Compositions and methods for the treatment of hereditary cystatin C amyloid angiopathy (HCCAA) and other neurodegenerative disorders with abnormal amyloid deposition.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- THE CHILDRENS HOSPITAL OF PHILADELPHIA
- Filing Date
- 2026-02-22
- Publication Date
- 2026-06-23
AI Technical Summary
Current treatments for hereditary cystatin C amyloid angiopathy (HCCAA) and other neurodegenerative disorders associated with abnormal amyloid deposition, such as Alzheimer's disease, are inadequate, as they often require high concentrations of compounds that are not therapeutically viable and do not effectively prevent the formation of toxic oligomers and fibrils.
Administering antioxidants like glutathione or N-acetylcysteine, or their derivatives, to patients to destroy amyloid deposits and reduce protein aggregation, accompanied by agents such as ionophores and proteases, and using siRNA to block mutated cystatin C alleles, along with monitoring amyloid deposition levels.
Reduces amyloid-cystatin protein aggregates, alleviating symptoms of HCCAA and other neurodegenerative disorders, as demonstrated by significant reductions in skin biopsies and plasma samples, indicating potential therapeutic efficacy.
Smart Images

Figure 2026102609000001_ABST
Abstract
Description
[Technical Field]
[0001] This application claims priority to U.S. Provisional Application No. 62 / 555,496, filed on 7 September 2017, the entire contents of which are incorporated herein by reference in full.
[0002] The present invention relates to the field of vascular disorders, most notably including cerebral amyloid angiopathy and neurodegenerative disorders associated with pathogenic fibrillation. More specifically, the present invention provides compositions and methods useful for the treatment and management of diseases associated with abnormal fibrillation, particularly hereditary cystatin C amyloid angiopathy (HCCAA) and Alzheimer's disease. [Background technology]
[0003] To illustrate the latest technologies relating to the present invention, several publications and patent documents are referenced throughout this specification. Each of these references is incorporated herein by reference to be fully described.
[0004] Hereditary cystatin C amyloid angiopathy (HCCAA) is a dominant genetic disorder caused by a variant of human cystatin C (hCC; L68Q-hCC) that replaces leucine 68 with glutamine. 1 HCCAA is classified as a cerebral amyloid angiopathy (CAA), a group of diseases characterized by the formation of amyloid deposits in the blood vessel walls of the central nervous system (CNS). While HCCAA is correctly classified as a CAA disorder due to its severe cerebral symptoms, hCC deposition is systemic and can be found in other organs as well. Most carriers of the mutation develop microinfarcts and cerebral hemorrhages in their 20s, leading to paralysis, dementia, and death in young adults, with an average life expectancy of 30 years. 2-6 Postmortem studies in humans have shown that hCC is most prominent in arteries and arterioles, as well as in all brain regions, including gray and white matter.
[0005] Human cystatin C, a cysteine protease inhibitor belonging to the cystatin superfamily, is a secreted type 2 cystatin, expressed in all nucleated human cells, and detected at particularly high concentrations in all tissues and body fluids, especially cerebrospinal fluid. 2、7-9 hCC inhibits cysteine proteases such as papain and legumain through interactions via multiple binding motifs resulting from the characteristic hCC fold. 9-11 Its normal conformation is composed of a polypeptide folded into a five-stranded β-sheet, partially wrapped around a central α-helix. The N-terminal segment and two hairpin loops build the edges of the protein, bind to the active site of cysteine proteases, and block proteolytic activity. 12-14 Mutation of leucine 68 to glutamate destabilizes the packing between the beta-sheet and the alpha-helix, causing the molecule to open. Two such open hCC molecules can interact with each other, with the helix of each molecule interacting with the beta-sheet of the other, and the resulting dimer is said to be the product of domain exchange. 15-17 Furthermore, through a process called propagating domain exchange, long chains of molecules are built, with the free domains of each molecule interacting with new hCC monomers. 18 Protein aggregation leads to the formation of highly ordered pathogenic fibrillar aggregates called amyloid fibrils, 19、20 In addition to HCCAA, it is also involved in a wide range of neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and other CAAs. 20
[0006] The degree of amyloid maturation observed in cystatin C deposits is shown to vary between tissues (i.e., maturation is less prominent in the skin than in the brain). 21Although the skin deposits were not amyloid fibers, the skin of mutant carriers showed that symptomatic carriers had significantly higher levels of hCC immunoreactivity in the skin than asymptomatic carriers. The fact that the amount of hCC deposition in the skin was associated with disease progression in the CNS suggests that skin biopsies can be used to assess disease progression and therefore to evaluate therapeutic interventions. 22
[0007] Protein oligomers of different pathogenic amyloid-forming proteins precede the fibrillary formation stage in HCCAA and other diseases; however, for HCCAA, it is unclear whether such oligomers directly link to pathogenic fibrils or whether fibrillary assembly arises most rapidly from monomers. 23 Drugs that reduce the aggregation of amyloid-producing proteins may reduce the formation of toxic oligomers known to occur in several types of amyloidosis. 24、25 Previous studies have suggested that preventing domain swapping in hCC may be used in the treatment of HCCAA. 24 WT hCC and L6Q-hCC possess intrachain-stabilized disulfide bonds, preventing domain swapping that could potentially lead to the formation of either dimers or amyloid fibrils. 26 These results suggest that understanding the molecular mechanisms that cause the transition from physiologically normal, soluble proteins to toxic oligomers and insoluble fibrils is essential for developing therapeutic strategies.
[0008] Ostner et al. have previously attempted to prevent the polymerization of hCC monomers and to destroy or remove the polymer species through various approaches. 24 Modified and stabilized hCC monomers have been used to demonstrate that preventing domain swapping prevents aggregation. Antibodies are specifically produced against domain-swapped dimerized hCC. These antibodies were able to specifically remove the hCC dimers, rather than the monomers, from patient plasma using size exclusion chromatography. 27High-throughput screening of compounds is an effort to find molecules that prevent dimerization, and the US Drug Collection (consisting of 1040 FDA-approved compounds, which can be found at worldwideweb.msdiscovery.com / usdrug.html) is one such example. 24 This approach requires large quantities of purified hCC protein produced by bacteria, and most of the compounds identified as inhibiting dimer formation were used at concentrations too high to be considered therapeutic in organisms.
[0009] Clearly, improved methods and compositions are needed to treat HCCAA. [Overview of the project] [Means for solving the problem]
[0010] According to the present invention, a method for treating amyloidosis comprises delivering an effective amount of at least one antioxidant to a patient, the antioxidant destroying the amyloid deposits and thereby alleviating disease symptoms. Amyloidosis includes, for example, hereditary cystatin C amyloid angiopathy (HCCAA), Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and Dutch-type cerebral amyloid angiopathy. In certain embodiments, the amyloid disease is HCCAA caused by mutant cystatin C. In other embodiments, the mutant cystatin C includes L68Q cystatin C. Preferred antioxidants for use in the above method include, but are not limited to, glutathione, N-acetylcysteine, or derivatives thereof. In certain embodiments, the derivative is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salts.
[0011] In another embodiment, a method for treating hereditary cystatin C amyloid angiopathy (HCCAA) in human subjects requiring such treatment is provided. An exemplary method involves administering an effective amount of N-acetylcysteine or a functional derivative thereof in a pharmaceutically acceptable carrier to a subject, the administration being effective in reducing amyloid-cystatin protein aggregates and thereby alleviating the symptoms of HCCAA. In certain embodiments, the NAC derivative is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salts. The method may optionally be accompanied by performing a skin biopsy on the subject after treatment to assess the reduction of amyloid-cystatin protein aggregates in the skin, or to measure the amount of cystatin C monomers, dimers, or oligomers in serum or plasma, or monomers excreted in urine.
[0012] In another embodiment, this method may involve the administration of additional agents to alleviate amyloid deposition symptoms. These include, but are not limited to, one or more ionophores, one or more anti-inflammatory agents, and one or more proteases. In other embodiments, siRNA directed to a cystatin C coding sequence is administered to selectively block the mutated allele.
[0013] Another aspect of the present invention discloses a method for treating neurodegenerative disorders associated with pathogenic fibrillation protein aggregates in human subjects requiring such treatment. An exemplary method comprises administering an effective amount of N-acetylcysteine or a functional derivative thereof to a subject in a pharmaceutically acceptable carrier, the administration being effective in reducing the protein fibrillation aggregates and thereby alleviating the symptoms of the neurodegenerative disorder. In certain embodiments, the disorder is selected from Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and other types of cerebral amyloid angiopathy (CAA), such as Dutch type.
[0014] In certain embodiments, the method described above includes monitoring the patient for amyloid deposition levels.
[0015] In yet another aspect of the present invention, a method is provided for identifying therapeutic agents that alter amyloid-cystatin protein aggregate formation. An exemplary method comprises providing cells expressing a nucleic acid encoding a mutant hCC protein, the mutant causing amyloid-cystatin protein aggregate formation, and providing cells expressing hCC protein lacking the hCC mutation. Both cell populations are brought into contact with a test drug and evaluated to determine whether the drug alters amyloid-cystatin protein aggregate formation in the mutant-expressing cells compared to cells expressing the wild-type protein, thereby identifying a drug that alters amyloid-cystatin protein aggregation. The drug thus identified should be effective in treating HCCAA or other disorders associated with abnormal fibrillation.
