Antibodies that bind to the adenosine A2A receptor, and methods of using them to treat cancer and neurological diseases.
A nucleic acid library encoding adenosine A2A receptor antibodies is generated through variant sequence mixing, addressing the challenge of low GPCR stability and expression, resulting in high-affinity antibodies for therapeutic use.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- TWIST BIOSCIENCE CORP
- Filing Date
- 2026-02-24
- Publication Date
- 2026-06-23
AI Technical Summary
The low expression and instability of G protein-coupled receptors (GPCRs) during purification make it difficult to produce effective antibodies against them, hindering therapeutic interventions targeting these receptors.
A method for generating a nucleic acid library encoding adenosine A2A receptor antibodies or antibody fragments, involving the mixing of polynucleotides encoding variant sequences for CDR1, CDR2, and CDR3 regions to create a diverse library of single-domain antibodies, such as VHH antibodies, with specific binding properties.
The method produces a diverse library of antibodies with high affinity and specificity for the adenosine A2A receptor, enabling effective therapeutic applications in treating cancer and neurological disorders.
Smart Images

Figure 2026102621000001_ABST
Abstract
Description
[Technical Field]
[0001] cross reference This application claims the interests of U.S. Provisional Patent Application No. 62 / 945,818, filed on 9 December 2019, which is incorporated in its entirety by reference. [Background technology]
[0002] background G protein-coupled receptors (GPCRs), such as adenosine receptors, are involved in a wide variety of diseases. GPCRs are often expressed at low levels in cells and become highly unstable after purification. This has made it difficult to produce antibodies against GPCRs due to problems in obtaining appropriate antigens. Therefore, there is a need for improved drugs for therapeutic interventions targeting GPCRs.
[0003] Embedding by reference All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent as any individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference. [Overview of the project]
[0004] Simple summary Provided herein is a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, the method comprising the steps of (a) providing a predetermined sequence encoding: i. a first plurality of polynucleotides, each of which encodes a variant sequence encoding CDR1 on a heavy chain; ii. a second plurality of polynucleotides, each of which encodes a variant sequence encoding CDR2 on a heavy chain; iii. a third plurality of polynucleotides, each of which encodes a variant sequence encoding CDR3 on a heavy chain; and (b) mixing the first plurality of polynucleotides, the second plurality of polynucleotides, and the third plurality of polynucleotides to form a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof. Further provided herein are methods for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the adenosine A2A receptor antibody or the antibody fragment thereof is a single-domain antibody. Further provided herein are methods for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the single-domain antibody comprises one heavy-chain variable domain. Further provided herein are methods for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the single-domain antibody is a VHH antibody. Further provided herein are methods for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the nucleic acid library comprises at least 50,000 variant sequences.Further provided herein are methods for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the nucleic acid library comprises at least 100,000 variant sequences. Further provided herein are methods for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the nucleic acid library comprises at least 10. 5 It contains several non-identical nucleic acids. Further provided herein is a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the nucleic acid library comprises less than 100 nM K D The present invention provides for a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. D The present invention provides for a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. D The present invention provides a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. The nucleic acid library comprises at least 500 variant sequences. The present invention provides a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or antibody fragment, wherein the nucleic acid library comprises less than 100 nM K DThe present invention provides for a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. The nucleic acid library comprises at least 500 variant sequences.
[0005] Provided herein are nucleic acid libraries comprising multiple nucleic acids, each nucleic acid encoding a sequence that, when translated, encodes an antibody or an antibody fragment, the antibody or antibody fragment comprising a variable region of a heavy chain (VH) containing an adenosine A2A receptor binding domain, and each nucleic acid comprising a sequence encoding a sequence variant of the adenosine A2A receptor binding domain. Further provided herein are nucleic acid libraries comprising multiple nucleic acids, wherein the VH length is approximately 90 to approximately 100 amino acids. Further provided herein are nucleic acid libraries comprising multiple nucleic acids, wherein the VH length is approximately 100 to approximately 400 amino acids. Further provided herein are nucleic acid libraries comprising multiple nucleic acids, wherein the VH length is approximately 270 to approximately 300 base pairs. Further provided herein are nucleic acid libraries comprising multiple nucleic acids, wherein the VH length is approximately 300 to approximately 1200 base pairs. Further provided herein are nucleic acid libraries comprising multiple nucleic acids, wherein the library comprises at least 10 5 It contains non-identical nucleic acids.
[0006] Provided herein are protein libraries comprising multiple proteins, each of which comprises a variable region of the heavy chain (VH) containing a sequence variant of the adenosine A2A receptor-binding domain. Further provided herein are protein libraries comprising multiple proteins, wherein the VH length is approximately 90 to approximately 100 amino acids. Further provided herein are protein libraries comprising multiple proteins, wherein the VH length is approximately 100 to approximately 400 amino acids. Further provided herein are protein libraries comprising multiple proteins, wherein the VH length is approximately 270 to approximately 300 base pairs. Further provided herein are protein libraries comprising multiple proteins, wherein the library comprises at least 10 5 It contains several non-identical nucleic acids. Further provided herein are protein libraries comprising multiple proteins, where the multiple proteins are used to generate a peptide mimetic library. Further provided herein are protein libraries comprising multiple proteins, where the protein library comprises antibodies. Further provided herein are protein libraries comprising multiple proteins, where the protein library comprises at least 500 variant sequences. Further provided herein are protein libraries comprising multiple proteins, where the protein library comprises at least 5000 variant sequences. Further provided herein are protein libraries comprising multiple proteins, where the protein library comprises at least 10000 variant sequences.
[0007] Provided herein are protein libraries comprising multiple proteins, each comprising sequences encoding different adenosine A2A receptor-binding domains, with each adenosine A2A receptor-binding domain having a length of approximately 100 to 400 amino acids. Further provided herein are protein libraries comprising multiple proteins, each comprising peptides. Further provided herein are protein libraries comprising multiple proteins, each comprising immunoglobulins. Further provided herein are protein libraries comprising multiple proteins, each comprising antibodies. Further provided herein are protein libraries comprising multiple proteins, each comprising single-domain antibodies. Further provided herein are protein libraries comprising multiple proteins, where the multiple proteins are used to generate a peptide-mimicking library. Further provided herein are protein libraries comprising multiple proteins, each comprising at least 500 variant sequences. Further provided herein are protein libraries comprising multiple proteins, each comprising at least 5000 variant sequences. Further provided herein are protein libraries containing multiple proteins, each containing at least 10,000 variant sequences.
[0008] Provided herein is a nucleic acid library comprising a plurality of nucleic acids, wherein each of the nucleic acids encodes, when translated, a sequence encoding an adenosine A2A receptor-binding immunoglobulin, the adenosine A2A receptor-binding immunoglobulin comprises a variant of an adenosine A2A receptor-binding domain, the adenosine A2A receptor-binding domain is a ligand of the adenosine A2A receptor, and the nucleic acid library comprises at least 10,000 variant immunoglobulin heavy chains and at least 10,000 variant immunoglobulin light chains. Further provided herein is a nucleic acid library comprising a plurality of nucleic acids, wherein the nucleic acid library comprises at least 50,000 variant immunoglobulin heavy chains and at least 50,000 variant immunoglobulin light chains. Further provided herein is a nucleic acid library comprising a plurality of nucleic acids, wherein the nucleic acid library comprises at least 100,000 variant immunoglobulin heavy chains and at least 100,000 variant immunoglobulin light chains. Further provided herein is a nucleic acid library comprising a plurality of nucleic acids, wherein the nucleic acid library comprises at least 10 5 non-identical nucleic acids. Further provided herein is a nucleic acid library comprising a plurality of nucleic acids, wherein the length of the immunoglobulin heavy chain when translated is from about 90 to about 100 amino acids. Further provided herein is a nucleic acid library comprising a plurality of nucleic acids, wherein the length of the immunoglobulin heavy chain when translated is from about 100 to about 400 amino acids.
[0009] Provided herein is a nucleic acid library comprising a plurality of nucleic acids, wherein each of the nucleic acids encodes, when translated, a sequence encoding an adenosine A2A receptor single-domain antibody, and each sequence of the plurality of sequences comprises a variant sequence encoding at least one of CDR1, CDR2, and CDR3 on the variable region of the heavy chain (VH), wherein the library comprises at least 30,000 variant sequences, wherein the antibody or antibody fragment has a K of less than 100 nM DIt binds to the antigen. Further provided herein are nucleic acid libraries containing multiple nucleic acids, the VH length when translated is about 90 to about 100 amino acids. Further provided herein are nucleic acid libraries containing multiple nucleic acids, the VH length when translated is about 100 to about 400 amino acids. Further provided herein are nucleic acid libraries containing multiple nucleic acids, the VH length is about 270 to about 300 base pairs. Further provided herein are nucleic acid libraries containing multiple nucleic acids, the VH length is about 300 to about 1200 base pairs.
[0010] Provided herein are vector libraries containing nucleic acid libraries as described herein. Provided herein are cell libraries containing nucleic acid libraries as described herein. Provided herein are cell libraries containing protein libraries as described herein.
[0011] Provided herein is a nucleic acid library comprising multiple nucleic acids, each of which, when translated, encodes a sequence encoding adenosine A2A receptor-binding immunoglobulin, the adenosine A2A receptor-binding immunoglobulin comprising a variant of the adenosine A2A receptor-binding domain, the adenosine A2A receptor-binding domain being a ligand for the adenosine A2A receptor, and the nucleic acid library comprising at least 10,000 variant immunoglobulin heavy chains and at least 10,000 variant immunoglobulin light chains. Further provided herein is a nucleic acid library comprising at least 50,000 variant immunoglobulin heavy chains and at least 50,000 variant immunoglobulin light chains. Further provided herein is a nucleic acid library comprising at least 100,000 variant immunoglobulin heavy chains and at least 100,000 variant immunoglobulin light chains. Further provided in the specification is a nucleic acid library, where the nucleic acid library comprises at least 10 5It contains non-identical nucleic acids. Further provided herein are nucleic acid libraries in which the length of the translated immunoglobulin heavy chain is about 90 to about 100 amino acids. Further provided herein are nucleic acid libraries in which the length of the translated immunoglobulin heavy chain is about 100 to about 400 amino acids. Further provided herein are nucleic acid libraries in which the translated variant immunoglobulin heavy chain has at least about 90% sequence identity to any one of SEQ ID NOs. 540-628. Further provided herein are nucleic acid libraries in which the translated variant immunoglobulin light chain has at least about 90% sequence identity to any one of SEQ ID NOs. 629-717. Further provided herein are nucleic acid libraries in which the translated variant immunoglobulin heavy chain has at least about 90% sequence identity to any one of SEQ ID NOs. 540-628. Further provided herein are nucleic acid libraries in which the translated variant immunoglobulin light chain has at least about 90% sequence identity to any one of SEQ ID NOs. 629-717.
[0012] Provided herein is a nucleic acid library comprising multiple nucleic acids, each nucleic acid encoding a sequence that, when translated, encodes an antibody or antibody fragment, the antibody or antibody fragment comprising a variable region of the heavy chain (VH) containing an adenosine A2A receptor binding domain, each nucleic acid comprising a sequence encoding a sequence variant of the adenosine A2A receptor binding domain, and the antibody or antibody fragment having a K content of less than 100 nM. D It binds to the antigen. Further provided herein are nucleic acid libraries in which the VH length is about 90 to about 100 amino acids. Further provided herein are nucleic acid libraries in which the VH length is about 100 to about 400 amino acids. Further provided herein are nucleic acid libraries in which the VH length is about 270 to about 300 base pairs. Further provided herein are nucleic acid libraries in which the VH length is about 300 to about 1200 base pairs. Further provided herein is a nucleic acid library, which comprises at least 10 5It contains non-identical nucleic acids.
[0013] Provided herein is a nucleic acid library comprising multiple nucleic acids, each of which, when translated, encodes a sequence encoding an adenosine A2A receptor single-domain antibody, and each of the multiple sequences comprises a variant sequence encoding CDR1, CDR2, or CDR3 on the variable region of the heavy chain (VH), wherein the library comprises at least 30,000 variant sequences, and wherein the adenosine A2A receptor single-domain antibody has a K content of less than 100 nM. D It binds to the antigen. Further provided herein are nucleic acid libraries in which the VH length when translated is about 90 to about 100 amino acids. Further provided herein are nucleic acid libraries in which the VH length when translated is about 100 to about 400 amino acids. Further provided herein are nucleic acid libraries in which the VH length is about 270 to about 300 base pairs. Further provided herein are nucleic acid libraries in which the VH length is about 300 to about 1200 base pairs. Further provided herein are nucleic acid libraries in which the variant library contains variant sequences encoding CDR1, CDR2, and CDR3. Further provided herein are nucleic acid libraries in which, when translated, the VH has at least 90% sequence identity to any one of sequence numbers 540-628. Further provided herein are nucleic acid libraries in which, when translated, the VH contains any one of sequence numbers 540-628.
[0014] Provided herein are antibodies or antibody fragments that bind to the adenosine A2A receptor, comprising an immunoglobulin heavy chain and an immunoglobulin light chain, wherein the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs. 540-628, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs. 629-717. Further provided herein are antibodies or antibody fragments, wherein the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 95% identical to that described in any one of SEQ ID NOs. 540-628, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 95% identical to that described in any one of SEQ ID NOs. 629-717. Further provided herein are antibodies or antibody fragments, wherein the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs. 540-628, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs. 629-717. Further provided herein are antibodies or antibody fragments, the antibodies being monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplant antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv), single-chain antibodies, Fab fragments, F(ab')2 fragments, Fd fragments, Fv fragments, single-domain antibodies, isolated complementarity-determining regions (CDRs), diabodies, fragments consisting only of a single monomeric variable domain, disulfide-bonded Fv(sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or their ab antigen-binding fragments. Further provided herein are antibodies or antibody fragments, the antibodies or their antibody fragments being chimeric or humanized. Further provided herein are antibodies or antibody fragments, the antibodies having an EC50 of less than approximately 25 nanomoles in a cAMP assay.Further provided herein are antibodies or antibody fragments, the antibodies having an EC50 of less than approximately 20 nanomolar concentrations in a cAMP assay. Further provided herein are antibodies or antibody fragments, the antibodies having an EC50 of less than approximately 10 nanomolar concentrations in a cAMP assay.
[0015] Provided herein are antibodies or antibody fragments, each comprising a complementation-determining region (CDR) having an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs: 6-539.
[0016] Provided herein are antibodies or antibody fragments, each comprising a variable heavy chain complementarity-determining region (CDRH) having an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs: 6-272.
[0017] Provided herein are antibodies or antibody fragments, each comprising a variable light chain complementarity-determining region (CDRH) having an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs. 273-539.
[0018] Provided herein are antibodies or antibody fragments, each comprising one of the sequences SEQ ID NOs: 6-539, and the antibodies are monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplant antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv), single-chain antibodies, Fab fragments, F(ab')2 fragments, Fd fragments, Fv fragments, single-domain antibodies, isolated complementarity-determining regions (CDRs), diabodies, fragments consisting only of a single monomeric variable domain, disulfide-linked Fv(sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or their ab antigen-binding fragments.
[0019] Provided herein is a method for treating cancer, comprising the step of administering an antibody or antibody fragment described herein.
[0020] Provided herein are methods for treating neurological disorders or conditions, comprising the step of administering an antibody or antibody fragment described herein.
[0021] Provided herein is a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, the method comprising the steps of (a) providing a predetermined sequence encoding: i. a first plurality of polynucleotides, wherein each polynucleotide of the first plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR1 on a heavy chain; ii. a second plurality of polynucleotides, wherein each polynucleotide of the second plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR2 on a heavy chain. (b) a step of mixing the first, second, and third polynucleotides to form a nucleic acid library of variant nucleic acids encoding an adenosine A2A receptor antibody or an antibody fragment, wherein at least about 70% of the variant nucleic acids are less than 100 nM DThe process includes encoding an antibody or antibody fragment that binds to the adenosine A2A receptor. Further provided herein is a method in which the adenosine A2A receptor antibody or antibody fragment is a single-domain antibody. Further provided herein is a method in which the single-domain antibody comprises one heavy chain variable domain. Further provided herein is a method in which the single-domain antibody is a VHH antibody. Further provided herein is a method in which the nucleic acid library comprises at least 50,000 variant sequences. Further provided herein is a method in which the nucleic acid library comprises at least 100,000 variant sequences. Further provided herein is a method in which the nucleic acid library comprises at least 10 5 This method involves including several non-identical nucleic acids. Further provided herein is a method in which the nucleic acid library contains less than 75 nM K D A method comprising at least one sequence encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. Further provided herein is a method comprising a nucleic acid library having a K content of less than 50 nM. D A method comprising at least one sequence encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. Further provided herein is a method wherein the nucleic acid library comprises an adenosine A2A receptor antibody or an antibody fragment less than 10 nM. D A method comprising at least one sequence encoding an antibody fragment that binds to the adenosine A2A receptor. Further provided herein is a method in which a nucleic acid library comprises at least 500 variant sequences. Further provided herein is a method in which a nucleic acid library comprises an adenosine A2A receptor antibody or K75 nM. D The method comprises at least five sequences encoding an antibody or antibody fragment that binds to the adenosine A2A receptor.
[0022] Provided herein are protein libraries encoded by nucleic acid libraries described herein, wherein the protein libraries include peptides. Further provided herein are protein libraries, wherein the protein libraries include immunoglobulins. Further provided herein are protein libraries, wherein the protein libraries include antibodies. Further provided herein are protein libraries, wherein the protein libraries are peptide mimetic libraries.
[0023] Provided herein are vector libraries, including the nucleic acid libraries described herein.
[0024] Provided herein is a cell library comprising the nucleic acid library described herein.
