Frizzled receptor antibodies and their use

Antibodies targeting the cysteine-rich domains of Frizzled receptors inhibit Wnt signaling, addressing the challenges of cancer therapy by reducing cancer cell proliferation and drug resistance.

JP2026123255APending Publication Date: 2026-07-29ANTLERA THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026078234
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2019-08-13
Filing Date
2026-05-07
Publication Date
2026-07-29

AI Technical Summary

Technical Problem

Existing therapies targeting the Wnt signaling pathway for cancer treatment are challenging due to the complexity of downstream activation and the difficulty in inhibiting frizzled receptors, particularly in cancer stem cells, which contribute to drug resistance and tumor recurrence.

Method used

Development of antibodies that specifically bind to the cysteine-rich domains of Frizzled receptors (FZD1, 2, 4, 5, 7, 8, and 9) with defined complementarity-determining regions (CDRs) to inhibit Wnt signaling and target cancer stem cells.

Benefits of technology

The antibodies effectively inhibit Wnt ligand binding to Frizzled receptors, disrupting signaling pathways and reducing cancer cell proliferation, particularly in cancers with mutations in RNF43 and ZNRF3, offering potential therapeutic benefits for various cancer types.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026123255000001_ABST
    Figure 2026123255000001_ABST
Patent Text Reader

Abstract

This invention provides an antibody that binds to the Frizzled receptor, particularly an antibody that binds to the Frizzled receptor 4-cysteine-rich domain, and a method for using the same. [Solution] The present invention provides an isolated antibody and immunoconjugate that specifically bind to the Frizzled receptor (FZD) 4 cysteine-rich domain (CRD), comprising a light chain variable region and a heavy chain variable region, wherein the heavy chain variable region comprises complementarity-determining regions CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises complementarity-determining regions CDR-L1, CDR-L2, and CDR-L3, and the amino acid sequence of the CDR comprises or consists of a sequence selected from a specific group of sequences.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] field This disclosure relates to antibodies that bind to the frizzled receptor, in particular to antibodies that bind to the frizzled receptor 4 cysteine-rich domain, and to the use of the same.

[0002] Cross-reference of related applications This application claims the benefit of the priority date of U.S. Provisional Application No. 62 / 885,781, filed on 12 August 2019, and U.S. Provisional Application No. 62 / 886,292, filed on 13 August 2019, the entirety of which is incorporated herein by reference. [Background technology]

[0003] background Frizzled receptors (FZDs) are a key class of seven-transmembrane receptors involved in many important biological processes, including development, cell proliferation, survival, migration, and stem cell maintenance. In adult animals, signaling pathways are activated when Wnt ligands interact with the Frizzled family of seven-transmembrane receptors, regulating the regeneration and differentiation of stem and progenitor cells during embryonic development and tissue homeostasis. Abnormal expression and signaling of these receptors and their ligands (Wnt) are associated with numerous cancers, including colon, lung, breast, and ovarian cancers. Often, multiple Wnt ligands and / or frizzled receptors are upregulated, leading to abnormal signaling that promotes tumorigenesis. Therefore, inhibition of multiple frizzled receptors may be necessary to achieve even better anticancer effects. Furthermore, frizzled receptors are also involved with cancer stem cells, a small population of cancer cells thought to be responsible for drug resistance, tumor recurrence, and metastasis. Thus, inhibition of FZD receptors (any one or more receptors), including FZD4, may be an effective method to target cancer stem cells and treat various types of cancer.

[0004] Wnt signaling leads to the activation of both classical and non-classical signaling pathways. Non-classical pathways activate signaling molecules that, rather than involving nuclear or transcriptional activity, activate cytoplasmic signaling that regulates the cytoskeleton and calcium levels. These pathways primarily play a role in regulating cell polarity or migration.

[0005] The classical pathway primarily regulates transcriptional activity by modulating the cytoplasmic level of β-catenin. In the unstimulated state, β-catenin associates with a degradation complex composed of Axin, APC, CD1, and GSKβ, which leads to phosphorylation, ubiquitination, and proteasomal degradation of β-catenin. Wnt signaling is active when Wnt binds to the frizzled (FDZ) 7-pass transmembrane receptor and co-receptor low-density lipoprotein receptor-related protein (either LRP5 or LRP6). This signaling destabilizes the complex, in part, by attracting disheveled (Dsh / Dvl) to the plasma membrane, leading to β-catenin accumulation, which in turn causes β-catenin to translocate to the nucleus and activate TCF / LEF-mediated transcription.

[0006] Several human cancers are caused by mutations in the cytoplasmic components of the WNT pathway, resulting in ligand-independent activation of Wnt target genes. For example, inactivation of APC mutations and activation of β-catenin mutations are major underlying causes in human colorectal cancer. Because this pathway is activated downstream of cell surface receptors, the development of targeted therapies against the Wnt pathway has proven challenging. However, in recent years, cancers causing mutations in RNF43 (colon cancer, endometrial cancer, pancreatic cancer, gastric cancer, ovarian cancer, liver cancer) and its homolog ZNRF3 (adrenocortical carcinoma and osteosarcoma), which are negative regulators of Wnt signaling, have been identified, suggesting ligand-dependent tumor growth. In fact, RNF43 and ZNRF3 are Wnt target genes encoding transmembrane E3 ubiquitin ligases that target the Frizzled receptor, and loss-of-function mutations in them can lead to high expression of FZD, making tumor cells sensitive to inhibition of Wnt-dependent signaling. [Overview of the project]

[0007] overview The following summary is intended to introduce readers to various aspects of this disclosure, but is not intended to define or limit any invention.

[0008] In one aspect, the disclosure provides antibodies that specifically bind to one or more cysteine-rich domains (CRDs) of human Frizzled receptors selected from FZD 1, 2, 4, 5, 7, 8, and 9, comprising a light chain variable region and / or a heavy chain variable region, wherein the heavy chain variable region comprises complementarity-determining regions CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises complementarity-determining regions CDR-L1, CDR-L2, and CDR-L3, and the amino acid sequence of the CDR comprises or consists of sequences selected from the sequences in Table 1a or Table 3a. In one aspect, the CDR comprises (a) a complete sequence set, (b) a light chain sequence set, or (c) a heavy chain sequence set selected from antibodies identified in Table 1a or Table 3a.

