AAV-mediated targeting of miRNAs in the treatment of X-linked disorders

AAV vectors with microRNA sponge cassettes target and inhibit miRNAs to reactivate X-linked genes, addressing the challenge of silenced genes in Rett syndrome, enhancing gene expression and symptom relief.

JP2026086508APending Publication Date: 2026-05-26RES INST AT NATIONWIDE CHILDRENS HOSPITAL +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
RES INST AT NATIONWIDE CHILDRENS HOSPITAL
Filing Date
2026-01-29
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

Current treatments for X-linked disorders such as Rett syndrome, caused by X-linked loss-of-function mutations, particularly in the MECP2 gene, are inadequate in effectively reactivating the silenced wild-type gene on the inactivated X chromosome.

Method used

A novel gene therapy approach using adeno-associated virus (AAV) vectors carrying microRNA sponge cassettes that target and inhibit specific miRNAs, such as miR106a, to reactivate the expression of X-linked genes like MECP2 by binding and inhibiting these miRNAs, thereby restoring gene function.

Benefits of technology

The approach effectively reactivates X-linked gene expression, improving symptoms and potentially extending lifespan in Rett syndrome models by administering a therapeutically effective dose of rAAV particles, demonstrating improved neuronal function and behavioral outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026086508000005
    Figure 2026086508000005
  • Figure 2026086508000006
    Figure 2026086508000006
  • Figure 2026086508000007
    Figure 2026086508000007
Patent Text Reader

Abstract

Providing AAV-mediated targeting of miRNAs in the treatment of X-linked disorders. [Solution] This disclosure relates to the targeting of miRNAs to activate the expression of genes on an inactivated X chromosome. This gene therapy is useful for treating X-linked disorders, including Rett syndrome. This disclosure provides a novel gene therapy approach for treating X-linked disorders, such as Rett syndrome, which is caused by X-linked loss-of-function mutations. Polynucleotides and gene therapy vectors targeting one or more miRNAs known to inactivate one or more genes on the X chromosome are provided herein. The polynucleotides and vectors disclosed herein are designed to inhibit miRNAs and thereby reactivate the wild-type gene of interest on the X chromosome that has been inactivated.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Cross-referencing of related applications and electronically submitted materials for incorporation. This application claims priority to U.S. Provisional Patent Application No. 62 / 978,285, filed on 18 February 2020, which is incorporated in its entirety by reference.

[0002] This application includes, as a separate part of the disclosure, a computer-readable sequence listing (filename: 54983_SeqListing.txt, 36950 bytes, ASCII text file, created on 18 February 2021) which is incorporated herein by reference in its entirety.

[0003] This disclosure relates to the targeting of miRNAs to activate the expression of genes on an inactivated X chromosome. This gene therapy is useful for treating X-linked disorders, including Rett syndrome. [Background technology]

[0004] Rett syndrome (RTT) is an X-linked neurodevelopmental disorder that affects approximately 1 in 10,000 girls. Patients exhibit a vast range of variation and heterogeneity of the disease. The onset of symptoms is typically characterized by the loss of previously achieved developmental milestones between 6 and 18 months of age, accompanied by a progressive loss of motor and cognitive functions. Approximately 15,000 girls and women in the United States and 350,000 individuals worldwide are affected by RTT. Girls with RTT may experience a variety of problems, including motor problems (apraxia, rigidity, dyskinesia, dystonia, tremor), seizures, gastrointestinal problems (reflux, constipation), orthopedic problems (contractures, scoliosis, hip problems), autonomic problems (irregular breathing, cardiac problems, swallowing), as well as sleep problems and anxiety.

[0005] Almost all RTT cases are caused by de novo loss-of-function mutations in the X-linked methyl-CpG-binding protein 2 (MECP2) gene. Most RTT patients are females who are heterozygous for MECP2 deficiency, with random X chromosome inactivation resulting in approximately 50% of cells expressing the mutant MECP2 gene and the other 50% expressing wild-type MECP2.

[0006] In males, the symptoms of Rett syndrome are usually too severe to be viable. The disease phenotype in females is less severe due to the presence of a second X chromosome that does not carry a mutation in the MECP2 gene or another X-linked gene. During development, each cell randomly inactivates one of the two X chromosomes in females. Thus, females contain a mixture of cells that express either a healthy copy or a mutated copy of the MECP2 gene, depending on the inactivated X chromosome.

[0007] RNA interference (RNAi) is a gene regulatory mechanism in eukaryotic cells that has been studied for the treatment of various diseases. RNAi refers to the post-transcriptional regulation of gene expression mediated by microRNAs (miRNAs). Native miRNAs are small (21-25 nucleotides), non-coding RNAs that share sequence homology and base pairs with the 3' untranslated region of their congeneral messenger RNA (mRNA), although regulation in the coding region may also occur. The interaction between miRNA and mRNA directs cellular gene silencing mechanisms to degrade the target mRNA and / or prevent its translation. The RNAi pathway is summarized in Duan (Ed.), Chapter 7, Section 7.3 of Muscle Gene Therapy, Springer Science+Business Media, LLC (2010).

[0008] Adeno-associated virus (AAV) is a replication-deficient parvovirus whose single-stranded DNA genome is approximately 4.7 kb long and contains two 145-nucleotide inverted terminal repeats (ITRs). Multiple serotypes of AAV exist. The nucleotide sequences of the AAV serotype genomes are known. For example, the complete genome of AAV-1 is available under GenBank acceptance number NC_002077, the complete genome of AAV-2 is available under GenBank acceptance number NC_001401 and Srivastava et al., J. Virol., 45:555-564 (1983), the complete genome of AAV-3 is available under GenBank acceptance number NC_1829, the complete genome of AAV-4 is available under GenBank acceptance number NC_001829, the genome of AAV-5 is available under GenBank acceptance number AF085716, the complete genome of AAV-6 is available under GenBank acceptance number NC_001862, at least portions of the genomes of AAV-7 and AAV-8 are available under GenBank acceptance numbers AX753246 and AX753249, respectively, and the genome of AAV-9 is available under Gao et al. The AAV-10 genome is available in al., J. Virol., 78:6381-6388 (2004), the AAV-11 genome is available in Mol. Ther., 13(1):67-76 (2006), and the AAV-11 genome is available in Virology, 330(2):375-383 (2004). Cloning of the AAVrh.74 serotype is described in Rodino-Klapac., et al. Journal of Translational Medicine 5, 45 (2007). Isolation of the AAV-B1 serotype is described in Choudhury et al., Mol. Therap. 24(7):1247-57, 2016. The Cis action sequence, which directs viral DNA replication (rep), capsid formation / packaging, and host cell chromosome integration, is contained within the AAV ITR. Three AAV promoters (named p5, p19, and p40 relative to their relative map locations) promote the expression of two AAV internal open reading frames that encode rep and cap genes.Two rep promoters (p5 and p19), coupled with differential splicing of a single AAV intron (at nucleotides 2107 and 2227), produce four rep proteins (rep78, rep68, rep52, and rep40) from the rep gene. The rep proteins possess multiple enzymatic properties that ultimately contribute to the replication of the viral genome. The cap gene, expressed from the p40 promoter, encodes three capsid proteins: VP1, VP2, and VP3. Alternative splicing and non-consensus translation initiation sites are involved in the production of the three associated capsid proteins. A single-consensus polyadenylation site is located at map position 95 of the AAV genome. The life cycle and genetics of AAV are outlined in Muzyczka, Current Topics in Microbiology and Immunology, 158:97-129 (1992).

[0009] AAV possesses unique characteristics that make it attractive as a vector for delivering foreign DNA to cells, for example, in gene therapy. AAV infection of cells in culture is non-cellular, and natural infections in humans and other animals are silent and asymptomatic. Furthermore, AAV infects many mammalian cells and allows for the potential to target many different tissues in vivo. Additionally, AAV can transduce slow-dividing and non-dividing cells and persist essentially for the lifetime of those cells as a transcriptionally active nuclear episome (extrachromosomal element). The AAV proviral genome is inserted as cloned DNA within a plasmid, enabling the construction of a recombinant genome. Furthermore, since signals directing AAV replication and genomic capsid formation are contained within the ITR of the AAV genome, some or all of the internal approximately 4.3 kb of genome (rep-cap, encoding replication and structural capsid proteins) may be replaced with foreign DNA. To generate an AAV vector, the rep and cap proteins can be supplied trans. Another important characteristic of AAV is that it is an extremely stable and robust virus. This makes it easy to withstand the conditions used to inactivate adenoviruses (56°C to 65°C for several hours), reducing the importance of chilling AAV. AAV can be freeze-dried. Finally, AAV-infected cells do not show resistance to co-infection. There is a need to develop therapeutic approaches to treat X-linked disorders such as Rett syndrome. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Gao et al., J. Virol., 78:6381-6388 (2004) [Non-Patent Document 2] Rodino-Klapac.,et al.Journal of Translational Medicine 5,45(2007) [Non-Patent Document 3] Choudhury et al.,Mol.Therap.24(7):1247-57,2016 [Overview of the project] [Means for solving the problem]

[0011] This disclosure provides novel gene therapy approaches for treating X-linked disorders, such as Rett syndrome, caused by X-linked loss-of-function mutations. Polynucleotides and gene therapy vectors targeting one or more miRNAs known to inactivate one or more genes on the X chromosome are provided herein. The polynucleotides and vectors disclosed herein are designed to inhibit miRNAs and thereby reactivate the wild-type gene of interest on the X chromosome that has been inactivated.

[0012] In various embodiments, the disclosure provides polynucleotides and vectors comprising a microRNA sponge cassette, the microRNA sponge cassette comprising one or more nucleotide sequences targeting one or more miRNAs of interest. Targeting the miRNAs of interest by the sponge results in binding and inactivation of the miRNAs of interest, inhibition of the expression of the miRNAs of interest, and / or increased expression and / or activity of genes associated with X-linked disorders (X-linked genes).

[0013] As used herein, “target” means binding to, interacting with, or hybridizing with the miRNA of interest. “Targeting” the miRNA of interest means causing, inducing, or inhibiting the degradation of the miRNA of interest.

[0014] In various embodiments, the polynucleotide comprises one or more nucleotide sequences targeting the microRNA of interest, which are tandem multiplexes of sequences that are fully or partially complementary to the microRNA of interest. In various embodiments, the nucleotide comprises one or more nucleotide sequences targeting the microRNA of interest, which are at least 85% complementary to the sequence of the mature microRNA of interest, at least 90% complementary to the sequence of the mature microRNA of interest, at least 95% complementary to the sequence of the mature microRNA of interest, at least 96% complementary to the sequence of the mature microRNA of interest, at least 97% complementary to the sequence of the mature microRNA of interest, at least 98% complementary to the sequence of the mature microRNA of interest, or at least 99% complementary to the sequence of the mature microRNA of interest.

[0015] The disclosure also provides polynucleotides comprising a microRNA sponge cassette comprising at least two nucleotide sequences targeting one or more miRNAs of interest, at least three nucleotide sequences targeting one or more miRNAs of interest, at least four nucleotide sequences targeting one or more miRNAs of interest, or at least two nucleotide sequences targeting one or more miRNAs of interest. In relevant embodiments, the microRNA sponge cassette comprises 2, 4, 6, or 8 repeats of the nucleotide sequence targeting the microRNA of interest. In some embodiments, the sponge sequence is reverse-oriented and therefore the sponge sequence is on the complementary strand of the cassette.

[0016] In various embodiments, the present disclosure provides a polynucleotide comprising a microRNA sponge cassette, the microRNA sponge cassette comprising one or more nucleotide sequences targeting miR106a. For example, the polynucleotide comprises a nucleotide sequence targeting a miRNA of interest, which comprises any one of the nucleotide sequences of SEQ ID NO: 1 or 2. In various embodiments, the polynucleotide comprises a microRNA sponge cassette comprising the nucleotide sequence of SEQ ID NO: 3, 4, 5, 6, 7, or 8. In various embodiments, the sponge cassette sequence is the RNA sequence of SEQ ID NO: 3, 5, or 7, or the DNA sequence of SEQ ID NO: 4, 6, or 8. The present disclosure also provides a polynucleotide comprising two or more microRNA sponge cassettes, for example, a polynucleotide comprising two microRNA sponge cassettes, three microRNA sponge cassettes, four microRNA sponge cassettes, or five microRNA sponge cassettes. These microRNA sponge cassettes may target the same microRNA or different microRNAs.

[0017] The present disclosure also provides recombinant AAV (rAAV) having a genome comprising any of the polynucleotide sequences disclosed herein. In various embodiments, the rAAV genome comprises a U6 promoter. In alternative embodiments, the rAAV genome comprises an H1 promoter, 7SK, or other polymerase III promoter. In any of these embodiments, the promoter is in reverse orientation, and thus the U6 promoter is on the complementary strand of the genome. In various embodiments, the rAAV genome further comprises a stuffer sequence. As used herein, a "stuffer sequence" refers to a variable-length non-coding nucleotide sequence included in a vector (e.g., rAAV) to maintain an optimal packaging length of the vector construct. For example, rAAV further comprises a stuffer sequence comprising the nucleotide sequence of SEQ ID NO: 11. In various embodiments, the rAAV genome comprises nucleotides 980-3131 of the nucleotide sequence of SEQ ID NO: 21. In other embodiments, the rAAV genome comprises nucleotides 980-2962 of the nucleotide sequence of SEQ ID NO: 22. In various embodiments, the vector is a serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVRH74, AAV11, AAV12, AAV13, Anc80, or AAV7m8, or a derivative thereof.

[0018] The present disclosure provides rAAV particles comprising any of the rAAV disclosed herein. The present disclosure also provides a composition comprising any of the polynucleotides, rAAV, or rAAV particles disclosed herein.

[0019] The present disclosure provides a method of treating Rett syndrome comprising administering a therapeutically effective amount of any one of the rAAV disclosed herein. The present disclosure also provides the use of any one of the rAAV disclosed herein for the preparation of a medicament for treating Rett syndrome in a therapeutically effective amount. The present disclosure also provides a composition for treating Rett syndrome comprising any of the polynucleotides, rAAV, or rAAV particles disclosed herein.

[0020] This disclosure provides a method for activating the expression of an X-linked gene, comprising administering a therapeutically effective dose of any one of the rAAVs disclosed herein. This disclosure also provides the use of any one of the rAAVs disclosed herein for the preparation of a therapeutically effective dose of a drug for activating the expression of an X-linked gene. This disclosure also provides compositions for activating the expression of an X-linked gene, comprising any of the polynucleotides, rAAVs, or rAAV particles disclosed herein. In various embodiments, the X-linked gene is methyl CpG-binding protein 2 (MECP2).

