Nucleic acid recovery material and nucleic acid amplification method

Abstract

The present invention provides an easy-to-use nucleic acid recovery material that allows for the convenient recovery of nucleic acids from a sample for nucleic acid amplification, and a method for the convenient amplification of nucleic acids from a sample. [Solution] A nucleic acid recovery material comprising a gel containing a compound which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less, contained in a container. A method for recovering and amplifying nucleic acids in a sample using this nucleic acid recovery material, comprising the steps of: placing a sample containing nucleic acids into a container containing a gel which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less; heating the resulting mixture to form a complex of nucleic acids in the sample and this compound; recovering this complex from the mixture; and adding this complex to a nucleic acid amplification solution to carry out a nucleic acid amplification reaction.

Description

[Technical Field]

[0001] This invention relates to a material for easily recovering nucleic acids contained in biological samples, and a nucleic acid amplification method using the same. [Background technology]

[0002] A long-established and widely used method for separating nucleic acids from cells involves lysing the cells, removing proteins by phenol-chloroform treatment, and then precipitating the nucleic acids by adding ethanol. However, this method is multi-step and time-consuming. Furthermore, it is difficult to apply to samples with low nucleic acid content due to the low recovery rate of nucleic acids in the sample. Furthermore, methods such as the Boom method (adsorbing nucleic acids onto a silica support in the presence of a chaotropic salt and then eluting the nucleic acids using a suitable eluent), the SPRI method (eluting nucleic acids adsorbed onto magnetic beads), and the Charge-Switch technology method (isolating nucleic acid components using charge interactions) are employed. However, these methods require expensive equipment and are not suitable for processing large numbers of samples.

[0003] In recent years, a method has been proposed in which, after lysing cells, the free nucleic acids are adsorbed onto particulate hydroxyapatite (hereinafter sometimes abbreviated as "HAP"), and the nucleic acid-HAP complex is precipitated and separated from the sample solution (Patent Document 1). Another method has been proposed in which particulate strontium apatite (hereinafter sometimes abbreviated as "SrHAP") is added to the cell lysate, the nucleic acids in the lysate are adsorbed onto the SrHAP, and the nucleic acid-SrHAP complex is precipitated and separated from the sample solution (Patent Document 2). Since SrHAP selectively adsorbs nucleic acids, a highly pure and highly concentrated nucleic acid-SrHAP complex can be obtained. In the methods of Patent Documents 1 and 2, nucleic acids are dissociated or desorbed from HAP or SrHAP using a phosphate buffer. High concentrations of phosphate inhibit the nucleic acid amplification reaction, so it is necessary to remove the phosphate by dialysis or the like before nucleic acid amplification, resulting in a low nucleic acid recovery rate.

[0004] As a solution to this problem, the present inventors have reported a method for amplifying nucleic acids by contacting nucleic acids with a nucleic acid adsorbent, which is an alkaline earth metal phosphate and / or carbonate compound with a solubility in water of 1 g / 100 g H2O or less, and then directly subjecting the resulting nucleic acid-nucleic acid adsorbent complex to a nucleic acid amplification reaction (Patent Document 3). In this method, since the nucleic acid dissociates from the nucleic acid adsorbent at the temperature at which the nucleic acid amplification reaction is performed, there is no need to desorb the nucleic acid with phosphate buffer. Therefore, a decrease in nucleic acid recovery rate due to phosphate removal, and consequently a decrease in nucleic acid detection sensitivity, can be avoided. In addition, because the number of steps is small, the time from sample collection to nucleic acid amplification is dramatically shortened.

[0005] The method described in Patent Document 3 involves adding a nucleic acid-containing sample to a tube containing a powdered nucleic acid adsorbent or a suspension of a nucleic acid adsorbent to form a complex. However, powdered nucleic acid adsorbents are prone to spillage when dispensed into tubes, and when transporting tubes containing powdered nucleic acid adsorbents, the powder can scatter inside the tube and adhere to various parts of the inner wall of the container, causing the powder to spill out when the tube lid is opened to add the sample. When an aqueous suspension of a nucleic acid adsorbent is placed in a tube, it is difficult to dispense a uniform amount of nucleic acid adsorbent into the tube because the nucleic acid adsorbent precipitates in the suspension. Also, the suspension is prone to spillage when the tube lid is opened to add the sample. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] Japanese Patent Publication No. 2000-23668 [Patent Document 2] Japanese Patent Publication No. 2017-35651 [Patent Document 3] Patent No. 7446576 [Overview of the project] [Problems that the invention aims to solve]

[0007] The present invention aims to provide an easy-to-use nucleic acid recovery material that can conveniently recover nucleic acids from a sample for nucleic acid amplification, and a method that can conveniently amplify nucleic acids from a sample. [Means for solving the problem]

[0008] The inventors conducted extensive research to solve the above problems and obtained the following findings. A compound of alkaline earth metal phosphate and / or carbonate with a solubility in water of 1 g / 100 g H2O or less functions as a nucleic acid adsorbent (Patent No. 7446576 (Non-Patent Literature 3)). When a test sample is placed in a container containing a gel with this nucleic acid adsorbent and heated, nucleic acids elute from the cells and the gel becomes liquid (sol), forming a complex of nucleic acids and nucleic acid adsorbent. If this complex is separated from the sol and subjected to a nucleic acid amplification reaction, the nucleic acids desorb from the nucleic acid adsorbent at the nucleic acid amplification reaction temperature, and if the target nucleic acid sequence is present in the test sample, that portion can be amplified. In other words, when the complex is separated from the sol and used as a sample for nucleic acid amplification, a small amount of gelling agent remains in the complex. Therefore, the gelling agent is introduced into the nucleic acid amplification solution, but the nucleic acid amplification reaction is not inhibited.