[0016] Also provided are pharmaceutical compositions comprising an effective amount of an agent acting as an antioxidant or a reducing agent for the treatment of amyloid deposition diseases in a pharmaceutically acceptable carrier. Diseases treated with the compositions include, for example, HCCAA, Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and other CAAs. In one embodiment, the agent is glutathione, N-acetylcysteine, or a derivative thereof. In a preferred embodiment, the agent is a derivative and is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salt. The compositions of the present invention may also comprise one or more ionophores, anti-inflammatory agents, or proteases. [Brief explanation of the drawing]
[0017] [Figure 1A] Figure 1A shows that genetically engineered HEK-293T cells detect and secrete hCC (WT or L68Q) that can be oligomerized under non-reducing conditions. Figure 1A is a schematic diagram of WT and L68Q mutant hCC proteins. The dashed line represents the N-terminal signal peptide that undergoes proteolysis. The red rectangle represents the Myc tag added to the C-terminus. [Figure 1B] Figure 1B (left panel) Lysates of HEK-293T cells stably expressing hCC WT or the L68Q mutant or supernatants (right panel) were mixed with 2% SDS, with or without the reducing agents DTT or β-mercaptoethanol. Samples were electrophoresed and cystatin C levels were examined by Western blot procedure using an anti-cystatin C antibody. Figure 1B: Incubation with glutathione impairs cystatin C di- / oligomerization in cell extracts and supernatants (biological replicates). [Figure 1C] Figure 1C is a biological replicate related to the experiment shown in Figure 2. Supernatants and cell extracts were incubated for 1 h at 37 °C at the indicated concentrations in the presence of glutathione. Samples were mixed with 2% SDS without reducing agent before electrophoresis, and protein levels were detected by anti-cystatin C antibody WB. [Figure 2A] Figure 2A: Incubation with glutathione inhibits cystatin C di- / oligomerization in cell extracts and supernatants. Supernatants and cell extracts were incubated for 1 h at 37 °C in the presence of the indicated concentrations of glutathione. Samples were mixed with 2% SDS without reducing agent before electrophoresis, and protein levels were detected by Western blot of cystatin C (N = 3; * significant at P < 0.05 vs untreated (HMW); significant at P < 0.05 vs untreated (monomer)). [Figure 2B] Figure 2B: Glutathione and N-acetylcysteine impair oligomerization of secreted cystatin C L68Q (biological replicates). Biological replicates related to the experiment shown in Figure 3 incubated supernatants at the indicated concentrations for 1 h at 37 °C in the presence of glutathione or NAC. Samples were mixed with 2% SDS without reducing agent before electrophoresis, and protein levels were detected by anti-cystatin C antibody WB. [Figure 3A]Glutathione and N-acetylcysteine impair the oligomerization of secreted cystatin C L68Q. Supernatants were incubated at 37 °C for 1 h in the presence of glutathione or NAC at the indicated concentrations. Before electrophoresis, samples were mixed with 2% SDS without a reducing agent, and protein levels were detected with an anti-cystatin C antibody. The histogram represents quantification by densitometry of Western blot bands of the high molecular weight fraction (HMW) relative to the monomer (Mono) for untreated samples or DTT-treated samples. No HMW fraction was detected in the supernatants of HEK-293T cells stably expressing hCC WT. (*Significant at P < 0.05 for untreated (HMW); + significant at P < 0.05 for untreated (monomer)). [Figure 3B] Figure 3B: N-acetylcysteine impairs the oligomerization of secreted cystatin C L68Q. A small amount of supernatant was removed from the cells and analyzed by Western blot at the indicated times. On day 2 and day 3, only the L68Q supernatant was analyzed. Before electrophoresis, samples were mixed with 2% SDS without a reducing agent, and protein levels were detected by anti-cystatin C antibody WB. [Figure 4] Figure 4 shows that NAC impairs the oligomerization of secreted hCC L68Q. 293T cells expressing WT or L68Q cystatin C were incubated for 24 h, 48 h, or 72 h with medium containing either the indicated amount of GSH or NAC. A small amount of supernatant was removed from the cells and analyzed by Western blot at the indicated times. On day 2 and day 3, only the supernatants of cells expressing the hCC L68Q variant were analyzed. Before electrophoresis, samples were mixed with 2% SDS without a reducing agent, and protein levels were detected with an anti-cystatin C antibody. The histogram represents quantification by densitometry of Western blot bands of the high molecular weight fraction (HMW) relative to the monomer (Mono) for untreated samples or DTT-treated samples. (*Significant at P < 0.05 for untreated (HMW); + significant at P < 0.05 for untreated (monomer)). [Figure 5]Figure 5 shows that reduced activity of GSH or NAC is important for the breakdown of oligomers into monomers of secreted cystatin C L68Q. The supernatant was incubated at 37°C for 1 hour at specified concentrations in the presence of oxidized (GSSG) or reduced glutathione (GSH), NAC, or an inactive analog (NAS). Samples were mixed with 2% SDS without reducing agents before electrophoresis, and protein levels were detected by anti-cystatin C antibody. [Figure 6] Figure 6. NAC-amide and NAC-ethyl ester impair the oligomerization of intracellular and secretory cystatin C L68. Supernatants and cell extracts were incubated at specified concentrations at 37°C for 1 hour in the presence of NAC, NAC-amide, and NAC-methyl ester. Samples were mixed with 2% SDS without reducing agent before electrophoresis, and protein levels were detected by anti-cystatin C antibody. [Figure 7] Figure 7. High molecular weight complexes of Cyst-C L68Q can be detected in transgenic mice. Short incubation with NAC impairs oligomerization of Cyst-C L68Q on blood and brain extracts. Plasma or brain extracts were incubated at 37°C for 1 hour at specified concentrations in the presence of NAC. Samples were mixed with 2% SDS without reducing agent before electrophoresis, and protein levels were detected by biotinylated anti-cystatin C antibody followed by streptavidin-HRP. [Figure 8A]Figure 8A: Efficacy of NAC therapy in HCCAA patients. Cystatin C immunostaining (brown staining) was performed using rabbit anti-human cystatin C antibody on three separate skin biopsies obtained from the same location on the back of two members of the HCCAA family who were carriers of the hCC L68Q variant. Biopsies in each left panel (skin biopsy #1 in Figures 8A and 8B) were obtained when the family joined the study more than two years prior to the start of this work. Biopsies in the center panel (skin biopsy #2 in Figures 8A and 8B) were taken approximately 18 months later. Biopsies in the right panel of both subjects (skin biopsy #3 in Figures 8A and 8B) show deposition of the cystatin C protein complex after 6 months of treatment with NAC. Significant reductions were observed in the proband (panel A) and parent (panel B) after 6 months of NAC therapy. Panel A: Cystatin C immunostaining of skin biopsies from the proband. Panel B: Cystatin C immunostaining of skin biopsies from parents. [Figure 8B] Figure 8B: Efficacy of NAC therapy in HCCAA patients. Cystatin C immunostaining (brown staining) was performed using rabbit anti-human cystatin C antibody on three separate skin biopsies obtained from the same location on the back of two members of the HCCAA family who were carriers of the hCC L68Q variant. Biopsies in each left panel (skin biopsy #1 in Figures 8A and 8B) were obtained when the family joined the study more than two years prior to the start of this work. Biopsies in the center panel (skin biopsy #2 in Figures 8A and 8B) were taken approximately 18 months later. Biopsies in the right panel of both subjects (skin biopsy #3 in Figures 8A and 8B) show deposition of the cystatin C protein complex after 6 months of treatment with NAC. Significant reductions were observed in the proband (panel A) and parent (panel B) after 6 months of NAC therapy. Panel A: Cystatin C immunostaining of skin biopsies from the proband. Panel B: Cystatin C immunostaining of skin biopsies from parents. [Figure 8C] Figure 8C. Cyst-C monomer can be detected in subjects with reduced blood concentrations due to the L68Q mutation. A high molecular weight complex appears to exist in one carrier who does not take NAC. [Modes for carrying out the invention]
[0018] To create a system to test the ability of compounds to affect hCC multimerization while gaining some insight into their toxicity, cell lines expressing large amounts of wild-type or mutant hCC were created. The characteristics of the cell lines and the monomeric and multimeric hCCs they produce were investigated and used in experiments to non-toxically interfere with the aggregation of mutant proteins. Furthermore, biomarker studies using NAC were conducted to treat human subjects with HCCAA.
[0019] This system facilitates the evaluation of the molecule's ability to inhibit the aggregation of mutant hCC, while also providing information on its toxicity to cells or organisms. Clones of 293T cells overexpressing wild-type or mutant hCC were generated. These cells produce and secrete detectable levels of hCC. Importantly, conditions were established that allowed for the detection of high molecular weight complexes formed in both the lysates and supernatants of cells expressing mutant hCC, which are not present in cells expressing equivalent amounts of wild-type protein. High molecular weight complexes of mutant hCC can be detected by Western blotting under non-reducing conditions. Interestingly, short-term incubation of either the lysate or supernatant with either reduced glutathione (GSH) or N-acetylcysteine (NAC) as two reducing agents degrades the mutant oligomers to monomers. Furthermore, treatment of L68Q hCC-expressing cells with either NAC or GSH reduces the oligomerization of secreted hCC L68Q at 24, 48, and 72 hours. Patients with HCCAA were subsequently treated with NAC for 6 months. As a biomarker of response, skin biopsies were obtained to determine whether amyloid cystatin C complex staining was reduced in the skin after treatment. The proband was at the highest dose, used NAC for 9 months to treat pulmonary mucus plugs, had previously experienced three major strokes in the 9 months prior to initiating NAC, and showed approximately 75% reduction in amyloid staining in the skin, and was event-free for 18 months of NAC therapy.
[0020] In summary, this study provides a novel cell model for testing new therapies for the treatment of HCCAA and clearly demonstrates that mutant hCC is a pharmacological target for reducing agents such as NAC. Most importantly, the data, based on skin biomarker results from three patients with HCCAA, suggest that NAC is relevant as a potentially useful therapy for treating this devastating disease.
