RNA molecules, chimeric NA molecules, double-stranded RNA molecules, and double-stranded chimeric NA molecules
Modified RNA molecules with specific base mismatches and sugar modifications address off-target issues in RNA interference, enabling precise suppression of mutant alleles without affecting wild-type genes.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- THE UNIV OF TOKYO
- Filing Date
- 2026-03-23
- Publication Date
- 2026-06-23
Smart Images

Figure 2026102850000012 
Figure 2026102850000013 
Figure 2026102850000014
Abstract
Description
Technical Field
[0001] The present invention relates to RNA molecules, chimeric NA molecules, double-stranded RNA molecules, and double-stranded chimeric NA molecules for use in RNA interference methods.
Background Art
[0002] The RNA interference method is a simple and efficient method for specifically suppressing the expression of a specific target gene in cells.
[0003] However, it has been known that gene expression is also suppressed in genes (off-targets) that are not the original targets, more than initially predicted (Jackson, A.L. et al., (2003) Nature Biotechnology vol.21, p.635-7).
[0004] In particular, it has been clarified that the stronger the affinity of siRNA for the target gene, the greater the off-target effect (Ui-Tei, K. et al., (2008) Nucleic Acids Res. vol.36, p.7100-7109.).
Summary of the Invention
Problems to be Solved by the Invention
[0005] An object of the present invention is to provide novel RNA molecules, novel chimeric NA molecules, novel double-stranded RNA molecules, and novel double-stranded chimeric NA molecules.
Means for Solving the Problems
[0006] The inventors of this invention have been diligently working to identify RNA sequences with low off-target effects, and have found that having a mismatch at the 5th or 6th base and modifying the 2' position of the pentose sugar at the 8th ribonucleotide reduces the off-target effect. Here, off-target effect refers to a non-specific effect that suppresses the expression of an unintended target different from the original target.
[0007] One embodiment of the present invention is an RNA molecule for use in RNA interference with a mutant allele having a single nucleotide point mutation relative to the wild-type allele of a gene, and which satisfies the following requirements: (1) Having a nucleotide sequence complementary to the coding region of the variant allele, excluding the nucleotides specified in (2-1) below; (2) The base sequence complementary to the mutant allele, counting from the 5' end: (2-1) The 5th or 6th base is a mismatch with the base of the variant allele; (2-2) The 10th position corresponds to the location of the point mutation, and the 10th base is a base present in the mutant allele, or the 11th position corresponds to the location of the point mutation, and the 11th base is a base present in the mutant allele; (2-3) In the eighth ribonucleotide, the 2' position of the pentose is modified with OCH3, a halogen, or LNA; and (2-4) In the seventh ribonucleotide, the 2' position of the pentose is not modified with OCH3, a halogen, or LNA. In the sixth ribonucleotide, the 2' position of the pentose may be modified with OCH3, a halogen, or LNA. The seventh ribonucleotide may not be modified in any way. The halogen may be F. If the 5' end base of the base sequence specified in (1) above is not adenine or uracil, it may be substituted with adenine or uracil. If the 3' end base of the base sequence specified in (1) above is not cytosine or guanine, it may be substituted with cytosine or guanine. Any of the above RNA molecules may consist of 13 to 28 nucleotides. Any of the above RNA molecules may be chimeric NA molecules in which one or more ribonucleotides are substituted with deoxyribonucleotides, artificial nucleic acids, or nucleic acid analogs.
[0008] A further embodiment of the present invention is a double-stranded RNA molecule in which any of the above RNA molecules is a guide strand and an RNA molecule having a sequence complementary to the above RNA molecule is a passenger strand. The guide strand may have an overhang at its 3' end and / or the 3' end of the passenger strand, and the overhang may consist of 1 to 3 nucleotides. Any of the above double-stranded RNA molecules may be double-stranded chimeric NA molecules in which one or more ribonucleotides are substituted with deoxyribonucleotides, artificial nucleic acids, or nucleic acid analogs.
[0009] A further embodiment of the present invention is a method for producing an RNA molecule for use as a guide strand in RNA interference, the method comprising the step of producing any of the above-mentioned RNA molecules. The RNA molecule may be a chimeric NA molecule in which one or more ribonucleotides are replaced with deoxyribonucleotides, artificial nucleic acids, or nucleic acid analogs.
[0010] A further embodiment of the present invention is an RNA interference method in which a cell has a wild-type allele of a gene and a mutant allele of the gene having a single-nucleotide point mutation, the mutant allele being the target gene, and the RNA interference method comprises the step of introducing any of the above RNA molecules, a chimeric NA molecule, a double-stranded RNA molecule, or any of the above double-stranded chimeric NA molecules into the cell.
[0011] A further embodiment of the present invention is a therapeutic agent for a patient having a disease caused by a disease having a wild-type allele of a disease-causing gene and a mutant allele of the disease-causing gene having a single-nucleotide point mutation, wherein the patient has one of the above-mentioned RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or one of the above-mentioned double-stranded chimeric NA molecules as an active ingredient.
