Optimized protein linker and method of use
A novel linker sequence and domain architecture for Cas12a-based adenine base editors enhance editing efficiency, enabling targeted adenine base editing in various genomes, including crop genomes.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- PAIRWISE PLANTS SERVICES INC
- Filing Date
- 2026-02-27
- Publication Date
- 2026-06-30
AI Technical Summary
Existing CRISPR-based adenine base editors using Cas12a have not been optimized for efficient adenine base editing, as the linker sequence and domain architecture are not ideal for this application.
A novel linker sequence and domain architecture are designed for a Cas12a-based adenine base editor, optimizing the fusion protein to efficiently edit adenine bases in nucleic acids.
The optimized Cas12a-based adenine base editor expands the repertoire of targeted and site-directed base editing tools, suitable for both prokaryotic and eukaryotic genomes, including editing in commercially relevant crops.
Smart Images

Figure 2026108651000001_ABST
Abstract
Description
[Technical Field]
[0001] Statement regarding the electronic file of the sequence listing Submitted in accordance with 37C.FR§1.821, Title 1499.50.WO_ST2 5.txt, with a size of 722,708 bytes, created on July 14, 2021, E The array listing in ASCII text format submitted via FS-Web, on paper copy Provided instead. This sequence listing is provided by reference in this specification for its disclosure. It shall form a section.
[0002] Declaration of priority This application is a U.S. patent application filed on July 21, 2020, in accordance with 35 U.S.C. §119(e). Claiming the interests of National Provisional Patent Application No. 63 / 054,449, the entire content of this application is cited. This shall constitute a part of this specification.
[0003] Field of the present invention This invention aims to optimize the activity of peptide linkers and the proteins contained therein. Fusion proteins containing linkers designed for this purpose, and methods for using them. The present invention further relates to a newly designed Cas12a-based adenine base editor. ru. [Background technology]
[0004] Over the past six years, CRISPR-based gene editing tools (especially Cas9-based) have been used. The tools have become increasingly widespread. Early tools included homologous recombination and non-homologous end joining, etc. Along with the double-strand break repair mechanism, Cas9 generates blunt-end double-strand breaks in DNA. It was dependent on its capabilities, but as a targeting tool for other covalently bound effector proteins A newer method has been developed that primarily uses a modified version of the nuclease. In particular, the first base editor based on Cas9 has been found to use Cas9 in the deaminase domain. Developed by linking (e.g., Gaudelli et al. Natu See re551:464-471(2017). The first cytosine base editor is R A rat APO that deaminates cytosine to uracil in both NA and DNA. The BEC1 domain (apolipoprotein B mRNA editing enzyme) was previously published as Using a linker based on the unstructured XTEN protein, the N-terminus of Cas9 Constructed by linking (Komor et al. Nature 533 (7 603):420-424(2016). Uracil DNA glycosylase inhibitor ( The UGI domain is ligated to the C-terminus of Cas9 to reduce base excision repair activity. Later versions of the Cas9 cytosine base editor (CBE) are flexible glycine and By adding biserine residues, the length of both linkers is doubled, and an additional UGI domain is added. Then, the UGI domain was removed, and the APOBEC1 domain was added, typically E. coli TadA, which targets tRNA but has evolved to target DNA (tRNA-targeting) By substituting with a different adenosine deaminase domain, the same architecture and Using a marker, an adenine base editor (ABE) was developed. The evolved TadA is Denine is deaminated to form inosine, which forms a base pair with cytosine during DNA replication. This leads to A→G or T→C editing. The latest version of ABE is codon optimization. With improved nuclear localization signaling, it has been optimized for use in human cells.
[0005] Cas12a, also known as Cpf1, is a more recently discovered CRISPR end Cas12a is a nuclease and is increasingly being used as a genome editing tool. For example, its size, nuclease activity, and how the nuclease binds to its guide RNA. In some directions, including the recognized protospacer adjacent motif (PAM), Ca It is different from s9. However, the success of adenine base editing using Cas12a has been demonstrated. It has not been done. Therefore, in order to overcome the shortcomings of this technology, Cas12a is used. A new adenosine base editing tool is needed. [Overview of the project]
[0006] The most advanced CRISPR-based adenine base editor is GS-XTEN-G The N-terminus of Cas9 was fused to a TadA heterodimer that evolved via the S-linker. These Cas9-based ABEs efficiently edit DNA, but similar Ca It has not been found that merging to s12a successfully generates edits. The linker sequence has not yet been optimized based on the position of the deaminase domain. Based on the structural differences between Cas9 and Cas12a, useful for Cas9-based ABE The linker sequence and domain architecture are not ideal for Cas12a-based ABEs. There is a possibility that it does not exist. The inventors have designed a novel linker sequence based on Cas12a. The domain architecture of the adenine base editor was optimized, but this was due to a new site This enables an expansion of the repertoire of targeted and / or site-directed base editing tools, and / or may be suitable for commercial use. Further, the fusion protein of the present invention and / or A method of modifying nucleic acids using the polynucleotide encoding it is also provided. These editors can be used for applications to prokaryotes and / or eukaryotes, including editing of the genomes of commercially relevant crops.
[0007] One aspect of the present invention provides a polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 24 (L1 to L24). A polypeptide comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 24 is provided.
[0008] A second aspect of the present invention provides a polypeptide comprising a Cas12a domain and any one of the amino acid sequences of SEQ ID NOs: 1 to 24. A polypeptide comprising a Cas12a domain and any one of the amino acid sequences of SEQ ID NOs: 1 to 24 is provided.
[0009] A third aspect provides a fusion protein comprising a Cas12a domain, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1 to 24. A fusion protein comprising a Cas12a domain, a polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1 to 24 is provided.
[0010] A fourth aspect is a fusion protein comprising (a) a Cas12a domain, a linker comprising any one of the amino acid sequences of SEQ ID NOs: 1 to 24, and a polypeptide of interest, wherein the Cas12a domain is linked to the polypeptide of interest via any one of the amino acid sequences of SEQ ID NOs: 1 to 24, or a nucleic acid encoding the fusion protein, and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA, gRNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid can form a complex with the Cas12a domain of the fusion protein, and the spacer sequence can hybridize to a target nucleic acid, thereby cross-linking the fusion protein, or a nucleic acid encoding the fusion protein, and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA, gRNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid can form a complex with the Cas12a domain of the fusion protein, and the spacer sequence can hybridize to a target nucleic acid, thereby and (b) a guide nucleic acid (CRISPR RNA, CRISPR DNA, crRNA, crDNA, gRNA) comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid can form a complex with the Cas12a domain of the fusion protein, and the spacer sequence can hybridize to a target nucleic acid, thereby the guide nucleic acid can form a complex with the Cas12a domain of the fusion protein, and the spacer sequence can hybridize to a target nucleic acid, thereby The Cas12a domain and the polypeptide of interest are guided to the target nucleic acid. The system contains a guide nucleic acid that allows the system to modify or regulate the target nucleic acid, and is a type V C lustered Regularly Interspaced Short Pal Indromic Repeats (CRISPR) Related (Cas) (CRISPR-C (as) Provide the system.
[0011] A fifth aspect of the present invention is (a) a field together with a bound guide nucleic acid (e.g., gRNA). In this case, the Cas12a domain specifically binds to the target nucleic acid sequence. (b) First adenine deaminase domain, (c) Second adenine deaminase domain It contains the first and second adenine deaminase domains, and the Cas12a domain and adenosine bases in the single-stranded portion of the target nucleic acid sequence when present with the gRNA Deamination is performed, and the Cas12a domain is any of the amino acid sequences of SEQ ID NOs: 1 to 24 via one of the first adenine deaminase domains or the second adenine deaminase domain It provides a fusion protein linked to a minase domain.
[0012] The sixth aspect is (a) a first adenine deaminase domain, (b) a second adenine Cas12a(C) containing mutations in the aminase domain and (c) nuclease active site. The second adenine deaminase domain includes the pf1) domain, and the first adenine Unlike the adenine deaminase domain, the C-terminus of the first adenine deaminase domain is The second deaminase domain is ligated to the N-terminus of the Cas12a domain. The end is connected to the second via one of the amino acid sequences of sequence numbers 1-10 (L1-10). This provides a fusion protein linked to the C-terminus of the adenine deaminase domain.
[0013] The seventh aspect is (a) Cas12a(Cpf1) domain, (b) first adeninedea (c) comprising a minase domain and a second adenine deaminase domain, the second Unlike the first adenine deaminase domain, the adenine deaminase domain of this domain The C-terminus of the first adenine deaminase domain is the C-terminus of the second deaminase domain The N-terminus is ligated, and the C-terminus of the Cas12a domain is the first adenine deaminar The first deaminase domain is linked to the N-terminus of the zedomain, and the first deaminase domain is wild-type adenine If it is an andeaminase domain, the Cas12a domain is sequence numbers 11-24 ( The first adenine deaminase via any one of the amino acid sequences L11-24) It is ligated to the N-terminus of the domain, and the first deaminase domain has mutated / evolved If it is an adenine deaminase domain, the Cas12a domain is sequence number 11~ The first adenine deami via any one of the amino acid sequences of 15 (L11~15) It provides a fusion protein that is ligated to the N-terminus of the enzyme domain.
[0014] An eighth aspect of the present invention is a target nucleic acid (a)(i) fusion protein of the present invention and (a) (ii) guide nucleic acid, (b) complex comprising the fusion protein and guide nucleic acid of the present invention, c) A composition comprising the fusion protein and guide nucleic acid of the present invention, and / or (d) the present invention A method for modifying a target nucleic acid, comprising modifying the target nucleic acid by contacting it with the system of the invention. To provide.
[0015] A ninth aspect of the present invention relates to a cell or cell-free system containing a target nucleic acid (a)(i) the present invention Polynucleotides or components that encode a polypeptide or fusion protein Expression cassette or vector, and (a)(ii) guide nucleic acid or expression containing the same. (b) a current cassette or vector, and / or (b) a composite comprising the fusion protein of the present invention Nucleic acid constructs and / or expression cassettes containing them that encode fusion and guide nucleic acids. Alternatively, under conditions where a vector and a fusion protein are expressed and form a complex with a guide nucleic acid. , including contacting the complex so that it hybridizes with the target nucleic acid, thereby This invention provides a method for modifying target nucleic acids, which involves modifying an existing nucleic acid.
[0016] A tenth aspect of the present invention is a fusion protein of the present invention and (a (ii) guide nucleic acid, (b) complex comprising the fusion protein and guide nucleic acid of the present invention, (c)(i) A composition comprising the fusion protein of the present invention and (c)(ii) a guide nucleic acid, (d)(i) including bringing the adenine The aminase domain converts adenosine (A) in the target nucleic acid to guanine (G), and This invention proposes a method for editing target nucleic acids, thereby editing the target nucleic acid to induce (point) mutations. To provide.
[0017] An eleventh aspect of the present invention relates to a cell or cell-free system containing a target nucleic acid (a)(i) Polynucleotides encoding the fusion protein of the invention or expression cassettes containing the same (a)(ii) a vector, and (ii) a guide nucleic acid or an expression cassette containing the same. Vectors, and / or (b) complexes and guide nuclei comprising the fusion protein of the present invention. Acid-encoding nucleic acid constructs and / or expression cassettes or vectors containing them, The fusion protein is expressed and brought into contact with the guide nucleic acid under conditions that allow it to form a complex. The complex contains, and the complex hybridizes with the target nucleic acid, and the adenine deaminase molecule The substance converts adenosine (A) in the target nucleic acid to guanine (G), thereby targeting the target This invention provides a method for editing target nucleic acids to produce (point) mutations by editing the nucleic acid.
[0018] The present invention further comprises constructs comprising polypeptides and / or fusion proteins of the present invention. Complexes, compositions, expression cassettes, vectors and cells, and / or fusion vectors of the present invention The present invention provides polynucleotides and nucleic acid constructs that encode proteins and complexes.
[0019] These and other aspects of the present invention are described in more detail in the following description of the invention. . [Sequence Listing Free Text]
[0020] Sequence IDs 1-24 are amino acid sequences of the present invention that are useful for linking polypeptides. . Sequence IDs 25-29 are exemplary peptide linkers useful for linking polypeptides. This is the amino acid sequence. Sequence IDs 30-46 are example Cas12a amino acid sequences useful in the present invention. Sequence IDs 47-48 and 79-82 are examples of TadA amino acids useful in the present invention. It is an array. Sequence IDs 49-77 and 90-96 are exemplary fusion proteins. Sequence numbers 83-89 are examples of spacer sequences. [Brief explanation of the drawing]
[0021] [Figure 1] Figures 1A–C provide exemplary domain configurations of the Cas12a-based adenine base editor of the present invention selected for screening. Ten linker designs were selected with TadA heterodimers fused to the N-terminus of Cpf1 (Figure 1A), and 14 were selected with TadA heterodimers fused to the C-terminus of Cpf1 (Figure 1B). Furthermore, five of the 14 C-terminal linkers (Cterm_1, Cterm_4, Cterm_5, C9R, and Cterm_10) were selected with the order of the TadA and TadA* domains reversed (Figure 1C). "GS-" indicates a GS linker, including, for example, GS-XTEN-GS. [Figure 2] Figure 2 shows the average LbCas12a nuclease activity observed in each of the three exemplary spacers in the same experiment. [Figure 3] Figure 3 is a graph showing the editing frequency of the fusion protein of the present invention having DMNT1 spacer 1. [Figure 4] Figure 4 is a graph of the editing frequency of the fusion protein of the present invention having a DMNT1 spacer 2. [Figure 5] Figure 5 is a graph showing the editing frequency of the fusion protein of the present invention having the DMNT1 spacer 3. [Figure 6] Figure 6 shows the average LbCas12a nuclease activity observed in each of the four exemplary spacers: RNF2 spacer 1, RNF2 spacer 2, RNF2 spacer 3, and RNF2 spacer 4. [Figure 7] Figure 7 is a graph showing the average adenine-to-guanine editing frequency observed in the fusion protein of the present invention having RNF2 spacer 1. [Figure 8] Figure 8 is a graph showing the average adenine-to-guanine editing frequency observed in the fusion protein of the present invention having RNF2 spacer 2. [Figure 9]Figure 9 is a graph showing the average adenine-to-guanine editing frequency observed in the fusion protein of the present invention having the RNF2 spacer 3. [Figure 10] Figure 10 is a graph showing the average adenine-to-guanine editing frequency observed in the fusion protein of the present invention having an RNF2 spacer 4. [Modes for carrying out the invention]
[0022] Next, the present invention will be described below with reference to the attached drawings and examples illustrating embodiments of the present invention. This description also serves as a detailed catalog of all possible ways in which the present invention can be carried out. It is not intended that these are all features that may be added to the present invention. For example, relating to one embodiment The features described in detail may be incorporated into other embodiments, and in a particular embodiment Features specifically described in terms of form may be omitted from the embodiment. Therefore, In some embodiments of the present invention, any features or characteristics shown herein are not applicable. It is intended that combinations of symbols may be excluded or omitted. Also, in this specification Numerous modifications and additions to the various embodiments suggested herein, which do not depart from the present invention, In consideration of this disclosure, it will be obvious to those skilled in the art. Therefore, the following description is based on the present invention. It is intended to show some specific embodiments of the arrays, their combinations and It is not intended to exhaustively specify all possible transformations.