[0021] The following definitions are provided to supplement the understanding of the subject matter considered to be the present invention.
[0022] In this invention, "a" or "an" means "at least one" or "one or more" unless otherwise clearly indicated by the context. The term "or" means "and / or" unless otherwise specified. However, in the case of multiple dependent claims, the use of the term "or" refers to multiple prior claims, but only alternatives.
[0023] As used herein, "human cystatin C (hCC)" refers to a protein belonging to the cystatin superfamily that functions as a cysteine protease inhibitor. hCC is a secreted 2-cystatin and is expressed in all nucleated human cells. L68Q-hcc refers to a mutant hCC in which leucine at position 68 is replaced with a glutamine variant.
[0024] The terms “drug” and “test compound” are used interchangeably herein and refer to chemical compounds, mixtures of compounds, biomacromolecules, or extracts made from biological materials such as bacteria, plants, fungi, or animals (especially mammals), cells, or tissues. Biomacromolecules include siRNA, shRNA, antisense oligonucleotides, peptides, peptide / DNA complexes, and nucleic acid-based molecules that exhibit the ability to modulate the activity of hCC. Exemplary drugs include reducing agents such as NAC and its derivatives, used alone and in combination. Other useful drugs include, but are not limited to, glutathione, monensin, papain, cathepsin B, and farsipain. The biological activity of such drugs may be evaluated by screening assays described below herein.
[0025] As used herein, “treatment” encompasses the administration or application of therapeutic agents for a disease in mammals, including humans, and means inhibiting or slowing the progression of the disease or the disease or its progression, halting its development, partially or completely alleviating the disease, preventing the onset of the disease, or preventing the recurrence of symptoms of the disease. Exemplary treatments include the administration of at least one NAC derivative in an effective dose.
[0026] The terms “inhibit” or “inhibit” refer to a property that results in a reduction or cessation of any event (such as fibril formation), a reduction or cessation of a phenotypic property, or a reduction or cessation of its occurrence, degree, or possibility. “Reduce” or “inhibit” means to reduce, decrease, or block activity, function, and / or quantity compared to a standard. The suppression or reduction does not necessarily have to be complete. For example, in certain embodiments, “reduce” or “inhibit” means the ability to cause an overall reduction of 20% or more. In another embodiment, “reduce” or “inhibit” means the ability to cause an overall reduction of 50% or more. In yet another embodiment, “reduce” or “inhibit” means the ability to cause an overall reduction of 75%, 85%, 90%, 95%, or more.
[0027] The term "inhibitor" refers to a drug that slows down or prevents a particular chemical reaction, signaling pathway, or other process, or a drug that reduces the activity of a particular reactant, catalyst, or enzyme.
[0028] The terms "patient" and "subject" are used interchangeably to refer to mammals, including humans.
[0029] N-acetylcysteine (NAC) is a cysteine derivative that reduces disulfide bonds associated with fibrillation, which are present in neurodegenerative diseases such as HCCAA and Alzheimer's disease. While NAC and its ester derivatives are exemplified herein, other NAC derivatives are known in the art and are described in the following patent documents: US3242052, US3591686, US3647834, US3749770, US4016287, US4132803, US4276284, US4331648, US4708965, and US47117. This is described in 80, US4721705, US4724239, US4827016, US4859653, US4868114, US4876283, DE150694C, EP0219605A2, EP0219455A2, EP0269017A2, EP0280606A1, EP0304017A2, and EP0339508A1.
[0030] As used herein, “nucleic acid” or “nucleic acid molecule” refers to a single-stranded or double-stranded DNA or RNA molecule, and, in the case of a single-stranded molecule, whether its complementary sequence is linear or circular. In discussion of nucleic acid molecules, the sequence or structure of a particular nucleic acid molecule may be described herein in accordance with the usual convention of providing the 5' to 3' sequence.
[0031] In relation to the nucleic acids of the present invention, the term “isolated nucleic acid” is sometimes used. When applied to DNA, this term refers to a DNA molecule isolated from a sequence that is immediately continuous in the naturally occurring genome of the organism from which it originates. For example, “isolated nucleic acid” may include a DNA molecule inserted into a vector such as a plasmid or viral vector, or incorporated into the genomic DNA of a prokaryotic or eukaryotic cell or host organism.
[0032] When applied to RNA, the term “isolated nucleic acid” primarily refers to RNA molecules encoded by isolated DNA molecules as defined above. Alternatively, the term may refer to RNA molecules that are sufficiently isolated from other related nucleic acids in their natural state (i.e., cells or tissues). Isolated nucleic acid (either DNA or RNA) may further represent molecules that are produced directly by biological or synthetic means and separated from other components present during their production.
[0033] A "replicon" is a genetic element such as a plasmid, cosmid, bacmid, phage, or virus that can replicate primarily under its own control. Replicons can be RNA or DNA, and can be single-stranded or double-stranded.
[0034] A “vector” is a replicon, such as a plasmid, cosmid, bacmid, phage, or virus, that can bind to another gene sequence or element (DNA or RNA) and cause replication of the bound sequence or element. Exemplary vectors of the present invention include, but are not limited to, adenovirus-based vectors, adeno-associated virus vectors, and retroviral vectors.
[0035] An "expression operon" refers to a nucleic acid segment that contains and promotes transcriptional and translational regulatory sequences such as promoters, enhancers, translation initiation signals (e.g., ATG or AUG codons), polyadenylation signals, and terminators, thereby promoting the expression of polypeptide coding sequences in host cells or organisms.
[0036] The terms “isolated protein” or “isolated and purified protein” are used as sometimes as used herein. This term primarily refers to proteins produced by the expression of isolated nucleic acid molecules of the present invention. Alternatively, this term may refer to proteins sufficiently isolated from other naturally related proteins to exist in a “substantially pure” form. “Isolated” does not mean to exclude artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that may be present, for example, by incomplete purification, addition of stabilizers, or formulation into immunogenic or pharmaceutically acceptable formulations, without interfering with the basic activity.
[0037] The term "substantially pure" refers to a preparation containing at least 50–60% by weight of a given material (e.g., nucleic acids, oligonucleotides, proteins, etc.). More preferably, the preparation contains at least 75% by weight, most preferably 90–95% by weight, of the given compound. Purity is measured by a method suitable for the given compound (e.g., chromatography, agarose or polyacrylamide gel electrophoresis, HPLC analysis, etc.).
[0038] The terms “tag,” “tag sequence,” or “protein tag” refer to a chemical portion of any of the following: nucleotide, oligonucleotide, polynucleotide, or amino acid, peptide, or protein, or any other chemical substance, which, when added to another sequence, provides additional utility or useful properties to that sequence, particularly in detection or separation. Therefore, for example, a nucleic acid sequence complementary to a homopolymerized nucleic acid sequence or a captured oligonucleotide may be added to a primer or probe sequence to facilitate the subsequent isolation of the elongation or hybridization product. In the case of protein tags, histidine residues (such as 4-8 consecutive histidine residues) can be added to the amino or carboxyl terminus of a protein to facilitate protein separation by chelation using metal chromatography. Alternatively, amino acid sequences, peptides, proteins, or fusion partners (e.g., flag epitopes, c-myc epitopes, transmembrane epitopes of influenza A virus hemagglutinin protein, protein A, cellulose-binding domains, calmodulin-binding proteins, maltose-binding proteins, chitin-binding domains, glutathione S transferase, etc.) representing epitopes or binding determinants that react with specific antibody molecules or other molecules can be added to proteins to facilitate protein separation by procedures such as affinity chromatography and immunoaffinity chromatography. Chemical tag portions include molecules such as biotin, which can be added to either nucleic acids or proteins to facilitate separation or detection through interaction with reagents such as avidin. Numerous other tag portions are known to trained artisans, can be imagined, and are considered to fall within this definition.
[0039] As used herein, the terms “reporter,” “reporter system,” “reporter gene,” or “reporter gene product” mean an operable gene system in which a nucleic acid contains a gene encoding a product that produces a reporter upon expression, such as a signal readily measurable by biological assays, immunoassays, radioimmunoassays, or by colorimetric, fluorescence, chemiluminescence, or other methods. The nucleic acid is either RNA or DNA, linear or circular, single-stranded or double-stranded, antisense or sense polarity, and is functionally linked to regulatory elements necessary for the expression of the reporter gene product. The necessary regulatory elements vary depending on the nature of the reporter system and whether the reporter gene is DNA or RNA, and include, but are not limited to, elements such as promoters, enhancers, translational control sequences, polyaddition signals, transcription termination signals, etc.
[0040] The terms “transformation,” “transfect,” and “transduction” refer to any method or means that can be used interchangeably to introduce nucleic acids into cells or host organisms and to convey the same meaning. Such methods include, but are not limited to, transfection, electroporation, microinjection, and PEG fusion.
[0041] The introduced nucleic acid may be incorporated into (but not covalently bonded to) the nucleic acid of the recipient cell or organism. For example, in bacterial, yeast, plant, and mammalian cells, the introduced nucleic acid may be maintained as an episomal element or an independent replicon such as a plasmid. Alternatively, the introduced nucleic acid may be incorporated into the nucleic acid of the recipient cell or organism, stably maintained within that cell or organism, and further inherited or hereditary by the recipient cell or organism's offspring cells or organisms. In other ways, the introduced nucleic acid may exist only transiently in the recipient cell or host organism.
[0042] A "clone" or "clonal cell population" is a group of cells that originate from a single cell or a common ancestor through mitosis.
[0043] A "cell line" is a clone of primary cells or a cell population that can grow stably in vitro over many generations.