[0009] The present invention was completed based on the above findings and provides the following [1] to [9]. [1] A nucleic acid recovery material comprising a gel containing a compound which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less, contained in a container. [2] The nucleic acid recovery material according to [1], wherein the gelling agent concentration in the gel is 0.2 to 70% by mass. [3] A nucleic acid recovery material according to [1] or [2], wherein the ratio of the amount of a compound that is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less to the amount of gel is 0.01 ng / mL to 10000 mg / mL. [4] A nucleic acid recovery material according to any one of [1] to [3], wherein the compound is an alkaline earth metal phosphate and / or carbonate, has a solubility in water of 1 g / 100 g H2O or less, and has a volume-average particle size of 1 nm to 1000 μm. [5] A nucleic acid recovery material according to any one of [1] to [4], wherein the gel contains a gelling agent and water or an aqueous solution with a pH of 5 to 9. [6] A method for recovering and amplifying nucleic acids in a sample using a nucleic acid recovery material described in any of [1] to [5], comprising the steps of: placing a sample containing nucleic acids into a container containing a gel containing a compound which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less; heating the resulting mixture to form a complex of nucleic acids in the sample and this compound; recovering the complex from the mixture; and adding the complex to a nucleic acid amplification solution to carry out a nucleic acid amplification reaction. [7] The nucleic acid amplification method according to [6], wherein the heating temperature in the step of forming a complex of nucleic acid in the sample with a compound which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less is 40 to 200°C. [8] The nucleic acid amplification method according to [6] or [7], wherein the nucleic acid amplification reaction is carried out at a temperature of 45°C or higher. [9] A nucleic acid amplification kit comprising a nucleic acid recovery material as described in any of [1] to [5]. [Effects of the Invention]

[0010] The nucleic acid recovery material of the present invention contains a compound, which is an alkaline earth metal phosphate and / or carbonate with a solubility in water of 1 g / 100 g H2O or less, enclosed in a gel within a container. That is, this compound is immobilized within the gel. This compound functions as a nucleic acid adsorbent. Therefore, unlike when the nucleic acid adsorbent is in powder form or as a suspension in a container, the nucleic acid adsorbent will not scatter or spill from the container during distribution or when the lid is opened and a sample is added. In addition, in the production of the nucleic acid recovery material of the present invention, in order to dispense into a container a material in which a nucleic acid adsorbent is uniformly dispersed in a gel (sol) made viscous by heating, a nucleic acid recovery material with a uniform amount of nucleic acid adsorbent can be easily mass-produced.

[0011] In the nucleic acid recovery material of the present invention, a test sample is added to a gel containing a nucleic acid adsorbent and heated to make the gel into a liquid state (sol), thereby forming a complex of the nucleic acid eluted from the test sample by heat and the nucleic acid adsorbent. Then, the complex is separated from the sol and used as a sample for nucleic acid amplification reaction. A small amount of gelling agent attached to the complex does not inhibit the nucleic acid amplification reaction, and a target nucleic acid sequence can be detected with high sensitivity.

[0012] In addition, if a nucleic acid / nucleic acid adsorbent complex is obtained using the nucleic acid recovery material of the present invention and subjected to a nucleic acid amplification reaction, the nucleic acid in the sample can be amplified in a short time of about 1 to 2.5 hours from sample collection.

[0013] Thus, the nucleic acid recovery material of the present invention is easy to handle, can be produced using inexpensive materials, and can perform nucleic acid amplification simply in a short time by using the nucleic acid recovery material of the present invention, so it can be suitably used for the treatment of a large number of biological samples. Among them, it is easy to use in hospital examinations and mass screenings that require quick results for a large number of biological samples. For example, clinical tests such as measles, tuberculosis, pneumonia, avian influenza infection, herpes virus infection, severe acute respiratory syndrome (SARS-CoV), etc. using nucleic acid amplification methods such as PCR are actually being carried out, and the nucleic acid recovery material of the present invention can be used for these nucleic acid amplification methods. It is also very useful for quickly diagnosing the presence or absence of infection during the sudden outbreak of infectious diseases such as coronavirus disease (COVID-19) caused by the novel virus (2019-nCoV). In addition, by using it for detection tests of food poisoning bacteria in food, detection tests of pathogenic microorganisms in environmental water (tap water, lake water, river water, etc.) and soil, and nucleic acid amplification in laboratories, etc., the nucleic acid amplification reaction can be carried out simply.

Brief Description of Drawings

[0014] [Figure 1] These are photographs of the appearance of the nucleic acid recovery material of the present invention. (A) is before use, (B) is after mixing with a saliva sample and heating, and (C) is after further centrifugation. [Figure 2] This is a photograph of the reaction solution after performing a nucleic acid amplification reaction using the LAMP method in Example 1, with HAP used as the nucleic acid adsorbent, and (A) λ phage DNA and (B) saliva as samples. [Figure 3] This is a gel photograph of the agarose gel electrophoresis of the reaction solution after performing a nucleic acid amplification reaction using the LAMP method with λ phage DNA as the sample, using HAP as the nucleic acid adsorbent in Example 2. [Figure 4] This is a photograph of the reaction solution after performing a nucleic acid amplification reaction using the LAMP method with λ phage DNA as the sample, using HAP as the nucleic acid adsorbent, in Example 3. The LAMP reagents used were (A) LAMP MASTER for Turbidity and (B) WarmStart Colorimetric LAMP. The tube on the left of (B) shows red, and the tube on the right shows yellow. [Figure 5] This is a photograph of the reaction solution after performing a nucleic acid amplification reaction using the LAMP method with λ phage DNA as the sample, in Example 4, using SrHAP as the nucleic acid adsorbent and low-melting-point agarose instead of agarose as the gelling agent. The heating temperature after adding λ phage DNA to the gel was 70°C for (A) and 98°C for (B). In both (A) and (B), the tube on the left shows red, and the tube on the right shows yellow. [Figure 6] In Example 5, a nucleic acid recovery material was prepared by using HAP as a nucleic acid adsorbent and dissolving agarose in a TE solution. The image shows the reaction solution after a nucleic acid amplification reaction was performed using the LAMP method with lambda phage DNA as the sample. Both tubes are yellow in color. [Figure 7] This is a photograph of the reaction solution after performing a nucleic acid amplification reaction using the LAMP method with λ phage DNA as the sample, using HAP or tricalcium phosphate (TCP) as the nucleic acid adsorbent in Example 6. [Modes for carrying out the invention]

[0015] The present invention will be described in detail below. (1) Nucleic acid recovery material The nucleic acid recovery material of the present invention comprises a gel contained in a container, which is an alkaline earth metal phosphate and / or carbonate compound having a solubility in water of 1 g / 100 g H2O or less (sometimes referred to as a "nucleic acid adsorbent" in the present invention). The nucleic acid recovery material of the present invention can be suitably used as a material for recovering nucleic acids for use in nucleic acid amplification reactions or for use in nucleic acid amplification reactions. The nucleic acids are recovered from a sample containing nucleic acids.