[0023] Unless otherwise defined, all technical and scientific terms used herein are defined in this Specification. This specification has the same meaning as that generally understood by those skilled in the art to which the invention belongs. The technical terms used in the description of this invention are intended to explain only specific embodiments. Yes, and this is not intended to be a limitation of the present invention.
[0024] All publications, patent applications, patents, and other references cited herein are those indicated by the references. Regarding the instruction relating to the sentences and / or paragraphs being cited, the entirety of them shall be cited. This shall thereby form part of this specification.
[0025] Unless otherwise indicated by the context, the various features of the present invention described herein are not limited to any It is specifically intended that they be used in combination. Furthermore, the present invention is also In some embodiments, any feature or combination of features shown herein is excluded. It is intended that it can be removed or omitted. The composition consists of components A, B, and To indicate whether the specification states that C is included, either A, B, or C, The ability to omit and abandon those combinations individually or in any combination It is specifically intended.
[0026] The singular forms "a" and "an" used in the description of this invention and the attached claims, And "the" also includes the plural form unless the context clearly indicates otherwise. It is illustrated.
[0027] Furthermore, as used herein, "and / or" refers to one of the related items described. Or any multiple possible combinations, and if interpreted alternatively ("Also") It refers to and encompasses the absence of the combination of "ha" () ( ).
[0028] The term "when referring to measurable values, such as quantity or concentration, as used herein" "Approximately" means a variation of ±10%, ±5%, ±1%, ±0.5%, or ±0.1% of the specified value. It is intended to encompass both movement and a specified value. For example, if X is a measurable value. In this case, "approximately X" means X, as well as ±10%, ±5%, ±1%, ±0.5%, or ± This is intended to include variations of 0.1%. The range of measurable values provided herein is limited. The range may include any other range and / or individual values within it.
[0029] The phrases "between X and Y" and "approximately between X and Y" used in this specification are: It should be interpreted as including X and Y. The term "about between X and Y" as used herein. Phrases like these mean "approximately between X and approximately Y," and phrases like "approximately X to Y" mean It means "approximately X to approximately Y".
[0030] The terms "comprise" and "comprises" as used herein include: , and "comprising") are explicitly stated features, integers, processes, operations, elements, and / or specifies the presence of a component, but one or more other features, integers, processes, It does not exclude the existence or addition of operations, elements, components, and / or groups thereof.
[0031] As used herein, the transitional phrase "essentially becomes from" means that the claims are essentially the claims The specified materials or processes listed in the scope, and the basic aspects of the claimed invention It should be interpreted that this includes things that do not materially affect the new characteristics. To taste. Therefore, the term "essentially derived from" as used in the claims of this invention. It is not intended to be interpreted as equivalent to "include".
[0032] The terms "to increase," "to increase," and "to be increased" as used in this specification, "to strengthen," "to be strengthened," "to strengthen," and "strengthening" (and the sentences Legal deformations are at least approximately 25%, 50%, 75%, 100%, and 15% compared to the control. Explain increases of 0%, 200%, 300%, 400%, 500%, or more.
[0033] The terms used in this specification are "to lower," "lowered," and "the act of lowering." "to lower," "to reduce," and "to decrease" (and their grammatical variations) For example, at least about 5%, 10%, 15%, 20%, 25%, 35% compared to the control. , 50%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or This explains a 100% reduction. In certain embodiments, the reduction is due to a detectable activity or It cannot produce a quantity, or does not produce one in nature (i.e., a quantity that is not significant, for example) (For example, about 10% or less than 5%).
[0034] "Hexagram" or "recombinant" nucleotide sequences are naturally related to the host cells into which they are introduced. It is a non-linked nucleotide sequence, and is a naturally occurring nucleotide sequence that does not exist in nature. Multiple copies can be cited.
[0035] "Natural" or "wild-type" nucleic acids, nucleotide sequences, polypeptides, or amino acids The sequence is a naturally occurring or endogenous nucleic acid, nucleotide sequence, polypeptide, This refers to the amino acid sequence. Therefore, for example, "wild-type mRNA" is naturally present in living organisms. It is either endogenous mRNA in the organism. "Homologous" nucleic acid sequences are those into which this is introduced. These are nucleotide sequences that are naturally associated with host cells.
[0036] The terms "nucleic acid," "nucleic acid molecule," "nucleotide sequence," and used herein refer to the following: "Polynucleotides" are either linear or branched, single-stranded or double-stranded. It refers to RNA or DNA, which are strands or hybrids thereof. Furthermore, the term also means: It includes RNA / DNA hybrids. Also, when dsRNA is synthesized, Less common bases, such as inosine, 5-methylcytosine, 6-methyladenine, Hypoxanthine and others are used for antisense, dsRNA, and ribozyme pair formation. This is possible. For example, poly containing C-5 propine analogs of uridine and cytidine. Nucleotides bind to RNA with high affinity and are a strong antagonist of gene expression. It has been shown to be a sense inhibitor. Also, other modifications, such as phosphodiesters, have been shown. It is possible to modify the tel skeleton or the 2'-hydroxyl group within the ribose sugar group of RNA. ru.
[0037] As used herein, the term "nucleotide sequence" refers to the sequence from the 5' end to the 3' end of a nucleic acid molecule. cDNA refers to a heteropolymer or sequence of nucleotides extending to the end. DNA fragment or portion, genomic DNA, synthetic (e.g., chemically synthesized) DNA, p Rasmid DNA, mRNA, and antisense RNA (all single-stranded or double-stranded) Possible candidates include DNA molecules or RNA molecules. Also, the term "nuclear "Rheotide sequence", "nucleic acid", "nucleic acid molecule", "oligonucleotide", and "polynucleotide" In this specification, "rheotide" is used interchangeably to refer to a heteropolymer of nucleotides. The nucleic acid molecules and / or nucleotide sequences provided herein are used in this specification. The orientation is shown from left to right, 5' to 3', and according to US sequencing rules, 37 CFR §§1 As shown in .821-1.825 and World Intellectual Property Organization (WIPO) standard ST.25 Represented using standard codes to indicate nucleotide properties. The "5' region" refers to the region of a polynucleotide that is closest to the 5' end. It is possible. Therefore, for example, an element within the 5' region of a polynucleotide can be... From the first nucleotide positioned at the 5' end, to the middle of the polynucleotide It can be positioned anywhere up to the nucleotide used herein. The "3' region" refers to the region of a polynucleotide that is closest to the 3' end of the polynucleotide. It is possible. Therefore, for example, an element within the 3' region of a polynucleotide can be... From the first nucleotide positioned at the 3' end, to the position in the middle of the polynucleotide It can be positioned anywhere up to the nucleotide.
[0038] As used herein, the term "gene" refers to mRNA, antisense RNA, and miRN. A, and anti-microRNA antisense oligodeoxyribonucleotides (AMOs), etc. A gene refers to a nucleic acid molecule that can be used to produce a functional protein or genetic material. Genes can sometimes be used to produce genetic products, and sometimes they cannot. This includes the code domain and the non-code domain (e.g., introns, modulators, promoters, etc.). This may include both the nucleotide, termination sequence, and / or the 5' and 3' untranslated regions. Yes, it is possible. Genes may be "isolated," which means they are not associated with nucleic acids in their natural state. The intended nucleic acids are those that are substantially or essentially free from their commonly found components. Components such as other cellular material, culture media derived from recombinant products, and / or nucleic acids. Various chemical substances are used to chemically synthesize it.
[0039] The term "mutation" refers to point mutations (for example, missense, or nonsense, or frame mutation). Insertion or deletion of a single base pair resulting in a transient, insertion, deletion, and / or transient This refers to a mutation. A mutation is the substitution of a residue in an amino acid sequence with another residue, or a change in the sequence. If the mutation involves the deletion or insertion of one or more residues, the mutation is typically a result of the original residues. By identifying the position of residues in the sequence following the base, and by identifying the newly substituted residues, It is explained by defining it.
[0040] As used herein, the terms “complementary” or “complementarity” refer to acceptable salt and temperature This refers to the natural bonding of polynucleotides through base pairing under specific conditions. For example, the sequence "A -GT (5' to 3') binds to the complementary sequence TCA (3' to 5'). The complementarity between two single-stranded molecules is "partial," meaning that only a portion of the nucleotides are bonded together. It may be so, or it may be perfect if total complementarity exists between single-strand molecules. The degree of complementarity is significant to the efficiency and strength of hybridization between nucleic acid strands. It has an impact.
[0041] As used herein, "complementary" refers to a 100% complementary relationship with the comparator nucleotide sequence. It can mean complementarity, or complementarity less than 100% (for example, about 70%, 71%, 72%, 7%). 3%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 8 3%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 9 This also means complementarity such as 3%, 94%, 95%, 96%, 97%, 98%, and 99%. obtain.
[0042] A "part" or "fragment" of the nucleotide sequence of the present invention is a reference nucleic acid or nucleotide Compared to an array, the length is reduced (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or (The number of nucleotides exceeding the limit is reduced), and it is identical to the reference nucleic acid or nucleotide sequence. or nearly identical (for example, 70%, 71%, 72%, 73%, 74%, 75%, 7 6%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 8 6%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 9 Contains nucleotide sequences of consecutive nucleotides (6%, 97%, 98%, 99% identical). This means the nucleotide sequence that will become and / or will become essentially. It is understood. Such nucleic acid fragments or portions according to the present invention, where appropriate, constitute The component may be contained within a larger polynucleotide. For example, the present invention The repeat sequence of the id nucleic acid may include a portion of the wild-type Cas12a repeat sequence.
[0043] The terms "fragment" or "part" as used herein with respect to polypeptides refer to the references provided. Compared to lipeptides, the length is reduced and it is identical to the corresponding portion of the reference polypeptide. or nearly identical (for example, 90%, 91%, 92%, 93%, 94%, 95%, 9) (6%, 97%, 98%, 99% identical) Containing a sequence of consecutive amino acids, This can refer to polypeptides that are essentially and / or will be polypeptides. The cytoplasmic fragment, when appropriate, is included in the larger polypeptide in which it is a component. Alternatively, in some embodiments, the polypeptide fragment may be at least of the reference polypeptide. Approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25 , 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 260, 270, 2 Containing 80, 290, or more consecutive amino acid residues, or essentially derived from them It becomes, or consists of, these things.
[0044] Different nucleic acids or proteins that have homology are referred to as "homologues" in this specification. The term "homogenetic sequence" refers to homologous sequences originating from the same species and other species, as well as homologous sequences originating from the same species and other species. Includes orthologous sequences from other species. "Homologousness" refers to positional identity (e.g., sequence similarity). The percentage of identity between two or more nucleic acids and / or amino acid sequences. This refers to the level of similarity. Homology, on the other hand, refers to the similarity of functions between different nucleic acids or proteins. This refers to the concept of properties. Therefore, the compositions and methods of the present invention further include the nucleotides of the present invention. Includes homologs to sequences and polypeptide sequences. The term "orthologism" as used herein refers to homologs to sequences and polypeptide sequences. "G" refers to homologous nucleotide sequences in different species that arose from a common ancestral gene during speciation. and / or amino acid sequences. Homogenetics of the nucleotide sequences of the present invention are prior to the present invention. Substantial sequence identity with respect to the nucleotide sequence (e.g., at least about 70%, 71%) 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81% 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, ma It has 100%.
[0045] As used herein, “sequence identity” refers to two optimally aligned polynucleotides. A sequence of nucleotides or polypeptides is a combination of its constituent elements, such as nucleotides or amino acids. It refers to a degree of constancy throughout the entire window of the inment. "Identity" is Comp utational Molecular Biology(Lesk, AM, ed. .)Oxford University Press, New York(1988) , Biocomputing:Informatics and Genome Pro jects(Smith,DW,ed.)Academic Press,New York (1993), Computer Analysis of Sequence Data, Part I (Griffin, AM, and Griffin, H. G., eds.) Humana Press, New Jersey (1994), Se Quence Analysis in Molecular Biology(von Heinje, G., ed.) Academic Press (1987), and S sequence Analysis Primer (Gribskov, M. and D evereux, J., eds.) Stockton Press, New York ( Examples include, but are not limited to, those described in 1991, other known methods. Therefore, it can be easily calculated.
[0046] As used herein, the terms “sequence identity percentage” or “identity percentage” are: The test ("subject") compared the polynucleotide molecule (or its complementary chain) to the reference ("c") "Eri" within the linear polynucleotide sequence of a polynucleotide molecule (or its complementary chain) This refers to the percentage of identical nucleotides when two sequences are optimally aligned. In some embodiments, "identity percentage" is the percentage of the reference polypeptide compared to the ami. This can refer to the percentage of identical amino acids within a no-acid sequence.
[0047] The phrases, two nucleic acid molecules, nucleotide sequences, or proteins used herein In the context of sequence comparisons, "substantially identical" or "substantial identity" refers to the following sequence comparisons. The maximum correspondence is compared using one of the algorithms or by visual inspection. Furthermore, the nucleotide or amino acid residue identity when aligned is at least approximately 70%. 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80% 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90% 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%. Refers to two or more sequences or subsequences that constitute 5% or 100%. Partial embodiment of the present invention In terms of morphology, substantial identity is approximately 10 to 30 nucleotides, and approximately 15 nucleotides. Rheotide ~ approximately 25 nucleotides, approximately 30 nucleotides ~ approximately 40 nucleotides, approximately 50 nucleotides Rheotide ~ approximately 60 nucleotides, approximately 70 nucleotides ~ approximately 80 nucleotides, approximately 90 nucleotides Rheotides ~ nucleotides with a length of approximately 100 nucleotides or more, and those The present invention provides a continuous nucleotide sequence that spans the entire range, up to the full length of the sequence. It is present throughout the region of the ocide. In some embodiments, the nucleotide sequence is small At most about 20 nucleotides (for example, about 20, 21, 22, 23, 24, 25, 26, 2) 7, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 They may be substantially identical across nucleotides. In some embodiments, substantially A nucleotide or protein sequence that is identical to a nucleotide that is substantially identical It performs essentially the same function as (or the encoded protein sequence).
[0048] In sequence comparison, typically, one sequence functions as the reference sequence compared to the test sequence. When using a sequence comparison algorithm, the test sequence and reference sequence are input into the computer. If necessary, sub-array coordinates are specified, and the array algorithm program parameters are... The data is specified. Next, the array comparison algorithm is specified by the program parameters Based on this, the sequence identity percentage for the test sequence compared to the reference sequence is calculated.
[0049] The optimal alignment of the array for aligning the comparison window is well known to those skilled in the art. Yes, there are tools, such as Smith and Waterman's local homology algorithm. The homology alignment algorithm of Zum, Needleman, and Wunsch , by Pearson and Lipman's similarity search method, and in some cases This involves computer implementation of these algorithms, for example, GCG(registered trademark) Wi sconsin Package (registered trademark) (Accelrys Inc., San GAP, BESTFIT, FASTA, and more are available as part of Diego, CA. This may be done by TFASTA. Aligned segments of the test sequence and reference sequence The "identity fraction" for a ment is the total number of components within the reference array segment, for example, The entire reference array, or two alignments obtained by dividing the reference array into two smaller parts defined by the reference array. This is the number of identical components shared by the sequence. Sequence identity percentage is 10 It is expressed as an identity fraction multiplied by 0. Comparison of one or more polynucleotide sequences. This refers to a full-length polynucleotide sequence, a portion thereof, or a longer polynucleotide sequence. It may also be used for the purposes of this invention. Furthermore, for the purposes of this invention, "identity percentage" is translated as Regarding nucleotide sequences, BLASTX version 2.0 and polynucleotide sequences This can also be determined using BLASTN version 2.0.