[0044] HCCAA and other methods and uses of treatment for neurodegenerative disorders This specification includes methods for treating the subject HCCAA and other neurodegenerative disorders, comprising administering an effective amount of NAC or a functional derivative thereof. As used herein, the term “treatment” includes the administration or application of a therapeutic agent for the subject disease or disorder, the inhibition of the disease, the cessation of its onset, the alleviation of the symptoms of the disease, or the prevention of its occurrence or recurrence.
[0045] In some embodiments, the treatment method includes identifying or diagnosing a subject having a genetic alteration in hCC that causes HCCAA, and administering NAC or a functional derivative thereof to the identified or diagnosed subject. In other embodiments, the subject has different diseases related to pathological fibrillation, including but not limited to Alzheimer's disease.
[0046] One or more total therapeutic doses (when adjusting for two or more targets) can be administered to the subject as a single dose, or using a divided therapy protocol that administers multiple / separate doses over a longer period, for example, over a day to allow for the administration of a daily dose, or over a longer period to administer the dose over a desired period. A person skilled in the art will know that the amount of therapeutic agent required to obtain an effective dose in a subject depends on many factors, including the subject's age, weight, and general health, as well as the route and number of therapies administered. Taking these factors into consideration, a person skilled in the art will adjust a particular dose to obtain an effective dose for treating an individual with HCCAA.
[0047] The effective dose of the therapeutic agent depends on the method of administration and the body weight of the individual being treated. The doses described herein are generally average adult doses but can be adjusted for the treatment of children. Doses generally range from approximately 0.001 mg to approximately 1000 mg.
[0048] In individuals suffering from more severe forms of the disease, the administration of therapeutic agents may be particularly useful, for example, when administered in combination with conventional drugs used to treat such diseases. Those skilled in the art would administer therapeutic agents alone or in combination and monitor the effectiveness of such treatment using routine methods such as neurological or pulmonary function assessments, radiological or immunological assays, or histopathological methods, if indicated.
[0049] The administration of the pharmaceutical formulation is preferably an "effective dose," which is sufficient to show benefit to the individual. This dose prevents, alleviates, reduces, or mitigates the severity of the patient's HCCAA symptoms. Treatment of patients with HCCAA with an effective dose of NAC or a functional derivative may result in improvements in neurological function, respiratory function, gradual reduction of concomitant drug use, or increased survival.
[0050] Pharmaceutical preparations are formulated in dosage units for ease of administration and uniformity of dosage. As used herein, dosage unit forms refer to physically distinct units of the pharmaceutical preparation appropriate for the patient receiving treatment. Each dose must contain an amount of the active ingredient calculated to produce the desired effect in relation to the selected pharmaceutical carrier. Procedures for determining appropriate dosage units are well known to those skilled in the art.
[0051] The dosage unit may be increased or decreased proportionally based on the patient's weight. The appropriate concentration for alleviating a specific pathological condition can be determined by calculating a dose-concentration curve, as is known in the art.
[0052] Pharmaceutical compositions useful in the methods of the present invention may be administered via parenteral, oral solid and liquid formulations, subcutaneous, intradermal, intramuscular, sublingual, topical, intraperitoneal, intranasal, transdermal, respiratory, ophthalmic, suppositories, aerosols, topical or other known routes of administration. In addition to agents useful for treating HCCAA, pharmaceutical compositions may include pharmaceutically acceptable carriers and other components known to facilitate and enhance drug delivery. Thus, such compositions may optionally include other components such as adjuvants, e.g., aqueous suspensions of aluminum hydroxide and magnesium hydroxide, and / or other pharmaceutically acceptable carriers such as saline. Other possible formulations, such as nanoparticles, liposomes, resealed red blood cells, and immunology-based systems, may also be used to deliver / administer appropriate agents to patients according to the methods of the present invention. The use of nanoparticles for delivering such agents and available cell membrane-permeable peptide carriers is described in Cromez et al., Biochemical Society Transactions v35:p44 (2007).
[0053] The pharmaceutical composition may also include anti-inflammatory agents for concomitant administration to further alleviate the symptoms of amyloid disease. These include, but are not limited to, corticosteroids, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, tolmetin, interleukins, cytokine receptors for IL-4, IL-6, IL-10, IL-11, IL-13, and IL-1, tumor necrosis factor-α, IL-18 and its derivatives and biosimilars.
[0054] To facilitate the implementation of the present invention, the following materials and methods are provided.
[0055] Cells and hCC WT and L68Q variant expression constructs Human fetal kidney 293 (HEK-239T) cells were obtained from ATCC (Manassas, Virginia) and grown at 37°C in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum. Plasmids containing CST3 cDNA were obtained from Dharmacon (Lafayette, CO). The full-length coding sequence was amplified with a c-terminal Myc tag by PCR using forward primer GATCGAATTCGCCACCATGGCCGGGCCCCTGCGCG (SEQ ID NO:1) and reverse primer TCGCGGCCGCCTACAGATCCTCTTCTGAGATGAGTTTTTGTTCGGCGTCCTGACAGGTGGATTTCG (SEQ ID NO:2) and NotI site ligation. The CMV-Puro.58 L68Q mutation was amplified with a c-terminal Myc tag by PCR using primers GTGAACTACTTCTTGGACGTCGAGCAGGGCCGAACCACGTGTACC (SEQ ID NO:3) and GGTACACGTGGTTCGGCCCTGCTCGACGTCCAAGAAGTAGTTCAC (SEQ ID NO:4). All sequences were confirmed by Sanger sequencing. Following the manufacturer's protocol, wild-type and mutant constructs were transfected into HEK-293T cells using Fugene HD (Promega, Madison, Wisconsin) with 3 μg of DNA and 9 μl of transfection reagent. After transfection, cells were incubated in fresh medium containing puromycin (1 μg / ml) for 3 weeks. After selection, stable clones of each transfectant were generated by limiting dilution. Clones were screened by Western blotting using the anti-hCystatin C antibody MAB1196 (R&D, Minneapolis, Minnesota).
[0056] Western blot method HEK-293T cells expressing hCC WT or the L68Q variant were washed twice with ice-cold phosphate-buffered saline (PBS) and lysed on ice using a freshly prepared ice-cold cell lysis buffer containing 20 μl per 1 mL of 50 mM Tris-HCl, pH 7.4, 100 mM NaCl, 50 mM β-glycerophosphate, 10% glycerol (w / v), 1% NP-40 (w / v), 1 mM EDTA, 2 mM NaVO4, and a completely EDTA-free protein inhibitor cocktail (Roche Applied Science, Mannheim Germany) lysis buffer. After removing the cell lysate by centrifugation (10 min, 21,000 × g, 4°C), the supernatant was collected and used for Western blotting. A sample buffer containing SDS, glycerol, Tris-HCl pH 6.8, and bromophenol blue was added to each sample until the final concentration was 2% SDS, 10% glycerol, 50 mM Tris-HCl, and 0.02% bromophenol blue. For samples with reduced concentration, DTT (final concentration 50 mM) or β-mercaptoethanol (final concentration 5%) was added. Equal volumes of lysate or supernatant samples were loaded onto NuPAGE 4-12% Bis-Tris gels (Thermo Fisher Scientific, Waltham, Massachusetts) without heating / boiling. Proteins were transferred to PVDF membranes (Millipore, Billerica, Massachusetts), blotted with anti-hCystatin C, and colored by chemiluminescence enhancement (ECL; Thermo Fisher Scientific). ECL films were scanned, and band density was determined using the gel analysis function of Fiji.59.
[0057] Drug treatment HEK-239T cells were seeded in 6-well plates and cultured for 2 days, at which point reduced glutathione (GSH) (Sigma, Missouri, St. Louis) or N-acetylcysteine (NAC) (Sigma) was added at the specified concentration. Cells were incubated with the compound for 72 hours, and 100 μl of the supernatant sample was removed at 24, 48, and 72 hours. The supernatant was removed by centrifugation (10 min, 21,000 × g, 4°C). Sample buffer containing SDS, glycerol, Tris-HCl pH 6.8, and bromophenol blue was added to each sample until the final concentration of 2% SDS, 10% glycerol, 50 mM Tris-HCl, and 0.02% bromophenol blue was reached. If instructed, cells were washed with PBS, lysed, and cystatin C levels were determined by Western blotting.
[0058] statistical analysis The mean and standard deviation of the data were calculated. A one-sided t-test was used to determine the level of significance for the untreated sample, and p<0.05 was considered statistically significant.
[0059] NAC treatment for HCCAA patients Three 4 mm skin biopsies were taken from the back of each of the three individuals studied. The skin biopsies were formalin-fixed and paraffin-embedded. These were cut into 3 μm sections for immunohistochemistry and immunostained with rabbit polyclonal cystatin C antibody (Sigma, HPA013143) using the EnVision Detection System described above. 22 hCC immunoreactivity in carrier skin biopsies was quantified by semi-automated image analysis using the aforementioned ImageJ software. 22 Bright-field images of each section from the carrier were captured using a ×20 / 0.3NA objective lens. The RGB color images of the sections were imported into ImageJ. A rectangular 2000×2000 pixel region of interest (ROI) was defined in each image. Subsequent processing to generate % regional coverage of hCC immunoreactivity within each ROI was performed as described above. 22The first biopsy was a historic one, performed approximately two years before the start of the study. The proband had received NAC therapy (400 mg four times a day) for more than nine months to treat pulmonary mucus blockage after his third stroke. The second biopsy was performed just before the entire family began NAC therapy (600 mg of NAC three times a day for six months). The third biopsy was performed three times six months after the start of 600 mg of NAC therapy.
[0060] The proband received 400 mg of NAC four times a day for nine months, followed by 600 mg three times a day for six months. The parent received only 600 mg three times a day for six months. The proband never missed a dose, while the parent missed two to three intermediate doses per week.
