spinach plant
Spinach plants with specific polynucleotide sequences provide resistance to multiple downy mildew races, and a screening method identifies these resistant plants, overcoming the lack of comprehensive resistance in current cultivars.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- TAKII
- Filing Date
- 2024-11-08
- Publication Date
- 2026-05-20
AI Technical Summary
Current spinach cultivars lack resistance to all known races of downy mildew, with outbreaks of new races such as Pe17, Pe18, and Pe19 reported, and no strains providing comprehensive resistance have been identified.
Development of spinach plants with specific polynucleotide sequences (Sequence A and Sequence B) in their genome, which confer resistance to downy mildew races Pe17, Pe18, and Pe19, and potentially other races, along with a screening method to identify these plants.
The described spinach plants exhibit resistance to multiple downy mildew races, including Pe17, Pe18, and Pe19, and a screening method ensures the identification of plants with these resistance traits, addressing the susceptibility issue in existing cultivars.
Smart Images

Figure 2026083708000013 
Figure 2026083708000014 
Figure 2026083708000015
Abstract
Description
Technical Field
[0001] This specification discloses a screening method for spinach plants and a method for producing spinach plants.
Background Art
[0002] Downy mildew of spinach is caused by the obligate parasite Peronospora effusa, which causes yellowing of leaves and significantly reduces quality by forming grayish-brown spores on both sides of the leaves. It is the most important disease of spinach. Downy mildew of spinach is prone to resistance breakdown, and the occurrence of downy mildew in resistant varieties has been frequently reported. In the past 20 years, 10 new races of downy mildew pathogens have been identified (Non-Patent Document 1). Currently, 20 races, Pe1 to 20, of downy mildew pathogens are officially recognized as races (Non-Patent Document 2), but in addition, downy mildew caused by multiple strains occurs every year. In Non-Patent Document 1, strains showing pathogenicity different from those in the past have been reported among the downy mildew isolated strains that occurred from 2013 to 2017, and it is predicted that the number of races will continue to increase in the future (Non-Patent Document 1, Non-Patent Document 5). Also, in Japan, the occurrence of Pe1 to 8, 10, 12, 13, and 17 has been reported (Non-Patent Document 3).
[0003] As spinach downy mildew resistance genes, in Non-Patent Document 1 and Non-Patent Document 4, 10 genes, RPF1, RPF2, RPF3, RPF4, RPF5, RPF6, RPF7, RPF9, RPF10, and RPF11, have been reported. Also, many downy mildew resistance genes named WOLF (Patent Documents 1, 12, 13), RPF11 (Patent Document 2), RPF12 (Patent Document 3), RPF13 (Patent Document 4), RPF14 (Patent Document 5), RPF15 (Patent Document 6), R6 (Patent Document 7), R15 (Patent Document 8), etc. have been reported. Furthermore, spinach having a downy mildew resistance gene without a given gene name has also been reported (Patent Documents 9, 10). However, it has been reported that no gene is known to express resistance to all known races (Patent Document 11). [Prior art documents] [Patent Documents]
[0004] [Patent Document 1] International Publication No. 2018 / 060474 [Patent Document 2] European Patent Application Publication No. 2848114 [Patent Document 3] International Publication No. 2015 / 036469 [Patent Document 4] International Publication No. 2015 / 036378 [Patent Document 5] International Publication No. 2019 / 145446 [Patent Document 6] International Publication No. 2019 / 145447 [Patent Document 7] Patent No. 6457269 specification [Patent Document 8] International Publication No. 2017 / 084724 [Patent Document 9] International Publication No. 2017 / 081187 [Patent Document 10] Japanese Patent Publication No. 2015-231359 Public Relations [Patent Document 11] International Publication No. 2018 / 059651 [Patent Document 12] International Publication No. 2022 / 090543 [Patent Document 13] International Publication No. 2022 / 090546 [Non-patent literature]
[0005] [Non-Patent Document 1] Chunda Feng et al., 2018. New Races and novel Strains of the Spinach Downy Mildew Pathogen Peronospora effusa. Plant Disease 102:613-618 [Non-Patent Document 2] https: / / worldseed.org / document / isf-different-set-spinach-update-2024 / ISF-diff-set-spinach-update-13-5-24-with-Pe20_final.pdf [Non-Patent Document 3] Kubota et al., 2019. New races of the spinach downy mildew pathogen, Peronospora farinosa f. sp. spinaciae, in Japan in 2017. Journal of General Plant Pathology:79-81 [Non-Patent Document 4] Ribera et al., 2020. A review on the genetic resources, domestication and breeding history of spinach (Spinacia oleracea L.). Euphytica 216:48 [Overview of the project] [Problems that the invention aims to solve]
[0006] In recent years, outbreaks of races similar to downy mildew race Pe17 have been confirmed in spinach-producing regions, and outbreaks of races corresponding to Pe18, Pe19, and Pe20 have also been reported overseas. All spinach resistance patterns are susceptible to at least one of the Pe1-20 races, and no strains resistant to all races have been reported.