[0009] In another aspect, the CDR comprises or consists of the following sequences: CDR-H1 is selected from the group consisting of ISYYYM (SEQ ID NO: 1), IYSYYM (SEQ ID NO: 2), LSYYYM (SEQ ID NO: 3), IYYYSI (SEQ ID NO: 4), LYSYYM (SEQ ID NO: 5), LSSYSM (SEQ ID NO: 6), ISYYYI (SEQ ID NO: 7), LSYSSM (SEQ ID NO: 8), IYYYYM (SEQ ID NO: 9), LYYYSI (SEQ ID NO: 10), ISSYYI (SEQ ID NO: 11), FSSSSI (SEQ ID NO: 12), LSYYSI (SEQ ID NO: 13), LYSYYI (SEQ ID NO: 14), LSSYYM (SEQ ID NO: 15), LSYYYI (SEQ ID NO: 16), ISSYYM (SEQ ID NO: 17), LSYYSM (SEQ ID NO: 18), LYSYSI (SEQ ID NO: 19), LYYYYI (SEQ ID NO: 20), IYSYYI (SEQ ID NO: 21), ISYSYI (SEQ ID NO: 22), and ISYYSM (SEQ ID NO: 23); CDR-H2 is SIYSYYGYTY (SEQ ID NO: 24), SIYSSSSSTY (SEQ ID NO: 25), SIYPSSSYTY (SEQ ID NO: 26), SIYSSSSYTS (SEQ ID NO: 27), YISSYSGSTY (SEQ ID NO: 28), and SIYSSYGYTY (SEQ ID NO: 29), YISSYYGYTY (SEQ ID NO: 30), SIYPSSSSTY (SEQ ID NO: 31), SIYSSSGYTY (SEQ ID NO: 32), YISSYSGSTS (SEQ ID NO: 33), SISSYYGSTY (SEQ ID NO: 34), SIYSYYGSTY (SEQ ID NO: 35), SIYPYSGYTY (SEQ ID NO: 36), YISPYYGYTS (SEQ ID NO: 37), SISSSSGYTY (SEQ ID NO: 38), SIYSYSSSTY (SEQ ID NO: 39), SISPSSSYTY (SEQ ID NO: 39). 40. YISPYYGYTY (SEQ ID NO: 41), SISPYSSSTY (SEQ ID NO: 42), SIYSSYGSTY (SEQ ID NO: 43), SIYSSSSYTY (SEQ ID NO: 44), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGSTY (SEQ ID NO: 45). 46. ​​SIYPSYGSTY (SEQ ID NO: 47), YISSYSSYTY (SEQ ID NO: 48), SIYSYYSSTY (SEQ ID NO: 49), YISSSYGYTS (SEQ ID NO: 50), SISPYSSYTY (SEQ ID NO: 51). 52) SIYPYYSYTY (SEQ ID NO: 53), SISPYYGYTS (SEQ ID NO: 54), SISPSYSSTY (SEQ ID NO: 55), SISSSYSSTY (SEQ ID NO: 56), SIYPYSGSTS (SEQ ID NO: 57), SISSYYSSTS (SEQ ID NO: 57) 58) and SIYSYSGYTY (SEQ ID NO: 59).CDR-H3、SSFSWAM (SEQ ID NO: 60)、SSFYWAL (SEQ ID NO: 61)、SWFGWGI (SEQ ID NO: 62)、YWFSYGYASYPAF (SEQ ID NO: 63)、HPWYGM (SEQ ID NO: 64) 65)、PAPGHWGF (SEQ ID NO: 66)、SSFFWAM (SEQ ID NO: 67)、SAFYWAM (SEQ ID NO: 68)、HFFAM (SEQ ID NO: 69)、SWWAWAF (SEQ ID NO: 70)、SAFGWF (SEQ ID NO: 70) (SEQ ID NO: 72)、PYYWSGGF (SEQ ID NO: 73)、HPSSSWFSFGAL (SEQ ID NO: 74)、SAFYWAF (SEQ ID NO: 75)、SSYAWAM (SEQ ID NO: 76)、SSFYWAI (SEQ ID NO: 77) 78)、PAVWVGL (SEQ ID NO: 79)、SWVFWAL (SEQ ID NO: 80)、SWVYWGM (SEQ ID NO: 81)、SWVYWAL (SEQ ID NO: 82)、NOSSYAWAI (SEQ ID NO: 83) 84)、HGASFGSGAPAF (SEQ ID NO: 85)、SCFFWAM (SEQ ID NO: 86)、WAFFGL (SEQ ID NO: 87)、SSFYFAM (SEQ ID NO: 88)、SAFSWAI (SEQ ID NO: 89)、SGFY IDW NO: 90)、PSVGYAAF (SEQ ID NO: 91)、SWVGWGL (SEQ ID NO: 92)、SSVGYVAM (SEQ ID NO: 93)、SWVYWAF (SEQ ID NO: 94)、YYYYSSSVYFWYAAL (SEQ ID NO: 95). 96)、SWVYWAI (SEQ ID NO: 97)、SWVGWGI (SEQ ID NO: 98)、SSVYWAL (SEQ ID NO:99) Selected from the group consisting of WGGWGSGGYFYAAL (SEQ ID NO: 100), FWYPGM (SEQ ID NO: 101), and SSFAWAF (SEQ ID NO: 102), CDR-L1 is SVSSA (SEQ ID NO: 103), CDR-L2 is SASSLYS (SEQ ID NO: 104), CDR-L3は、HPWSGGYLI (SEQ ID NO: 105), PVGYWGVPI (SEQ ID NO: 106), VSGGAHALI (SEQ ID NO: 107), VSSAYPI (SEQ ID NO: 108), FWGVPI (SEQ ID NO: 109), SYYHYAALI (SEQ ID NO: 110), WYYAPI (SEQ ID NO: 111), SHSYSLI (SEQ ID NO: 112), SGYGPF (SEQ ID NO: 113), SWSSPI (SEQ ID NO: 114), HYSVYASLI (SEQ ID NO: 115), and PHPPSLI (SEQ ID NO: 115). 116, VAYSHVGLI (SEQ ID NO: 117), GYGAPI (SEQ ID NO: 118), SWYSLI (SEQ ID NO: 119), PGYLF (SEQ ID NO: 120), VWFGLI (SEQ ID NO: 121), VYYGSPLF (SEQ ID NO: 120) 122, HAHSPLI (SEQ ID NO: 123), SSAYYPF (SEQ ID NO: 124), GHASPI (SEQ ID NO: 125), SSGGWSLI (SEQ ID NO: 126), VAWSSFLI (SEQ ID NO: 127), SVAAASLI (SEQ ID NO: 126). 128) SGWWGVSLI (SEQ ID NO: 129), SYAAYLF (SEQ ID NO: 130), HGSLF (SEQ ID NO: 131), YAGVSNLF (SEQ ID NO: 132), GWPYSALF (SEQ ID NO: 133), SGYYPSLF (SEQ ID NO: 132). 134)、SYHSGSGLI (SEQ ID NO: 135), HGYSASLI (SEQ ID NO: 136), APGWALF (SEQ ID NO: 137), GHSSPI (SEQ ID NO: 138), GWPSLF (SEQ ID NO: 139), VPGYPVPI (SEQ ID NO: 138). 140) HYYSHLI (SEQ ID NO: 141), GPASSLI (SEQ ID NO: 142), SVGSSYYLI (SEQ ID NO: 142)selected from the group consisting of YYGPWVLI (SEQ ID NO: 144), AASWGYPF (SEQ ID NO: 145), HWSYPI (SEQ ID NO: 146), and GGWGPF (SEQ ID NO: 147).

