in wild-type mice
[40] and diabetic mice [8] after treatment of acute wounds with recombinant IL-1RA. IL-1RA secretion from poorly characterized MSCs has been described as beneficial in a variety of pathological conditions in preclinical studies
[41] . The understanding that the unrestricted shift from pro-inflammatory M1 to anti-inflammatory M2 macrophages is due to beneficial IL-1RA effects that reliably control macrophage-controlled tissue inflammation is clearly advanced herein.
[0207] Conceptually and data-wise, from reference
[42] , there is clear evidence that human IL-1RA can efficiently bind to mouse cells with high affinity, thereby inhibiting mouse IL-1β binding and signaling. In this regard, it has been previously shown that human IL-1RA binds to the type I IL-1 receptor in mouse cells with an affinity of 150 pM, the same as the binding of human IL-1α and IL-1β.
[0208] It cannot be excluded that, in addition to IL1RA, other mechanisms may contribute to counteracting tissue damage caused by unrestricted M1 macrophage activation. Indeed, multiple researchers, including the inventors herein, have previously shown that MSCs attenuate inflammation and, as a result, reduce scar formation in tissue repair through the release of tumor necrosis factor-induced gene 6 protein (TSG-6) [36, 43]. In contrast to the promotion of full-thickness wound healing after TSG-6 release from MSCs injected into the wound site
[36] , TSG-6 does not appear to play a major role in promoting the healing of iron overload wounds, despite being expressed at the wound site of iron overload wounds. Indeed, injection of recombinant TSG-6 at concentrations that enhance acute wound healing does not enhance the healing of iron overload wounds. Differences in the microenvironment are sensed by the injected MSCs, which can, as a result, give rise to various adaptive responses by the released anti-inflammatory factors.
[0209] In addition to IL-1RA, other factors may contribute to promoting healing. In this regard, MSCs have been reported to suppress oxidative damage during sepsis by promoting the release of anti-inflammatory IL-10 through PGE2-dependent reprogramming of macrophages
[44] . In addition, by enhancing the release of IL-6 and TGF-β, MSCs inhibit neutrophil recruitment by cytokine-activated endothelial cells
[45] .
[0210] A minor limiting factor of the mouse wound model used is a moderate delay in wound closure compared to non-healing CVUs in patients. However, this model mimics the unrestricted activation of wound M1 macrophages with long-term inflammation and tissue destruction induced by iron and thus represents a model well-suited to studying the effects of treatment strategies against these specific pathophysiological traits [7].
[0211] In summary, the findings have substantial clinical implications for planned implementation into clinical routines. Here, we reveal for the first time the adaptive release of key factors that efficiently attenuates inflammation dominated by unrestricted M1 macrophages underlying dysregulated tissue repair in iron-overload chronic wounds. Secondly, the use of a single-marker strategy allows for the readily accessible homogeneous ABCB5 from human skin. + This enables the concentration of the derived MSC population in GMP-grade quality, ready for immediate use in clinical facilities. Thirdly, predictive in vitro assays were developed for the successful action of the MSC preparations used in chronic mouse wound models. Single or pooled MSCs from various donors, ABCB5 + The derived MSC preparation successfully inhibited the release of M1 macrophage cytokines, and this inhibitory effect is equivalent to that of ABCB5 + When derived MSCs are injected into iron-overloaded wounds, they correlate well with improved healing.
[0212] Therefore, the above data is newly described dermal ABCB5 + The enhanced efficacy and efficacy of derived MSCs have been demonstrated, which holds substantial promise for the successful clinical treatment of non-healing wounds. In fact, a Phase II clinical study has recently been initiated (EudraCT number: 2015-000399-81), and the results from the first patients studied are promising.