[0050] Furthermore, the two nucleotide sequences are such that the two sequences are such that they are such that they do not interact with each other under stringent conditions. When hybridizing, it can be considered substantially complementary. Representative Embodiments In this context, two nucleotide sequences that are considered substantially complementary are highly str They hybridize with each other under undesirable conditions.
[0051] Nucleic acid hybridization such as Southern hybridization and Northern hybridization "Stringent hybridization conditions" in the context of redylation experiments Furthermore, the "stringent hybridization washing conditions" are sequence-dependent and vary. It differs under various environmental parameters. A wide range of guidance on nucleic acid hybridization. Tijssen Laboratory Techniques in Bioc hemistry and Molecular Biology-Hybridiza tion with Nucleic Acid Probes part I cha pter2“Overview of principles of hybridiz ation and the strategy of nucleic acid p In "Robe Assays," Elsevier, New York (1993), It is released. Typically, highly stringent hybridization and washing conditions are used. The thermal melting point (T) for a specific arrangement at defined ionic strength and pH. m ) is about 5℃ lower Selected in a way that makes it easier.
[0052] T m This means that 50% of the target sequence hybridizes to a perfectly matching probe (definition). This refers to the temperature (under the given ionic strength and pH). T for a specific probe. m Equal to To achieve this, very stringent conditions are selected. Southern blot or Northern blot In the blotting, complementary nuclei with more than 100 complementary residues on the filter Stringent hybridization conditions for Otid sequence hybridization As an example, hybridization is performed overnight at 42°C with 1 mg heparin. It contains 50% formamide. As an example of highly stringent washing conditions, at 72°C There is 0.15M NaCl for approximately 15 minutes. As an example of stringent washing conditions, 6 There is a 15-minute 0.2×SSC wash at 5°C (see below for an explanation of SSC buffer). (See Sambrook). Often, high stringency washing is used in the background. To remove the probe signal, it is done after low stringency washing. For example, 10 As an example of moderate stringency washing for double hemispheres of nucleotides greater than 0 There is a 1×SSC at 45℃ for 15 minutes. For example, a double helix of more than 100 nucleotides. As an example of low stringency washing, 4-6 × SSC at 40°C for 15 minutes There is a stringent for short probes (e.g., about 10-50 nucleotides). The conditions are typically a salt concentration of less than approximately 1.0 M Na ions, and a pH of 7.0-8. 3 contains approximately 0.01-1.0 M Na ion concentrations (or other salts), and the temperature is typical. Specifically, the temperature is at least approximately 30°C. Furthermore, stringent conditions include the absence of formamide, etc. This can be achieved by adding stabilizers. Generally, certain hybridization 2× (or higher) than observed for unrelated probes in the assay. The signal-to-noise ratio indicates the detection of specific hybridization. Under stringent conditions. Nucleotide sequences that do not hybridize with each other are those that encode proteins that are substantially the same. If they are one, then they are essentially identical. This is, for example, a copy of a nucleotide sequence. - This can occur when using the maximum codon degeneracy allowed by the genetic code. .
[0053] Any nucleotide sequence, polynucleotide, and / or recombinant nucleic acid construction of the present invention The substance may be codon-optimized for expression in any organism of interest. Codon optimization is well known in this technology, and regarding codon usage frequency bias, species-specific This includes modifications of nucleotide sequences using codon frequency tables. Note: The codon frequency tables are... It is created by analyzing the sequence analysis of the most highly expressed genes in the target organism / species. When nucleotide sequences are expressed in the nucleus, the codon frequency table is used for the species of interest. It is created based on sequence analysis of highly expressed nuclear genes. Nucleotide sequence The modification involves a species-specific codon usage frequency table, which includes codons present in the natural polynucleotide sequence. Determined by comparison with n. Codon optimization of o-cido sequences results in less than 100% identity with respect to the natural nucleotide sequence. For example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, Having 99%, 99.5%, or 99.9%, or any range or value within those percentages. However, the nucleotides have the same function as those encoded by the original natural nucleotide sequence. This results in a nucleotide sequence that still encodes the nucleotide. Therefore, part of the invention is implemented. In terms of form, the present invention relates to polynucleotides, nucleic acid constructs, expression cassettes, and / or Vector (polypeptide, fusion protein, complex of the present invention, for example, Cas12a, note The polypeptide in question, adenine deaminase, and linker (containing / encoding) are of interest. For expression in specific species, such as specific plant species, specific bacterial species, specific animal species, etc. The codon-optimized version may also be used. In some embodiments, the codon-optimized version of the present invention is used. Polynucleotides, nucleic acid constructs, expression cassettes and / or vectors are codon-based. Unoptimized polynucleotides, nucleic acid constructs, expression cassettes and / or other products of the present invention This is approximately 70% to 99.9% of the vector, or more (for example, 70%, 7%). 1%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 8 1%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 9 1%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% They have 99.9% or 100% identity.
[0054] In any of the embodiments described herein, the polynucleotide of the present invention or Nucleic acid constructs are used for various purposes of expression within the cells of the organism of interest and / or within the cells of the organism of interest. It may be operably associated with promoters and other modulating elements. Therefore, in some embodiments Furthermore, an expression cassette or vector containing the polynucleotide or nucleic acid construct of the present invention. Furthermore, it comprises one or more polynucleotides or nucleic acid constructs operably linked to It may include one or more promoters, enhancers, and / or terminators. stomach.
[0055] As used herein, “operably connected” or “operably related” means “indicating The elements being considered are functionally related to each other and are usually also physically related. To taste. Therefore, the terms "operably connected" or "operably" as used herein "Related to" refers to a nucleotide sequence on a single nucleic acid molecule that is functionally related. Therefore, The first nucleotide sequence, which is operably linked to the second nucleotide sequence, This refers to a situation where the rheotide sequence is functionally related to and positioned in relation to the second nucleotide sequence. For example, a promoter is a promoter that transcribes or expresses the nucleotide sequence. If it brings about, it is operably related to the nucleotide sequence. Those skilled in the art will know that the controlled distribution Insofar as the sequence (e.g., promoter) functions to guide its expression, the control sequence is activatable. You will understand that the nucleotide sequence does not need to be consecutive with the related nucleotide sequence. Therefore, For example, an intervening sequence that is transcribed but not translated, and a promoter and a nucleotide sequence. It can exist between them, and the promoter is still "operably linked" to the nucleotide sequence. It can be considered that they are "connected."
[0056] In this specification, with respect to polypeptides, "concatenated" means that one of the polypeptides This refers to the attachment of one polypeptide to the other. A polypeptide attaches to another polypeptide (N-terminus or Even if they are directly linked (e.g., via a peptide bond) at the C-terminus, they can also be linked via a linker. It may be tied.
[0057] The term "linker" is recognized in the technology as referring to two molecules or parts, for example. For example, the Cas12a domain and the nucleic acid-editing domain (e.g., adenosine deaminase), etc. Linker refers to the bond, chemical group, or molecule that connects the two domains of a fusion protein. - may consist of a single linked molecule or may contain multiple linked molecules (for example, (amino acids). In some embodiments, the linker is an organic molecule, group, polymer, or chemical. It can be a chemical part. In some embodiments, the linker may be an amino acid, It may be a peptide linker. In some embodiments, the peptide linker is about 4 ~100, or more amino acid lengths, e.g., 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 , 25, 26, 27, 28, 29, 30, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 5 0, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63 ,64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 9 0, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, or more It can be an amino acid length. In some embodiments, the peptide linker is a GS linker. - May also be. In some embodiments, the linker is an amino acid sequence SGGS ( One or more of the following (sequence number 25), (GGS)n, or S(GGS)n(sequence number 26) It may include (repeating), where n is 1 to 20 (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 (and any range or value within it). In some embodiments, the linker It may also contain the amino acid sequence SGGSGGSGGS (SEQ ID NO: 27). Morphologically, the linker is an amino acid sequence also called the XTEN linker, SGSETP It may also contain GTSESATPES (SEQ ID NO: 28). In some embodiments, phosphorus The linker is an amino acid sequence called GS-XTEN-GS linker SGGSSGGSSG It may include SETPGTSESATPESSGGSSGGS (SEQ ID NO: 29). In some embodiments, the linker includes one of the amino acid sequences of SEQ ID NOs: 1 to 24. To become essentially from, or to consist of.
[0058] A "promoter" is a nucleotide sequence that is operably associated with the promoter (for example, nucleotide sequence A nucleotide sequence that controls or regulates the transcription of a nucleotide sequence (promoter). The coding sequences that are controlled or regulated encode polypeptides and / or functional RNAs. To obtain. Typically, the "promoter" contains the binding site for RNA polymerase II. It also refers to the nucleotide sequence that instructs the start of transcription. Generally, a promoter is a corresponding nucleotide sequence. It is found 5' to the side, or upstream, of the beginning of the chord region in the chord sequence. The ter region may also contain other elements that act as regulators of gene expression. ATA box consensus arrays and often CAAT box consensus arrays Including (Breathnach and Chambon, (1981) Annu.Rev (Biochem. 50:349). In plants, CAAT boxes are AGGA boxes. It may be replaced by (Messing et al., (1983) in Genetic Engineering of Plants,T.Kosuge, C. Meredith and A. Hollaender (eds.), Plenum Press, pp. 211-227).
[0059] Examples of promoters include recombinant nucleic acid molecules, such as "synthetic nucleic acid constructs" or "tannylcholine compounds." Constitutive, inducible, and temporally regulated developmental proteins used in the preparation of protein-RNA complexes. Chemically regulated, chemically regulated, tissue-preference and / or tissue-specific promoters These are some examples. These various types of promoters are known in the art. ru.
[0060] The choice of promoter may vary depending on the temporal and spatial requirements for expression. It may vary depending on the host cell to be transformed. The motor is well known in the art. Based on this knowledge, it is possible to select a promoter that is suitable for the specific host organism of interest. Therefore, for example, upstream of genes that are highly constitutively expressed in model organisms I am quite knowledgeable about motors, and such knowledge can be used with other systems as needed. It can be easily accessed and executed in [location].
[0061] In some embodiments, the polynucleotide and / or nucleic acid constructs of the present invention are: This may be an "expression cassette" or it may be contained within an expression cassette. The term "expression cassette" used in this document refers, for example, to the nucleic acid construct of the present invention (for example, the present invention). Recombination comprising a complex (e.g., encoding the fusion protein and guide nucleic acid of the present invention) This refers to a nucleic acid molecule, and a nucleic acid construct is at least one regulatory sequence (e.g., promoter). ) and operably related. Therefore, some embodiments of the present invention are, for example, nucleic acid structures of the present invention. We provide an expression cassette designed to express structures.
[0062] The expression cassette containing the nucleotide sequence of interest may be a chimeric one, and this is because At least one of the components is heterogeneous with respect to at least one of the other components. This means that (for example, the polynucleus of interest that will be expressed in the host organism) A promoter derived from the host organism, operably linked to a rheotide. Here, the focus is on the polynucleus. The creotide is of a different organism than the host, or is transmitted in association with the promoter. (Not usually found). Also, expression cassettes exist naturally, but recombinant ones useful for heterologous expression. It is also acceptable if it is obtained in a different form.
[0063] Expression cassettes, in some cases, are functional transcriptional and / or functional within selected host cells. Alternatively, it may include a translation stop region (i.e., a stop region) and / or an enhancer region. Various transcription terminators and / or enhancers are used in expression cassettes. It is available and is responsible for transcription termination and accurate mRNA polyadenylation. The region and / or enhancer region are connected to the operably linked nucleotide sequence of interest. It may be specific to the host cell, specific to the host cell, or derived from another source. For example, a promoter, a nucleotide sequence of interest, a host, or any combination thereof. (It is foreign to or different from the original species.)
[0064] Furthermore, the expression cassette of the present invention includes a nucleotide sequence encoding a selection marker. This can be done, and this can be used to select transformed host cells. The term "selection marker" used in this book refers to a host cell that, when expressed, expresses the marker. Since it gives a distinctive phenotype, such transformed cells have a marker. It refers to a nucleotide sequence that can be distinguished from cells that do not have it. The marker is determined by chemical means, for example, by using a selective agent (e.g., an antibiotic). Depending on whether the marker confers a trait that can be selected by doing so, or whether the marker is simply, Identification through observation or testing, for example, by screening (e.g., fluorescence). Depending on whether it is a trait that can be performed, a selection marker or a screening marker is coded. Many examples of suitable selection markers are known in the art and are described herein. It can be used in the expression cassette described.
[0065] In addition to expression cassettes, nucleic acid molecules / constructs and polynucleotides described herein are also included. The cytoplasmic sequence can be used in conjunction with a vector. The term "vector" refers to a sequence that enters a cell. A vector refers to a composition used to transmit, deliver, or introduce nucleic acids. - contains nucleic acid molecules containing nucleotide sequences that are transmitted, delivered, or introduced. The vectors used for transforming host organisms are well known in this technology. As an unrestricted example of a general class, although not limited to the following, even if self-contagious A linear or annular form of double or single strands, which may or may not be mobile. Viral vectors, plasmid vectors, phage vectors, phagemide vectors - Cosmid vectors, fosmid vectors, bacteriophages, artificial chromosomes, minis Examples include sclera or binary vectors of the genus Agrobacterium. In some embodiments, the viral vector is retro Viruses, lentiviruses, adenoviruses, adeno-associated viruses, or herpes simplex Viral vectors are one example. Vectors as defined herein are in the cell genome. Integration into or extrachromosomal presence (e.g., autonomous replicating plasmids with origins of replication) Either method can transform a prokaryotic or eukaryotic host. In addition, This includes organisms whose replication within two different host organisms is possible either naturally or by design. A shuttle vector is a DNA vehicle, and this is Actinomyces and related Related species, bacteria, and eukaryotes (e.g., higher-order plants, mammals, yeasts, or eukaryotes) (Can be selected from bacterial cells). In some embodiments, nucleic acids in the vector can be selected from host cells. It is under the control of a promoter or other regulatory element suitable for transcription within it, and is operable with it. It is linked to the function. The vector is a dual functional expression vector that functions in multiple hosts. This may also be the case. In the case of genomic DNA, this could be its own promoter or other It may contain regulatory elements, and in the case of cDNA, this affects its expression within the host cell. It may be under the control of a suitable promoter or other regulatory element. Therefore, the present invention Polynucleotides and nucleic acid constructs, and / or expression cassettes containing them, are described in this specification. The vectors described in the book, and those included in the vectors known in the art It's okay to be there.
[0066] The terms "to bring into contact," "making contact," and "in contact" as used herein, The grammatical variation is related to the desired reaction (e.g., transformation, transcriptional regulation, genome editing, etc.). The components of the king (and / or cut) are suitable conditions for carrying out the desired reaction. This refers to placing them together below. Therefore, for example, the fusion protein of the present invention on the target nucleic acid The target nucleic acid can be modified by contacting it with a guide nucleic acid. In terms of form, the target DNA is a polynucleotide or encoding the fusion protein of the present invention. The nucleic acid construct and guide nucleic acid are expressed, and the fusion protein forms a complex with the guide nucleic acid. Then, under conditions where the complex hybridizes to the target nucleic acid and modifies it, contact It can be made to happen.