[0021] This disclosure provides a method for treating X-linked disorders, comprising administering a therapeutically effective dose of any one of the rAAVs disclosed herein for the treatment of X-linked disorders. This disclosure also provides the use of any one of the rAAVs disclosed herein for the preparation of a therapeutically effective dose of an rAAV for treating X-linked disorders. In relevant embodiments, X-linked disorders include Rett syndrome, hemophilia A, hemophilia B, Dent's disease 1, Dent's disease 2, DDX3X syndrome, albinism-hearing syndrome, Aldrich syndrome, Alport syndrome, anemia (hereditary hypochromic), anemia (sideoblastic with ataxia), cataract, Charcot-Marie-Tooth, color blindness, diabetes insipidus, nephrogenic diabetes, congenital keratosis, ectodermal dysplasia, facogenital dysplasia, Fabry disease, glucose-6-phosphate dehydrogenase deficiency, glycogenital storage disease type VIII, gonadal dysplasia, testicular feminization syndrome, Addison's disease with cerebral sclerosis, Adrenal hypoplasia, granulomatosis, Sidelius X-linked intellectual disability, Bruton type agammaglobulinemia, choroidal retinal degeneration, choroidemia, albinism (eye), fragile X syndrome, epileptic encephalopathy (early infant 2), hydrocephalus (aqueductal stenosis), hypophosphatemic rickets, Lesch-Nyhan syndrome (hypoxanthine-guanine-phosphoribosyltransferase deficiency), incontinentia pigmenti, Kallmann syndrome, paroxysmal nocturnal hemoglobinuria, spinal muscular atrophy 2, spastic paraplegia, keratosis follicularis These include follicularis spinulosa, Lowe's (oculobrain-kidney) syndrome, Menkes syndrome, Renpenning syndrome, intellectual disability, Coffin-Lowry syndrome, microphthalmia (Lenz syndrome), muscular dystrophy (Becker type, Duchenne type, Emery-Dreyfus type), myotubular myopathy, night blindness, Norie's disease (pseudoglioma), nystagmus, orofacial-finger syndrome, ornithine transcarbamylase deficiency (type I hyperammonemia), phosphoglycerate kinase deficiency, phosphoribosyl pyrophosphate synthase deficiency, retinitis pigmentosa, retinoschisis, muscular atrophy / dihydrotestosterone receptor deficiency, spinal muscular atrophy, late-onset spondyloepiphyseal dysplasia, thrombocytopenia, thyroxine-binding globulin, and Macleod syndrome.

[0022] Other features and advantages of this disclosure will become apparent from the following detailed description. However, while the detailed description and specific examples illustrate preferred embodiments of this disclosure, various changes and modifications that are in the spirit and scope of this disclosure will become apparent to those skilled in the art from this detailed description and should be understood to be given only as examples. In certain embodiments, for example, the following are provided: (Item 1) A polynucleotide comprising a microRNA sponge cassette, wherein the microRNA sponge cassette comprises one or more nucleotide sequences that target one or more miRNAs of interest. (Item 2) The polynucleotide according to item 1, wherein one or more nucleotide sequences targeting the microRNA of the objective are a tandem multiplex of sequences that are completely or imperfectly complementary to the microRNA of the objective. (Item 3) One or more nucleotide sequences targeting the target microRNA are at least 85% complementary to the mature microRNA of the target sequence, at least 90% complementary to the mature microRNA of the target sequence, and at least 95% complementary to the mature microRNA of the target sequence. A polynucleotide as described in item 1, which is complementary, at least 96% complementary to the mature microRNA of the target sequence, at least 97% complementary to the mature microRNA of the target sequence, at least 98% complementary to the mature microRNA of the target sequence, or at least 99% complementary to the mature microRNA of the target sequence. (Item 4) The polynucleotide according to any one of items 1 to 3, wherein the microRNA sponge cassette comprises at least two nucleotide sequences targeting one or more miRNAs of interest, at least three nucleotide sequences targeting one or more miRNAs of interest, at least four nucleotide sequences targeting one or more miRNAs of interest, or at least two nucleotide sequences targeting one or more miRNAs of interest. (Item 5) The polynucleotide described in any one of items 1 to 4, wherein the microRNA sponge cassette contains 2, 4, 6, or 8 repeats of a nucleotide sequence targeting the microRNA of interest. (Item 6) The polynucleotide described in any one of items 1 to 5, wherein the microRNA sponge cassette contains one or more nucleotide sequences targeting miR106a. (Item 7) The polynucleotide according to any one of items 1 to 6, wherein the nucleotide sequence targeting the target miRNA includes the nucleotide sequence of SEQ ID NO: 1 or 2. (Item 8) The polynucleotide described in any one of items 1 to 7, wherein the microRNA sponge cassette comprises the nucleotide sequence of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8. (Item 9) Recombinant AAV (rAAV) having a genome containing a polynucleotide sequence described in any one of items 1 to 11. (Item 10) The genome described above contains a U6 or H1 promoter, as described in item 9 of the rAAV. (Item 11) The rAAV described in item 9 or 10, wherein the genome further comprises a stuffer sequence. (Item 12) The rAAV described in item 11, wherein the stuffer sequence includes the nucleotide sequence of sequence number 11. (Item 13) The rAAV described in any one of items 9 to 12, wherein the genome contains nucleotides 980 to 3131 of the nucleotide sequence of SEQ ID NO: 21. (Item 14) The rAAV described in any one of items 9 to 13, wherein the vector is serotype AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAVRH10, AAVRH74, AAV11, AAV12, AAV13, Anc80, or AAV7m8, or a derivative thereof. (Item 15) rAAV particles containing any one of the rAAVs described in items 9-14. (Item 16) A composition comprising a polynucleotide as described in any one of items 1 to 8, an rAAV as described in any one of items 9 to 14, or an rAAV particle as described in item 15. (Item 17) rAAV as described in any one of items 9-14 for the therapeutic effective dose, and rAA as described in item 15. A method for treating Rett syndrome, comprising administering V particles or the compositions described in item 16. (Item 18) A method for activating the expression of an X-linked gene, comprising administering a therapeutically effective dose of rAAV as described in any one of items 9 to 14, rAAV particles as described in item 15, or a composition as described in item 16. (Item 19) The method according to item 18, wherein the X-linked gene is methyl CpG-binding protein 2 (MECP2). (Item 20) A method for treating X-linked disorder, comprising administering a therapeutically effective amount of rAAV as described in any one of items 9 to 14, rAAV particles as described in item 15, or a composition as described in item 16. (Item 21) The aforementioned X-linked disorders include Rett syndrome, hemophilia A, hemophilia B, Dent's disease 1, Dent's disease 2, DDX3X syndrome, albinism-hearing syndrome, Aldrich syndrome, Alport syndrome, anemia (hereditary hypochromic), anemia (sideoblastic with ataxia), cataracts, Charcot-Marie-Tooth syndrome, color blindness, diabetes mellitus (diabetes insipidus, nephrogenic), congenital keratosis, ectodermal dysplasia, facogenital dysplasia, Fabry disease, glucose-6-phosphate dehydrogenase deficiency, glycogenital disease type VIII, gonadal dysplasia, testicular feminization syndrome, Addison's disease with encephalosclerosis, and adrenal hypoplasia. Degenerative diseases, granulomatous diseases, Siderius X-linked intellectual disability syndrome, Bruton type agammaglobulinemia, choroidal retinal degeneration, choroidemia, albinism (eyes), fragile X syndrome, epileptic encephalopathy (early infants 2), hydrocephalus (aqueductal stenosis), hypophosphatemic rickets, Lesch-Nyhan syndrome (hypoxanthine-guanine-phosphoribosyltransferase deficiency), incontinentia pigmenti, Kallmann syndrome, paroxysmal nocturnal hemoglobinuria, spinal muscular atrophy 2, spastic paraplegia, keratosis follicularis follicularis spinulosa), Lowe's (oculobrain-kidney) syndrome, Menkes syndrome, Renpenning syndrome, intellectual disability, Coffin-Lowry syndrome, microphthalmia (Lenz syndrome), muscular dystrophy (Becker type, Duchenne type, Emery-Dreyfus type), myotubular myopathy, night blindness, Norie's disease (pseudoglioma), nystagmus, orofacial-finger syndrome, ornithine transcarbamylase deficiency (type I hyperammonemia), phosphoglycerate kinase deficiency, phosphoribosyl pyrophosphate synthase deficiency, retinitis pigmentosa, retinoschisis, muscular atrophy / dihydrotestosterone receptor deficiency, spinal muscular atrophy, late-onset spondyloepiphysis dysplasia, thrombocytopenia, thyroxine-binding globulin, and MacLeod syndrome, as described in item 20. (Item 22) Use of a therapeutically effective amount of rAAV as described in any one of items 9 to 14, rAAV particles as described in item 15, or a composition as described in item 16, for the preparation of a drug for treating Rett syndrome. (Item 23) Use of a therapeutically effective amount of rAAV as described in any one of items 9-14, rAAV particles as described in item 15, or a composition as described in item 16, for the preparation of a drug to activate the expression of an X-linked gene. (Item 24) The use described in item 23, wherein the X-linked gene is methyl CpG-binding protein 2 (MECP2). (Item 25) Use of a therapeutically effective amount of rAAV as described in any one of items 9-14, rAAV particles as described in item 15, or a composition as described in item 16, for the preparation of a drug for the treatment of X-linked disorders. (Item 26) The aforementioned X-linked disorders include Rett syndrome, hemophilia A, hemophilia B, Dent's disease 1, Dent's disease 2, DDX3X syndrome, albinism-hearing syndrome, Aldrich syndrome, Alport syndrome, anemia (hereditary hypochromic), anemia (sideoblastic with ataxia), cataracts, Charcot-Marie-Tooth syndrome, color blindness, diabetes mellitus (diabetes insipidus, nephrogenic), congenital keratosis, ectodermal dysplasia, genitourinary dysplasia, Fabry disease, and glucose-6-phosphate. Dehydrogenase deficiency, glycogen storage disease type VIII, gonadal dysplasia, testicular feminization syndrome, Addison's disease with encephalosclerosis, adrenal hypoplasia, granulomatosis, Sidelius X-linked intellectual disability, Bruton type agammaglobulinemia, choroidal retinal degeneration, choroidemia, albinism (eye), fragile X syndrome, epileptic encephalopathy (early infant 2), hydrocephalus (aqueductal stenosis), hypophosphatemic rickets, Lesch-Nyhan syndrome (hypoxanthine-guanine- Phospholiposyltransferase deficiency, incontinentia pigmenti, Kallmann syndrome, paroxysmal nocturnal hemoglobinuria, spinal muscular atrophy 2, spastic paraplegia, follicular keratosis, Lowe's syndrome (oculo-brain-kidney), Menkes syndrome, Rempening syndrome, intellectual disability, Coffin-Lowry syndrome, microphthalmia (Lenz syndrome), muscular dystrophy (Becker type, Duchenne type, Emery-Dreyfus type), myotubular myopathy, night blindness, Norie's disease (Pseudoglioma), nystagmus, orofacial finger syndrome, ornithine transcarbamylase deficiency (type I hyperammonemia), phosphoglycerate kinase deficiency, phosphoribosyl pyrophosphate synthase deficiency, retinitis pigmentosa, retinoschisis, muscular atrophy / dihydrotestosterone receptor deficiency, spinal muscular atrophy, late-onset spondyloepic dysplasia, thrombocytopenia, thyroxine-binding globulin, and MacLeod syndrome are used as described in item 25. (Item 27) A composition for treating Rett syndrome, comprising a therapeutically effective amount of rAAV as described in any one of items 9 to 14, rAAV particles as described in item 15, or a composition as described in item 16. (Item 28) A composition comprising a therapeutically effective amount of rAAV as described in any one of items 9 to 14, rAAV particles as described in item 15, or the composition as described in item 16, for activating the expression of an X-linked gene. (Item 29) The composition according to item 28, wherein the X-linked gene is methyl CpG-binding protein 2 (MECP2). (Item 30) A composition comprising a therapeutically effective amount of rAAV as described in any one of items 9 to 14, rAAV particles as described in item 15, or a composition as described in item 16, for the treatment of X-linked disorders. (Item 31) The aforementioned X-linked disorders include Rett syndrome, hemophilia A, hemophilia B, Dent's disease 1, Dent's disease 2, DDX3X syndrome, albinism-hearing syndrome, Aldrich syndrome, Alport syndrome, anemia (hereditary hypochromic), anemia (sideroblastic with ataxia), cataracts, Charcot-Marie-Tooth syndrome, color blindness, diabetes mellitus (diabetes insipidus, nephrogenic), congenital keratosis, ectodermal dysplasia, facogenital dysplasia, Fabry disease, glucose-6-phosphate dehydrogenase deficiency, glycogen storage disease type VIII, gonadal dysplasia, testicular feminization syndrome, Addison's disease with encephalosclerosis, adrenal hypoplasia, granulomatosis, Sidelius X-linked intellectual disability, agammaglobulinemia Bruton type, choroidal retinal degeneration, choroidemia, albinism ( Ocular, Fragile X syndrome, Epileptic encephalopathy (early infant 2), Hydrocephalus (Cerebral aqueduct stenosis), Hypophosphatemic rickets, Lesch-Nyhan syndrome (Hypoxanthine-guanine-phosphoribosyltransferase deficiency), Incontinentia pigmenti, Kallmann syndrome, Paroxysmal nocturnal hemoglobinuria, Spinal muscular atrophy 2, Spastic paraplegia, Spinous follicular keratosis, Lowe (ophthalmoencephalorrhea-renal) syndrome, Menkes syndrome, Rempening syndrome, Intellectual disability, Coffin-Lowry syndrome, Microphthalmia (Lenz syndrome), Muscular dystrophy (Becker type, Duchenne type, Emery-Dreyfus type), Myotubular myopathy, Night blindness, Norie's disease (pseudoglioma), Nystagmus, Orofacial finger syndrome, Ornithine transcarbamylase deficiency (Type I) The composition described in item 30, which is hyperammonemia, phosphoglycerate kinase deficiency, phosphoribosyl pyrophosphate synthase deficiency, retinitis pigmentosa, retinoschisis, muscular atrophy / dihydrotestosterone receptor deficiency, spinal muscular atrophy, late-onset spondyloepic dysplasia, thrombocytopenia, thyroxine-binding globulin, or Macleod syndrome. [Brief explanation of the drawing]