[0025] Provided herein is a cell library containing the protein library described herein. [Brief explanation of the drawing]
[0026] [Figure 1] Figure 1A shows a schematic diagram of the first immunoglobulin scaffold. Figure 1B shows a schematic diagram of the second immunoglobulin scaffold. [Figure 2] A schematic diagram of the motifs to be placed on the scaffolding is shown. [Figure 3] A step diagram demonstrating an exemplary process workflow for gene synthesis as disclosed herein is presented. [Figure 4] Let's illustrate this with an example of a computer system. [Figure 5] This is a block diagram illustrating the architecture of a computer system. [Figure 6] This diagram illustrates a network configured to incorporate multiple computer systems, multiple mobile phones and personal data assistants, and network-attached storage (NAS). [Figure 7]This is a block diagram of a multiprocessor computer system that uses a shared virtual address memory space. [Figure 8] Figure 8A shows a schematic diagram of an immunoglobulin scaffold containing a VH domain bound to a VL domain using a linker. Figure 8B shows a schematic diagram of the full domain architecture of an immunoglobulin scaffold containing a VH domain bound to a VL domain using a linker, a leader sequence, and a pIII sequence. Figure 8C shows a schematic diagram of four framework elements (FW1, FW2, FW3, FW4) and three variable CDR elements (L1, L2, L3) for the VL or VH domain. [Figure 9A-D] Figure 9A shows the structure of the GLP-1 receptor (GLP-1R, gray) and glucagon-like peptide 1 (GLP-1, cyan) complexed with PDB entry 5VAI. Figure 9B shows the crystal structure of the CXCR4 chemokine receptor (gray) complexed with the cyclic peptide antagonist CVX15 (blue) and PDB entry 3OR0. Figure 9C shows the human crystal structure blunted with the gray transmembrane domain and orange extracellular domain (ECD) with PDB entry 5L7D. The ECD contacts the TMD via extracellular loop 3 (ECL3). Figure 9D shows the structure of GLP-1R (gray) complexed with Fab (magenta) and PDB entry 6LN2. [Figure 9E] Figure 9E shows the crystal structure of CXCR4 (gray) complexed with the viral chemokine antagonist viral macrophage inflammatory protein 2 (vMIP-II, green) and PDB entry 4RWS. [Figure 10] The schema for the GPCR-focused library design is shown below. It consists of two germline heavy chains, VH1-69 and VH3-30; four germline light chains, IGKV1-39 and IGKV3-15; and IGLV1-51 and IGLV2-14. [Figure 11]This graph shows the HCDR3 length distribution in a GPCR-focused library compared to the HCDR3 length distribution in a B cell population from three healthy adult donors. In total, 2,444,718 unique VH sequences from the GPCR library and 2,481,511 unique VH sequences from the human B cell repertoire were analyzed to generate the length distribution plots. [Figure 12] The clone, ELISA values, library, ProA values, and KD values for VHH-Fc are shown. [Figure 13] This describes the design schema of the phage-displayed hyperimmune library generated in the present invention. [Figure 14] Figures 14A and 14B show the dose curve (Figure 14A) and FACS analysis (Figure 14B) graphs for A2AR-90-007. [Figure 15A] The design schema for heavy-chain IGHV3-23 is shown. [Figure 15B] The design schema for the heavy chain IGHV1-69 is shown. [Figure 15C] This shows the design schema for light chain IGKV 2-28 and IGLV 1-51. [Figure 15D] This shows the schema of theoretical and final diversity in GPCR libraries. [Figure 16A-B] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 16C-D] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 16E-F] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 16G-H] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 16I-J] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 16K-L] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 16M-N] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 16O] Figures 16A–16O show flow cytometry data using variant A2A receptor immunoglobulin (Figure 16A–16N) and control (Figure 16O). [Figure 17A-B] Figures 17A-17H show graphs of the binding curves. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17C-D] Figures 17A-17H show graphs of the binding curves. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17E-F] Figures 17A-17H show graphs of the binding curves. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 17G-H] Figures 17A-17H show graphs of the binding curves. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 18A-B] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 18C-D] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 18E-F] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 18G-H] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 18I-J] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 18K-L] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 18M-N] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 18O] Figures 18A-18O show graphs of binding curves using variants (Figures 18A-18N) and controls (Figure 18O) from a mouse immunotherapy library. [Figure 19A-B] Figures 19A–19G show graphs of cell binding with adenosine A2aR monoclonal (MAB9497) and selected variants. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19C-D] Figures 19A–19G show graphs of cell binding with adenosine A2aR monoclonal (MAB9497) and selected variants. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19E-F] Figures 19A–19G show graphs of cell binding with adenosine A2aR monoclonal (MAB9497) and selected variants. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 19G] Figures 19A–19G show graphs of cell binding with adenosine A2aR monoclonal (MAB9497) and selected variants. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). [Figure 20A-B] Figures 20A-20G show graphs of cell binding in titration assays starting from 100 nM. [Figure 20C-D] Figures 20A-20G show graphs of cell binding in titration assays starting from 100 nM. [Figure 20E-F] Figures 20A-20G show graphs of cell binding in titration assays starting from 100 nM. [Figure 20G] Figures 20A-20G show graphs of cell binding in titration assays starting from 100 nM. [Figure 21] The data from the agonist dose-response assay measured using the cAMP assay are shown. [Figure 22] The data from the antagonist dose-response assay measured using the cAMP assay are shown. [Figure 23] The results from the cAMP antagonist titration assay are shown. [Figure 24] Data from variants A2A-1 and A2A-9 of the cAMP assay are shown. [Figure 25] The data for variant A2A9 using the cAMP assay are shown. [Figure 26] The data for variant A2A9 using the cAMP antagonist titration assay are shown. [Figure 27A] Figures 27A-27C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 27B] Figures 27A-27C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 27C] Figures 27A-27C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 28A] Figures 28A-28C show data for variant A2A receptor immunoglobulin in allosteric cAMP assays. [Figure 28B] Figures 28A-28C show data for variant A2A receptor immunoglobulin in allosteric cAMP assays. [Figure 28C]Figures 28A-28C show data for variant A2A receptor immunoglobulin in allosteric cAMP assays. [Figure 29A] Figures 29A-29C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 29B] Figures 29A-29C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 29C] Figures 29A-29C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 30A] Figures 30A-30C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 30B] Figures 30A-30C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Figure 30C] Figures 30A-30C show data for variant A2A receptor immunoglobulin in antagonistic cAMP assays. [Modes for carrying out the invention]
[0027] Detailed explanation This disclosure uses conventional molecular biology techniques that are within the scope of the art of those skilled in the art, unless otherwise indicated. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as they are commonly understood by those skilled in the art.
[0028] definition Throughout this disclosure, various embodiments are presented in range form. It should be understood that the range form is for convenience and conciseness only and should not be interpreted as an inflexible limitation on the scope of any embodiment. Therefore, unless explicitly indicated otherwise in the context, the range description should be considered to specifically disclose all possible subranges, as well as individual numerical values within ranges up to one-tenth of the lower limit unit. For example, a range description such as 1 to 6 should be considered to specifically disclose subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, as well as individual values within those ranges, such as 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the width of the range. The upper and lower limits of these intervening ranges may independently be included within smaller ranges and are also included within the scope of this disclosure, subject to any limitations specifically excluded in the range referred to. If the scope referred to includes one or both of the limitations, the scope excluding one or both of those limitations is also included in this disclosure, unless the context explicitly indicates otherwise.
[0029] The terms used herein are intended solely to describe specific embodiments and are not intended to limit any embodiment. Where used herein, the singular forms “a,” “an,” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. Where used herein, the terms “including” and / or “including” specify the presence of the mentioned feature, integer, process, operation, element, and / or component, but do not exclude the presence or addition of one or more other features, integers, processes, operations, elements, components, and / or groups thereof. Where used herein, the terms “and / or” include any and all combinations of one or more of the related enumerated items.
[0030] Unless otherwise stated or evident from the context, the term “about” with respect to a number or range of numbers, as used herein, is understood to mean 10% below the listed lower limit and 10% above the listed upper limit for the number mentioned and + / - 10% of that number or the values listed for the range.
[0031] Unless otherwise specified, the term “nucleic acid” as used herein includes double-stranded or triple-stranded nucleic acids, as well as single-stranded molecules. In double-stranded or triple-stranded nucleic acids, the nucleic acid strands do not need to have the same extent (i.e., a double-stranded nucleic acid does not need to be double-stranded along the entire length of both strands). Nucleic acid sequences, if provided, are enumerated in the 5' to 3' direction unless otherwise specified. The methods described herein provide the production of isolated nucleic acids. The methods described herein further provide the production of isolated and purified nucleic acids. The “nucleic acid” as used herein may include at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, or more base lengths. Furthermore, provided herein are methods for synthesizing polypeptide segments from other protein families, including non-coding DNA or RNA, such as sequences encoding non-ribosomal peptides (NRPs), non-ribosomal peptide synthetase (NRPS) modules, and sequences encoding synthetic variants, polypeptide segments of other modular proteins such as antibodies, regulatory sequences, for example, promoters, transcription factors, enhancers, nucleotide, shRNA, RNAi, miRNA, microRNA-derived nucleolar small RNAs, or any functional or structural DNA or RNA unit of interest.The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, intergenetic DNA, loci (one or more) defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), nucleolar small RNA, ribozymes, complementary DNA (cDNA), which is the DNA representation of mRNA, usually obtained by reverse transcription or amplification of messenger RNA (mRNA); DNA molecules produced by synthesis or amplification, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A cDNA encoding a gene or gene fragment as referred to in this specification may include at least one region encoding an exon sequence without intervening intron sequences in the genomic equivalent sequence.
[0032] Adenosine A2A Receptor Library Provided herein are methods and compositions relating to a G protein-coupled receptor (GPCR) binding library for the adenosine A2A receptor (ADORA2), comprising a nucleic acid encoding a scaffold containing an adenosine A2A receptor-binding domain. The scaffold described herein can stably support the adenosine A2A receptor-binding domain. The adenosine A2A receptor-binding domain can be designed based on the surface interaction between an adenosine A2A receptor ligand and the adenosine A2A receptor. Libraries such as those described herein can be further diversified to provide variant libraries comprising nucleic acids, each encoding a predetermined variant of at least one given reference nucleic acid sequence. Further described herein are protein libraries that may be produced when the nucleic acid library is translated. In some cases, the nucleic acid library described herein is transferred to cells to produce a cellular library. Downstream uses of libraries synthesized using the methods described herein are also provided herein. Downstream applications include the identification of mutant nucleic acid or protein sequences with enhanced biologically relevant functions, such as improved stability, affinity, binding, functional activity, and the treatment or prevention of disease conditions related to adenosine A2A receptor signaling.
[0033] The methods, compositions, and systems described herein for the optimization of adenosine A2A receptor immunoglobulins or antibodies include a ratio variation approach that reflects the natural diversity of antibody sequences. In some cases, a library of optimized adenosine A2A receptor immunoglobulins or antibodies comprises a variant adenosine A2A receptor immunoglobulin or antibody sequence. In some cases, a variant adenosine A2A receptor immunoglobulin or antibody sequence containing a variant CDR region is designed. In some cases, a variant adenosine A2A receptor immunoglobulin or antibody sequence containing a variant CDR region is generated by shuffling native CDR sequences within a llama, humanized, or chimeric framework. In some cases, such a library is synthesized, cloned into an expression vector, and the translation product (antibody) is evaluated for activity. In some cases, fragments of the sequence are synthesized and then assembled. In some cases, an expression vector is used to display and enrich the desired antibody, such as in phage display. In some cases, the phage vector is a Fab phagemide vector. In some cases, the selective pressures used during enrichment include binding affinity, toxicity, immune tolerance, stability, or other factors. Such expression vectors allow for the selection of antibodies with specific properties ("panning"), and subsequent proliferation or amplification of such sequences enriches the library with these sequences. Panning rounds can be repeated any number of times, such as one, two, three, four, five, six, seven, or more than seven rounds. In some cases, each round of panning involves numerous washes. In some cases, each round of panning involves at least or about one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, or more than sixteen washes.
[0034] This specification describes methods and systems for in silico library design. The libraries described herein are, in some cases, designed based on a database containing various antibody sequences. In some cases, the database contains multiple variant antibody sequences against various targets. In some cases, the database contains at least 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 antibody sequences. An exemplary database is the iCAN database. In some cases, the database contains naive and memory B cell receptor sequences. In some cases, the naive and memory B cell receptor sequences are human, mouse, or primate sequences. In some cases, the naive and memory B cell receptor sequences are human sequences. In some cases, the database is analyzed for site-specific variations. In some cases, the antibodies described herein contain site-specific variations in the CDR region. In some cases, the CDR region contains multiple sites for variation.
[0035] Scaffolding Library Provided herein is a library containing nucleic acids encoding scaffolds, where sequences of adenosine A2A receptor-binding domains are positioned on the scaffolds. The scaffolds described herein allow for improved stability of sequences encoding a series of adenosine A2A receptor-binding domains when inserted into the scaffolds, compared to unmodified scaffolds. Exemplary scaffolds include, but are not limited to, proteins, peptides, immunoglobulins, their derivatives, or combinations thereof. In some cases, the scaffolds are immunoglobulins. The scaffolds described herein include improved functional activity, structural stability, expression, specificity, or combinations thereof. In some cases, the scaffolds include long regions for supporting adenosine A2A receptor-binding domains.
[0036] Provided herein is a library containing nucleic acids encoding scaffolds, where the scaffolds are immunoglobulins. In some cases, immunoglobulins are antibodies. As used herein, the term antibody is understood to include one or more fragments of an antibody that possess the characteristic Y-shape of the two arms of a typical antibody molecule, as well as the ability to specifically bind to an antigen. Exemplary antibodies include monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplant antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelized antibodies, single-chain Fv(scFv) (containing fragments in which VL and VH are linked by synthetic or natural linkers, or by recombination, allowing them to be made as a single protein chain, with the VL and VH regions paired to form a monovalent molecule containing single-chain Fab and scFab), single-chain antibodies, Fab fragments (containing monovalent fragments containing the VL domain, VH domain, CL domain, and CH1 domain), and F(ab')2 fragments (containing two Fab fragments linked by disulfide crosslinks in the hinge region). These include, but are not limited to, bivalent fragments containing a nucleotide, Fd fragments (including fragments containing VH and CH1 fragments), Fv fragments (including fragments containing the VL and VH domains of a single arm of the antibody), single-domain antibodies (dAb or sdAb) (including fragments containing the VH domain), isolated complementarity-determining regions (CDRs), diabodies (including fragments containing bivalent dimers such as two VL and VH domains that bind to each other and recognize two different antigens), fragments consisting of only a single monomeric variable domain, disulfide-linked Fv (sdFv), intrabodies, anti-idiotype (anti-Id) antibodies, or their ab antigen-binding fragments. In some examples, the libraries disclosed herein include nucleic acids encoding a scaffold, the scaffold being an Fv antibody comprising a minimal antibody fragment containing a complete antigen-recognition and antigen-binding site.In some embodiments, the Fv antibody consists of a dimer of one heavy chain and one light chain variable domain, with three hypervariable regions of each variable domain interacting to define an antigen-binding site on the surface of the VH-VL dimer. In some embodiments, six hypervariable regions confer antigen-binding specificity to the antibody. In some embodiments, a single variable domain (or a half of Fv containing only three antigen-specific hypervariable regions, a VHH antibody, or a nanobody, including a single-domain antibody isolated from a camel animal containing one heavy chain variable domain or variable region of the heavy chain) has the ability to recognize and bind to an antigen. In some examples, the libraries disclosed herein include nucleic acids encoding a scaffold, where the scaffold is a single-chain Fv or scFv containing an antibody fragment containing VH, VL, or both VH and VL domains, both domains present on a single polypeptide chain. In some embodiments, the Fv polypeptide further includes a polypeptide linker between the VH and VL domains, allowing the scFv to form a desired structure for antigen binding. In some cases, scFv is linked to an Fc fragment, or VHH is linked to an Fc fragment (including a minibody). In some cases, the antibody comprises an immunoglobulin molecule and an immunoactive fragment of the immunoglobulin molecule, e.g., a molecule containing an antigen-binding site. The immunoglobulin molecule is of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG 1, IgG 2, IgG 3, IgG 4, IgA 1, and IgA 2) or subclass.
[0037] In some embodiments, the library contains immunoglobulins adapted to the species of the intended therapeutic target. Generally, these methods involve “mammalization” and include methods for transferring donor antigen-binding information to less immunogenic mammalian antibody receptors in order to produce useful therapeutic measures. In some cases, the mammals are mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, and humans. In some cases, libraries and methods for feline and canine antibody transformation are provided herein.
[0038] The "humanized" form of a non-human antibody may be a chimeric antibody containing the smallest sequence derived from the non-human antibody. A humanized antibody is generally a human antibody (recipient antibody) in which one or more residues from a CDR are replaced by one or more residues from a non-human antibody (donor antibody). The donor antibody can be any suitable non-human antibody, such as a mouse, rat, rabbit, chicken, or non-human primate antibody, possessing the desired specificity, affinity, or biological effect. In some cases, selected framework region residues of the recipient antibody are replaced by corresponding framework region residues from the donor antibody. Humanized antibodies may also contain residues not found in either the recipient or donor antibody. In some cases, these modifications are made to further refine the antibody's performance.
[0039] "Canine transformation" may include methods for transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody acceptor in order to produce therapeutics useful as therapeutic agents in dogs. In some cases, the canine transformation of a non-canine antibody provided herein is a chimeric antibody containing the smallest sequence derived from the non-canine antibody. In some cases, the canine transformation antibody is a canine antibody sequence ("acceptor" or "recipient" antibody) in which the hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-canine species ("donor" antibody), such as mouse, rat, rabbit, cat, dog, goat, chicken, cattle, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or engineered sequence having desired properties. In some cases, framework region (FR) residues of the canine antibody are replaced by corresponding non-canine FR residues. In some cases, the canine transformation antibody contains residues not found in the recipient or donor antibody. In some cases, these modifications are made to further refine the performance of the antibody. Canine antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of the canine antibody.
[0040] "Felineization" may include methods for transferring non-feline antigen-binding information from a donor antibody to a less immunogenic feline antibody acceptor to produce a therapeutic agent useful for cats. In some cases, the felineized form of a non-feline antibody provided herein is a chimeric antibody containing the smallest sequence derived from the non-feline antibody. In some cases, the felineized antibody is a feline antibody sequence ("acceptor" or "recipient" antibody) in which the hypervariable region residues of the recipient are replaced by hypervariable region residues from a non-feline species ("donor" antibody), such as mouse, rat, rabbit, cat, dog, goat, chicken, cattle, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant sequence, or engineered sequence having desired properties. In some cases, framework region (FR) residues of the feline antibody are replaced by corresponding non-feline FR residues. In some cases, the felineized antibody contains residues not found in the recipient antibody or donor antibody. In some cases, these modifications are made to further refine the performance of the antibody. Feline antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of the feline antibody.
[0041] Provided herein are libraries containing nucleic acids encoding scaffolds, where the scaffold is a non-immunoglobulin. In some cases, the scaffold is a non-immunoglobulin-binding domain. For example, the scaffold is an antibody mimetic. Exemplary antibody mimetics include, but are not limited to, antikalin, affilin, affibody molecules, affimers, afitins, alphabodies, avimers, atrimers, DARPin, finomers, Knitz domain-based proteins, monobodies, antikalin, Notchin, armadillo repeat protein-based proteins, and bicyclic peptides.
[0042] A library described herein, comprising a nucleic acid encoding a scaffold, wherein the scaffold is an immunoglobulin, comprises variations of at least one region of the immunoglobulin. Exemplary regions of an antibody for mutation include, but are not limited to, complementarity-determining regions (CDRs), variable domains, or constant domains. In some cases, the CDR is CDR1, CDR2, or CDR3. In some cases, the CDR is a heavy domain, including but not limited to CDRH1, CDRH2, and CDRH3. In some cases, the CDR is a light domain, including but not limited to CDRL1, CDRL2, and CDRL3. In some cases, the variable domain is a variable domain, light chain (VL), or variable domain, heavy chain (VH). In some cases, the VL domain includes a kappa chain or a lambda chain. In some cases, the constant domain is a constant domain, light chain (CL), or constant domain, heavy chain (CH).
[0043] The methods described herein provide the synthesis of a library containing nucleic acids encoding a scaffold, where each nucleic acid encodes a predetermined variant of at least one given reference nucleic acid sequence. In some cases, the given reference sequence is a nucleic acid sequence encoding a protein, and the variant library contains sequences encoding variations of at least a single codon, resulting in multiple different variants of a single residue in a subsequent protein encoded by the synthesized nucleic acids being generated by a standard translation process. In some cases, the scaffold library contains a variety of nucleic acids collectively encoding variations at multiple positions. In some cases, the variant library contains sequences encoding variations of at least a single codon in the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the variant library contains sequences encoding variations of multiple codons in the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the variant library contains an array that codes for variations of multiple codons in framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). An exemplary number of codons for a variation may include, but are not limited to, at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.
[0044] In some cases, at least one region of the immunoglobulin for the variation originates from the heavy chain V gene family, the heavy chain D gene family, the heavy chain J gene family, the light chain V gene family, or the light chain J gene family. In some cases, the light chain V gene family includes the immunoglobulin kappa (IGK) gene or the immunoglobulin lambda (IGL) gene. Exemplary genes include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59 / 61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1. In some cases, the genes are IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, the genes are IGHV1-69 and IGHV3-30. In some cases, the genes are IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In some cases, the genes are IGHJ3, IGHJ6, IGHJ, or IGHJ4.
[0045] Provided herein are libraries containing nucleic acids encoding immunoglobulin scaffolds, the libraries being synthesized using a variety of fragments. In some cases, the fragments include CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the fragments include framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, the scaffold libraries are synthesized using at least or about two fragments, three fragments, four fragments, five fragments, or more than five fragments. The length or average length of each synthesized nucleic acid fragment may be at least or approximately 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some cases, the length is approximately up to 50-600, 75-575, 100-550, 125-525, 150-500, 175-475, 200-450, 225-425, 250-400, 275-375, or 300-350 base pairs.
[0046] The libraries comprising nucleic acids encoding immunoglobulin scaffolds described herein contain amino acids of varying lengths when translated. In some cases, the length or average length of each synthesized amino acid fragment may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some cases, the length of an amino acid is approximately 15-150, 20-145, 25-140, 30-135, 35-130, 40-125, 45-120, 50-115, 55-110, 60-110, 65-105, 70-100, or 75-95 amino acids. In some cases, the length of an amino acid is approximately 22-75 amino acids. In some cases, an immunoglobulin scaffold contains at least or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.
[0047] Numerous variant sequences for at least one region of immunoglobulin for variation are de novo synthesized using the methods described herein. In some cases, numerous variant sequences are de novo synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some cases, several variant sequences are de novo synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). The number of variant sequences may be at least or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500. In some cases, the number of variant sequences may be at least or approximately 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000. In some cases, the number of variant sequences is approximately 10-500, 25-475, 50-450, 75-425, 100-400, 125-375, 150-350, 175-325, 200-300, 225-375, 250-350, or 275-325 sequences.
[0048] In some cases, the variant sequence of at least one region of the immunoglobulin varies in length or sequence. In some cases, the at least one region that is de novo synthesized is for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or a combination thereof. In some cases, the at least one region that is de novo synthesized is for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 variant nucleotides or amino acids compared to the wild type. In some cases, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids compared to the wild type. In some cases, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 fewer nucleotides or amino acids compared to the wild type. In some cases, the library contains at least or about 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , or 10 10 Includes variants exceeding [a certain number].
[0049] Following the synthesis of the scaffold library, it can be used for screening and analysis. For example, the scaffold library is assayed for the library's visibility and panning. In some cases, visibility is analyzed using selectable tags. Exemplary tags include, but are not limited to, radiolabels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric labels, affinity tags, or other labels or tags known in the art. In some cases, the tags are histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. In some cases, the scaffold library is assayed by sequencing using a variety of methods, including, but not limited to, single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyro sequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthesis sequencing.