[0012] A further embodiment of the present invention is a method for selecting RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules for use in an RNA interference method for suppressing a target gene, comprising the steps of: performing the RNA interference method in vitro using each of the plurality of RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules to examine the specific gene expression suppression ability of the plurality of RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules for the target gene; and selecting RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules whose specific gene expression suppression ability is at or above a predetermined level.
[0013] ==Cross-reference with related literature== This application claims priority based on Japanese Patent Application No. 2021-005336, filed on 15 January 2021, which is incorporated herein by reference. [Brief explanation of the drawing]
[0014] [Figure 1] This graph shows the results of investigating the ability to suppress siRNA expression when the 9th to 11th positions of siRNA targeting the K-ras gene are aligned with the location of a point mutation, in one embodiment of the present invention. [Figure 2] This graph shows the results of investigating the expression suppression ability of an siRNA when, in one embodiment of the present invention, the 11th position of an siRNA targeting the K-ras gene is aligned with the location of a point mutation, the base at the 5' end of the siRNA guide strand is replaced from guanine to uracil, and the base at the 5' end of the passenger strand is replaced from uracil to guanine. [Figure 3] This graph shows the results of investigating the expression suppression ability of siRNA when, in one embodiment of the present invention, the 11th position of siRNA targeting the K-ras gene is aligned with the location of a point mutation, the 5' terminal base of the siRNA guide strand is replaced from guanine to uracil, the 5' terminal base of the passenger strand is replaced from uracil to guanine, and the 2' position of the pentose in the 6th to 8th ribonucleotides of the siRNA guide strand is replaced with OCH3. [Figure 4] This graph shows the results of investigating the ability to suppress siRNA expression in one embodiment of the present invention, where the 11th position of the siRNA targeting the K-ras gene was aligned with the location of a point mutation, the 5' terminal base of the siRNA guide strand was replaced from guanine to uracil, the 5' terminal base of the passenger strand was replaced from uracil to guanine, and the 3rd to 7th bases of the siRNA guide strand were mismatched with the bases of the A mutant allele. [Figure 5]This graph shows the results of investigating the ability to suppress siRNA expression when, in one embodiment of the present invention, the 11th position of the siRNA targeting the K-ras gene is aligned to the position of a point mutation, the 5' terminal base of the siRNA guide strand is replaced from guanine to uracil, the 5' terminal base of the passenger strand is replaced from uracil to guanine, the 2' position of the pentose in the 6th to 8th ribonucleotides of the siRNA guide strand is replaced with OCH3, and the 3rd to 7th bases of the siRNA guide strand are mismatched with the bases of the A mutant allele. [Figure 6] This graph shows the results of investigating the expression suppression ability and off-target effects of siRNA when, in one embodiment of the present invention, the 11th position of siRNA targeting the K-ras gene is aligned to the location of a point mutation, the 5' terminal base of the siRNA guide strand is replaced from guanine to uracil, the 5' terminal base of the passenger strand is replaced from uracil to guanine, the 2' position of the pentose at the 6th and 8th ribonucleotides of the siRNA guide strand is replaced with OCH3, and the 6th base of the siRNA guide strand is mismatched with the base of the A mutant allele. [Modes for carrying out the invention]
[0015] The object, features, advantages, and ideas of the present invention will be apparent to those skilled in the art from the description herein, and will be easily reproducible to those skilled in the art from the description herein. The embodiments and specific examples of the invention described below are examples of preferred embodiments of the present invention and are provided for illustrative or explanatory purposes only, and do not limit the present invention thereto. It will be apparent to those skilled in the art that various modifications and modifications can be made based on the description herein, within the intent and scope of the present invention as disclosed herein. In the nucleotide sequences described herein, unless otherwise specified, the left side is the 5' end and the right side is the 3' end.
[0016] ==RNA molecule== One embodiment of the present invention is an RNA molecule for use in an RNA interference method targeting a mutant allele having a single-base point mutation with respect to the wild-type allele of a gene. The target gene is not particularly limited as long as the RNA molecule of the present disclosure can be designed, but it is preferably a cancer gene in which normal cells are cancerated by a point mutation, a causative gene of a hereditary disease that develops by a point mutation, or a causative gene of a disease, and a gene having an SNP linked on the coding region to the mutation that is the cause of the disease. Here, in the gene pool, the ratio of the mutation that is the cause of the disease and the SNP being linked is preferably 50% or more, more preferably 60% or more, 70% or more, 80% or more, or 90% or more, and even more preferably 95% or more, 99% or more, or 99.5% or more.
[0017] For example, as cancer genes, there are the ZMYM3 gene, CTNNB1 gene, SMARCA4 gene, SMO gene, AR gene, etc.; as causative genes of hereditary diseases, there are the DNM2 gene, KRT14 gene, IL4R gene, MAPT gene, MS4A2 gene, PABPN1 gene, SCNIA gene, APOB gene, F12 gene, CLCN7 gene, SCN8A gene, PCSK9 gene, KRT6A gene, RHO gene, etc.; as causative genes of diseases having SNPs, there are the ATXN3 gene, HTT gene, etc. These are the causative genes of the diseases shown in Table 1 respectively.