[0213] material and method Research design The purpose of this study is to study human dermal ABCB5 + The objective is to determine whether the cells are MSCs and whether they have a beneficial effect on the healing of chronic wounds in cell therapy. In vitro, ABCB5 cells are obtained from at least six different donors (Table 1: B02-B07). + MSC and donor match ABCB5 -HDF was quantitatively tested for its characteristic trilinear differentiation of MSCs, surface marker expression, clonal proliferation, autoregeneration, and anti-inflammatory effects on activated macrophages. In vivo, the improvement of wound healing by anti-inflammatory mechanisms was evaluated in a mouse iron-overloaded full-thickness excision wound model for chronic venous ulcers, characterized by delayed wound closure, prolonged inflammation, and an abundance of activated M1 macrophages [7]. For these animal studies, sample size was estimated based on differences in wound closure, building on previous studies that identified delayed wound healing in genetically modified mice
[46] , and one additional animal (four wounds) was included to protect against deviations from the Gaussian distribution in order to reach a 5% significance level and 80% power by Welch's test. ABCB5 + ABCB5 with matching origin MSC and donor. - Key animal studies involving HDF injection were performed three times using cells from three different donors (Table 1: B01, B13, B14). Repeated experiments for sample retrieval were performed using human dermal cells from donor B01 (internal number B01), for which cell preparation purity and wound closure data are shown here, or using pooled cell samples from six different donors that were phenotypically and functionally validated (Table 1). This pooled dermal ABCB5 + Derived MSC preparations were also used for Il-1RA knockdown and humanized NSG mouse wound closure experiments. The amount of independent biological material analyzed in each quantitative assay. Microscopic images are representative of six wound samples per treatment group. Xenografted ABCB5 + For the analysis of the persistence of derived MSCs, biological samples for analysis by human-specific beta-actin qPCR and ELISA quantification of wound cytokine titers on wound sections were pooled from two independent wounds, and for hIL-1RA Western blotting and wound macrophage flow cytometry, samples were pooled from four independent wounds.
[0214] Human skin samples In this study, ABCB5 + and ABCB- The skin biopsy used for isolating the cell fraction was 1 cm 2 The biopsies were of a certain size and were obtained from young, healthy volunteers at the University Clinic of Dermatology and Allergic Diseases in Ulm, University Clinic of Gynecology (skin from healthy women undergoing breast reduction surgery) (donors B02-B07), either after approval by the Ethics Committee at the University of Ulm, or directly from clients of Ticeba GmbH (Heidelberg, Germany) (donors B01, B08-B14) after written informed consent was obtained in accordance with the principles of the Declaration of Helsinki. Location was selected to avoid isolating cells from sun-exposed areas of skin. Variations in location (buttock region, medial upper arm, or behind the left ear) depended on surgical standards and donor preference. All biopsies were histologically evaluated for any pathological conditions. Only biopsies without pathological conditions were used for immunohistochemistry and ABCB5 staining. + and ABCB - Used for the isolation of cell fractions. Of the biopsies obtained, ABCB5 + No cells were able to be generated. Anonymous donor data can be found in Table 1. Plastic-adherent dermal cell proliferation and isolation based on ABCB5, modified from Frank et al.
[47] , was performed as shown (see Materials and Methods for details). Cell viability was assessed before in vitro experiments and ABCB5 + and ABCB5 - No differences were found between the two groups (>90%). Additionally, Accutase was used for injection into wounds, resulting in ABCB5 + MSC and ABCB5 - When collecting cell fractions, viability is conventionally checked by trypan blue exclusion, ABCB5 + and ABCB5 - In both groups, the percentage was consistently very high (>90%).
[0215] Prior to application in in vivo wound healing experiments, ABCB5 + The cell preparations were tested for their M1 macrophage inhibitory function in co-culture with IFN-γ / LPS-activated mouse bone marrow-derived macrophages, and TNFα release was evaluated using mouse-specific TNFα ELISA (R&D Systems).
[0216] Differentiation and clonal proliferation assays In vitro differentiation potential for adipogenic, osteogenic, and chondrogenic cells was tested using commercially available differentiation media (Lonza); TGF-β3 (CellSystems) and procedures, following the manufacturer's instructions. For adipogenic differentiation, lipid droplet accumulation was verified by staining with Oil Red O (Sigma-Aldrich) and quantified by dye extraction as described above
[48] . Mineralization of the extracellular matrix of osteoblasts was verified by staining with Alizarin Red S (Sigma-Aldrich) and quantified by subsequent dye extraction as described above
[49] . To visualize chondrogenic differentiation, 3D-micromass cultures were immunostained for aggrecan according to a standard procedure (see "Immunofluorescence Staining") (R&D Systems, AF1220). To quantify cartilage formation, cartilage-specific sulfated proteoglycans and glycosaminoglycans formed in micromasses were measured using the Blyscan glycosaminoglycan assay kit (Biocolor) according to the manufacturer's instructions. For evaluation of clonal proliferation, ABCB5 was used. + Dermal MSCs and donor-matched ABCB5 - HDF was seeded at a density of 200 cells per 100 mm of culture dish. After 14 days, colonies were stained with 0.5% crystal violet (Sigma-Aldrich), and colonies with ≥25 cells were counted on 3-5 parallel dishes per sample. For clonal proliferation assay, ABCB5 +Derived MSCs were seeded at a density of 200 cells per 100 mm of culture dish. After 14 days, 12 colonies were picked from adjacent colonies, separated by at least one microscopic field of view, and allowed to grow. Well-developed clonal cultures were selected for secondary trisequence differentiation and clonal growth assays.