[0007] The present invention aims to provide spinach plants having a novel downy mildew resistance pattern. It also aims to provide a screening method for screening spinach plants having a novel downy mildew resistance pattern. [Means for solving the problem]
[0008] The present invention may include the following embodiments. Section 1. Spinach plants having one or both of the following two polynucleotide sequences in their genome: Sequence A: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 3, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 3, the amino acid corresponding to the 625th amino acid of Sequence ID No. 3 is a polynucleotide sequence encoding an amino acid other than glycine (G), arginine (R), and glutamic acid (E). Sequence B: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 4, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 4, the polynucleotide sequence encoding an amino acid other than serine (S) corresponding to the 191st amino acid of Sequence ID No. 4. Section 2. The spinach plant according to item 1, wherein the spinach plant has a polynucleotide sequence A and a polynucleotide sequence B on the same chromosome or on different chromosomes. Section 3. The spinach plant described in item 2, wherein the polynucleotide sequence of sequence A and the polynucleotide sequence of sequence B are located on the same chromosome. Section 4. In an amino acid sequence having 90% or more identity with the amino acid sequence represented by Sequence ID No. 3, the amino acid corresponding to the 625th amino acid of Sequence ID No. 3 is serine (S), or In an amino acid sequence having 90% or more identity with the amino acid sequence represented by SEQ ID NO: 4, the amino acid corresponding to the 191st amino acid of SEQ ID NO: 4 is isoleucine (I). The spinach plant according to claim 1. Item 5. The spinach plant according to claim 1, in which the polynucleotide sequence of SEQ A and / or SEQ B is located at the downy mildew resistance locus on chromosome 3. Item 6. The spinach plant according to claim 1, which shows resistance to at least one selected from the group consisting of spinach downy mildew races Pe17, Pe18, Pe19 and Pe20. Item 7. The spinach plant according to claim 1, which is derived from the seeds deposited under accession number FERM BP-22487. Item 8. The spinach plant according to claim 1, wherein the spinach plant is a plant individual, seeds, or a part thereof. Item 9. A hybrid spinach plant produced by directly or indirectly crossing the spinach plant according to claim 1 with a spinach plant of another strain, and having at least one of the polynucleotide sequences of SEQ A and SEQ B on the genome. Item 10. A hybrid spinach plant produced by directly or indirectly crossing the spinach plant according to claim 7 with a spinach plant of another strain, and having at least one of the polynucleotide sequences of SEQ A and SEQ B on the genome. Item 11. (1) Detecting a part or all of at least one polynucleotide sequence selected from the following two polynucleotide sequences from the genomic DNA of a spinach plant Sequence A: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 3, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 3, the amino acid corresponding to the 625th amino acid of Sequence ID No. 3 is a polynucleotide sequence encoding an amino acid other than glycine (G), arginine (R), and glutamic acid (E). Sequence B: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 4, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 4, the amino acid corresponding to the 191st amino acid of Sequence ID No. 4 is a polynucleotide sequence encoding an amino acid other than serine (S); (2) Determine the spinach plant in which a portion of at least one of the polynucleotide sequences of sequence A or sequence B is detected as the target plant, A screening method for spinach plants, including [specific characteristics]. Section 12. The screening method according to claim 11, further comprising determining whether the spinach plant exhibits resistance to at least one selected from the group consisting of spinach downy mildew races Pe17, Pe18, Pe19, and Pe20. Section 13. Crossing spinach plants described in item 1 with spinach plants of other strains, directly or indirectly. A method for producing a hybrid spinach plant having at least one of the polynucleotide sequences A and B in its genome. Section 14. The production method according to item 13, further comprising selecting hybrid spinach plants having at least one of the polynucleotide sequences A and B in their genome by the screening method described in item 11. Section 15. (i) Determine the 76th nucleotide sequence of the polynucleotide sequence represented by Sequence ID No. 5 on the genomic DNA of the spinach plant, (ii) When the base of the 76th nucleotide is thymine (T), the spinach plant is determined to be the target plant, A screening method for spinach plants, including [specific characteristics]. Section 16. The screening method according to item 15, wherein the spinach plant exhibits resistance to at least one selected from the group consisting of spinach downy mildew fungal races Pe17, Pe18, Pe19, and Pe20. Section 17. A spinach plant having a polynucleotide sequence on its genomic DNA that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or to the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by Sequence ID No. 5, wherein the base of the 76th nucleotide is thymine (T). Section 18. The spinach plant according to item 17, wherein the spinach plant exhibits resistance to at least one selected from the group consisting of spinach downy mildew races Pe17, Pe18, Pe19, and Pe20. Section 19. A hybrid spinach plant produced by directly or indirectly crossing a spinach plant described in item 17 with another strain of spinach plant, having a polynucleotide sequence on its genomic DNA that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or the sequences from the 70th to 75th and 77th to 82nd positions of the polynucleotide sequence represented by Sequence ID No. 5, with the base of the 76th nucleotide being thymine (T). Section 20. Crossing spinach plants described in item 17 with spinach plants of other strains, directly or indirectly. A method for producing hybrid spinach plants, comprising having a polynucleotide sequence on its genomic DNA that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by Sequence ID No. 5, wherein the base of the 76th nucleotide is thymine (T). Section 21. The production method according to item 20, further comprising selecting hybrid spinach plants having a polynucleotide sequence on their genomic DNA that is identical to the polynucleotide sequence represented by SEQ ID NO: 5, or the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by SEQ ID NO: 5, wherein the base of the 76th nucleotide is thymine (T), by the screening method described in item 15. [Effects of the Invention]
[0009] This invention provides spinach plants with novel downy mildew resistance patterns. It also provides a screening method for screening spinach plants with novel downy mildew resistance patterns. [Brief explanation of the drawing]
[0010] [Figure 1] The electrophoretic results of the amplification products obtained by PCR using the primer set of SEQ ID NO: 10 and SEQ ID NO: 11, with genomic DNA extracted from the F2 isolated population as a template, are shown. [Figure 2] This shows the alignment of the alpha-type amino acid sequence (SEQ ID NO: 3) derived from the spinach blight resistance gene of the TK08 strain with the alpha-type amino acid sequences derived from other spinach blight resistance genes. [Figure 3] This shows the alignment of the beta-type amino acid sequence (SEQ ID NO: 4) derived from the spinach rot resistance gene of the TK08 strain with the beta-type amino acid sequence derived from other spinach rot resistance genes. [Modes for carrying out the invention]
[0011] In this specification, "spinach plant" (hereinafter sometimes simply referred to as "spinach") is a plant classified as the spinach species (S. oleracea L.) of the genus Spinacia L., subfamily Chenopodiaceae, family Amaranthaceae. The aforementioned spinach plant may be, for example, a hybrid with a closely related species or a wild species. The spinach plant is preferably for cultivation.