[0061] Approval of the test All necessary authorizations for the use of skin biopsies from L68Q-CST3 carriers, and records related to the samples and medical information, were obtained from the National Bioethics Committee of Iceland, reference numbers 04-046-S2 and 15-060-S1. Both family members signed informed consent forms containing the information. NAC therapy was prescribed clinically and incidentally as a mucolytic therapy to treat the proband's pulmonary atelectasis. The other family member took NAC as a dietary supplement (i.e., purchased NAC online from Amazon).
[0062] The following examples are provided to illustrate specific embodiments of the present invention. They are not intended to limit the invention in any way. [Examples]
[0063] As previously mentioned, HCCAA is a dominant genetic disorder caused by a variant of human cystatin C from leucine 68 to glutamine (hCC; L68Q-hCC) (see reference). Most carriers of the mutation develop microinfarcts and cerebral hemorrhages in their 20s, with an average lifespan of 30 years (1-5), leading to paralysis, dementia, and death in young adulthood. Postmortem studies in humans show that hCC is most prominently deposited in all brain regions, gray matter, as well as in arteries and arterioles. These deposits consist of amyloid fibrils composed of hCC. This can be demonstrated by staining postmortem tissue with Congo red stain, which shows birefringence of amyloid structures under polarized light (6).
[0064] To create a system to test the ability to influence hCC multimerization while investigating the toxicity of compounds, we created cell lines expressing large amounts of wild-type or mutant hCC. This example describes the characterization of the cell lines and the monomeric and polymeric hCCs they produce, an attempt to non-toxically inhibit the aggregation of mutant proteins, and a pilot biomarker study using NCC to treat subjects with HCCAA.
[0065] Genetically modified HEK-293T cells produce and secrete hCC (wt or L68Q) that can be oligomerized under non-reducing conditions. To identify therapeutic agents capable of halting the production of L68Q hCC oligomers and fibrils, recombinant HEK-293T cells expressing either wild-type (WT) or L68Q variant hCC were generated. The proteins were tagged with a myc tag at the c-terminus, and c-terminal tagging was chosen to avoid interference with secretion of the produced protein, which could result from signal peptide cleavage or n-terminal tagging. After stably incorporating these constructs into HEK-293T cells, both secretion and intracellular steady-state levels of hCC WT and the L68Q variant were monitored. hCC analysis was developed using an SDS-PAGE gel electrophoresis system, which allows for the formation and detection of low and high molecular weight oligomers (LMW and HMW). As shown in Figure 1A, the cells produce and secrete detectable levels of both oligomerizable hCC WT or variant L68Q under non-reducing conditions (lanes #1 and #3). WT and L68Q-expressing cells contain similar levels of hCC protein in their lysates and exhibit similar expression levels. However, the controlled supernatant of L68Q-expressing cells contains significantly less hCC protein than the supernatant of WT-expressing cells. This is consistent with previous reports (17, 18) indicating that L68Q variant proteins are not secreted from cells as efficiently as WT. Intracellular hCC WT exists primarily as monomers with a low proportion of dimers (99% and 1%, respectively), while intracellular hCC L68Q variants were found to form monomers and dimers, but with an increased tendency to form oligomers, so LMW and HMW species were also formed as expected (19). Interestingly, secreted hCC WT behaves similarly to the intracellular fraction and is found primarily as monomers. In contrast, secreted hCC L68Q is detected only as HMW. Notably, oligomerization of both WT and L68Q variant proteins is completely abolished in the presence of the reducing agent DTT or β-mercaptoethanol. Both are powerful reducing agents that cause typical disulfide bond reduction.
[0066] Immunofluorescence assays were performed to detect levels of hCC protein in non-transfected or WT and L68Q-expressing 293T cells. hCC protein was primarily expressed in the cytoplasm. This showed an intracellular distribution consistent with previously reported localization in late endosomes / plelysosomes and Golgi / ER / early endosomal compartments, the latter being in good agreement with the typical characteristics of secreted proteins (20).
[0067] Incubation with glutathione impairs the hCC di / oligomerization of cell extracts and supernatants. The depletion of LMW and HMW in the presence of DTT or β-mercaptoethanol highlights the importance of disulfide bonds in the dimerization / oligomerization process. Therefore, we hypothesize that treatment with other reducing agents impairs dimerization. We extensively characterized the effects of reducing agents on dimerization / oligomerization levels at both secretory and intracellular levels for hCC WT and L68Q variants. Supernatants and cell extracts were treated with different concentrations of GSH at 37°C for 15 minutes. In particular, as shown in Figure 2A, treatment with 3 or 10 mM GSH significantly reduced the amount of dimers and / or HMW oligomers observed in both the secretory and intracellular fractions of hCC WT or L68Q variants. Quantification of these results by densitometry showed that 3 mM GSH inhibited approximately 90% of HMW in the secretory fraction and approximately 50% in the intracellular fraction of the L68Q hCC variant (Figures 2A and 1B).
[0068] Incubation with NAC or glutathione impairs the dimerization of secreted hCC L68Q. The oxidative / reduced glutathione pair is crucial for combating oxidative stress and can effectively disrupt hCC dimers and HMW oligomers, as shown in Figure 2. Therefore, we analyzed whether the commonly used dietary supplement NAC (which has similar antioxidant effects to GSH) affects the oligomerization / dimerization of secreted hCC. Supernatants were treated with different concentrations of GSH and NAC at 37°C for 60 minutes. As shown in Figure 3A, treatment with 3 or 10 mM glutathione or NAC significantly reduced the oligomerization / dimerization levels of secreted hCC L68Q variants in vitro. Quantitative analysis showed near-complete removal of HMW at either a 3 mM concentration of GSH or NAC (Figures 3A and 2B). This result clearly indicates that GSH or NAC may reduce the oligomerization levels of pathogenic versions of hCC L68Q and could potentially be used in the treatment of patient HCCAA.
[0069] The presence of GSH or NAC reduces the oligomerization of cystatin C L68Q secreted at 24, 48, and 72 hours. To investigate whether the effects of NAC or GSH reduce the oligomerization of secreted hCC L68Q in cell lines that better reflect in vivo biology, cells expressing hCC WT or L68Q were treated with both agents. Cells were seeded on plates and allowed to secrete hCC for 48 hours, at which point the concentration of GSH or NAC was increased and added to the culture medium. Cells were cultured in the presence of a reducing agent for 72 hours, and supernatant samples were removed at 24, 48, and 72 hours. The oligomerization status of hCC was determined by Western blotting at each time point. Cells were viable throughout the experimental period in the presence of both reducing agents at all concentrations (up to 10 mM). Cell proliferation was slightly affected at the highest 10 mM concentration (data not shown). As shown in Figure 4 (and Figure 3B), treatment of cells with 10 mM GSH or NAC resulted in the complete elimination of HMW and LMW at 24 and 48 hours, and a significant, but incomplete, reduction of HMW and LMW persisted at 72 hours. Treatment with low doses of NAC or GSH was only partially effective at 24 and 48 hours, and no significant effect was detected at 72 hours.
[0070] Treatment with reducing agents such as NAC or with reduced glutathione in either the supernatant or cell extracts of cell lines designed to overexpress mutant versions of human cystatin C (Cyst-C) clearly reduces the formation of macromolecular complexes of L68Q mutant Cyst-C. To determine whether the effects of NAC and GSH are due to their reducing ability or other properties of the compounds, the supernatant and cell extracts were treated with compounds structurally similar to NAC and GSH but lacking reducing activity. As shown in Figure 5, treatment with n-acetylserine (NAS), in which the reducing sulfhydryl group of NAC is substituted with a hydroxyl group, or with the oxidized form of glutathione (GSSH), resulted in a significant reduction in L68Q Cyst-C, and both reducing agents showed a significant decrease. The reducing activity of either NAC or GSH is required for their effect on Cyst-C oligomerization.
[0071] Multiple derivatives of NAC were generated exhibiting improved reducing activity and bioavailability, as well as the ability to cross the blood / brain barrier. Two NAC derivatives were tested in our cell culture system. As shown in Figure 6, both the amide and methyl ester derivatives of NAC retained the ability to disrupt the high molecular weight complex of L68Q Cyst-C when the supernatant or cell extract was treated in vitro. Our data also suggest that both derivatives may be slightly potent in their ability to disrupt oligomerization, as the loss of high molecular weight signal was observed in the 1 mM derivatives equivalent to that seen in 10 mM NAC.
[0072] Additional results were generated from transgenic mice obtained from collaborator Eufrat Levy at New York University. These mice were transformed with human genomic DNA containing the coding sequence for Cyst-C, but without any non-coding portions of the gene that could affect expression levels. The mice did not exhibit a phenotype comparable to that of HCCAA. However, as shown in Figure 7, we were able to demonstrate the presence of high molecular weight Cyst-C complexes in both the brain and blood of the transgenic animals. Western blots from mouse tissue extracts are not as clean as blots from cell lines because the antibodies used for detection were generated in the mice. Despite this complication, comparisons between transgenic mice (numbers 6028 and 6019) and non-transgenic C57Bl6 animals show a significant signal induced by transgenic human Cyst-C. While several non-specific high molecular weight bands are observed in non-transgenic samples, a distinct high molecular weight "smear" is seen in transgenic animals, consistent with that observed in the supernatant of cell culture systems. Treatment with NAC reduces this smear and causes monomer appearance. This indicates that NAC can reduce oligomerization of biological samples.