[0018]
Table 1
[0019] The number of nucleotides constituting the RNA molecule is not particularly limited, but may be 13 or more and 100 or less, 13 or more and 50 or less, 13 or more and 28 or less, 15 or more and 25 or less, 17 or more and 21 or less, and more preferably 19 or more and 21 or less. Further, one or more ribonucleotides may be substituted with deoxyribonucleotides, artificial nucleic acids, or nucleic acid analogs such as inosine and morpholino. In the present specification, such an RNA molecule is referred to as a chimeric NA molecule, but in the present disclosure, the RNA molecule is described including the chimeric NA molecule.
[0020] This RNA molecule has a mismatch between the bases of the mutant allele and the base sequence complementary to the mutant allele. The 5th or 6th base, counting from the 5' end of the complementary base sequence, is mismatched to the base of the mutant allele, but the rest of the molecule has a base sequence complementary to the coding region of the mutant allele. This RNA molecule may also have a base sequence other than the complementary base sequence of the mutant allele, for example, a sequence complementary to the complementary base sequence, thereby enabling self-annealing and functioning as siRNA. Bonac nucleic acid is an example of such a single-stranded RNA. Alternatively, it may have 1 to 3 nucleotides attached to the 3' end, and the base sequence is not particularly limited. If the 5' end of the complementary base sequence is not adenine or uracil, it may be substituted with adenine, uracil, or thymine. Also, if the 3' end of the complementary base sequence is not cytosine or guanine, it may be substituted with cytosine or guanine. These manipulations can improve the gene expression repression function when this RNA molecule functions as a guide strand for siRNA. Furthermore, this RNA molecule may contain chemical substances other than nucleic acids for delivery, to enhance membrane permeability, or to improve blood retention. For example, the RNA molecule may be conjugated with GalNAc or PEG. Also, except for the 5th or 6th base, the RNA molecule may consist of a sequence other than the base sequence complementary to the coding region of the mutant allele. The RNA molecule has a base sequence complementary to the mutant allele except for the 5th or 6th base, but it is preferable that it has a complementarity of 90% or more, more preferably 95% or more, even more preferably 98% or more, and most preferably 100%. The 5th or 6th base is not particularly limited as long as it is a mismatch with the mutant allele, and any base other than the base of the mutant allele at that position may be A, U, C, G, T, I, or other artificial nucleic acids or nucleic acid analogs.
[0021] Furthermore, in this RNA molecule, the 10th or 11th base, counting from the 5' end of the complementary base sequence to the mutant allele, corresponds to the location of the point mutation, and that base is the base present in the mutant allele. That is, if the mutated bases present in the mutant allele are adenine, cytosine, guanine, and thymine, then the 10th or 11th bases of the RNA molecule are adenine, cytosine, guanine, and uracil (or thymine), respectively.
[0022] Furthermore, in this RNA molecule, counting from the 5' end of the base sequence complementary to the mutant allele, the 2' position of the pentose sugars at the 8th nucleotide, preferably the 6th and 8th nucleotides, is modified (i.e., substituted) with OCH3, a halogen, or LNA, while the 2' position of the pentose sugar at the 7th nucleotide is not modified (i.e., substituted) with OCH3, a halogen, or LNA, but preferably no modification at all. For example, RNA in which the 2' position of the pentose sugar is substituted with -OCH3 (hereinafter referred to as 2'-O-methyl RNA) has the structure of the following general formula.
[0023] [ka]
[0024] The type of halogen is not particularly limited, but fluorine is preferred due to its small molecular size. Other nucleotides may be partially or entirely modified, but it is preferable that all nucleotides remain unmodified. The modification of the nucleotide is not particularly limited, but examples include substitution of the 2' position of the pentose with a group selected from the group consisting of H, OR, R, halogen, SH, SR, NH2, NHR, NR2, CN, COOR, and LNA (wherein R is a C1-C6 alkyl, alkenyl, alkynyl, or aryl; halogen is F, Cl, Br, or I).
[0025] The IC50 of the RNA molecule for the target gene is preferably 1 nM or less, more preferably 500 pM or less, and even more preferably 200 pM or less.
[0026] When this RNA molecule is used in RNA interference as a single strand, it is preferable that its 5' end is phosphorylated or can be phosphorylated in situ or in vivo.
[0027] This RNA molecule design method includes the following steps.