[0012] "For cultivation" refers to plant varieties or breeding lines cultivated by humans. Cultivated spinach may be hybrids, or hybrids with closely related species or wild species.
[0013] In this specification, “plant” includes a plant, a seed, or a part thereof. A plant may include a mature plant and a young plant. “Plant” can also include, for example, plant cells, plant protoplasts, plant cell tissue cultures capable of regenerating plant plants, plant callus, plant clums, plant cells isolated from a plant or part of a plant, leaves, pollen, embryos, cotyledons, hypocotyls, roots, root tips, anthers, pistils, flowers, ovaries, ovules, seeds, fruits, stems, seedlings, etc. A part of a plant may include, for example, an organ, tissue, cell, or vegetative propagule. An organ may include, for example, a petal, corolla, flower, leaf, seed, fruit, stem (including petiole), root, etc. A tissue may be, for example, a part of an organ. Specific examples of the plant individual parts include microspores, flowers, flower buds, pistils, anthers, pollen, ovaries, embryos, ovules, hypocotyls, embryo sacs, egg cells, cuttings, roots, root tips, trunks, stems, leaves, petioles, pith, cotyledons, cells, meristematic cells, protoplasts, seeds, etc. The pollen may be mature or immature. The plant individual parts may originate from any stage of plant development, such as pre-rooting, post-rooting, seedlings, cuttings, or mature individuals. The plant individual parts may consist of one type of organ, tissue, and / or cell, or two or more types of organs, tissues, and / or cells.
[0014] Downy mildew is a disease caused by filamentous fungi. Examples of pathogens of downy mildew include Peronospora effusa (also known as Peronospora farinosa). The race of the downy mildew pathogen (Peronospora effusa race (Pe)) is not particularly limited and may be a known race as described below, or a new race. The term "race" refers to a fungal strain with different pathogenicity, or more specifically, a strain that exhibits different pathogenicity to varieties with different resistance genes or resistance loci.
[0015] In this specification, in descriptions of polynucleotide sequences and nucleotides, the letters "A," "G," "T," and "C" represent each nucleotide. "A" represents a nucleotide having adenine as a base, "G" represents a nucleotide having guanine as a base, "T" represents a nucleotide having thymine as a base, and "C" represents a nucleotide having cytosine as a base.
[0016] 1. Spinach plant One embodiment relates to the spinach plant. Spinach plants have one or both of the following two polynucleotide sequences, sequence A and sequence B, on their genome. Preferably, spinach plants have both of the following polynucleotide sequences, sequence A and sequence B, on their genome.
[0017] In this specification, the polynucleotide sequence of sequence A has a predetermined proportion or greater identity with the beet disease resistance gene alpha. The polynucleotide sequence of sequence B has a predetermined proportion or greater identity with the beet disease resistance gene beta.
[0018] Sequence A is a polynucleotide sequence that encodes the amino acid sequence represented by Sequence ID No. 3 (hereinafter sometimes referred to as "Sequence A-1"), or a polynucleotide sequence that encodes an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence (hereinafter sometimes referred to as "Sequence A-2"). Sequence A-1 preferably has a polynucleotide sequence represented by Sequence ID No. 1.
[0019] Sequence A-2 has a polynucleotide sequence such that, when translated into a polypeptide, the identity between the polypeptide and the amino acid sequence represented by Sequence ID No. 3 is 90% or more, 93% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more. Furthermore, it is preferable that the identity between the polypeptide translated from the polynucleotide sequence of Sequence A-2 and the amino acid sequence represented by Sequence ID No. 3 is less than 100%. In the polypeptide translated from the polynucleotide sequence of Sequence A-2, the portion that is not identical to the amino acid sequence represented by Sequence ID No. 3 may include, for example, deletions, insertions, substitutions of 58 amino acids or less, 35 amino acids or less, 24 amino acids or less, 12 amino acids or less, or 6 amino acids or less. It is preferable that Sequence A-2 has 90% or more, 93% or more, 95% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more identity with the polynucleotide sequence represented by Sequence ID No. 1.
[0020] Here, in the polypeptide translated from the polynucleotide sequence of sequence A-2, the amino acid corresponding to the 625th amino acid of SEQ ID NO: 3 is other than glycine (G), arginine (R), and glutamic acid (E). Preferably, in the polypeptide translated from the polynucleotide sequence of sequence A-2, the amino acid corresponding to the 625th amino acid of SEQ ID NO: 3 is serine (S).
[0021] Sequence B is a polynucleotide sequence that encodes the amino acid sequence represented by Sequence ID No. 4 (hereinafter sometimes referred to as "Sequence B-1"), or a polynucleotide sequence that encodes an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence (hereinafter sometimes referred to as "Sequence B-2"). Sequence B-1 preferably has a polynucleotide sequence represented by Sequence ID No. 2.
[0022] Sequence B-2 has a polynucleotide sequence such that, when translated into a polypeptide, the identity between the polypeptide and the amino acid sequence represented by Sequence ID No. 4 is 90% or more, 93% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more. Furthermore, it is preferable that the identity between the polypeptide translated from the polynucleotide sequence of Sequence B-2 and the amino acid sequence represented by Sequence ID No. 4 is less than 100%. In the polypeptide translated from the polynucleotide sequence of Sequence B-2, the portion that is not identical to the amino acid sequence represented by Sequence ID No. 4 may include, for example, deletions, insertions, substitutions, etc. of 56 amino acids or less, 34 amino acids or less, 23 amino acids or less, 12 amino acids or less, or 6 amino acids or less. It is preferable that Sequence B-2 has 90% or more, 93% or more, 95% or more, 95% or more, 97% or more, 98% or more, 99% or more, or 99.5% or more identity with the polynucleotide sequence represented by Sequence ID No. 2.