[0010] In yet another aspect, the CDRs comprise or consist of the following sequences: CDR-H1 is selected from the group consisting of ISYYYM (SEQ ID NO: 1), IYSYYM (SEQ ID NO: 2), LSYYYM (SEQ ID NO: 3), IYYYSI (SEQ ID NO: 4), LYSYYM (SEQ ID NO: 5), LSSYSM (SEQ ID NO: 6), ISYYYI (SEQ ID NO: 7), LSYSSM (SEQ ID NO: 8), IYYYYM (SEQ ID NO: 9), LYYYSI (SEQ ID NO: 10), ISSYYI (SEQ ID NO: 11), FSSSSI (SEQ ID NO: 12), LSYYSI (SEQ ID NO: 13), LYSYYI (SEQ ID NO: 14), LSSYYM (SEQ ID NO: 15), LSYYYI (SEQ ID NO: 16), ISSYYM (SEQ ID NO: 17), LSYYSM (SEQ ID NO: 18), LYSYSI (SEQ ID NO: 19), LYYYYI (SEQ ID NO: 20), IYSYYI (SEQ ID NO: 21), ISYSYI (SEQ ID NO: 22), and ISYYSM (SEQ ID NO: 23); CDR-H2 is SIYSYYGYTY (SEQ ID NO: 24), SIYSSSSSTY (SEQ ID NO: 25), SIYPSSSYTY (SEQ ID NO: 26), SIYSSSSYTS (SEQ ID NO: 27), YISSYSGSTY (SEQ ID NO: 28), and SIYSSYGYTY (SEQ ID NO: 29), YISSYYGYTY (SEQ ID NO: 30), SIYPSSSSTY (SEQ ID NO: 31), SIYSSSGYTY (SEQ ID NO: 32), YISSYSGSTS (SEQ ID NO: 33), SISSYYGSTY (SEQ ID NO: 34), SIYSYYGSTY (SEQ ID NO: 35), SIYPYSGYTY (SEQ ID NO: 36), YISPYYGYTS (SEQ ID NO: 37), SISSSSGYTY (SEQ ID NO: 38), SIYSYSSSTY (SEQ ID NO: 39), SISPSSSYTY (SEQ ID NO: 39). 40. YISPYYGYTY (SEQ ID NO: 41), SISPYSSSTY (SEQ ID NO: 42), SIYSSYGSTY (SEQ ID NO: 43), SIYSSSSYTY (SEQ ID NO: 44), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGSTY (SEQ ID NO: 45). 46. ​​SIYPSYGSTY (SEQ ID NO: 47), YISSYSSYTY (SEQ ID NO: 48), SIYSYYSSTY (SEQ ID NO: 49), YISSSYGYTS (SEQ ID NO: 50), SISPYSSYTY (SEQ ID NO: 51). 52) SIYPYYSYTY (SEQ ID NO: 53), SISPYYGYTS (SEQ ID NO: 54), SISPSYSSTY (SEQ ID NO: 55), SISSSYSSTY (SEQ ID NO: 56), SIYPYSGSTS (SEQ ID NO: 57), SISSYYSSTS (SEQ ID NO: 57) 58) and SIYSYSGYTY (SEQ ID NO: 59).CDR-H3、SSFSWAM (SEQ ID NO: 60)、SSFYWAL (SEQ ID NO: 61)、SWFGWGI (SEQ ID NO: 62)、YWFSYGYASYPAF (SEQ ID NO: 63)、HPWYGM (SEQ ID NO: 64) 65)、PAPGHWGF (SEQ ID NO: 66)、SSFFWAM (SEQ ID NO: 67)、SAFYWAM (SEQ ID NO: 68)、HFFAM (SEQ ID NO: 69)、SWWAWAF (SEQ ID NO: 70)、SAFGWF (SEQ ID NO: 70) (SEQ ID NO: 72)、PYYWSGGF (SEQ ID NO: 73)、HPSSSWFSFGAL (SEQ ID NO: 74)、SAFYWAF (SEQ ID NO: 75)、SSYAWAM (SEQ ID NO: 76)、SSFYWAI (SEQ ID NO: 77) 78)、PAVWVGL (SEQ ID NO: 79)、SWVFWAL (SEQ ID NO: 80)、SWVYWGM (SEQ ID NO: 81)、SWVYWAL (SEQ ID NO: 82)、NOSSYAWAI (SEQ ID NO: 83) 84)、HGASFGSGAPAF (SEQ ID NO: 85)、SCFFWAM (SEQ ID NO: 86)、WAFFGL (SEQ ID NO: 87)、SSFYFAM (SEQ ID NO: 88)、SAFSWAI (SEQ ID NO: 89)、SGFY IDW NO: 90)、PSVGYAAF (SEQ ID NO: 91)、SWVGWGL (SEQ ID NO: 92)、SSVGYVAM (SEQ ID NO: 93)、SWVYWAF (SEQ ID NO: 94)、YYYYSSSVYFWYAAL (SEQ ID NO: 95). 96)、SWVYWAI (SEQ ID NO: 97)、SWVGWGI (SEQ ID NO: 98)、SSVYWAL (SEQ ID NO:99) Selected from the group consisting of WGGWGSGGYFYAAL (SEQ ID NO: 100), FWYPGM (SEQ ID NO: 101), and SSFAWAF (SEQ ID NO: 102), CDR-L1 is SVSSA (SEQ ID NO: 103), CDR-L2 is SASSLYS (SEQ ID NO: 104), CDR-L3は、HPWSGGYLI (SEQ ID NO: 105), PVGYWGVPI (SEQ ID NO: 106), VSGGAHALI (SEQ ID NO: 107), VSSAYPI (SEQ ID NO: 108), FWGVPI (SEQ ID NO: 109), SYYHYAALI (SEQ ID NO: 110), WYYAPI (SEQ ID NO: 111), SHSYSLI (SEQ ID NO: 112), SGYGPF (SEQ ID NO: 113), SWSSPI (SEQ ID NO: 114), HYSVYASLI (SEQ ID NO: 115), and PHPPSLI (SEQ ID NO: 115). 116, VAYSHVGLI (SEQ ID NO: 117), GYGAPI (SEQ ID NO: 118), SWYSLI (SEQ ID NO: 119), PGYLF (SEQ ID NO: 120), VWFGLI (SEQ ID NO: 121), VYYGSPLF (SEQ ID NO: 120) 122, HAHSPLI (SEQ ID NO: 123), SSAYYPF (SEQ ID NO: 124), GHASPI (SEQ ID NO: 125), SSGGWSLI (SEQ ID NO: 126), VAWSSFLI (SEQ ID NO: 127), SVAAASLI (SEQ ID NO: 126). 128) SGWWGVSLI (SEQ ID NO: 129), SYAAYLF (SEQ ID NO: 130), HGSLF (SEQ ID NO: 131), YAGVSNLF (SEQ ID NO: 132), GWPYSALF (SEQ ID NO: 133), SGYYPSLF (SEQ ID NO: 132). 134)、SYHSGSGLI (SEQ ID NO: 135), HGYSASLI (SEQ ID NO: 136), APGWALF (SEQ ID NO: 137), GHSSPI (SEQ ID NO: 138), GWPSLF (SEQ ID NO: 139), VPGYPVPI (SEQ ID NO: 138). 140) HYYSHLI (SEQ ID NO: 141), GPASSLI (SEQ ID NO: 142), SVGSSYYLI (SEQ ID NO: 142)The group is selected from 143), YYGPWVLI (SEQ ID NO: 144), AASWGYPF (SEQ ID NO: 145), HWSYPI (SEQ ID NO: 146), and GGWGPF (SEQ ID NO: 147).