[0028] First, the mutated base of the mutant allele is designated as the 10th or 11th base from the 5' end, and a base sequence of a predetermined length having a complementary sequence to the base sequence of the mutant allele is determined. Next, the 5th or 6th base from the 5' end is made into a mismatch base. Then, the 8th nucleotide from the 5' end, preferably the 6th and 8th nucleotides, have their pentose sugars at the 2' position modified with OCH3, a halogen, or LNA. Here, if the 5' end of the complementary base sequence is not adenine or uracil, a step of substituting with adenine, uracil, or thymine may be performed. The 7th nucleotide from the 5' end is assumed to have its pentose sugar at the 2' position not modified with OCH3, a halogen, or LNA, but may not be modified at all. Furthermore, if the 3' end base of the complementary base sequence is not cytosine or guanine, a step of substitution with cytosine or guanine may be performed. Finally, a step of adding 1 to 3 bases to the 3' end may be performed. In this way, a base sequence can be designed. A program for performing this design method on a computer may be created, and the program may be stored on a computer-readable recording medium. Nucleotides having the base sequence designed in this way can be chemically synthesized according to standard methods.
[0029] ==Double-stranded RNA molecule== One embodiment of the present invention is a double-stranded RNA molecule in which the aforementioned RNA molecule (hereinafter referred to as the first RNA molecule) is a guide strand, and a second RNA molecule having a sequence complementary to the first RNA molecule is a passenger strand. The second RNA molecule has a sequence complementary to the first RNA molecule and forms a double helix with the first RNA molecule under physiological conditions, preferably having 90% or more complementarity, more preferably 95% or more complementarity, even more preferably 98% or more complementarity, and most preferably 100% complementarity.
[0030] The length of the passenger strand is not particularly limited and may be considerably shorter than the first RNA molecule, for example, less than half the length of the first RNA molecule, but it is preferable that they be the same length. If the passenger strand is shorter than the first RNA molecule, a single-stranded portion will be created in the first RNA molecule. This portion may remain single-stranded, or a complementary third RNA molecule may be bound to it. When the second and third RNA molecules bind to the entire first RNA molecule, it is equivalent to having a nick in one passenger strand that splits into two.
[0031] The ends of the double-stranded RNA molecule may be blunt ends, but the 3' end of the first RNA molecule (the guide strand) and / or the 3' end of the second RNA molecule (the passenger strand) may have overhangs. The number of nucleotides in the overhang is not particularly limited, but it is preferably 1 to 3.
[0032] The guide strand and passenger strand may both be double-stranded chimeric NA molecules in which 1-3, 4-6, 7-9, 10-12, 13-15, 16-18, 19-21, 22-24, or 25 or more ribonucleotides, or all ribonucleotides, are replaced with artificial nucleic acids such as deoxyribonucleotides or morpholine, or nucleic acid analogs such as glycol nucleic acids. The substitution sites are not particularly limited.
[0033] The nucleotides constituting the passenger chain may be modified, but it is preferable that they be unmodified. The modifications to the nucleotides are not particularly limited, but examples include substitution of the 2' position of the pentose with a group selected from the group consisting of H, OR, R, halogen, SH, SR1, NH2, NHR, NR2, CN, COOR, and LNA (wherein R is a C1-C6 alkyl, alkenyl, alkynyl, or aryl; halogen is F, Cl, Br, or I).
[0034] The passenger chain can also be easily designed and manufactured according to well-known techniques. The guide chain and passenger chain may be linked by a linker. The material of the linker is not particularly limited, but may include peptides or PEG.
[0035] Taking the above into consideration, for example, sequences like those shown in Table 2 can be designed for siRNAs targeting HTT genes and AR genes, such as K-ras gene, N-ras gene, ZMYM3 gene, CTNNB1 gene, SMARCA4 gene, SMO gene, RHO gene, ATXN3 gene, DNM2 gene, KRT14 gene, IL4R gene, MAPT gene, MS4A2 gene, PABPN1 gene, SCNIA gene, APOB gene, F12 gene, CLCN7 gene, SCN8A gene, PCSK9 gene, KRT6A gene, etc.
[0036] In the table, the parentheses around the K-ras gene indicate the type of mutation, the parentheses around the HTT gene indicate its location on the genome, and the parentheses around other genes indicate their order from the translation start site (i.e., A in the start codon ATG). P represents the passenger strand, and G represents the guide strand. (1) K(35)11ArevOM(6+8)M5 and K(35)11TrevOM(6+8)M5 have a mismatch at the 5th base with respect to the base of the variant allele, and all other bases are mismatches with respect to the base of the variant allele at the 6th base notation. (2) In all cases, the 11th base corresponds to the location of the point mutation, and the 11th base is the base present in the mutant allele. (3) In all cases, the 2' position of the pentose at the 6th and 8th ribonucleotides is modified with OCH3, halogen, or LNA. (4) In all cases, the 2' position of the pentose at the 7th ribonucleotide is not modified with OCH3, halogen, or LNA.
[0037] [Table 2] JPEG2026102850000004.jpg144170
[0038] ==RNA Interference== One embodiment of the present invention is an RNA interference method targeting the mutant allele as the target gene in cells having a wild-type allele of a target gene and a mutant allele of a gene having a single-nucleotide point mutation. This RNA interference method includes the step of introducing a first RNA molecule containing a chimeric NA molecule, or the above-mentioned double-stranded RNA molecule containing a double-stranded chimeric NA molecule, into cells having a wild-type allele and a mutant allele.