[0067] As used herein, “modifying” or “modifying” with respect to target nucleic acids is edited (e.g., mutation), covalent modification, nucleic acid / nucleotide base exchange / substitution, deletion, cleavage, This includes hacking and / or transcriptional regulation of target nucleic acids.
[0068] The phrases "to introduce," "to introduce," and "to introduce" in the context of polynucleotides of interest. "reta" (and its grammatical variations) refers to the nucleotide sequence of interest (e.g., polynucleotides). Oxides, nucleic acid constructs, complexes (e.g., protein-RNA chimeric complexes), and / or A guide nucleic acid is introduced into a host organism or the cells of the organism (for example, a host cell). This means that the cytoplasmic sequence is presented in a way that allows it to gain access to the inside of the cell. Therefore, For example, the polynucleotide and guide nucleic acid encoding the fusion protein of the present invention are used It may be introduced into the cells of an object, thereby transforming the cells.
[0069] As used herein, the term "transformation" refers to the introduction of a different nucleic acid into a cell. The transformation may be stable or transient. Therefore, in some embodiments In this case, the host cell or host organism is stably transformed with the nucleic acid molecule of the present invention. In this embodiment, a host cell or host organism is temporarily transformed by the recombinant nucleic acid molecule of the present invention. It will be replaced.
[0070] In the context of polynucleotides, "transient transformation" refers to the process by which polynucleotides are present in cells. This means that it is introduced but not integrated into the cell's genome.
[0071] In the context of polynucleotides introduced into cells, "stable introduction" and The phrase "stable introduction" implies that the introduced polynucleotides are finely divided. Because it is stably incorporated into the cell's genome, the cell is stable with polynucleotides. It has been transformed.
[0072] As used herein, "stable transformation" or "stablely transformed" means This means that nucleic acid molecules are introduced into cells and incorporated into the cell's genome. The incorporated nucleic acid molecules, through subsequent generations, more specifically, through multiple consecutive generations... It can be inherited by subsequent generations. In this specification, "genome" refers to the nuclear genome. And because it includes the plastid genome, for example, into the chloroplast genome or mitochondrial genome This includes the incorporation of nucleic acids. Furthermore, the stable transformations used herein include, for example, micro-staining. This can refer to a transgene maintained outside the chromosome as a chromosome or plasmid.
[0073] Transient transformation can be performed, for example, by enzyme-linked immunosorbent assay (ELISA) or Western blotting. These can be detected by blotting, and they are one or more transgenes introduced into an organism. The presence of peptides or polypeptides encoded by the child can be detected. Stable cell transformation is, for example, Southern blot of the cell's genomic DNA with nucleic acid sequences. This can be detected by an ebridization assay, which can be used to detect organisms (e.g., plants). ) It specifically hybridizes with the nucleotide sequence of the transgene introduced into it. Stable cell transformation is achieved, for example, by Northern blotting of the cell's RNA with nucleic acid sequences. It can be detected by hybridization assays, which introduces into the host organism. It specifically hybridizes with the nucleotide sequence of the introduced gene. Furthermore, it contributes to the stability of the cell. The defined transformation is, for example, a polymerase chain reaction (PCR) well known in this technology. This can be detected by other amplification reactions, which involve hybridization with the target sequence of the transgene. Using a specific primer sequence for soybeans, amplification of the transgene sequence occurs, and this It can be detected according to standard methods. Furthermore, transformation is a direct method well known in the art. Detection by tangent sequencing and / or hybridization protocols. It is possible.
[0074] Therefore, in some embodiments, the nucleotide sequence, nucleic acid construct, and The expression cassette may be transiently expressed and / or stable within the genome of the host organism. It can be incorporated in a fixed manner. Therefore, in some embodiments, the fusion protein of the present invention The polynucleotide that codes for it is introduced into the cell along with the guide nucleic acid, so DN A cannot be maintained within the cell.
[0075] The nucleic acid constructs / polynucleotides of the present invention can be obtained by any method known to those skilled in the art. and can be introduced into cells. In some embodiments of the present invention, cell transformation is performed on the nucleus This includes qualitative transformation. In other embodiments, the cell transformation is plastid transformation (e.g., chloroplast transformation). (including somatic transformation). In further embodiments, nucleic acid constructs / polynucleotides of the present invention. It can be introduced into cells through conventional breeding techniques.
[0076] Procedures for transforming both eukaryotes and prokaryotes are well known in this art. Furthermore, it is routine and described throughout the literature (e.g., Jiang et al.). al.2013.Nat.Biotechnol.31:233-239, Ran et al. al.Nature Protocols8:2281-2308(2013)) .
[0077] Therefore, the nucleotide sequence is obtained by several methods well known in the art. The present invention can be introduced into a host organism or its cells. The present invention comprises one or more methods. The nucleotide sequence is introduced into an organism, but accesses the inside of at least one cell of the organism. It does not depend on a specific method of introduction. When multiple nucleotide sequences are introduced, These can be assembled as part of a single nucleic acid construct or as separate nucleic acid constructs. It is possible to position them on the same or different nucleic acid constructs. Therefore, the nucleotide sequence can be determined by a single transformation event or by separate transformations. In the exchange event, it can be introduced into the cells of interest, or in other relevant cases. Nucleotide sequences can be incorporated into plants, for example, as part of a breeding protocol. can.
[0078] The present invention can be used, for example, to link two or more protein / protein domains. This applies to polypeptides that can be used (e.g., SEQ ID NOs: 1-24). In some embodiments... The polypeptide of the present invention has one of the amino acid sequences of SEQ ID NOs: 1 to 24 They can be approximately 70% to 100% identical (for example, 70%, 71%, 72%, 73%, 74%). %, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84 %, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94% (Same as %) %, 95%, 96%, 97%, 98%, 99%, 99.5%, or 100%. In one embodiment of the present invention, the present invention uses one of the amino acid sequences of SEQ ID NOs: 1 to 24 A polynucleotide and / or any one of the amino acid sequences of SEQ ID NOs. 1-24 For polynucleotides encoding one component, 70% to 100% (for example, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% or Provides polynucleotides having 100% identity. In some embodiments, A polynucleotide that codes for any one of the amino acid sequences from sequence number 1 to 24 is found in living organisms. It may be codon-optimized for expression in that context.
[0079] The present invention also covers synthetic fusion proteins containing these polypeptides. In terms of form, the present invention involves one of the amino acid sequences of SEQ ID NOs: 1 to 24 and a point of interest. Provided is a polypeptide comprising a lipopeptide. In some embodiments, the polypeptide of interest may be linked, optionally at its C-terminus and / or its N-terminus, to any one of the amino acid sequences of SEQ ID NOs: 1-24, optionally at the C-terminus or N-terminus. In some embodiments, the polypeptide of interest may comprise two or more polypeptides of interest (e.g., 2, 3, 4, 5, 6, 7 or more), which may be the same or different, where at least two of the two or more polypeptides of interest may be linked to each other via any one of the amino acid sequences of SEQ ID NOs: 1-24. The polypeptide of interest useful in the present invention may comprise a polypeptide or protein domain having deaminase (deamination) activity (e.g., cytosine deaminase, adenine deaminase), nickase activity, recombinase activity, transposase activity, methylase activity, glycosylase (DNA glycosylase) activity, glycosylase inhibitory activity (e.g., uracil-DNA glycosylase inhibitor (UGI)), demethylase activity, transcriptional activation activity, transcriptional repression activity, transcriptional derepression factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity, DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, dephosphorylation activity, oxidation activity, pyrimidine dimer formation activity, integrase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and / or photolyase activity, but this is not limiting.
[0080] It is not limited to these. In some embodiments, the polypeptide of interest is adenine de aminase, cytosine deaminase, Fok1 nuclease, or uracil-DNA gly cosylase inhibitor. In some embodiments, the polynucleotide of interest is may be codon-optimized for expression in an organism.
[0081] In some embodiments, the polypeptide of interest is the CRISPR Cas12a poly peptide or the Cas12a domain, and Cas12a is the C-terminus or N-terminus of any one of the amino acid sequences of SEQ ID NOs: 1-24, and is linked at its C-terminus and / or N-terminus thereby.
[0082] In some embodiments, a fusion protein is provided that includes Cas12a, the polypeptide of interest, and any one of the amino acid sequences of SEQ ID NOs: 1-24. In some embodiments the amino acid sequences of SEQ ID NOs: 1-24 allow for an optimal arrangement relative to the Cas12a domain of Cas12a and one or more (e.g., 1, 2, 3, 4, 5, 6, 7 or more) polypeptides of interest (e.g., adenine deaminase domain, e.g., TadA / TadA ). The amino acid sequences of SEQ ID NOs: 1-24 may be used to link Cas12a and the polypeptide of interest so as to allow access to the single-stranded portion of the non-target strand, for example for nucleic acid modification, e.g * for base editing. In some embodiments, when used to link Cas12a to the polypeptide of interest, the amino acid sequences of SEQ ID NOs: 1-24 are different for nucleic acid modification or editing e.g. for access to the single-stranded portion of the non-target strand, for example for nucleic acid modification, e.g for base editing, the amino acid sequences of SEQ ID NOs: 1-24 may be used to link Cas12a and the polypeptide of interest.
[0083] In some embodiments, when used to link Cas12a to the polypeptide of interest the amino acid sequences of SEQ ID NOs: 1-24 are different for nucleic acid modification or editing It can provide an array. For example, an array that links the polypeptide of interest to Cas12a. The amino acid sequences 1-24 correspond to the PAM (protoss) in the target nucleic acid (e.g., DNA). Win for editing or modification of 1 to approximately 25 nucleotides from a pacer adjacent motif. It can provide a do (for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 from PAM) 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 (or 25 nucleotides, or any range or value of those nucleotides in the editing / modification window) In some embodiments, the editing or modification window is 1, 2, 3, 4 from PAM. From 5, 6, 7, 8, 9, 10 to approximately 11, 12, 13, 14, 15, 16, 17, 18, 1 It can be 9, 20, 21, 22, 23, 24, 25 nucleotides (for example, from PAM) 1 to 20, 1 to 15, 1 to 10, 3 to 15, 4 to 10, 5 to 25, 5 to 2 (e.g., 0, 5 to 15, 5 to 10, 7 to 15 nucleotides).
[0084] Cas12a is a V-type clustered regularly interspacing ed Short Palindromic Repeats (CRISPR)-Cas It is a nuclease. Cas12a is a more well-known type II CRISPR Cas9 nuclease. Cas9 differs from ase in several respects. For example, Cas9 has a guide RNA (g RNA, sgRNA) binding site (protospacer, target nucleic acid, target DNA) on the 3' side While recognizing a certain G-rich protospacer adjacent motif (PAM) (3'-NGG) Cas12a is a T-rich PAM (5'-tt) located on the 5' side of the target nucleic acid. N, 5'TTTN) is recognized. In fact, Cas9 and Cas12a recognize their guide R The orientation in which NA binds is mostly reversed with respect to their N-terminus and C-terminus. Furthermore, the Cas12a enzyme is a dual guide found in the natural Cas9 system. Single RNA (sgRNA (e.g., crRNA and tracrRNA)) Using guide RNA (gRNA, CRISPR array, crRNA), and Cas12 a processes its own gRNA. In addition, Cas12a nuclease activity is Instead of the blunt ends generated by Cas9 nuclease activity, two staggered DNA molecules are produced. Cas12a generates a strand break, and a single Rubicon is used to cleave both DNA strands. It relies on the C domain, but Cas9 uses the HNH domain and RuvC domain for cleavage. Use it.
[0085] CRISPR Cas12a polypeptide or CRISPR Cas useful in the present invention The 12a domain is any Cas12a nucleus that is known or later identified. It may be an ase (formerly known as Cpf1) (e.g., U.S. 9,799 Regarding the disclosure of sequence 0,490 (Cpf1(Cas12a)), by citation, this is clearly stated. (This shall form part of the detailed document) (see reference). Terms: "Cas12a", "Cas12a polypeptide The "Cyd" or "Cas12a domain" is the guide nucleic acid binding domain of Cas12a. and / or active, inactive, or partially active Cas12a RNA containing a Cas12a polypeptide or a fragment thereof, which contains a DNA cleavage domain. This refers to donuclease. In some embodiments, Cas12a useful for the present invention is mutated. may also be included within a nuclease active site (e.g., the RuvC site of the Cas12a domain). Since it has a mutation within the nuclease active site, a Cas12a domain or Cas12a polypeptide that no longer contains nuclease activity is generally referred to as dead Cas12a (e.g., dCas12a). In some embodiments, a Cas12a domain or Cas12a polypeptide having a mutation within the nuclease active site may have impaired activity.
[0086] In some embodiments, the Cas12a domain can include, but is not limited to, any one of the amino acid sequences of SEQ ID NOs: 30-46 (e.g., SEQ ID NOs: 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46), or a polynucleotide encoding the same. In some embodiments, the fusion protein of the present invention may include the Cas12a domain (e.g., SEQ ID NO: 30) of Cas12a (LbCas12a) of the bacterium Lachnospiraceae ND2006.
[0087] In some embodiments, the polynucleotide encoding the Cas12a domain may be codon-optimized for expression in a biological organism. Thus, in some embodiments, the present invention provides a polynucleotide encoding any one of the amino acid sequences of SEQ ID NOs: 30-46 with at least about 70% identity (e.g., about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 9 (Having identity of 3%, 94%, 95%, 96%, 97%, 98%, 99%, and 100%) We provide polynucleotides.
[0088] In some embodiments, V-type Clustered Regularly Intersp Related to aced Short Palindromic Repeats (CRISPR) (Cas)(CRISPR-Cas) system, (a)Cas12a domain, A linker containing one of the amino acid sequences of SEQ ID NOs: 1-24, and the polyp A fusion protein containing a plutide, wherein the Cas12a domain is the same as sequence numbers 1-24. A fusion protein linked to the polypeptide of interest via any one of its amino acid sequences. (b) a protein, or nucleic acid encoding the fusion protein, and spacer sequence Guide nucleic acids containing repeating sequences (CRISPR RNA, CRISPR DNA, crRN) A, crDNA), and the guide nucleic acid is the Cas12a of the fusion protein. The spacer sequence can form a complex with the main component, and the spacer sequence hybridizes to the target nucleic acid. This allows the Cas12a domain and the polypeptide of interest to be configured accordingly. The system guides the target nucleic acid, thereby modifying the target nucleic acid (for example, cutting Includes guide nucleic acids that can be interrupted or edited or modulated (e.g., modulated transcription). The system is provided.
[0089] In some embodiments, Cas12a, the polypeptide of interest, and SEQ ID NOs: 1-24 A fusion protein containing any one of the amino acid sequences is provided, and here, the poly A peptide is an adenine deaminase polypeptide or domain.