[0011] In a further aspect, this disclosure may include: (i) Heavy chain amino acid sequences listed in Table 2, (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity with the heavy chain amino acid sequences listed in Table 2, wherein the CDR sequence is one of the CDR sequence sets listed in Table 1a or Table 3a, or (iii)(i) Conservatively substituted amino acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. The present invention provides the aforementioned antibody, which includes a heavy chain variable region.

[0012] In a further aspect, this disclosure may include: (i) Light chain amino acid sequences listed in Table 2, (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity with the light chain amino acid sequences listed in Table 2, wherein the CDR sequence is one of the CDR sequence sets listed in Table 1a or Table 3a, or (iii)(i) Conservatively substituted amino acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. The present invention provides an antibody further comprising a light chain variable region including the following:

[0013] In a further embodiment, the disclosure provides an antibody that specifically binds to FZD4. In a further embodiment, the antibody CDR sequence that specifically binds to FZD4 is a set of antibody CDR sequences selected from antibodies 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, 5077-5080, or 5081.

[0014] In a further embodiment, the disclosure provides an antibody that specifically binds to FZD4 and at least one other receptor selected from FZD1, 2, 5, 7, 8, and 9. In a further embodiment, the CDR sequence is a set of CDR sequences of antibodies selected from antibodies 5014, 5016, 5018-5023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. In a further embodiment, the antibody preferentially binds to Frizzled 4 (FZD4) compared to another FZD receptor. In a further embodiment, the CDR sequence is a set of CDR sequences of antibodies selected from antibodies 5028, 5029, 5031, 5034, 5035, 6497, 6498, 5039, 5045, 5048, 5054, 5056, 5057, 5067, 5073, 5074, and 5075. In a further embodiment, the antibody has a binding affinity of approximately 0.2 nM to approximately 15.3 nM, as measured by surface plasmon resonance.

[0015] In a further embodiment, the CDR sequence is a set of CDR sequences of antibodies selected from antibodies 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, 5077-5080, or 5081.

[0016] In further embodiments, the antibody is monoclonal, humanized, single-stranded, antibody fragment, polyvalent, bispecific, contains a non-natural glycosylation pattern, contains cysteine ​​substitution or addition, or blocks the binding of Wnt to FZD. In further embodiments, the antibody fragment is selected from the group consisting of fragments selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and their multimers. In further embodiments, the polyvalent antibody is bivalent, trivalent, or tetravalent. In further embodiments, the cysteine ​​substitution is located in the constant region or framework region. In further embodiments, the bispecific antibody further binds to LRP 5 and / or 6. In further embodiments, the antibody contains a non-natural glycosylation pattern. In further embodiments, the cysteine ​​substitution is located in the constant region or framework region. In further embodiments, the antibody described herein blocks the binding of Wnt to FZD.

[0017] In another aspect, the present disclosure provides an immunoconjugate comprising an antibody described herein and a detectable label or cytotoxic agent. In one embodiment, the cytotoxic agent is selected from meitansinoids, auristatin, drastatin, tubulysin, cryptophycin, pyrrolobenzodiazepine (PBD) dimers, indolinobenzodiazepine dimers, α-amanitin, trichothene, SN-38, duocalmycin, CC1065, calicheamincin, engine antibiotics, taxanes, doxorubicin derivatives, anthracyclines, and their stereoisomers, azanofide, isosteres, analogs, or derivatives.

[0018] In another aspect, this disclosure provides nucleic acids encoding antibodies described herein. In one embodiment, one or more CDR sequences encoded by the nucleic acid are listed in Tables 1b, 1c, 3b, and 3c.

[0019] In another embodiment, antibodies encoded by nucleic acids are (i) Heavy chain nucleic acid sequences listed in Table 2, (ii) A nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity with respect to the light chain nucleic acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii)(i) codon-degenerate nucleic acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. It includes a light chain variable region encoded by nucleic acids containing [the specified component].

[0020] In another embodiment, antibodies encoded by nucleic acids are (i) Light chain nucleic acid sequences listed in Table 2, (ii) A nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity with respect to the light chain nucleic acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii)(i) Codon-degenerate nucleic acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. It includes a light chain variable region encoded by nucleic acids containing [the specified component].

[0021] In another aspect, this disclosure provides a vector comprising an expression control sequence functionally linked to a nucleic acid encoding an antibody described herein.

[0022] In a further aspect, this disclosure provides a host cell comprising a recombinant nucleic acid molecule containing an expression regulatory sequence functionally linked to a nucleic acid encoding an antibody described herein. In one embodiment, the host cell is a Chinese hamster ovary (CHO) cell.

[0023] In a further context, this disclosure provides a method for producing an anti-FZD antibody, comprising the step of culturing host cells as described herein.

[0024] In further aspects, this disclosure provides compositions comprising one or more antibodies, immunoconjugates, nucleic acids, vectors, or host cells as described herein, along with an optional suitable diluent. In one embodiment, the composition comprises one or more antibodies or immunoconjugates, and optionally, the composition is a pharmaceutical composition.

[0025] In further context, this disclosure provides a kit comprising one or more antibodies, immunoconjugates, nucleic acids, vectors, or host cells as described herein.

[0026] In a further aspect, the Disclosure provides a method for detecting FZD expression, comprising the steps of contacting a sample containing one or more cells with one or more antibodies or immunoconjugates described herein under conditions that allow the formation of antibody:cell complexes, and detecting the presence of any antibody complex. In one embodiment, the detection method is by immunofluorescence. In another embodiment, the detection method is by flow cytometry. In yet another embodiment, the method is for detecting FZD4 expression, and the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081.