[0073] The efficacy of NAC therapy in HCCAA patients In Iceland, there are hundreds of patients suffering from HCCAA (i.e., suffering a major stroke in their early twenties), all of whom are thought to have a founder mutation from the early 1500s. RNA sequencing was performed on 30 subjects from three multiple families and showed that genes involved in coronary artery disease, stroke, and atherosclerosis are upregulated in cystatin C mutation carriers. Reversing the disease process would be readily approved by the Icelandic Pharmacy. Amyloid fibril dimerization is a critical step in the process of amyloid deposition in small to medium-sized cerebral arteries. Cell-based assays show that both wild-type and mutant proteins are expressed, and that the expression of the mutant protein dimerizes. This is a process that is inhibited. Therefore, drugs that block amyloid fibril dimerization are expected to be effective in preventing amyloid deposition and halting the progression of the disease process, thereby offering an effective treatment.
[0074] Figure 8A shows the changes in staining from biopsy 1, biopsy 2, and biopsy 3, all obtained two years prior, in all three patients six months after NAC therapy. Overall, the drug reduced the intensity of the skin biomarker (amyloid-cystatin protein aggregates) and suggests a reduction in amyloid deposition in other organs, as previously demonstrated (21).
[0075] Based on staining results measuring amyloid-cystatin protein complex aggregates in the skin, the proband, who had very high levels of amyloid-cystatin staining in the initial skin biopsy, was found not to have progressed significantly between skin biopsies #1 and #2. Her father and her brother (both also carriers of the L68Q variant) showed significant progression in the intensity of the plaque over time, reflecting an increase in the deposition of amyloid complexes in the skin, in the absence of NAC therapy. It is noteworthy that the proband had been taking NAC medication for approximately nine months to treat her lung condition. She discontinued treatment several months prior to the second biopsy. The second biopsy was initially performed as a baseline to serve as a biomarker response to subsequent NAC therapy.
[0076] The three biopsies from each individual were all stained simultaneously for legal comparison. The lead proband (three strokes in nine months) was 100% compliant with 600 mg of NAC therapy per day, and she showed a very noticeable reduction in amyloid staining compared to the original skin biopsy. It reached a 75% reduction at the end of a 6-month prospective treatment (Figure 8A). The reduction in staining in her father was 50%, and the reduction in staining in her sister's biopsy was not as pronounced, as the NAC dosage was lower, as shown in the Materials and Methods section.
[0077] Finally, blood samples were taken from seven members of an Icelandic family known to be carriers of the L68Q mutation. Five of the family members were in a known mutational state (three L68Q carriers, two wild-type), and DNA from all individuals was Sanger sequenced to confirm the known state and determine the state of individuals not previously tested, one of whom was found to carry the mutation. The relationship between the mutational state of this family and the proband is shown in Figure 8B. Western blotting of plasma runs under reducing conditions showed a decrease in total Cyst-C levels in adult carriers of the L68Q mutation (proband, siblings, and father). Carriers did not show a decrease in protein levels and showed a potential age-related effect (and was not affected by any treatment). Blotting of non-reduced samples showed the detection of high molecular weight complexes in child carriers. In other subjects, the interpretation of these results is complicated by the fact that all adult carriers of the mutation regularly take NAC. Oligomers may be detected in adult L68Q carriers who do not take NAC.
[0078] Both NAC derivatives are proposed to exhibit improved membrane permeability because they substitute hydroxyl groups with less polar substituents. Increased membrane permeability often correlates with better passage across the blood-brain barrier. To access the membrane permeability of the derivative compounds, live cells were treated with either NAC or the derivatives. If the compounds pass through the cell membrane, the effect of the derivatives on the accumulation of intracellular oligomers of L68Q Cyst-C is expected. As shown in Figure 6, the compounds reduced the amount of high molecular weight Cyst-C in the supernatant. The minimal effect on intracellular substances may be due to timing. Cells continuously produce L68Q Cyst-C at overexpression levels, and compounds entering the cells may be consumed immediately, resulting in an initial effect that is lost as culture continues.
[0079] discussion Identifying agents capable of reducing hCC dimerization and amyloid fibril formation is key to the development of drugs for the treatment and / or prevention of amyloid formation and fatal cerebral hemorrhage associated with HCCAA. hCC variants are the cause of HCCAA, and there is no treatment to avoid premature death due to cerebral hemorrhage. Here, we first created cells that produce and secrete detectable levels of hCC (wt or L68Q) that can oligomerize under non-reducing conditions, and show that short incubation with either GSH or NAC degrades the oligomers into monomers of intracellular and secreted hCC L68Q. Treatment with either NAC or GSH reduced oligomerization of secreted hCC L68Q at 24, 48, and 72 hours, and in a manner that shows that treatment with NAC in human patients not only prevents ongoing amyloid precipitation in the skin but also significantly reduces previously precipitated amyloid, a reduction of over 75% was observed after 6 months of well-tolerated oral therapy with no adverse events.
[0080] The developed cell system was constructed to identify agents that reduce hCC dimerization and amyloid fibril formation "in vivo" for both wt cystatin C and L68Q variants. While previous systems for studying hCC dimerization have been developed, most of them were performed primarily with wild-type cystatin C because it is very difficult to produce sufficient amounts of monomeric L68Q-cystatin C (14). Recombinant HEK-293T cells expressing both c-terminally tagged wt and L68Q hCC provide an excellent model for studying and characterizing the effects of small molecules at both secretory and intracellular levels of wt and L68Q hCC. It is important to emphasize, in particular, that, due to the different behaviors in the L68Q-hCC variant, it is necessary to study and characterize agents that reduce oligomerization in both fractions. This variant was mainly found as an LMW oligomer in the intracellular fraction, but mainly forms HMWs in the extracellular compartment. These are because the secretory process induces oligomerization of the L68Q variant, or because environmental conditions in the extracellular compartment promote oligomerization of this variant, or because oligomerization extends the protein's half-life.
[0081] L68Q cystatin C is highly amyloidogenic, and subjects with the corresponding mutation suffer from cerebral amyloidosis, leading to cerebral hemorrhage and death in early adulthood (16). Other amyloid diseases such as Alzheimer's disease, Parkinson's disease, and HD have similar amyloid origins, and they are also caused by the accumulation of misfolded proteins. This broad spectral effect of proteotoxic stress leads to the term “protein disorder” in neurodegenerative diseases. Interestingly, the risk of developing any of these neurodegenerative diseases increases dramatically with age, perhaps as a result of increased misfolding stress on proteins, decreased proteasome activity, and reduced antioxidant protection that promotes the extracellular accumulation of misfolded proteins (22). The proteasome and autophagy-lysosome pathways are the major pathways for intracellular aggregation clearance. However, little is known about the corresponding mechanisms that function extracellularly, or effective strategies to slow or prevent the neurodegeneration that results from these diseases in humans (23).
[0082] Glutathione (GSH) is synthesized in the cytosol from the precursor amino acids glutamic acid, cysteine, and glycine, and is considered the major endogenous antioxidant in cells. It is present in varying concentrations in the cytoplasm, sometimes as high as 10 mM depending on the intracellular compartment, and sometimes as low as 10 mM (24). Due to the high concentration of GSH, protein disulfide bonds are rarely formed in the cytosol, whereas, in contrast, the endoplasmic reticulum (ER) and the lumen of extracellular compartments contain relatively high concentrations of oxidized glutathione (GSSG) (25). This different distribution of GSH enables the formation of native disulfide bonds in the ER through a complex process that includes not only disulfide bond formation but also isomerization of non-native disulfide bonds. Our immunofluorescence studies and previous reports show that hCC is localized to the late endosome / prelysosome and Golgi / ER / early endosomal compartments (20). This localization is consistent with the typical characteristics of secreted proteins and supports the hypothesis that L68Q hCC polymerizes in these compartments where aggregation increases with decreased exposure to GSH, thereby explaining the aggregates released in the extracellular compartment.
[0083] Under normal conditions, GSH levels are controlled by two main mechanisms that regulate its synthesis rate and export rate from cells. However, GSH levels are also affected by agents or conditions that alter the thiol redox state, leading to the formation of glutathione S-conjugates or complexes, and / or conditions that disrupt the distribution of GSH among various intracellular organelles. Furthermore, GSH levels are influenced by nutritional status and hormone / stress levels, exhibit developmental and diurnal variations, and are affected by certain physiological conditions such as pregnancy and exercise (26-33). Physiological levels of GSH in the blood need to provide a suitable antioxidant environment to avoid extracellular accumulation of proteins, but as a result of nutritional status and age, the presence of mutations such as hCC L68Q or GSH level deficiencies can lead to the undesirable accumulation of misfolded proteins (3). Furthermore, GSH deficiency, or a decrease in the GSH / glutathione disulfide (GSSG) ratio, is known to manifest primarily as increased susceptibility to oxidative stress, and the resulting damage is thought to be involved in diseases such as Parkinson's disease and Alzheimer's disease, which are strongly associated with other age-related conditions (34, 35). The results shown in this study suggest that NAC may represent an interesting therapeutic approach for amyloid diseases such as HCCAA by reducing amyloid protein accumulation.
[0084] Acetylcysteine is a synthetic N-acetyl derivative of the endogenous amino acid L-cysteine, a precursor of the antioxidant enzyme glutathione. Both GSH and NAC are already approved for human use and are administered at high doses over long periods without adverse side effects. They act directly as reactive oxygen species (ROS) scavengers and as sources of SH groups, stimulating GSH synthesis and increasing the presence of 1) non-protein and 2) protein SH groups. In addition, acetylcysteine also regenerates hepatic stores of GSH. These effects give NAC the ability to reduce disulfide bonds, which is why NAC is widely used to reduce mucus viscosity and elasticity among other applications. Our data show that treatment with antioxidants such as GSH and NAC (and DTT or beta-MetOH) inactivates hCC oligomerization. This effect indicates that disulfide bond formation is essential for the oligomerization process. Although disulfide bonds do not appear to be directly involved in the dimerization process (16), human cystatin C has two disulfide bonds (as with all type 2 cystatins), and their conservation in the dimer structure indicates its important role in the dimerization process (16). We hypothesize that intramolecular disulfide bonds are essential for the correct folding of the hCC monomer and for preventing the exchange of three-dimensional "subdomains" between the two subunits of the dimer and oligomerization.