[0050] In some cases, scaffold libraries are assayed for functional activity, structural stability (e.g., thermal or pH stability), expression, specificity, or a combination thereof. In some cases, scaffold libraries are assayed for their foldable scaffolds. In some cases, regions of antibodies are assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof. For example, the VH region or VL region is assayed for functional activity, structural stability, expression, specificity, folding, or a combination thereof.
[0051] Adenosine A2A Receptor Library Provided herein are adenosine A2A receptor-binding libraries comprising nucleic acids encoding scaffolds containing sequences of adenosine A2A receptor-binding domains. In some cases, the scaffolds are immunoglobulins. In some cases, the scaffolds containing sequences of adenosine A2A receptor-binding domains are determined by the interaction between the adenosine A2A receptor-binding domain and the adenosine A2A receptor.
[0052] Provided herein is a library comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, the adenosine A2A receptor-binding domain being designed based on surface interactions on the adenosine A2A receptor. In some cases, the adenosine A2A receptor-binding domain comprises the sequence defined by Sequence ID No. 1. In some cases, the adenosine A2A receptor-binding domain interacts with the amino-terminus or carboxy-terminus of the adenosine A2A receptor. In some cases, the adenosine A2A receptor-binding domain interacts with at least one transmembrane domain, including but not limited to transmembrane domain 1 (TM1), transmembrane domain 2 (TM2), transmembrane domain 3 (TM3), transmembrane domain 4 (TM4), transmembrane domain 5 (TM5), transmembrane domain 6 (TM6), and transmembrane domain 7 (TM7). In some cases, the adenosine A2A receptor-binding domain interacts with the intracellular surface of the adenosine A2A receptor. For example, the adenosine A2A receptor-binding domain interacts with at least one intracellular loop, including but not limited to intracellular loop 1 (ICL1), intracellular loop 2 (ICL2), and intracellular loop 3 (ICL3). In some cases, the adenosine A2A receptor-binding domain interacts with the extracellular surface of the adenosine A2A receptor. For example, the adenosine A2A receptor-binding domain interacts with at least one extracellular domain (ECD) or extracellular loop (ECL) of the adenosine A2A receptor. The extracellular loop includes, but is not limited to, extracellular loop 1 (ECL1), extracellular loop 2 (ECL2), and extracellular loop 3 (ECL3).
[0053] Described herein are adenosine A2A receptor-binding domains, which are designed based on surface interactions between an adenosine A2A receptor ligand and an adenosine A2A receptor. In some cases, the ligand is a peptide. In some cases, the ligand is an adenosine A2A receptor agonist. In some cases, the ligand is an adenosine A2A receptor antagonist. In some cases, the ligand is an adenosine A2A receptor allosteric modulator. In some cases, the allosteric modulator is a negative allosteric modulator. In some cases, the allosteric modulator is a positive allosteric modulator. Exemplary ligands for the adenosine A2A receptor include, but are not limited to, DU172, PSB36, ZM241385, XAC, caffeine, T4G, T4E, 6DY, 6DZ, 6DX, 6DV, 8D1b, theophylline, UK-432097, adenosine, NECA, and CGS21680.
[0054] The sequence of the adenosine A2A receptor binding domain, based on the surface interaction between the adenosine A2A receptor ligand and the adenosine A2A receptor, is analyzed using various methods. For example, multiple computational analyses are performed. In some cases, structural analysis is performed. In some cases, sequence analysis is performed. Sequence analysis can be performed using databases known in the art. Non-exclusive examples of databases include, but are not limited to, NCBI BLAST (blast.ncbi.nlm.nih.gov / Blast.cgi), UCSC Genome Browser (genome.ucsc.edu / ), UniProt (www.uniprot.org / ), and IUPHAR / BPS Guide to PHARMACOLOGY (guidetopharmacology.org / ).
[0055] Described herein are adenosine A2A receptor-binding domains designed based on sequence analysis across various organisms. For example, sequence analysis is performed to identify homologous sequences in different organisms. Exemplary organisms include, but are not limited to, mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, fish, flies, and humans.
[0056] Following the identification of the adenosine A2A receptor binding domain, a library containing nucleic acids encoding the adenosine A2A receptor binding domain can be generated. In some cases, the library of adenosine A2A receptor binding domains includes sequences of adenosine A2A receptor binding domains designed based on conformational ligand interactions, peptide ligand interactions, small molecule ligand interactions, the extracellular domain of the adenosine A2A receptor, or antibodies targeting the adenosine A2A receptor. In some cases, the library of adenosine A2A receptor binding domains includes sequences of adenosine A2A receptor binding domains designed based on peptide ligand interactions. In some cases, the ligand is not an antibody ligand. The library of adenosine A2A receptor binding domains can be translated to generate a protein library. In some cases, the library of adenosine A2A receptor binding domains is translated to generate a peptide library, an immunoglobulin library, their derivatives, or a combination thereof. In some cases, the library of adenosine A2A receptor binding domains is translated to generate a protein library, which is then further modified to generate a peptide mimetic library. In some cases, a library of adenosine A2A receptor-binding domains is translated to generate a protein library used to produce small molecules.
[0057] The methods described herein provide the synthesis of a library of adenosine A2A receptor-binding domains, each comprising nucleic acids encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library comprises sequences encoding variations of at least a single codon, resulting in multiple different variants of a single residue of the subsequent protein encoded by the synthetic nucleic acid being generated by a standard translation process. In some cases, the library of adenosine A2A receptor-binding domains comprises various nucleic acids collectively encoding variations at multiple positions. In some cases, the variant library comprises sequences encoding variations of at least a single codon in the adenosine A2A receptor-binding domain. In some cases, the variant library comprises sequences encoding variations of multiple codons in the adenosine A2A receptor-binding domain. An exemplary number of codons for variation includes, but is not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.
[0058] The methods described herein provide the synthesis of a library comprising nucleic acids encoding an adenosine A2A receptor-binding domain, wherein the library comprises a sequence encoding a variation in the length of the adenosine A2A receptor-binding domain. In some cases, the library comprises a sequence encoding a variation in length of at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons compared to a given reference sequence. In some cases, the library includes sequences that encode variations of a length with at least or approximately 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons compared to a given reference sequence.
[0059] Following the identification of the adenosine A2A receptor-binding domain, the adenosine A2A receptor-binding domain may be positioned on a scaffold as described herein. In some cases, the scaffold is an immunoglobulin. In some cases, the adenosine A2A receptor-binding domain is positioned in the CDRH3 region. The adenosine A2A receptor-binding domain that can be positioned on a scaffold may also be called a motif. Scaffolds containing the adenosine A2A receptor-binding domain may be designed based on binding, specificity, stability, expression, folding, or downstream activity. In some cases, scaffolds containing the adenosine A2A receptor-binding domain enable contact with the adenosine A2A receptor. In some cases, scaffolds containing the adenosine A2A receptor-binding domain enable high-affinity binding to the adenosine A2A receptor. Exemplary amino acid sequences of the adenosine A2A receptor-binding domain are shown in Table 1.
[0060] [Table 1]
[0061] Provided herein are scaffolds or immunoglobulins comprising an adenosine A2A receptor-binding domain, wherein the sequence of the adenosine A2A receptor-binding domain supports interaction with the adenosine A2A receptor. The sequence may be homologous or identical to the sequence of an adenosine A2A receptor ligand. In some cases, the adenosine A2A receptor-binding domain sequence contains at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to SEQ ID NO: 1. In some cases, the adenosine A2A receptor-binding domain sequence contains at least or about 95% homology with respect to SEQ ID NO: 1. In some cases, the adenosine A2A receptor-binding domain sequence contains at least or about 97% homology with respect to SEQ ID NO: 1. In some cases, the adenosine A2A receptor-binding domain sequence contains at least or approximately 99% homology to SEQ ID NO: 1. In some cases, the adenosine A2A receptor-binding domain sequence contains at least or approximately 100% homology to SEQ ID NO: 1. In some cases, the adenosine A2A receptor-binding domain sequence contains at least a portion of the sequence having at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids of Sequence ID No. 1.
[0062] Provided herein are antibodies or immunoglobulins, each containing a sequence with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 540-717. In some cases, the antibody or immunoglobulin sequence contains at least or about 95% sequence identity to any one of SEQ ID NOs: 540-717. In some cases, the antibody or immunoglobulin sequence contains at least or about 97% sequence identity to any one of SEQ ID NOs: 540-717. In some cases, the antibody or immunoglobulin sequence contains at least or about 99% sequence identity to any one of SEQ ID NOs: 540-717. In some cases, the antibody or immunoglobulin sequence contains at least or about 100% sequence identity to any one of SEQ ID NOs: 540-717. In some cases, the antibody or immunoglobulin sequence contains at least a portion of one of sequence numbers 540-717 having at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or more than 110 amino acids.
[0063] In some embodiments, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing sequences listed in Tables 15-16. In some embodiments, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 6-539. In some cases, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing at least or about 95% homology to any one of SEQ ID NOs: 6-539. In some cases, the antibody or immunoglobulin sequence includes a complementation-determining region (CDR) containing at least or about 97% homology to any one of SEQ ID NOs: 6-539. In some cases, the antibody or immunoglobulin sequence contains a complementation-determining region (CDR) that has at least or approximately 99% homology to any one of SEQ ID NOs: 6-539. In some cases, the antibody or immunoglobulin sequence contains a complementation-determining region (CDR) that has at least or approximately 100% homology to any one of SEQ ID NOs: 6-539. In some cases, the antibody or immunoglobulin sequence contains a complementation-determining region (CDR) that has at least a portion of any one of SEQ ID NOs: 6-539 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids.
[0064] In some embodiments, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with either SEQ ID NOs: 6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 95% homology with either SEQ ID NOs: 6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 97% homology with either SEQ ID NOs: 6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence includes a CDR1 having at least or about 99% homology with either SEQ ID NOs: 6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence contains a CDR1 having at least or approximately 100% homology to either SEQ ID NOs. 6-270 or 273-537. In some cases, the antibody or immunoglobulin sequence contains a CDR1 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids to either SEQ ID NOs. 6-94 or 273-361.
[0065] In some embodiments, the antibody or immunoglobulin sequence includes a CDR2 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to either SEQ ID NOs. 95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence includes a CDR2 having at least or about 95% homology to either SEQ ID NOs. 95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence includes a CDR2 having at least or about 97% homology to either SEQ ID NOs. 795-183 and 362-450. In some cases, the antibody or immunoglobulin sequence includes a CDR2 having at least or about 99% homology to either SEQ ID NOs. 95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence contains a CDR2 having at least or approximately 100% homology to one of sequence numbers 95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence contains a CDR2 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids to one of sequence numbers 95-183 and 362-450.
[0066] In some embodiments, the antibody or immunoglobulin sequence includes a CDR3 having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with respect to one of SEQ ID NOs: 184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence includes a CDR3 having at least or about 95% homology with respect to one of SEQ ID NOs: 184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence includes a CDR3 having at least or about 97% homology with respect to one of SEQ ID NOs: 184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence includes a CDR3 having at least or about 99% homology with respect to one of SEQ ID NOs: 184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence contains a CDR3 having at least or approximately 100% homology to one of SEQ ID NOs. 184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence contains a CDR3 having at least or approximately 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from either SEQ ID NOs. 184-272 and 451-539.
[0067] In some embodiments, the antibody or immunoglobulin sequence has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 6-94, CDRH1; and at least or about 70%, 80%, 85% sequence identity to any one of SEQ ID NOs. 95-183. CDRH2 containing 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity; and CDRH3 containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of sequence numbers 184-272. In some cases, the antibody or immunoglobulin sequence contains CDRH1 with at least or approximately 95%, 97%, 99%, or 100% homology to any one of SEQ ID NOs. 6-94; CDRH2 with at least or approximately 95%, 97%, 99%, or 100% homology to any one of SEQ ID NOs. 95-183; and CDRH3 with at least or approximately 95%, 97%, 99%, or 100% homology to any one of SEQ ID NOs. 184-272. In some cases, the antibody or immunoglobulin sequence includes CDRH1, which contains at least a portion of SEQ ID NOs: 6-94 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; CDRH2, which contains at least a portion of SEQ ID NOs: 95-183 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; and CDRH, which contains at least a portion of SEQ ID NOs: 184-272 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids.
[0068] In some embodiments, the antibody or immunoglobulin sequence has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NOs. 273-361; and at least or about 70%, 80%, 85%, 90% to SEQ ID NOs. 362-450. CDRL2 containing 0%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity; and CDRL3 containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity for sequence numbers 451-539. In some cases, the antibody or immunoglobulin sequence contains CDRL1 with at least or approximately 95%, 97%, 99%, or 100% homology to SEQ ID NOs. 273-361; CDRL2 with at least or approximately 95%, 97%, 99%, or 100% homology to SEQ ID NOs. 362-450; and CDRL3 with at least or approximately 95%, 97%, 99%, or 100% homology to SEQ ID NOs. 451-539. In some cases, the antibody or immunoglobulin sequence includes CDRL1, which comprises at least a portion of SEQ ID NOs. 273-361 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; CDRL2, which comprises at least a portion of SEQ ID NOs. 362-450 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids; and CDRL3, which comprises at least a portion of SEQ ID NOs. 451-539 having at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids.
[0069] In some embodiments, the antibody or immunoglobulin sequence has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 6-94 (CDRH1); at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 95-183 (CDRH2); and at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 184-272 (CDRH2). CDRL1 containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity for any one of sequence numbers 273-362; CDRH3 containing sex; CDRL1 containing at least or approximately 70%, 80%, 85%, 90%, or 91% sequence identity for any one of sequence numbers 362-450 CDRL2 containing 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity; and CDRL3 containing at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity for any one of sequence numbers 451-539.In some cases, the antibody or immunoglobulin sequence has at least or approximately 95%, 97%, 99%, or 100% homology to any one of SEQ ID NOs. 6-94 (CDRH1); at least or approximately 95%, 97%, 99%, or 100% homology to any one of SEQ ID NOs. 95-183 (CDRH2); and at least or approximately 95%, 97%, 99%, or 100% homology to any one of SEQ ID NOs. 184-272 (CDRH2). CDRH3 includes; CDRL1 includes at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 273-362; CDRL2 includes at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 362-450; and CDRL3 includes at least or approximately 95%, 97%, 99%, or 100% homology to any one of sequence numbers 451-539. In some cases, the antibody or immunoglobulin sequence contains at least one of the sequence numbers 6-94 containing at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids (CDRH1); at least one of the sequence numbers 95-183 containing at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids (CDRH2); and at least one of the sequence numbers 184-272 containing at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids (CDRH2). Includes CDRH3; CDRL1 containing at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from any one of SEQ ID NOs. 273-362; CDRL2 containing at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from any one of SEQ ID NOs. 362-450; and CDRL3 containing at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids from any one of SEQ ID NOs. 451-539.
[0070] Described herein are, in some embodiments, antibodies or immunoglobulins that bind to the adenosine A2A receptor. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence includes a heavy chain variable domain containing at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs: 540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence includes a heavy chain variable domain containing at least or about 95% sequence identity to any one of SEQ ID NOs: 540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence includes a heavy chain variable domain containing at least or about 97% sequence identity to any one of SEQ ID NOs: 540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a heavy chain variable domain having at least or approximately 99% sequence identity to any one of SEQ ID NOs. 540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a heavy chain variable domain having at least or approximately 100% sequence identity to any one of SEQ ID NOs. 540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a heavy chain variable domain having at least or approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or more amino acids of SEQ ID NOs. 540-628.
[0071] In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a light chain variable domain with at least or approximately 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NOs. 629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a light chain variable domain with at least or approximately 95% sequence identity to any one of SEQ ID NOs. 629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a light chain variable domain with at least or approximately 97% sequence identity to any one of SEQ ID NOs. 629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a light chain variable domain with at least or approximately 99% sequence identity to any one of SEQ ID NOs. 629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a light chain variable domain with at least or approximately 100% sequence identity to any one of SEQ ID NOs. 629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a light chain variable domain that includes at least or part of the sequence number 629-717 having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids.
[0072] In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 540, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 629. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 541, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 630. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 542, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 631. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 543, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 632. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 544, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 633. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 545, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 634. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 546, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 635. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 547, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 636.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 548, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 637. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 549, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 638. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 550, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 639. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 551, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 640. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 552, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 641. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 553, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 642. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 554, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 643. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 555, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 644.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 556, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 645. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 557, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 646. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 558, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 647. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 559, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 648. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 560, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 649. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 561, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 650. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 562, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 651. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 563, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 652.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 564, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 653. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 565, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 654. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 566, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 655. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 567, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 656. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 568, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 657. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 569, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 658. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 570, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 659. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 571, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 660.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 572, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 661. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 573, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 662. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 574, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 663. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 575, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 664. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 576, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 665. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 577, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 666. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 578, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 667. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 579, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 668.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 580, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 669. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 581, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 670. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 582, and the immunoglobulin light chain comprises a sequence. It includes an amino acid sequence that is at least about 90% identical to that described in sequence number 671. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 583, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 672. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 584, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 673. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 585, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 674. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 586, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in sequence number 675. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 587, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 676. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 588, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 677. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 589, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 678. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 590, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 679.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 591, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 680. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 592, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 681. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 593, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 682. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 594, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 683. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 595, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 684. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 596, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 685. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 597, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 686. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 598, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 687.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 599, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 688. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 600, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 689. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 601, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 690. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 602, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 691. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 603, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 692. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 604, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 693. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 605, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 694. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 606, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 695.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 607, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 696. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 608, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 697. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 609, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 698. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 610, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 699. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 611, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 700. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 612, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 701. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 613, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 702. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 614, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 703.In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 615, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 704. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 616, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 705. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 617, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 706. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 618, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 707. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 619, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 708. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 620, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 709. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 621, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 710. In some embodiments, the immunoglobulin heavy chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 622, and the immunoglobulin light chain includes an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 711.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 623, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 712. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 624, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 713. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence that is at least about 90% identical to that described in SEQ ID NO: 625. In some embodiments, the immunoglobulin light chain contains an amino acid sequence that is at least approximately 90% identical to the one described in SEQ ID NO: 714. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least approximately 90% identical to the one described in SEQ ID NO: 626, and the immunoglobulin light chain contains an amino acid sequence that is at least approximately 90% identical to the one described in SEQ ID NO: 715. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least approximately 90% identical to the one described in SEQ ID NO: 627, and the immunoglobulin light chain contains an amino acid sequence that is at least approximately 90% identical to the one described in SEQ ID NO: 716. In some embodiments, the immunoglobulin heavy chain contains an amino acid sequence that is at least approximately 90% identical to the one described in SEQ ID NO: 628, and the immunoglobulin light chain contains an amino acid sequence that is at least approximately 90% identical to the one described in SEQ ID NO: 717.
[0073] Provided herein are adenosine A2A receptor-binding libraries comprising a scaffold or nucleic acid encoding an immunoglobulin, which includes an adenosine A2A receptor-binding domain, including variations in domain type, domain length, or residue variations. In some cases, the domain is a region within the scaffold containing the adenosine A2A receptor-binding domain. For example, the region is a VH, CDRH3, or VL domain. In some cases, the domain is an adenosine A2A receptor-binding domain.
[0074] The methods described herein provide for the synthesis of an adenosine A2A receptor-binding library of nucleic acids, each encoding a predetermined variant of at least one given reference nucleic acid sequence. In some cases, the given reference sequence is a nucleic acid sequence encoding a protein, and the variant library comprises sequences encoding variations of at least a single codon, so that multiple different variants of a single residue of the subsequent protein encoded by the synthesized nucleic acid are generated by a standard translation process. In some cases, the adenosine A2A receptor-binding library comprises a variety of nucleic acids that collectively encode variations at multiple positions. In some cases, the variant library comprises sequences encoding variations of at least a single codon in the VH, CDRH3, or VL domain. In some cases, the variant library comprises sequences encoding variations of at least a single codon in the adenosine A2A receptor-binding domain. For example, at least one single codon in the adenosine A2A receptor-binding domain is altered, as listed in Table 1. In some cases, the variant library comprises sequences encoding variations of multiple codons in the VH, CDRH3, or VL domain. In some cases, a variant library contains sequences that encode variations of multiple codons in the adenosine A2A receptor-binding domain. An exemplary number of codons for a variation may include, but are not limited to, at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons.