[0023] [Figure 1A] (Figure 1A) General schematic diagram of the CRISPR / Cas9 genome widescreen. BMSL2 cells stably expressing Cas9 were transduced with the lentiCRISPRv2 library at an MOI of 0.2. After puromycin selection, cells expressing Xi-Hprt were enriched in HAT selection medium. (Figure 1B) qRT-PCR of HPrt and MECP2 in BMSL2 cells expressing sgRNA for the shown miRNAs. Results were normalized to control (NS). (Figure 1C) Allele-specific Taqman analysis of MECP2 in RTT treated with control or miR106i and wild-type (WT) neurons. Error bars, SD;*, p<0.01. Relative expression levels of miR106a in cortical, spleen, liver, and lung tissues for both male and female mice are shown in Figure 1D. [Figure 1B] Same as above. [Figure 1C] Same as above. [Figure 1D] Same as above. [Figure 2A] This shows that miR106a inhibition reactivates known targets without affecting viability. (Figure 2A) qRT-PCR of PAK5 and Ankrd52 (Figure 2B) MTT assay of NS or cells treated with miR106 inhibitor or miR106a sgRNA. Black dotted line indicates seeding density on day 0. Error bars, SD. Figures 2C-2D show relative expression levels of MECP2 transcripts in Patski cells and Rett neurons in the presence and absence of miR106a inhibitor (Figure 2C) or miR106a SgRNA (Figure 2D). [Figure 2B] Same as above. [Figure 2C] Same as above. [Figure 2D] Same as above. [Figure 3A]This shows that miR106a interacts with RepA. (Figure 3A) Strategies for capturing the miR106a-RepA complex. (Figure 3B) Competitive elution of RepA from the miR106a-RepA complex using mismatched, fully complementary, or incompletely complementary oligonucleotides. (Figure 3C) qRT-PCR monitoring RepA in BMSL2 cells treated with miR106a mimetic. Chr14 is a negative control. Error bars, SD;*, p<0.01. [Figure 3B] Same as above. [Figure 3C] Same as above. [Figure 4A] This shows that miR106a does not regulate Xist transcription. (Figure 4A) ChIP monitoring PolII binding on Xist and the Gfp promoter in H4SV. (Figure 4B) qRT-PCR of Xist expression in H4SV treated with either a non-silencer (NS) or a miR106a inhibitor. (Figure 4C) qRT-PCR analysis of Xist in NS or miR106a-depleted H4SV after actinomycin D treatment. GAPDH was used as a normalization control. Error bars, SD. [Figure 4B] Same as above. [Figure 4C] Same as above. [Figure 5A] Representative images and quantifications of RNA FISH monitoring Xist in control or miR106i-treated cells. (Figure 5A) Quantification of Xist cloud area and Xist point staining using Image J (Figure 5B). Error bars, SD;*, p<0.01. Figures 5C and 5D show miR106a-RepA free energy (Figure 5C) and miR106a-RepA binding (Figure 5D). [Figure 5B] Same as above. [Figure 5C] Same as above. [Figure 5D] Same as above. [Figure 6] miRNA sponge inhibits miR106a. *Sea urchin activity in control or BMSL2 expressing miR106sp or miR106sp and miR106i. Error bars, SD;*, p<0.01. [Figure 7A] We demonstrate that loss of miR106a leads to MECP2 expression in RTT neurons, rescuing the phenotypic defect. (Figure 7A) Taqman analysis of MECP2 in control or LTV-miR106sp-treated RTT and wild-type (WT) neurons. (Figures 7B-C) Quantitative analysis of cell body area (Figure 7B) and number of neuronal branch points (Figure 7C) in control or LTV-miR106sp-treated MAP2+RTT neurons. Error bars, SD; *, p<0.01. [Figure 7B] Same as above. [Figure 7C] Same as above. [Figure 8A] This demonstrates that miR106a depletion rescues activity-dependent Ca2+ transients in RTT-neurons. (Figure 8A) Representative images acquired during Ca2+ imaging showing control RTT (NS), miR106sp-treated (miR106sp), and wild-type (WT) neurons. Color warmth corresponds to Ca2+ concentration. (Figure 8B) Ca2+ spikes (left) and neuronal signaling percentage (right) in NS, miR106sp, and WT neurons (n=100). Error bars, SD. *, p<0.01. [Figure 8B] Same as above. [Figure 9A] This study demonstrates that the Mir106a inhibitor induces Xi-linked MECP2 expression in primary mouse embryonic fibroblasts derived from the XistΔ:Mecp2 / Xist:Mecp2 mouse model. (Figure 9A) Schematic diagram of the reproductive strategy for generating XistΔ:Mecp2 / Xist:Mecp2. (Figure 9B) Quantitative analysis of GFP+ nuclei isolated from mouse brain cells by FACS analysis. (Figure 9C) RT-PCR analysis monitoring Mecp2-Gfp and Mecp2 expression in female XistΔ:Mecp2 / Xist:Mecp2-GfpMEF after treatment with control or mir106i. GAPDH was used as a loading control. [Figure 9B] Same as above. [Figure 9C] Same as above. [Figure 10A]This shows that AAV9-mir106sp induces Xi-linked MECP2 expression in the brains of XistΔ:Mecp2 / Xist:Mecp2-Gfp mice. (Figure 10A) Fluorescence analysis of brain cells in mice injected with AAV9-Gfp. (Figure 10B) Fluorescence analysis of Mecp2-Gfp expression in the brains of XistΔ:Mecp2 / Xist:Mecp2-Gfp mice injected with AAV9-control and AAV9-miR106sp. (Figure 10C) RT-PCR analysis monitoring Mecp2-Gfp and Mecp2 expression in female XistΔ:Mecp2 / Xist:Mecp2-Gfp mice after treatment with control (vehicle) or mir106sp. GAPDH was monitored as a loading control. [Figure 10B] Same as above. [Figure 10C] Same as above. [Figure 11A] The viral vector, the pAAV.miR106a sponge.stuffer.Kan map (Figure 11A), and the pAAV.miR106a sponge.stuffer.Kan vector sequence (Figure 11B) are shown. [Figure 11B-1] Same as above. [Figure 11B-2] Same as above. [Figure 12A] The viral vector, the pAAV.miR106a shRNA.stuffer.Kan map (Figure 12A), and the pAAV.miR106a shRNA.stuffer.Kan vector sequence (Figure 12B) are shown. [Figure 12B-1] Same as above. [Figure 12B-2] Same as above. [Figure 13A] Figure 13A shows the RNA sequence of mir106a sponge (sp1) design 1 having eight sponges (the sponge sequence is [SEQ ID NO: 7] (the sequence below), shown next to the mouse miR106a-5p target sequence [SEQ ID NO: 20]), mir106a sponge (sp1) design 2 (Figure 13B [SEQ ID NO: 3]), mir106a sponge (sp1) design 3 (Figure 13C [SEQ ID NO: 5]), and an exemplary shRNA sequence targeting miR106a (Figure 13D [SEQ ID NO: 15]). [Figure 13B] Same as above. [Figure 13C] Same as above. [Figure 13D] Same as above. [Figure 14A] This study demonstrates that AAV9-miR106sp rescues behavioral defects in female ΔCpG-RTT mice. (Figure 14A) Rotarod performance of female mice injected with AAV9-control (circles) and AAV9-miR106sp (squares) at weeks 4 and 7. Day 1 represents baseline performance, with a maximum time of 300 seconds (dashed line). (Figures 14B-D) Burns maze performance at week 7, plotted as mean latency (Figure 14B), mean speed (Figure 14C), and total distance traveled (Figure 14D) for female mice injected with AAV9-control (circles) and AAV9-miR106sp (squares). n=3. Error bars, SD. *, p<0.01. [Figure 14B] Same as above. [Figure 14C] Same as above. [Figure 14D] Same as above. [Figure 15A] This figure shows the survival, phenotypic scoring, and rotarod performance of 16-week-old AAV9.miR106sp-treated mice up to 250 days of age. (Figure 15A) The survival curves of AAV9-control (empty virus particle) treated mice versus healthy littermates (genetic control) and AAV9-miR106sp-treated mice show a strong improvement in survival with no deaths up to 250 days. (Figure 15B) A graph showing the improvement in phenotypic scoring of treated mice up to 21 weeks of age compared to AAV9-control treated mice. (Figure 15C) Rotarod performance of 16-week-old AAV9-miR106sp-treated mice compared to AAV9-control or untreated mice is presented as a heatmap (upper panel) for individual animals in each group, and the graph (lower panel) shows the dramatically improved ability to grip a spinning wheel, measured in seconds (p<0.0001), quantified. Error bars indicate SEM. [Figure 15B] Same as above. [Figure 15C] Same as above. [Modes for carrying out the invention]

[0024] This disclosure provides a novel gene therapy approach for treating X-linked disorders, such as Rett syndrome, caused by X-linked loss-of-function mutations. For example, Rett syndrome is an X-linked disorder that primarily affects females as a result of heterozygous loss-of-function mutations in the X-linked methyl CpG-binding protein 2 (MECP2) gene. The gene therapy approach disclosed herein utilizes the fact that each cell expressing a variant form of MeCP2 also contains a native backup copy of the gene on the inactivated X chromosome. Thus, reactivation of the silenced portion of the chromosome leads to the re-expression of the healthy gene.

[0025] Gene therapy vectors targeting miRNAs known to inactivate genes on the X chromosome are provided herein. The gene therapies disclosed herein are designed to inhibit miRNAs and thereby reactivate a wild-type gene of interest on an inactivated X chromosome. For example, miRNA106a is known to inactivate a portion of the X chromosome containing the MECP2 gene, and gene therapy methods targeting miRNA106a would reactivate gene expression in this cluster on the X chromosome.

[0026] microRNA MicroRNAs (miRNAs) are single-stranded RNAs of approximately 22 nucleotides that mediate gene silencing at the post-transcriptional level by pairing with bases within the 3' UTR of mRNA, inhibiting translation, or promoting mRNA degradation. A 7 bp seed sequence at the 5' end of a miRNA targets the miRNA, and additional recognition is provided by the remainder of the target sequence and its secondary structure.

[0027] miRNA sponge To achieve efficient miRNA inhibition in vivo, a loss-of-function miRNA "sponge" has been designed. In various embodiments, this disclosure provides a nucleic acid or nucleotide cassette that acts as a microRNA sponge to competitively inhibit one or more mature miRNAs in vivo. The miRNA sponge is a nucleotide sequence containing multiple target sites complementary to the miRNA of interest. These target sites are designed to bind to the miRNA of interest, thereby causing degradation of the targeted miRNA.

[0028] For example, microRNA sponges designed to target miRNA106a associated with Rett syndrome and / or other X-linked disorders are provided herein. Targeting miRNA106a with the sponge induces degradation of miRNA106a and thus interferes with miRNA106a-induced X-chromosome silencing, thereby reactivating a gene on the X chromosome, such as the MECP2 gene.

[0029] As used herein, “target miRNA” refers to one or more miRNAs (i.e., miRNAs targeted by the miRNA sponge) to which a microRNA sponge or small RNA binds and whose expression is inactivated or prevented. In various embodiments, the sponge may target multiple microRNAs of interest.

[0030] In various embodiments, the sponge cassette may comprise a tandem multiplex of fully or partially complementary nucleotide sequences that bind to a target miRNA to "absorb" any target miRNA. In relevant embodiments, the partially complementary nucleotide sequence targeting the target microRNA may result in a "bulge" of the sponge cassette. The "bulge" refers to the secondary nucleic acid structure that the sponge cassette can form.

[0031] A sponge cassette contains one or more sequences that target or bind to a target miRNA. A sponge cassette may contain multiple identical nucleic acid or nucleotide sequences targeting a single target miRNA, or it may contain multiple different sequences targeting a single target miRNA. Alternatively, a sponge cassette may contain multiple different nucleotide sequences targeting one or more target miRNAs.

[0032] In addition, the microRNA sponge cassette contains one or more nucleotide sequences that target the miRNA of interest. In various embodiments, the one or more nucleotide sequences that target the microRNA of interest are at least 85% complementary to the mature microRNA of interest, at least 90% complementary to the mature microRNA of interest, at least 95% complementary to the mature microRNA of interest, at least 96% complementary to the mature microRNA of interest, at least 97% complementary to the mature microRNA of interest, at least 98% complementary to the mature microRNA of interest, or at least 99% complementary to the mature microRNA of interest.

[0033] In various embodiments, the microRNA sponge cassette includes at least two nucleotide sequences targeting one or more target miRNAs, at least three nucleotide sequences targeting one or more target miRNAs, at least four nucleotide sequences targeting one or more target miRNAs, or at least two nucleotide sequences targeting one or more target miRNAs.

[0034] In various embodiments, the sponge cassette contains nucleotide sequences that bind to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different miRNAs of interest. In certain embodiments, the sponge cassette contains one or more nucleotide sequences that target one miRNA of interest. In certain embodiments, the sponge cassette contains one or more nucleotide sequences that target two different miRNAs of interest, or three different miRNAs of interest, or four different miRNAs of interest, or five different miRNAs of interest.

[0035] In various embodiments, the sponge cassette contains multiple copies or “repeats” of a nucleotide sequence targeting the miRNA of interest, “absorbing” any miRNA of interest present at the site where the vector is expressed. In various embodiments, one or more sponge cassettes may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 repeats of the nucleotide sequence targeting the miRNA of interest. In a particular embodiment, the sponge cassette contains 2 repeats of the nucleotide sequence targeting the miRNA of interest. In a particular embodiment, the sponge cassette contains 4 repeats of the sequence targeting the miRNA of interest. In a particular embodiment, the sponge cassette contains 6 repeats of the nucleotide sequence targeting the miRNA of interest. In a particular embodiment, the sponge cassette contains 8 repeats of the sequence targeting the miRNA of interest.

[0036] In some embodiments, rAAV may also contain a stuffer sequence. The stuffer sequence is included in the vector to maintain the optimal packaging length of the viral vector construct. The length of the stuffer sequence depends on the length of the sponge cassette. For example, the vector may contain a stuffer sequence with a length in the range of 1000–1500 nucleotides, 500–2000 nucleotides, or 100–1000 nucleotides. Exemplary stuffer sequences are 100 nucleotides long, or 200 nucleotides long, or 300 nucleotides long, or 400 nucleotides long, or 500 nucleotides long, or 600 nucleotides long, or 700 nucleotides long, or 800 nucleotides long, or 900 nucleotides long, or 1000 nucleotides long, or 1100 nucleotides long, or 1200 nucleotides long, or 1300 nucleotides long, or 1400 nucleotides long, or 1500 nucleotides long, or 1600 nucleotides long, or 1700 nucleotides long, or 1800 nucleotides long, or 1900 nucleotides long, or 2000 nucleotides long. To date, none of the FDA-approved stuffer sequences are readily available. However, there are several plasmid backboards that are FDA-approved for human administration. Small DNA fragments were extracted from these plasmids that do not correspond to any essential DNA sequences required for the selection and replication of elements of the plasmid or transcription unit. Exemplary plasmid backboards are listed in Table 1 and shown in Figures 11A–11B. To generate a complete 1350bp stuffer sequence (SEQ ID NO: 11), DNA elements from different plasmids were placed in tandem.

[0037] miRNA106a Large-scale loss-of-function screening identified miRNAs that enable the re-expression of the MECP2 gene from the X chromosome, which is inactivated if inhibited. Based on cell model results, a miRNA sponge was designed to inhibit microRNA 106a (also known as “miRNA106a” or “miR106a”), and a vector was designed to deliver this sponge in vivo. In various embodiments, this disclosure provides vectors such as recombinant AAV vectors (rAAV) containing one or more microRNA sponge cassettes targeting a miRNA of interest, such as miR106a. miR106a is encoded by the miR106a-363 ​​cluster on the X chromosome. Analysis of published miR106a-CLIP data revealed multiple miR106a seed regions in XistRNA. Upregulation of miR-106a is positively correlated with tumor metastasis in patients with gastric cancer. miR106a knockout mice are viable and phenotypic. miR106a is highly expressed in the mouse cerebral cortex.