[0085] Our data show that treatment with NAC increases GSH production, and both antioxidants reduce oligomerization of secreted hCC, thereby reducing amyloid formation in the brains of HCCAA patients. While treatment with GSH may be effective, its low bioavailability limits its potential as a therapeutic agent for HCCAA patients. NAC appears to be a perfect candidate due to its role in restoring GSH levels, its antioxidant properties, and its ability to break disulfide bonds, as reviewed in (36). Furthermore, NAC supplementation significantly improved coronary and peripheral vasodilation (37). NAC, specifically targeted at brain damage, has been administered with some efficacy to patients with Alzheimer's disease (38), and our data suggest it could be an excellent alternative to HCCAA.
[0086] Because the cell membrane, along with the blood-brain barrier, exhibits reduced permeability to NACs, extracellular NAC treatment does not appear to affect the intracellular dimerization state of L68Q hCCs (no data references). Therefore, the effects of NAC derivatives, including but not limited to N-acetylcysteine ethyl ester (NACET) or N-acetylcysteine methyl ester, are administered. These novel lipophilic cell-permeable membrane cysteine derivatives should offer suitable candidates for oral use as H2S producers in the treatment of amyloid diseases such as HCCAA (39).
[0087] The reduction observed in amyloid staining of skin biopsies following NAC treatment is very promising and indicates that this treatment is effective in treating HCCAA patients. Since amyloid precipitates in all organs, if a reduction is observed in the skin, there is no reason to believe that amyloid precipitation and accumulation are continuing in the brain. It is more likely that similar reductions are occurring in other organs of the body, including cerebral blood vessels and the brain. None of the three individuals have experienced any new events, all are continuing treatment, and the proband is now approximately two years after his third and last stroke.
[0088] It is noteworthy that a significant number of HCCAA patients in Iceland never experience a clinical stroke, only exhibiting dementia in early childhood. Since the disease process of amyloid precipitation in HCCAA patients is comparable to that of Alzheimer's disease, blocking the dimerization and polymerization ability of amyloid fibrils (enhanced by L68Q-cystatin C founder mutation cases) may help Alzheimer's patients with amyloid-associated dementia. Therefore, NAC therapy or NAC-like compounds may be beneficial for Alzheimer's disease.
[0089] The analogy here is familial combined hypercholesterolemia (FCH). Statins were developed to treat this familial condition (patients with FCH experience stroke and myocardial infarction in their 20s). Subsequently, it became clear that elevated cholesterol is harmful, a major risk factor for MI and stroke, and that patients with CV risk factors benefit from statin treatment. HCCAA promotes amyloid deposition, which occurs early in life and leads to the devastating events of the 20s and early dementia. This process is somewhat comparable, but slower in Alzheimer's disease, so dementia usually lasts until the mid-to-late 60s or 70s, but the treatment is the same.
[0090] literature 1.Palsdottir, A. et al.Mutation in cystatin C gene causes hereditary brain haemorrhage.Lancet 2,603-604(1988). 2. Abrahamson, M., Barrett, AJ, Salvesen, G. & Grubb, A. Isolation of six cysteine proteinase inhibitors from human urine. Their physicochemical and enzyme kinetic properties and concentrations in biological fluids. J Biol Chem 261, 11282-11289 (1986). 3.SnorradottirA.O. et al.Deposition of collagen IV and aggrecan in leptomeningeal arteries of hereditary brain haemorrhage with amyloidosis. Brain Res 1535, 106-114(2013). 4.Palsdottir,A.et al.A drastic reduction in the life span of cystatin C L68Q carriers due to life-style changes during the last two centuries.PLoS Genet 4,e1000099 (2008). 5.Gudmundsson,G.,Hallgrimsson,J.,Jonasson,T.A.&Bjarnason, O. Hereditary cerebral haemorrhage with amyloidosis.Brain 95,387-404(1972). 6.Osk Snorradottir,A.et al.Parenchymal cystatin C focal deposits and glial scar formation around brain arteries in Hereditary Cystatin C Amyloid Angiopathy. Brain Res 1622,149-162(2015). 7.Abrahamson,M.,Grubb,A.,Olafsson,I.&Lundwall,A.Molecular cloning and sequence analysis of cDNA coding for the precursor of the human cysteine proteinase inhibitor cystatin C.FEBS Lett 216,229-233(1987). 8.Grubb,A.&Lofberg,H.Human gamma-trace,a basic microprotein: amino acid sequence and presence in the adenohypophysis.Proc Natl Acad Sci U S A 79,3024-3027(1982). 9.Grubb,A.O.Cystatin C--properties and use as diagnostic marker. Adv Clin Chem 35,63-99(2000). 10.Henskens,Y.M.et al.Effect of periodontal treatment on the protein composition of whole and parotid saliva.J Periodontol 67,205-212(1996). 11.Turk,V.&Bode,W.The cystatins:protein inhibitors of cysteine proteinases.FEBS Lett 285, 213-219(1991). 12.Bode,W.et al.The 2.0 A X-ray crystal structure of chicken egg white cystatin and its possible mode of interaction with cysteine proteinases.EMBO J 7,2593-2599 (1988). 13.Orlikowska,M.,Jankowska,E.,Kolodziejczyk,R.,Jaskolski,M.&Szymanska,A.Hinge-loop mutation can be used to control 3D domain swapping and amyloidogene of human cystatin C.J Struct Biol 173,406-413(2011). 14.Kolodziejczyk,R.et al.Crystal structure of human cystatin C stabilized against amyloid formation.FEBS J 277,1726-1737 (2010). 15.Janowski,R.et al.Human cystatin C, an amyloidogenic protein,dimerizes through three-dimensional domain swapping.Nat Struct Biol 8,316-320(2001). 16.Janowski,R.,Abrahamson,M.,Grubb,A.&Jaskolski,M.Domain swapping in N-truncated human cystatin C.J Mol Biol 341,151-160(2004). 17.Janowski,R.,Kozak,M.,Abrahamson,M.,Grubb,A.& Jaskolski,M.3D domain-swapped human cystatin C with amyloidlike intermolecular beta-sheets.Proteins 61,570-578(2005). 18.Wahlbom,M.et al.Fibrillogenic oligomers of human cystatin C are formed by propagated domain swapping.J Biol Chem 282,18318-18326(2007). 19.Tsiolaki,P.L.,Louros,N.N.,Hamodrakas,S.J.& Iconomidou,V.A.Exploring the‘aggregation-prone’ core of human Cystatin C:A structural study. J Struct Biol 191, 272-280(2015). 20.Sipe,J.D.et al.Amyloid fibril protein nomenclature: 2012 recommendations from the Nomenclature Committee of the International Society of Amyloidosis.Amyloid 19,167-170(2012). 21.Palsdottir,A.,Snorradottir,A.O.&Thorsteinsson,L. Hereditary cystatin C amyloid angiopathy:genetic,clinical,and pathological aspects.Brain Pathol 16,55-59(2006). 22.Snorradottir,A.O.et al.Pathological changes in basement membranes and dermal connective tissue of skin from patients with hereditary cystatin C amyloid angiopathy.Lab Invest 97,383-394(2017). 23.Perlenfein, T.J.,Mehlhoff,J.D.&Murphy,R.M.Insights into the mechanism of cystatin C oligomer and amyloid formation and its interaction with beta-amyloid.J Biol Chem 292,11485-11498(2017). 24.Ostner,G.et al.High throughput testing of drug library substances and monoclonal antibodies for capacity to reduce formation of cystatin C dimers to identify candidates for treatment of hereditary cystatin C amyloid angiopathy.Scandinavian Journal of Clinical and Laboratory Investigation 71,676-682(2011). 25.Chen,J.,Armstrong,A.H.,Koehler,A.N.&Hecht,M.H.Small molecule microarrays enable the discovery of compounds that bind the Alzheimer’s Abeta peptide and reduce its cytotoxicity.J Am Chem Soc 132,17015-17022 2010). 26.Nilsson,M. et al.Prevention of domain swapping inhibits dimerization and amyloid fibril formation of cystatin C:use of engineered disulfide bridges,antibodies,and carboxymethylpapain to stabilize the monomeric form of cystatin C.J Biol Chem 279(2004). 27.Ostner,G.et al.Stabilization,Characterization,and Selective Removal of Cystatin C Amyloid Oligomers.Journal of Biological Chemistry 288,16438-16450(2013). 28.Pollak,J.,Szymanska,A.,Lindstrom, V.& Grubb,A.Production of Cystatin C Wild Type and Stabilized Mutants.EJIFCC 20,166-170(2010). 29.Bjarnadottir,M.et al.Intracellular accumulation of the amyloidogenic L68Q variant of human cystatin C in NIH / 3T3 cells.Mol Pathol 51,317-326(1998). 30.Benedikz,E.et al.Cellular processing of the amyloidogenic cystatin C variant of hereditary cerebral hemorrhage with amyloidosis,Icelandic type.Amyloid 6,172-182 (1999). 31.Thorsteinsson,L.et al.On the role of monocytes / macrophages in the pathogenesis of central nervous system lesions in hereditary cystatin C amyloid angiopathy.J Neurol Sci 108,121-128 (1992). 32.Wei,L.et al.Instability of the amyloidogenic cystatin C variant of hereditary cerebral hemorrhage with amyloidosis,Icelandic type.J Biol Chem 273,11806-11814 (1998). 33.Merz,G.S.et al.Human cystatin C forms an inactive dimer during intracellular trafficking in transfected CHO cells.J Cell Physiol 173,423-432(1997). 34.Xu,Y.,Lindemann,P.,Vega-Ramos,J.,Zhang,J.G.&Villadangos,J.A.Developmental regulation of synthesis and dimerization of the amyloidogenic protease inhibitor cystatin C in the hematopoietic system.J Biol Chem 289,9730-9740(2014). 