[0217] Human and mouse macrophage co-culture Mouse bone marrow-derived macrophages were isolated from femurs and matured for 6 days with macrophage colony-stimulating factor (M-CSF) including supplementation with L929 cell supernatant
[46] . Human macrophages were matured for 8 days in the presence of 20 ng / ml recombinant human M-CSF (Miltenyi Biotec) from PBMC-derived monocytes sorted to >95% purity for CD14 expression by positive magnetic bead selection (Miltenyi Biotec). Fresh buffy coat for PBMC isolation by gradient centrifugation (PAA) was obtained from German Red Cross. For co-culture experiments, ABCB5 + ABCB5 originating from MSC or donor matching - HDF in a 24-well plate, 2 x 10 4 Cells were seeded and adhered to 0.5 ml of DMEM containing 10% high-quality fetal bovine serum, 100 U / ml penicillin / streptomycin, and 2 mM L-glutamine in each well. After 24 hours, macrophages were placed on top of 1 × 10⁶ cells. 5 Cells were seeded in 0.5 ml of wells to obtain a 1:5 cell ratio unless otherwise indicated. The co-culture was transferred to 50 ml of wells. -1 Incubate with recombinant mice or human IFN-γ (R&D Systems) for 24 hours, then inject 20 ng ml. -1 LPS (Sigma-Aldrich) and 50Uml -1 The cells were stimulated with IFN-γ for an additional 24 hours, and the supernatant was then collected and analyzed by ELISA (R&D Systems).
[0218] Mouse and wound healing models Female C57BL / 6N (Charles River, strain 027) and female or male NOD.Cg-Prkdc skid Il2rgtm1Wjl / SzJ (Jax strain 005557) mice were both 10-12 weeks old at the start of the experiment and were kept in individually ventilated cages under specific pathogen-free conditions at the animal facility of the University of Ulm. The experiment was conducted in accordance with the German Law for the Welfare of Laboratory Animals and approved by the Baden-Württemberg State Government Review Board.
[0219] The C57BL / 6 mouse model related to the physiopathology of CVU was prepared as previously described [7]. Human dermal ABCB5 + Originating from MSC or corresponding ABCB5 - For cell treatment with HDF, 1 × 10⁶ mice per individual suspended in PBS. 6 The cells were injected into the dermis at three 50 μl injection points around the contour of each wound.
[0220] To evaluate wound closure, NSG mice were injected with 200 μl of PBS containing 2 × 10¹⁶ molecules via tail vein injection, as previously described, 8 days prior to wound formation. 7 Humanized with human PBMCs
[18] . On day 1 after wound formation, mice were randomly assigned to a pool of 6 donors (ABCB5). + MSC preparations (Table 1: B01+B08+B09+B10+B11+B12), ABCB5 with matching donor. - Participants were assigned to receive intradermal injections of either HDF or PBS alone. To evaluate macrophage phenotypic shifts, NSG mice were humanized one day before wound formation. On day 1 after wound formation, the randomized group received ABCB5 from donor B01 as described above. + The mice were treated with either MSC or PBS. On day 5 after wound formation, half of each mouse's two independent wounds was treated for immunofluorescence staining, and the other half was pooled for flow cytometry.
[0221] ABCB5 + Knockdown of siRNA-mediated IL-1RA expression in derived MSCs ABCB5 + Derived MSCs were transiently transfected with either a combination of four siRNAs specific to 20 nM human IL-1RA or scrambled control-A siRNA using the accompanying transgenic medium (all products from Santa Cruz Biotechnologies) at the lowest recommended concentration, according to the manufacturer's instructions. Prior to use in in vivo experiments, successful knockdown at the protein level was tested by in vitro inflammatory stimulation with IFN-γ / LPS-activated mouse bone marrow macrophages and by ELISA of the culture supernatant for human IL-1RA (R&D Systems), which was typically around 80%.