[0090] In some embodiments, the present invention relates to (a) a bound guide nucleic acid (e.g., gRNA) (b) The Cas12a domain that specifically binds to the target nucleic acid sequence when present with (b) the first (c) Adenine deaminase domain, fusion including a second adenine deaminase domain The protein is provided, where the first and second adenine deaminase domains are the same The Cas12a domain and, when present with the gRNA, the single strand of the target nucleic acid sequence The adenosine base in the fraction is deaminated, and the Cas12a domain is represented by Sequence IDs 1-24. The first adenine deaminase domain or This is linked to the second adenine deaminase domain. In some embodiments, The N-terminus of the Cas12a domain is one of the amino acid sequences of SEQ ID NOs: 1-10. It may be ligated to the C-terminus of the second adenine deaminase domain via Cas, or The C-terminus of the 12a domain is via one of the amino acid sequences of SEQ ID NOs: 11-24 N of the first adenine deaminase domain or the second adenine deaminase domain It may be ligated to the terminal. In some embodiments, the first adenine deaminase is Wild-type adenine deaminase (e.g., TadA (tRNA-specific adenosine deaminase) Ze, (for example, sequence number 47), and the second adenine deaminase domain is mutated / Evolved adenine deaminase domains (e.g., TadA * (evolved tRNA specific) Adenosine deaminase, for example, SEQ ID NOs. 48 or 78-82)) and Cas1 The C-terminus of the 2a domain is connected to the second domain via one of the amino acid sequences of SEQ ID NOs: 11-15. The N-terminus of the adenine deaminase domain, or the amino acid sequence of SEQ ID NOs: 11-24 It is linked to the N-terminus of the first adenine deaminase domain via one of the following: Alternatively, the N-terminus of the Cas12a domain may be one of the amino acid sequences from SEQ ID NOs: 1-10. It is linked to the C-terminus of the second adenine deaminase domain via one of them. Exemplary fusion proteins include SEQ ID NOs. 49-77 and / or SEQ ID NOs. 90-96. This includes, but is not limited to, amino acid sequences.
[0091] In some embodiments, (a) a first adenine deaminase domain, (b) a second adenine Fusion including the nindeaminase domain and the (c)Cas12a(Cpf1) domain A protein wherein the Cas12a domain contains a mutation in the nuclease active site, The aforementioned second adenine deaminase domain and the aforementioned first adenine deaminase domain In contrast, the C-terminus of the first adenine deaminase domain is the second deaminase domain The main N-terminus is ligated to the N-terminus of the Cas12a domain, and the N-terminus of the Cas12a domain is sequence numbers 1-10(L The second adenine deaminase inhibitor is transmitted via any one of the amino acid sequences 1-10. A fusion protein is provided, which is ligated to the C-terminus of the ion. In some embodiments, the Adenine deaminase 1 is wild-type adenine deaminase (e.g., TadA) (for example) For example, sequence number 47) indicates that the second adenine deaminase domain is a mutated / evolved adenine deaminase domain. Denine deaminase domain (e.g., TadA * )(For example, sequence number 48 or 78) ~82) In some embodiments, SEQ ID NOs. 49~77 and / or SEQ ID NOs. 90 A fusion protein containing any one of the ~96 amino acid sequences is provided.
[0092] In some embodiments, (a) Cas12a domain, (b) first adenine deaminar A fusion protein containing (c) a zedomain and a second adenine deaminase domain. And here, the second adenine deaminase domain is the first adenine deaminase domain Unlike the main enzyme, the C-terminus of the first adenine deaminase domain is the second deaminase. The N-terminus of the domain is ligated to the first adenine deamina of the Cas12a domain. - It is linked to the N-terminus of the deaminase domain, and the first deaminase domain is wild-type adenine If it is a deaminase domain, the Cas12a domain is sequence number 11-24 (L11 The first adenine deaminase domain via one of the amino acid sequences ~24) Adenine deaminase domain is ligated at the N-terminus and the first deaminase domain is mutated / evolved. If it is an enzyme domain, the Cas12a domain is sequence numbers 11-15 (L11-15 The N-terminus of the first adenine deaminase domain via any one of the amino acid sequences of ) A fusion protein is provided which is linked to the first Ade. In some embodiments, the first Ade The nindeaminase domain is wild-type adenosine deaminase (e.g., wild-type tRNA). (Specific adenosine deaminase domain) or mutated / evolved adenosine deaminase In a domain (for example, a mutated / evolved tRNA-specific adenosine deaminase domain) Yes (for example, Sequence IDs 47, 48 or 78-82). In some embodiments, the second The adenine deaminase domain is similar to that of wild-type adenosine deaminase (e.g., wild-type t RNA-specific adenosine deaminase domain) or mutated / evolved adenosine deaminase domain Nase domain (e.g., mutated / evolved tRNA-specific adenosine deaminase domain) (For example, Sequence IDs 47, 48 or 78-82). In some embodiments, this is the case. The first adenine deaminase and the second adenine deaminase form a dimer. In some embodiments, the amino acid sequences of SEQ ID NOs. 49-77 and / or 90-96 A fusion protein containing one of these is provided.
[0093] Adenine deaminase (or adenosine deaminase) useful in the present invention is any Any known or later identified adenine deaminase of biological origin It is possible (for example, U.S. Patent No. 10,113,163 (Disclosure of adenine deaminase) (and by reference thereof, shall form part of this specification) (see reference). The enzymes "adenine deaminase" and "adenosine deaminase" are derived from adenine or It catalyzes the hydrolytic deamination of adenosine (e.g., removal of the amine group from adenine). Refers to polypeptides or their domains that can catalyze or otherwise. Morphologically, adenine deaminase is an enzyme that converts adenosine or deoxyadenosine into inosine. Alternatively, it can catalyze hydrolytic deamination to deoxyinosine. Some embodiments In this context, adenosine deaminase hydrolyzes adenine or adenosine in DNA. It catalyzes target deamination. In some embodiments, the nucleic acid construct of the present invention encodes The adenine deaminase that is used to convert the sense strand (e.g., "+"; template) of the target nucleic acid from A to G This can cause a conversion, or a T→C change in the antisense (e.g., "-", complementary) strand of the target nucleic acid. It can cause exchange. The adenine deaminase useful in this invention can cause all biological processes It could be any known or later identified adenine deaminase. (For example, U.S. Patent No. 10,113,163 (Disclosure of adenine deaminase, (By reference, these shall form part of this specification) (see reference).
[0094] In some embodiments, adenosine deaminase is derived from naturally occurring adenosine deaminase. It may also be a variant of the enzyme. Therefore, in some embodiments, an enzyme useful for the present invention Nosine deaminase is approximately 70% to 100% identical to wild-type adenine deaminase. For example, compared to naturally occurring adenine deaminase, the percentages are approximately 70%, 71%, 72%, and 73%. %, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83 %, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93 (Possible to be 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) In some embodiments, deaminase or deaminase is not naturally occurring and is manipulated. It can be referred to as a created, mutated, or evolved adenosine deaminase. Therefore, For example, engineered, mutated, or evolved adenine deaminase polypeptides. Alternatively, the adenine deaminase domain is a naturally occurring adenine deaminase polypeptide. Approximately 70% to 99.9% identical to the cide / domain (for example, naturally occurring adenine Approximately 70% and 71% of the aminase polypeptide or adenine deaminase domain. 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81% 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91% , 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 9 9.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8% , or 99.9% identical) may be. In some embodiments, adenosine deaminate Ze refers to bacteria (for example, E. coli, Staphylococcus aureus). Haemophilus influenzae, a type of bacteria (eus), (e.g., Caulobacter crescentus) This is what happens. In some embodiments, adenine deaminase polypeptide / domer Polynucleotides that encode nucleotides are necessary for expression in living organisms (e.g., plants). It may be optimized.
[0095] In some embodiments, the adenine deaminase domain is wild-type tRNA-specific Denosine deaminase domain, for example, tRNA-specific adenosine deaminase (Ta dA) and / or mutated / evolved adenosine deaminase domains, e.g., mutated / Evolved tRNA-specific adenosine deaminase domain (TadA * ) In some embodiments, the TadA domain may be derived from Escherichia coli. Morphologically, TadA is modified, for example, truncated, and compared to the full-length TadA, one is Alternatively, it may be missing multiple N-terminal and / or C-terminal amino acids (e.g., 1, 2 , 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 6, 17, 18 , 19, or 20 N-terminal and / or C-terminal amino acid residues may be missing compared to the full-length TadA). In some embodiments, the TadA polypeptide or TadA domain does not contain the N-terminal methionine. In some embodiments, wild-type E. coli TadA contains the amino acid sequence of SEQ ID NO: 47. In some embodiments, the mutant / evolved E. coli TadA contains the amino acid sequence of SEQ ID NO: 48 or 78-82. In some * embodiments, the polynucleotide encoding TadA / TadA may be codon-optimized for expression in an organism. * For expression in an organism it may be codon-optimized.
[0096] In some embodiments, the first deaminase domain is linked to the second deaminase domain via a linker (e.g., a peptide linker) to form an adenine deaminase dimer. In some embodiments, the first deaminase domain is linked to the second deaminase domain via a GS linker. In some embodiments , the GS linker contains the amino acid sequence SGGS (SEQ ID NO: 25), (GGS) n, or S(GGS)n (one or more repeats of SEQ ID NO: 26) where n is 1-20 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, and any range or value therein). In some embodiments, the GS linker has the amino acid sequence SGG SGGSGGS (SEQ ID NO: 27), SGSETPGTSESATPES (SEQ ID NO: 28) , and / or SGGSSGGSSGSETPGTSESATPESSGGSSGGS (Sequence ID 29) may be included. In some embodiments, adenine deaminase Dimer is SGGSSGGSSGSETPGTSESATPESSGGSSGGS (distribution The first deaminase domain is linked to the second deaminase domain via column number 29) Contains . In some embodiments, the first deaminase domain has a C-terminus It is ligated to the N-terminus of the second deaminase domain. In some embodiments, the second The deaminase domain of this molecule is linked at its C-terminus to the N-terminus of the first deaminase domain. It is being done.
[0097] This specification includes a Cas12a domain linked to the polypeptide of interest described herein. The fusion protein of the present invention, along with the Cas12a domain, modifies the target nucleic acid. Guide RNA (gRNA, CRISPR array, CRISPR) designed to enable this function It can be used in combination with RNA, crRNA. A useful guide nucleic acid (CRI) for the present invention. SPR RNA, CRISPR DNA, crRNA, crDNA) are spacer sequences. and includes repeat sequences. The guide nucleic acid is complexed with the Cas12a domain of the fusion protein. The spacer sequence can form a spacer sequence that hybridizes to the target nucleic acid, thereby It can guide the Cas12a domain and the polypeptide of interest to the target nucleic acid. The target nucleic acid is modified by the polypeptide of interest of the fusion protein (for example, cleaved or otherwise modified). It is edited or modified (for example, the transcription is modified). For example, as described herein A fusion protein containing a Cas12a domain linked to an adenine deaminase domain The quality can be used in combination with Cas12a guide nucleic acids to modify target nucleic acids. However, here, the adenine deaminase domain of the fusion protein is involved in the adenine in the target nucleic acid. The syn base is deaminated, thereby editing the target nucleic acid.
[0098] The terms "guide nucleic acid," "guide RNA," "gRNA," and "CRI" as used herein are used in this specification. SPR RNA / DNA, crRNA, or crDNA is a target DNA (for example) (or, a prototype spacer) and at least one spacer that is complementary (hybridizes) to the prototype spacer. A sequence, and at least one repeating sequence (e.g., V-type Cas12a CRISPR-C) as means nucleic acids containing repeats of the system, or fragments or parts thereof, where the repeats The sequence is ligated to the 5' end of the spacer sequence. The design of the gRNA of the present invention is V-type C Based on the as12a CRISPR-Cas system. In some embodiments, Cas The gRNA of 12a has a repeating sequence (full length or part of it ("handle")) from 5' to 3'. ), may include, for example, pseudoknot-like structures and spacer arrangements. Some implementations In this state, the guide nucleic acid consists of multiple repetitive sequence-spacer sequences (e.g., 2, 3, 4, 5) It may include 6, 7, 8, 9, 10, or more repeating spacer sequences. (For example, repetition-spacer-repetition, for example, repetition-spacer-repetition-spacer-reverse) (Repeat-spacer-repeat-spacer-repeat-spacer etc.). The guide nucleic acid of the present invention is It is artificial, not found in nature. gRNA can be very long, and ( Aptamers (as in the MS2 mobilization strategy), or other RNA structures that hang spacers It may also be used as a construction.
[0099] As used herein, "repetitive sequence" refers, for example, to wild-type CRISPR Cas12a This refers to any repeat sequence of a gene locus, or a repeat sequence of synthetic crRNA. Useful for the present invention The repetitive sequence is a known or, This could be any repetitive sequence later identified, or a V-type CRISPR-Cas system It may be a synthetic iteration designed to function in such a context. The iterative sequence has a hairpin structure and It may also include a stem-loop structure. In some embodiments, the repeating sequence is A pseudoknot-like structure (i.e., a "handle") can form at its 5' end. Therefore, In some embodiments, the repeat sequence is a repeat sequence derived from the wild-type V-type CRISPR locus. It may be identical or substantially identical (for example, at least 70% identical). Wild-type Cas Repetitive sequences derived from the 12a (type V) CRISPR gene locus are analyzed by an established algorithm. For example, CRISPRfinder (Griss) provided by CRISPRdb. a et al. Nucleic Acids Res. 35 (Web server publication) This can be determined using (see W52-7). In some embodiments, a repeating sequence or A portion of it is attached to the 5' end of the spacer array, thereby creating a repeating spacer. - Forms sequences (e.g., guide RNA, crRNA).
[0100] In some embodiments, the repeat sequence is a guide RNA containing specific repeats and repeats. Depending on whether they are processed or not, at least 10 nucleotides (For example, about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 2 1, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 ,35,36,37,38,39,40,41,42,43,44,45,46,47, 48, 49, 50-100 nucleotides, or more than that, or a fraction of them It includes, essentially consists of, or comprises any range or value. In some embodiments, the repeating sequence is approximately 10 to 20, approximately 10 to 30, and approximately 10 to 4 5. Approximately 10-50, approximately 15-30, approximately 15-40, approximately 15-45, approximately 15-5 0, approximately 20-30, approximately 20-40, approximately 20-50, approximately 30-40, approximately 40-8 0, containing approximately 50 to 100 nucleotides, or more, or from these. To become qualitative, or to consist of qualitative.
[0101] The repetitive sequence ligated to the 5' end of the spacer sequence is part of the repetitive sequence (e.g., wild type). The repeating sequence is 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 1 8, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 It may contain 32, 33, 34, 35 or more consecutive nucleotides. In this embodiment, a portion of the repeating sequence attached to the 5' end of the spacer sequence is approximately 5~ It is approximately 10 consecutive nucleotides long (for example, approximately 5, 6, 7, 8, 9, 10 nucleotides). And, compared to the same region (e.g., the 5' end) of the wild-type Cas12a repeat nucleotide sequence and at least 90% (for example, at least about 90%, 91%, 92%, 93%, 94%) It has identity of 95%, 96%, 97%, 98%, 99%, or more. In some embodiments, a portion of the repeating sequence has a pseudoknot-like structure at its 5' end. For example, this includes "handle" (or "handle").
[0102] As used herein, the “spacer sequence” is complementary to the target nucleic acid (e.g., target DNA). It is a typical nucleotide sequence (e.g., a protospacer). The spacer sequence is the target nucleic acid. It may be completely complementary to or substantially complementary to (for example, at least about 70% (for example, approximately 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%) 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% (Complementary, 98%, 99%, or more). Therefore, in some embodiments The spacer sequence, compared to the target nucleic acid, contains 1, 2, 3, 4, or 5 mismatched elements. It may have a mismatch, and the mismatch may be continuous or discontinuous. In one embodiment, the spacer sequence may have 70% complementarity with the target nucleic acid. In this embodiment, the spacer nucleotide sequence has 80% complementarity to the target nucleic acid. It may have. In another embodiment, the spacer nucleotide sequence is the target nucleic acid ( 85%, 90%, 95%, 96%, 97%, 98%, 99% relative to the protospacer , or may have complementarity of 99.5% or the like. In some embodiments, the spacer arrangement is The spacer sequence is 100% complementary to the target nucleic acid. The spacer sequence is approximately 15 nucleotides in length. 30 nucleotides (for example, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, or a fraction of them It can be any range or value. Therefore, in some embodiments, the spacer array is , target nucleic acids (e.g., protonucleotides) that are at least approximately 15 to 30 nucleotides in length. The spacer may have complete or substantial complementarity across its region. Morphologically, the spacer is approximately 20 nucleotides long. In some embodiments, The spacer is approximately 23 nucleotides long.