[0023] Here, in the polypeptide translated from the polynucleotide sequence of sequence B-2, the amino acid corresponding to the 191st amino acid of sequence number 4 is an amino acid other than serine (S). Preferably, in the polypeptide translated from the polynucleotide sequence of sequence B-2, the amino acid corresponding to the 191st amino acid of sequence number 4 is isoleucine (I).
[0024] In the above, "corresponding" refers to a description that takes into account the fact that the polynucleotide sequences of sequences A-2 and B-2 may have shifts in nucleotide numbers due to insertions or deletions relative to the polynucleotide sequences of sequences A-1 and B-1, respectively. For example, in the BLAST search provided by the National Center for Biotechnology Information, "corresponding" can be described as the nucleotide positions being determined to be the same (aligned to the same position) when the polynucleotide sequences of sequences A-2 and B-2 are aligned to the polynucleotide sequences of sequences A-1 and B-1. The polynucleotide sequences of sequence A and sequence B are preferably located at the downy mildew resistance locus on chromosome 3.
[0025] Spinach plants may have the polynucleotide sequence A and the polynucleotide sequence B on the same chromosome or on different chromosomes. When the polynucleotide sequences A and B are on the same chromosome, it is sometimes called the cis type, and when the polynucleotide sequences A and B are on different chromosomes, preferably homologous chromosomes, it is sometimes called the trans type. More preferably, the polynucleotide sequences A and B are located in the cis type on one of homologous chromosomes.
[0026] Spinach plants can also be defined by the following single nucleotide polymorphisms (SNPs). The following SNPs can be used as SNP markers for spinach plants disclosed herein.
[0027] Spinach plants have a polynucleotide sequence on their genomic DNA that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by Sequence ID No. 5, with the base of the 76th nucleotide being thymine (T). Preferably, spinach plants have a polynucleotide sequence on their genomic DNA that is identical to the sequences from the 60th to the 75th and 77th to the 92nd nucleotides of the polynucleotide sequence represented by Sequence ID No. 5; the sequences from the 50th to the 75th and 77th to the 102nd nucleotides; or the sequences from the 40th to the 75th and 77th to the 112th nucleotides, with the base of the 76th nucleotide being thymine (T).
[0028] The aforementioned SNP is linked to the downy mildew resistance gene beta and is preferably located in the range of 1 centimorgan (cM) to 1.5 centimorgans (cM), more specifically, in the range of 1.2 centimorgans (cM) to 1.4 centimorgans (cM), from the locus of the downy mildew resistance gene beta. Preferably, the SNP is located on chromosome 3. If sequences A and B are in the cis form, the SNP is also linked to the downy mildew resistance gene alpha.
[0029] Spinach plants can also be defined as plants derived from seeds deposited under accession number FERM BP-22487 (hereinafter also referred to as "deposited spinach plants"). The deposit information is as follows: Type of deposit: International deposit Depository name: National Institute of Technology and Evaluation (NITE), Patent Organism Depository Center Address: Room 120, 2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture 292-0818, Japan Accession number: FERM BP-22487 Identification mark: Takii35 Date received: October 20, 2023 "Derived from seeds" means that the plant must include spinach plants grown from deposited seeds and their descendants.
[0030] Progeny lines include lines obtained by self-pollinating and / or cross-pollinating deposited spinach plants or their offspring (directly obtained lines), and lines that are not deposited spinach plants or their offspring themselves but maintain the downy mildew resistance locus of deposited spinach plants (indirectly obtained lines).
[0031] Furthermore, the progeny include spinach plants regenerated from a portion of a deposited spinach plant or a portion of a plant individual of such a progeny, or their descendants. Methods for regenerating a plant individual from a portion of a plant individual are well known. For example, one method is to regenerate a plant individual from a protoplast or callus via tissue culture.
[0032] Spinach plants may include spinach plants that have been genetically modified to possess one or both of the polynucleotide sequences A and B described above. Methods for genetically modifying spinach plants are well known.
[0033] Spinach plants may include spinach plants identified by the polynucleotide sequence of sequence A and / or the polynucleotide sequence of sequence B; spinach plants identified by the above SNP; or depositary spinach plants (hereinafter, these spinach plants may be collectively referred to as "parental spinach plants"), as well as hybrid spinach plants. Hybrid spinach plants are spinach plants that inherit the genome of a parental spinach plant and possess the genome of a spinach plant of another lineage other than the parental spinach plant. Hybrid spinach plants are produced by directly or indirectly crossbreeding a parental spinach plant with a spinach plant of another lineage. Direct crossbreeding means cross-pollinating a parental spinach plant with a spinach plant of another lineage. Indirect hybridization refers to methods such as self-pollination of hybrid spinach plants, cross-pollination of hybrid spinach plants with each other, or hybridization of a hybrid spinach plant with a spinach plant that is not the parent plant and is of a different lineage than the hybrid spinach plant. Indirect hybridization may also include backcrossing.
[0034] "Hybridization" refers to the process of producing offspring from two parent plants. Hybridization includes "cross-pollination" and "self-pollination." Cross-pollination means that male and female gametes from different plant individuals fertilize each other. Self-pollination means that male and female gametes from the same individual fertilize each other.
[0035] A hybrid spinach plant derived from a spinach plant identified by the polynucleotide sequence A and / or the polynucleotide sequence B has at least one of the polynucleotide sequences A and B in its genome. In this case, at least one of the polynucleotide sequences A and B may be present in the genome as a homozygote or as a heterozygote.
[0036] Hybrid spinach plants derived from depositary spinach plants have at least one of the polynucleotide sequences A and B in their genome. The polynucleotide sequences A and B may exist in the genome in a cis form, where both sequences exist on the same chromosome, or in a trans form, where both sequences exist on two different chromosomes, preferably homologous chromosomes. In the cis form, they may exist in the genome as homozygotes or as heterozygotes.
[0037] Furthermore, hybrid spinach plants derived from deposited spinach plants have the above-mentioned SNP in their genome. In this case, the SNP may be present in the genome as a homozygous or heterozygous state.