[0222] Histology and immunofluorescence staining Human skin tissue samples were embedded in OCT compound (TissueTek), frozen at -80°C, processed into 5 μm sections, and fixed in acetone. Mouse wounds were fixed overnight with 4% PFA, centrally dissected, and paraffin-embedded. To avoid wound contours, only 5 μm sections from the first series were used. Adherent cells were cultured on glass coverslips, fixed with 4% PFA, and permeabilized with 0.5% TritonX-100 in PBS. Sections or slides were incubated at 4°C with the listed primary antibodies in supplement material (Table 3), diluted in antibody diluent (DAKO) as recommended by the manufacturer. 14 μg ml of mouse anti-ABCB5 was used for staining frozen sections. -1 Use at this concentration, incubate at 37°C for 40 minutes, and use 4 μg ml for staining adherent cells. -1The cells were incubated overnight at 4°C. After washing with PBS, the sections were incubated with either AlexaFluor488 or AlexaFluor555, along with the corresponding secondary antibody (all from Invitrogen). The nuclei were counterstained with DAPI and then mounted in fluorescent mounting medium (DAKO). Background staining was controlled with appropriate isotype-matched control antibodies. The specificity of anti-ABCB5 staining was evaluated by a peptide competition assay, which involved pre-incubating with a 200-fold molar excess of the epitope amino acid sequence peptide
[47] (RFGAYLIQAGRMTPEG, GeneCrust) followed by immunofluorescence staining, which showed loss of fluorescence signal.
[0223] Masson's trichrome (Sigma-Aldrich) and picrosilius red (Polysciences) staining were performed on paraffin sections according to the manufacturer's instructions, and the picrosilius red-stained slides were analyzed using circularly polarized light. Images were acquired using an AxioImager.M1 microscope, AxioCam MRc camera, and AxioVision software (Carl Zeiss).
[0224] Human-specific beta-actin sequence-specific qPCR Injected human ABCB5 in mouse wound sections + Source MSC and ABCB5 -HDF quantification was performed by human-specific beta-actin sequence PCR. Briefly, genomic DNA was isolated from PFA-fixed paraffin-embedded wound sections using the QIAamp DNA FFPE tissue kit (56404, Qiagen), and then PCR was performed using human-specific beta-actin primers (forward primer: CACCACCGCCGAGACCGC and reverse primer: GCTGGCCGGGCTTACCTG). Next, densitometry analysis was performed to separate the PCR products on a gel image, and the density of the PCR products, normalized with mouse-specific beta-actin sequence PCR products, was quantified. Mouse beta-actin PCR was performed using mouse-specific beta-actin primers (forward primer: CCTTCCTTCTTGGGTAAGTTGTAGC and reverse primer: CCATACCTAAGAGAAGAGTGACAGAAATC).
[0225] ELISA and Western blot Frozen and finely chopped wound tissue samples were dissolved in RIPA buffer (Sigma) supplemented with a protease inhibitor cocktail (Roche) and phosphatase inhibitors Na3VO4 (2 mM) and NaF (10 mM) in a Lysing D column (MP Biomedicals), and subjected to three rounds of 20-second cooling vibration. Protein yield was measured by Bradford assay and spectrophotometric analysis against BSA-standard dilutions. All ELISA assays were performed using DuoSet kits (R&D Systems) according to the manufacturer's instructions. Western blot analysis for IL-1RA was performed as previously published
[50] . Rabbit anti-IL-1RA IgG1 antibody (Abcam#ab124962) for detecting human and mouse IL-1RA was used at a dilution of 1:1000, and secondary HRP-conjugated anti-rabbit IgG(H+L) antibody (Dianova) was used at a dilution of 1:10,000. Equivalent loading was verified using actin. After the addition of the TMB substrate (BD OptEIA), chemiluminescence was detected using Vilber Fusion Fx7 (Vilber Lourmat).
[0226] Flow cytometry Flow cytometry for ABCB5 was performed using anti-ABCB5 mouse IgG1 (clone 3C2-1D12;
[47] ) and secondary AlexaFluor647-conjugated donkey anti-mouse IgG (H+L) (Fisher Scientific). Multicolor labeling of cells for the MSC marker panel CD90, CD73, and CD105, as well as for CD34, CD14, CD20, and CD45, was performed using the human MSC phenotyping kit (Miltenyi Biotec) according to the manufacturer's instructions. Anti-human SSEA4-PE, CD271-FITC, CD133, CD318, and Melan-A antibodies (Table 3) were incubated with cells at 4°C for 45 minutes at the manufacturer's recommended concentrations. For the detection of CD133, CD318, and Melan-A, cells washed with FACS buffer (1% BSA in PBS) were then incubated with fluorescent dye-conjugated secondary antibodies at 4°C for 45 minutes. Dead cells were excluded by co-staining with SYTOX Blue (Invitrogen). A control antibody with a matching isotype was used for gate setting.