[0016] nucleic acid adsorbent As a phosphate and / or carbonate of an alkaline earth metal, a compound having a solubility in water of 1 g / 100 g H2O or less can be used, such as a phosphoric acid and / or carbonate of at least one alkaline earth metal selected from magnesium (Mg), calcium (Ca), strontium (Sr), and barium (Ba). Nucleic acids can be adsorbed in water-containing samples if they are poorly soluble in water, i.e., have a solubility in water of 1 g / 100 g H2O or less. In this invention, "solubility in water" refers to the solubility in water at a temperature of 25°C and a pH of 7. While the pH of water is theoretically 7, it fluctuates slightly depending on the water source and the dissolution of atmospheric components. In this case, water adjusted to pH 7 using NaOH or HCl is used.

[0017] Examples of phosphates include magnesium phosphate, magnesium hydrogen phosphate, calcium phosphate, calcium hydrogen phosphate, hydroxyapatite, strontium phosphate, strontium hydrogen phosphate, strontium apatite, strontium halide apatite, barium phosphate, barium hydrogen phosphate, barium apatite, barium halide apatite, magnesium-substituted strontium apatite, zinc-substituted strontium apatite, magnesium-substituted hydroxyapatite, and strontium-substituted hydroxyapatite. As compounds with suitable compositions, magnesium phosphate (Mg3(PO4)2), magnesium hydrogen phosphate (MgHPO4), tricalcium phosphate (Ca3(PO4)2), calcium hydrogen phosphate (CaHPO4), hydroxyapatite (Ca , ,

[0018] , , , 10-x , x (PO4)6(OH)2), strontium phosphate (Sr3(PO4)2), strontium hydrogen phosphate (SrHPO4), strontium apatite (Sr 10 (PO4)6(OH)2), halogenated strontium apatite (Sr 10 (PO4)6X2) (X represents a halogen atom.), barium phosphate (Ba3(PO4)2), barium hydrogen phosphate (BaHPO4), barium apatite (Ba 10 (PO4)6(OH)2), halogenated barium apatite (Ba 10 (PO4)6X2) (X represents a halogen atom.), magnesium-substituted strontium apatite (Sr 10-x Mg x (PO4)6(OH)2: 0 < x < 5), zinc-substituted strontium apatite (Sr 10-x Zn x (PO4)6(OH)2: 0 < x < 5), magnesium-substituted hydroxyapatite (Ca 10-x Mg x (PO4)6(OH)2: 0 < x < 5), strontium-substituted hydroxyapatite (Ca 10-x Sr x (PO4)6(OH)2: 0 < x < 10), etc. Examples of the halogen include fluorine, chlorine, bromine, and iodine. Hydroxyapatite is commercially available, and for example, "HAP-100" (Taihei Chemical Industry Co., Ltd.), "natural apatite" (Excel Co., Ltd.), etc. can be used. Commercially available products can be used for calcium hydrogen phosphate, calcium phosphate, and magnesium phosphate. Other compounds can be produced by the method described in Example 7446576 of the patent or a method analogous thereto.

[0018] Examples of the carbonate include magnesium carbonate, calcium carbonate, strontium carbonate, strontium carbonate apatite, barium carbonate, and the like. As compounds with a suitable composition, magnesium carbonate (MgCO3), calcium carbonate (CaCO3), strontium carbonate (SrCO3), strontium carbonate apatite (Sr x (PO4) 6-y (CO3) y X2)(0 < y < 1), barium carbonate (BaCO3), and the like can be mentioned. Strontium carbonate apatite can be produced by the method described in the example section of Patent No. 7446576. Other carbonates can use commercially available products.

[0019] As the phosphoric acid and carbonate, strontium-substituted carbonated hydroxyapatite, for example, (Ca 10-x Sr x (PO4) 6-y (CO3) y X2)(0 < x < 10, 0 < y < 1) and the like having a composition of strontium-substituted carbonated hydroxyapatite can be mentioned. Strontium-substituted carbonated hydroxyapatite can be produced by introducing strontium into the apatite crystal of commercially available carbonated hydroxyapatite by an ion exchange reaction according to the method of Synthesis Example 8 in the example section of Patent No. 7446576.

[0020] Strontium apatite (SrHAP) can be produced by the method described in the examples of Patent No. 7446576, but can also be produced, for example, by the method described in JP-A-2015-86084. Specifically, in water, a strontium salt (for example, strontium chloride), a phosphate (for example, disodium hydrogen phosphate), and a carbonate (for example, sodium hydrogen carbonate) are mixed, and by adjusting the molar ratio of each component, SrHAP can be obtained in one step.

[0021] Among them, widely used HAP and SrHAP with extremely high selective adsorption power for nucleic acids are preferable.

[0022] The chemical formulas of various apatites are not uniquely represented by the ratios of constituent elements exemplified above; the above are merely examples of representative compositions. In reality, the ratios of constituent elements vary considerably depending on the synthesis method and conditions of various apatites (for example, calcium-deficient hydroxyapatite). Furthermore, alkali metals such as sodium may be included in the crystal lattice of various apatites. Moreover, it is difficult to accurately analyze and determine the ratio of hydroxyl groups in the structural formulas of various apatites, so the above composition ratio ((OH)2) is given as a representative ratio, but it is not necessarily limited to this, and the proportion of hydroxyl groups may be higher if, for example, hydration water on the crystal surface of various apatites is included.

[0023] The shape of the nucleic acid adsorbent is not particularly limited and can be in the form of powder, granules, etc. The volume-average particle diameter of the nucleic acid adsorbent can be 1000 μm or less, 500 μm or less, 100 μm or less, 15 μm or less, or 5 μm or less. As mentioned above, nucleic acid recovery material can be manufactured by dispensing a solution of nucleic acid adsorbent dispersed in a gelling agent into a container. Within this range, the nucleic acid adsorbent can be uniformly dispersed in a viscous sol. Furthermore, the amount of nucleic acid adsorbed per particle surface area, and thus per particle weight, becomes sufficient. Furthermore, the volume-average particle size of the nucleic acid recovery material can be 1 nm or larger, 10 nm or larger, or 50 nm or larger. Within this range, the complex of nucleic acid and nucleic acid adsorbent can be recovered by centrifugation or other methods. The volume-average particle size of nucleic acid adsorbents after manufacturing is usually about 10 μm or larger, but it can be reduced by wet dispersion treatment using, for example, a media mill. In this invention, the volume-average particle diameter is a value measured by laser diffraction scattering while dispersed in water.