[0038] In exemplary embodiments, the sponge cassette includes a sequence targeting miRNA106a (miR106a). The sequence for mouse miRNA106a-5p is provided in SEQ ID NO: 20, and the sequence for human miRNA106a-5p is provided in SEQ ID NO: 25. Exemplary sequences targeting miRNA106a are shown as SEQ ID NOs: 1 and 2. The miRNA106(a) sponge sequence may include one or more copies of SEQ ID NO: 1 or 2, or one or more copies of a sequence that is at least 90% identical to SEQ ID NO: 1 or 2. Copies of SEQ ID NO: 1 or 2 may be separated by spacer sequences, such as AGTTA (SEQ ID NO: 18) or AGUUA (SEQ ID NO: 19), between any one of the copies of SEQ ID NO: 1 or 2. In various embodiments, the miR106a sponge is the nucleotide sequence shown in SEQ ID NOs: 3, 4, 5, 6, 7, or 8, or within the AAV genome (nucleotides 1144-1368) of SEQ ID NO: 21. In various embodiments, the miR106a sponge cassette sequence includes the nucleotide sequence shown in either SEQ ID NO: 1 or 2, or a variant thereof having at least about 90% identity with the nucleotide sequence shown in either SEQ ID NO: 1 or 2. In any of these embodiments, the sponge sequence is in reverse orientation and therefore lies on the complementary strand of the cassette.

[0039] miRNA (small RNA) As described herein, this disclosure includes the use of inhibitory RNA, used alone or in combination with the miRNA sponge described herein, to further reduce or inhibit the activity and / or expression of the miRNA of interest. Thus, in some embodiments, the products and methods of this disclosure also include short hairpin RNA or small hairpin RNA (shRNA) to affect the expression of the miRNA of interest (e.g., knockdown or inhibit or inactivate the expression of the miRNA of interest). Short hairpin RNA (shRNA / hairpin vector) is an artificial RNA molecule (nucleotide) having a sharp hairpin curve that can be used to silence the expression of a target gene via RNA interference (RNAi). shRNA is a useful mediator of RNAi in that it has a relatively low rate of degradation and turnover, but requires the use of an expression vector. Once the vector transduces the host genome, the shRNA is then transcribed in the nucleus by polymerase II or polymerase III by promoter selection. The product mimics primary microRNA (pri-miRNA) and is processed by Drosha. The resulting pre-shRNA is exported from the nucleus by exportin 5. This product is then processed by Dicer and loaded into an RNA-induced silencing complex (RISC). The sense (passenger) strand is degraded. The antisense (guide) strand directs the RISC to mRNA with a complementary sequence. In the case of perfect complementarity, the RISC cleaves the mRNA. In the case of incomplete complementarity, the RISC inhibits translation of the mRNA. In both of these cases, the shRNA causes silencing of the target gene. In some embodiments, this disclosure involves the production and administration of an AAV vector expressing one or more miRNA-targeted antisense sequences via shRNA. shRNA expression is regulated by the use of various promoters. Promoter selection is essential to obtain robust shRNA expression. In various embodiments, polymerase II promoters such as U6 and H1, as well as polymerase III promoters, are used. In some embodiments, U6 shRNA is used.

[0040] In various embodiments, the disclosure provides a vector comprising one or more small RNAs targeting one or more miRNAs of interest. In various embodiments, the small RNAs are designed to target one or more miRNAs of interest associated with X-linked disorders (e.g., Rett syndrome). In various embodiments, binding of the small RNAs to the microRNA of interest induces its degradation and thus interferes with X-chromosome silencing.

[0041] In various embodiments, the term “small RNA” as used herein refers to small RNAs known to induce RNAi processes in mammalian cells, including short (or small) interfering RNAs (siRNAs), as well as short (or small) hairpin RNAs (shRNAs) and microRNAs (miRNAs). Small RNAs are <200 nucleotides in length and are typically non-coding RNA molecules.

[0042] In various embodiments, the small RNA is a polynucleotide comprising a nucleotide sequence that targets one or more microRNAs of interest. In relevant embodiments, the small RNA comprises a nucleotide sequence that binds to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different miRNAs of interest. In certain embodiments, the small RNA comprises one or more nucleotide sequences that target one miRNA of interest. In certain embodiments, the small RNA comprises one or more nucleotide sequences that target two different miRNAs of interest, or three different miRNAs of interest, or four different miRNAs of interest, or five different miRNAs of interest.

[0043] In some embodiments, rAAV may also contain a stuffer sequence. The stuffer sequence is included in the vector to maintain the optimal packaging length of the viral vector construct. The length of the stuffer sequence depends on the length of the sponge cassette. For example, the vector may contain a stuffer sequence with a length in the range of 1000–1500 nucleotides, 500–2000 nucleotides, or 100–1000 nucleotides. Exemplary stuffer sequences are 100 nucleotides long, or 200 nucleotides long, or 300 nucleotides long, or 400 nucleotides long, or 500 nucleotides long, or 600 nucleotides long, or 700 nucleotides long, or 800 nucleotides long, or 900 nucleotides long, or 1000 nucleotides long, or 1100 nucleotides long, or 1200 nucleotides long, or 1300 nucleotides long, or 1400 nucleotides long, or 1500 nucleotides long, or 1600 nucleotides long, or 1700 nucleotides long, or 1800 nucleotides long, or 1900 nucleotides long, or 2000 nucleotides long. To date, none of the FDA-approved stuffer sequences are readily available. However, there are several plasmid backboards that are FDA-approved for human administration. Small DNA fragments were extracted from these plasmids that do not correspond to any essential DNA sequences required for the selection and replication of elements of the plasmid or transcription unit. Exemplary plasmid backboards are listed in Table 2 and shown in Figures 12A–12B. To generate a complete 1350bp stuffer sequence (SEQ ID NO: 11), DNA elements from different plasmids were placed in tandem.

[0044] Therefore, in some embodiments, the present disclosure describes using a U6 shRNA molecule to further inhibit, knock down, or interfere with the expression of a target miRNA associated with X-linked damage. Conventional small / short hairpin RNA (shRNA) sequences are typically transcribed into the cell nucleus from vectors containing a Pol III promoter, such as U6. The endogenous U6 promoter is typically well-characterized and controls the expression of U6 RNA, a small RNA involved in splicing [Kunkel et al., Nature. 322(6074):73-7 (1986), Kunkel et al., Genes Dev. 2(2):196-204 (1988), Paule et al., Nucleic Acids Res. 28(6):1283-98 (2000)]. In some embodiments, the U6 promoter is used to control vector-based expression of shRNA molecules in mammalian cells because (1) the promoter is recognized by RNA polymerase III (Poly-III) and controls high levels of constitutive expression of shRNA, and (2) the promoter is active in most mammalian cell types [Paddison et al., Proc. Natl. Acad. Sci. USA 99(3):1443-8 (2002), Paul et al., Nat. Biotechnol. 20(5):505-8 (2002)]. In some embodiments, the promoter is a type III Pol-III promoter in that all factors necessary to control shRNA expression are located upstream of the transcription start site (Paule et al., Nucleic Acids Res. 28(6):1283-98 (2000)). This disclosure includes both mouse and human U6 or H1 promoters. In some embodiments, the U6 promoter is reverse-oriented and lies on the complementary strand of the AAV genome. The shRNA, containing sense and antisense sequences derived from the target gene and connected by a loop, is transported from the nucleus into the cytoplasm, where Dicer processes it into small interfering RNA (siRNA). In any of these embodiments, the shRNA is reverse-oriented and therefore lies on the complementary strand of the AAV genome.

[0045] As our understanding of the natural RNAi pathway has advanced, researchers have designed artificial shRNAs for use in modulating the expression of targeted genes to treat diseases. Several classes of small RNAs that trigger RNAi processes in mammalian cells are known, including small (or small molecule) interfering RNAs (siRNAs), as well as small (or small molecule) hairpin RNAs (shRNAs) and microRNAs (miRNAs), which constitute a similar class of vector expression triggers [Davidson et al., Nat. Rev. Genet. 12:329-40, 2011; Harper, Arch. Neurol. 66:933-8, 2009]. Since shRNAs and miRNAs are expressed in vivo from plasmids or virus-based vectors, long-term gene silencing can be achieved with a single dose, provided the vector is present in the target cell nucleus and the driving promoter is active [Davidson et al., Methods Enzymol. 392:145-73, 2005]. Importantly, this vector expression approach reinforces decades of progress already made in the field of muscle gene therapy. However, instead of expressing a gene-coding protein, the vector cargo in RNAi therapeutic strategies is an artificial shRNA or miRNA cassette targeting the disease gene of interest. This strategy is used to express native miRNAs. Each shRNA / miRNA is based on the hsa-miR-30a sequence and structure. The native miR-30a mature sequence is replaced by intrinsic sense and antisense sequences derived from the target miRNA.

[0046] miRNAs that inactivate genes on the X chromosome In many X-linked disorders, during development, each cell randomly inactivates one of the two X chromosomes in the female. Therefore, the female contains a mixture of cells expressing either a healthy copy or a mutant copy of the X-linked gene, depending on the inactivated X chromosome. The gene therapy approach disclosed herein utilizes the fact that each cell expressing a mutant form of the X-linked gene also contains a native backup copy of the X-linked gene on the inactivated X chromosome. Thus, reactivation of the silenced portion of the chromosome allows for the re-expression of the healthy gene.

[0047] As disclosed herein, CRISPR / Cas9-based screening was performed to identify small non-coding RNAs involved in the silencing of inactive X chromosomes (Xi). Certain genes associated with X-linked disorders (X-linked genes) are located on the X chromosome, and their allele-specific expression patterns are determined by X-linked disorder inactivation (XCI), an epigenetic mechanism that randomly inactivates one of the female X chromosomes. Certain small non-coding RNAs, such as miRNAs, can be epigenetic regulators of XCI. Such miRNAs (e.g., miR106a) inhibit the expression and / or activity of genes associated with X-linked disorders (e.g., the MECP2 gene). Inhibition of these X-linked miRNA targets increases the expression and / or activity of genes associated with X-linked disorders.

[0048] In various embodiments, the Disclosure provides vectors comprising a sponge cassette targeting one or more miRNAs of interest. The Disclosure also provides vectors comprising small RNAs targeting one or more miRNAs of interest. Targeting miRNAs of interest by either the sponge or the small RNA results in binding and inactivation of the miRNAs of interest, inhibition of the expression of the miRNAs of interest, and / or increased expression and / or activity of genes associated with X-linked disorder.

[0049] Methyl CpG-binding protein 2 The methyl CpG-binding protein 2 (MECP2) gene encodes the MECP2 protein. MECP2 is a nuclear protein that functions as a key epigenetic leader, a repressor of thousands of genes in the central nervous system with local and cell-type-specific alterations in gene expression. 95% of typical Rett syndrome (RTT) cases are caused by a deficiency of MECP2, a critical regulator of gene expression in the central nervous system (CNS). The clinical phenotype underlying RTT is a global neuronal phenotype characterized by neuronal compression, characterized by smaller cell bodies and shortened, fewer neurites. Furthermore, clinical and animal modeling have shown a direct link between disease severity and neuroanatomical changes dependent on various MECP2 mutations.

[0050] The feasibility and safety of in vivo expression of Xi-linked MECP2 were evaluated using small molecule inhibitors of phosphoinositide-dependent protein kinase 1 and activin A receptor 1 (2, 3). Expression of Xi-linked genes did not cause any adverse effects in treated animals, and no off-target effects were observed in tissues such as the liver (2).

[0051] In various embodiments, the disclosure provides vectors or compositions comprising sponge cassettes or small RNAs that target miRNAs for the purpose of regulating MECP2 gene expression. In various embodiments, the expression of the sponge cassette or small RNA activates the expression of the MECP2 gene.

[0052] Rett syndrome and X-linked disorders Any of the vectors disclosed herein may be used to treat X-linked disorders. For example, any of the vectors disclosed herein may be used to treat Rett syndrome. Rett syndrome (RTT) is a neurodevelopmental disorder that affects almost exclusively girls and has an incidence of approximately 1 in 10,000 live births.

[0053] X-linked disorders that can be treated with any of the disclosed vectors include, but are not limited to, Rett syndrome, hemophilia A, hemophilia B, Dent's disease 1, Dent's disease 2, albinism-hearing syndrome, Aldrich syndrome, Alport syndrome, anemia (hereditary hypochromic), anemia (sideroblastic with ataxia), cataracts, Charcot-Marie-Tooth syndrome, color blindness, diabetes insipidus, nephrogenic diabetes, congenital keratosis, ectodermal dysplasia, and genitourinary dysplasia. Fabry disease, glucose-6-phosphate dehydrogenase deficiency, glycogen storage disease type VIII, gonadal dysplasia, testicular feminization syndrome, Addison's disease with encephalosclerosis, adrenal hypoplasia, granulomatosis, Sidelius X-linked intellectual disability, Bruton type agammaglobulinemia, choroidal retinal degeneration, choroidemia, albinism (eye), fragile X syndrome, epileptic encephalopathy (early infant 2), hydrocephalus (aqueous stenosis), hypophosphatemic rickets, Lesch-Nyhan Syndrome (hypoxanthine-guanine-phosphoribosyltransferase deficiency), incontinentia pigmenti, Kallmann syndrome, paroxysmal nocturnal hemoglobinuria, spinal muscular atrophy 2, spastic paraplegia, follicular keratosis, Lowe's syndrome (oculobrain-kidney), Menkes syndrome, Renpenning syndrome, intellectual disability, Coffin-Lowry syndrome, microphthalmia (Lenz syndrome), muscular dystrophy (Becker type, Duchenne type, Emery-Dreyfus type), myotubular This includes myopathy, night blindness, Norie's disease (pseudoglioma), nystagmus, orofacial finger syndrome, ornithine transcarbamylase deficiency (type I hyperammonemia), phosphoglycerate kinase deficiency, phosphoribosyl pyrophosphate synthase deficiency, retinitis pigmentosa, retinoschisis, muscular atrophy / dihydrotestosterone receptor deficiency, spinal muscular atrophy, late-onset spondyloepic dysplasia, thrombocytopenia, thyroxine-binding globulin, and Macleod syndrome.

[0054] Further X-linked disorders that can be treated using any of the vectors disclosed herein are incorporated by reference in Germain, “Chapter 7: General These are listed in "Aspects of X-linked diseases" in Fabry Disease: Perspectives from 5 Years of FOS. Mehta A, Beck M, Sunder-Plassmann Gc editors. (Oxford: Oxford PharmaGenesis; 2006) and in "Diseases and Disorders" (Marshall Cavendish, 2007).

[0055] In various embodiments, the disclosure provides vectors or compositions comprising rAAVs that include either a sponge cassette or small RNAs targeting one or more miRNAs for the purpose of regulating X-linked gene expression. In various embodiments, the expression of the disclosed sponge or small RNAs activates the expression of X-linked genes.