[0227] For the isolation of wound macrophages, mouse wounds were digested as previously described [33, 36]. Briefly, finely chopped tissue was incubated in HEPES-interfered saline with 1.5 mg / ml collagenase I and 1.5 mg / ml hyaluronidase I (Sigma-Aldrich) at 37°C for 1 hour. Single-cell preparations were filtered and incubated with FcR blocking (MACS) for 15 minutes, followed by staining with the antibodies listed in supplementary materials (Table 3). Further intracellular staining was performed after fixation and permeabilization using commercially available kits (BD) according to the manufacturer's protocol. Blank and single-stained samples were used for PMT and compensation setting. For wound macrophages, singlet F4 / 80+ mouse macrophages from C57BL / 6N samples and singlet CD68+ human macrophages from humanized NSG mouse samples were gated for subsequent M1 and M2 marker expression analysis based on relative fluorescence units (RFU = geometric mean fluorescence intensity relative to isotype control sample) or % positive events within the macrophage population. A positive threshold was set for control samples stained with appropriate fluorescence-conjugated isotype controls and macrophage gating markers. Flow cytometry was performed using FACSCanto II, FACSAria Fusion, or Accuri flow cytometers (BD Biosciences), and the data were subsequently analyzed using FlowJo analysis software (TreeStar Inc.).
[0228] Comprehensive transcriptome profiling and quantitative PCR To prepare the total RNA-Seq library, 500 ng of total RNA was used as input. First, the 500 ng of total RNA was used to deplete rRNA using a commercially available kit (Low Input Ribominus Eukaryotic System v2, Thermo) with minor modifications as described in the manual. Briefly, after depleting rRNA using RiboMinus® Eukaryote Probe Mix, the supernatant containing the rRNA-depleted RNA was collected and incubated on ice for 20 minutes with 3×Agencourt RNAClean XP beads. Then, the supernatant was removed, the RNAClean XP beads were washed twice with 80% ethanol, and finally, the rRNA-depleted RNA was eluted from the beads in 10 μl of nuclease-free water. The rRNA-depleted RNA was used to prepare RNASeq libraries for the Illumina platform using the NEBNext Ultra II Directional RNA Library Prep Kit (NEB) with some modifications. Quality control of the RNASeq libraries was performed using an Agilent Bioanalyzer, and library concentrations were measured in qubits using the dsDNA HS assay kit (Thermo). The libraries were sequenced on an Illumina NextSeq 500 system using the NextSeq 500 / 550 v2 kit (Microsynth AG, Switzerland) for 75 cycles of sequencing (1×75 single-ended reads) and two index reads of 8 cycles each. Demultiplexed rough reads (fastq) were used for gene expression analysis as previously described
[51] . In short, we used a fastq file, aligned it with the human genome reference (GRCh38) using Hisat2, then assembled the transcript, and estimated abundances and differential expression were performed using cufflinks and cuffdiff, respectively.The visualization of RNASeq data analysis was performed using custom scripts with R packages, cummeRbund, gplots, and ggplot2.
[0229] Data availability The RNASeq data was uploaded to GEO under accession number GEO GSE125829. The 2906-base pair ABCB5 cDNA sequence can be found in NCBI GenBank under accession number AY234788.
[0230] statistical analysis Statistical analysis of differences between each of the two treatment groups in independent quantitative measurements in vitro and in vivo was performed using a two-tailed independent Student t-test, protected for unequal variances by Welch correction. ABCB5 + and donor matching ABCB5 - In vitro comparisons of cell fractions were analyzed using paired t-tests. In rare cases, outliers detected visually were excluded from the analysis after post-hoc validation with Grubbs test at α=5%. Statistical data analysis was performed using GraphPad Prism 6 software (Software for Science). Unless otherwise indicated, graphs show the mean, error bars represent the standard deviation, and stars represent the significance level: ns = not significant; *p<0.05; **p<0.01; ***p<0.001.