[0024] The ratio of nucleic acid adsorbent to gel (weight ratio of nucleic acid adsorbent per 1 mL of gel) can be 0.01 ng / mL or more, 0.1 ng / mL or more, 1 ng / mL or more, 0.01 mg / mL or more, 1 mg / mL or more, 30 mg / mL or more, 50 mg / mL or more, or 100 mg / mL or more. Within this range, contact efficiency with nucleic acids is good, and nucleic acids can be adsorbed at high density. Alternatively, it can be 10,000 mg / mL or less, 1,000 mg / mL or less, 500 mg / mL or less, 100 mg / mL or less, 50 mg / mL or less, or 1 mg / mL or less. Within this range, waste of nucleic acid adsorbent can be minimized.

[0025] gel containing nucleic acid adsorbent A gel containing a nucleic acid adsorbent can be obtained by placing a gelling agent, water or aqueous solution, and the nucleic acid adsorbent in a container, heating it to a temperature appropriate to the type of gelling agent to liquefy the gel, and then cooling it to, for example, room temperature. The heating can be done at, for example, 50 to 100°C.

[0026] Examples of gelling agents include natural polysaccharides such as agarose, pectin, carrageenan, xanthan gum, guar gum, tara gum, locust bean gum, gum arabic, gellan gum, glucomannan, and alginic acid; synthetic polysaccharides such as methylcellulose and hydroxypropyl methylcellulose; and proteins such as gelatin. One or more gelling agents may be used.

[0027] The concentration of the gelling agent in the gel can be 0.2% by mass or more, 0.4% by mass or more, 0.8% by mass or more, or 1% by mass or more. Within this range, the nucleic acid adsorbent can be uniformly dispersed when the gel containing the nucleic acid adsorbent is dispensed into a container. Alternatively, it can be 70% by mass or less, 50% by mass or less, 20% by mass or less, 10% by mass or less, 5% by mass or less, or 2% by mass or less. Within this range, the gel containing the nucleic acid adsorbent will not solidify easily even after mixing it with a sample and dissolving the gelling agent by applying heat, and therefore the nucleic acid adsorbent that has adsorbed the nucleic acid will be easy to recover.

[0028] As described above, the gelling agent is mixed with water or an aqueous solution and heated to form a gel. The aqueous solution only needs to be one that does not inhibit the nucleic acid amplification reaction even if a small amount is introduced into the nucleic acid amplification solution. In terms of stabilizing nucleic acids, an aqueous solution that is neutral to weakly alkaline (for example, pH 5 to 9, more preferably 5.5 to 8.5, and more preferably 6 to 8) is preferred. Examples include TE solution (Tris-hydrochloric acid, EDTA), TAE solution (Tris-acetic acid, EDTA), TBE solution (Tris-boric acid, EDTA-Na2), Tris-hydrochloric acid buffer, Tris-acetic acid buffer, Tris-boric acid buffer, MOPS-NaOH buffer, and HEPES-NaOH buffer.

[0029] container The amount of gel contained in a single container can be 2 μL or more, 10 μL or more, 50 μL or more, or 200 μL or more. Within this range, it is easy to dispense the gel into the container. Alternatively, it can be 1000 μL or less, 500 μL or less, 300 μL, or 100 μL or less. Within this range, it is possible to efficiently bring nucleic acids in the sample into contact with the nucleic acid adsorbent using a sample volume that is easy to collect. The container capacity can be, for example, 0.5 mL or more, 1.5 mL or more, 15 mL or more, or 50 mL or more, and can also be 2000 mL or less, 1000 mL or less, 500 mL or less, 100 mL or less, 50 mL or less, or 10 mL or less. Within this range, it is easy to handle. The container material is not particularly limited, but plastic containers are preferable. The container shape is not particularly limited, but tube-shaped containers with individual lids can be used to prevent bacterial contamination during storage. Open containers such as tubes without lids or the wells of a multi-well plate can also be used. A multi-well plate allows for the processing of a large number of samples.

[0030] (2) Nucleic acid amplification method The nucleic acid amplification method of the present invention is a method for recovering and amplifying nucleic acids in a sample using the nucleic acid recovery material of the present invention as described above, and includes the steps of: placing a sample containing nucleic acids into a container containing a gel containing a compound (nucleic acid adsorbent) which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less; heating the resulting mixture to form a complex of nucleic acids in the sample and the nucleic acid adsorbent; recovering the complex of nucleic acids and nucleic acid adsorbent from the mixture; and adding this complex to a nucleic acid amplification solution to carry out a nucleic acid amplification reaction.

[0031] Samples containing nucleic acids Examples of nucleic acid-containing samples include, in the case of biological samples, oral samples such as saliva, dental plaque, oral mucosa, pharyngeal swabs, sputum, and tracheal aspirate; tissues suspected of being cancerous; blood such as whole blood, serum, and plasma; lymph; and semen. Other biological samples include bacteria, viruses, fungi, algae, and protozoa. Samples containing nucleic acids extracted from cells are also included. Solid samples can be converted into liquid samples by suspending them in water or an aqueous solution, or by homogenizing them in water or an aqueous solution. In the present invention, nucleic acids include DNA, RNA, oligonucleotides, and chemically modified forms thereof.

[0032] Sample pretreatment In the method of the present invention, when a sample containing nucleic acids is placed in a container containing a gel containing a nucleic acid adsorbent and then heated, the cells are destroyed and the nucleic acids are eluted depending on the temperature, so it is not necessary to extract nucleic acids from the cells in the sample beforehand. However, if nucleic acids are not extracted from the cells during the heat treatment in the above complex formation step, the nucleic acids may be extracted from the cells before placing them in the container. Also, even if the heating temperature in the above complex formation step is the temperature at which nucleic acids are extracted from the cells, nucleic acid extraction may be performed beforehand. In this invention, nucleic acid extraction refers to a process that increases the permeability of cells to remove at least a portion of nucleic acids from the cells. Such processes are well known to those skilled in the art and include, for example, heat treatment (heating to about 50-100°C), surfactant treatment (nonionic surfactants such as TritonX-100, ionic surfactants such as SDS and guanidine salts, etc.), calcium chloride treatment, enzyme treatment (cell wall lysis enzymes such as lysozyme, etc.), pulse voltage application, osmotic shock application, and electron beam irradiation.