[0038] Hybrid spinach plants derived from the spinach plants identified by the above SNP have a polynucleotide sequence in their genome that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or sequences 70-75 and 77-82 of the polynucleotide sequence represented by Sequence ID No. 5, with the base of the 76th nucleotide being thymine (T). In this case, the polynucleotide sequence containing the SNP may exist in the genome as a homozygote or as a heterozygote.
[0039] Spinach plants preferably exhibit resistance to at least one selected from the group consisting of spinach downy mildew races Pe17, Pe18, Pe19, and Pe20. More preferably, spinach plants exhibit resistance to at least one selected from the group consisting of spinach downy mildew races Pe1 to Pe16 and at least one selected from the group consisting of spinach downy mildew races Pe17, Pe18, Pe19, and Pe20. Even more preferably, spinach plants exhibit resistance to spinach downy mildew races Pe1 to Pe20.
[0040] "Resistance" to downy mildew is also called "tolerance" or "disease resistance." Resistance refers to the ability to inhibit or suppress the onset and progression of disease caused by infection with the downy mildew pathogen. For example, "inhibition" means preventing the onset of disease or stopping the progression of disease once it has occurred. "Suppression" means that infection with the downy mildew pathogen occurs, but the progression of the disease is slower compared to susceptible plants. Resistance to downy mildew can be confirmed, for example, by the following test methods. • Testing method for resistance to downy mildew Execution of the test Plant growth stage: Plant individual with two true leaves Temperature: 12℃ Light: 12 hours after germination (day length) Cultivation method: Downy mildew-carrying plants (host plants) and test plants are cultivated in a greenhouse. Each plant is grown on potting soil packed into a container. Inoculation method: Take leaves that have formed conidia from host plants 14 days after inoculation with downy mildew fungus, wash them thoroughly with sterile water, filter the resulting conidial suspension through gauze, and spray it onto the test plant (e.g., a variety with many leaves) so that it does not drip from the leaves. The spore concentration of the sprayed suspension is 10,000 conidia / ml. The suspension should be used immediately after preparation. After inoculation, maintain a humidity of approximately 80-95% RH (relative humidity) around the plants. • Duration of the exam From inoculation with downy mildew to investigation: 14 days Infection assessment: Plants with 10 or more spores formed on any side of the true leaves are classified as susceptible; plants with fewer than 10 spores on any side of the true leaves but 10 or more spores formed on any side of the cotyledons are classified as moderately resistant; and plants with fewer than 10 spores on any side of both the true leaves and cotyledons are classified as resistant. Identifying varieties for race identification Downy mildew races Pe1-20 are defined based on the distinguishing varieties listed in the table below (Viroflay, NIL1, NIL2, NIL3, NIL4, NIL5, NIL6, NIL9, Caladonia, Meerkat, Hydrus, Yakalo). Plant material in which conidia of the aforementioned distinguishing varieties and Pe1-20 have formed, stored at -20°C, is available from the following source. Table 1 is quoted from the literature: Guidelines for Identification of Spinach Downy Mildew (Peronospora effusa) Races on Differential Spinach Hosts, and shows the resistance of each distinguishing variety to Pe1-20. (Sources of identification varieties and plant materials (Pe1-20)) Naktuinbouw PO Box 40 NL-2370 AA Roelofarendsveen Netherlands http: / / www.naktuinbouw.com
[0041] [Table 1] Excerpt from https: / / worldseed.org / document / isf-different-set-spinach-update-2024 / ISF-diff-set-spinach-update-13-5-24-with-Pe20_final.pdf -:Resistance (R) (-): Intermediate resistance (IR) +: Sensitivity (S)
[0042] 2. Method for producing spinach plants One embodiment relates to a method for producing spinach plants. Spinach plants can be produced by crossbreeding parent spinach plants or hybrid spinach plants. The crossbreeding may be self-pollinating or cross-pollinating. Alternatively, spinach plants can be produced by crossbreeding parent spinach plants with hybrid spinach plants. In this case, the crossbreeding is cross-pollinating.
[0043] Whether or not a spinach plant possesses the desired genomic information can be evaluated using the screening method described later. The method for producing spinach plants includes selecting spinach plants identified by the polynucleotide sequence of sequence A and / or the polynucleotide sequence of sequence B, or spinach plants identified by the above SNP, using the screening method described later.
[0044] 3. Screening method for spinach plants One embodiment relates to a method for screening spinach plants. The method includes a method for screening spinach plants identified by the polynucleotide sequence of sequence A and / or the polynucleotide sequence of sequence B (hereinafter also referred to as "screening method 1"), and a method for screening spinach plants identified by the above SNP (hereinafter also referred to as "screening method 2"). Deposited spinach plants can be screened using either screening method 1 or screening method 2.
[0045] 3-1. Screening Method 1 Screening method 1 includes (1) detecting a part or all of at least one polynucleotide sequence selected from the polynucleotide sequence of sequence A and the polynucleotide sequence of sequence B (hereinafter also referred to as the "target sequence") from the genomic DNA of a spinach plant, and (2) determining the spinach plant in which a part of at least one of the polynucleotide sequences of sequence A and sequence B is detected as the target plant.
[0046] The target sequence can be detected by methods such as DNA fingerprinting, nucleotide sequencing, PCR, and microarray analysis.
[0047] DNA fingerprinting methods may include restriction fragment length polymorphism (RFLP) and amplified fragment length polymorphism (AFLP). RFLP involves treating genomic DNA extracted from spinach plants targeted for screening with a predetermined restriction enzyme, separating the treated DNA fragments by electrophoresis, transferring them to a membrane by Southern blotting, hybridizing them with a probe capable of detecting the target sequence, and detecting the probe. AFLP involves amplifying a portion of the downy mildew resistance gene locus of spinach plants targeted for screening using PCR, treating the amplified fragments with restriction enzymes as needed, separating the amplified fragments by electrophoresis, transferring them to a membrane by Southern blotting, hybridizing them with a probe capable of detecting the target sequence, and detecting the probe. For amplification, for example, the primer sets of SEQ ID NOs. 10 and SEQ ID NOs. 11, described later, can be used.