[0039] RNA interference can be easily performed according to well-known techniques. For example, by introducing a first RNA molecule or a double-stranded RNA molecule into cultured cells expressing the target gene, or into human or non-human organisms, the expression of the target gene can be reduced.
[0040] When performing RNA interference, using the first RNA molecule or double-stranded RNA molecule described above, it is possible to primarily suppress the expression of the mutant allele of the target gene without effectively suppressing the expression of the wild-type allele. Here, the expression of the wild-type allele may be suppressed to the extent that the wild-type allele functions and produces a normal phenotype. The expression of the mutant allele should be suppressed to the extent that the mutant allele does not function and does not produce an abnormal phenotype. This makes it possible, for example, to allow cells to function normally without expressing the phenotype caused by the mutation, even if the mutant allele has a dominant mutation.
[0041] ==Medications== One embodiment of the present invention provides a therapeutic agent for patients with a disease caused by the mutant allele of a disease-causing gene, comprising a wild-type allele of the disease-causing gene and a mutant allele of the disease-causing gene having a single-nucleotide point mutation, wherein the active ingredient is an RNA molecule containing the aforementioned chimeric NA molecule, or a double-stranded RNA molecule containing a double-stranded chimeric NA molecule. A carrier is defined as a person who possesses the mutant allele of the disease-causing gene but has not yet developed the disease and is likely to develop it in the future. Furthermore, a preventive agent for a carrier is a drug that prevents a carrier from developing the disease because they possess the mutant allele of the disease-causing gene.
[0042] Here, the cause of the disease is not limited to the point mutation in question, but may also be due to another mutation, with a predetermined percentage of patients or carriers possessing that point mutation. In the latter case, it is preferable that the disease-causing mutation and the point mutation are linked. The predetermined percentage is not particularly limited, but is preferably 50% or more, more preferably 60% or more, 70% or more, 80% or more, or 90% or more, and even more preferably 95% or more, 99% or more, or 99.5% or more. If the predetermined percentage is low, the patient or carrier may be examined to determine whether they possess the point mutation before administering the drug. In these cases, it is preferable that healthy individuals other than the patient or carrier do not possess the point mutation.
[0043] Examples of the former include hereditary diseases and tumors caused by a single nucleotide mutation. Hereditary diseases are not particularly limited as long as they are caused by a single nucleotide mutation, but examples include the diseases shown in Table 1. Tumors are also not particularly limited as long as they are caused by a single nucleotide mutation in the tumor gene, but examples include the diseases shown in Table 1.
[0044] An example of the latter is triplet repeat disease. Triplet repeat disease is known to develop when repeats such as CAG are repeated 5 to 40 times in healthy individuals and 36 to 3000 times in patients. For example, the ATXN3 mutant gene, which is the causative gene for Machado-Joseph disease, has a SNP in which the G immediately following the CAG repeat is mutated to C, and this mutation can be targeted by the siRNA disclosed herein. Triplet repeat disease is not particularly limited, but the diseases shown in Table 1 are examples.
[0045] The method of administering the drugs disclosed herein is not particularly limited, but injection is preferred, and intravenous injection is more preferred. In this case, in addition to the active ingredient, pH adjusters, buffers, stabilizers, isotonic agents, local anesthetics, etc., may be added to the therapeutic agent.
[0046] The dosage is not particularly limited and should be selected as appropriate depending on the effectiveness of the ingredients, the form of administration, the route of administration, the type of disease, the characteristics of the patient (such as weight, age, medical condition, and whether other medications are being used), and the judgment of the attending physician.
[0047] ==Selection Method== One embodiment of the present invention is a method for selecting an RNA molecule, a chimeric NA molecule, a double-stranded RNA molecule, or a double-stranded chimeric NA molecule for use in an RNA interference method for suppressing a target gene, comprising the steps of: investigating the specific gene expression suppression ability by performing an RNA interference method in vitro using a plurality of the above-mentioned RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules; and selecting an RNA molecule, a chimeric NA molecule, a double-stranded RNA molecule, or a double-stranded chimeric NA molecule whose specific gene expression suppression ability is at or above a predetermined level.
[0048] When performing RNA interference in vitro, the target gene is either a wild-type allele or a mutant allele with a single-nucleotide point mutation. A molecule is selected that does not suppress the expression of the wild-type allele above a predetermined level, but suppresses the expression of the mutant allele above a predetermined level. This allows for the acquisition of a molecule that suppresses the expression of the mutant allele but not the expression of the wild-type allele. The numerical value of the predetermined level is not particularly limited, but 50% is preferred, 70% is more preferred, and 90% is even more preferred.