[0075] The methods described herein provide for the synthesis of an adenosine A2A receptor-binding library of nucleic acids, each encoding a predetermined variant of at least one given reference nucleic acid sequence, wherein the adenosine A2A receptor-binding library comprises a sequence encoding a variation in domain length. In some cases, the domain is a VH, CDRH3, or VL domain. In some cases, the domain is an adenosine A2A receptor-binding domain. In some cases, the library comprises a sequence encoding a variation in length with at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 fewer codons compared to a given reference sequence. In some cases, the library includes sequences that code for length variations that have at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more codons compared to a given reference sequence.
[0076] Provided herein are adenosine A2A receptor-binding libraries comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, the adenosine A2A receptor-binding libraries being synthesized using a variety of fragments. In some cases, the fragments contain VH, CDRH3, or VL domains. In some cases, the adenosine A2A receptor-binding libraries are synthesized using at least or about 2 fragments, 3 fragments, 4 fragments, 5 fragments, or more than 5 fragments. The length or average length of each synthesized nucleic acid fragment may be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some cases, the lengths of the base pairs are approximately 50-600, 75-575, 100-550, 125-525, 150-500, 175-475, 200-450, 225-425, 250-400, 275-375, or 300-350.
[0077] The adenosine A2A receptor-binding libraries comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain as described herein contain amino acids of varying lengths when translated. In some cases, the length or average length of each synthesized amino acid fragment may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some cases, the length of an amino acid is approximately 15-150, 20-145, 25-140, 30-135, 35-130, 40-125, 45-120, 50-115, 55-110, 60-110, 65-105, 70-100, or 75-95. In some cases, the length of an amino acid is approximately 22-75 amino acids.
[0078] An adenosine A2A receptor-binding library containing de novo-synthesized variant sequences encoding a scaffold containing an adenosine A2A receptor-binding domain contains numerous variant sequences. In some cases, numerous variant sequences are de novo-synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some cases, numerous variant sequences are de novo-synthesized for framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, numerous variant sequences are de novo-synthesized for the adenosine A2A receptor-binding domain. For example, the number of variant sequences is approximately 1 to 10 for the VH domain and approximately 10 for the adenosine A2A receptor-binding domain. 8 For sequences and VK domains, there are approximately 1 to 44 sequences. The number of variant sequences can be at least or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences. In some cases, the number of variant sequences is approximately 10-300, 25-275, 50-250, 75-225, 100-200, or 125-150 sequences.
[0079] Adenosine A2A receptor-binding libraries containing de novo-synthesized variant sequences encoding scaffolds containing adenosine A2A receptor-binding domains exhibit improved diversity. For example, variants are generated by placing an adenosine A2A receptor-binding domain variant into an immunoglobulin scaffold variant containing an N-terminal CDRH3 variant and a C-terminal CDRH3 variant. In some cases, variants include affinity-mature variants. Alternatively, or in combination, variants include variants in other regions of immunoglobulins, including but not limited to CDRH1, CDRH2, CDRL1, CDRL2, and CDRL3. In some cases, the number of variants in an adenosine A2A receptor-binding library is at least or about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 These are non-identical sequences exceeding 10. For example, a library containing approximately 10 variant sequences in the VH region, approximately 237 variant sequences in the CDRH3 region, and approximately 43 variant sequences in the VL and CDRL3 regions is 10 5 Includes non-identical sequences (10×237×43).
[0080] Provided herein are libraries comprising nucleic acids encoding adenosine A2A receptor antibodies, which include variations in at least one region of the antibody, the CDR region. In some cases, the adenosine A2A receptor antibody is a monodomain antibody containing one heavy chain variable domain, such as a VHH antibody. In some cases, the VHH antibody contains one or more variations of the CDR region. In some cases, the libraries described herein include at least or about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3. In some cases, the libraries described herein include at least or about 10 CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 2000 sequences from CDR1, at least 1200 sequences from CDR2, and at least 1600 sequences from CDR3. In some cases, the sequences are not identical.
[0081] In some cases, CDR1, CDR2, or CDR3 are of a variable domain, light chain (VL). The variable domains, light chains (VL) of CDR1, CDR2, or CDR3 may be referred to as CDRL1, CDRL2, or CDRL3, respectively. In some cases, the libraries described herein contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3 of the VL. In some cases, the libraries described herein include at least or about 10 of the VL CDR1, CDR2, or CDR3. 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20It contains arrays exceeding [a certain number]. For example, the library contains at least 20 arrays of VL's CDR1, at least 4 arrays of VL's CDR2, and at least 140 arrays of VL's CDR3. In some cases, the library contains at least 2 arrays of VL's CDR1, at least 1 array of VL's CDR2, and at least 3000 arrays of VL's CDR3. In some cases, VL is IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, or IGLV3-1. In some cases, VL is IGKV2-28. In some cases, VL is IGLV1-51.
[0082] In some cases, CDR1, CDR2, or CDR3 is of the variable domain of the heavy chain (VH). The CDR1, CDR2, or CDR3 of the variable domain of the heavy chain (VH) can be referred to as CDRH1, CDRH2, or CDRH3 respectively. In some cases, the library described herein contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or arrays exceeding 3000 of VH's CDR1, CDR2, or CDR3. In some cases, the library described herein contains at least or about 10 4 、10 5 、10 6 、10 7 、10 8 、10 9 、10 10 、10 11 、10 12 、10 13 、10 14 、10 15 、10 16 、10 17 、1018 , 10 19 , 10 20 , or 10 20 It includes sequences exceeding a certain number. For example, the library includes at least 30 sequences of VH's CDR1, at least 570 sequences of VH's CDR2, and at least 10 sequences of VH's CDR3. 8 The library includes the sequences of VH's CDR1, VH's CDR2, and VH's CDR3, at least 30 sequences of VH's CDR1, at least 860 sequences of VH's CDR2, and at least 10 sequences of VH's CDR3. 7 The sequence is included. In some cases, VH is IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, or IGHV4-59 / 61. In some cases, VH is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, VH is IGHV1-69 and IGHV3-30. In some cases, VH is IGHV3-23.
[0083] The libraries described herein include, in some embodiments, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 of varying lengths. In some cases, the lengths of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 include at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acids. For example, CDRH3 includes at least or about 12, 15, 16, 17, 20, 21, or 23 amino acids of varying lengths. In some cases, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 include a range of amino acids in length of approximately 1–10, approximately 5–15, approximately 10–20, or approximately 15–30.
[0084] A library containing nucleic acids encoding antibodies having the variant CDR sequences described herein, when translated, will contain amino acids of varying lengths. In some cases, the length or average length of each synthesized amino acid fragment may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some cases, the length of an amino acid is approximately 15-150, 20-145, 25-140, 30-135, 35-130, 40-125, 45-120, 50-115, 55-110, 60-110, 65-105, 70-100, or 75-95. In some cases, the length of an amino acid is approximately 22 to 75. In some cases, an antibody contains at least or approximately 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.
[0085] The ratio of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 lengths may vary in the libraries described herein. In some cases, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 containing amino acid lengths of at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90% of the library may constitute about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more than 90% of the library. For example, 40% of the library may contain CDRH3 with a length of approximately 23 amino acids, 30% with a length of approximately 21 amino acids, 20% with a length of approximately 17 amino acids, and 10% with a length of approximately 12 amino acids. In some cases, 40% of the library may contain CDRH3 with a length of approximately 20 amino acids, 30% with a length of approximately 16 amino acids, 20% with a length of approximately 15 amino acids, and 10% with a length of approximately 12 amino acids.
[0086] The libraries described herein that encode VHH antibodies contain at least or about 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It includes variant CDR sequences that are shuffled to generate a library with theoretical sequence diversity exceeding 10. In some cases, the library contains at least or about 10 7 , 10 8, 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 , 10 16 , 10 17 , 10 18 , 10 19 , 10 20 , or 10 20 It has a final library diversity of sequences exceeding [number].
[0087] Provided herein are adenosine A2A receptor-binding libraries encoding immunoglobulins. In some cases, the adenosine A2A receptor immunoglobulin is an antibody. In some cases, the adenosine A2A receptor immunoglobulin is a VHH antibody. In some cases, the adenosine A2A receptor immunoglobulin has a binding affinity to the adenosine A2A receptor (e.g., K) of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nM, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM. D ) includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 1 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin is less than 1.2 nM K D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 2 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 5 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 10 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 13.5 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 15 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 20 nM. DThis includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 25 nM. D This includes. In some cases, adenosine A2A receptor immunoglobulin has a K content of less than 30 nM. D Includes.
[0088] In some cases, adenosine A2A receptor immunoglobulin is an adenosine A2A receptor agonist. In some cases, adenosine A2A receptor immunoglobulin is an adenosine A2A receptor antagonist. In some cases, adenosine A2A receptor immunoglobulin is an adenosine A2A receptor allosteric modulator. In some cases, an allosteric modulator is a negative allosteric modulator. In some cases, an allosteric modulator is a positive allosteric modulator. In some cases, adenosine A2A receptor immunoglobulin produces agonist, antagonist, or allosteric effects at concentrations of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 120 nM, 140 nM, 160 nM, 180 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, or above 1000 nM. In some cases, adenosine A2A receptor immunoglobulin is a negative allosteric modulator. In some cases, adenosine A2A receptor immunoglobulin is a negative allosteric modulator at concentrations of at least or about 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or above 100 nM. In some cases, adenosine A2A receptor immunoglobulin is a negative allosteric modulator at concentrations in the range of about 0.001–about 100, 0.01–about 90, about 0.1–about 80, 1–about 50, about 10–about 40 nM, or about 1–about 10 nM. In some cases, adenosine A2A receptor immunoglobulin contains an EC50 or IC50 of at least or about 0.001, 0.0025, 0.005, 0.01, 0.025, 0.05, 0.06, 0.07, 0.08, 0.9, 0.1, 0.5, 1, 2, 3, 4, 5, 6, or 6 nM or higher.In some cases, adenosine A2A receptor immunoglobulin contains an EC50 or IC50 of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or above 100 nM.
[0089] The adenosine A2A receptor immunoglobulins described herein may have improved properties. In some cases, the adenosine A2A receptor immunoglobulin is monomeric. In some cases, the adenosine A2A receptor immunoglobulin is less prone to aggregation. In some cases, at least or about 70%, 75%, 80%, 85%, 90%, 95%, or 99% of the adenosine A2A receptor immunoglobulin is monomeric. In some cases, the adenosine A2A receptor immunoglobulin is thermally stable. In some cases, the adenosine A2A receptor immunoglobulin results in reduced nonspecific binding.
[0090] Following the synthesis of an adenosine A2A receptor-binding library containing nucleic acids encoding a scaffold with an adenosine A2A receptor-binding domain, the library can be used for screening and analysis. For example, the library can be assayed for its manifestability and panning. In some cases, manifestability is assayed using selectable tags. Exemplary tags include, but are not limited to, radiolabels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric labels, affinity tags, or other labels or tags known in the art. In some cases, the tags are histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. The adenosine A2A receptor-binding library may contain nucleic acids encoding a scaffold with an adenosine A2A receptor-binding domain, accompanied by multiple tags such as GFP, FLAG, and Lucy, as well as DNA barcodes. In some cases, libraries are assayed by sequencing using a variety of methods, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyro sequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthesis sequencing.
[0091] Expression system Provided herein are libraries comprising nucleic acids encoding scaffolds containing an adenosine A2A receptor-binding domain, the libraries having improved specificity, stability, expression, folding, or downstream activity. In some cases, the libraries described herein are used for screening and analysis.
[0092] Provided herein are libraries containing nucleic acids encoding scaffolds containing adenosine A2A receptor-binding domains, which are used for screening and analysis. In some cases, the screening and analysis include in vitro, in vivo, or ex vivo assays. Cells for screening include primary cells taken from living subjects or cell lines. Cells may originate from prokaryotes (e.g., bacteria and fungi) or eukaryotes (e.g., animals and plants). Exemplary animal cells include, but are not limited to, cells from mice, rabbits, primates, and insects. In some cases, cells for screening include, but are not limited to, cell lines such as the Chinese hamster ovary (CHO) cell line, the human embryonic kidney (HEK) cell line, or the baby hamster kidney (BHK) cell line. In some cases, the nucleic acid libraries described herein may also be delivered to multicellular organisms. Exemplary multicellular organisms include, but are not limited to, plants, mice, rabbits, primates, and insects.
[0093] The nucleic acid libraries or protein libraries encoding them described herein can be screened for a variety of pharmacological or pharmacokinetic properties. In some cases, the libraries are screened using in vitro assays, in vivo assays, or exo vivo assays. For example, in vitro pharmacological or pharmacokinetic properties to be screened include, but are not limited to, binding affinity, binding specificity, and binding avidity. Exemplary in vivo pharmacological or pharmacokinetic properties of the libraries described herein to be screened include, but are not limited to, therapeutic effect, activity, preclinical toxicity properties, clinical effect properties, clinical toxicity properties, immunogenicity, potency, and clinical safety properties.
[0094] Pharmacological or pharmacokinetic properties that can be screened include, but are not limited to, cell binding affinity and cell activity. For example, cell binding affinity assays or cell activity assays are performed to determine the agonist, antagonist, or allosteric effects of the libraries described herein. In some cases, the cell activity assay is a cAMP assay. In some cases, the libraries described herein are compared to the cell binding or cell activity of adenosine A2A receptor ligands.
[0095] The libraries described herein can be screened in cell-based or non-cell-based assays. Examples of non-cell-based assays include, but are not limited to, the use of viral particles, in vitro translation proteins, and protealiposomes with adenosine A2A receptors.
[0096] The nucleic acid libraries described herein can be screened by sequencing. In some cases, next-generation sequencing is used to determine the sequence enrichment of adenosine A2A receptor-binding variants. In some cases, V gene distribution, J gene distribution, V gene family, CDR3 count per length, or combinations thereof are determined. In some cases, clone frequency, clone accumulation, lineage accumulation, or combinations thereof are determined. In some cases, the number of sequences, sequences with VH clones, clones, clones greater than 1, chronotypes, chronotypes greater than 1, lineages, Simpson, or combinations thereof are determined. In some cases, the percentage of non-identical CDR3s is determined. For example, the percentage of non-identical CDR3s is calculated by dividing the number of non-identical CDR3s in the sample by the total number of sequences with CDR3s in the sample.
[0097] Provided herein are nucleic acid libraries, which can be expressed in vectors. Expression vectors for inserting the nucleic acid libraries disclosed herein may include eukaryotic or prokaryotic expression vectors. Exemplary expression vectors include mammalian expression vectors: pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV, pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4 This includes, but is not limited to, pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1 vector, pEF1a-tdTomato vector, pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), and pSF-CMV-PURO-NH2-CMYC; bacterial expression vectors: pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20, and pSF-Tac; plant expression vectors: pRI 101-AN DNA and pCambia2301; and yeast expression vectors: pTYB21 and pKLAC2; and insect vectors: pAc5.1 / V5-HisA and pDEST8. In some cases, the vector is pcDNA3 or pcDNA3.1.
[0098] Described herein are nucleic acid libraries expressed in a vector to generate constructs comprising a scaffold containing a sequence of adenosine A2A receptor-binding domains. In some cases, the size of the constructs varies. In some cases, the constructs contain at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000 bases, or more than 10000 bases. In some cases, the structures are approximately 300-1,000, 300-2,000, 300-3,000, 300-4,000, 300-5,000, 300-6,000, 300-7,000, 300-8,000, 300-9,000, 300-10,000, 1,000-2,000, 1,000-3,000, 1,000-4,000, 1,000-5,000, 1, 000-6,000, 1,000-7,000, 1,000-8,000, 1,000-9,000, 1,000-10,000, 2,000-3,000, 2,000-4,000, 2,000-5,000, 2,000-6,000, 2,000-7,000, 2,000-8,000, 2,000-9,000, 2,000-10,000, 3,000-4,000, 3, 000-5,000, 3,000-6,000, 3,000-7,000, 3,000-8,000, 3,000-9,000, 3,000-10,000, 4,000-5,000, 4,000-6,000, 4,000-7,000, 4,000-8,000, 4,000-9,000, 4,000-10,000, 5,000-6,000, 5,000-7,000, 5, This includes the ranges of 000-8,000, 5,000-9,000, 5,000-10,000, 6,000-7,000, 6,000-8,000, 6,000-9,000, 6,000-10,000, 7,000-8,000, 7,000-9,000, 7,000-10,000, 8,000-9,000, 8,000-10,000, or 9,000-10,000 bases.
[0099] Provided herein are libraries comprising nucleic acids encoding scaffolds containing an adenosine A2A receptor-binding domain, wherein the nucleic acid library is expressed in cells. In some cases, the library is synthesized to express a reporter gene. Exemplary reporter genes include, but are not limited to, acetohydroxy acid synthase (AHAS), alkaline phosphatase (AP), beta-galactosidase (LacZ), beta-glucolonidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), cerulean fluorescent protein, citrin fluorescent protein, orange fluorescent protein, cherry fluorescent protein, turquoise fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), nopalin synthase (NOS), octopine synthase (OCS), luciferase, and their derivatives. Methods for determining the regulation of reporter genes are well known in the art and include, but are not limited to, fluorescence analysis (e.g., fluorescence spectroscopy, fluorescence-activated cell sorting (FACS), fluorescence microscopy) and antibiotic resistance determination.
[0100] Diseases and Disabilities Provided herein are adenosine A2A receptor-binding libraries comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain that may have therapeutic effects. In some cases, the adenosine A2A receptor-binding libraries, when translated, yield proteins used to treat a disease or disorder. In some cases, the protein is an immunoglobulin. In some cases, the protein is a peptide mime. Exemplary diseases include, but are not limited to, cancer, inflammatory diseases or disorders, metabolic diseases or disorders, cardiovascular diseases or disorders, respiratory diseases or disorders, pain, gastrointestinal diseases or disorders, reproductive diseases or disorders, endocrine diseases or disorders, or neurological diseases or disorders. In some cases, neurological diseases or disorders are neurodegenerative diseases or disorders. In some cases, neurological diseases or disorders are Parkinson's disease, Alzheimer's disease, or multiple sclerosis. In some cases, cancer is a solid tumor or a hematological cancer. In some cases, the A2AR immunoglobulins described herein are used as monotherapy for the treatment of cancer. In some cases, the A2AR immunoglobulins described herein are used in combination with other therapeutic agents for treating cancer. In some cases, the A2AR immunoglobulins described herein enhance tumor vaccines, checkpoint blockades, and adoptive T-cell therapies. In some cases, the adenosine A2A receptor inhibitors described herein are used for the treatment of diseases or disorders of the central nervous system, kidneys, intestines, lungs, hair, skin, bones, or cartilage. In some cases, the adenosine A2A receptor inhibitors described herein are used for sleep regulation, angiogenesis, or immune system modulation. In some cases, the subject is a mammal. In some cases, the subject is a mouse, rabbit, dog, or human. The subject treated by the methods described herein may be an infant, an adult, or a child. Pharmaceutical compositions comprising the antibodies or antibody fragments described herein may be administered intravenously or subcutaneously.
[0101] Variant Library Codon Variations The variant nucleic acid libraries described herein may comprise multiple nucleic acids, each encoding a variant codon sequence compared to a reference nucleic acid sequence. In some cases, each nucleic acid in the first nucleic acid population contains a variant at a single variant site. In some cases, the first nucleic acid population contains multiple variants at a single variant site, resulting in the first nucleic acid population containing one or more variants at the same variant site. The first nucleic acid population may comprise nucleic acids that collectively encode multiple codon variants at the same variant site. The first nucleic acid population may comprise nucleic acids that collectively encode up to 19 or more codons at the same location. The first nucleic acid population may comprise nucleic acids that collectively encode up to 60 variant triplets at the same location, or the first nucleic acid population may comprise nucleic acids that collectively encode up to 61 different codon triplets at the same location. Each variant may encode a codon that results in a different amino acid during translation. Table 2 provides a list of possible codons (and representative amino acids) for each variant site.
[0102] [Table 2] JPEG2026102621000004.jpg158165
[0103] A nucleic acid population may contain various nucleic acids that collectively encode up to 20 codon variations at multiple positions. In such cases, each nucleic acid in the population contains codon variations at more than one position within the same nucleic acid. In some cases, each nucleic acid in the population contains codon variations at codons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more within a single nucleic acid. In some cases, each variant's long nucleic acid contains codon variations at codons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more within a single long nucleic acid. In some cases, a variant nucleic acid population contains codon variations in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codons within a single nucleic acid. In some cases, a variant nucleic acid population contains codon variations in at least approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more codons within a single long nucleic acid.
[0104] Highly parallel nucleic acid synthesis Provided herein is a platform approach that leverages miniaturization, parallelization, and vertical integration of end-to-end processes, from polynucleotide synthesis to gene assembly in nanowells on silicon, to create innovative synthetic platforms. The devices described herein provide a silicon synthesis platform with the same footprint as a 96-well plate, which can improve throughput by up to 1,000 times or more compared to conventional synthesis methods, and can generate up to approximately 1,000,000 or more polynucleotides, or 10,000 or more genes, in a single, highly parallelized run.