[0048] Nucleotide sequencing may include methods such as the Sanger sequencing method and next-generation sequencing.
[0049] PCR methods may include PCR methods using primers capable of detecting the target sequence, and PCR-SSCP methods for detecting regions containing the target sequence. When detecting the target sequence using PCR, the screening method may include the extraction of genomic DNA. Methods for DNA extraction are well known.
[0050] The microarray method involves immobilizing a probe capable of detecting the target sequence on a DNA chip, labeling the genomic DNA extracted from the target spinach plant (which is the subject of the screening) or the amplification product obtained by PCR using the region containing the target sequence with a labeling substance (preferably a fluorescent dye), and then hybridizing the product with the probe on the DNA chip to detect the labeling substance.
[0051] The target sequence is located on the genomic DNA of the spinach plant to be screened, preferably on chromosome 3, and more preferably at the downy mildew resistance locus.
[0052] 3-2. Screening Method 2 Screening method 2 includes step (i) determining the 76th nucleotide of the polynucleotide sequence represented by Sequence ID No. 5 on the genomic DNA of a spinach plant, or determining the polynucleotide sequence from the 70th to the 82nd nucleotide of the polynucleotide represented by Sequence ID No. 5, and step (ii) determining the spinach plant as the target plant when the base of the 76th nucleotide of the polynucleotide sequence represented by Sequence ID No. 5 is thymine (T).
[0053] The 76th nucleotide in the polynucleotide sequence represented by Sequence ID No. 5 is a single nucleotide polymorphism (SNP). When the base of the 76th nucleotide in the polynucleotide sequence represented by Sequence ID No. 5 is thymine (T), spinach plants have "resistance" to downy mildew. Conversely, when the base of the 76th nucleotide in the polynucleotide sequence represented by Sequence ID No. 5 is anything other than thymine (T), spinach plants are "susceptible" to downy mildew.
[0054] The nucleotide or polynucleotide sequence in step (i) can be determined by methods such as DNA fingerprinting, nucleotide sequencing, PCR, or microarray. Details of each method are, in principle, based on the explanation in section 3-1 above. However, "determination of the target sequence" in section 3-1 above shall be read as "determination of the nucleotide or polynucleotide sequence in step (i)".
[0055] Furthermore, when detecting the 76th nucleotide of the polynucleotide sequence represented by Sequence ID No. 5 using PCR, it can be detected by conventional methods. [Examples]
[0056] The present invention will be described below with reference to examples. However, the present invention is not limited to the examples.
[0057] 1. Identifying races that will be a source of resistance Inoculation tests were conducted using 20 races of spinach downy mildew fungus Pe1-20 with the deposited seeds of the present invention (seed deposit number FERM BP-22487; also referred to herein as "TK08" or "TK08 line") and the downy mildew race-discriminating varieties described in Non-Patent Literature 2, in accordance with the method of Non-Patent Literature 3. Specifically, seeds of the race-discriminating varieties and the TK08 line were sown in 128-cell trays filled with Takii seed-starting soil and grown until two true leaves unfolded. Cotyledons remained at this time. Next, at the Takii Seed Co., Ltd. research farm, conidia of each spinach downy mildew fungus maintained on fresh spinach leaves (variety: Toyoha) were suspended in sterile water to a concentration of 10,000 spores / ml, and 1 ml was sprayed per individual, with 8 individuals per variety or line, onto the race-discriminating varieties and the TK08 line. Subsequently, the test plants were grown for two weeks under conditions of 12°C, 12-hour day length, and humidity of 95% or higher. Disease severity was evaluated as follows: susceptible (S) if 10 or more spores were formed on any side of the inoculated true leaves; moderately resistant (IR) if fewer than 10 spores were formed on any side of the true leaves but 10 or more spores were formed on any side of the cotyledons; and resistant (R) if fewer than 10 spores were formed on any side of both the true leaves and cotyledons. As a result, the TK08 line was resistant to Pe1-20 (Table 2).
[0058] [Table 2] In Table 2, phenotypes other than TK08 are cited from Patent Documents 1-11 and Non-Patent Documents 1, 2, and 4. Blank spaces indicate that data is unavailable.
[0059] 2. Identification of the resistance locus in TK08 Genomic DNA was extracted from one individual each of five spinach strains (NIL1, NIL2, NIL3, NIL4, NIL5) each possessing only one known resistance gene (RPF1, RPF2, RPF3, RPF4, RPF5), the TK08 strain, and one strain (Viroflay) lacking a resistance gene. Whole genome sequencing was performed using next-generation sequencing. The obtained raw reads were mapped to two reference sequences (http: / / spinachbase.org / ftp / genome / Sp75 / (hereinafter, reference sequence 1) and Spov3 (https: / / doi.org / 10.1002 / tpg2.20101 (hereinafter, reference sequence 2)) to perform polymorphism detection. From the obtained polymorphism information, a single nucleotide polymorphism (SNP) specific to the TK08 strain was extracted and named SNP1. The genetic distance between SNP1 and the beta sequence is approximately 1.3 cM. The polymorphic sequences are as follows:
[0060] TCATGATATTGTTTCCCTTTTCAGGACTTCAGTAGCACCAATAAAGGCCAGACCGCCAGACTAGCATAGATGACAYGAGAGCAAATTTTATCAGGAGACACAATGATATTACCATTGTTGACAAAGTGGAAAAGTAAAATCACAATAGCC (SEQ ID NO: 5) (In the array, Y represents either C or T.)