[0049] In vitro assay methods using RNA interference are common technical knowledge, and gene selection, cell selection, and introduction of RNA molecules into cells are obvious to those skilled in the art. [Examples]
[0050] (method) HeLa cells cultured in DMEM containing 10% FBS, 1 x 10 5 Cells were seeded at a density of cells / mL in 24-well plates and co-transfected with 100 ng of each reporter and 100 ng of an internal standard plasmid (pGL3) along with double-stranded siRNA and 2 μL of lipofectamine 2000. The concentrations of the double-stranded siRNAs are shown in each figure. SiGY441 was introduced as the control siRNA. After 24 hours, cells were harvested, and the activity of firefly luciferase and Renilla luciferase was measured using a dual-luciferase reporter assay system (Promega). The Renilla luciferase measurement was standardized using the firefly luciferase measurement. The measurements obtained with double-stranded siRNA were plotted with the measurement obtained with siGY441 set to 100% in the graph. [Examples]
[0051] In this example, the K-ras gene was used as the target gene for expression suppression.
[0052] (Example 1-1) In this example, by aligning the 10th or 11th position of the siRNA with the location of the point mutation in the A-mutant K-ras(c.35G>A) allele (hereinafter referred to as the A-mutant allele), we demonstrate that the specificity of the ability to suppress RNA molecule expression against the A-mutant K-ras(c.35G>A) allele is improved compared to the wild-type K-ras allele (hereinafter referred to as the wild-type allele).
[0053] First, to investigate the gene expression suppression effect, DNA with the same base sequence as the wild-type K-ras(wt) allele and the A-mutant K-ras(c.35G>A) allele was chemically synthesized and inserted into the 3'-UTR of the luciferase gene in the expression vector (psiCHECK) to create wild-type K reporters and A-mutant K reporters. The sequences of the regions incorporated into the vectors are shown below.
[0054] JPEG2026102850000005.jpg53170
[0055] Next, double-stranded RNA with the following sequence was chemically synthesized as siRNA. The siRNAs K(35)9A, K(35)10A, and K(35)11A correspond to the point mutation sites of the A-mutant K-ras(c.35G>A) allele at positions 9, 10, and 11, respectively. In the sequence below, the base pairs corresponding to the point mutation sites are enclosed in squares.
[0056] JPEG2026102850000006.jpg49170
[0057] Figure 1 shows the gene expression suppression effect of each siRNA. K(35)9A had a strong inhibitory effect on the expression of both the A mutant and wild-type alleles. K(35)10A and K(35)11A had a slightly weaker inhibitory effect, but still strongly suppressed the expression of the A mutant allele more than the wild-type allele.
[0058] (Examples 1-2) In this example, we demonstrate that by using an siRNA in which the 11th position of the siRNA corresponds to the point mutation site of the A mutant allele, and the 5' terminal base of the guide strand of the siRNA is replaced from guanine to uracil, and the 5' terminal base of the passenger strand is replaced from uracil to guanine, the ability to suppress RNA molecule expression against the A mutant allele is strengthened, and its specificity is further improved.
[0059] To investigate the gene expression suppression effect, wild-type K reporters and A-mutant K reporters were used as reporters. As siRNA, a double-stranded RNA with the following sequence was chemically synthesized, and K(35)11A was used as a control. In the following sequence, the base pairs corresponding to the point mutation site and the substituted base pairs at the 5' ends of the guide and passenger strands are enclosed in squares.
[0060] JPEG2026102850000007.jpg18170
[0061] Figure 2 shows the gene expression suppression effect of each siRNA. While K(35)11A strongly suppressed the expression of the A mutant allele compared to the wild-type allele, K(35)11Arev showed a stronger suppressive effect on both, further suppressing the expression of the A mutant allele more strongly than the wild-type allele.
[0062] (Examples 1-3) In this example, the 11th position of the siRNA is aligned with the point mutation site of the A mutant allele, the 5' terminal base of the siRNA guide strand is replaced from guanine to uracil, and the 5' terminal base of the passenger strand is replaced from uracil to guanine. Furthermore, the 2' position of the pentose in the 6th to 8th ribonucleotides of the siRNA guide strand is replaced with OCH3, thereby strengthening the ability to suppress RNA molecule expression against the A mutant allele and further improving its specificity.
[0063] To investigate the gene expression suppression effect, wild-type K reporters and A-mutant K reporters were used as reporters. Double-stranded RNA with the following sequence was chemically synthesized as siRNA, and K(35)11Arev was used as a control. In the following sequence, the base pair corresponding to the point mutation site and the substituted base pair at the 5' end of the guide and passenger strands are enclosed in squares, and nucleotides with the 2' position of the pentose substituted with OCH3 are marked with a shadow.
[0064] JPEG2026102850000008.jpg31170
[0065] Figure 3 shows the gene expression repression effect of each siRNA. K(35)11Arev strongly suppressed the expression of the A mutant allele more than the wild-type allele, but K(35)11ArevOM(6-8) showed a stronger suppressive effect on both, strongly suppressing the expression of the A mutant allele more than the wild-type allele. Another control, K(35)11ArevOM(2-5) (in which the 2' position of the pentose in the 2nd to 5th ribonucleotides of the guide chain is substituted with OCH3), showed a considerably weaker suppressive effect on both.