[0033] The process of placing a sample containing nucleic acids into a container. The temperature at which the sample is placed in the container and brought into contact with the gel containing the nucleic acid adsorbent can be less than 45°C, and more specifically, 40°C or lower, 30°C or lower, 25°C or lower, and 10°C or lower. Performing the procedure at room temperature is simpler. The amount of sample to be placed in the container should be 3 or more, 10 or more, 50 or more, or 500 or more parts per 1 volume of gel. Within this range, solidification by the gelling agent will not occur even after cooling to room temperature following the subsequent heating step. Alternatively, the amount of sample should be 5000 or less, 2500 or less, or 1000 or less parts per 1 volume of gel. Within this range, the nucleic acid adsorbent can diffuse sufficiently uniformly to form a complex with the nucleic acids in the sample.

[0034] While the nucleic acid content of nucleic acid-containing samples is often unknown, if the nucleic acid content is known, the sample quantity should be such that the mass ratio of nucleic acid adsorbent to 1 part by mass of nucleic acid is 10 to 10,000 parts by mass, and more specifically, 20 to 1,000 parts by mass. Within this range, enough nucleic acid to be amplified can be adsorbed.

[0035] Complex formation process Next, the mixture of the gel containing the nucleic acid amplification agent and the sample is heated. The heating temperature can be any temperature at which the mixture becomes liquid, and can be 40°C or higher, 50°C or higher, 60°C or higher, 70°C or higher, 80°C or higher, or 90°C or higher. Within this range, the mixture will become liquid, and nucleic acids will usually be eluted from the cells in the sample. Alternatively, the heating temperature can be 200°C or lower, 150°C or lower, 100°C or lower, 95°C or lower, 80°C or lower, 60°C or lower, 50°C or lower, 46°C or lower, or less than 45°C. Within this range, nucleic acids adsorbed to the nucleic acid adsorbent are less likely to desorb, and nucleic acid degradation is suppressed. Once the above mixture becomes liquid, the nucleic acid adsorbent and nucleic acid can come into contact. The heating time is preferably 1 second or more, more preferably 10 seconds or more, and more preferably 60 seconds or more. The contact time can be 60 minutes or less, and more preferably 30 minutes or less, in order to prevent the degradation of nucleic acid. After heating, the mixture will cool naturally to room temperature if left to stand or stirred, but it can also be cooled in a water bath or similar method. Since the gelling agent is diluted to accommodate liquid samples, it usually does not solidify even at room temperature.

[0036] Composite recovery process The complex of nucleic acid and nucleic acid adsorbent can be recovered from the mixture by centrifugation, filtration, decantation, etc. The recovered complex can be suspended in water or an aqueous solution and added to the nucleic acid amplification solution as a sample for the nucleic acid amplification reaction. The complex may be washed with water before being added to the nucleic acid amplification solution. The amount of complex to be added to the nucleic acid amplification solution should be the same as the sample amount specified in the nucleic acid amplification reagent manual.

[0037] nucleic acid amplification process The nucleic acid amplification method is not particularly limited, as long as it includes a step performed at 45°C or higher. At 45°C or higher, nucleic acids are desorbed or dissociated from the nucleic acid adsorbent, and the nucleic acid amplification reaction proceeds simultaneously. Methods for amplifying DNA include methods involving thermal denaturation of double-stranded DNA, such as PCR (Polymerase chain reaction) (Science 239, 487-491 (1988)), LCR (Ligase chain reaction) (Proc. Natl. Acad. Sci. USA, 88:189-193 (1991)); LAMP (Loop-mediated isothermal amplification) (International Publication No. 00 / 28082), SDA (Strand displacement amplification) (US Patent No. 5455166), ICAN (Isothermal and chimeric primer-initiated amplification of nucleic acids) (International Publication No. 00 / 56877), SMAP (Smart amplification process) (Seibutsu Butsuri Kagaku, 52(4):183-187, 2008), and 3SR (Self-stranded sequence Examples include isothermal amplification methods that do not involve the thermal denaturation step of double-stranded DNA, such as replication (Am. Biotechnol. Lab. 8, 14-25 (1990)).

[0038] When amplifying RNA, since RNA is single-stranded from the beginning, there is no need for thermal denaturation, and isothermal amplification can be performed. Examples of nucleic acid amplification methods for RNA include TMA (Transcription Mediated Amplification) (In Ferre, F.(ed), Gene quantification, Boston, Birkhauser p189-201(1998)), NASBA (Nucleic Acid Sequence-Based Amplification) (In Ferre, F.(ed), Gene quantification, Boston, Birkhauser p169-188(1998)), and TRC (Transcription-reverse transcription concerted reaction) (J. Clin. Microbiol, .42(9):4284-4292, 2004).

[0039] Among these methods, isothermal amplification is preferable because it is simple and inexpensive, as it does not require temperature changes. The LAMP method is particularly simple because it can amplify DNA in a single step using only one type of synthetic enzyme. Furthermore, the LAMP method has high amplification efficiency, allowing for detectable amplification even with small amounts of target DNA, and its extremely high specificity minimizes false detection of related bacterial species. In isothermal amplification, the amplification temperature varies depending on the type of DNA amplification enzyme, but it can be set to around 50-70°C.

[0040] Furthermore, because the nucleic acid recovery material of the present invention has a high nucleic acid recovery rate, target sequences can be sufficiently detected even when using general-purpose nucleic acid amplification methods such as PCR. The amplification temperature during PCR, including denaturation, annealing, and extension, can be set to approximately 45-98°C.

[0041] The target sequence portion to be amplified using nucleic acid amplification methods should be determined appropriately depending on the test. For example, when detecting Streptococcus mutans (a caries-causing bacterium) from oral samples such as saliva, the sequence portion containing all or part of the glycosyltransferase gene (GenBank accession number: M1736) can be targeted. Because the base sequences of the glycosyltransferase gene differ relatively significantly among species of the Streptococcus genus, targeting the glycosyltransferase gene allows for accurate detection of Streptococcus mutans. Furthermore, targeting the sequence portion containing all or part of the gene encoding the cnm protein (GenBank accession number: AB465300.1) allows for the detection of cnm-positive Streptococcus mutans. Furthermore, when detecting Porphyromonas gingivalis (a type of periodontal disease-causing bacterium) from oral samples such as dental plaque, the target can be a sequence containing all or part of the Porphyromonas gingivalis 16S RNA gene.