[0061] When the seven strains were analyzed using a primer set capable of detecting SNPs (nucleotide at position 76 of SEQ ID NO: 5) around the downy mildew resistance gene locus on chromosome 3, the expected polymorphisms were detected (Table 3).
[0062] [Table 3]
[0063] Next, an F2 population was created by self-pollinating F1 individuals obtained by crossing a homozygous RPF2 gene strain (NIL2) with the TK08 strain. Pe17, Pe18, and Pe19 were inoculated into these 79 F2 individuals, and their phenotypes and SNPs (as listed in Table 3) were detected individually. The results showed that in 75 out of 76 individuals from which a phenotype was obtained, the phenotype and genotype matched, strongly suggesting that resistance to these races is exerted by a single resistance gene located on chromosome 3 (Table 4).
[0064] [Table 4]
[0065] 3. Identification of the resistance gene region sequence in the TK08 strain. Whole genome sequencing was performed on the TK08 strain. First, high molecular weight genomic DNA was extracted from the TK08 strain using the Nucleobond HMW DNA extraction kit (Macherey-Nalgen) according to the instructions provided with the kit. Next, whole genome sequencing data was obtained using Oxford Nanopore Technology's MinION (R10.4) according to the instructions, de novo assembly was performed using Flye (https: / / github.com / fenderglass / Flye / blob / flye / docs / USAGE.md), and polishing was performed using pilon (https: / / software.broadinstitute.org / software / pilon / ) to obtain contig sequences. Furthermore, in order to compare with previously reported nucleotide sequences of resistance gene regions, sequences containing the resistance gene region and common to reference sequence 1 and reference sequence 2 were extracted, and a primer set capable of amplifying the entire resistance gene region in the TK08 strain (each sequence is represented by sequence numbers 6-9 shown in Table 5) was constructed. The amplified fragments obtained by PCR using these primer sets were sequenced with MinION (R10.4), and the consensus sequence was obtained using Amplicon sorter (https: / / onlinelibrary.wiley.com / doi / full / 10.1002 / ece3.8603). Comparison of the obtained nucleotide and amino acid sequences with previously reported sequences revealed that the TK08 strain possesses a resistance gene sequence distinct from all others, and that it harbors two genes classified as alpha and beta types, as described in Patent Document 1, in the cis phase. The relevant region is extracted and shown at the end as Sequence ID No. 12.
[0066] Next, PCR was performed using the DNA of the F2 population analyzed in step 2 above, with a primer set that amplified approximately 800 base pairs of the beta-type gene sequence (each sequence is represented by SEQ ID NOs. 10 and 11 shown in Table 5). Using genomic DNA extracted from the F2 segregated population as a template, PCR was performed using the primer sets of SEQ ID NOs. 10 and 11, and electrophoresis was performed on a 2% agarose gel for 1 hour. Samples showing a clear amplification fragment were marked "+", and samples showing no amplification or only a very faint band were marked "-". As a result, the expected amplification product was obtained for TK08, while no amplification product was obtained for NIL2. Furthermore, all samples that showed amplification products were resistant, and all samples that did not show amplification products were susceptible (Table 4). In addition, amplification products were obtained in 60 out of 61 samples in which the TK08-derived allele was homozygous or heterozygous by SNP analysis, while no amplification products were obtained in 17 out of 18 samples in which the RPF2-derived allele was homozygous (Tables 4, 6, and Figure 1). Based on the above, it was strongly suggested that the sequence specific to the TK08 strain and SNP1 are located at the same locus and are either strongly linked to a resistance gene or are resistance genes themselves.
[0067] [Table 5]
[0068] [Table 6] In the table, A represents homozygous reference sequence allele (C / C), B represents homozygous TK08 allele (T / T), and H represents heterozygous reference sequence allele and TK08 allele (C / T).
[0069] 4. Comparison of amino acid sequences between other spinach varieties and disease resistance genes. Figures 2-1 to 2-26 show the alignment of the alpha-type amino acid sequence (SEQ ID NO: 3) derived from the spinach rot resistance gene of the TK08 strain with the alpha-type amino acid sequences derived from other spinach rot resistance genes. The amino acid sequence represented by SEQ ID NO: 3 differs from other known alpha-type amino acid sequences in that the 149th amino acid of SEQ ID NO: 3 is glutamic acid (E), the 184th amino acid is aspartic acid (N), and the 292nd amino acid is lysine (K). Furthermore, differences in the amino acid sequences were observed at other sites, indicating that the alpha-type spinach rot resistance gene of the TK08 strain is a novel gene.
[0070] Figures 3-1 to 3-4 show the alignment of the beta-type amino acid sequence (SEQ ID NO: 4) derived from the spinach downy mildew resistance gene of the TK08 strain with the beta-type amino acid sequences derived from other spinach downy mildew resistance genes. The amino acid sequence represented by SEQ ID NO: 4 differs from other known beta-type amino acid sequences in that the 19th amino acid of SEQ ID NO: 4 is asparagine (N) and the 25th amino acid is cysteine (C). Furthermore, differences in the amino acid sequence were observed at other sites, indicating that the beta-type spinach downy mildew resistance gene of the TK08 strain is a novel gene.
[0071] 5. Downy mildew resistance in offspring of TK08 spinach strain In step 2 above, the NIL2 strain was crossed with the TK08 strain to produce F1 individuals, which were then backcrossed with the NIL2 strain to obtain progeny BC1. Subsequently, BC1 was backcrossed with the NIL2 strain again to obtain progeny BC2. Next, BC2 was self-pollinated to obtain progeny BC2F2. Furthermore, BC2F2 was self-pollinated to obtain progeny BC2F3. The sequences of BC2F2 were identified by the PCR method described in step 3 above, and individuals resistant to downy mildew were distinguished from those susceptible. Furthermore, BC2F3 was inoculated with downy mildew and its resistance to each downy mildew race was evaluated.