[0103] In some embodiments, the 5' region of the spacer sequence of the guide RNA is connected to the target DNA. While they may be identical, the 3' region of the spacer may be substantially identical to the target DNA, For example, the overall complementarity of the spacer sequence to the target DNA may be less than 100%. Therefore, for example, 5 of the 20-nucleotide spacer sequence (i.e., seed region) For example, the first nucleotides within the region, such as 1, 2, 3, 4, 5, 6, 7, 8, etc., are target D While it may be 100% complementary to NA, the remaining nucleotides within the 3' region of the spacer sequence The DNA is substantially complementary to the target DNA (e.g., at least about 70% complementary). In one embodiment, the first 1 to 8 nucleotides of the 5' end of the spacer sequence (for example, The first 1, 2, 3, 4, 5, 6, 7, 8 nucleotides, and any range within them) While it may be 100% complementary to the target DNA, the remaining DNA within the 3' region of the spacer sequence Cleotides are substantially complementary to the target DNA (for example, at least about 50%). ba, 50%, 55%, 60%, 65%, 70%, 71%, 72%, 73%, 74%, 75 %, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85 %, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95 %, 96%, 97%, 98%, 99%, or more (complementary). Some actual In the application configuration, the seed region of the spacer may have a length of approximately 5 to 6 nucleotides. In some embodiments, the seed region of the spacer has a length of 5 nucleotides. In this embodiment, the seed region of the spacer has a length of 6 nucleotides.
[0104] The terms "target nucleic acid," "target DNA," and "target nucleotide sequence" as used herein are used in this specification. The "target region," or "target region within the genome," is a spacer within the guide RNA of the present invention. The sequence is fully complementary (100% complementary) or substantially complementary (e.g., at least 70) % Complementary (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%) 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87% 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97% CRIS (Critical Values) refers to the region of an organism's genome that is 98%, 99%, or more. Useful target regions for the PR-Cas12a system are PAM sequences within the genome of organisms. It is positioned immediately to the 3' side. The target region is positioned immediately adjacent to the PAM sequence. At the very least, 15 consecutive nucleotides (for example, 16, 17, 18, 19, 20, 21, 2) From any of the following nucleotides (2, 23, 24, 25, 26, 27, 28, 29, 30, etc.) It is a possible choice.
[0105] The "protospacer sequence" is the spacer sequence of the CRISPR iterative-spacer sequence and Target double-stranded DNs that are completely or substantially complementary (and hybridize to them) A. Specifically, this refers to a portion of the target DNA (for example, a target region within the genome) (for example) (guide RNA, CRISPR array, crRNA). Type V CRISPR-Cas Ca In the s12a system, the protospacer arrangement is the protospacer adjacent motif (P AM) is located next to (for example, immediately adjacent to). PAM is at the 5' end of the non-target strand. It is then positioned at the 3' end of the target chain (see below for an example). [ka]
[0106] Canonical Cas12a PAM is T-rich. In some embodiments, canonical The nical Cas12a PAM sequence is 5'-TTN, 5'-TTTN, or 5'-TT It may be a TV. In some embodiments, a non-canonical PAM may be used. It may not be very effective.
[0107] Further PAM sequences can be determined using established experimental and computational approaches. And it may be determined by those skilled in the art. Therefore, for example, an experimental approach is conceivable. All nucleotide sequences target adjacent sequences, and for example, target plasmids This includes identifying sequence members that are not targeted by DNA transformation (E svelt et al.2013.Nat Methods10:1116-1121 , Jiang et al.2013.Nat.Biotechnol.31:233- 239). In some embodiments, computational approaches can be used to BLAST natural spacers. Perform a search to identify the original target DNA sequence within the bacteriophage or plasmid. This involves aligning these sequences to determine the conserved sequences adjacent to the target sequence. This may include (Briner and Barrangou. 2014. Appl.) Environ.Microbiol.80:994-1001, Mojica et al.2009.Microbiology155:733-740).
[0108] In some embodiments, one or more of the present invention (e.g., 1, 2, 3, 4, 5, 6, 7) Fusion proteins (8, or more) and one or more (e.g., 1, 2, 3, Guide nucleic acids (e.g., CRISPR RNA / ) of 4, 5, 6, 7, 8 or more A complex and composition containing DNA (e.g., crRNA / crDNA) are provided. In some embodiments, the polypeptide, fusion protein, guide nucleic acid, and / or A polynucleotide or nucleic acid construct encoding a complex is provided. Some embodiments Therefore, nucleic acids comprising the polynucleotide and / or one or more guide nucleic acids of the present invention A construct, expression cassette, and / or vector are provided. In some embodiments, The polynucleotide encoding the fusion protein of the present invention is the same as that containing the guide nucleic acid. or on a separate polynucleotide, nucleic acid construct, expression cassette or vector It may be a guide nucleic acid. The fusion protein may be a separate polynucleotide from the one containing the guide nucleic acid. When encoded on an ocide, nucleic acid construct, expression cassette, or vector, the present invention Polynucleotides, nucleic acid constructs, expression cassettes or nucleotides encoding fusion proteins The ctor, before the guide nucleic acid is provided (for example, before contact with the target nucleic acid), simultaneously or may be provided thereafter (for example, in contact with the target nucleic acid).
[0109] In some embodiments, the polynucleotides, nucleic acid constructs, expression cassettes, and The vector may be codon-optimized for expression in organisms. In the embodiments of the present invention, an optimized polynucleotide, nucleic acid construct, or expression The cassette contains polynuclei encoding the polypeptides, fusion proteins, and complexes of the present invention. Approximately 70% to 100% (for example, approximately 70%) of the rheotide, nucleic acid construct, or expression cassette. %, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80 %, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90 %, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99 They may be identical (0.5% or 100%).
[0110] In some embodiments, one or more polynucleotides, guide nucleic acids, nucleic acids of the present invention Cells containing constructs, expression cassettes, or vectors are provided.
[0111] The polypeptide, fusion protein, guide RNA, complex, and composition of the present invention The polynucleotides / nucleic acid constructs / expression cassettes / vectors that encode the standard It can be used to modify the expression of specific nucleic acids and / or their respective nucleic acids.
[0112] In some embodiments, the fusion protein of the present invention is used for base editing of target nucleic acids. It is an adenine base editor (ABE), where the fusion protein is adenine deami It contains a Cas12a domain linked to the nasase domain.
[0113] In some embodiments, the target nucleic acid is (a)(i) the fusion protein of the present invention and (a)( ii) Guide nucleic acids (e.g., CRISPRRNA, CRISPRDNA, crRNA) (b) a complex comprising the fusion protein and guide nucleic acid of the present invention, (c) A composition comprising the fusion protein and guide nucleic acid of the present invention, and / or (d) the present invention A method for modifying a target nucleic acid is proposed, which involves modifying the target nucleic acid by bringing it into contact with a system. The target nucleic acid is provided. The target nucleic acid is provided before, at the time of, or upon contact of the target nucleic acid and the guide nucleic acid. After this, the fusion protein may be brought into contact with it.
[0114] In some embodiments, the target nucleic acid is the amino acid sequence of SEQ ID NOs. 49-77 or 90-96. A target nucleic acid, which includes contacting a fusion protein containing one of the following with a guide nucleic acid. A method for modifying is provided. The target nucleic acid is contacted with the guide nucleic acid before contacting the target nucleic acid. The fusion protein of the present invention may be brought into contact with the other substance at the same time as, or after, the other substance.
[0115] In some embodiments, cells or cell-free systems containing the target nucleic acid are (a)(i) the present invention Polynucleotides encoding polypeptides or fusion proteins of the present invention, or An expression cassette or vector containing it, and (a)(ii) guide nucleic acids, and / or an expression cassette or vector containing the same, and / or (b) the fusion of the present invention A nucleic acid construct encoding a complex containing a protein and a guide nucleic acid, and / or it An expression cassette or vector containing a fusion protein is expressed and complexed with a guide nucleic acid. Under conditions that form a complex, the complex is brought into contact with the target nucleic acid, This provides a method for modifying target nucleic acids, thereby modifying target nucleic acids on a separate construct. If provided, the target nucleic acid is used before, simultaneously with, contact with the guide nucleic acid, and Alternatively, after contact, the polynucleotide encoding the fusion protein, nucleic acid construct, expression It may come into contact with a cassette or vector.
[0116] In some embodiments, cells or cell-free systems containing the target nucleic acid are represented by SEQ ID NOs: 49-7 A fusion protein encoding either 7 or 90-96 amino acid sequences. Linucleotides or expression cassettes or vectors containing them, and guide nucleic acids The expression cassette or vector containing it, and the fusion protein are expressed, and the guide nucleic acid The process involves contacting the target nucleic acid under conditions that form a complex, and the complex hybridizes with the target nucleic acid. A method for modifying a target nucleic acid is provided, which involves modifying the target nucleic acid by a separate process. When provided on a construct, the target nucleic acid is contacted with the guide nucleic acid before contacting the target nucleic acid. Simultaneously or after contact, polynucleotides encoding fusion proteins and nucleic acid construction. It can be brought into contact with an object, expression cassette, or vector.
[0117] In some embodiments, the present invention uses a target nucleic acid as (a)(i) the fusion protein of the present invention. and (a)(ii) guide nucleic acid, (b) fusion protein and guide nucleic acid of the present invention A composition comprising (c)(i) the fusion protein of the present invention and (ii) a guide nucleic acid. , and / or (d)(i) to bring into contact with the CRISPR-Cas system of the present invention It contains and the adenine deaminase domain converts adenosine (A) in the target nucleic acid into guanine (G) is converted, thereby editing the target nucleic acid to generate (point) mutations, editing the target nucleic acid. The method is provided. The target nucleic acid is used before and immediately after contact with the guide nucleic acid. Alternatively, the fusion protein of the present invention may be brought into contact with the other material after initial contact.
[0118] In some embodiments, the target nucleic acid is the amino acid sequence of SEQ ID NOs. 49-77 or 90-96. This involves contacting a fusion protein containing one of the following with a guide nucleic acid, and including A method for editing target nucleic acids is provided. Before, simultaneously with, or after contacting the guide nucleic acid, the fusion protein of the present invention It may be brought into contact with a substance.
[0119] In some embodiments, cells or cell-free systems containing the target nucleic acid are (a)(i) the present invention Polynucleotides encoding a fusion protein, and / or an expression cassette containing it (a)(ii) guide nucleic acids, and / or (a)(i) and / or an expression cassette or vector including (a)(ii), and / or (b) A nucleic acid construct encoding a complex comprising the fusion protein and guide nucleic acid of the present invention, Alternatively, an expression cassette or vector containing it, and the fusion protein is expressed in a guide nucleus. The process involves contacting the target nucleic acid under conditions that form a complex with an acid, and the complex hybridizes the target nucleic acid. The adenine deaminase domain then converts adenosine (A) in the target nucleic acid into guanine. (G) is converted, thereby editing the target nucleic acid to generate (point) mutations, editing the target nucleic acid. A method is provided. If provided on a separate construct, the target nucleic acid and guide Before, simultaneously with, or after contacting the nucleic acid, the fusion protein is brought into contact with it. That's fine.
[0120] In some embodiments, cells or cell-free systems containing the target nucleic acid are represented by SEQ ID NOs: 49-7 A fusion protein encoding either 7 or 90-96 amino acid sequences. Linucleotides or expression cassettes or vectors containing them, and guide nucleic acids The expression cassette or vector containing it, and the fusion protein are expressed, and the guide nucleic acid The process involves contacting the target nucleic acid under conditions that form a complex, and the complex hybridizes with the target nucleic acid. A method for editing a target nucleic acid is provided, which involves editing the target nucleic acid. A fusion protein containing one of the amino acid sequences 49-77 or 90-96 The polynucleotide to be used is expressed in the same expression cassette or vector as the one containing the guide nucleic acid. - May be present on top of: either amino acid sequence 49-77 or 90-96 A polynucleotide encoding a fusion protein containing one of these is different from one containing a guide nucleic acid. If the target nucleic acid is on a separate expression cassette or vector, the target nucleic acid is placed on the expression cassette containing the guide nucleic acid. Before, during, or after contact with the set / vector, the target nucleic acid is fused It may be brought into contact with an expression cassette / vector containing the combined protein.
[0121] In some embodiments, the adenine deaminase of the fusion protein of the present invention targets the nucleus Acid sense (e.g., "+"; template) causes A→G conversion in the chain, or the target nucleic acid This causes a T→C conversion in the chisene (e.g., "-"; complementary) chain.
[0122] The fusion proteins and polypeptides of the present invention and nucleic acid constructs encoding them are The emergence of A→G or T→C mutations in target nucleic acids, including but not limited to rasmid sequences. In the development of A→G or T→C mutations in the coding sequence to change the identity of amino acids. Generation of A→G or T→C mutations in coding sequences to generate stop codons, opening Generation of A→G or T→C mutations in coding sequences to disrupt the initial codon, transcription factors Splice junctions: generation of point mutations in genomic DNA to disrupt bonds. The generation of point mutations in genomic DNA to disrupt, and / or SEQ ID NO: 1~ Other domains via one of the 24 amino acid sequences (e.g., peptide linkers) (the polypeptide of interest) is fused to a fusion protein containing a Cas12a domain. For modifications of target nucleic acids, including but not limited to other nucleic acid modifications that are generated, It can be used in combination with id nucleic acids.
[0123] The fusion protein of the present invention and the polypeptide and nucleic acid construct encoding it are, A mark of any living organism, including but not limited to objects, plants, fungi, archaea, or bacteria. It may be useful for modifying target nucleic acids. Animals include mammals, insects, fish, birds, etc. However, it is not limited to these.
[0124] Exemplary mammals to which the present invention may be useful include primates (humans) and non-humans (e.g., chrysoprazole). Panpanzees, baboons, monkeys, gorillas, etc.), cats, dogs, mice, rats, ferrets This may include gerbils, hamsters, cows, pigs, horses, goats, donkeys, or sheep. , but not limited to these.
[0125] The fusion protein of the present invention, as well as polypeptides and nucleic acid constructs encoding it, In any plant or plant part, the target nucleic acid can be modified. Angiosperms, gymnosperms, monosperms Cotyledons, dicotyledons, C3, C4, CAM plants, bryophytes, ferns and / or ferns This includes all plants (or groups of plants) such as microalgae and / or macroalgae. For example, classifications of a genus or a higher order may be used when carrying out the present invention. The plants and / or plant parts useful in this invention are any plant species / variety / cultivar and It may be a part of the plant. The term "plant part" as used herein is not limited to the following: It is not defined, but it refers to the embryo, pollen, ovule, seed, leaf, trunk, shoot, flower, branch, fruit, kernel, ear, and Roots, outer layer, stem, root, root tip, anther, plant cells (in an intact state in the plant and / or part of the plant) Plant cells, plant protoplasts, plant tissues, plant cell tissue cultures, plant callus, plant masses Examples include the following. In this specification, the term "shoot" refers to the leaves and stems. This refers to the above-ground parts. Furthermore, as used herein, "plant cell" refers to the structural physiology of a plant. This refers to a plant cell, which includes the cell wall and can also refer to a protoplast. A cell may be in the form of an isolated single cell or a cultured cell. It may also be a more highly organized unit, such as part of plant tissue or a plant organ.