[0042] Phosphates can be added to the nucleic acid amplification solution, which promotes the desorption of nucleic acids from the nucleic acid adsorbent. Examples of phosphates include sodium phosphate, potassium phosphate, ammonium phosphate, sodium hydrogen phosphate, potassium hydrogen phosphate, and ammonium hydrogen phosphate. One or more types of phosphates can be used. The amount of phosphate added can be set to a final concentration of 1 mM or higher, 10 mM or higher, 20 mM or higher, 40 mM or higher, or 50 mM or higher. Within this range, nucleic acid dissociation can be promoted. Alternatively, the amount of phosphate added can be set to a final concentration of 300 mM or lower, 200 mM or lower, 100 mM or lower, 80 mM or lower, 50 mM or lower, 40 mM or lower, 30 mM or lower, 20 mM or lower, or 10 mM or lower. Within this range, there is little inhibition of nucleic acid amplification enzymes, and the nucleic acid amplification reaction proceeds to a detectable level. When PCR is used as the nucleic acid amplification method, the amount of phosphate added should be lower compared to other nucleic acid amplification methods, with a final concentration of 50 mM or less, 40 mM or less, 30 mM or less, 20 mM or less, or 10 mM or less being preferable. It is also possible to omit the addition of nucleic acid dissociation agents such as phosphates to the nucleic acid amplification solution.

[0043] Amplification of the target sequence region of nucleic acids can be confirmed by conventional methods. For example, this can be done by performing an amplification reaction in the presence of an intercalator that binds to double-stranded nucleic acids, such as ethidium bromide (EtBr) or SYBR GREEN, and observing the fluorescence under a UV lamp. Additionally, chelating agents such as calcein bind to manganese ions and quench before amplification, but as the nucleic acid amplification reaction proceeds, the generated pyrophosphate ions steal the manganese ions, causing fluorescence. Furthermore, the fluorescence is enhanced by binding to magnesium ions in the reaction solution, so the presence or absence of amplification can be confirmed by observing the fluorescence under a UV lamp. Furthermore, in the DNA amplification reaction using DNA amplification enzymes, pyrophosphate is produced as a byproduct. This pyrophosphate reacts with magnesium ions in the reaction solution to form magnesium pyrophosphate. In methods that produce a large amount of amplification product, such as the LAMP method, magnesium pyrophosphate precipitates in the reaction solution, causing turbidity. By visually confirming this turbidity, the amplification of the target sequence can be confirmed. Furthermore, since the reaction solution becomes acidic when the amplification reaction by LAMP occurs, adding a pH indicator to the reaction solution will cause a color change, which can be used as an indicator to confirm the amplification of the target sequence.

[0044] As described above, nucleic acids are desorbed from the nucleic acid adsorbent by a nucleic acid amplification reaction at 45°C or higher. However, before subjecting the nucleic acid amplification reaction to the complex of nucleic acid and nucleic acid adsorbent, the gel, and the sample mixture, the nucleic acids may be desorbed from the nucleic acid adsorbent by heating them to 45°C or higher, 55°C or higher, 65°C or higher, or 75°C or higher. The heating temperature can be kept below 100°C to prevent the decomposition of nucleic acids. The heating time can be from 1 second to several minutes (for example, 2, 3, 4, or 5 minutes). Within this range, sufficient nucleic acid desorption can be achieved.

[0045] (3) Nucleic acid amplification kit The nucleic acid amplification kit of the present invention comprises the nucleic acid recovery material of the present invention as described above. In addition to the nucleic acid recovery material of the present invention, the nucleic acid amplification kit may also comprise one or more other components such as a nucleic acid amplification reagent, a nucleic acid amplification primer, water (e.g., purified water), and a nucleic acid amplification container. Using this kit, the operations up to the nucleic acid amplification step of the method of the present invention described above can be performed without preparing anything else. After that, the nucleic acid amplification container containing the nucleic acid / nucleic acid adsorbent complex, nucleic acid amplification reagent, primer, and water can be set in a nucleic acid amplification device, and the reaction and detection can be performed, which is extremely simple. [Examples]

[0046] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples. Preparation of nucleic acid recovery material Nucleic acid adsorbent and agarose (Agarose SFR; Amresco) were placed in beakers containing distilled water at concentrations of 20 mg / mL and 1.5% by mass, respectively. The mixture was boiled and stirred repeatedly in a microwave oven to dissolve the agarose and obtain a sol. This sol was stirred to uniformly disperse the nucleic acid adsorbent, and 50 μL portions were dispensed into 2.0 mL (10 mm diameter, 43 mm length) lidded plastic tubes. The tubes were left to stand at room temperature, causing the sol to solidify into a gel containing the nucleic acid adsorbent. A photograph of the appearance of the tubes containing the solidified nucleic acid adsorbent is shown in Figure 1(A). A tube with a nucleic acid adsorbent solidified on the phase was obtained in the same manner using low-melting-point agarose (melting point 65°C (1.5%)) (Agarose XP; Nippon Gene Co., Ltd.) instead of agarose. Gelatin (Wako) was used instead of agarose, and the gelatin concentration was set to 5% by mass. The beaker was placed in 98°C hot water and the gelatin was dissolved to obtain a sol. The rest of the procedure was the same to obtain a tube with a nucleic acid adsorbent solidified on it. As nucleic acid adsorbents, SrHAP (synthesized by referring to the synthesis example in the Examples section of Japanese Patent No. 7446576), hydroxyapatite (HAP) (CAS No.: 1306-06-5; Taihei Chemical Industry Co., Ltd.), or tricalcium phosphate (α-TCP-A (average particle size 8-15 μm, CAS No.: 7758-87-4; Taihei Chemical Industry Co., Ltd.), α-TCP-B (average particle size 3-8 μm, CAS No.: 7758-87-4; Taihei Chemical Industry Co., Ltd.), β-TCP-100 (CAS No.: 7758-87-4; Taihei Chemical Industry Co., Ltd.)) were used.