[0105] With the advent of next-generation sequencing, high-resolution genomic data has become a crucial element for research that delves into the biological roles of various genes in both normal biology and disease pathogenesis. At the core of this research lies the central dogma of molecular biology and the concept of "residue-by-residue transfer of continuous information." Genomic information encoded in DNA is transcribed into messages, which are then translated into proteins, the active products within a given biological pathway.
[0106] Another exciting area of research concerns the discovery, development, and manufacture of therapeutic molecules focused on highly specific cellular targets. Highly diverse DNA sequence libraries are central to the targeted therapy development pipeline. Gene variants are used to express proteins in the design, construction, and testing of protein engineering cycles, ideally leading to genes optimized for high expression of proteins with high affinity to therapeutic targets. Consider, as an example, the binding pocket of a receptor. The ability to simultaneously test all sequence permutations of all residues within the binding pocket allows for thorough exploration and increases the likelihood of success. Saturated mutagenesis, in which researchers attempt to generate all possible mutations at a specific site within the receptor, represents one approach to this development challenge. Although costly, time-intensive, and labor-intensive, it allows for the introduction of each variant at each location. In contrast, combinatorial mutagenesis, where several selected locations or short stretches of DNA may be extensively altered, generates an incomplete repertoire of variants with biased expressions.
[0107] To accelerate drug development pipelines, a precision library—a library containing desired variants available at intended frequencies and in appropriate locations for testing—enables reductions in screening costs and turnaround times. Provided herein is a method for synthesizing nucleic acid synthetic variant libraries that provide precise introduction of each intended variant at desired frequencies. For end-users, this translates not only to the ability to fully sample sequence space but also to the ability to query these hypotheses in an efficient manner, reducing costs and screening time. Genome-wide editing allows for the elucidation of libraries where critical pathways, each variant, and sequence permutation can be tested to confirm optimal function, and also allows for the reconstruction of entire pathways and genomes using thousands of genes, redesigning biological systems for drug discovery.
[0108] In the first example, the drug itself can be optimized using the methods described herein. For example, to improve a specific function of an antibody, a variant polynucleotide library encoding a portion of the antibody is designed and synthesized. The variant nucleic acid library of the antibody can then be produced by the processes described herein (e.g., PCR mutagenesis followed by insertion into a vector). The antibody is then expressed in a production cell line and screened for enhanced activity. Examples of screening include testing for binding affinity to the antigen, stability, or modulation of effector function (e.g., ADCC, complementarity, or apoptosis). Exemplary regions for antibody optimization include the Fc region, Fab region, variable region of the Fab region, constant region of the Fab region, heavy chain or light chain (V H or V L ) variable domain, and V H or V L This includes, but is not limited to, specific complementarity-determining regions (CDRs).
[0109] Nucleic acid libraries synthesized by the methods described herein can be expressed in a variety of cells associated with the disease. These disease-associated cells include cell lines, tissue samples, primary cells from a subject, cultured cells expanded from a subject, or cells in a model system. Exemplary model systems include, but are not limited to, plant and animal models of the disease.
[0110] To identify variant molecules associated with the prevention, mitigation, or treatment of a disease, the variant nucleic acid libraries described herein are expressed in disease-associated cells or cells capable of inducing the disease within them. In some cases, drugs are used to induce the disease in cells. Exemplary tools for disease induction include, but are not limited to, Cre / Lox recombinant systems, LPS inflammation induction, and streptozotocin for inducing hypoglycemia. Disease-associated cells may be cells from model systems or cultured cells, as well as cells from subjects with a particular disease. Exemplary diseases include bacterial, fungal, viral, autoimmune, or proliferative disorders (e.g., cancer). In some cases, the variant nucleic acid libraries are expressed in primary cells derived from model systems, cell lines, or subjects and screened for changes in at least one cellular activity. Exemplary cellular activities include, but are not limited to, proliferation, cycle progression, cell death, adhesion, migration, replication, cell signaling, energy production, oxygen utilization, metabolic activity, and aging, response to free radical damage, or any combination thereof.
[0111] Base material Devices used as surfaces for polynucleotide synthesis may take the form of a substrate, including but not limited to homogeneous array surfaces, patterned array surfaces, channels, beads, and gels. Provided herein are substrates comprising multiple clusters, each cluster containing multiple loci (locations) that support the binding and synthesis of polynucleotides. In some cases, the substrate includes a homogeneous array surface. For example, a homogeneous array surface is a homogeneous plate. As used herein, the term “loci” refers to a distinct structural region that provides support for a single polynucleotide encoding a given sequence extending from the surface. In some cases, the loci are on a two-dimensional surface, e.g., a substantially planar surface. In some cases, the loci are on a three-dimensional surface, e.g., a well, microwell, channel, or post. In some cases, the surface of the loci comprises a material that is actively functionalized to bind at least one nucleotide, or preferably a population of identical nucleotides, for the synthesis of a population of polynucleotides, for polynucleotide synthesis. In some cases, polynucleotides refer to a population of polynucleotides encoding the same nucleic acid sequence. In some cases, the surface of the substrate includes one or more surfaces of the substrate. The average error rate of polynucleotides synthesized in the library described herein using the provided system and method is, without error correction, often less than 1 / 1000, less than about 1 / 2000, and less than or equal to about 1 / 3000.
[0112] Provided herein is a surface that supports the parallel synthesis of multiple polynucleotides having different predetermined sequences at addressable positions on a common support. In some cases, the substrate is 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, It provides support for the synthesis of non-identical polynucleotides exceeding 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000, or more. In some cases, the surface is 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1 It supports the synthesis of polynucleotides encoding different sequences exceeding 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000, or more. In some cases, the polynucleotides are configured so that at least a portion of them have the same sequence or are synthesized using the same sequence. In some cases, the substrate provides a surface environment for the proliferation of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, and 500 bases.
[0113] Provided herein are methods for the synthesis of polynucleotides at distinct loci of a substrate, where each locus supports the synthesis of a population of polynucleotides. In some cases, each locus supports the synthesis of a population of polynucleotides having a different sequence from the population of polynucleotides synthesized at another locus. In some cases, each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9, or more redundancies across different loci within the same cluster of surface loci for polynucleotide synthesis. In some cases, the loci of the substrate are located within multiple clusters. In some cases, the substrate contains at least 10,500, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 11,000, 12,000, 13,000, 14,000, 15,000, 20,000, 30,000, 40,000, 50,000, or more clusters. In some cases, the base material is 2,000, 5,000, 10,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,100,000, 1,200,000, 1,300,000, 1,400,000, 1,500,000, 1,600,000, 1,700,000, 1,800,000, 1,900,000, 2,000,000 This includes more than 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, or 10,000,000 or more distinct loci. In some cases, the substrate contains approximately 10,000 distinct loci. The number of loci within a single cluster varies from case to case.In some cases, each cluster contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500, or more loci. In some cases, each cluster contains approximately 50–500 loci. In some cases, each cluster contains approximately 100–200 loci. In some cases, each cluster contains approximately 100–150 loci. In some cases, each cluster contains approximately 109, 121, 130, or 137 loci. In some cases, each cluster contains approximately 19, 20, 61, 64, or more loci. Alternatively, or in combination, polynucleotide synthesis occurs on a homogeneous array surface.
[0114] In some cases, the number of distinct polynucleotides synthesized on the substrate depends on the number of distinct loci available on the substrate. In some cases, the density of loci within a cluster or on the surface of the substrate is 1 mm 2 Per unit, there are at least or approximately 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000, or more loci. In some cases, the substrate has 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm 2This includes: In some cases, the distance between the centers of two adjacent loci within a cluster or surface is about 10–500, about 10–200, or about 10–100 μm. In some cases, the distance between the centers of two adjacent loci is greater than about 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, the distance between the centers of two adjacent loci is less than about 200, 150, 100, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the width of each locus is about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, the width of each gene locus is approximately 0.5–100, 0.5–50, 10–75, or 0.5–50 μm.
[0115] In some cases, the density of clusters within the substrate is at least or about 100 mm 2 1 cluster per unit, 10mm 2 1 cluster per unit, 5 mm 2 1 cluster per unit, 4mm 2 1 cluster per unit, 3 mm 2 1 cluster per unit, 2 mm 2 1 cluster per unit, 1 mm 2 1 cluster per unit, 1 mm 2 2 clusters per unit, 1 mm 2 3 clusters per unit, 1 mm 2 4 clusters per 1mm 2 5 clusters per 1 mm 2 10 clusters per unit, 1 mm 2 There are 50 clusters or more per unit. In some cases, the substrate is 10 mm 2 Approximately 1 cluster to 1 mm 2Each cluster contains up to approximately 10 clusters. In some cases, the distance between the centers of two adjacent clusters is at least or approximately 50, 100, 200, 500, 1000, 2000, or 5000 μm. In some cases, the distance between the centers of two adjacent clusters is approximately 50-100, 50-200, 50-300, 50-500, and 100-2000 μm. In some cases, the distance between the centers of two adjacent clusters is between approximately 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster has a cross-section of approximately 0.5–2, approximately 0.5–1, or approximately 1–2 mm. In some cases, the cross-sectional area of each cluster is approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In some cases, the internal cross-section of each cluster is approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.
[0116] In some cases, the substrate is roughly the size of a standard 96-well plate, e.g., approximately 100-200 mm × approximately 50-150 mm. In some cases, the substrate has a diameter of approximately 1000, 500, 450, 400, 300, 250, 200, 150, 100, or 50 mm or less. In some cases, the diameter of the substrate is between approximately 25-1000, 25-800, 25-600, 25-500, 25-400, 25-300, or 25-200 mm. In some cases, the substrate is at least approximately 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 12,000, 15,000, 20,000, 30,000, 40,000, or 50,000 mm. 2, or having a planar surface area of , or greater. In some cases, the thickness of the substrate is between approximately 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.
[0117] surface material The substrates, devices, and reactors provided herein are manufactured from any variety of materials suitable for the methods, compositions, and systems described herein. In certain examples, the substrate material is manufactured to exhibit low levels of nucleotide bonding. In some cases, the substrate material is modified to produce distinct surfaces exhibiting high levels of nucleotide bonding. In some cases, the substrate material is transparent to visible and / or UV light. In some cases, the substrate material is sufficiently conductive, for example, to form a uniform electric field across all or part of the substrate. In some cases, the conductive material is connected to an electrical ground. In some cases, the substrate is thermally conductive or thermally insulating. In some cases, the material is chemically resistant and heat-resistant to support chemical or biochemical reactions, such as polynucleotide synthesis reaction processes. In some cases, the substrate includes flexible materials. In the case of flexible materials, the material includes, but is not limited to, nylon, nitrocellulose, polypropylene, and the like, both modified and unmodified. In some cases, the substrate includes rigid materials. For rigid materials, the materials may include, but are not limited to, glass, fused silica, silicon, plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and blends thereof), and metals (e.g., gold, platinum). Substrates, solid supports, or reactors can be manufactured from materials selected from the group consisting of silicon, polystyrene, agarose, dextran, cellulosic polymers, polyacrylamide, polydimethylsiloxane (PDMS), and glass. Substrates / solid supports or their microstructures, reactors, etc., can be manufactured from the materials listed herein or any other suitable combination of materials known in the art.
[0118] surface structure Provided herein are substrates for the methods, compositions, and systems described herein, the substrates having a surface structure suitable for the methods, compositions, and systems described herein. In some cases, the substrates include raised and / or recessed features. One advantage of having such features is an increased surface area for supporting polynucleotide synthesis. In some cases, substrates having raised and / or recessed features are called three-dimensional substrates. In some cases, the three-dimensional substrates include one or more channels. In some cases, one or more loci constitute the channels. In some cases, the channels are accessible for reagent deposition via a deposition device, such as a material deposition device. In some cases, reagents and / or fluids accumulate in larger wells of one or more channels for fluid communication. For example, the substrate includes multiple channels corresponding to multiple loci with clusters, and the multiple channels are fluid-connected to one well of the cluster. In some methods, a library of polynucleotides is synthesized in clusters of multiple loci.
[0119] Provided herein are substrates for the methods, compositions, and systems described herein, wherein the substrate is configured for polynucleotide synthesis. In some cases, the structure is configured to allow controlled flow and mass transfer pathways for polynucleotide synthesis on the surface. In some cases, the configuration of the substrate allows for a controlled and uniform distribution of mass transfer pathways, chemical exposure time, and / or scrubbing efficiency during polynucleotide synthesis. In some cases, the configuration of the substrate allows for increased sweeping efficiency by providing sufficient volume for the growing polynucleotide, for example, so that the volume excluded by the growing polynucleotide does not exceed 50, 45, 40, 35, 30, 25, 20, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1% or less of the initial available volume available or suitable for growing the polynucleotide. In some cases, the three-dimensional structure allows for controlled fluid flow and rapid exchange of chemical exposure.
[0120] Provided herein are substrates for the methods, compositions, and systems described herein, the substrates comprising structures suitable for the methods, compositions, and systems described herein. In some cases, separation is achieved by physical structure. In some cases, separation is achieved by different functionalization of the surface to generate active and passive regions for polynucleotide synthesis. In some cases, differential functionalization is achieved by alternating hydrophobicity across the entire substrate surface, thereby creating a water contact angle effect that causes beading or wetting of the deposited reagent. By employing a larger structure, splashing and cross-contamination of separate polynucleotide synthesis sites by reagents from adjacent spots can be reduced. In some cases, reagents are deposited at separate polynucleotide synthesis sites using equipment such as a material deposition apparatus. Substrates with three-dimensional features are configured to enable the synthesis of a very large number of polynucleotides (e.g., more than approximately 10,000) with a low error rate (e.g., less than approximately 1:500, 1:1000, 1:1500, 1:2,000, 1:3,000, 1:5,000, or 1:10,000). In some cases, the substrate has approximately 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 features / mm 2 It includes features having a density of [value].
[0121] Wells in the substrate may have the same or different width, height, and / or volume as other wells in the substrate. Channels in the substrate may have the same or different width, height, and / or volume as other channels in the substrate. In some cases, the diameter of a cluster or the diameter of a well containing a cluster, or both, is between approximately 0.05–50, 0.05–10, 0.05–5, 0.05–4, 0.05–3, 0.05–2, 0.05–1, 0.05–0.5, 0.05–0.1, 0.1–10, 0.2–10, 0.3–10, 0.4–10, 0.5–10, 0.5–5, or 0.5–2 mm. In some cases, the diameter of a cluster or well, or both, is less than 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm or approximately 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some cases, the diameter of a cluster or well, or both, is approximately 1.0–1.3 mm. In some cases, the diameter of a cluster or well, or both, is approximately 1.150 mm. In some cases, the diameter of a cluster or well, or both, is approximately 0.08 mm. The cluster diameter refers to a cluster within a two-dimensional or three-dimensional substrate.
[0122] In some cases, the well height is approximately 20-1000, 50-1000, 100-1000, 200-1000, 300-1000, 400-1000, or 500-1000 μm. In some cases, the well height is approximately 1000, 900, 800, 700, or less than 600 μm.
[0123] In some cases, the substrate contains multiple channels corresponding to multiple gene loci within the cluster, with channel heights or depths of 5–500, 5–400, 5–300, 5–200, 5–100, 5–50, or 10–50 μm. In some cases, channel heights are less than 100, 80, 60, 40, or 20 μm.
[0124] In some cases, the diameters of channels, loci (e.g., in a substantially planar substrate), or both channels and loci (e.g., in a three-dimensional substrate where the locus corresponds to a channel) are approximately 1–1000, 1–500, 1–200, 1–100, 5–100, or 10–100 μm, e.g., approximately 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the diameters of channels, loci, or both channels and loci are less than approximately 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the distance between the centers of two adjacent channels, loci, or channels and loci is approximately 1–500, 1–200, 1–100, 5–200, 5–100, 5–50, or 5–30, e.g., approximately 20 μm.
[0125] surface modification Provided herein are methods for the synthesis of polynucleotides on a surface, wherein the surface includes various surface modifications. In some cases, surface modification is used to chemically and / or physically modify a surface by additive or subtractive processes to alter one or more chemical and / or physical properties of the substrate surface, or selected parts or regions of the substrate surface. For example, surface modification includes, but is not limited to, (1) altering the wettability of the surface, (2) functionalizing the surface, i.e., providing, modifying, or substituting surface functional groups, (3) defunctionalizing the surface, i.e., removing surface functional groups, (4) altering the chemical composition of the surface by other means, for example, through etching, (5) increasing or decreasing the surface roughness, (6) providing a coating on the surface, e.g., providing a coating that exhibits different wettability than the surface, and / or (7) depositing particles on the surface.
[0126] In some cases, adding a chemical layer on top of a surface (referred to as an adhesion promoter) facilitates the formation of structured patterns of loci on the substrate surface. Exemplary surfaces to which adhesion promoters can be applied include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with high surface energy. In some cases, a second chemical layer is deposited on the substrate surface. In some cases, the second chemical layer has low surface energy. In some cases, the surface energy of the chemical layer coated on the surface supports the localization of droplets on the surface. Depending on the selected pattern arrangement, the proximity of loci and / or the area of fluid contact at the loci can be modified.
[0127] In some cases, for example, for polynucleotide synthesis, the substrate surface or degraded gene locus on which nucleic acids or other moieties are deposited may be smooth or substantially planar (e.g., two-dimensional), or may have irregularities such as raised or recessed features (e.g., three-dimensional features). In some cases, the substrate surface is modified with one or more different layers of compounds. Such modifying layers of interest include, but are not limited to, inorganic and organic layers such as metals, metal oxides, polymers, and small organic molecules.
[0128] In some cases, the degraded gene loci of a substrate are functionalized with one or more moieties that increase and / or decrease the surface energy. In some cases, the moieties are chemically inert. In some cases, the moieties are configured to support one or more processes in a desired chemical reaction, e.g., polynucleotide synthesis. The surface energy, or hydrophobicity, of a surface is a factor for determining the affinity of nucleotides to adhere to the surface. In some cases, a method for functionalizing a substrate comprises (a) providing a substrate having a surface containing silicon dioxide, and (b) silanizing the surface using a suitable silanizing agent described herein or otherwise known in the art, e.g., an organofunctionalized alkoxysilane molecule. The method and functionalizing agent are described in whole herein by reference in U.S. Patent No. 5,474,796.
[0129] In some cases, the substrate surface is functionalized by contact with a derivatization composition containing a mixture of silanes under reaction conditions effective for bonding the silanes to the substrate surface, typically via reactive hydrophilic moieties present on the substrate surface. Silanation generally involves coating the surface by self-assembly with organofunctional alkoxysilane molecules. Various siloxane functionalization reagents can be further used, for example, to lower or increase the surface energy, as is currently known in the art. Organofunctional alkoxysilanes are classified according to their organic function.
[0130] Polynucleotide synthesis Methods of polynucleotide synthesis as currently disclosed may include processes involving phosphoramidite chemistry. In some cases, polynucleotide synthesis includes coupling a base with a phosphoramidite. Polynucleotide synthesis may include coupling of a base by deposition of a phosphoramidite under coupling conditions, where the same base is optionally deposited with the phosphoramidite more than once, i.e., double coupling. Polynucleotide synthesis may include capping of unreacted sites. In some cases, capping is optional. Polynucleotide synthesis may also include oxidation or one or more oxidation steps. Polynucleotide synthesis may include deblocking, detritylation, and sulfidation. In some cases, polynucleotide synthesis includes either oxidation or sulfidation. In some cases, the device is washed during one or each step of the polynucleotide synthesis reaction, for example, with tetrazole or acetonitrile. The time frame for any single step in the phosphoramidite synthesis method can be approximately 2 minutes, 1 minute, 50 seconds, 40 seconds, 30 seconds, 20 seconds, and less than 10 seconds.
[0131] Polynucleotide synthesis using the phosphoramidite method may involve the subsequent addition of phosphoramidite building blocks (e.g., nucleoside phosphoramidites) to a growing polynucleotide chain for the formation of phosphytotryester bonds. Phosphoramidite polynucleotide synthesis proceeds in the 3' to 5' direction. Phosphoramidite polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain in each synthetic cycle. In some cases, each synthetic cycle includes a coupling step. Phosphoramidite coupling involves the formation of a phosphytotryester bond between an activated nucleoside phosphoramidite and a nucleoside bound to a substrate, for example, via a linker. In some cases, the nucleoside phosphoramidite is supplied to an activated device. In some cases, the nucleoside phosphoramidite is supplied to the device together with an activator. In some cases, the nucleoside phosphoramidite is supplied to the device in an excess of 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, or 100 times or more of the nucleoside bound to the substrate. In some cases, the addition of the nucleoside phosphoramidite is carried out in an anhydrous environment, for example, in anhydrous acetonitrile. Following the addition of the nucleoside phosphoramidite, the device is optionally washed. In some cases, the coupling step is repeated one or more times, optionally accompanied by a washing step between the addition of the nucleoside phosphoramidite to the substrate. In some cases, the polynucleotide synthesis method used herein comprises one, two, three, or more consecutive coupling steps. Before coupling, the nucleoside bonded to the device is often deprotected by the removal of a protecting group, which functions to prevent polymerization. A common protecting group is 4,4'-dimethoxytrityl (DMT).