[0126] The fusion proteins and polypeptides of the present invention and nucleic acid constructs encoding them are Modifying target nucleic acids in any plant or plant part (e.g., base editing, cleavage, nicking, etc.) It can be used for the following purposes. Non-limiting examples of plants useful in this invention include turfgrass (e.g., bluegrass). Grass, bentgrass, ryegrass, (genus *Phragmites*), reed, broad-leaved reed Ki, Miscanthus, Arundo, switchgrass, vegetable crops (artichoke, kohlrabi) Yellow radish, chives, asparagus, lettuce (for example, salad greens, leaf lettuce) (, Tachichisha), Maranga, Melon (for example, muskmelon, watermelon, Crencha melon) (e.g., honeydew melon, cantaloupe), Brassica crops (e.g., Brussels sprouts, cabbage) (Vegetables: cauliflower, broccoli, collard, kale, Chinese cabbage, bok choy), cardamom Cardoni, carrots, Chinese cabbage, okra, onions, celery, parsley, chickpeas Beans, parsnips, chicory, pepper, potatoes, cucurbits (e.g., mallow, Cucumber, zucchini, squash, pumpkin, honeydew melon, watermelon, cantaro P), radish, dried onion, rutabaga, eggplant, burdock, chrysanthemum greens, Shallots, endive, garlic, spinach, leeks, squash, greens, biscuits Beets (sugar beets and feed beets), sweet potatoes, Swiss chard, horseradish, Tomatoes, turnips, and spices are examples), fruit crops, such as apples and apricots. Cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, Figs, nuts (for example, chestnuts, pecans, pistachios, hazelnuts, pistachios, Peanuts, walnuts, macadamia nuts, almonds, etc.), citrus fruits (for example, clementa) Orange, kumquat, orange, grapefruit, tangier mandarin, mandarin, lemon, ra (Imma, etc.), blueberries, black raspberries, boysenberries, cranberries, currants Gooseberries, loganberries, raspberries, strawberries, blackberries, grapes (For wine and eating), avocado, banana, kiwi, persimmon, pomegranate, pineapple, to Tropical fruits, pear-shaped fruits, melons, mangoes, papayas, and lychees, agricultural products, for example clover, alfalfa, timothy, evening primrose, meadowfoam, corn Koshi (for animal feed, sweet corn, popcorn), hops, jojoba, buckwheat, safflower, k Noah, wheat, rice, barley, rye, millet, sorghum, oats, rye wheat, mo Rosco, tobacco, kapok, legumes (green beans (e.g., string beans and dried beans) Dried kidney beans, lentils, peas, soybeans, oil plants (rapeseed, canola, Mustard, poppy, olive, sunflower, coconut, castor oil plant, cocoa beans, peanuts Living organisms, oil palm, duckweed, Arabidopsis genus, fiber plants Materials (cotton, flax, hemp, jute), cannabis (for example, hemp (Cannabis s Cannabis ativa, Indian hemp (Cannabis indica), and Cannabis rudden Cannabis ruderalis, Lauraceae family (cinnamon, camphor) -), or plants such as coffee, sugarcane, tea, and natural rubber plants, as well as / Or flowering plants for flowerbeds, such as flowering plants, cacti, succulents, and / or ornamental plants. (For example, roses, tulips, violets), as well as trees, such as forest trees (broadleaf trees and and evergreen plants, such as conifers, such as elm, ash, oak, maple, fir, spruce, Japanese cedar, pine, birch, cypress, eucalyptus, willow, as well as shrubs and other seedlings. A tree is one example. In some embodiments, the fusion protein and polypeptide of the present invention And the nucleic acid constructs that encode them are found in corn, soybeans, wheat, canola, and Greens, tomatoes, pepper, sunflowers, raspberries, blackberries, black raspberries, It can be used to modify and / or cherry.
[0127] The present invention further includes a kit for carrying out the method of the present invention. The kit of the present invention is a trial Drugs, buffers, and apparatus for mixing, measuring, sorting, labeling and other purposes, as well as labels This may include instructions or other materials suitable for modifying the target nucleic acid.
[0128] In some embodiments, the present invention relates to one or more polypeptides of the present invention. One or more fusion proteins of the present invention, encoding one or more fusion proteins of the present invention One or more polynucleotides, the CRISPR-Cas system of the present invention, and A kit containing an expression cassette or vector containing it, and / or, in some cases, the Provided with instructions for use. In some embodiments, the kit further includes Cas12a gas It may include id nucleic acids and / or expression cassettes or vectors containing them. In some embodiments, the guide nucleic acid is a polynucleotide encoding the fusion protein of the present invention. The rheotide may be provided on the same expression cassette or vector.
[0129] Therefore, in some embodiments, (a) encoding the fusion protein provided herein (b) Promo drives the expression of polynucleotides of (a) and (b)(a). A kit is provided that includes nucleic acid constructs containing a meter. In some embodiments, the kit is Furthermore, it may include a nucleic acid construct that codes for a guide nucleic acid, the construct being a target nucleic acid sequence and For cloning identical or complementary nucleic acid sequences into the guide nucleic acid backbone. Includes the cloning site.
[0130] In some embodiments, the polypeptide of the kit is fused to one of the fusion proteins. or further comprising multiple nuclear localization signals, or polynucleotides encoding them. It may be so. In some embodiments, the polynucleotides of the kit are further transformed One or more selection markers useful for identifying a body (e.g., antibiotic resistance gene, It may encode nucleic acids that encode herbicide resistance genes, etc. In some embodiments, Then, polynucleotides contain one or more introns within the encoded fusion protein. It may also be mRNA capable of encoding.
[0131] Next, the present invention will be described with respect to the following embodiments. These embodiments are within the scope of the claims. This invention is not intended to be limited to this invention, but rather to be an example of a specific embodiment. It should be recognized that the methods described, as conceived by those skilled in the art, are not suitable for those skilled in the art. Slight deformation is intended to fall within the scope of this invention. [Examples]
[0132] [Example 1] Currently, a successful version of the Cas12a-based adenine base editor has been demonstrated. No. Therefore, the inventors focused on the ideal placement of the deaminase relative to the DNA strand being edited. Based on this, the optimal linker length and sequence, Cas12a and adenine deaminase (for example, TadA / TadA * Designing a fusion of either the N-terminus or C-terminus of a dimer. Therefore, we are attempting to develop an optimized Cas12a-based adenine base editor. I saw it.
[0133] Early fusion protein designs were found to be less temperature-sensitive and their activity in plant cells was not demonstrated. Therefore, the Cas12a (LbCas12a) of the Lacnospirae bacterium ND2006 ( For example, using sequence number 30), however, different Cas12a endonuclei Due to the high structural similarity between the species, these designs are similar to those of other species (e.g., *Ashida minoko*). Cpf1 (AsCpf1) of the genus Acidaminococcus sp., Francisella novicida Cpf1 (FnC Cas12 from pf1), and others (see, for example, SEQ ID NOs. 31-46) This should also be extended to enzyme a.
[0134] Using a structure-based approach, the inventors found that adenine in the Cas12a domain Deaminase domain (e.g., TadA / TadA * To enable the optimal placement of ) We developed several linker sequences designed for base editing. This enables access to the non-target strand single-stranded portion. The terminal arrangement of Cas12a and its The ideal linker sequence and length depend on the orientation of the id RNA, as used in Cas9 ABE. It is highly likely that this is significantly different from the current state-of-the-art linkers. In this example, the linker It supports several possible base editor domain architectures, and adenine deamina - The ze domain is linked to one of the ends of Cas12a, and the evolved Ta is different from the wild type. The dA domains are designed to alternate in order. (Example linker design) — is listed in Table 1.
[0135] [Table 1]
[0136] Figures 1A to 1C provide an overview of various structures developed using the designed linker.
[0137] The effectiveness of each designed linker sequence (length, flexibility, and sensitivity to proteases) To test (including) each linker in the vector for expression in mammalian cells A construct containing the sequences was created (see, for example, sequence numbers 49-77 or 90-96). Each linker is configured with the relevant domain placement (TadA to the N-terminus or C-terminus of LbCpf1). The experiment is conducted in heterodimer fusion (Figures 1A and 1B). One of the C-terminal linkers. Sections (Cterm_1, Cterm_4, Cterm_5, C9R, and Cterm_1 For 0), the test is performed by reversing the order of the deaminase components (mutant and wild type). Figure 1C). After screening in mammalian cells, stable plant transformations (e.g., soybeans) For testing in ), select the most effective linker for each architecture.
[0138] [Example 2] Editing in HEK293T cells HEK293T cells were incubated in DMEM medium in the absence of antibiotics, in 48 wells. Seeds were sown on collagen-coated plates (Corning). 70-80% conf Luency, 750 ng of base editor plasmid and 250 ng of guide RNA plasmid Using Sumid, according to the manufacturer's protocol, 1.5 μL of Lipofectamine 30 Transfect cells with 00 (ThermoFisher Scientific) Three days later, the cells were lysed and extracted using the MagMax DNA extraction kit (Applied Bio). DNA was extracted using the system. Spacer sequences used in guide RNA: DMNT1 Spacer 1: AAGAAATATTACAACATATAAAA Sequence ID 83 DMNT1 Spacer 2: AAATCCAGAATGCACAAAGTACT Sequence ID 84 DMNT1 Spacer 3: ATATAATGCATAATAAAAAACTT Sequence ID 85 RNF2 Spacer 1: TATGAGTTACAACGAACACCTCA Sequence ID 8 6 RNF2 Spacer 2: CACGTCTCATATGCCCCTTGGCA Sequence ID 8 7 RNF2 Spacer 3: GAACATGAAAACTTAAATAGAAC Sequence ID 8 8 RNF2 Spacer 4: ATGTTCTAAAAATGTATCCCAGT Sequence ID 8 9
[0139] Adenine to guani observed at the editing position in the three tested spacers The average frequency of edits to the linker is listed in Table 2. All experimental linker constructs are displayed as follows: Using a linker, the dLbCas12a from the end of the label is melted into TadA8.20m. It is constructed as a composite (for example, the Cterm1_8.20m construct is dLbCas1 (Includes 2a-Cterm1-TadA8.20m). GS-XTEN-GS linker N-terminal fusion of TadA8.20m or TadA8e to dLbCas12a - An object was used as a comparison.
[0140] [Table 2]
[0141] Figures 3-5 show the editing frequency of Table 2 in graph format. For each structure, spacers The amount of adenine-to-guanine editing observed at each editing position within the graph is indicated by individual bars. (For example, A8, A11 in Figure 3, A9, A10, A14 in Figure 4, A in Figure 5) 10, A12, etc.). Figure 2 shows the observations made in each of the three test spacers in the same experiment. This shows the average activity of LbCas12a nuclease. Based on these data, T As candidates for further testing as a fusion with adA8e deaminase, five phosphorus molecules I selected a car (Cterm10, Cterm12, Nterm7, Nterm10, (and Nterm11). Edited data for these constructs and two contrasting ABEs are shown in Table 3 and This is shown in Figures 6-10.
[0142] [Table 3]
[0143] Figures 7-10 show the observations for each of the five selected linkers at each position within the target spacer. Figure 6 shows the average frequency of adenine-to-guanine editing in the same experiment. The average activity of LbCas12a nuclease observed in each of the two test spacers was This is shown. In each of these figures, the error bars represent the standard deviation over three iterations. It is.
[0144] These data are linked to dLbCas12 using the designed linker Cterm12. This indicates that the C-terminal fusion of adenine deaminase is consistently superior to that of the control construct. It is showing.
[0145] The foregoing is an example of the present invention and should not be construed as an limitation thereof. The present invention is based on Defined by the claims below, and including equivalents of the claims therein should also be included. That is the case.
Claims
1. A polypeptide containing one of the amino acid sequences from SEQ ID NOs: 1 to 24.
2. The polypeptide of interest and one of the amino acid sequences of SEQ ID NOs: 1-24 are further selected. A polypeptide according to claim 1, including.
3. A port containing the Cas12a domain and one of the amino acid sequences of SEQ ID NOs: 1 to 24. Lipeptide.
4. Cas12a domain, the polypeptide of interest, and the amino acid sequence of SEQ ID NOs: 1-24 A fusion protein containing any one of the columns.
5. The Cas12a domain contains a mutation within the nuclease active site, as described in claim 3. A polypeptide or the fusion protein according to claim 4.
6. The Cas12a domain is located at its C-terminus and / or N-terminus in sequence numbers 1-2. The fusion according to claim 4 or claim 5, which is linked to any one of the four amino acid sequences. Composite protein.
7. The C-terminus of the Cas12a domain is one of the amino acid sequences of SEQ ID NOs: 1 to 24 The C-terminus of any one of the amino acid sequences of SEQ ID NOs: 1 to 24 is linked to the N-terminus of the above note. The polypeptide to be targeted is linked to the N-terminus, according to any one of claims 4 to 6. Fusion protein.
8. The N-terminus of the Cas12a domain is one of the amino acid sequences of SEQ ID NOs: 1 to 24 The C-terminus is linked to the note, and the N-terminus of any one of the amino acid sequences of SEQ ID NOs: 1 to 24 is linked to the note. The polypeptide to be targeted is linked to the C-terminus, according to any one of claims 4 to 6. Fusion protein.
9. The polypeptide of interest mentioned above has deaminase (deamination) activity (for example, cytosine deaminase). Aminase, adenine deaminase), nicasse activity, recombinase activity, trans Posase activity, methylase activity, glycosylase (DNA glycosylase) activity, glyco Sylase inhibitory activity (e.g., uracil-DNA glycosylase inhibitor (UGI)) Demethylase activity, transcriptional activation activity, transcriptional repression activity, transcriptional deactivation factor activity, histone repair Restriction activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA cleavage activity, restriction end Nuclease activity (e.g., Fok1), nucleic acid binding activity, methyltransferase activity DNA repair activity, DNA damage activity, dismutase activity, alkylation activity, deprylation activity Sexual activity, oxidative activity, pyrimidine dimer formation activity, integrase activity, transposase activity Sex, polymerase activity, ligase activity, helicase activity, and / or photolyase The polypeptide according to claim 2 or claim 4, comprising an active protein domain. A fusion protein as described in any one of items 8 to 8.
10. Claim 2 or The polypeptide according to claim 3 or the fusion protein according to any one of claims 4 to 8 Quality.
11. The adenine deaminase domain is TadA (tRNA-specific adenosine deaminase Ze) and / or TadA * (An evolved tRNA-specific adenosine deaminase) or a polypeptide according to any one of claims 2, 3, or 10, or claim 4 A fusion protein as described in any one of items 10.
12. A polypeptide according to any one of claims 1 to 3, 5 or 9 to 11, or Polynucleotide encoding the fusion protein according to any one of claims 4 to 11 。
13. Claim 1, the polynucleotide is codon-optimized for expression in a living organism. The polynucleotide described in 2.