[0056] cancer Exemplary conditions or disorders that can be treated with any of the vectors disclosed herein include cancer. In various embodiments, cancer includes, but is not limited to, gastric cancer, bone cancer, lung cancer, hepatocellular carcinoma, pancreatic cancer, kidney cancer, fibrous carcinoma, breast cancer, myeloma, squamous cell carcinoma, colorectal cancer, and prostate cancer. In relevant embodiments, cancer is metastatic. In relevant embodiments, metastasis includes metastasis to bone or bone tissue, liver, lungs, kidneys, or pancreas. The methods described herein are intended to reduce tumor size or tumor volume in a subject and / or reduce metastasis in a subject. In various embodiments, the methods reduce tumor size by 10%, 20%, 30% or more. In various embodiments, this method reduces tumor size by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%.

[0057] AAV In some embodiments, the Disclosure provides adeno-associated virus (AAV) comprising any one or more nucleotides provided herein. In various embodiments, the one or more nucleotides are microRNA sponges disclosed herein. In various embodiments, the gene therapy vector is a single-stranded or self-complementary adeno-associated virus vector serotype 9 (AAV9) or similar vector, e.g., AAV8, AAV10, Anc80, and AAV rh74. The recombinant AAV genome of the Disclosure comprises one or more miRNA sponge molecules or one or more AAV ITRs flanking a nucleotide molecule. The AAV DNA in the rAAV genome may originate from any AAV serotype capable of inducing recombinant viruses, including but not limited to AAV-B1, AAVrh.74, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, AAV-13, Anc80, or AAV7m8, or their derivatives. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692. Other types of rAAV variants, such as rAAV with capsid mutations, are also considered. See, for example, Marsic et al., Molecular Therapy, 22(11):1900-1909 (2014). As described in the background technology section above, the nucleotide sequences of various AAV serotype genomes are known in the field of this technology.

[0058] This disclosure also provides one or more nucleotide sequences of this disclosure and one or more AAVs of this disclosure in a composition. In some embodiments, the composition also comprises a diluent, an excipient, and / or an acceptable carrier. In some embodiments, the carrier is a pharmaceutically acceptable carrier or a physiologically acceptable carrier.

[0059] In various embodiments, the gene therapy vector contains a microRNA sponge cassette that competitively inhibits mature miR106a. In relevant embodiments, the sponge is a tandem multiplex of sequences that are fully or partially complementary to mature microRNA 106a. MicroRNA 106a has been previously identified as modulating X chromosome inactivation by interacting with Xist non-coding RNA. Binding of the sponge to the microRNA induces its degradation and thus interferes with X chromosome silencing. In various embodiments, the expression of the microRNA sponge will be regulated by U6.

[0060] In various embodiments, gene therapy vectors may be delivered via one of the following injection methods, or using a combination of several injection methods: intravenous delivery, lumbar intrathecal injection, or delivery via cerebrospinal fluid (CSF) via other injection methods that access the CSF.

[0061] In various embodiments, for CSF delivery in humans or macro animal species, the viral vector may be mixed with a contrast agent (Omnipaque or similar). In relevant embodiments, the contrast agent composition may include a nonionic, hypoosmolar contrast agent. In relevant embodiments, the composition may include a nonionic, hypoosmolar contrast agent selected from the group consisting of iovitridol, iohexol, iomeprole, iopamidol, iopentol, iopromide, ioversol, ioxiran, and combinations thereof. In certain embodiments, immediately after CSF injection, the patient may be held in the Trendelenburg position with the head tilted downward at an angle of 15–30 degrees for 5, 10, or 15 minutes. In relevant embodiments, the CSF dose would range from 1e13 viral genome (vg) to 1e15vg / patient, based on age group. In various embodiments, the intravenous delivery dose may range from 1 e1 3 vg / kg body weight to 2 e1 4 vg / kg.

[0062] In various embodiments, the vector may be used for other X-linked disorders, such as DDX3X syndrome and fragile X syndrome, which are additional diseases caused by loss-of-function mutations in genes located on the X chromosome.

[0063] Self-complementary AAV (scAAV) vectors are also intended for use in this disclosure. ScAAV vectors are generated by reducing the vector size to approximately 2500 base pairs, which contain a unique 2200 base pair transgene sequence, in addition to two copies of a 145 base pair ITR packaged as a dimer. ScAAV has the ability to refold into a double-stranded DNA template for expression. McCarthy, Mol.Therap.16(10):1648-1656, 2008.

[0064] The DNA plasmids of this disclosure contain an rAAV genome. The DNA plasmids are transferred to cells tolerant of infection with an AAV helper virus (e.g., adenovirus, E1 deletion adenovirus, or herpesvirus) for assembly of the rAAV genome into infectious viral particles. Techniques for producing rAAV particles, in which the AAV genome, rep and cap genes, and helper virus functions are provided to the cell, are known in the art. The production of rAAV requires that the following components, the rAAV genome, the AAV rep and cap genes isolated from (i.e., not present in) the rAAV genome, and the helper virus functions, be present in a single cell (referred to herein as a packaging cell). The AAV rep and cap genes may originate from any AAV serotype capable of inducing recombinant virus, and may originate from an AAV serotype different from the rAAV genome ITR, including, but not limited to, AAV serotypes AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-11, AAV-12, and AAV-13. The production of pseudotyped rAAV is disclosed, for example, in WO01 / 83692, which is incorporated in its entirety herein by reference.

[0065] The method for generating packaging cells involves creating a cell line that stably expresses all the components necessary for AAV particle production. For example, a plasmid (or multiple plasmids) containing an rAAV genome lacking the AAV rep and cap genes, the AAV rep and cap genes isolated from the rAAV genome, and selectable markers such as the neomycin resistance gene, is incorporated into the cell's genome. The AAV genome has been introduced into bacterial plasmids by procedures such as GC tailing (Samulski et al., 1982, Proc. Natl. Acad. S6. USA, 79:2077-2081), addition of a synthetic linker containing restriction endonuclease cleavage sites (Laughlin et al., 1983, Gene, 23:65-73), or direct blunt-end ligation (Senapathy & Carter, 1984, J. Biol. Chem., 259:4661-4666). Next, the packaging cell line is infected with a helper virus such as adenovirus. The advantage of this method is that the cells are selectable and it is suitable for large-scale production of rAAV. Another example of a preferred method is to use adenovirus or baculovirus instead of plasmids to introduce the rAAV genome and / or rep and cap genes into the packaging cells.

[0066] The general principles of rAAV production are outlined, for example, in Carter, 1992, Current Opinions in Biotechnology, 1533-539, and Muzyczka, 1992, Curr. Topics in Microbial. and Immunol., 158:97-129). Various approaches include Ratschin et al., Mol. Cell. Biol. 4:2072 (1984), Hermonat et al., Proc. Natl. Acad. Sci. USA, 81: 6466 (1984), Tratschin et al., Mo 1. Cell. Biol. al., J. Virol., 62:1963 (1988), and Lebkowski et al., 1988 Mol. Cell. Biol., 7: 349 (1988). Samulski et al. al. (1989, J. Virol., 63:3822-3828), U.S. Patent No. 5,173,414, WO95 / 13365 and corresponding U.S. Patent No. 5,658,776, WO95 / 13392, WO96 / 17947, PCT / US98 / 18600, WO97 / 09441 (PCT / US96 / 14423), WO97 / 08298 (PCT / US96 / 13872), WO97 / 21825 (PCT / US96 / 20777), WO97 / 06243 (PCT / FR96 / 01064), WO99 / 11764, Perrin et al. (1995) Vaccine 13:1244-1250, Paul et al. This is described in al. (1993) Human Gene Therapy 4:609-615, Clark et al. (1996) Gene Therapy 3:1124-1132, U.S. Patent Nos. 5,786,211, 5,871,982, and 6,258,595. The aforementioned documents are incorporated herein by reference in their entirety, with particular emphasis on the portions relating to rAAV production.

[0067] Accordingly, this disclosure provides packaging cells that produce infectious rAAV. In one embodiment, the packaging cells may be stably transformed cancer cells such as HeLa cells, 293 cells, and PerC.6 cells (allogeneic 293 strain). In another embodiment, the packaging cells may be non-transformed cancer cells, such as low-passage 293 cells (human fetal kidney cells transformed with adenovirus E1), MRC-5 cells (human fetal fibroblasts), WI-38 cells (human fetal fibroblasts), Vero cells (monkey kidney cells), and FRhL-2 cells (rhesus macaque fetal lung cells).

[0068] The recombinant AAVs of this disclosure (i.e., infectious capsidized rAAV particles) comprise an rAAV genome. Embodiments include, but are not limited to, an rAAV named “pAAV.miR106a sponge.stuffer.Kan” encoding a miR106a sponge, as encoded by the nucleotide sequence shown in SEQ ID NO: 21. In exemplary embodiments, the rAAV genome lacks both rep and cap DNA of AAV, i.e., there is no rep or cap DNA of AAV between the ITRs of the rAAV genome. Examples of rAAVs that can be constructed to include the nucleic acid molecules of this disclosure are described in International Patent Application No. PCT / US2012 / 047999 (WO2013 / 016352), which is incorporated herein by reference in its entirety.

[0069] rAAV can be purified by methods such as column chromatography or a cesium chloride gradient. Methods for purifying rAAV vectors from helper viruses are known in the art and include, for example, the methods disclosed in Clark et al., Hum. Gene Ther., 10(6):1031-1039 (1999), Schenpp and Clark, Methods Mol. Med., 69:427-443 (2002), U.S. Patent No. 6,566,118, and WO98 / 09657.

[0070] In another embodiment, the present disclosure contemplates a composition comprising the disclosed rAAV. The compositions of the present disclosure comprise rAAV in a pharmaceutically acceptable carrier. The composition may also include other components such as diluents and adjuvants. Acceptable carriers, diluents, and adjuvants are non-toxic to the recipient and are preferably inert at the dosages and concentrations used, buffers such as phosphoric acid, citric acid, or other organic acids, antioxidants such as ascorbic acid, low molecular weight polypeptides, proteins such as serum albumin, gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrolidone, amino acids such as glycine, glutamine, asparagine, arginine, or lysine, monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrin, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counterions such as sodium, and / or nonionic surfactants such as Tween®, Pluronic®, or polyethylene glycol (PEG).

[0071] The titer of rAAV administered by the methods of the present disclosure can vary depending on, for example, the particular rAAV, the method of administration, the treatment goal, the individual, and the targeted cell type, and can be determined by methods known in the art. The titer of rAAV can be, per milliliter, from about 1×10 6 to about 1×10 7 to about 1×10 8 to about 1×10 9 to about 1×10 10 to about 1×10 11 to about 1×10 12 to about 1×10 13 to about 1×10 14 or more DNase-resistant particles (DRP) and may range. The dosage may be expressed in units of viral genome (vg).

[0072] A method for transducing target cells with rAAV in vivo or in vitro is contemplated by this disclosure. The in vivo method comprises the step of administering a composition comprising an effective dose or effective multiple doses of the rAAV of this disclosure to an animal (including humans) in need thereof. If the dose is administered before the onset of the disorder / disease, the administration is prophylactic. If the dose is administered after the onset of the disorder / disease, the administration is therapeutic. In embodiments of this disclosure, the effective dose is a dose that alleviates (eliminates or reduces) at least one symptom associated with the disorder / disease condition being treated, delays or prevents progression to the disorder / disease condition, reduces the severity of the disease, results in disease remission (partial or complete) and / or prolongs survival. An example of a disease for which prevention or treatment by the methods disclosed is contemplated is FSHD.

[0073] Combination therapies are also contemplated in this disclosure. The combinations used herein include both concurrent and sequential therapies. In particular, combinations of the methods disclosed herein with standard medical treatments (e.g., corticosteroids), such as in combination with novel therapies, are contemplated.

[0074] The effective dose of the composition may be administered by routes known in the art, including but not limited to intramuscular, parenteral, intravenous, oral, oral cavity, nasal cavity, lung, intracranial, intraosseous, intraocular, rectal, or vaginal. The routes of administration and serotypes of the AAV components of the rAAV of this disclosure (in particular, AAV ITR and capsid protein) may be selected and / or adapted by those skilled in the art, taking into account the infectious disease and / or disease state being treated, as well as target cells / tissues expressing miRNA sponges or miRNA minima.

[0075] This disclosure provides topical and systemic administration of the recombinant AAV and compositions of this disclosure in effective doses. For example, systemic administration means administration to the circulatory system so that the whole body is affected. Systemic administration includes enteral administration such as absorption through the gastrointestinal tract and parenteral administration by injection, infusion, or transplantation.

[0076] In particular, the practical administration of rAAV according to this disclosure can be achieved by using any physical method for transporting the rAAV recombinant vector to the target tissue of an animal. Administration according to this disclosure includes, but is not limited to, intramuscular injection, bloodstream injection, and / or direct injection into the liver. Simply resuspending rAAV in phosphate-buffered saline has been demonstrated to be sufficient to provide a vehicle useful for muscle tissue expression, and there are no known limitations on carriers or other components that may be co-administered with rAAV (although DNA-degrading compositions should be avoided in the usual manner with rAAV). The capsid protein of rAAV may be modified so that rAAV targets a specific target tissue of interest, such as muscle. See, for example, WO02 / 053703, the disclosure of which is incorporated herein by reference. Pharmaceutical compositions can be prepared as injectable formulations or as topical formulations delivered to muscle by transdermal transport. Numerous formulations for both intramuscular injection and transdermal transport have been developed prior to and can be used in the implementation of the disclosed methods and compositions. rAAV can be used with any pharmaceutically acceptable carrier to facilitate administration and handling.

[0077] Solutions of rAAV as a free acid (DNA contains acidic phosphate groups) or a pharmacochemically acceptable salt can be prepared in water suitably mixed with a surfactant such as hydroxypropyl cellulose. Dispersions of rAAV can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, as well as in oil. Under normal storage and use conditions, these formulations contain preservatives to prevent microbial growth. In this regard, all sterile aqueous media used are readily available by techniques known to those skilled in the art.

[0078] Pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersions, and sterile powders for the immediate preparation of sterile injection solutions or dispersions. In all cases, the form must be sterile and fluid enough to allow for easy syringe injection. The form must be stable under manufacturing and storage conditions and protected against microbial contamination, such as bacteria and fungi. The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc.), suitable mixtures thereof, and vegetable oils. Adequate fluidity can be maintained, for example, by the use of coating agents such as lecithin, by maintaining the required particle size in the case of dispersants, and by the use of surfactants. Prevention of microbial action can be provided by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it would be preferable to include isotonic agents, such as sugars or sodium chloride. The prolonged absorption of injectable compositions can be achieved by using absorption-delaying agents, such as aluminum monostearate and gelatin.

[0079] Sterile injectable solutions are prepared by combining the required amount of rAAV in a suitable solvent, along with various other components listed above as needed, and then sterilizing by filtration. Generally, dispersions are prepared by mixing the sterilized active ingredient into a sterile vehicle containing a basic dispersion medium and other required components from those listed above. For sterile powders for the preparation of sterile injectable solutions, preferred methods of preparation are vacuum drying and freeze-drying techniques, which yield a powder of the active ingredient plus any additional desired components from those solutions that have been previously sterilized and filtered.