[0132] Following coupling, the phosphoramidite polynucleotide synthesis method optionally includes a capping step. In the capping step, the growing polynucleotide is treated with a capping agent. The capping step helps block the unreacted substrate-bound 5'-OH group after coupling, preventing the formation of polynucleotides with internal base deletions. Furthermore, phosphoramidites activated with 1H-tetrazole may react slightly with the O6 position of guanosine. While not bound by theory, oxidation with I2 / water may cause this byproduct to undergo depurination, possibly via O6-N7 migration. During the final deprotection of the polynucleotide, the depurinated base site may be cleaved, reducing the yield of the full-length product. The O6 modification can be removed by treatment with a capping reagent before oxidation with I2 / water. In some cases, including a capping step during polynucleotide synthesis reduces the error rate compared to synthesis without capping. As an example, the capping step involves treating the polynucleotide bound to the substrate with a mixture of acetic anhydride and 1-methylimidazole. Following the capping step, the device is optionally washed.
[0133] In some cases, after the addition of nucleoside phosphoramidite and optionally after capping and one or more washing steps, the growing nucleic acids bound to the device are oxidized. The oxidation step involves the oxidation of phosphite triesters to tetracoordinate phosphate triesters, which are naturally occurring phosphate diester nucleoside bond-protected precursors. In some cases, the oxidation of the growing polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, lutidine, colidine). Oxidation may be carried out under anhydrous conditions, for example, using tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaziridine (CSO). In some methods, a capping step is performed following oxidation. A second capping step allows for drying of the device because residual water from potentially persistent oxidation may inhibit subsequent coupling. Following oxidation, the device and the growing polynucleotide are optionally washed. In some cases, the oxidation step is replaced by a sulfurization step to obtain polynucleotide phosphorothioates, where any capping step can be performed after sulfurization. Many reagents, including but not limited to 3-(dimethylaminomethylidene)amino)-3H-1,2,4-dithiazole-3-thione, DDTT, 3H-1,2-benzodithiol-3-one 1,1-dioxide, and N,N,N'N'-tetraethylthiuram disulfide (TETD), also known as Beaucage reagents, enable efficient sulfur transfer.
[0134] To allow the next cycle of nucleoside incorporation to occur via coupling, the protected 5' end of the growing polynucleotide bound to the device is removed, resulting in the primary hydroxyl group reacting with the next nucleoside phosphoramidite. In some cases, the protecting group is DMT, and deblocking occurs with trichloroacetic acid in dichloromethane. Prolonged or stronger detritylation than the recommended acid solution can lead to increased depurine of the polynucleotide bound to the solid support, and thus a decrease in the yield of the desired full-length product. The methods and compositions of this disclosure described herein provide controlled deblocking conditions that limit undesirable depurine reactions. In some cases, the polynucleotide bound to the device is washed after deblocking. In some cases, efficient washing after deblocking contributes to the synthesis of polynucleotides with a low error rate.
[0135] Methods for the synthesis of polynucleotides typically involve a repeating sequence of the following steps: application of a protected monomer to an actively functionalized surface (e.g., a locus) for linking with either an activated surface, a linker, or a previously deprotected monomer; deprotection of the applied monomer to react with a subsequently applied protected monomer; and application of another protected monomer for linking. One or more intermediate steps may involve oxidation or sulfurization. In some cases, one or more washing steps may occur before or after one or all of the steps.
[0136] A method for the synthesis of phosphoramidite-based polynucleotides comprises a series of chemical steps. In some cases, one or more steps of the synthesis method include reagent cycling, and one or more steps of the method include the application of reagents useful for that step to a device. For example, reagents are cycled by a series of liquid deposition and vacuum drying steps. In the case of a substrate having three-dimensional features such as wells, microwells, channels, etc., the reagents optionally pass through one or more regions of the device via the wells and / or channels.
[0137] The methods and systems described herein relate to polynucleotide synthesis devices for synthesizing polynucleotides. Synthesis can be carried out in parallel. For example, at least or about at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more polynucleotides can be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel may be 2-100,000, 3-50,000, 4-10,000, 5-1,000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150, 22-100, 23-50, 24-45, 25-40, and 30-35. Those skilled in the art will understand that the total number of polynucleotides synthesized in parallel may fall within any range limited by any of these values, for example, 25-100. The total number of polynucleotides synthesized in parallel may fall within any range defined by any of the values that act as the endpoints of the range. The total molar mass of polynucleotides synthesized within the device, or the molar mass of each polynucleotide, may be at least or approximately 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, or 100000 picomoles or more. The length of each polynucleotide within the device, or the average length of polynucleotides, may be at least or approximately 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 nucleotides, or more.The length of each polynucleotide or the average length of polynucleotides within a device may be at most approximately 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 nucleotides, or less. The length of each polynucleotide or the average length of polynucleotides within a device may be in the range of 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25. Those skilled in the art will understand that the length of each polynucleotide or the average length of polynucleotides within a device may fall within any range limited by any of these values, for example, 100-300. The length of each polynucleotide within the device, or the average length of the polynucleotides, may fall within any range defined by one of the values that acts as the range's endpoint.
[0138] The surface-based polynucleotide synthesis methods provided herein enable rapid synthesis. For example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 nucleotides, or more, are synthesized per hour. The nucleotides include adenine, guanine, thymine, cytosine, uridine building blocks, or their analogues / modified versions. In some cases, libraries of polynucleotides are synthesized in parallel on the substrate. For example, a device containing approximately or at least approximately 100, 1,000, 10,000, 30,000, 75,000, 100,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, or 5,000,000 degraded loci can support the synthesis of at least the same number of distinct polynucleotides, where polynucleotides encoding distinct sequences are synthesized on the degraded loci. In some cases, a library of polynucleotides is synthesized on the low-error-rate devices described herein in approximately 3 months, 2 months, 1 month, 3 weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, within 24 hours, or less. In some cases, larger nucleic acids assembled from polynucleotide libraries synthesized with low error rates using the substrates and methods described herein can be prepared in approximately 3 months, 2 months, 1 month, 3 weeks, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 days, within 24 hours, or less.
[0139] In some cases, the methods described herein provide for the generation of a library of nucleic acids containing variant nucleic acids different at multiple codon sites. In some cases, the nucleic acids may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or more variant codon sites.
[0140] In some cases, one or more variant codon sites may be adjacent. In some cases, one or more variant codon sites may not be adjacent and may not be separated by codons 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more.
[0141] In some cases, nucleic acids may contain multiple variant codon sites, where all variant codon sites are adjacent to each other and form a stretch of variant codon sites. In some cases, nucleic acids may contain multiple variant codon sites, where none of the variant codon sites are adjacent to each other. In some cases, nucleic acids may contain multiple variant codon sites, where some variant codon sites are adjacent to each other and form a stretch of variant codon sites, and some variant codon sites are not adjacent to each other.
[0142] Referring to the diagram, Figure 3 shows an exemplary process workflow for synthesizing nucleic acids (e.g., genes) from shorter nucleic acids. The workflow is generally divided into phases: (1) de novo synthesis of a single-stranded nucleic acid library, (2) joining nucleic acids to form larger fragments, (3) error correction, (4) quality control, and (5) shipping. Prior to de novo synthesis, the target nucleic acid sequence or group of nucleic acid sequences is pre-selected. For example, a group of genes is pre-selected for production.
[0143] Once a large nucleic acid for synthesis is selected, a given nucleic acid library is designed for de novo synthesis. Various suitable methods are known for generating high-density polynucleotide arrays. In the example workflow, a surface layer of a device is provided. In this example, the chemical properties of the surface are modified to improve the polynucleotide synthesis process. Areas with low surface energy are generated to repel liquids, and areas with high surface energy are generated to attract liquids. The surface itself may be planar in shape or may include changes in shape such as protrusions or microwells that increase the surface area. In the example workflow, the selected high-surface-energy molecules perform a dual function to support DNA chemistry, as disclosed in international patent application publication WO / 2015 / 021080, which is incorporated in its entirety herein by reference.
[0144] In-situ preparation of polynucleotide arrays is performed on a solid support, utilizing a single-nucleotide elongation process to elongate multiple oligomers in parallel. Deposition devices, such as material deposition devices, are designed to release reagents in a stepwise manner, allowing multiple polynucleotides to elongate one residue at a time in parallel to produce oligomers having a predetermined nucleic acid sequence 302. In some cases, the polynucleotides are cleaved from the surface at this stage. Cleavage includes, for example, gas cleavage with ammonia or methylamine.
[0145] The generated polynucleotide library is placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also called a “nanoractor”) is a silicon-coated well containing PCR reagents and lowered over the polynucleotide library 303. Before or after sealing the polynucleotides 304, reagents are added to release the polynucleotides from the substrate. In this exemplary workflow, the polynucleotides are released following sealing the nanoreactor 305. Once released, the single-stranded polynucleotide fragments hybridize to span the entire long-range sequence of DNA. Partial hybridization 305 is possible because each synthesized polynucleotide is designed to have a small portion that overlaps with at least one other polynucleotide in the pool.
[0146] Following hybridization, the PCA reaction is initiated. During the polymerase cycle, polynucleotides anneal to complementary fragments, and gaps are filled by the polymerase. Each cycle randomly increases the length of various fragments depending on which polynucleotides find each other. The complementarity between fragments allows for the formation of a fully large span of double-stranded DNA 306.
[0147] After PCA is complete, the nanoreactor is separated from the device 307 and positioned for interaction with the device having primers for PCR 308. After sealing, the nanoreactor is subjected to PCR 309 to amplify larger nucleic acids. After PCR 310, the nanochamber is opened 311, error correction reagent is added 312, the chamber is sealed 313, the error correction reaction takes place, and mismatched base pairs and / or less complementary strands are removed from the double-stranded PCR amplification product 314. The nanoreactor is opened and separated 315. The error-corrected product is then subjected to additional processing steps such as PCR or molecular barcoding and packaged for shipment 323 322.
[0148] In some cases, quality control measures are taken. After error correction, the quality control process includes, for example, interaction with a wafer having sequencing primers for amplification of the error-corrected product 316, wafer sealing into a chamber containing the error-corrected amplified product 317, and performing additional rounds of amplification 318. The nanoreactor is opened 319, the product is pooled 320, and sequenced 321. After an acceptable quality control decision is made, the packaged product 322 is approved for shipment 323.
[0149] In some cases, nucleic acids generated by a workflow as shown in Figure 3 are subject to mutagenesis using the duplicate primers disclosed herein. In some cases, the primer library is generated by in-situ preparation on a solid support and multiple oligomers are elongated in parallel using a single-nucleotide elongation process. Deposition devices, such as material deposition devices, are designed to release reagents in a stepwise manner so that multiple polynucleotides are elongated one residue at a time in parallel to produce oligomers having a given nucleic acid sequence.302
[0150] Computer system Any of the systems described herein may be operably connected to a computer and may be automated via the computer, either locally or remotely. In various examples, the methods and systems of this disclosure may further include software programs on a computer system and the use thereof. Thus, computer control for the synchronization of distribution / vacuum / replenishment functions, such as the adjustment and synchronization of the movement of the material deposition apparatus, distribution operations, and vacuum operations, is within the scope of this disclosure. The computer system may be programmed to interface between a user-specified base sequence and the position of the material deposition apparatus in order to deliver the correct reagent to a specified area of the substrate.
[0151] The computer system 400 illustrated in Figure 4 can be understood as a logical device capable of reading instructions from a medium 411 and / or a network port 405, the network port 405 being optionally connected to a server 409 having a fixed medium 412. A system as shown in Figure 4 may include a CPU 401, a disk drive 403, optional input devices such as a keyboard 415 and / or a mouse 416, and an optional monitor 407. Data communication can be achieved to a server located locally or remotely via the indicated communication medium. The communication medium may include any means for transmitting and / or receiving data. For example, the communication medium may be a network connection, a wireless connection, or an Internet connection. Such a connection may provide communication over the World Wide Web. It is assumed that the data relating to this disclosure may be transmitted over such a network or connection for reception and / or review by party 422, as illustrated in Figure 4.
[0152] As shown in Figure 5, the high-speed cache 504 can be connected to or integrated into the processor 502 to provide high-speed memory for instructions or data recently or frequently used by the processor 502. The processor 502 is connected to the northbridge 506 by the processor bus 508. The northbridge 506 is connected to the random access memory (RAM) 510 by the memory bus 512, which manages access to the RAM 510 by the processor 502. The northbridge 506 is also connected to the southbridge 514 by the chipset bus 516. The southbridge 514 is then connected to the peripheral bus 518. The peripheral bus can be, for example, PCI, PCI-X, PCI Express, or other peripheral buses. The northbridge and southbridge are often referred to as the processor chipset and manage data transfer between the processor, RAM, and peripheral components on the peripheral bus 518. In some alternative architectures, instead of using a separate northbridge chip, the functions of the northbridge can be integrated into the processor. In some cases, the system 500 may include an accelerator card 522 connected to a peripheral bus 518. The accelerator may include a field-programmable gate array (FPGA) or other hardware to accelerate specific processing. For example, the accelerator may be used for reconstructing adaptive data or for evaluating algebraic expressions used in extended set processing.
[0153] Software and data are stored in external storage 524 and can be loaded into RAM 510 and / or cache 504 for use by the processor. System 500 includes an operating system for managing system resources, and non-exclusive examples of operating systems include Linux®, Windows®, MACOS®, BlackBerry OS®, iOS®, and other functionally equivalent operating systems, as well as application software running on the operating system for managing data storage and optimization in accordance with the examples of this disclosure. In these examples, System 500 also includes network interface cards (NICs) 520 and 521 connected to a peripheral bus to provide a network interface to external storage such as network-attached storage (NAS) and other computer systems that can be used for distributed parallel processing.
[0154] Figure 6 shows a network 600 comprising multiple computer systems 602a and 602b, multiple mobile phones and personal data assistants 602c, and network-attached storage (NAS) 604a and 604b. In an exemplary case, systems 602a, 602b, and 602c can manage data storage and optimize data access to data stored in network-attached storage (NAS) 604a and 604b. Mathematical models can be used with data and evaluated using distributed parallel processing across computer systems 602a and 602b, as well as mobile phones and personal data assistant systems 602c. Computer systems 602a and 602b, as well as mobile phones and personal data assistant systems 602c, can also provide parallel processing for adaptive data reconstruction of data stored in network-attached storage (NAS) 604a and 604b. Figure 6 illustrates only one example, and a wide variety of other computer architectures and systems can be used in conjunction with the various examples of this disclosure. For example, blade servers can be used to provide parallel processing. Processor blades can be connected via a backplane to provide parallel processing. Storage can be connected to the backplane or as network-attached storage (NAS) via a separate network interface. In some cases, processors can maintain separate memory spaces and send data via network interfaces, backplanes, or other connectors for parallel processing by other processors. In other cases, some or all processors can use a shared virtual address memory space.
[0155] Figure 7 is a block diagram of a multiprocessor computer system 700 using a shared virtual address memory space, in an exemplary case. This system includes multiple processors 702a-f that can access a shared memory subsystem 704. The system incorporates multiple programmable hardware memory algorithm processors (MAPs) 706a-f into the memory subsystem 704. Each MAP 706a-f may include memory 708a-f and one or more field-programmable gate arrays (FPGAs) 710a-f. The MAPs provide configurable functional units that can provide specific algorithms or parts of algorithms to the FPGAs 710a-f for processing in close cooperation with their respective processors. For example, MAPs can be used to evaluate algebraic expressions relating to a data model or, in the exemplary case, to perform adaptive data reconstruction. In this example, all processors have global access to each MAP for these purposes. In one configuration, each MAP can access its associated memory 708a-f using direct memory access (DMA), enabling it to perform tasks independently and asynchronously from its respective microprocessor 702a-f. In this configuration, one MAP can directly feed its results to another MAP for algorithm pipelining and parallel execution.
[0156] The computer architectures and systems described above are merely examples and can be used in relation to exemplary cases, including architectures and systems of a wide variety of other computers, mobile phones, and personal digital assistants, including systems using common processors, coprocessors, FPGAs and other programmable logic devices, systems on a chip (SOC), application-specific integrated circuits (ASICs), and any other combination of processing and logic elements. In some cases, all or part of a computer system can be implemented in software or hardware. Any variety of data storage media, including random access memory, hard drives, flash memory, tape drives, disk arrays, network-attached storage (NAS), and other local or distributed data storage devices and systems, can be used in relation to exemplary cases.
[0157] In exemplary cases, a computer system can be implemented using software modules that run on any of the above or other computer architectures and systems. In other examples, the functionality of a system can be partially or completely implemented with firmware, programmable logic devices such as field-programmable gate arrays (FPGAs) as referenced in Figure 5, systems-on-chip (SOCs), application-specific integrated circuits (ASICs), or other processing and logic elements. For example, a set processor and optimizer can be implemented with hardware acceleration by using a hardware accelerator card such as the accelerator card 522 illustrated in Figure 5.
[0158] The following examples are provided to more clearly illustrate to those skilled in the art the principles and practices of the embodiments disclosed herein and should not be construed as limiting the scope of the claimed embodiments. Unless otherwise specified, all parts and percentages are on a weight basis. [Examples]
[0159] The following embodiments are provided for illustrative purposes to illustrate various embodiments of the Disclosure and are not intended to limit the Disclosure in any way. These embodiments, together with the methods described herein, represent and are illustrative of currently preferred embodiments and are not intended to limit the scope of the Disclosure. Any modifications and other uses thereof that are included in the spirit of the Disclosure as defined by the Claims will be understood by those skilled in the art.
[0160] Example 1: Functionalization of device surface The devices were functionalized to support the binding and synthesis of polynucleotide libraries. The device surface was first wet-washed for 20 minutes using a piranha solution containing 90% H2SO4 and 10% H2O2. The devices were rinsed with DI water in several beakers, held under a DI water gun tap for 5 minutes, and then dried with N2. Subsequently, the devices were immersed in NH4OH (1:100; 3 mL:300 mL) for 5 minutes, rinsed with DI water using a hand gun, immersed in DI water in three consecutive beakers for 1 minute each, and then rinsed again with DI water using a hand gun. Next, the devices were plasma-cleaned by exposing the device surface to O2. O2 plasma etching was performed using a SAMCO PC-300 instrument in downstream mode at 250 watts for 1 minute.
[0161] The cleaned device surface was actively functionalized with a solution containing N-(3-triethoxysilylpropyl)-4-hydroxybutyramide using a YES-1224P vapor deposition oven system with the following parameters: 0.5-1 torr, 60 minutes, 70°C, vaporizer at 135°C. The device surface was resist-coated using a Brewer Science 200X spin coater. SPR(trademark) 3612 photoresist was spin-coated onto the device at 2500 rpm for 40 seconds. The device was pre-baked on a Brewer hot plate at 90°C for 30 minutes. The device was subjected to photolithography using a Kurl Suss MA6 mask aligner apparatus. The device was exposed for 2.2 seconds and developed with MSF 26A for 1 minute. The remaining developer was rinsed off with a hand gun, and the device was immersed in water for 5 minutes. After baking the device in an oven at 100°C for 30 minutes, lithography defects were visually inspected using a Nikon L200. The residual resist was removed using a SAMCO PC-300 instrument via the DESCAM process, followed by O2 plasma etching at 250 watts for 1 minute.
[0162] The device surface was passively functionalized with a 100 μL solution of perfluorooctyltrichlorosilane mixed with 10 μL of light mineral oil. The device was placed in a chamber and pumped for 10 minutes, after which the valve was closed relative to the pump and left for 10 minutes. The chamber was vented to air. The device resist stripping was performed by immersing it twice in 500 mL of NMP at 70°C for 5 minutes each, using sonication at maximum power (9 on the Crest system). Next, the device was immersed in 500 mL of isopropanol at room temperature for 5 minutes and sonicated at maximum power. The device was immersed in 300 mL of 200 proof ethanol and dried by spraying with N2. The functionalized surface was activated to function as a support for polynucleotide synthesis.
[0163] Example 2: Synthesis of a 50-mer sequence on an alkyl synthesis device A two-dimensional oligonucleotide synthesis device was assembled in a flow cell, which was connected to an Applied Biosystems (ABI394 DNA synthesizer). The two-dimensional oligonucleotide synthesis device was homogeneously functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (Gelest), and a 50 bp exemplary polynucleotide ("50-mer polynucleotide") was synthesized using the polynucleotide synthesis method described herein.