14. The polymorphism according to claim 13, wherein the organism is an animal, plant, fungus, archaea, or bacterium. nucleotide.
15. A complex comprising the fusion protein and guide nucleic acid according to any one of claims 4 to 9 。
16. A complex comprising the fusion protein and guide nucleic acid according to claim 10 or claim 11.
17. A nucleic acid construct encoding the complex according to claim 15 or claim 16.
18. (a) A polypeptide according to any one of claims 1 to 3, 5 or 9, or A fusion protein according to any one of the requirements 4 to 9, and a set comprising (b) guide nucleic acid. A finished product.
19. The polynucleotide described in any one of claims 12 to 14 or claim 17 An expression cassette or vector containing a nucleic acid construct.
20. (a) Cas12a domain, containing one amino acid sequence from SEQ ID NOs: 1 to 24 A fusion protein comprising a linker and a polypeptide of interest, wherein Cas12 The α domain is connected to the poly(α) domain via one of the amino acid sequences of SEQ ID NOs: 1 to 24. A fusion protein linked to a peptide, or a nucleic acid encoding the fusion protein. ; and (b) A guide nucleic acid comprising a spacer sequence and a repeat sequence, wherein the guide nucleic acid is The fusion protein can form a complex with the Cas12a domain, and the spec The ser sequence can hybridize to the target nucleic acid, thereby the Cas12a sequence The main polypeptide and the polypeptide of interest are guided to the target nucleic acid, thereby the system The target nucleic acid is modified (e.g., cleaved or edited) or regulated (e.g., regulated transcription) Guide nucleic acids that can be used V-type Clustered Regularly Interspaced Show rt Palindromic Repeats (CRISPR) related (Cas) (CR ISPR-Cas system.
21. The Cas12a domain contains a mutation in the nuclease active site, as described in claim 20. system.
22. The Cas12a domain is located at its C-terminus and / or N-terminus in sequence numbers 1-2. The amino acid sequence of claim 20 or claim 21 is linked to any one of the four amino acid sequences. The system.
23. The Cas12a domain, via its C-terminus, is located at the N-terminus of the polypeptide of interest. Claim 20, which is linked via any one of the amino acid sequences of SEQ ID NOs: 1 to 24. The system described in any one of items 22.
24. The Cas12a domain, via its N-terminus, is located at the C-terminus of the polypeptide of interest. Claim 20, which is linked via any one of the amino acid sequences of SEQ ID NOs: 1 to 24. The system described in any one of items 22.
25. The polypeptide of interest mentioned above exhibits deaminase (deamination) activity, nicasse activity, and Combinase activity, transposase activity, methylase activity, glycosylase (DNA) Lycosylase activity, glycosylase inhibitory activity (e.g., uracil-DNA glycosylase) Zein inhibitor (UGI), demethylase activity, transcriptional activation activity, transcriptional repression activity, Decryption factor activity, histone modification activity, nuclease activity, single-stranded RNA cleavage activity, double-stranded RNA RNA cleavage activity, restriction endonuclease activity (e.g., Fok1), nucleic acid binding activity, Tilttransferase activity, DNA repair activity, DNA damage activity, dismutase activity, A Lucylization activity, depurination activity, oxidative activity, pyrimidine dimer formation activity, integrator Helicase activity, transposase activity, polymerase activity, ligase activity, helicase activity, and / or at least one polypeptide or protein having photolyase activity A system according to any one of claims 20 to 24, comprising a quality domain.
26. The polypeptide of interest mentioned above is adenine deaminase or adenine deaminase domain. The system according to any one of claims 20 to 25.
27. The adenine deaminase is tRNA-specific adenosine deaminase (TadA). The system according to claim 26.
28. The polypeptide of interest is an adenine deaminase dimer (for example, the first adenine deaminase dimer). The system according to claim 26, wherein the enzyme is a minase and a second adenine deaminase.
29. (a) and (b) either or both are one or more expression cassettes and / or The system according to any one of claims 20 to 28, wherein the vector is included.
30. The polynucleotide according to any one of claims 12 to 14, the nucleus according to claim 17 Acid construct, expression cassette or vector according to claim 19, or claims 20 to 2 A cell containing the system described in any one of item 9.
31. Target nucleic acids (a) (i) A fusion protein according to any one of claims 4 to 11, and (a) (ii) Guide nucleic acids; (b) The composite according to claim 15 or 16; (c) comprising the fusion protein and guide nucleic acid according to any one of claims 4 to 11 compositions; and / or (d) The system according to any one of claims 20 to 28 A method for modifying a target nucleic acid, comprising bringing it into contact with a target nucleic acid, thereby modifying the target nucleic acid.
32. Cells or cell-free systems containing target nucleic acids (a) (i) The polypeptide according to claim 3 or claim 5, or claims 4 to 1 A polynucleotide encoding the fusion protein described in any one of item 1, or a polynucleotide that (a)(ii) an expression cassette or vector, and (ii) a guide nucleic acid or containing the same. Expression cassette or vector; and / or (b) A nucleic acid construct encoding the complex described in claim 15 or claim 16 and / or an expression cassette or vector containing it. Under conditions in which the fusion protein is expressed and forms a complex with the guide nucleic acid, contact This includes causing the complex to hybridize with the target nucleic acid, thereby causing the target nucleic acid A method for modifying a target nucleic acid.
33. Target nucleic acids (a)(i) The fusion protein according to claim 10 or claim 11, and (a)(i i) Guide nucleic acids; (b) The composite according to claim 16; (c)(i) The fusion protein according to claim 10 or claim 11 and (c)(i i) Compositions comprising guide nucleic acids; and / or (d) (i) The system according to any one of claims 26 to 28 The process includes contacting the adenine deaminase domain with the adenine in the target nucleic acid. Syn (A) is converted to guanine (G), thereby editing the target nucleic acid to induce mutations (for example) A method for editing target nucleic acids, which involves causing point mutations.
34. Cells or cell-free systems containing target nucleic acids (a) (i) Polynucleation encoding the fusion protein described in claim 10 or claim 11 Rheotide, or an expression cassette or vector containing it, and (a)(ii) Guy Nucleic acid or an expression cassette or vector containing it; (b) A nucleic acid construct encoding the complex described in claim 16, or an expression cassette containing the same To or vector, and / or (c) The system according to claim 29 Under conditions in which the fusion protein is expressed and forms a complex with the guide nucleic acid, contact This includes causing the complex to hybridize to the target nucleic acid, and the adenine deami The enzyme domain converts adenosine (A) in the target nucleic acid to guanine (G), and A method for editing a target nucleic acid, wherein the target nucleic acid is edited to produce a (point) mutation.
35. The point mutation causes an A→G conversion in the sense (e.g., "+"; template) strand of the target nucleic acid. , or in the T→C conversion in the antisense (e.g., "-"; complementary) strand of the target nucleic acid A method according to claim 33 or 34.
36. (a) When bound to a guide nucleic acid (e.g., gRNA), it is specific to the target nucleic acid sequence. Targeted binding Cas12a domain; (b) First adenine deaminase domain, (c) Second adenine deaminase domain Includes, The first and second adenine deaminase domains are the Cas12a domain and Furthermore, when present with the gRNA, it removes adenosine bases from the single-stranded portion of the target nucleic acid sequence. Amination The Cas12a domain is accessed via any one of the amino acid sequences of SEQ ID NOs: 1 to 24. The first adenine deaminase domain or the second adenine deaminase domain A fusion protein linked to the nucleotide.
37. The first adenine deaminase is wild-type adenine deaminase, and the second a The denine deaminase domain is a mutated / evolved adenine deaminase domain, and The C-terminus of the Cas12a domain is one of the amino acid sequences of SEQ ID NOs: 11-15 It is linked to the N-terminus of the second adenine deaminase domain via; the Cas The C-terminus of the 12a domain is preceded by one of the amino acid sequences of SEQ ID NOs: 11-24. The first adenine deaminase domain is ligated to the N-terminus; or the Cas The N-terminus of the 12a domain is via one of the amino acid sequences of SEQ ID NOs: 1 to 10 The fusion according to claim 36, which is linked to the C-terminus of the second adenine deaminase domain. Composite protein.
38. (a) First adenine deaminase domain; (b) Second adenine deaminase domain; and (c) Cas12a (Cpf1) domain containing a mutation in the nuclease active site Includes, The second adenine deaminase domain is the first adenine deaminase domain Unlike the above, the C-terminus of the first adenine deaminase domain is the second deaminase The N-terminus of the domain is ligated to the N-terminus of the Cas12a domain, and the N-terminus of sequence numbers 1 to 10 The C-terminus of the second adenine deaminase domain via any one of the amino acid sequences A fusion protein linked to it.
39. The first adenine deaminase domain is a wild-type adenosine deaminase domain A fusion protein according to any one of claims 36 to 38.
40. Adenosine deaminases in which the second adenine deaminase domain has mutated / evolved The main fusion protein is described in any one of claims 36 to 39.
41. (a) Cas12a (Cpf1) domain; (b) the first adenine deaminase domain; and (c) Second adenine deaminase domain, Includes, The second adenine deaminase domain is the first adenine deaminase domain Unlike the above, the C-terminus of the first adenine deaminase domain is the second deaminase The domain is ligated to the N-terminus, and the C-terminus of the Cas12a domain is the first adenine It is linked to the N-terminus of the deaminase domain, and If the first deaminase domain is a wild-type adenine deaminase domain, The Cas12a domain is accessed via any one of the amino acid sequences of SEQ ID NOs: 11-24 The first adenine deaminase domain is ligated to the N-terminus, and the first deaminase If the domain is a mutated / evolved adenine deaminase domain, then Cas12a The domain is connected to the first adenine via any one of the amino acid sequences of SEQ ID NOs: 11-15. A fusion protein linked to the N-terminus of the endoaminase domain.
42. The first adenine deaminase domain is wild-type tRNA-specific adenosine deaminase -ase or mutated / evolved tRNA-specific adenosine deaminase domain, claim The fusion protein described in item 41.
43. The second adenine deaminase domain described above is wild-type tRNA-specific adenosine deaminase -ase or mutated / evolved tRNA-specific adenosine deaminase domain, claim The fusion protein according to item 41 or claim 42.
44. The wild-type tRNA-specific adenosine deaminase is wild-type E. coli TadA. A fusion protein as described in any one of the requests 39, 42, or 43.
45. The aforementioned mutated / evolved tRNA-specific adenosine deaminase domain is evolved in the large intestine. Bacterium TadA * The fusion protein according to any one of claims 40, 42, or 43 quality.
46. The fusion tadA according to claim 44, wherein the Escherichia coli TadA contains the amino acid sequence of Sequence ID No.
47. Protein.
47. The aforementioned E. coli Tada * The fusion according to claim 45, wherein the fusion comprises the amino acid sequence of sequence number 48. protein.
48. Claims 36 to 47, wherein the Cas12a domain includes a mutation in the nuclease active site. A fusion protein as described in any one of the items.
49. The first deaminase domain, via a linker, connects to the second deaminase domain A fusion protein according to any one of claims 36 to 48, which is linked to the fusion protein.
50. The fusion protein according to claim 49, wherein the linker is a GS linker.
51. The aforementioned GS linker is (GSS)n, S(GGS)n (Sequence No. 25), SGGS (Sequence No. 25) Number 26), SGGSGGGGS (Sequence No. 27), SGSETPGTSESATPE S (Sequence ID 28), and / or SGGSSGGSSGSETPGTSEATPE The fusion protein according to claim 50, which is SSGGSSGGS (Sequence ID 29).
52. The linker is SGGSSGGSSGSETPGTSESATPESSGGSSGG The fusion protein according to claim 50, which is (Sequence ID 29).
53. Polynucleo encoding the fusion protein according to any one of claims 36 to 52 Chido.
54. Claim 5, the polynucleotide is codon-optimized for expression in a living organism. The polynucleotide described in 3.
55. A fusion protein and guide nucleic acid according to any one of claims 36 to 52 Combine.
56. A nucleic acid construct encoding the complex described in claim 55.
57. The polynucleotide according to claim 53 or claim 54 or the nucleus according to claim 56 An expression cassette or vector containing an acid construct.
58. The polynucleotide according to claim 53 or claim 54 or the nucleus according to claim 56 Cells comprising an acid construct or the expression cassette or vector according to claim 57.
59. A set comprising a fusion protein and a guide nucleic acid according to any one of claims 36 to 52 A finished product.
60. Target nucleic acids (a)(i) A fusion protein according to any one of claims 36 to 52, and (a (ii) Guide nucleic acids; (b) The composite according to claim 55; and / or (c) The composition according to claim 59 This includes making contact with The adenine deaminase domain converts adenosine (A) in the target nucleic acid into guanine ( Convert to G), thereby editing the target nucleic acid to produce (point) mutations in the target nucleic acid. A method for editing target nucleic acids.
61. Cells or cell-free systems containing target nucleic acids (a)(i) Polynucleotides according to claim 53 or claim 54 and (a) ii) Guide nucleic acids, and / or (a)(i) and / or (a)(ii) Expression cassettes or vectors; and / or (b) The nucleic acid construct and / or expression cassette containing the same as described in claim 56 vector Under conditions where the fusion protein is expressed and forms a complex with the guide nucleic acid, contact is made. The complex includes the above, and the complex hybridizes with the target nucleic acid, The adenine deaminase domain converts adenosine (A) in the target nucleic acid into guanine ( Convert to G), thereby editing the target nucleic acid to produce (point) mutations in the target nucleic acid. A method for editing target nucleic acids.
62. The point mutation causes an A→G conversion in the sense (e.g., "+"; template) strand of the target nucleic acid. , or in the T→C conversion in the antisense (e.g., "-"; complementary) strand of the target nucleic acid A method according to claim 60 or 61.
63. The guide nucleic acid includes a repeat sequence and a spacer sequence from 5' to 3', and the space - The sequence is 70% to 100% complementary to the target nucleic acid (protospacer), claim. The method according to claim 60 or 61.
64. Claim 60, wherein the target nucleic acid is adjacent to a protospacer adjacent motif (PAM). The method described in any one of paragraphs 63 to 63.
65. The PAM is a nucleotide sequence of 5'-TTN, 5'-TTTV, or 5'-TTTN. The method according to claim 64, including the method described in claim 64.
66. A polypeptide according to any one of claims 1 to 3, or claims 4 to 11 or 36. The fusion protein described in any one of paragraphs 52, along with, if applicable, its instructions for use. kit includes.
67. The polynucleotide according to any one of claims 12 to 14, 53 or 54, The expression cassette or vector containing it, and / or its usage instructions, if applicable. A kit that includes the book.
68. Cas12a guide nucleic acid and / or expression cassette or vector containing it The kit according to claim 66 or 67, further comprising the above.
69. The guide nucleic acid has a nucleic acid sequence that is identical or complementary to the target nucleic acid sequence as the framework of the guide nucleic acid. The kit according to claim 68, comprising a cloning site for cloning within a cell.
70. The polypeptide is fused to the fusion protein, forming one or more nuclear localization signatures. Claims 66 to 69 further comprising a nucleotide or a polynucleotide encoding it Either one of the kits described in item 1.
71. Claim 6, wherein the polynucleotide further encodes one or more selection markers. A kit as described in any one of items 6 through 70.
72. The polynucleotide is mRNA, and one is contained within the encoded fusion protein. A kit according to any one of claims 66 to 71, which encodes a plurality of introns. 。