[0231] material and method ABCB5 + and ABCB5 - Proliferation and isolation of dermal cell fraction Plastic-adhered dermal cells were grown for up to 16 passages, equivalent to doubling of 25 cumulative populations, and sorted by magnetic beads with mouse anti-human ABCB5 IgG1 antibody (clone UG3C2-2D12;(51)) in 2 and 3 consecutive rounds, respectively, and ABCB5 + and ABCB5 -The sample was divided into fractions. The sorting purity exceeded 90%, achieving GMP grade dermal ABCB5. + It is one of the criteria for cell release (Table 2). Flow cytometry revealed ABCB5 + The average cell purity was 98.33% ± 1.12% (n=243). For the experiment, selected cells were cryoprotected or cultured for up to 72 hours. At this point, purity was typically >70%. ABCB5 + Dermal MSCs were cultured at 37°C and 3% CO2 in Ham F10 supplemented with 15% heat-inactivated high-quality fetal bovine serum, 6 mM HEPES, 2.8 μg / ml hydrocortisone, 100 U / ml penicillin / streptomycin, 2 mM L-glutamine, 10 μg / ml insulin, 0.2 mg / ml glucose, 6.16 ng / ml PMA (Sigma-Aldrich), and 0.6 ng / ml recombinant human basic fibroblast growth factor (Prospecbio). ABCB5 was used with Versene (Gibco). + Dermal cells were detached from the culture plastic. ABCB5 - HDF was maintained at 37°C and 5% CO2 in DMEM containing 10% high-quality fetal bovine serum, 100 U / ml penicillin / streptomycin, and 2 mM L-glutamine (Biochrom).
[0232] C57BL / 6 mouse model related to CVU pathophysiology C57 / BL / 6 mice were intraperitoneally injected with 5 mg / 200 μl of iron-dextran or 200 μl of PBS-dextran (Sigma-Aldrich) seven times at 3-day intervals. One day after the last iron injection, under anesthesia, four 6 mm full-thickness excision wounds were made on the dorsal skin of shaved mice using a biopsy punch (Stiefel). The wounds were photographed next to a linear measuring tape using Adobe Photoshop software (Adobe Systems) to quantify the wound area.
[0233] IL-1β quantitative PCR Total RNA was isolated from human chronic venous lower extremity ulcers (CVU), mouse wounds, and corresponding healthy control skin using a commercially available kit (RNeasy Microarray Tissue Mini Kit, Qiagen) as described by the manufacturer. 2 μg of RNA per sample was reverse transcribed using illustra Ready-To-Go RT-PCR Beads (GE Healthcare). The quantity and quality of total RNA and cDNA were assessed using Nanodrop 1000 (Thermo Scientific) and the QIAxcel Advance system (Qiagen). cDNA was amplified using the Power SYBR Green Master Mix (Applied Biosystems, Life Technologies) on a 7300 Real-Time PCR system (Applied Biosystems, Life Technologies). For the data shown in Figure S4, primers specific to human IL-1β (FW:5'-CCCAAGCAATACCCAAAGA-3' and REV:5'-CCACTTTGCTCTTGACTTCTA-3') and primers specific to mouse IL-1β (FW:5'-TCACAAGCAGAGCACAAG-3' and REV:5'-GAAACAGTCCAGCCCATAC-3') were used.
[0234] The effect of human recombinant IL-1RA intradermal injection on delayed wound healing. Iron-overloaded chronic wound healing model mice were randomly divided into three treatment groups, including: (i) dextran / PBS acute wound healing control, (ii) iron / PBS group, and (iii) iron / rhIL-1RA treatment group with intradermal injection of 250 ng / wound recombinant human IL-1RA around the wound contour on days 2 and 4, as previously described for the acute model (36). Acute wound healing model mice were randomly assigned to (i) a control group injected with PBS, and (ii) an rhIL-1RA treatment group as described for the chronic model. Wound closure over time was quantified by the area of the wound surface on days 3, 5, 7, and 10 compared to day 0 (Figure S5).