[0027] In a further aspect, the Disclosure provides a method for inhibiting Wnt ligand binding to the FZD receptor, interfering with the Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting the activation of disheveled, promoting the preservation of the β-catenin degradation complex, promoting the accumulation of β-catenin, or inhibiting cell proliferation, the method comprising the step of contacting cells expressing the FZD receptor with an antibody or immunoconjugate described herein. In another aspect, the Disclosure provides an antibody or immunoconjugate described herein for use in inhibiting Wnt ligand binding to the FZD receptor, interfering with the Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting the activation of disheveled, promoting the preservation of the β-catenin degradation complex, promoting the accumulation of β-catenin, or inhibiting cell proliferation. In a further aspect, the Disclosure provides the use of antibodies or immunoconjugates described herein for inhibiting Wnt ligand binding to the FZD receptor, interfering with the Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting disheveled activation, promoting the preservation of the β-catenin degradation complex, promoting β-catenin accumulation, or inhibiting cell proliferation. In a further aspect, the Disclosure provides the use of antibodies or immunoconjugates described herein in the manufacture of pharmaceuticals for inhibiting Wnt ligand binding to the FZD receptor, interfering with the Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting disheveled activation, promoting the preservation of the β-catenin degradation complex, promoting β-catenin accumulation, or inhibiting cell proliferation. In one embodiment, the Wnt ligand is Wnt3a.In another embodiment, the antibody or immunoconjugate is (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081 or (b) 5014, 5016, 5018-5 Includes a set of CDR sequences corresponding to antibodies selected from 023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076.

[0028] In a further aspect, the Disclosure provides a method for treating a target cancer in need of treatment, comprising the step of administering an effective amount of a pharmaceutical composition comprising an antibody or immunoconjugate described herein to the target. In another aspect, the Disclosure provides the use of an antibody or immunoconjugate described herein for the treatment of cancer. In yet another aspect, the Disclosure provides an antibody or immunoconjugate described herein for use in the treatment of cancer. In yet another aspect, the Disclosure provides the use of an antibody or immunoconjugate described herein in the manufacture of a pharmaceutical product for the treatment of cancer. In one embodiment, the cancer is selected from acute myeloid leukemia, neuroblastoma, liver cancer, lung cancer, endometrial cancer, salivary adenoid cystic carcinoma cancer, colorectal cancer, prostate cancer, glioblastoma, bladder cancer, cervical cancer, pancreatic cancer, colon cancer, breast cancer, esophageal cancer, glioma, gastric cancer, astrocytoma, and osteosarcoma. In another embodiment, the method or use comprises an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay, and optionally, the antibody or immunoconjugate is an antibody or immunoconjugate described herein. In yet another embodiment, the antibody or immunoconjugate of the method or use is (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081 or (b) 5014, 5016, The set includes a CDR sequence set corresponding to an antibody selected from 5018-5023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. In a further embodiment, the antibody or immunoconjugate includes a CDR sequence set corresponding to an antibody selected from 5019 and 5020.In a further embodiment, the cancer treated by this method or use comprises one or more cancer cells containing a mutation in the RNF43 gene, and the antibody and antibody or immunoconjugate comprises a set of CDR sequences corresponding to antibody 5020.

[0029] Other features and advantages of this disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while illustrating aspects, are given only as illustrations, and the claims should not be limited by the aspects described in the examples, and the claims should be given the broadest interpretation consistent with the description as a whole.

[0030] Next, one aspect of the present disclosure will be described in relation to the drawings. [Brief explanation of the drawing]