[0164] The sequence of the 50-mer was as described in Sequence ID No. 2. 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACTTCGGCAT##TTTTTTTTTT3' (SEQ ID NO: 2), where # represents thymidine-succinyl hexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker that allows oligos to be released from the surface during deprotection.
[0165] Synthesis was performed using standard DNA synthesis chemistry (coupling, capping, oxidation, and deblocking) according to the protocols and ABI synthesizers shown in Table 3.
[0166] [Table 3] JPEG2026102621000006.jpg250134 JPEG2026102621000007.jpg69137
[0167] The phosphoramidite / activator combination was delivered similarly to the bulk reagents delivered via a flow cell. Since the environment remained constantly "wet" with the reagents, no drying step was performed.
[0168] To allow for faster flow, the flow limiter was removed from the ABI 394 synthesizer. Without the flow limiter, the flow rate for amidite (0.1 M in ACN), activator (0.25 M benzoylthiotetrazole ("BTT"; Glen Research 30-3070-xx) in ACN, and Ox (0.02 M I2 in 20% pyridine, 10% water and 70% THF) was approximately ~100 μL / sec, with acetonitrile ("ACN") and capping reagent (a 1:1 mixture of CapA and CapB, where CapA is acetic anhydride in THF / pyridine and CapB is 16% in THF) For 1-methylimidiso, the flow rate was approximately ~200 μL / second, and for Deblock (3% dichloroacetic acid in toluene), it was approximately ~300 μL / second (compared to ~50 μL / second for all reagents with flow limiters). The time required to completely flush out the oxidizing agent was observed, and the timing of the chemical flow times was adjusted accordingly, with additional ACN washing introduced between different chemicals. After polynucleotide synthesis, the tip was deprotected overnight with gaseous ammonia at 75 psi. Five drops of water were applied to the surface to recover the polynucleotides. The recovered polynucleotides were then analyzed using a BioAnalyzer small RNA tip.
[0169] Example 3: Synthesis of a 100-mer sequence using an alkyl group synthesis device The same process described in Example 2 for the synthesis of the 50-mer sequence was used for the synthesis of the 100-mer polynucleotide ("100-mer polynucleotide"; 5'CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGCTGTCCACCAGTCATGCTAGCCATACCATGATGATGATGATGATGAGAACCCCGCAT##TTTTTTTTTT3'), where # indicates thymidine-succinylhexamide CED phosphoramidite (CLP-2244 of ChemGenes, SEQ ID NO: 3) on two different silicon chips, the first homogeneously functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide and the second functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane, and the polynucleotides extracted from the surface were analyzed using a BioAnalyzer instrument.
[0170] All 10 samples from the two chips were subjected to the following thermal cycling program using forward primer (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO: 4) and reverse primer (5'CGGGATCCTTATCGTCATCG3'; SEQ ID NO: 5) in a 50 μL PCR mix (25 μL NEB Q5 master mix, 2.5 μL 10 μM forward primer, 2.5 μL 10 μM reverse primer, 1 μL polynucleotide extracted from the surface, and up to 50 μL of water): 98℃, 30 seconds 98°C, 10 seconds; 63°C, 10 seconds; 72°C, 10 seconds; repeat 12 cycles. 72℃, 2 minutes Further PCR amplification was performed using [this method].
[0171] The PCR products were also electrophoresed on a BioAnalyzer, demonstrating a sharp peak at the position of the 100-mer. Next, the PCR amplified samples were cloned and Sanger sequencing was performed. Table 4 summarizes the results of Sanger sequencing of the samples obtained from spots 1-5 from chip 1 and spots 6-10 from chip 2.
[0172]
Table 4
[0173] Thus, the high quality and uniformity of the synthesized polynucleotides were repeated on two chips with different surface chemical characteristics. Overall, 89% of the sequenced 100-mers were error-free complete sequences, corresponding to 233 out of 262.
[0174] Table 5 summarizes the error characteristics of the sequences obtained from the polynucleotide samples from spots 1-10.
[0175]
Table 5
[0176]
Table 6
[0177] Example 4: Design of Antibody Substrate To generate scaffolds, we performed structural analysis, heavy chain repertory sequencing analysis, and specific analyses of heterodimer high-throughput sequencing datasets. Each heavy chain was associated with each light chain scaffold. Each heavy chain scaffold was assigned one of five different long CDRH3 loop options. Each light chain scaffold was assigned one of five different L3 scaffolds. The heavy chain CDRH3 stem was selected from frequently observed long H3 loop stems (10 amino acids at the N-terminus and C-terminus) found both between individuals and between V gene segments. The light chain scaffold L3 was selected from heterodimers containing long H3. We used direct heterodimers based on information from the Protein Databank (PDB) and deep sequencing datasets with fixed CDR H1, H2, L1, L2, L3, and CDRH3 stems. The various scaffolds were then formatted for display on phages to evaluate their expression.
[0178] structural analysis Approximately 2,017 antibody structures were analyzed, and 22 structures containing long CDRH3 molecules of at least 25 amino acids were observed. The heavy chains included IGHV1-69, IGHV3-30, IGHV4-49, and IGHV3-21. The identified light chains included IGLV3-21, IGKV3-11, IGKV2-28, IGKV1-5, IGLV1-51, IGLV1-44, and IGKV1-13. In the analysis, four heterodimer combinations, including IGHV4-59 / 61-IGLV3-21, IGHV3-21-IGKV2-28, IGHV1-69-IGKV3-11, and IGHV1-69-IGKV1-5, were observed multiple times. Sequence and structural analysis identified intracellular disulfide bonds in CDRH3 in several structures, with bulky side chains such as tyrosine packing the stem, providing support for long H3 stability. Secondary structures including beta-turned beta sheets and "hammerhead" subdomains were also observed.
[0179] Repertoire Analysis Repertory analysis was performed on 1,083,875 IgM+ / CD27 naive B-cell receptor (BCR) sequences from 12 healthy controls and 1,433,011 CD27+ sequences obtained by unbiased 5'RACE. The 12 healthy controls consisted of an equal number of males and females, with 4 Caucasians, 4 Asians, and 4 Hispanic individuals. Repertory analysis demonstrated that less than 1% of the human repertoire contained BCRs with CDRH3 longer than 21 amino acids. A V gene bias was observed in the long CDR3 subrepertoire, with IGHV1-69, IGHV4-34, IGHV1-18, and IGHV1-8 showing preferential enrichment in BCRs with long H3 loops. A bias towards long loops was observed for IGHV3-23, IGHV4-59 / 61, IGHV5-51, IGHV3-48, IGHV3-53 / 66, IGHV3-15, IGHV3-74, IGHV3-73, IGHV3-72, and IGHV2-70. The IGHV4-34 scaffold was demonstrated to be self-reactive and have a short half-life.
[0180] Viable N-terminal and C-terminal CDRH3 scaffold variations for long loops were also designed based on the 5'RACE reference repertoire. Approximately 81,065 CDRH3s with amino acid lengths of 22 amino acids or more were observed. By comparing across V gene scaffolds, scaffold diversity was avoided, allowing for cloning of scaffolds to multiple scaffold references.
[0181] Heterodimer analysis Heterodimer analysis was performed on the scaffold. The variant sequences and lengths of the scaffold were assayed.
[0182] structural analysis Structural analysis was performed using a GPCR scaffold of the variant sequence, and its length was assayed.
[0183] Example 5: Generation of a GPCR antibody library Libraries were designed and de novo synthesized based on the GPCR-ligand interaction surface and scaffold configuration. See Example 4. Ten variant sequences were designed for the variable domain and heavy chain, 237 variant sequences for the heavy chain complementarity determination region 3, and 44 variant sequences for the variable domain and light chain. The fragments were synthesized as three fragments according to the same method as described in Examples 1-3.
[0184] Following de novo synthesis, 10 variant sequences were generated for the variable domain and heavy chain, 236 variant sequences were generated for the heavy chain complementarity determination region 3, 43 variant sequences were designed for the variable domain, light chain, and region containing CDRL3, and 9 variants were designed for the variable domain and light chain. This resulted in approximately 10 5 This resulted in a library of diversity (10 × 236 × 43). This was confirmed using next-generation sequencing (NGS) with 16 million reads.
[0185] Next, various light and heavy chains were tested for expression and protein folding. Ten variant sequences of the variable domain and heavy chain included: IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, and IGHV4-59 / 61. Of the ten variant sequences, IGHV1-18, IGHV1-69, and IGHV3-30 / 33rn showed improved properties, such as improved thermal stability. The nine variant sequences of the variable domain and light chain included IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, and IGLV2-14. Of the nine variant sequences, IGKV1-39, IGKV3-15, IGLV1-51, and IGLV2-14 showed improved properties, such as improved thermal stability.
[0186] Example 6: GPCR Library This example illustrates the generation of a GPCR library.
[0187] material and method Generation of stable cell lines and phage libraries A full-length human GLP-1R gene (UniProt-P43220) with an N-terminal FLAG tag and a C-terminal GFP tag, cloned into a pCDNA3.1(+) vector (ThermoFisher), was transfected into Chinese hamster ovary cell (CHO) suspension to generate a stable cell line expressing GLP-1R. Target cells were confirmed by FACS. Cells expressing >80% GLP-1R via GFP were then directly used for cell-based selection.
[0188] Combinations of germline heavy chains IGHV1-69, IGHV3-30 and germline light chains IGKV1-39, IGKV3-15, IGLV1-51, IGLV2-14 frameworks were used in a GPCR-focused phage display library, and the diversity of all six CDRs was encoded by an oligopool synthesized as in Examples 1-3 above. The CDRs were also screened to ensure they did not contain manufacturability responsibilities, potential splice sites, or commonly used nucleotide restriction sites. The heavy chain variable region (VH) and light chain variable region (VL) were linked by a (G4S)3 linker. The resulting scFv(VH-linker-VL) gene library was cloned into the pADL 22-2c (Antibody Design Labs) phage display vector by NotI restriction digestion and electroporated into TG1 electrocompetent E. coli cells (Lucigen). The final library includes 1.1 × 10⁶ data validated by NGS. 10 There is a variety of sizes.
[0189] Panning and screening strategies used to isolate agonist GLP-1R scFv clones. Before panning on GLP-1R-expressing CHO cells, phage particles were blocked with 5% BSA / PBS and depleted of non-specific binders on CHO parental cells. To deplete CHO parental cells, an aliquot of input phage was rotated at 14 rpm for 1 hour at room temperature (RT) with CHO parental cells. Next, the cells were pelleted by centrifugation at 1,200 rpm for 10 minutes using a tabletop Eppendorf centrifuge 5920RS / 4×1000 rotor to deplete non-specific CHO cell binders. Next, the phage supernatant depleted of CHO cell binders was transferred to GLP-1R-expressing CHO cells. The phage supernatant and GLP-1R-expressing CHO cells were rotated at 14 rpm for 1 hour at RT to select for GLP-1R binders. After incubation, the cells were washed several times with 1×PBS / 0.5% Tween to remove unbound clones. To elute phage bound to GLP-1R cells, the cells were incubated with trypsin in PBS buffer at 37°C for 30 minutes. The cells were pelleted by centrifugation at 1,200 rpm for 10 minutes. The output supernatant enriched in GLP-1R binding clones was amplified in TG1 E. coli cells and used as input phage for the next round of selection. This selection strategy was repeated for 5 rounds. All rounds were depleted against the CHO parental background. The amplified output phage from each round was used as input phage for the next round, and the stringency of washing increased in each subsequent round of selection with more washes. After 5 rounds of selection, 500 clones from each of rounds 4 and 5 were Sanger sequenced to identify unique clones. 8 8 8 8
[0190] Next-generation sequencing analysis Phagemid DNA was miniprepped from output bacterial stocks of all panning rounds. Variable heavy chain (VH) was PCR amplified from phagemid DNA using forward primer ACAGAATTCATTAAAGAGGAGAAATTAACC and reverse primer TGAACCGCCTCCACCGCTAG. The PCR products were used directly for library preparation using the KAPA HyperPlus Library Preparation Kit (Kapa Biosystems, product no. KK8514). To add diversity to the library, the samples were spiked with 15% PhiX Control (product no. FC-110-3001) purchased from Illumina, Inc. The libraries were then loaded into Illumina's 600-cycle MiSeq reagent kit v3 (Illumina, product no. MS-102-3003) and run on the MiSeq instrument.
[0191] Reformatting and High-Throughput (HT) IgG Purification Expi293 cells were transfected with heavy and light chain DNA in a 2:1 ratio using Expifectamine (ThermoFisher, A14524). The supernatant was collected 4 days after transfection, and cell viability was reduced to less than 80%. Purification was performed using either a King Fisher (ThermoFisher) or Phynexus Protein A column tip (Hamilton) equipped with Protein A magnetic beads. For large-scale production of IgG clones evaluated in in vivo mouse studies, an Akta HPLC purification system (GE) was used.
[0192] IgG characterization and quality control. Purified IgG from positive GLP-1R conjugates (hits) was characterized for purity using the LabChip GXII Touch HT ProteinExpress high-sensitivity assay. IgG was reduced to VH and VL using dithiothreitol (DTT). IgG concentration was measured using Lunatic (UnChain). IgG for in vivo mouse studies was further characterized by HPLC and tested for endotoxin levels (Endosafe® nexgen-PTS® Endotoxin Testing, Charles River) at doses of less than 5 EU per kg.
[0193] Binding assays and flow cytometry GLP-1R IgG clones were tested in a binding assay combined with flow cytometry analysis as follows: FLAG-GLP-1R-GFP expressing CHO cells (CHO-GLP-1R) and CHO parental cells were incubated with 100 nM IgG on ice for 1 hour, washed three times, incubated with Alexa 647-conjugated goat anti-human antibody (1:200) (Jackson ImmunoResearch Laboratories, 109-605-044) on ice for 30 minutes, washed three times, and centrifuged to pellet cells between each washing step. All incubation and washing were performed in buffer containing PBS + 1% BSA. In titration, IgG was serially diluted 1:3 from 100 nM to 0.046 nM. Cells were analyzed by flow cytometry to identify hits (hits being IgG that specifically binds to CHO-GLP-1R) by measuring the GFP signal against the Alexa 647 signal. Flow cytometry data from binding assays using 100 nM IgG are presented as dot plots. Analysis of binding assays using IgG titration is presented as binding curves plotting IgG concentration against MFI (mean fluorescence intensity).
[0194] Ligand competition assay The ligand competition assay involved co-incubating primary IgG with 1 μM GLP-1(7-36). For each data point, IgG (600 nM) was prepared in flow buffer (PBS + 1% BSA) and diluted 1:3 at eight titration points. Peptide GLP-17-36 (2 μM) was similarly prepared using flow buffer (PBS + 1% BSA). Each well contained 100,000 cells, to which 50 μL of IgG and 50 μL of peptide (= plus) or buffer without peptide (= minus) were added. Cells and IgG / peptide mixes were incubated on ice for 1 hour, washed, and then a secondary antibody (goat anti-human APC, Jackson ImmunoResearch Laboratories, product no. 109-605-044) diluted 1:200 in PBS + 1% BSA was added. This was incubated on ice for 30 minutes (50 μL per well), then washed and resuspended in 60 μL of buffer. Finally, assay readings were measured at a rate of 4 seconds per well using an Intellicyt® IQue3 Screener.
[0195] result The design of antibody libraries focused on GPCRs is based on GPCR-binding motifs and GPCR antibodies. We analyzed all known GPCR interactions, including interactions between GPCRs and ligands, peptides, antibodies, endogenous extracellular loops, and small molecules, to map GPCR binding molecule determinants. Using the crystal structures of approximately 150 peptides, ligands, or antibodies bound to the ECD of approximately 50 GPCRs (http: / / www.gpcrdb.org), we identified GPCR binding motifs. From this analysis, we extracted over 1000 GPCR binding motifs. Furthermore, analysis of all resolved GPCR structures (zhanglab.ccmb.med.umich.edu / GPCR-EXP / ) identified over 2000 binding motifs from the endogenous extracellular loops of GPCRs. Finally, by analyzing the structures of over 100 small molecule ligands bound to GPCRs, we identified a reduced amino acid library of five amino acids (Tyr, Phe, His, Pro, and Gly) that could potentially reproduce many of the structural contacts of these ligands. This reduced amino acid diversity sublibrary was placed within the CxxxxxC motif. In total, we identified over 5000 GPCR binding motifs (Figures 9A-9E). These binding motifs were located in one of five different stem regions: CARDLRELECEEWTxxxxxSRGPCVDPRGVAGSFDVW, CARDMYYDFxxxxxEVVPADDAFDIW, CARDGRGSLPRPKGGPxxxxxYDSSEDSGGAFDIW, CARANQHFxxxxxGYHYYGMDVW, CAKHMSMQxxxxxRADLVGDAFDV
[0196] These stem regions were selected from structural antibodies containing extra-long HCDR3s. Antibody germline cells were specifically selected to tolerate these extra-long HCDR3s. Structural and sequence analysis of human antibodies longer than 21 amino acids revealed V gene bias in antibodies with long CDR3s. Finally, germline IGHV (IGHV1-69 and IGHV3-30), IGKV (IGKV1-39 and IGKV3-15), and IGLV (IGLV1-51 and IGLV2-14) genes were selected based on this analysis.
[0197] In addition to HCDR3 diversity, limited diversity was also introduced into the other five CDRs. The IGHV1-69 domain contained 416 HCDR1 and 258 HCDR2 variants; the IGHV3-30 domain contained 535 HCDR1 and 416 HCDR2 variants; the IGKV1-39 domain contained 490 LCDR1, 420 LCDR2, and 824 LCDR3 variants; the IGKV3-15 domain contained 490 LCDR1, 265 LCDR2, and 907 LCDR3 variants; the IGLV1-51 domain contained 184 LCDR1, 151 LCDR2, and 824 LCDR3 variants; and the IGLV2-14 domain contained 967 LCDR1, 535 LCDR2, and 922 LCDR3 variants (Figure 10). These CDR variants were selected by comparing germline CDRs with germline-closed spaces of single, double, and triple mutations observed in CDRs within the V gene repertoire of at least two of 12 human donors. All CDRs were pre-screened to remove manufacturability responsibilities, potential splice sites, or nucleotide restriction sites. The CDRs were synthesized as oligopools and incorporated into selected antibody scaffolds. The heavy chain (VH) and light chain (VL) genes were linked by a (G4S)3 linker. The resulting scFv(VH-linker-VL) gene pool was cloned into a phagemide display vector at the N-terminus of the M13 gene-3 minor coat protein. The final size of the GPCR library was 1 × 10⁶ in scFv format. 10 Next-generation sequencing (NGS) was performed on the final phage library, and the HCDR3 length distribution within the library was analyzed and compared to the HCDR3 length distribution in a B cell population from three healthy adult donors. The HCDR3 sequences from the three healthy donors used were obtained from a publicly available database containing over 37 million B cell receptor sequences. 31The length of HCDR3 in GPCR libraries is much longer than that of HCDR3 observed in B cell repertoire sequences. On average, the median length of HCDR3 in GPCR libraries (showing a biphasic distribution pattern) is 2–3 times longer (33–44 amino acids) than the median length observed in native B cell repertoire sequences (15–17 amino acids) (Figure 11). The biphasic length distribution of HCDR3 in GPCR libraries is mainly caused by two groups of stems used to present motifs within HCDR3: (8aa, 9aaxxxxx10aa, 12aa) and (14aa, 16aaxxxxx18aa, 14aa).
[0198] Example 7: VHH Library We developed a synthetic VHH library. For the "VHH Ratio" library with adjusted CDR diversity, 2391 VHH sequences (iCAN database) were aligned using Clustal Omega, a consensus was determined at each position, and the framework was derived from the consensus at each position. All 2391 sequence CDRs were analyzed for position-specific variations, and this diversity was introduced into the library design. For the "VHH Shuffle" library with shuffled CDR diversity, the iCAN database was scanned to search for unique CDRs within nanobody sequences. 1239 unique CDR1s, 1600 unique CDR2s, and 1608 unique CDR3s were identified, and the framework was derived from the consensus at each framework position within the 2391 sequences in the iCAN database. Each unique CDR was synthesized individually and shuffled with the consensus framework to generate a library with a theoretical diversity of 3.2 × 10^9. Next, restriction enzyme digestion was used to clone the libraries into phagemide vectors. For the "VHHhShuffle" library (a synthetic "human" VHH library with shuffled CDR diversity), the iCAN database was scanned to search for unique CDRs within nanobody sequences. 1239 unique CDR1s, 1600 unique CDR2s, and 1608 unique CDR3s were identified, and frameworks 1, 3, and 4 were derived from the human germline DP-47 framework. Framework 2 was derived from the consensus at each framework position within 2391 sequences in the iCAN database. Each unique CDR was individually synthesized and shuffled in a partially humanized framework using the NUGE tool, generating a library with a theoretical diversity of 3.2 × 10^9. The libraries were then cloned into phagemide vectors using the NUGE tool.