[0080] Transduction with rAAV can also be performed in vitro. In one embodiment, desired target muscle cells are isolated from the target, transduced with rAAV, and reintroduced into the target. Alternatively, syngeneic or heterologous muscle cells may be used if those cells do not produce an inappropriate immune response in the target.

[0081] Suitable methods for transduction into a target and reintroduction of transduced cells are known in the art. In one embodiment, cells can be transduced in vitro, for example, by combining rAAV with muscle cells in a suitable medium and screening for cells having the DNA of the interest using techniques such as Southern blotting and / or PCR, or by using a selectable marker. The transduced cells can then be formulated into a pharmaceutical composition, which can be introduced into a target by various techniques, such as intramuscular, intravenous, subcutaneous, and intraperitoneal injection, or by injection into smooth muscle and cardiac muscle using a catheter, for example.

[0082] Transduction of cells with the rAAVs of this disclosure results in sustained expression of a microRNA sponge cassette. This disclosure therefore provides methods for administering / delivering rAAVs expressing a microRNA sponge to animals, preferably humans. These methods involve transducing tissues (including, but not limited to, tissues such as muscle, organs such as the liver and brain, and glands such as salivary glands) with one or more of the disclosed rAAVs. Transduction may be performed with a gene cassette containing tissue-specific regulatory elements.

[0083] The term "transduction" is used to refer to the administration / delivery of a microRNA sponge cassette to recipient cells, either in vivo or in vitro, via replication-deficient rAAV, resulting in the expression of the microRNA sponge by the recipient cells.

[0084] The present invention also provides pharmaceutical compositions (or, as often referred to herein simply as “compositions”) comprising any of the rAAV vectors of the present invention.

[0085] Treatment methods Terms such as “to treat,” “to be treated,” “to treat,” and “treatment” mean reducing or improving a disorder and / or its associated symptoms (e.g., Rett syndrome, other X-linked disorders, or cancer). “To treat” may refer to the administration of combination therapy to a subject after the onset or suspected onset of Rett syndrome, other X-linked disorders, or cancer. “To treat” includes the concept of “relieving,” which means reducing the frequency or severity of any symptoms or other adverse effects and / or side effects associated with Rett syndrome or other X-linked disorders and / or side effects associated with such disorders. The term “to treat” also encompasses the concept of “managing,” which means reducing the severity of a particular disease or disorder in a patient or delaying its recurrence, for example, extending the remission period in a patient with the disease. It is understood, though not excluded, that treating a disorder or condition does not require the complete elimination of the disorder, condition, or its associated symptoms.

[0086] In various embodiments, this disclosure provides methods for treating Rett syndrome, X-linked disorders, or cancer.

[0087] This disclosure provides a method for administering a recombinant AAV vector containing a microRNA sponge cassette to a patient in need of it, in an effective dose (or essentially concurrently administered doses or intervally doses) of rAAV encoding one or more microRNA sponge cassettes targeting miR106a.

[0088] This entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated even if combinations of features do not appear together in the same sentence, paragraph, or section as in this document. This disclosure also includes, for example, all embodiments of the invention that are narrower in scope than the modifications specifically mentioned above. With respect to aspects of the disclosure described as a genus, all individual species are considered distinct aspects of this disclosure. With respect to aspects of the disclosure described or claimed as "a" or "an," it should be understood that these terms mean "one or more" unless the context explicitly requires a more limited meaning. Where an aspect of this disclosure is described as "containing" a feature, the embodiment is also contemplated to "consist of" or "essentially consist of" that feature.

[0089] All publications, patents, and patent applications cited herein are incorporated herein by reference in such a manner as each individual publication or patent application is specifically and individually indicated to be incorporated in whole by reference, to the extent that it does not conflict with this disclosure.

[0090] The examples and embodiments described herein are for illustrative purposes only, and it will be understood that various modifications or changes in light thereof are suggested to those skilled in the art and fall within the spirit and scope of this application and the scope of the appended claims.

[0091] array Sequence ID 1. miR106a targeting miR106a sponge RNA sequence CUACCUGCACUGUUAGCACUUUG

[0092] Sequence ID 2. miR106a sponge DNA sequence targeting miR106a CTACCTGCACTGTTAGCACTTTG

[0093] Sequence ID 3.mir106a sp1 design 2RNA CCGGCUACCUGCACUGUUAGCACUUUGAGUUACUACCUGCACUCCCGCACUUUGUUUUUG

[0094] Sequence ID 4.mir106a sp1 design 2DNA CCGGCTACCTGCACTGTTAGCACTTTGAGTTACTACCTGCACTCCCGCACTTTGTTTTTG

[0095] Sequence ID 5.mir106a sp1 design 3RNA ACCGGCUACCUGCACUGUUAGCACUUUGAGUUACUACCUGCCUGCACUCCCGCACUUUGAGUUACUACUGCACUGUUAGCACUGUUAGCACUUUGAGUUACUACCUGCACUCCCGCACUUUGUUUUUAAUUC

[0096] Sequence ID 6.mir106a sp1 design 3DNA ACCGGCTACCTGCACTGTTAGCACTTTGAGTTACTACCTGCCTGCACTCCCGCACTTTGAGTTACTACTGCACTGTTAGCACTGTTAGCACTTTGAGTTACTACCTGCACTCCCGCACTTTGTTTTTAATTC

[0097] Sequence ID 7.miR106a Sponge Cassette RNA CCGGCUACCUGCACUGUUAGCACUUUGAGUUACUACCUGCACUCCCGCACUUUGAGUUACUACCUGCACUGUUAGCACUUUGAGUUACUACCUGCACUCCCGCACUUUGAGU UACUACCUGCACUGUUAGCACUUUGAGUUACUACCUGCACUCCCGCACUUUGAGUUACUACCUGCACUGUUAGCACUUUGAGUUACUACCUGCACUCCCGCACUUUGUUUUUG

[0098] SEQ ID NO:8.miR106a sponge cassette DNA CCGGCTACCTGCACTGTTAGCACTTTGAGTTACTACCTGCACTCCCGCACTTTGAGTTACTACCTGCACTGTTAGCACTTTGAGTTACTACCTGCACTCCCGCACTTTGAGTTACTACCTGCACTGTTAGCACTTTGAGTTACTACCTGCACTCCCGCACTTTGAGTTACTACCTGCACTGTTAGCACTTTGAGTTACTACCTGCACTCCCGCACTTTGTTTTTG

[0099] Sequence ID 9.mITR CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGG

[0100] Sequence ID 10.U6 promoter GTCCTTTCCACAAGATATATAAAGCCAAGAAATCGAAATACTTTCAAGTTACGGTAAGCATATGATAGTCCATTTTAAAACATAATTTTAAAACTGCAAACTACCCAAGAAATTATTACTTTCTACGTCACGTATTTTGTACTAATATCTTGTGTTTACAGTCAAATTAATTCCAATTATCTCTCTAACAGCCTTGTATCGTATATGCAAATATGAAGGAATCATGGGAAATAGGCCCTC

[0101] Sequence ID 11. Staffer

[0102] Sequence ID 12.ITR AGGAACCCCTAGTGATGGAGTTGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGG

[0103] Sequence ID 14.mITR CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGG

[0104] Sequence ID 18 Spacer 1 AGTTA

[0105] Sequence ID 19 Spacer 2 AGUUA

[0106] Sequence ID 20: Mouse miR106a-5p sequence CAAAGUGCUAACAGUGCAGGUAG

[0107] Sequence ID 21.pAAV.miR106a sponge.stuffer.Kan GGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGC

[0108] TGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTG AGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATC TTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTACGGTTCCTGGCCTTTTGCTGGCCTTT TGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGC

[0109] Sequence ID 23.miR106a shRNA DNA (shRNA target sequence, bold nucleotides 5-24) [ka]

[0110] Sequence ID 24.miR106a shRNA RNA (shRNA target sequence, bold nucleotides 5-24) [ka]

[0111] Sequence ID 25. Human mir106a-5p AAAAGUGCUUACAGUGCAGGUAG

[0112] Further aspects and details of this disclosure will be apparent from the following examples, which are intended to be illustrative rather than restrictive. [Examples]

[0113] Example 1 CRISPR / Cas9 screening identifies miR106a as an epigenetic regulator of XCI. miRNAs as epigenetic regulators of X chromosome inactivation (XCI) were identified through unbiased CRISPR / Cas9 screening (Figure 1A). A female mouse fibroblast reporter cell line (BMSL2) with deletions in the Xist promoter and the HPrt gene allowed for specific monitoring of Xi-linked HPrt and showed X-reactivation (5, 6). To initiate the screening, a BMSL2 cell line stably expressing wild-type Cas9 endonuclease was generated. After viral delivery of a single guide RNA (sgRNA) library, cells expressing Xi-to-Hprt were enriched in hypoxanthine-aminopterin-thymidine selective medium (see, e.g., (6)). Using next-generation sequencing, six miRNAs, including miR106a, miR363, miR181a, miR340, miR34b, and miR30e, were identified as XCI regulators (data not shown). In addition to miRNAs, 19 protein-coded XCIFs were identified, including two factors previously identified through shRNA screening, ACVR1 and STC1(6), thereby validating the screening.

[0114] miRNAs were ranked based on the reactivation of HPrt and MECP2 obtained with sgRNAs targeting the same target in multiple cell models (Figure 1B). The focus was on miR106a (Figure 1B), a top-scoring candidate encoded by a miRNA cluster on the X chromosome and highly expressed in the mouse cerebral cortex (Figure 1D). Furthermore, analysis of previously published miR106a crosslinked immunoprecipitation data revealed multiple miR106a seed sequences in the 5' region of Xist RNA, a key regulator in XCI (data not shown), supporting the proposed miR106a function in XCI.

[0115] Next, miR106a inhibition was tested to reactivate Xi-linked MECP2 in human postmittal neurons, the cell type most associated with RTT (8, 9). For this purpose, miR106a was inhibited using single-stranded and chemically enhanced RNA oligonucleotides. For convenience, these agents are referred to herein as miR106a inhibitors (miR106i). RTT neurons were used that had the T158M missense mutation in MECP2 on the active X and not in the wild-type MECP2 gene on Xi (10). Since females are mosaic with respect to XCI, RTT iPSC clones derived from the same RTT patient and having wild-type MECP2 on the active X and mutant MECP2 on Xi that is completely skewed relative to wild-type MECP2 were used as positive isogeneic controls (WT-iPSCs, (44)). WT neurons have been previously shown to be phenotypically normal compared to RTT neurons. For example, RTT neurons exhibited slower growth, smaller cell body size, and fewer branching points compared to WT neurons, as determined by viability and immunofluorescence assays (see, e.g., (2)). Importantly, miR106i-treated RTT neurons expressed Xi-linked MECP2 at levels ranging from approximately 12% to levels observed in WT neurons (Figure 1C). As expected, miR106a inhibition upregulated known miR106a targets, PAK5 (11) and Ankrd52 (7) (Figure 2A) but did not affect cell viability (Figure 2B), demonstrating that miR106a is target-specific and safe in vitro. Furthermore, inhibition of miR106a with a miR106a inhibitor (Figure 2C) or miR106a-specific sgRNA (Figure 2D) was shown to reactivate MECP2 in Patski cells (Figure 2C) and Ret neurons (Figure 2D).

[0116] Example 2 Reliable miR106a-Xist interaction mapping Given that Xist is a key regulator of XCI (12-14) and possesses multiple miR106a seed sequences (7), we investigated whether miR106a targets Xist. Using a computational prediction algorithm (15), we identified five putative binding sites for miR106a in the 5' region of Xist, defined as repeats (referred to herein as RepA). Although the molecular function of RepA is unknown, RepA-mediated recruitment of proteins such as RBM15 / 15b (16) and SPEN (17) is important for Xist function in XCI.

[0117] To directly confirm the miR106a-RepA interaction, competitive elution of RepA transcripts was performed in complex with a biotinylated miR106a mimite (Figure 3A). To demonstrate the target specificity of the miR106a mimite, a luciferase reporter gene construct expressing the known miR106a target, PAK5, was designed in the psi-CHECK-2 reporter system. Addition of miR106i resulted in approximately 80% reduction in luciferase signaling compared to the rescued control, confirming the specificity of both the miR106a mimite and miR106i.

[0118] Next, the elution efficiency of 5'-P32 radiolabeled RepA transcripts was compared for each of the five predicted miR106a binding sites using mismatched, complete, and incomplete complementary capture oligonucleotides. As shown in a representative subset of the results (Figure 3B), larger RepA transcripts were detected in the washing solution pooled after elution with complete and incomplete complementarity, rather than with mismatched capture oligonucleotides. Similar analyses were performed with full-length RepA transcripts that confirmed miR106a binding. In conclusion, these results demonstrate that miR106a physically interacts with RepA at multiple sites.

[0119] Next, to confirm the binding of miR106a to endogenous RepA, an intracellular pull-down assay was performed using biotinylated miR106a mimics. Biotinylated miRNA / RNA complexes were extracted from whole cell lysates using streptavidin beads, and RepA enrichment was analyzed by quantitative RT-PCR (qRT-PCR). Pull-down complexes were enriched for RepA in miR106a mimic-transfected cells, but no RepA signal was observed in negative controls (Figure 3C), confirming that miR106a and RepA form a complex in vivo.

[0120] Example 3 MiR106a transcribs Xist. Next, we investigated whether miR106a could positively regulate Xist transcription by either depleting the repressor or indirectly affecting Xist stability. Therefore, we examined RNA polymerase II (PolII) mobilization at the Xist promoter by chromatin immunoprecipitation (ChIP) in miR106a-depleted cells. Surprisingly, miR106a depletion did not affect PolII mobilization on the Xist promoter; however, as expected, the Gfp promoter (Xi-linked transgene in H4SV cells) was enriched for PolII, indicating Xi reactivation (Figure 4A). miR106a depletion reduced Xist levels (Figure 4B), and the actinomycin D assay showed a significantly reduced half-life of Xist (Figure 4C).

[0121] Example 4 Functional interaction of miR106a with RepA Xist function and its association with Xi depend on its structure (18, 36). Therefore, we investigated whether miR106a depletion affects Xist association with Xi using RNA in situ hybridization (RNA-FISH). As expected, approximately 80% of the Xist "cloud" was observed in control cells (Figure 5A, left). In contrast, miR106a depletion caused a dramatic change in the Xist "cloud," which appeared to be dispersed throughout the nucleus in approximately 65% ​​of cells (number of dots, Figure 5A-B) and more diffused with Xi in approximately 45% of cells (area of ​​the cloud, Figure 5A-B). Overall, these results indicate that miR106a is important for Xist localization to Xi.