[0031] [Figure 1] Figure 1 is a graph showing the binding of phage clones to FZD4-CRD-Fc and Fc. Single colonies were inoculated into 96-well culture plates, and the phage supernatant was diluted 1:2 overnight with 0.05% Tween 20 / 0.5% BSA / PBS (dilution buffer) and tested for binding by ELISA. Phages were detected using anti-M13-HRP secondary antibody (1:5000 in dilution buffer), and the plates were colored using TMB substrate and acid inhibitor. As shown, absorbance at 450 nm was read for the FZD4-Fc coated wells and the control Fc coated wells. [Figure 2]Figure 2 is a graph showing competitive ELISA binding of anti-FZD4 Fab. ELISA was performed to estimate the affinity of the FZD4 Fab panel. 384-well ELISA plates were coated overnight at 4°C with 2 μg / ml FZD4 CRD-Fc (R&D systems) in PBS. The plates were blocked at room temperature for 1 hour with 0.5% BSA / PBS and then washed three times with 0.05% Tween20 / PBS. The final concentration of Fab (0.5 μg / ml) was pre-incubated at room temperature for 1 hour in an unbound 96-well ELISA plate containing a solution of FZD4 CRD-Fc at the indicated concentrations (in 0.05% Tween20 / 0.5% BSA / PBS). This Fab antigen mixture was transferred to a 384-well plate and incubated at room temperature for 20 minutes. The plates were washed six times, and bound Fab was detected using anti-FLAG-HRP secondary antibody (Sigma) in 1:5000 of 0.05% Tween 20 / 0.5% BSA / PBS. The secondary antibody was incubated at room temperature for 45 minutes, the plates were washed, and then colored using TMB substrate containing an acid inhibitor. Absorbance at 450 nm was read. The absorbance of Fab wells containing competing soluble FZD4 CRD-Fc was divided by the absorbance of Fab wells without competing soluble FZD4 CRD-Fc, and this was multiplied by 100 to calculate the binding rate (%). [Figure 3-1] Figure 3 shows a series of immunofluorescence images illustrating the binding of anti-FZD4 Fab to FZD expressed on CHO cells. Fab was tested for reactivity from FZD4 selection by immunofluorescence (IF) staining of a CHO overexpression strain stably expressing the FZD4 CRD region as a myc-tagged GPI-linked domain. Fab was detected using an anti-F(ab')2-FITC secondary antibody (Jackson Immuno). FITC staining is indicated by white areas. [Figure 3-2] Refer to the explanation in Figure 3-1. [Figure 4-1]Figure 4 shows a series of immunofluorescence images illustrating the binding of anti-FZD4 Fab to CHO cells. Fab from FZD4 selection was tested for reactivity by immunofluorescence (IF) staining of control CHO cell lines stably transfected with a GPI linker and myc tag. Fab was detected using anti-F(ab')2-FITC secondary antibody (Jackson Immuno). FITC staining is indicated by white areas. [Figure 4-2] Refer to the explanation in Figure 4-1. [Figure 5] Figure 5 is a table showing the binding of Fab to FZD as determined by IF staining. [Figure 6] Figure 6 shows a series of immunofluorescence staining images illustrating the binding of Fab5019 and Fab5020 to FZD in multiple human pancreatic cancer cell lines. [Figure 7-1] Figure 7 is a series of graphs showing the binding of Fab5019 and Fab5020 to pancreatic cell lines by flow cytometry. The numbers indicate the multiple increase in MFI compared to the secondary Ab control. [Figure 7-2] Refer to the explanation in Figure 7-1. [Figure 8A] Figures 8A-D are a series of graphs showing the binding of anti-FZD4 Fab to FZD. [Figure 8B] Figures 8A-D are a series of graphs showing the binding of anti-FZD4 Fab to FZD. [Figure 8C] Figures 8A-D are a series of graphs showing the binding of anti-FZD4 Fab to FZD. [Figure 8D] Figures 8A-D are a series of graphs showing the binding of anti-FZD4 Fab to FZD. [Figure 9A] Figures 9A-B are tables showing the binding of anti-FZD4 Fab to FZD as determined by IF. CHO myc GPI cell line. 200nM Fab. -=no binding;+=very weak binder;++=weak binder;+++=good binder;++++=very good binder. [Figure 9B] Refer to the explanation in Figure 9A. [Figure 10]Figure 10 is a table showing the binding affinity of anti-FZD4 Fab to FZD4 as determined by SPR. [Figure 11] Figure 11 is a graph showing the binding of anti-FZD4 Fab to pancreatic cancer cells as measured by flow cytometry. [Figure 12]Figures 12A-B are a series of graphs showing the inhibition of WNT5A binding by anti-FZD4 Fab. (A) Wnt5a (R&D systems) was biotinylated using a commercially available kit (Thermo 21329 EZ-link NHS-PEG4-Biotin), and excess biotin was removed by buffer exchange using a 3000MWCO Amicon filter. FZD4-CRD-Fc or control Fc protein (R&D systems) was diluted to the indicated concentrations with 1% BSA / 0.05% Tween20 / PBS (dilution buffer) and incubated with a fixed amount of biotinylated Wnt5a in a BSA-blocked 96-well TC-treated plate at room temperature for 1 hour. Control wells with only buffer added instead of biotinylated Wnt5a were also included. Biotinylated Wnt5a was added at a final concentration of 150 ng / µl. The samples were transferred to pre-blocked streptavidin-coated plates (R&D systems) and trapped at room temperature for 1 hour. The wells were washed four times with 0.05% Tween20 / PBS, and then anti-Fc-HRP (1:5000 in dilution buffer, Jackson Immuno) was added to the wells over 45 minutes at room temperature. The wells were washed four times and colored using TMB reagent containing an acid inhibitor. Absorbance at 450 nm was read. (B) FZD4-CRD-Fc was diluted to the concentration predetermined in (A) to obtain an ELISA signal within the linear range and incubated with the desired Fab or buffer control for 1 hour at room temperature in a 96-well TC plate pre-blocked with 1% BSA. Control wells containing Fc protein were also included as described above. Biotinylated wnt5a was added to the wells and the plate was incubated for a further 1 hour. Control wells containing only buffer instead of biotinylated wnt5a were also included. Biotinylated Wnt5a was added at a final concentration of 150 ng / µl. The Fab proteins were at a final concentration of 400 nM, with the exception of Fab 6494 at 180 nM, Fab 6406 at 135 nM, and Fab 6500 at 159 nM. Negative control Fabs specific to different protein antigens were included, as well as a control (Fab buffer control) regarding the effect from neutralization elution buffer containing the stored Fab proteins. Binding rates were calculated. [Figure 13]Figure 13 is a table showing the effect of Fab on β-catenin-promoting transcription (TOPFLASH assay). [Figure 14A] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 14B] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 14C] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 14D] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 14E] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 14F] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 14G] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 14H] Figures 14A-H are a series of graphs showing the effect of anti-FZD4 Fab on the proliferation of cancer cells. [Figure 15] Figure 15 is a table showing the effect of anti-FZD4 Fab on the proliferation of pancreatic cancer cells as determined by the SRB sulforhodamine B assay, where "na" means not tested. [Figure 16] Figure 16 is a summary table of anti-FZD4 Fab, where na means not tested. Antiproliferative activity appears to be related to binding to FZD 1, 2, 4, 5, 7, 8, and 9, and inhibition of wnt3a activity. The most potent inhibitors shown in this assay are 5014, 5019-5023, and 6495. [Figure 17]Figure 17 is a graph showing that anti-FZD4 antibody inhibits the expression of Axin2, a Wnt pathway regulatory gene, in human pancreatic adenocarcinoma cell line (HPAF II). Gene expression (RT-qPCR) after treatment with 200 nM Fab / IgG was normalized to β-actin. [Figure 18A] Figures 18A and 18B are a series of graphs showing the proliferation inhibition of IgG 5019 and IgG 5020. (A) shows that IgG 5019 and IgG 5020 inhibit the proliferation of pancreatic cancer cells using the Allamer Blue proliferation assay, 200 nM Fab / IgG, and (B) shows that IgG 5020 inhibits cell proliferation in a dose-dependent manner. [Figure 18B-1] See the explanation in Figure 18A. [Figure 18B-2] See the explanation in Figure 18A. [Figure 19] Figure 19 shows a series of colony images demonstrating that IgG 5020 inhibits colony formation. [Figure 20] Figure 20 shows a series of immunofluorescence images illustrating the binding of Fab 5019 and Fab 5020 to FZD in PDAC patient-derived xenograft (PDX) cell lines (GP2A and GP14A). [Figure 21] Figure 21 is a graph showing the effects of Fab 5019, Fab 5020, and IgG 5020 on the proliferation of PDAC PDX cell lines in the Alamar Blue proliferation assay at 200 nM Fab / IgG. [Figure 22] Figure 22 shows a diagram of the Wnt classical signaling pathway. [Modes for carrying out the invention]

[0032] Detailed explanation of disclosure I. Definition Unless otherwise defined, scientific and technical terms used in connection with this disclosure shall have meanings generally understood by those skilled in the art. Furthermore, unless contextually required, singular terms shall include plural forms, and plural terms shall include singular forms. For example, the term “cell” includes a single cell and a group of cells or a population of cells. In general, the nomenclature and techniques used in connection with the cell and tissue cultures, molecular biology, and the chemistry and hybridization of proteins and oligonucleotides or polynucleotides described herein are well known and commonly used in the art (see, for example, Green and Sambrook, 2012).

[0033] As used herein, the term “polypeptide” refers to a molecule having a sequence of natural and / or non-natural amino acids linked via peptide bonds. The term “peptide” typically refers to a short polypeptide of 30 amino acids or less in length. The amino acid sequence of a polypeptide is called its “primary structure.” The term “protein” refers to a polypeptide having secondary, tertiary, and / or quaternary structures, such as structures stabilized by hydrogen bonds, and relationships between the secondary structure and structures formed from multiple proteins. Proteins can be further modified by other binding sites, such as carbohydrates (glycoproteins), lipids (lipoproteins), and phosphate groups (phosphoproteins).