[0047] Example 1 156 ng of lambda phage DNA (Invitrogen) was placed in a HAP-immobilized tube containing 1 mL of distilled water, heated at 98°C for 5 minutes, and then the tube was inverted and mixed for 10 minutes to bind the DNA to the HAP. The mixture was centrifuged at 6200 rpm for 15 seconds using a small microcentrifuge (Tommy), the supernatant was removed, and 5 μL of distilled water was added to obtain a DNA-HAP complex suspension. Figure 1(B) shows the appearance of the nucleic acid adsorbent-immobilized tube after the saliva sample was placed in it, and Figure 1(C) shows a photograph of the tube after centrifugation and removal of the supernatant. λ phage DNA was amplified using a 5 μL DNA-HAP complex suspension as a template with the LAMP reagent (LAMP MASTER for Turbidity, Nippon Gene Co., Ltd.). The primers used are as follows: λ phage DNA amplification primer set F3: CAGCTATGCGCCGACCAGAAC(Sequence ID 1) R3: GACTTGGGGGTGATGAGTTTACC (Sequence ID 2) FIP: GAGAGTTGTTCCGTTGTGGGGGCCGATCAGCCAAACGTCTC(Sequence No. 3) BIP: GCATGGGATCATTGGGTACTGGAAACTGATCAGGGATAGCGG (Sequence ID 4) LF: AGTTATCGCTAGTCAGTGGC (Sequence ID 5) LB: GGGTTTAGTGGTTGTAAAAACACC (Sequence ID 6) Furthermore, 1.5 mL of saliva was placed in a HAP-immobilized tube instead of distilled water and lambda phage DNA, and the amplification reaction was carried out in the same manner using the LAMP method. The cnm protein gene possessed by cnm-positive Streptococcus mutans was amplified using the following primers. CNM protein gene amplification primer set F3: CCAGTAATACTGTCATTGAAAGT (Sequence ID 7) R3: CGCTTTGAGTTTGATGAGC (Sequence ID 8) FIP: AACCATTAAGCTGGAGGTTCAGGAACTGCTTTGTCTTGCGT (Sequence ID 9) BIP: CGTATAACCTGTTCCTCTGACTGTAATATTAAAGCAGGCGACAC(Sequence ID 10) LF: GCAAGTATGTTGGTGATTTG (Sequence ID 11) LB: CCTGAATTCTGCCAGTTAAC (Sequence ID 12) Furthermore, a HAP suspension obtained using distilled water instead of lambda phage DNA or saliva was used as a negative control, and the LAMP procedure was performed similarly. Figure 2 shows the results of observing each reaction tube after the reaction under a UV lamp. λ phage DNA and the cnm protein gene present in cnm-positive Streptococcus mutans in saliva were detected.

[0048] Example 2 Using 5 μL of the λ phage DNA-HAP suspension obtained in Example 1 as a template, λ phage DNA was amplified using PCR reagent (Quick Taq; TOYOBO). Similarly, a HAP suspension obtained using distilled water instead of λ phage DNA was used as a negative control, and the PCR procedure was performed in the same manner. The reaction involved thermal denaturation at 98°C for 2 minutes, followed by 30 cycles of 98°C for 10 seconds, 55°C for 20 seconds, and 68°C for 45 seconds. After the reaction, 3% agarose gel electrophoresis was performed, and the DNA was stained with GelRed (Wako). The PCR primers used were F3 (SEQ ID NO: 1) and R3 (SEQ ID NO: 2) from the λ DNA primers used in Example 1. Figure 3 shows the results of observing the agarose gel under a UV lamp. The results showed the detection of a band indicating amplification of λ phage DNA. This demonstrates that gene amplification is possible not only with the LAMP method but also with the PCR method.

[0049] Example 3 In Example 1, 5% by mass gelatin was used instead of 1.5% by mass agarose as the gelling agent. A HAP-solid-phase tube was obtained using the gelatin preparation method described in the section on nucleic acid recovery material preparation. Next, a λ phage DNA-HAP complex was obtained in the same manner as in Example 1. Using 2 μL of DNA-HAP suspension as a template, λ phage DNA was amplified using two types of LAMP reagents (LAMP MASTER for Turbidity (Nippon Gene Co., Ltd.) and WarmStart Colorimetric LAMP (New England BioLabs)). In addition, a HAP suspension obtained using distilled water instead of λ phage DNA was used as a negative control, and the LAMP procedure was performed in the same manner. Figure 4(A) shows the results of observing the reaction tube under a UV lamp after the reaction using LAMP MASTER for Turbidity. Figure 4(B) shows the results using WarmStart Colorimetric LAMP, observed under visible light. In the LAMP reaction, the reaction solution becomes acidic as nucleic acid amplification occurs. The WarmStart Colorimetric LAMP reagent is an indicator that changes color from pink to yellow in acidic conditions, and is used to detect nucleic acid amplification. In this case, the reaction solution turned yellow, indicating that amplification occurred even when using the WarmStart Colorimetric LAMP reagent. This suggests that λ phage DNA was detected regardless of the LAMP reagent used, and that the nucleic acids recovered from this nucleic acid recovery material are compatible with various LAMP amplification reagents, including commercially available ones.

[0050] Example 4 In Example 1, low-melting-point agarose (Agarose XP (Nippon Gene Co., Ltd.)) was used as the gelling agent instead of agarose, and SrHAP was used as the nucleic acid adsorbent instead of HAP. Furthermore, the heating temperature after adding the λ phage DNA was set to 70°C and 98°C. A λ phage DNA-SrHAP complex was obtained in the same manner as in Example 1. Next, λ phage DNA was amplified using a WarmStart Colorimetric LAMP (New England BioLabs) with 5 μL of the DNA-SrHAP suspension as a template. A SrHAP suspension obtained using distilled water instead of λ phage DNA was used as a negative control, and the LAMP procedure was performed in the same manner. Figure 5 shows the results of observing the tubes after the reaction under visible light. It was found that gene amplification is possible even when the gelling agent is low-melting-point agarose and the nucleic acid adsorbent is SrHAP. Furthermore, it was found that gene amplification is possible when the heating temperature during the reaction between DNA and the nucleic acid adsorbent is 70°C, similar to the case at 98°C.