[0122] Example 5 To determine whether inhibiting miR106a can normalize the dysfunctional neuronal phenotype. To achieve efficient in vivo inhibition of miR106a, a loss-of-function miR106a "sponge" was designed, possessing a tandem multiplex of an incomplete complementary sequence to the nucleotide sequence of miR106a. This sponge sequence is called miR106sp. Based on the following parameters, miR106sp was demonstrated to be fully functional: (i) Gibbs free energy: miR106a showed a lower ΔGtotal for miR106sp than for the RepA region (Figure 5C). (ii) Functional assay: Physical association of miR106sp-miR106a was confirmed by expressing the sponge sequence through a dual luciferase reporter system in BMSL2 cells endogenously expressing miR106a. Compared to an empty vector, the reporter vector with the miR106sp sequence showed a lower 60% lower pith / pith ratio, which is rescued by miR106i (Figure 6). (iii) Transcriptional effect: miR106sp-mediated sequestration of miR106a reactivates Xi-linked TgGfp and known targets of miR106a, PAK5 and Ankrd52, in H4SV cells. (iii) Sponge mRNA containing multiple target sites complementary to the miRNA of interest is used in a dominant-negative method. The sponge interacted with mature miRNA, and their efficacy was not affected by clustering of miRNA precursors (Figure 5D). Together, the results disclosed herein confirm that miR106sp is biologically active.

[0123] To maximize sponge expression and conduct a long-term miR106a loss-of-function study, we manipulated the lentiviral vector pLKO.1 expressing miR106sp (LTV-miR106sp). Transduction efficiency of NPCs was optimized by co-transfecting LTV-miR106sp with pLKO.1 expressing Gfp, which yielded approximately 80% transduction efficiency (data not shown). Furthermore, miR106a depletion did not affect neuronal differentiation, as indicated by the expression of NPCs and neuronal lineage-specific markers.

[0124] The reactivation of MECP2 by miR106sp is tested to see if it can normalize the phenotype of RTT neurons. While it is recognized that normalization may be a partial rather than complete modification, for brevity, the term “normalize” is used to mean a partial or complete modification of the phenotype. To assess the rescue of the RTT neuron phenotype, RTT neuron lines are analyzed using the following quantifiable measures.

[0125] (i) Neuronal phenotype: RTT-NPCs were differentiated into neurons at 4, 8, and 12 weeks, wild-type MECP2 expression was confirmed and quantified by allele-specific Taqman assays. Then, different RTT neuron lines were assayed for cell body size, branching points, neuronal network, point density, and synapse formation.

[0126] As proof of concept, treatment of RTT neurons with LTV-miR106sp resulted in approximately 30% higher expression of wild-type MECP2 compared to healthy neurons approximately 8 weeks post-treatment (Figure 7A), and most importantly, it was sufficient to rescue cell body size and branching density in MAP2-positive (neuronal marker) neurons (n=200, Figures 7B and 7C).

[0127] These results support the hypothesis that (1) even partial reactivation of MECP2 has a normalizing effect on the phenotype of RTT neuronal dysfunction, and (2) demonstrate that the level of MECP2 reactivation achieved has a potent normalizing effect.

[0128] (ii) Activity-dependent calcium (Ca 2+ ) Transient: Spontaneous electrophysiological activity is Ca 2+ Using the sensitive fluorescent dye gCAMP6s, Ca in various RTT neuron lines 2+ It is investigated by imaging methods (39). Time-lapse image sequences (63X magnification) are acquired at 28 Hz in a 336 × 256 pixel area using a Zeiss upright fluorescence spin-disk confocal microscope. Spontaneous Ca2+ Transients were analyzed over time in several independent experiments, and images were analyzed using ImageJ software.

[0129] Next activity-dependent Ca 2+ Transients were monitored in 8-week-old RTT neurons treated with LTV-miR106sp. Simply put, RTT neurons were transduced with GCaMP6, and intracellular Ca was increased. 2+ The fluctuations were monitored over time using high-speed imaging. Figure 8A shows Ca in miR106sp. 2+ This shows that the rapid increase in oscillation amplitude and frequency was depleted, but not in control RTT neurons. In particular, Ca in miR106sp-treated cells 2+ Transient intensity corresponded to WT neurons (Figure 8B). MECP2 expression was optimized after miR106sp treatment, but the results showed that miR106a inhibition was associated with activity-dependent Ca 2+ We will demonstrate improvements in transient response and also prove the feasibility of the proposed approach.

[0130] (iii) Excitatory synaptic signaling: The effect of MECP2 restoration on the functional maturation of RTT neurons is determined using electrophysiological methods. Whole-cell recordings are performed on neurons that have been fractionated for at least 6 weeks. Changes in the frequency and amplitude of spontaneous postsynaptic currents are evaluated in RTT neurons after wild-type MECP2 expression.

[0131] Example 6 Construction of gene therapy constructs The sponge cassette (miR106sp) described in Example 4 was subcloned into a self-complementary AAV9 genome under the U6 promoter. The plasmid construct included the U6 promoter, the miR106a sponge cassette (miR106sp), a stuffer sequence, a reverse terminal repeat (ITR), a mutant ITR (mITR), an origin of replication (Ori), and a kanamycin-resistant cassette (KanR). A schematic diagram of the plasmid construct, called pAAV.miR106a sponge.stuffer.Kan, is provided in Figure 11A. The exact sequence range, strand orientation, and length of the pAAV.miR106a sponge.stuffer.Kan component are provided in Table 1. The plasmid sequence of pAAV.miR106a sponge.stuffer.Kan is provided in Figure 11B and is provided as Sequence ID No. 21. The pAAV.miR106a sponge-stuffer-Kan construct was packaged into the AAV9 genome and expressed according to a standard method known in the art. [Table 1]

[0132] A short hairpin RNA construct of mIRNA106a was also generated. mIRNA106a shRNA was subcloned into a self-complementary AAV9 genome under the U6 promoter. The plasmid construct included the U6 promoter, miR106a shRNA, a stuffer sequence, a reverse-ended repeat (ITR), a variant ITR (mITR), an origin of replication (Ori), and a kanamycin-resistant cassette (KanR). A schematic diagram of the plasmid construct, called pAAV.miR106a shRNA.stuffer.Kan, is provided in Figure 12A. The precise sequence range, strand orientation, and length of the pAAV.miR106a shRNA.stuffer.Kan component are provided in Table 2. The plasmid sequence of pAAV.miR106a shRNA.stuffer.Kan is provided in Figure 12B and in Sequence ID No. 22. The pAAV.miR106a shRNA.stuffer.Kan construct was packaged into the AAV9 genome and expressed according to a standard method known in the art. The efficient adeno-associated virus serotype 9 (AAV9) vector expression miR106sp was called AAV9-miR106sp. miR106sp expression, driven by the U6 promoter, was packaged into a self-complementary AAV9 vector. The expression cassette also contained stuffer to ensure optimal packaging size (40, 41). [Table 2]

[0133] Example 7 To determine whether inhibition of miR106a can normalize behavioral disorders in a female ΔCpG RTT preclinical model. As described in Example 5, efficient AAV9 vector-expressing miR106sp (referred to as AAV9-miR106sp) was engineered to investigate the inhibition of miR106a in vivo. Empty virus particles were used as a negative control (AAV9-control). AAV9-miR106sp particles were produced using a triple transfection method with transfer plasmids and helper plasmids (42). Viral vector concentrations were determined by silver gel and Taqman qRT-PCR.

[0134] Next, AAV9-mir106sp was tested to reactivate MECP2 in the brains of XistΔ:Mecp2 / Xist:Mecp2-Gfp mice (2, 3). More recently, an XCI mouse model was developed by crossing Xist:Mecp2-Gfp / Y mice with XistΔ:Mecp2 / Xist:Mecp2 mice (Figure 9A, (2)). This model was demonstrated to allow for accurate and robust quantification of Xi-linked Mecp2 reactivation, primarily for two reasons: (i) The results show that 100% of cells are not excluded by mosaic expression of GFP with Mecp2-Gfp in Xi. Importantly, a FACS-based approach was established, showing that all cortical nuclei from XistΔ:Mecp2 / Xist:Mecp2 were Gfp-negative, while 100% of nuclei from Xist:Mecp2-Gfp / Xist:Mecp2-Gfp were Gfp-positive, representing the theoretical maximum in the experiment (Figure 9B). (ii) Genetic labeling of Mecp2 allows for direct visualization of individual neurons with Gfp, thereby minimizing experimental manipulation of cells (2). To assess the feasibility of an XistΔ:Mecp2 / Xist:Mecp2-Gfp mouse model for monitoring treated mouse embryonic fibroblasts isolated from female XistΔ:Mecp2 / Xist:Mecp2-Gfp embryos (d15.5) with either Xi-linked Mecp2 desuppression and control or miR106i, miR106i treatment desuppressed Xi-Mecp2-Gfp, but not the control (Figure 9C).

[0135] Next, a single dose of 5.0e+10 vector genome / kg AAV9-miR106sp or AAV9-control was administered to neonates via the ICV pathway as previously described (42). Using AAV9 expressing Gfp (AAV9-Gfp), the efficient transduction efficiency of the AAV9 vector was confirmed, showing a uniform distribution in the brains of XistΔ:Mecp2 / Xist:Mecp2 mice (n=2, Figure 10A). Importantly, Xi-Mecp2-Gfp expression was detected at 5 weeks in mice injected with AAV9-miR106sp but not in mice injected with AAV9-control (Figure 10B). Mecp2-Gfp expression in RNA isolated from mouse brains was also confirmed using RT-PCR (Figure 10C). Notably, in ongoing experiments in RTT mice, no signs of distress have been observed for approximately 15 weeks after miR106a inhibition.

[0136] The results presented above provide strong evidence for the feasibility of AAV9-miR106sp inhibiting miR106a in vivo, strongly supporting the hypothesis that inhibiting miR106a reactivates Mecp2 from Xi, and demonstrating that Xi reactivation is well tolerated in vivo.

[0137] Optimal Dose and CSF Delivery of AAV9-miR106sp: Next, the most effective dose of AAV9-miR106sp for maximal Xi-linked Mecp2 expression in XistΔ:Mecp2 / Xist:Mecp2-Gfp mice will be determined using three different concentrations and cerebrospinal fluid-mediated injection. Mice will be injected into the CSF using intracerebrospinal fluid injection at doses ranging from 1 e10vg, 2.5 e10vg, and 5 e10vg per animal on postnatal day 1. Mecp2-Gfp expression will be quantified at the RNA level (qRT-PCR) and protein level (flow cytometry, immunofluorescence, and immunohistochemistry).

[0138] Example 8 Rescue and survival improvement for behavioral disorders in RTT models using AAV9-miR106sp Rescue of behavioral disorders in ΔCpG-RTT models with AAV9-miR106sp: A comprehensive evaluation of phenotypic female RTT mouse models is crucial for translating the disclosed therapies to RTT patients. As a result, rescue of a wide range of behavioral measures across development was observed in Tsix mice treated with AAV9-miR106sp. ΔCpG :Mecp2 / Tsix:Mecp2 null (ΔCpG-RTT, Proc Natl Acad Sci USA. 2018 Aug 7;115(32):8185-8190) Female mice were evaluated in a standard C57BL / 6J background. ΔCpG-RTT female mice have a deletion of Tsix and MECP2 on the opposite X chromosome, resulting in the preferential expression of the null MECP2 allele. Treated female mice were scored for symptoms known to arise from MECP2 disruption and observed in RTT patients: motor paralysis, increased tremor, gait disturbance, repetitive behaviors, and self-injury (Proc Natl Acad Sci US A. 2018 Aug 7;115(32):8185-8190, Hum Mol Genet.2018 Dec 1;27(23):4077-4093).

[0139] Previous research identified abnormalities in motor function in MECP2 mutant mice that were reminiscent of the motor impairments observed in RTT girls (Hum Mol Genet. 2018 Dec 1;27(23):4077-4093). A proof-of-concept experiment was conducted to evaluate improvements in motor coordination and learning using an accelerated rotarod (3 trials per day, mean, 3 consecutive days). As shown in Figure 14A, AAV9-miR106sp injected mice outperformed AAV9-control injected mice on days 2 and 3 at both 4 and 7 weeks. At 7 weeks of age, AAV9-miR106sp injected mice showed dramatic improvement from baseline on day 1 compared to AAV9-control treated mice, demonstrating improvements in motor coordination and learning. These data were also confirmed in 16-week-old mice, where AAV9-miR106sp treated mice showed a strong improvement in rotarod performance compared to AAV9 control or untreated mice (Figure 15C).

[0140] Similarly, in the Barnes maze (3 trials per day, average, 5 consecutive days over 7 weeks), AAV9-miR106sp treatment resulted in significant cognitive improvements, as evidenced by 1) reduced latency in identifying the spatial location of previously rewarded responses (Figure 14B) and 2) increased speed in completing responses (Figure 14C). A statistically significant increase in distance traveled during training reveals that treated mice exhibited more exploratory behavior and a greater reduction in anxiety compared to controls with high levels of immobility (Figure 14D). In contrast, AAV9 control-injected mice spent more time in the arena than AAV9-miR106sp-injected mice, which was also confirmed in the open-field exploration test.

[0141] Survival and phenotypic severity were also evaluated in AAV9.miR106sp-treated animals versus controls. As shown in Figure 15A, AAV9-miR106sp-injected mice showed a dramatically improved survival rate of up to 250 days compared to AAV9-control (empty virus particle) treated animals, with a median survival of approximately 80–100 days (median survival 91 days). Phenotypic severity in AAV9.miR106sp-treated animals versus controls was also evaluated by phenotypic scoring, demonstrating that AAV9.miR106sp-treated animals showed reduced phenotypic severity up to 21 weeks of age compared to AAV9-control treated animals.