[0034] As used herein, an amino acid sequence "consists" of only the amino acids within that sequence.

[0035] As used herein, if the first amino acid sequence (1) comprises a second amino acid sequence and (2) is 1, 2, or 3 times longer than the second amino acid sequence, then the first amino acid sequence "essentially consists of" the second amino acid sequence.

[0036] As used herein, if the second amino acid sequence includes the first amino acid sequence, the first amino acid sequence is a "fragment" of the second amino acid sequence. In certain embodiments, the first amino acid sequence, which is a fragment of the second amino acid sequence, may have one, two, three, four, five, six, seven, eight, nine, or ten fewer amino acids than the second amino acid sequence.

[0037] As used herein, a “functional equivalent” of a reference amino acid sequence is a sequence that is not identical to the reference sequence but contains minor changes, such as the insertion, deletion, or substitution of one or more amino acids. A functionally equivalent sequence retains the function (e.g., immunogenicity) of the reference sequence to which it is equivalent. If a functionally equivalent amino acid sequence contains one or more amino acid substitutions relative to the reference sequence, these are generally conservative amino acid substitutions.

[0038] As used herein, a “conservative amino acid substitution” is a substitution in which one amino acid residue is replaced by another amino acid residue without losing the desired properties of the protein. Suitable conservative amino acid substitutions can be made by substituting amino acids with similar hydrophobicity, polarity, and R-chain length. See, for example, Watson, et al., “Molecular Biology of the Gene,” 4th Edition, 1987, The Benjamin / Cummings Pub. Co., Menlo Park, CA, p. 224. Examples of conservative amino acid substitutions include (note that some categories are not mutually exclusive):

[0039] TIFF2026123255000002.tif50133

[0040] As used herein, the term “substantially identical” means the identity between the first and second amino acid sequences such that the first and second amino acid sequences contain a sufficient or minimum number of amino acid residues that are either (i) identical to aligned amino acid residues in the second amino acid sequence, or (ii) conserved substitutions of aligned amino acid residues in the second amino acid sequence, so that the first and second amino acid sequences have a common structural domain and / or common functional activity and / or common immunogenicity. For example, amino acid sequences containing a common structural or antigenic domain having at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity are referred to as sufficiently or substantially identical. In the context of nucleotide sequences, the term “substantially identical” is used herein to refer to a first nucleic acid sequence containing a sufficient or minimum number of nucleotides that are identical to the aligned nucleotides in the second nucleic acid sequence, such that the first and second nucleotide sequences encode polypeptides having common functional activity, or encoding common structural polypeptide domains or common functional polypeptide activity, or encoding polypeptides having the same immunogenic properties.

[0041] As used herein, the terms “antigen,” “immunogen,” and “antibody target” refer to a molecule, compound, or complex that is recognized by an antibody, i.e., that can be bound by an antibody. The terms may refer to any molecule that can be recognized by an antibody, such as a polypeptide, polynucleotide, carbohydrate, lipid, chemical moiety, or combination thereof (e.g., phosphorylated polypeptide or glycosylated polypeptide). Those skilled in the art will understand that the terms merely indicate that a molecule can be targeted by an antibody, rather than indicating that the molecule is immunogenic in all circumstances.

[0042] As used herein, the term “epitope” refers to a site on an antigen that is recognized and bound by an antibody. An epitope may consist of several amino acids, or a portion of several amino acids, e.g., five or six, or more, e.g., twenty or more amino acids, or a portion of those amino acids. In some cases, an epitope may consist of non-protein components, e.g., carbohydrates, nucleic acids, or lipids. In some cases, an epitope is a three-dimensional portion. Thus, for example, if the target is a protein, the epitope may consist of consecutive amino acids, or amino acids from different parts of the protein that are adjacent by protein folding (e.g., a discontinuous epitope).

[0043] As used herein, the term “antibody” refers to an immunoglobulin that recognizes and specifically binds to one or more target antigens, such as proteins, polypeptides, peptides, carbohydrates, polynucleotides, lipids, or combinations thereof. This binding occurs at one or more epitopes on the antigen via at least one antigen-recognition site within the variable region of the immunoglobulin. The variable region is most important for binding specificity and affinity. As used herein, the term “antibody” includes intact polyclonal antibodies, intact monoclonal antibodies, antibody fragments, single-chain Fv(scFv) variants, multispecific antibodies, chimeric antibodies, humanized antibodies, human antibodies, hybrid antibodies, fusion proteins, and any other immunoglobulin molecules, including antigen-recognition sites, as long as the antibody exhibits the desired biological activity. Antibodies may be (i) any of the five major classes of immunoglobulins based on the identity of their heavy chain constant domains—α (IgA), δ (IgD), ε (IgE), γ (IgG), and μ (IgM)—or (ii) a subclass (isotype) thereof (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2). The light chain may be either λ or κ. Antibodies may be naked or conjugated with other molecules, such as toxins, drugs, radioisotopes, chemotherapeutic agents, etc.

[0044] In one aspect, an "intact antibody" includes a tetramer composed of two identical pairs of polypeptide chains, each pair having one "light" chain (about 25 kD) and one "heavy" chain (about 50 - 70 kD). The heavy and light chains are linked via various covalent and non-covalent bonds (e.g., disulfide bonds) that vary in number and amount between different immunoglobulin classes. In one aspect, each chain includes a variable region and a constant region. The antigen recognition site of the variable region is composed of hypervariable regions or complementarity determining regions (CDRs) and framework regions. The framework regions typically do not contact the antigen but provide structural support for the CDRs. The constant region interacts with other immune cells in the body. Between the constant region and the variable region (only IgG, IgD, IgA, not IgM or IgE), there is a hinge region in the middle between the two heavy chains that provides flexibility for linking antigen binding.

[0045] The following is a non-exhaustive list of different antibody forms that all retain antigen binding activity: (1) Whole immunoglobulin (also called "intact" antibody) (two light chains and two heavy chains, e.g., tetramer). (2) Immunoglobulin polypeptide (light or heavy chain). (3) Antibody fragments, e.g., Fv (monovalent or bivalent variable region fragment) which is the variable region (e.g., V L and / or V H ), Fab (V L C L V H C H ), F(ab’)2, Fv (V L V H ), scFv (single-chain Fv) (a polypeptide containing V L and V H linked by a linker, e.g., a peptide linker), (scFv)2, sc(Fv)2, bispecific sc(Fv)2, bispecific (scFv)2, minibody (sc(Fv)2 fused to a CH3 domain), and can only include tribody which is trivalent sc(Fv)3 or trispecific sc(Fv)3. (4) Polyvalent antibodies (antibodies that contain binding regions that bind to two different epitopes or proteins, such as "scorpion" antibodies). (5) A fusion protein containing an immunoglobulin binding site fused to another amino acid sequence (such as a fluorescent protein).