[0199] The binding affinity and affinity distribution of the VHH-Fc variant were evaluated using the CaltaraPR system. VHH-Fc showed a certain range of affinity for TIGIT, with a lower limit of 12 nM K. D The upper limit is 1685 nM K D (Data not shown). Figure 12 shows ELISA, protein A (mg / ml), and K D Provides specific values for VHH-Fc clones regarding (nM).
[0200] Example 8. Hyperimmune immunoglobulin library for A2A receptors The hyperimmune immunoglobulin (IgG) library was prepared using a method similar to that described in Example 7. Briefly, the hyperimmune IgG library was generated from the analysis of a database of human naive and memory B cell receptor sequences consisting of over 37 million unique IgH sequences from each of three healthy donors. Over 2 million CDRH3 sequences were collected from the analysis and constructed individually using a method similar to that described in Examples 1-3. The CDRH3 sequences were incorporated into the VHH hShuffle library described in Example 9. The diversity of the final library was 1.3 × 10⁶. 10 It was decided that this was the case. A schematic diagram of the design is shown in Figure 13.
[0201] Of the 88 unique clones, 73 had a target cell MFI value twice that of the parent cell. Of the 88 unique clones, 15 had a target cell MFI value 20 times that of the parent cell. Data for the adenosine A2A receptor variant A2AR-90-007 are shown in Figures 14A-14B.
[0202] This example demonstrates high affinity and K in the sub-nanomole range. D This demonstrates the generation of a VHH library for A2ARs that have values.
[0203] Example 9. GPCR library with various CDRs The GPCR library was constructed using a CDR randomization scheme.
[0204] In short, the GPCR library was designed based on GPCR antibody sequences. Over 60 different GPCR antibodies were analyzed, and the sequences of these GPCRs were modified using a CDR randomization scheme.
[0205] The design of the heavy chain IGHV3-23 is shown in Figure 15A. As shown in Figure 15A, IGHV3-23 CDRH3 has four characteristic lengths: 23 amino acids, 21 amino acids, 17 amino acids, and 12 amino acids, with residue diversity at each length. The ratio of the four lengths was as follows: 40% for CDRH3 of length 23 amino acids, 30% for CDRH3 of length 21 amino acids, 20% for CDRH3 of length 17 amino acids, and 10% for CDRH3 of length 12 amino acids. The diversity of CDRH3 is 9.3 × 10⁻⁶. 8 It was determined that the complete heavy chain IGHV3-23 diversity is 1.9 × 10⁻⁶. 13 That was the case.
[0206] The design of the heavy chain IGHV1-69 is shown in Figure 15B. As shown in Figure 15B, IGHV1-69 CDRH3 has four characteristic lengths: 20 amino acids, 16 amino acids, 15 amino acids, and 12 amino acids, with residue diversity at each length. The ratio of the four lengths was as follows: 40% for the 20-amino acid CDRH3, 30% for the 16-amino acid CDRH3, 20% for the 15-amino acid CDRH3, and 10% for the 12-amino acid CDRH3. The diversity of CDRH3 is 9 × 10⁻⁶. 7 It was determined that the complete heavy-chain IGHV-69 diversity is 4.1 × 10⁻⁶. 12 That was the case.
[0207] The designs of light chains IGKV 2-28 and IGLV 1-51 are shown in Figure 15C. The antibody light chain CDR sequences were analyzed for position-specific variation. Two light chain frameworks with fixed CDR lengths were selected. Theoretical variability was determined to be 13800 and 5180 for the kappa chain and light chain, respectively.
[0208] The final theoretical diversity is 4.7 × 10⁻⁶. 17 It was determined that the final generated Fab library was 6 × 10 9 It exhibited diversity. See Figure 15D.
[0209] Example 10. Adenosine A2A receptor library with various CDRs The adenosine A2A receptor library is prepared using the CDR randomization scheme similarly described in Example 9.
[0210] In short, the adenosine A2A receptor library is designed based on GPCR antibody sequences. Over 60 different GPCR antibodies were analyzed, and sequences from these GPCRs were modified using a CDR randomization scheme. The adenosine A2A receptor variant IgG designed using the CDR randomization scheme was purified and assayed to determine cell-based affinity measurements and for functional analysis.
[0211] Example 11. A2A variant immunoglobulin The generated A2AR variant immunoglobulins were assayed in various functional assays.
[0212] First, the A2AR immunoglobulin scFv phage library was panned on cells, immobilized with A2a protein, and then screened. The number of output phages from each round of selection is shown in Table 7-8.
[0213] [Table 7]
[0214] [Table 8]
[0215] Example 12. Screening of antibody binding A2AR immunoglobulins selected from the groups listed in Table 15-18 were assayed for binding to targets as listed in the table.
[0216] HEK293-A2a cells Flow cytometry data showing the binding of immunoglobulins from variant libraries to HEK293-A2a cells were generated using 100 nM IgG and compared to the binding detected in parental cells. Binding using variants from the immunolibrary is shown in Figures 16A–16N. The control is shown in Figure 16O, which shows cell binding to human adenosine A2aR monoclonal (MAB9497). Selected variants were evaluated for binding at titrated concentrations starting from 100 nM. The resulting curves are shown in Figures 17A–17H1. Binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity). Binding using variants from the mouse immunolibrary is shown in Figures 18A–18N. The control is shown in Figure 18O, which shows cell binding to human adenosine A2aR monoclonal (MAB9497). Selected variants were evaluated for binding at titrated concentrations starting from 100 nM. The resulting curves are shown in Figures 19A-19G. The binding curves are plotted against IgG concentration versus MFI (mean fluorescence intensity).
[0217] protein binding Purified A2a immunoglobulins from Tables 15-18 were assayed for binding by titration from 100 nM. The results for the selected variants are shown in Figures 20A-20G.
[0218] Example 13. Agonist response in the LANCE® cAMP assay The agonist dose-response assay was performed using the LANCE® cAMP assay in a 384-well format with 2500 cells / well, according to the manufacturer's instructions. Cell stimulation with NECA and CGS 21680 was performed at room temperature for 30 minutes. Readings were performed with an EnVision plate reader in laser mode. Data are shown in Figure 21. The Z' factor was calculated for NECA with at least 16 backgrounds and 16 maximum signal points (Z'=0.80). The EC calculated for NECA 50 (M) = 2.7 × 10 -7 And for CGS21680 = 4.3 × 10 -7 Regarding this.
[0219] Example 14. Antagonist response in the LANCE® cAMP assay The antagonist dose-response assay was performed using the LANC® cAMP assay in a 384-well format with 2500 cells / well and 1 μM NECA (reference agonist), according to the manufacturer's instructions. Cell stimulation with ZM241385 was performed at room temperature for 30 minutes. Readings were performed using an EnVision plate reader in laser mode. The data are shown in Figure 22. The calculated IC for ZM241385. 50 (M) = 1.25 × 10 -5 .
[0220] Example 15. A2A cAMP antagonist titration Cells were plated at 3000 cells / well, pre-incubated with immobilized 100 nM IgG at room temperature for 1 hour, and then stimulated for 30 minutes at room temperature using NECA titration according to the manufacturer's instructions. The buffer was PBS + 0.1% BSA + 0.5 mM IBMX. The results are shown in Figure 23. The absolute IC50 is shown in Table 9, which indicates that A2A-1 is a negative allosteric modulator.
[0221] [Table 9]
[0222] Example 16. LANCE® Allosteric cAMP Assay A2A-1 and A2A-9 were assayed for allosteric modulation. Cells were pre-incubated with titrated IgG at room temperature for 1 hour, and then stimulated with fixed NECA concentrations. The results are shown in Figure 24. The IC50 values are shown in Table 10, which indicate that A2A-1 is a negative allosteric modulator.
[0223] [Table 10]
[0224] Example 17. cAMP Allosteric A2A PerkinElmer A2A-9 was assayed as described in Example 15. The resulting response curve is shown in Figure 25. The calculated IC50 for A2A-9 is shown in Table 11.
[0225] [Table 11]
[0226] Example 18. Titration of A2A cAMP antagonist A2A-9 was assayed as described in Example 16. The resulting response curve is shown in Figure 26. The calculated IC50 values are shown in Table 12. The results indicate that A2A-9 is an antagonist.
[0227] [Table 12]
[0228] Example 19. A2A antagonistic cAMP assay The selected variants were assayed for binding to the target. Immunoglobulins were titrated in triplicates and incubated on cells for 1 hour, followed by incubation with 0.5 μM NECA for 30 minutes. Binding curves showing the relative fluorescence unit (RFU) ratio at 665 nm / 615 nm for nM IgG on a logarithmic scale are shown in Figures 27A-27C. In the final binding studies, functional antibodies were found in the generated libraries, as listed in Tables 13 and 14.
[0229] [Table 13]
[0230] [Table 14]
[0231] Example 20. A2AR cell functional cAMP assay Allosteric and antagonist cAMP assays were performed using A2A cell lines.
[0232] In short, cells were pre-incubated with 100 nM anti-A2AR antibody, followed by 3× titration with NECA stimulation starting from 100 μM. Data from the functional allosteric cAMP assay are shown in Figures 28A-28C. ZM241385 functioned as an antagonist. "No Ab" functioned only as an agonist.
[0233] For the functional antagonist cAMP assay, cells were pre-incubated with a 3× titration of anti-A2AR antibody starting from 100 nM, followed by NECA stimulation with 0.5 μM. Data are shown in Figures 29A-29C. Cells were also pre-incubated with a 3× titration of anti-A2AR antibody starting from 100 nM, followed by NECA stimulation with 10 μM. Data are shown in Figures 30A-30C.
[0234] Based on the data, A2AR variants A2A-17, A2A-19, A2A-24, A2A-26, and A2A-27 showed improved function in cAMP assays for NECA titration, IgG titration (NECA 0.5 μM), and IgG titration (NECA 10 μM).
[0235] Example 21. Exemplary arrangement
[0236] [Table 15] JPEG2026102621000020.jpg239170 JPEG2026102621000021.jpg120170
[0237] [Table 16] JPEG2026102621000023.jpg248170 JPEG2026102621000024.jpg247170 JPEG2026102621000025.jpg30170
[0238] [Table 17] JPEG2026102621000027.jpg247170 JPEG2026102621000028.jpg247170 JPEG2026102621000029.jpg246170 JPEG2026102621000030.jpg247170 JPEG2026102621000031.jpg24170
[0239] [Table 18] JPEG2026102621000033.jpg252170 JPEG2026102621000034.jpg253170 JPEG2026102621000035.jpg249163 JPEG2026102621000036.jpg244170
[0240] While preferred embodiments of the Disclosure have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided only as examples. Numerous variations, modifications, and substitutions can be made by those skilled in the art without departing from the Disclosure. It should be understood that various alternatives to the embodiments of the Disclosure described herein may be used in the practice of the Disclosure. The following claims define the scope of the Disclosure, and the methods and structures within these claims, as well as their equivalents, are intended to be covered thereby.
Claims
1. A nucleic acid library comprising multiple nucleic acids, each of which, when translated, encodes a sequence encoding an adenosine A2A receptor-binding immunoglobulin, the adenosine A2A receptor-binding immunoglobulin comprising a variant of an adenosine A2A receptor-binding domain, the adenosine A2A receptor-binding domain being a ligand for the adenosine A2A receptor, and the nucleic acid library comprising at least 10,000 variant immunoglobulin heavy chains and at least 10,000 variant immunoglobulin light chains.
2. The nucleic acid library according to claim 1, wherein the nucleic acid library comprises at least 50,000 variant immunoglobulin heavy chains and at least 50,000 variant immunoglobulin light chains.
3. The nucleic acid library according to claim 1, wherein the nucleic acid library comprises at least 100,000 variant immunoglobulin heavy chains and at least 100,000 variant immunoglobulin light chains.
4. The nucleic acid library comprises at least 10 5 A nucleic acid library according to claim 1, comprising several non-identical nucleic acids.
5. The nucleic acid library according to claim 1, wherein the length of the immunoglobulin heavy chain when translated is about 90 to about 100 amino acids.
6. The nucleic acid library according to claim 1, wherein the length of the immunoglobulin heavy chain when translated is about 100 to about 400 amino acids.
7. The nucleic acid library according to claim 1, wherein the variant immunoglobulin heavy chain, when translated, has at least about 90% sequence identity with respect to any one of sequence numbers 540-628.
8. The nucleic acid library according to claim 1, wherein the variant immunoglobulin light chain, when translated, has at least about 90% sequence identity with respect to any one of sequence numbers 629-717.
9. The nucleic acid library according to claim 1, wherein the variant immunoglobulin heavy chain, when translated, contains any one of sequence numbers 540-628.
10. The nucleic acid library according to claim 1, wherein the variant immunoglobulin light chain, when translated, contains any one of sequence numbers 629-717.
11. A nucleic acid library comprising multiple nucleic acids, wherein each of the multiple nucleic acids encodes a sequence that, when translated, encodes an antibody or an antibody fragment, the antibody or antibody fragment comprises a variable region of the heavy chain (VH) containing an adenosine A2A receptor binding domain, each of the multiple nucleic acids comprises a sequence that encodes a sequence variant of the adenosine A2A receptor binding domain, and the antibody or antibody fragment has a K content of less than 100 nM. D And a nucleic acid library that binds to that antigen.
12. The nucleic acid library according to claim 11, wherein the length of the VH is about 90 to about 100 amino acids.
13. The nucleic acid library according to claim 11, wherein the length of the VH is about 100 to about 400 amino acids.
14. The nucleic acid library according to claim 11, wherein the length of VH is approximately 270 to approximately 300 base pairs.
15. The nucleic acid library according to claim 11, wherein the length of VH is approximately 300 to approximately 1200 base pairs.
16. The aforementioned library has at least 10 5 A nucleic acid library according to claim 11, comprising several non-identical nucleic acids.
17. A nucleic acid library comprising multiple nucleic acids, each of which, when translated, encodes a sequence encoding an adenosine A2A receptor single-domain antibody, each of which sequence comprises a variant sequence encoding CDR1, CDR2, or CDR3 on the variable region of the heavy chain (VH), the library comprising at least 30,000 variant sequences, and the adenosine A2A receptor single-domain antibody having a K content of less than 100 nM. D And a nucleic acid library that binds to that antigen.
18. The nucleic acid library according to claim 17, wherein the length of the translated VH is about 90 to about 100 amino acids.
19. The nucleic acid library according to claim 17, wherein the length of the translated VH is about 100 to about 400 amino acids.
20. The nucleic acid library according to claim 17, wherein the length of VH is approximately 270 to approximately 300 base pairs.
21. The nucleic acid library according to claim 17, wherein the length of VH is approximately 300 to approximately 1200 base pairs.
22. The nucleic acid library according to claim 17, wherein the variant library includes variant sequences encoding CDR1, CDR2, and CDR3.
23. The nucleic acid library according to claim 17, wherein the translated VH contains at least 90% sequence identity with respect to any one of sequence numbers 540-628.
24. The nucleic acid library according to claim 17, wherein the translated VH includes one of sequence numbers 540-628.
25. An antibody or antibody fragment comprising an immunoglobulin heavy chain and an immunoglobulin light chain that binds to an adenosine A2A receptor, a. The immunoglobulin heavy chain contains an amino acid sequence that is at least about 90% identical to that described in any one of Sequence IDs 540-628. b. The immunoglobulin light chain contains an amino acid sequence that is at least about 90% identical to that described in any one of Sequence IDs 629-717. Antibody or antibody fragment.
26. The antibody or antibody fragment according to claim 25, wherein the immunoglobulin heavy chain comprises an amino acid sequence identical by at least about 95% to that described in any one of SEQ ID NOs: 540-628, and the immunoglobulin light chain comprises an amino acid sequence identical by at least about 95% to that described in any one of SEQ ID NOs: 629-717.
27. The antibody or antibody fragment according to claim 25, wherein the immunoglobulin heavy chain comprises an amino acid sequence described in any one of SEQ ID NOs: 540-628, and the immunoglobulin light chain comprises an amino acid sequence that is at least about 90% identical to that described in any one of SEQ ID NOs: 629-717.
28. The antibody or antibody fragment according to claim 25, wherein the antibody is a monoclonal antibody, a polyclonal antibody, a bispecific antibody, a multispecific antibody, a grafted antibody, a human antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a camelized antibody, a single-chain Fv (scFv), a single-chain antibody, a Fab fragment, an F(ab')2 fragment, an Fd fragment, an Fv fragment, a single-domain antibody, an isolated complementarity-determining region (CDR), a diabody, a fragment consisting only of a single monomeric variable domain, a disulfide-linked Fv (sdFv), an intrabody, an anti-idiotype (anti-Id) antibody, or an ab antigen-binding fragment thereof.
29. The antibody or antibody fragment according to claim 25, wherein the antibody or antibody fragment is a chimeric or humanized.
30. The antibody or antibody fragment according to claim 25, wherein the antibody has an EC50 of less than about 25 nanomoles in a cAMP assay.
31. The antibody or antibody fragment according to claim 25, wherein the antibody has an EC50 of less than about 20 nanomoles in a cAMP assay.
32. The antibody or antibody fragment according to claim 25, wherein the antibody has an EC50 of less than about 10 nanomoles in a cAMP assay.
33. An antibody or antibody fragment comprising a complementation-determining region (CDR) having an amino acid sequence that is at least approximately 90% identical to that described in any one of SEQ ID NOs: 6-539.
34. An antibody or antibody fragment comprising a variable heavy chain complementarity-determining region (CDRH) having an amino acid sequence that is at least approximately 90% identical to that described in any one of SEQ ID NOs: 6-272.
35. An antibody or antibody fragment comprising a variable light chain complementarity-determining region (CDRH) having an amino acid sequence that is at least approximately 90% identical to that described in any one of Sequence IDs 273-539.
36. An antibody or antibody fragment comprising any one sequence of SEQ ID NOs: 6-539, wherein the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplant antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelized antibody, single-chain Fv(scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), diabody, fragment consisting only of a single monomeric variable domain, disulfide-linked Fv(sdFv), intrabody, anti-idiotype (anti-Id) antibody, or its ab antigen-binding fragment.
37. A method for treating cancer, comprising administering an antibody or antibody fragment according to any one of claims 25-36.
38. A method for treating a neurological disorder or condition, comprising the step of administering an antibody or antibody fragment according to any one of claims 25-36.
39. A method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the method is (a) A step of providing a predetermined sequence that codes for the following: i. A first plurality of polynucleotides, wherein each polynucleotide of the first plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR1 on the heavy chain, ii. A second plurality of polynucleotides, wherein each polynucleotide of the second plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR2 on the heavy chain, iii. A third plurality of polynucleotides, wherein each polynucleotide of the third plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR3 on the heavy chain, and (b) A step of mixing the first plurality of polynucleotides, the second plurality of polynucleotides, and the third plurality of polynucleotides to form a nucleic acid library of variant nucleic acids encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein at least about 70% of the variant nucleic acids are less than 100 nM D The process involves encoding an antibody or antibody fragment that binds to the adenosine A2A receptor. Methods that include...
40. The method according to claim 39, wherein the adenosine A2A receptor antibody or its antibody fragment is a single-domain antibody.
41. The method according to claim 40, wherein the single-domain antibody comprises one heavy chain variable domain.
42. The method according to claim 40, wherein the single-domain antibody is a VHH antibody.
43. The method according to claim 39, wherein the nucleic acid library comprises at least 50,000 variant sequences.
44. The method according to claim 39, wherein the nucleic acid library comprises at least 100,000 variant sequences.
45. The nucleic acid library comprises at least 10 5 The method according to claim 39, comprising several non-identical nucleic acids.
46. The nucleic acid library contains K75 nM D The method according to claim 39, comprising at least one sequence encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor.
47. The nucleic acid library contains K50 nM D The method according to claim 39, comprising at least one sequence encoding an adenosine A2A receptor antibody or antibody fragment that binds to an adenosine A2A receptor.
48. where the nucleic acid library has a K of less than 10 nM D The method according to claim 39, comprising at least one sequence encoding an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor with D .
49. The method according to claim 48, wherein the nucleic acid library comprises at least 500 variant sequences.
50. The nucleic acid library contains K75 nM D The method according to claim 39, comprising at least five sequences encoding an antibody or antibody fragment that binds to the adenosine A2A receptor.
51. A protein library encoded by a nucleic acid library according to any one of claims 1 to 24, wherein the protein library comprises peptides.
52. The protein library according to claim 51, wherein the protein library comprises immunoglobulins.
53. The protein library according to claim 51, wherein the protein library includes an antibody.
54. The protein library according to claim 51, wherein the protein library is a peptide-mimicking library.
55. A vector library comprising a nucleic acid library according to any one of claims 1 to 24.
56. A cell library comprising the nucleic acid library according to any one of claims 1 to 24.
57. A cell library comprising the protein library according to any one of claims 51-54.