[0066] (Examples 1-4) In this example, we demonstrate that by aligning the 11th position of the siRNA with the point mutation site of the A mutant allele, substituting the 5' terminal base of the siRNA guide strand from guanine to uracil, substituting the 5' terminal base of the passenger strand from uracil to guanine, and then mismatching the 5th or 6th base of the siRNA guide strand with the base of the A mutant allele, the ability to suppress RNA molecule expression against the wild-type allele is weakened, resulting in further improvement of specificity against the A mutant allele.
[0067] To investigate the gene expression suppression effect, wild-type K reporters and A-mutant K reporters were used as reporters. As siRNA, a double-stranded RNA with the following sequence containing mismatches at bases 3-7 was chemically synthesized based on K(35)11Arev, and K(35)11Arev was used as a control. In the sequence below, the base pairs corresponding to the point mutation site, the substituted base pairs at the 5' ends of the guide and passenger strands, and the mismatched base pairs are enclosed in squares.
[0068] JPEG2026102850000009.jpg75170
[0069] Figure 4 shows the gene expression repression effect of each siRNA. While K(35)11Arev strongly suppressed the expression of the A mutant allele compared to the wild-type allele, K(35)11ArevM5 and K(35)11ArevM6 showed very weak suppression of RNA molecule expression against the wild-type allele, resulting in further improved specificity for the A mutant allele.
[0070] (Examples 1-5) In this example, we demonstrate that the specificity for the A mutant allele is further improved by aligning the 11th position of the siRNA with the point mutation site of the A mutant allele, substituting the 5' terminal base of the siRNA guide strand from guanine to uracil, substituting the 5' terminal base of the passenger strand from uracil to guanine, and then substituting the 2' position of the pentose in the 6th to 8th ribonucleotides of the siRNA guide strand with OCH3, and mismatching the 5th or 6th base of the siRNA guide strand with the base of the A mutant allele.
[0071] To investigate the gene expression suppression effect, wild-type K reporters and A-mutant K reporters were used as reporters. As siRNA, double-stranded RNA with the following sequence containing mismatches at bases 3-7 was chemically synthesized based on K(35)11Arev, and K(35)11Arev was used as a control. In the following sequence, the base pairs corresponding to the point mutation site, the substituted base pairs at the 5' ends of the guide and passenger strands, and the mismatched base pairs are enclosed in squares, and nucleotides with the 2' position of the pentose substituted with OCH3 are marked with a shadow.
[0072] JPEG2026102850000010.jpg78170
[0073] Figure 5 shows the gene expression repression effect of each siRNA. K(35)11ArevOM(6-8)M5 and K(35)11ArevOM(6-8)M6 exhibited significantly weaker suppression of RNA molecule expression against the wild-type allele, resulting in further improved specificity for the A mutant allele.
[0074] (Examples 1-6) This study demonstrates that by aligning the 11th position of the siRNA with the point mutation site of the A mutant allele, substituting the 5' terminal base of the siRNA guide strand from guanine to uracil, substituting the 5' terminal base of the passenger strand from uracil to guanine, substituting the 2' position of the pentose in ribonucleotides 6 through 8 of the siRNA guide strand with OCH3 (i.e., removing the modification at ribonucleotide 7), and mismatching the 6th base of the siRNA guide strand with the base of the A mutant allele, the ability to suppress expression against the wild-type allele is weak, the ability to suppress expression against the A mutant allele remains strong, and nonspecific off-target effects are reduced.
[0075] To investigate the gene expression repression effect, we used a wild-type K reporter, an A-mutant K reporter, and off-target detection reporters (SEQ ID NOs. 40 and 41). The off-target reporters were prepared by chemically synthesizing DNA containing the off-target detection reporter sequence described below, similar to the wild-type K reporter and the A-mutant K reporter, and inserting it into the 3'-UTR of the luciferase gene in the expression vector (psiCHECK).
[0076] Reporter sequence for off-target detection: 5'-CUCAACCUGCACCACGCCUAGGACG-3'(SEQ ID NO: 40) 3'- CACCCUCGACUACCGGAUCCU -5'(Sequence ID 41)
[0077] As siRNA, double-stranded RNAs (SEQ ID NOs. 42 and 43) with the following sequence were chemically synthesized based on K(35)11Arev, with a mismatch at the 6th base and substitution of the 2' position of the pentose with OCH3 at the 6th and 8th ribonucleotides. K(35)11ArevOM(6-8)M6 was used as a control. In the sequence below, the base pair corresponding to the point mutation, the substituted base pair at the 5' end of the guide and passenger strands, and the mismatched base pair are enclosed in squares, and the nucleotide with the 2' position of the pentose substituted with OCH3 is marked with a shadow.
[0078] JPEG2026102850000011.jpg18170
[0079] Figure 6 shows the gene expression repression effect and off-target effects of each siRNA. K(35)11ArevOM(6-8)M6 showed very weak repression of RNA expression against the wild-type allele and strong repression of RNA expression against the A mutant allele. However, K(35)11ArevOM(6+8)M6 showed almost no change in its effect on both the wild-type and A mutant alleles compared to K(35)11ArevOM(6-8)M6, while significantly reducing nonspecific off-target effects. [Industrial applicability]
[0080] The present invention makes it possible to provide novel RNA molecules, novel chimeric NA molecules, novel double-stranded RNA molecules, and novel double-stranded chimeric NA molecules.