[0235] Table 1. Human skin donors. (A) In this study, ABCB5 in vivo + (B) Data on CVU of healthy skin donors and IL-1β immunostaining of normal human skin used to characterize dermal cells and CVU. (A) Data from healthy skin donors used for dermal cell ABCB5 sorting in this study. [Table 1-1] [Table 1-2]
[0236] Table 2. GMP-compliant dermal ABCB5 used in this study + Release standards for MSC preparations. [Table 2]
[0237] Table 3. List of antibodies used in this study. A: The primary antibody used for immunohistochemical staining. [Table 3-1]
[0238] B: Flow cytometry antibody. [Table 3-2] [Table 3-3]
[0239] References [Table B-1] [Table B-2] [Table B-3] [Table B-4] [Table B-5] [Table B-6]
[0240] All references cited herein are to be incorporated solely by reference. It should be understood that by having several aspects of at least one aspect of the present invention as described herein, those skilled in the art will readily recall a variety of modifications, modifications and improvements. Such modifications, modifications and improvements are intended to be part of the present disclosure and to be within the spirit and scope of the present invention. Accordingly, the foregoing description and drawings are merely examples.
Claims
1. A population of synthetic ABCB5+ stem cells, where more than 96% of the population are in vitro descendants of physiologically present skin-derived ABCB5-positive mesenchymal stem cells. A composition containing the following:
2. The composition according to claim 1, wherein more than 96.5%, 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
3. The composition according to claim 1, wherein 100% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
4. The composition according to claim 1 or 2, wherein more than 90% of the synthetic stem cells in the population co-express CD90.
5. The composition according to any one of claims 1 to 4, wherein a population of synthetic stem cells is capable of secreting VEGF under hypoxic conditions, which is measured by ELISA.
6. The composition according to any one of claims 1 to 5, wherein a population of synthetic stem cells can secrete IL-1RA after being co-cultured with macrophages polarized to Mi.
7. The composition according to any one of claims 1 to 6, wherein a population of synthetic stem cells induces a decrease in TNF-alpha and IL-12 / IL-23p40 secretion and an increase in IL-10 secretion in a macrophage coculture compared to isolated physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
8. The composition according to any one of claims 1 to 7, wherein the population of synthetic stem cells has pluripotent differentiation ability.
9. The composition according to any one of claims 1 to 8, wherein a population of synthetic stem cells has the ability to differentiate into cells derived from all three germ layers: endoderm, mesoderm, and ectoderm.
10. The composition according to any one of claims 1 to 8, wherein the population of synthetic stem cells has the ability to differentiate into corneal epithelium.
11. The composition according to any one of claims 1 to 10, wherein a population of synthetic stem cells shows increased expression of stem cell markers including SOX2, NANOG, and SOX3 compared to isolated physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
12. The composition according to any one of claims 1 to 11, wherein a population of synthetic stem cells exhibits reduced expression of mesenchymal stromal cell differentiation markers, including MCAM, CRIG1, and ATXN1, compared to isolated physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
13. The composition according to any one of claims 1 to 12, wherein at least 5% of the population of synthetic stem cells contains an exogenous gene.
14. The composition according to any one of claims 1 to 12, wherein at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the population of synthetic stem cells contain an exogenous gene.
15. The composition according to claim 13 or 14, wherein the exogenous gene is a gene encoding a protein selected from the group consisting of tissue-specific homing factors, secretory tissue remodeling proteins, growth factors, cytokines, hormones, and neurotransmitters.
16. The composition according to any one of claims 1 to 12, wherein at least 5% of the population of synthetic stem cells contains gene modifications.
17. The composition according to any one of claims 1 to 12, wherein at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the population of synthetic stem cells contain gene modifications.
18. The composition according to claim 16 or 17, wherein synthetic stem cells are modified by delivering a complex comprising a CRISPR RNA guide nuclease and a gene-targeting gRNA.
19. The composition according to claim 13 or 14, wherein the modified gene is a gene selected from the group consisting of COL7A or ABCB5+ deletion genes.
20. A method for preparing a population of cells, comprising: isolating primary cells from skin tissue of a human subject; culturing the primary cells in culture medium until the cells produce enough offspring to reach a mixed cell population with a confluence of more than 60%, collecting the mixed cells, culturing the collected mixed cells, recollecting them, and culturing the cells through at least five passages until the population of cells is such that at least 99% are manufactured synthetic cells and less than 10% are primary physiologically present skin-derived cells; and isolating ABCB5-positive cells using an ABCB5+ antibody.
21. The method according to claim 20, comprising recollecting and culturing cells through at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 passages.
22. The method according to claim 20, comprising recollecting and culturing cells until the cell population reaches a state in which at least 99.99% are manufactured synthetic cells and less than 0.01% are primary physiologically present skin-derived cells.
23. The method according to claim 20, comprising recollecting and culturing cells until the cell population reaches a state in which at least 99.9995% are manufactured synthetic cells and less than 0.0005% are primary physiologically present skin-derived cells.