[0072] In BC2F2, BC2F3 cells obtained by self-pollination of individuals possessing the TK08 allele (i.e., the blight resistance gene) showed resistance to all of Pe17-Pe20. BC2F3 cells obtained from BC2F2 individuals homozygous for the reference sequence allele did not show resistance to any of Pe17-Pe20. From these results, it became clear that the resistance of TK08 to soothes disease is maintained in subsequent generations.
[0073] [ka] [ka] [ka] [ka] [ka] [ka]
Claims
1. Spinach plants having one or both of the following two polynucleotide sequences in their genome: Sequence A: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 3, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 3, the amino acid corresponding to the 625th amino acid of Sequence ID No. 3 is a polynucleotide sequence encoding an amino acid other than glycine (G), arginine (R), and glutamic acid (E). Sequence B: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 4, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 4, the amino acid corresponding to the 191st amino acid of Sequence ID No. 4 is an amino acid other than serine (S).
2. The spinach plant according to claim 1, wherein the spinach plant has a polynucleotide sequence A and a polynucleotide sequence B on the same chromosome or on different chromosomes.
3. The spinach plant according to claim 2, wherein the polynucleotide sequence of sequence A and the polynucleotide sequence of sequence B are located on the same chromosome.
4. In an amino acid sequence having 90% or more identity with the amino acid sequence represented by Sequence ID No. 3, the amino acid corresponding to the 625th amino acid of Sequence ID No. 3 is serine (S), or In an amino acid sequence having 90% or more identity with the amino acid sequence represented by Sequence ID No. 4, the amino acid corresponding to the 191st amino acid of Sequence ID No. 4 is isoleucine (I). The spinach plant according to claim 1.
5. The spinach plant according to claim 1, wherein the polynucleotide sequences of sequence A and / or sequence B are located at the downy mildew resistance gene locus on chromosome 3.
6. The spinach plant according to claim 1, wherein the spinach plant exhibits resistance to at least one selected from the group consisting of spinach downy mildew fungal races Pe17, Pe18, Pe19, and Pe20.
7. A spinach plant according to claim 1, derived from seeds deposited under accession number FERM BP-22487.
8. The spinach plant according to claim 1, wherein the spinach plant is a plant individual, a seed, or a part thereof.
9. A hybrid spinach plant having at least one of the polynucleotide sequences A and B in its genome, produced by directly or indirectly crossing the spinach plant described in claim 1 with a spinach plant of another strain.
10. A hybrid spinach plant having at least one of the polynucleotide sequences A and B in its genome, produced by directly or indirectly crossing the spinach plant described in claim 7 with a spinach plant of another strain.
11. (1) To detect part or all of at least one polynucleotide sequence selected from the following two polynucleotide sequences from the genomic DNA of spinach plants, Sequence A: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 3, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 3, the amino acid corresponding to the 625th amino acid of Sequence ID No. 3 is a polynucleotide sequence encoding an amino acid other than glycine (G), arginine (R), and glutamic acid (E). Sequence B: A polynucleotide sequence encoding an amino acid sequence represented by Sequence ID No. 4, or an amino acid sequence having 90% or more identity with the aforementioned amino acid sequence, wherein in the amino acid sequence having 90% or more identity with the aforementioned amino acid sequence No. 4, the amino acid corresponding to the 191st amino acid of Sequence ID No. 4 is an amino acid other than serine (S); (2) Determine the spinach plant in which a portion of at least one of the polynucleotide sequences of sequence A or sequence B is detected as the target plant, A screening method for spinach plants, including [specific characteristics].
12. The screening method according to claim 11, further comprising determining whether the spinach plant exhibits resistance to at least one selected from the group consisting of spinach downy mildew races Pe17, Pe18, Pe19, and Pe20.
13. Crossing the spinach plant described in claim 1 with a spinach plant of another strain, directly or indirectly. A method for producing a hybrid spinach plant having at least one of the polynucleotide sequences A and B in its genome.
14. Furthermore, the manufacturing method according to claim 13, comprising selecting hybrid spinach plants having at least one of the polynucleotide sequences A and B in their genome by the screening method described in claim 11.
15. (i) To determine the 76th nucleotide sequence of the polynucleotide sequence represented by Sequence ID No. 5 on the genomic DNA of the spinach plant, (ii) When the base of the 76th nucleotide is thymine (T), the spinach plant is determined to be the target plant, A screening method for spinach plants, including [specific characteristics].
16. The screening method according to claim 15, wherein the spinach plant exhibits resistance to at least one selected from the group consisting of spinach downy mildew races Pe17, Pe18, Pe19, and Pe20.
17. A spinach plant having a polynucleotide sequence on its genomic DNA that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by Sequence ID No. 5, wherein the base of the 76th nucleotide is thymine (T).
18. The spinach plant according to claim 17, wherein the spinach plant exhibits resistance to at least one selected from the group consisting of spinach downy mildew fungal races Pe17, Pe18, Pe19, and Pe20.
19. A hybrid spinach plant produced by directly or indirectly crossing the spinach plant described in claim 17 with another strain of spinach plant, having a polynucleotide sequence on its genomic DNA that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by Sequence ID No. 5, wherein the base of the 76th nucleotide is thymine (T).
20. Crossing the spinach plant described in claim 17 with a spinach plant of another strain, either directly or indirectly. A method for producing hybrid spinach plants, comprising having a polynucleotide sequence on the genomic DNA that is identical to the polynucleotide sequence represented by Sequence ID No. 5, or the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by Sequence ID No. 5, wherein the base of the 76th nucleotide is thymine (T).
21. Furthermore, the manufacturing method according to claim 20, comprising selecting hybrid spinach plants having a polynucleotide sequence on their genomic DNA that is identical to the polynucleotide sequence represented by SEQ ID NO: 5, or the sequences from the 70th to the 75th and 77th to the 82nd nucleotides of the polynucleotide sequence represented by SEQ ID NO: 5, wherein the base of the 76th nucleotide is thymine (T), by the screening method according to claim 15.