35.Benedikz,E.,Blondal,H.&Gudmundsson,G. Skin deposits in hereditary cystatin C amyloidosis.Virchows Arch A Pathol Anat Histopathol 417,325-331(1990). 36.Unnithan, A.S., Choi,H.J.,Titler,A.M.,Posimo,J.M.&Leak,R.K.Rescue from a two hit,high-throughput model of neurodegeneration with N-acetyl cysteine.Neurochem Int 61,356-368 (2012). 37.Yerbury,J.J.,Stewart,E.M.,Wyatt,A.R.&Wilson,M.R.Quality control of protein folding in extracellular space.EMBO Rep 6,1131-1136(2005). 38.Lai,A.Y.&McLaurin,J.Clearance of amyloid-beta peptides by microglia and macrophages: the issue of what,when and where.Future Neurol 7,165-176 (2012). 39.Go, Y.M. & Jones, D.P. Redox compartmentalization in eukaryotic cells. Biochim Biophys Acta 1780, 1273-1290 (2008). 40.Hwang,C., Sinskey,A.J.&Lodish,H.F.Oxidized redox state of glutathione in the endoplasmic reticulum.Science 257,1496-1502(1992). 41.Lautwein,A.et al.Inflammatory stimuli recruit cathepsin activity to late endosomal compartments in human dendritic cells.Eur J Immunol 32,3348-3357(2002). 42.DeLeve,L.D.&Kaplowitz, N. Importance and regulation of hepatic glutathione. Semin Liver Dis 10,251-266 (1990). 43.Hahn, R.,Wendel,A.&Flohe,L.The fate of extracellular glutathione in the rat.Biochim Biophys Acta 539,324-337(1978). 44.Isaacs,J.T.& Binkley,F.Cyclic AMP-dependent control of the rat hepatic glutathione disulfide-sulfhydryl ratio.Biochim Biophys Acta 498,29-38(1977). 45.Kemp,M.,Go,Y.M.&Jones,D.P.Nonequilibrium thermodynamics of thiol / disulfide redox systems:a perspective on redox systems biology. Free radical biology&medicine 44,921-937(2008). 46.Lauterburg,B.H.,Smith,C.V.,Hughes, H. &Mitchell,J.R. Biliary excretion of glutathione and glutathione disulfide in the rat. Regulation and response to oxidative stress.J Clin Invest 73,124-133(1984). 47.Meister,A.&Tate,S.S.Glutathione and related gamma-glutamyl compounds: biosynthesis and utilization.Annu Rev Biochem 45,559-604(1976). 48.Meister,A.& Anderson,M.E.Glutathione.Annu Rev Biochem 52,711-760(1983). 49.Uhlig,S.&Wendel, A. The physiological consequences of glutathione variations.Life Sci 51,1083-1094(1992). 50.Ballatori,N.et al.Glutathione dysregulation and the etiology and progression of human diseases.Biol Chem 390,191-214(2009). 51.Samiec,P.S.et al.Glutathione in human plasma:decline in association with aging,age-related macular degeneration, and diabetes.Free radical biology&medicine 24,699-704(1998). 52.Atkuri,K.R., Mantovani,J.J.,Herzenberg,L.A.& Herzenberg,L.A.N-Acetylcysteine--a safe antidote for cysteine / glutathione deficiency.Curr Opin Pharmacol 7,355-359(2007). 53.Aitio,M.L.N-acetylcysteine -- passe-partout or much ado about nothing? Br J Clin Pharmacol 61,5-15(2006). 54.Bavarsad Shahripour,R.,Harrigan,M.R.&Alexandrov,A.V.N-acetylcysteine(NAC)in neurological disorders:mechanisms of action and therapeutic opportunities.Brain Behav 4,108-122(2014). 55.Andrews, N.P., Prasad, A. & Quyyumi, A.A. N-acetylcysteine improves coronary and peripheral vascular function. J Am Coll Cardiol 37, 117-123 (2001). 56. Adair, JC, Knoefel, JE & Morgan, N. Controlled trial of N-acetylcysteine for patients with probable Alzheimer's disease. Neurology 57, 1515-1517 (2001). 57. Giustarini, D., Milzani, A., Dalle-Donne, I., Tsikas, D. & Rossi, RN-Acetylcysteine ethyl ester (NACET): A novel lipophilic cell-permeable cysteine derivative with an unusual pharmacokinetic feature and remarkable antioxidant potential. Biochemical pharmacology 84, 1522-1533 (2012). 58.Cohen, GBet al.The selective downregulation of class I major histocompatibility complex proteins by HIV-1 protects HIV-infected cells from NK cells.Immunity 10,661-671(1999). 59. Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nat Methods 9,676-682(2012).
[0091] While certain preferred embodiments of the present invention have been described and specifically illustrated above, the invention is not intended to be limited to such embodiments. It will be apparent to those skilled in the art that various changes and modifications can be made without departing from the scope of the invention, as described in the appended claims.
Claims
1. A method for treating amyloidosis, comprising the step of delivering an effective amount of at least one antioxidant to a patient exhibiting amyloid disease, wherein the agent destroys the amyloid deposits and thereby alleviates the symptoms of the disease.
2. The method according to claim 1, wherein the amyloid disease is hereditary cystatin C amyloid angiopathy (HCCAA) caused by mutant cystatin C.
3. The method according to claim 2, wherein the mutant cystatin C comprises L68Q cystatin C.
4. The method according to claim 1, wherein the antioxidant is selected from the group consisting of glutathione, N-acetylcysteine, or derivatives thereof.
5. A method according to claim 4, wherein the method is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salt.
6. A method for treating hereditary cystatin C amyloid angiopathy (HCCAA) in human subjects requiring such treatment, comprising the administration of an effective amount of N-acetylcysteine or a functional derivative thereof in a pharmaceutically acceptable carrier, wherein the administration is effective in reducing amyloid-cystatin protein aggregates, thereby alleviating the symptoms of HCCAA, and the NAC derivative is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salt.
7. A method according to any one of claims 1 to 6, further comprising the step of performing a skin biopsy on the subject after treatment to evaluate the reduction of amyloid-cystatin protein aggregates in the skin.
8. A method according to any one of claims 1 to 7, comprising the administration of an ionophore.
9. A method according to any one of claims 1 to 8, comprising the administration of an anti-inflammatory agent.
10. A method according to claim 9, wherein the anti-inflammatory agent is selected from the group consisting of one or more of the following: corticosteroids, aspirin, celecoxib, diclofenac, diflunisal, etodolac, ibuprofen, indomethacin, ketoprofen, ketorolac, nabumetone, naproxen, oxaprozin, piroxicam, salsalate, sulindac, tolmetin, interleukin (IL)-1 receptor antagonists, IL-4, IL-6, IL-10, IL-11, IL-13, cytokine receptors for IL-1, tumor necrosis factor alpha, IL-18, and their derivatives and biosimilars.
12. A method according to claim 1, comprising the administration of one or more of glutathione, siRNA, monensin, papain, cathepsin B, and farsipain.
13. A method for treating neurodegenerative disorders associated with pathogenic fibrillation protein aggregates in human subjects requiring such treatment, comprising the administration of an effective amount of N-acetylcysteine or a functional derivative thereof in a pharmaceutically acceptable carrier, wherein the administration is effective in reducing the protein aggregates, thereby alleviating the symptoms of the neurodegenerative disorder.
14. The method according to claim 1, wherein the disorder is selected from Alzheimer's disease, Parkinson's disease, Creutzfeldt-Jakob disease, Huntington's disease, and other CAAs.
15. A method according to claim 1, further comprising the step of observing the amyloid deposition level of the patient.
16. A method for identifying therapeutic agents that alter amyloid-cystatin protein aggregate formation, a) A step of providing cells that express nucleic acids encoding a mutant hCC protein, wherein the mutant causes the formation of amyloid-cystatin protein aggregates; b) A step of providing cells that express the hCC protein lacking the hCC mutation, c) the step of bringing the cells from steps a) and b) into contact with the test agent, and d) A step of analyzing whether the amyloid-cystatin protein aggregate formation of the cells in step a) is altered by comparing them with the cells in step b), and a step of identifying a drug that thereby alters amyloid-cystatin protein aggregation. Methods that include...
17. A method according to claim 16, wherein the therapeutic agent is effective for treating HCCAA or other disorders related to abnormal fibrillation.
18. A method for treating HCAA in patients requiring it, comprising administering an effective amount of the drug described in claim 16.
19. The method according to claim 16, wherein the agent is NAC or a functional derivative thereof.
20. A pharmaceutical composition comprising an effective amount of an agent acting as an antioxidant and / or a reducing agent for treating amyloidosis in a pharmaceutically acceptable carrier.
21. A pharmaceutical composition according to claim 20, wherein the drug is glutathione, N-acetylcysteine, or a derivative thereof.
22. A pharmaceutical composition according to claim 21, wherein the derivative is selected from NAC-amide, NAC-ethyl ester, and zinc mercaptide N-acetylcysteine carboxylate salt.
23. A pharmaceutical composition according to claim 20, further comprising one or more of an ionophore, an anti-inflammatory agent, or a protease.