[0142] In summary, these preliminary results suggest that MECP2 restoration via miR106a inhibition rescues neuromotor and learning impairments in ΔCpG-RTT female mice. References 1.Neul JL,Zoghbi HY.Rett syndrome:a prototypical neurodevelopmental disorder.Neuroscientist.2004;10(2):118-28.doi:10.1177 / 1073858403260995.PubMed PMID:15070486.2.Przanowski P,Wasko U,Zheng Z,Yu J,Sherman R,Zhu LJ,McConnell MJ,Tushir-Singh J,Green MR,Bhatnagar S.Pharmacological reactivation of inactive X-linked Mecp2 in cerebral cortical neurons of living mice.Proc Natl Acad Sci U S A.2018.doi:10.1073 / pnas.1803792115.PubMed PMID:30012595. 3.Przanowski P,Zheng Z,Wasko U,Bhatnagar S.A Non-random Mouse Model for Pharmacological Reactivation of Mecp2 on the Inactive X Chromosome.J Vis Exp.2019(147).Epub 2019 / 06 / 11.doi:10.3791 / 59449.PubMed PMID:31180354. 4.Yildirim E,Kirby JE,Brown DE,Mercier FE,Sadreyev RI,Scadden DT,Lee JT.Xist RNA is a potent suppressor of hematologic cancer in mice.Cell.2013;152(4):727-42. doi:10.1016 / j.cell.2013.01.034.PubMed PMID:23415223;PMCID:PMC3875356. 5.Komura J,Sheardown SA,Brockdorff N,Singer-Sam J,Riggs AD.In vivo ultraviolet and dimethyl sulfate footprinting of the 5’ region of the expressed and silent Xist alleles.J Biol Chem.1997;272(16):10975-80.PubMed PMID:9099757. 6.Bhatnagar S,Zhu X,Ou J,Lin L,Chamberlain L,Zhu LJ,Wajapeyee N,Green MR.Genetic and pharmacological reactivation of the mammalian inactive X chromosome.Proc Natl Acad Sci U S A.2014;111(35):12591-8.Epub 2014 / 08 / 20.doi:10.1073 / pnas.1413620111.PubMed PMID:25136103;PMCID:Pmc4156765. 7.Imig J,Brunschweiger A,Brummer A,Guennewig B,Mittal N,Kishore S,Tsikrika P,Gerber AP,Zavolan M,Hall J.miR-CLIP capture of a miRNA targetome uncovers a lincRNA H19-miR-106a interaction.Nature chemical biology.2015;11(2):107-14.Epub 2014 / 12 / 23. doi:10.1038 / nchembio.1713.PubMed PMID:25531890. 8.Johnston MV,Blue ME,Naidu S.Rett syndrome and neuronal development.J Child Neurol.2005;20(9):759-63.Epub 2005 / 10 / 18.doi:10.1177 / 08830738050200091101.PubMed PMID:16225832. 9.Johnston MV,Mullaney B,Blue ME.Neurobiology of Rett syndrome.J Child Neurol.2003;18(10):688-92.Epub 2003 / 12 / 03. doi:10.1177 / 08830738030180100501.PubMed PMID:14649550. 10.Marchetto MC,Carromeu C,Acab A,Yu D,Yeo GW,Mu Y,Chen G,Gage FH,Muotri AR.A model for neural development and treatment of Rett syndrome using human induced pluripotent stem cells.Cell.2010;143(4):527-39.doi:10.1016 / j.cell.2010.10.016.PubMed PMID:21074045;PMCID:PMC3003590. 11.Pan YJ,Wei LL,Wu XJ,Huo FC,Mou J,Pei DS.MiR-106a-5p inhibits the cell migration and invasion of renal cell carcinoma through targeting PAK5.Cell Death Dis.2017;8(10):e3155.doi:10.1038 / cddis.2017.561.PubMed PMID:29072688;PMCID:PMC5680926.12.Arthold S,Kurowski A,Wutz A.Mechanistic insights into chromosome-wide silencing in X inactivation.Human genetics.2011;130(2):295-305.Epub 2011 / 05 / 14.doi:10.1007 / s00439-011-1002-0.PubMed PMID:21567178. 13.Pontier DB,Gribnau J.Xist regulation and function explored.Hum Genet.2011;130(2):223-36.Epub 2011 / 06 / 01.doi:10.1007 / s00439-011-1008-7.PubMed PMID:21626138;PMCID:PMC3132428. 14.Wutz A.Gene silencing in X-chromosome inactivation:advances in understanding facultative heterochromatin formation.Nat Rev Genet.2011;12(8):542-53.Epub 2011 / 07 / 19.doi:10.1038 / nrg3035.PubMed PMID:21765457. 15.Riffo-Campos AL,Riquelme I,Brebi-Mieville P.Tools for Sequence-Based miRNA Target Prediction:What to Choose?Int J Mol Sci.2016;17(12).doi:10.3390 / ijms17121987.PubMed PMID:27941681;PMCID:PMC5187787.16.Patil DP,Chen CK,Pickering BF,Chow A,Jackson C,Guttman M,Jaffrey SR.m(6)A RNA methylation promotes XIST-mediated transcriptional repression.Nature.2016;537(7620):369-73.doi:10.1038 / nature19342.PubMed PMID:27602518;PMCID:PMC5509218. 17.Lu Z,Zhang QC,Lee B,Flynn RA,Smith MA,Robinson JT,Davidovich C,Gooding AR,Goodrich KJ,Mattick JS,Mesirov JP,Cech TR,Chang HY.RNA Duplex Map in Living Cells Reveals Higher-Order Transcriptome Structure.Cell.2016;165(5):1267-79.doi:10.1016 / j.cell.2016.04.028.PubMed PMID:27180905;PMCID:PMC5029792. 18.Wutz A,Rasmussen TP,Jaenisch R.Chromosomal silencing and localization are mediated by different domains of Xist RNA.Nat Genet.2002;30(2):167-74.doi:10.1038 / ng820.PubMed PMID:11780141. 19.Duszczyk MM,Wutz A,Rybin V,Sattler M.The Xist RNA A-repeat comprises a novel AUCG tetraloop fold and a platform for multimerization.RNA.2011;17(11):1973-82.doi:10.1261 / rna.2747411.PubMed PMID:21947263;PMCID:PMC3198591. 20.Deigan KE,Li TW,Mathews DH,Weeks KM.Accurate SHAPE-directed RNA structure determination.Proc Natl Acad Sci U S A.2009;106(1):97-102.doi:10.1073 / pnas.0806929106.PubMed PMID:19109441;PMCID:PMC2629221. 21.Smola MJ,Christy TW,Inoue K,Nicholson CO,Friedersdorf M,Keene JD,Lee DM,Calabrese JM,Weeks KM.SHAPE reveals transcript-wide interactions,complex structural domains,and protein interactions across the Xist lncRNA in living cells.Proc Natl Acad Sci U S A.2016;113(37):10322-7.doi:10.1073 / pnas.1600008113.PubMed PMID:27578869;PMCID:PMC5027438. 22.Smola MJ,Rice GM,Busan S,Siegfried NA,Weeks KM.Selective 2’-hydroxyl acylation analyzed by primer extension and mutational profiling (SHAPE-MaP) for direct,versatile and accurate RNA structure analysis.Nat Protoc.2015;10(11):1643-69.doi:10.1038 / nprot.2015.103.PubMed PMID:26426499;PMCID:PMC4900152. 23.Duncan CD,Weeks KM.SHAPE analysis of long-range interactions reveals extensive and thermodynamically preferred misfolding in a fragile group I intron RNA.Biochemistry.2008;47(33):8504-13.doi:10.1021 / bi800207b.PubMed PMID:18642882;PMCID:PMC4900158. 24.Gherghe CM,Shajani Z,Wilkinson KA,Varani G,Weeks KM.Strong correlation between SHAPE chemistry and the generalized NMR order parameter(S2) in RNA.J Am Chem Soc.2008;130(37):12244-5.doi:10.1021 / ja804541s.PubMed PMID:18710236;PMCID:PMC2712629. 25.Grohman JK,Kottegoda S,Gorelick RJ,Allbritton NL,Weeks KM.Femtomole SHAPE reveals regulatory structures in the authentic XMRV RNA genome.J Am Chem Soc.2011;133(50):20326-34.doi:10.1021 / ja2070945.PubMed PMID:22126209;PMCID:PMC3241870. 26.Hajdin CE,Bellaousov S,Huggins W,Leonard CW,Mathews DH,Weeks KM.Accurate SHAPE-directed RNA secondary structure modeling,including pseudoknots.Proc Natl Acad Sci U S A.2013;110(14):5498-503.doi:10.1073 / pnas.1219988110.PubMed PMID:23503844;PMCID:PMC3619282. 27.Lavender CA,Lorenz R,Zhang G,Tamayo R,Hofacker IL,Weeks KM.Model-Free RNA Sequence and Structure Alignment Informed by SHAPE Probing Reveals a Conserved Alternate Secondary Structure for 16S rRNA.PLoS Comput Biol.2015;11(5):e1004126.doi:10.1371 / journal.pcbi.1004126.PubMed PMID:25992778;PMCID:PMC4438973. 28.Leonard CW,Hajdin CE,Karabiber F,Mathews DH,Favorov OV,Dokholyan NV,Weeks KM.Principles for understanding the accuracy of SHAPE-directed RNA structure modeling.Biochemistry.2013;52(4):588-95.doi:10.1021 / bi300755u.PubMed PMID:23316814;PMCID:PMC3578230. 29.Low JT,Knoepfel SA,Watts JM,ter Brake O,Berkhout B,Weeks KM.SHAPE-directed discovery of potent shRNA inhibitors of HIV-1.Mol Ther.2012;20(4):820-8.doi:10.1038 / mt.2011.299.PubMed PMID:22314289;PMCID:PMC3321596. 30.Low JT,Weeks KM.SHAPE-directed RNA secondary structure prediction.Methods.2010;52(2):150-8.doi:10.1016 / j.ymeth.2010.06.007.PubMed PMID:20554050;PMCID:PMC2941709. 31.McGinnis JL,Duncan CD,Weeks KM.High-throughput SHAPE and hydroxyl radical analysis of RNA structure and ribonucleoprotein assembly.Methods Enzymol.2009;468:67-89.doi:10.1016 / S0076-6879(09)68004-6.PubMed PMID:20946765;PMCID:PMC4890575. 32.McGinnis JL,Dunkle JA,Cate JH,Weeks KM.The mechanisms of RNA SHAPE chemistry.J Am Chem Soc.2012;134(15):6617-24. doi:10.1021 / ja2104075.PubMed PMID:22475022;PMCID:PMC4337229. 33.McGinnis JL,Liu Q,Lavender CA,Devaraj A,McClory SP,Fredrick K,Weeks KM.In-cell SHAPE reveals that free 30S ribosome subunits are in the inactive state.Proc Natl Acad Sci U S A.2015;112(8):2425-30.doi:10.1073 / pnas.1411514112.PubMed PMID:25675474;PMCID:PMC4345610. 34.Merino EJ,Wilkinson KA,Coughlan JL,Weeks KM.RNA structure analysis at single nucleotide resolution by selective 2’-hydroxyl acylation and primer extension(SHAPE).J Am Chem Soc.2005;127(12):4223-31.doi:10.1021 / ja043822v.PubMed PMID:15783204. 35.Smola MJ,Calabrese JM,Weeks KM.Detection of RNA-Protein Interactions in Living Cells with SHAPE.Biochemistry.2015;54(46):6867-75.doi:10.1021 / acs.biochem.5b00977.PubMed PMID:26544910;PMCID:PMC4900165. 36.Maenner S,Blaud M,Fouillen L,Savoye A,Marchand V,Dubois A,Sanglier-Cianferani S,Van Dorsselaer A,Clerc P,Avner P,Visvikis A,Branlant C.2-D structure of the A region of PMID:20052282;PMCID:PMC2796953. 37.Mavrakis KJ,Wolfe AL,Oricchio E,Palomero T,de Keersmaecker K,McJunkin K,Zuber J,James T,Khan AA,Leslie CS,Parker JS,Paddison PJ,Tam W,Ferrando A,Wendel HG.Genome-wide RNA-mediated interference screen identifies miR-19 targets in Notch-induced T-cell acute lymphoblastic leukaemia.Nat Cell Biol.2010;12(4):372-9.doi:10.1038 / ncb2037.PubMed PMID:20190740;PMCID:PMC2989719. 38.Mu P,Han YC,Betel D,Yao E,Squatrito M,Ogrodowski P,de Stanchina E,D'Andrea A,Sander C,Ventura A.Genetic dissection of the miR-17~92 cluster of microRNAs in Myc-induced B-cell lymphomas.Genes Dev.2009;23(24):2806-11.doi:10.1101 / gad.1872909.PubMed PMID:20008931;PMCID:PMC2800095.39.Chen TW,Wardill TJ,Sun Y,Pulver SR,Renninger SL,Baohan A,Schreiter ER,Kerr RA,Orger MB,Jayaraman V,Looger LL,Svoboda K,Kim DS.Ultrasensitive fluorescent proteins for imaging neuronal activity.Nature.2013;499(7458):295-300.doi:10.1038 / nature12354.PubMed PMID:23868258;PMCID:PMC3777791. 40.Sinnett SE,Hector RD,Gadalla KKE,Heindel C,Chen D,Zaric V,Bailey MES,Cobb SR,Gray SJ.Improved MECP2 Gene Therapy Extends the Survival of MeCP2-Null Mice without Apparent Toxicity after Intracisternal Delivery.Mol Ther Methods Clin Dev.2017;5:106-15.doi:10.1016 / j.omtm.2017.04.006.PubMed PMID:28497072;PMCID:PMC5424572. 41.Iannitti T,Scarrott JM,Likhite S,Coldicott IRP,Lewis KE,Heath PR,Higginbottom A,Myszczynska MA,Milo M,Hautbergue GM,Meyer K,Kaspar BK,Ferraiuolo L,Shaw PJ,Azzouz M.Translating SOD1 Gene Silencing toward the Clinic:A Highly Efficacious,Off-Target-free,and Biomarker-Supported Strategy for fALS.Mol Ther Nucleic Acids.2018;12:75-88.Epub 2018 / 09 / 10.doi:10.1016 / j.omtn.2018.04.015.PubMed PMID:30195799;PMCID:PMC6023790. 42.Foust KD,Salazar DL,Likhite S,Ferraiuolo L,Ditsworth D,Ilieva H,Meyer K,Schmelzer L,Braun L,Cleveland DW,Kaspar BK.Therapeutic AAV9-mediated suppression of mutant SOD1 slows disease progression and extends survival in models of inherited ALS.Mol Ther.2013;21(12):2148-59.Epub 2013 / 09 / 07.doi:10.1038 / mt.2013.211.PubMed PMID:24008656;PMCID:PMC3863799. 43.Carrette LLG,Blum R,Ma W,Kelleher RJ,3rd, Lee JT.Tsix-Mecp2 female mouse model for Rett syndrome reveals that low-level MECP2 expression extends life and improves neuromotor function.Proc Natl Acad Sci U S A.2018;115(32):8185-90.Epub 2018 / 07 / 25.doi:10.1073 / pnas.1800931115.PubMed PMID:30038001;PMCID:PMC6094149. 44.Guy J,Hendrich B,Holmes M,Martin JE,Bird A.A mouse Mecp2-null mutation causes neurological symptoms that mimic Rett syndrome.Nat Genet.2001;27(3):322-6.Epub 2001 / 03 / 10.doi:10.1038 / 85899.PubMed PMID:11242117. 45.Guy J,Gan J,Selfridge J,Cobb S,Bird A.Reversal of neurological defects in a mouse model of Rett syndrome.Science (New York, NY).2007;315(5815):1143-7.Epub 2007 / 02 / 10.doi:10.1126 / science.1138389.PubMed PMID:17289941. 46.Hofseth LJ.Getting rigorous with scientific rigor.Carcinogenesis.2018;39(1):21-5.Epub 2017 / 10 / 03.doi:10.1093 / carcin / bgx085.PubMed PMID:28968787;PMCID:PMC5862244. 47.Samsa G,Samsa L.A Guide to Reproducibility in Preclinical Research.Acad Med.2019;94(1):47-52.Epub 2018 / 07 / 12.doi:10.1097 / ACM.0000000000002351.PubMed PMID:29995667;PMCID:PMC6314499.

Claims

[Claim 1] The invention described in the specification.