[0051] Example 5 Generally, TE solutions are used to stably preserve nucleic acids. In previous examples, agarose was dissolved in water to prepare a nucleic acid adsorbent-solid-phase tube. However, by using a TE solution (Tris-HCl (pH 9.0), EDTA; Nippon Gene Co., Ltd.) instead of water, the pH of the sample after heating to dissolve the gel is maintained at a neutral to slightly alkaline level, which is expected to stabilize the nucleic acids. Furthermore, since complex formation between DNA and nucleic acid adsorbents is difficult under acidic conditions, it is desirable to maintain the pH of the sample at a neutral to slightly alkaline level for this reason as well. In addition, by inactivating nucleases with EDTA, nucleic acid degradation is prevented, and further stabilization of nucleic acids is expected. In the process of extracting nucleic acids from cells, destroying cells at high temperatures and diffusing the nucleic acids into a solution increases the risk of nucleic acid degradation in the solution. Therefore, it is desirable to use a nucleic acid adsorbent solid-phase gel containing a chelating agent that is neutral to weakly alkaline for nucleic acid extraction from the sample. In this example, it was confirmed that nucleic acid amplification is possible in this case.

[0052] In Example 1, a HAP-immobilized tube was used, except that a TE solution (0.9 M Tris-HCl pH 9.0, 0.5 M EDTA) was used instead of distilled water to obtain a final concentration of 1.5% by mass. Using this HAP-immobilized tube, a heating procedure was performed in the same manner as in Example 1 to obtain a λ phage DNA-HAP complex suspension. The pH of this suspension was checked with pH test paper, and the pH was found to be approximately 9, indicating weak alkalinity. λ phage DNA was amplified using a LAMP reagent (WarmStart Colorimetric LAMP (New England BioLabs)) with a 2 μL λ phage DNA-HAP suspension as a template. Furthermore, as a positive control, a λ phage DNA-HAP complex suspension was obtained using a HAP-immobilized tube containing an agarose gel prepared with distilled water, similar to Example 1, and the same LAMP procedure as described above was performed. The results are shown in Figure 6. When agarose gels were prepared using TE solution, the reaction solution turned yellow after the reaction, similar to the case when prepared with distilled water, confirming that DNA amplification had occurred. In other words, it was found that the TE solution used for gel preparation did not affect the compounding of nucleic acids and nucleic acid adsorbents, nor the nucleic acid amplification by the LAMP method.

[0053] Example 6 In Example 1, a λ phage DNA-HAP complex suspension was obtained in the same manner as in Example 1, except that α-type tricalcium phosphate (α-TCP-A, average particle size 8-15 μm), α-type tricalcium phosphate (α-TCP-B, average particle size 3-8 μm), and β-type tricalcium phosphate (β-TCP-100) were used as nucleic acid adsorbents instead of HAP. Then, the λ phage DNA was amplified in the same manner as in Example 1. Furthermore, the LAMP method was performed using a SrHAP suspension obtained by using distilled water instead of λ phage DNA as a negative control. Figure 7 shows the results of observing each reaction tube after the reaction under an ultraviolet lamp. λ phage DNA could be detected in all cases where tricalcium phosphate was used as the nucleic acid adsorbent.

[0054] The nucleic acid amplification method using the nucleic acid recovery material of the present invention is based on the same principle as the nucleic acid amplification method of Japanese Patent No. 7446576 (Patent Document 3), in which nucleic acids are brought into contact with a compound (nucleic acid adsorbent) which is an alkaline earth metal phosphate and / or carbonate and has a solubility in water of 1 g / 100 g H2O or less, to form a complex, and then subjected to a nucleic acid amplification reaction. Therefore, if a nucleic acid recovery material containing a nucleic acid adsorbent, in which nucleic acid amplification was confirmed in the examples of Japanese Patent No. 7446576, is used, nucleic acid amplification can be similarly confirmed in the present invention. The nucleic acid adsorbents for which nucleic acid amplification was confirmed in the examples of Japanese Patent No. 7446576 are strontium carbonate apatite (SrCAP), strontium fluoride apatite (SrFAP), strontium hydrogen phosphate (β-SrHPO4), barium fluoride apatite (BaFAP), low-crystallinity magnesium-substituted strontium apatite (L-SrMgP), strontium / barium (2:8) apatite compounds (SrBa:2 / 8), SrHAP, and HAP. [Industrial applicability]

[0055] The nucleic acid recovery material of the present invention is easy to handle and allows for the convenient extraction of nucleic acids from a sample for use in nucleic acid amplification reactions, thus possessing high practical value.

Claims

1. Alkaline earth metal phosphates and / or carbonates with a solubility in water of 1 g / 100 g H 2 A nucleic acid recovery material comprising a gel containing a compound with a concentration of 0 or less, housed in a container.

2. The nucleic acid recovery material according to claim 1, wherein the gelling agent concentration in the gel is 0.2 to 70% by mass.

3. Alkaline earth metal phosphates and / or carbonates with a solubility in water of 1 g / 100 g H 2 The nucleic acid recovery material according to claim 1 or 2, wherein the ratio of the amount of compound with a concentration of 0 or less to the amount of gel is 0.01 ng / mL to 10000 mg / mL.

4. Alkaline earth metal phosphates and / or carbonates with a solubility in water of 1 g / 100 g H 2 The nucleic acid recovery material according to claim 1 or 2, wherein the volume-average particle size of the compound having a concentration of 0 or less is 1 nm to 1000 μm.

5. The nucleic acid recovery material according to claim 1 or 2, wherein the gel comprises a gelling agent and water or an aqueous solution with a pH of 5 to 9.

6. A method for recovering and amplifying nucleic acids in a sample using the nucleic acid recovery material described in claim 1 or 2, wherein the recovery material is an alkaline earth metal phosphate and / or carbonate with a solubility in water of 1 g / 100 g H 2 A nucleic acid amplification method comprising the steps of: placing a sample containing nucleic acid into a container containing a gel containing a compound with a concentration of 0 or less; heating the resulting mixture to form a complex between the nucleic acid in the sample and this compound; recovering the complex from the mixture; and adding the complex to a nucleic acid amplification solution to carry out a nucleic acid amplification reaction.

7. Nucleic acids in the sample and alkaline earth metal phosphates and / or carbonates with a solubility in water of 1 g / 100 g H 2 The nucleic acid amplification method according to claim 6, wherein the heating temperature in the step of forming a complex with a compound that is 0 or less is 40 to 200°C.

8. The nucleic acid amplification method according to claim 6, wherein the nucleic acid amplification reaction is carried out at a temperature of 45°C or higher.

9. A nucleic acid amplification kit comprising the nucleic acid recovery material according to claim 1 or 2.

Images