Claims
1. RNA molecules for use in RNA interference spectroscopy targeting a mutant allele having a single-nucleotide point mutation relative to the wild-type allele of a gene, and which satisfy the following requirements: (1) Having a base sequence complementary to the coding region of the variant allele, excluding the bases specified in (2-1) below; (2) The base sequence complementary to the mutant allele, counting from the 5' end: (2-1) The fifth or sixth base is a mismatch with the base of the variant allele; (2-2) The 10th or 11th base corresponds to the location of the point mutation, and the 10th or 11th base is a base present in the mutant allele; (2-3) In the eighth ribonucleotide, the 2' position of the pentose is OCH 3 , being modified with halogen or LNA; and (2-4) In the seventh ribonucleotide, the 2' position of the pentose is OCH 3 It must not be modified with halogens or LNAs.
2. In the sixth ribonucleotide, counting from the 5' end of the base sequence complementary to the aforementioned mutant allele, the 2' position of the pentose is OCH. 3 The RNA molecule according to claim 1, which is modified with a halogen or LNA.
3. The RNA molecule according to claim 1 or 2, wherein the seventh ribonucleotide is not modified in any way.
4. The RNA molecule according to claim 1, wherein the halogen is F.
5. The RNA molecule according to any one of claims 1 to 4, wherein the 5' terminal base of the base sequence defined in claim 1(1) is substituted with adenine or uracil if it is cytosine or guanine.
6. The RNA molecule according to any one of claims 1 to 5, wherein the 3' terminal base of the base sequence defined in claim 1(1) is substituted with cytosine or guanine if it is adenine or uracil.
7. An RNA molecule comprising 13 to 28 nucleotides, according to any one of claims 1 to 6.
8. An RNA molecule according to any one of claims 1 to 7, further having 1 to 3 nucleotides at the 3' end of the base sequence defined in claim 1(1).
9. A chimeric NA molecule in which one or more ribonucleotides in the RNA molecule according to any one of claims 1 to 8 are replaced with deoxyribonucleotides, artificial nucleic acids, or nucleic acid analogs.
10. A double-stranded RNA molecule in which the RNA molecule described in any one of claims 1 to 7 is the guide strand, and the RNA molecule having a sequence complementary to the RNA molecule is the passenger strand.
11. The double-stranded RNA molecule according to claim 10, having an overhang at the 3' end of the guide strand and / or the 3' end of the passenger strand.
12. The double-stranded RNA molecule according to claim 11, wherein the overhang region consists of 1 to 3 nucleotides.
13. A double-stranded chimeric NA molecule according to any one of claims 10 to 12, wherein one or more ribonucleotides are replaced with deoxyribonucleotides, artificial nucleic acids, or nucleic acid analogs.
14. A method for producing RNA molecules to be used as guide strands in RNA interference, A method for producing an RNA molecule according to any one of claims 1 to 8.
15. A method for producing chimeric NA molecules for use as guide strands in RNA interference, A method for producing a chimeric NA molecule as described in claim 9, comprising the step of producing the chimeric NA molecule described in claim 9.
16. RNA interference method for targeting the mutant allele of a gene in a cell having a wild-type allele of the gene and a mutant allele of the gene having a single-nucleotide point mutation, comprising the step of introducing an RNA molecule according to any one of claims 1 to 8, a chimeric NA molecule according to claim 9, a double-stranded RNA molecule according to any one of claims 10 to 12, or a double-stranded chimeric NA molecule according to claim 13 into the cell.
17. A therapeutic agent for patients with a disease caused by the mutant allele of a disease-causing gene, comprising a wild-type allele of the disease-causing gene and a mutant allele of the disease-causing gene having a single nucleotide point mutation, A therapeutic or prophylactic agent comprising an RNA molecule according to any one of claims 1 to 8, a chimeric NA molecule according to claim 9, a double-stranded RNA molecule according to any one of claims 10 to 12, or a double-stranded chimeric NA molecule according to claim 13 as an active ingredient.
18. A method for selecting RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules for use in RNA interference to suppress a target gene, comprising the steps of: performing the RNA interference method of claim 15 in vitro using each of the RNA molecules described in any one of the plurality of claims 1 to 7, the chimeric NA molecule described in claim 8, the double-stranded RNA molecule described in any one of the claims 9 to 11, or the double-stranded chimeric NA molecule described in claim 12, thereby investigating the specific gene expression suppression ability of the plurality of RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules for the target gene; A step of selecting an RNA molecule, a chimeric NA molecule, a double-stranded RNA molecule, or a double-stranded chimeric NA molecule whose specific gene expression repression ability is at or above a predetermined level, A method for selecting RNA molecules, chimeric NA molecules, double-stranded RNA molecules, or double-stranded chimeric NA molecules, including [the specified element].