24. The method according to claim 20, comprising recollecting and culturing cells until the cell population reaches a state in which at least 99.999997% are manufactured synthetic cells and less than 0.000003% are primary physiologically present skin-derived cells.
25. The method according to any one of claims 20 to 24, wherein the isolation step comprises an ABCB5 antibody conjugated to magnetic beads.
26. The method according to any one of claims 20 to 25, wherein the cells are cultured in a culture medium prepared using Ham F-10 as the basal medium.
27. The method according to any one of claims 20 to 26, wherein the cellular confluence and cellular morphology are evaluated at each cell proliferation step.
28. The method according to any one of claims 20 to 27, wherein the final culture and isolation steps are separated by at least three days.
29. The method according to any one of claims 20 to 26, wherein cells are collected using EDTA.
30. A method for inducing tissue development, comprising promoting the differentiation of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, into differentiated tissue.
31. A method for promoting syngeneic transplantation, comprising administering to a subject having a syngeneic graft an isolated population of synthetic ABCB5+ stem cells, wherein more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
32. A method for treating peripheral arterial occlusive disease (PAOD), comprising administering to a subject having PAOD an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective dose for treating the disease.
33. A method for treating acute exacerbation of chronic hepatic failure (AOCLF), comprising administering to a subject having AOCLF an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective dose for treating the disease.
34. A method for treating corneal margin stem cell deficiency (LSCD), comprising administering to a subject having LSCD an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective dose for treating the disease.
35. A method for treating a corneal disease, comprising administering to a subject having a corneal disease an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective amount for treating the disease.
36. A method for treating epidermolysis bullosa (EB), comprising administering to a subject having EB an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective amount for treating the disease.
37. A method for healing a skin wound, comprising contacting the wound with an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, in an effective amount to promote wound healing.
38. The method according to claim 37, wherein an isolated population of synthetic ABCB5+ stem cells is seeded on a matrix or scaffold.
39. The method according to claim 38, wherein the matrix is a polymer mesh or sponge, a polymer hydrogel, or a collagen matrix.
40. A method comprising administering to subjects undergoing organ transplantation an effective amount to promote the survival of an allograft of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
41. A method for treating an autoimmune disease, comprising administering to a subject having an autoimmune disease an effective amount for treating the autoimmune disease of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
42. A method for treating liver disease, comprising administering to a subject having liver disease an effective amount for treating liver disease of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
43. A method for treating a neurodegenerative disease, comprising administering to a subject having a neurodegenerative disease an effective amount for treating the neurodegenerative disease of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, wherein the neurodegenerative disease is related to an immune response against host cells, the method.
44. A method for treating cardiovascular disease, comprising administering to a subject having cardiovascular disease an effective amount for treating the cardiovascular disease of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells, wherein the cardiovascular disease is related to tissue remodeling.
45. A method for treating kidney disease, comprising administering to a subject having kidney disease an effective amount for treating kidney disease of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
46. A method for treating an inflammatory disorder, comprising administering to a subject having an inflammatory disorder an effective amount for treating the inflammatory disorder of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
47. The method according to claim 46, wherein the inflammatory disorder is selected from the group consisting of cardiovascular disease, ischemic stroke, Alzheimer's disease, and aging.
48. A method for treating a musculoskeletal disorder, comprising administering to a subject having an inflammatory disorder an effective amount for treating the musculoskeletal disorder of an isolated population of synthetic ABCB5+ stem cells, where more than 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro progeny of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.
49. The method according to claim 48, wherein the musculoskeletal disorder is hereditary muscular dystrophy.
50. The method according to any one of claims 30 to 49, wherein the population of synthetic stem cells is the synthetic cells described in any one of claims 1 to 19.
51. A method for reprogramming cells, Using a population of synthetic stem cells according to any one of claims 1 to 19 as a substrate for pluripotency-based cell reprogramming. The method, including the method described above.
52. A population of synthetic stem cells according to any one of claims 1 to 19, further comprising an exogenous PAX6 gene.
53. A population of synthetic ABCB5+ stem cells, in which this population of cells expresses KRT12. A composition containing the following:
54. The method according to claim 53, wherein more than 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, 99.7%, 99.9%, 99.99%, 99.998%, 99.999%, or 99.999997% of the population are in vitro offspring of physiologically present skin-derived ABCB5-positive mesenchymal stem cells.