[0046] As used herein, the term “antibody fragment” refers to a portion or part of an antibody or antibody chain that contains fewer amino acid residues than an intact or complete antibody or antibody chain, and that binds to an antigen or competes with the intact antibody. Fragments can be obtained by chemical or enzymatic treatment of an intact or complete antibody or antibody chain. Fragments can also be obtained by recombinant means. For example, the F(ab')2 fragment can be produced by treating an antibody with pepsin. The resulting F(ab')2 fragment can be processed to reduce the disulfide crosslinks and produce the Fab' fragment. Papain digestion can result in the formation of the Fab fragment. Fab, Fab' and F(ab')2, scFv, dsFv, ds-scFv, dimers, minibodies, diabodies, bispecific antibody fragments, and other fragments can also be constructed by recombinant expression techniques.

[0047] While various antibody fragments are defined in relation to the digestion products of intact antibodies, those skilled in the art will understand that such fragments may also be synthesized de novo chemically or constructed and expressed using recombinant DNA methods.

[0048] A single-stranded Fv (scFv) is a V molecule linked by a linker, such as a peptide linker. L and V HThis refers to polypeptides containing scFv. scFv can also be used to form tandem (or divalent) scFv or diabodies. The formation and characterization of tandem scFv and diabodies are described, for example, in Asano et al. (2011) J Biol. Chem. 286: 1812; Kenanova et al. (2010) Prot Eng Design Sel 23: 789; and Asano et al. (2008) Prot Eng Design Sel 21: 597.

[0049] The antibody fragment further comprises an Fd antibody (the heavy chain portion contained in the Fab fragment) and a single-domain antibody. The single-domain antibody (sdAb) is a variable domain of either the heavy chain or the light chain produced by recombinant DNA.

[0050] As used herein, the term “CDR sequence set” refers to the three heavy-chain CDRs and / or three light-chain CDRs of a particular antibody described herein. “Light-chain” CDR sequence set refers to the light-chain CDR sequences. “Heavy-chain” CDR sequence set refers to the heavy-chain CDR sequences. “Complete” CDR sequence set refers to both the heavy-chain and light-chain CDR sequences. For example, in the case of antibody 5017, as shown in Table 1a, the complete CDR sequence set includes or consists of SVSSA (CDR L1) (SEQ ID NO: 103), SASSLYS (CDR L2) (SEQ ID NO: 104), AAYHWPPLF (CDR L3) (SEQ ID NO: 148), LYYTDM (CDR H1) (SEQ ID NO: 149), SISLFFGYVS (CDR H2) (SEQ ID NO: 150), and YLAM (CDR H3) (SEQ ID NO: 151). The CDR sequence of each CDR includes, essentially consists of, or can consist of, the CDRs in Table 1a or 3a, for example. The CDRs are predicted based on IMGT sequence alignment.

[0051] As used herein, the term “monoclonal antibody” refers to a clonal preparation or composition of an antibody having a single binding specificity and affinity to a given epitope on an antigen (a “monoclonal antibody composition”). “Polyclonal antibody” refers to a preparation or composition of antibodies that arise for a single antigen but have different binding specificities and affinities (a “polyclonal antibody composition”).

[0052] As used herein, the term “chimeric antibody” refers to an antibody having an amino acid sequence derived from two or more species. In one embodiment, both the light and heavy chain variable regions correspond to the variable regions of an antibody derived from one species of mammal (e.g., mouse, rat, rabbit) having desired specificity, affinity, and ability, while the constant region is homologous to a sequence derived from another species (typically in the subject being treated, e.g., human) to avoid inducing an immune response.

[0053] As used herein, the term “humanized antibody” refers to a chimeric antibody in which CDRs obtained from the VH and VL regions of a non-human antibody having desired specificity, affinity, and competence are grafted onto a human framework sequence. In one embodiment, the framework residues of the humanized antibody are modified to improve and optimize the antibody’s specificity, affinity, and competence. Humanization, i.e., substitution of the corresponding sequence of a human antibody with a non-human CDR sequence, can be carried out according to the methods described, for example, U.S. Patent Nos. 5,545,806, 5,569,825, 5,633,425, 5,661,016, Riechmann et al., Nature 332: 323-327 (1988); Marks et al., Bio / Technology 10: 779-783 (1992); Morrison, Nature 368: 812-13 (1994); Fishwild et al., Nature Biotechnology 14: 845-51 (1996).

[0054] As used herein, the term "human antibody" means an antibody produced by a human being, or an antibody having a corresponding amino acid sequence prepared by any technique known in the art.

[0055] As used herein, the term “hybrid antibody” refers to an antibody in which pairs of heavy and light chains derived from antibodies having different antigenic determinant regions are assembled together such that the resulting tetramer can recognize and bind to two different epitopes or two different antigens. A hybrid antibody may be bispecific (binding to two different antigens or epitopes) or multispecific (binding to more than one different antigen or epitope).

[0056] As used herein, an antibody is "single-specific" if all of its antigen-binding sites bind to the same epitope.

[0057] As used herein, an antibody is "bispecific" if it has at least two different antigen-binding sites that bind to different epitopes or antigens, respectively.

[0058] As used herein, an antibody is "polyvalent" if it has multiple antigen-binding sites. For example, a tetravalent antibody has four antigen-binding sites.

[0059] Binding specificity can be defined with respect to the relative dissociation constant (Kd) of the antibody (or other targeting moiety) against the target, compared to the dissociation constants of the antibody and other materials in the environment, or generally unrelated molecules. Relatively large (relatively high) K d K represents a relatively low affinity interaction. d Conversely, a relatively small (relatively low) K d K represents a relatively high affinity interaction or a relatively tight bond. d As just one example, consider the K of an antibody that specifically binds to a target. dThis can be femtomole, picomole, nanomolar or micromolar, and is the K of an antibody that binds to an unrelated material. d This can be millimoles or more. Binding affinity is in the micromolar range (kD=10 -4 ~10 -6 ), nanomolar range (kD=10 -7 M~10 -9 M), picomolar range (kD=10 -10 M~10 -12 M), or femtomole range (kD=10 -13 M~10 -15 M) is a possibility.

[0060] When used in this specification, the antibody is 10 -4 When an antibody binds to an antigen or epitope with a Kd of less than M (i.e., in the micromolar range), it is said to "bind" to or "recognize" the antigen or epitope. The term "bind" in relation to a cell type (e.g., an antibody that binds to cancer cells) typically indicates that the active agent binds to the majority of cells within a pure population of those cells. For example, an antibody that binds to a given cell type will typically bind to at least two-thirds of the cells within the population of cells indicated (e.g., 67, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%). In some cases, binding to a polypeptide can be assayed by comparing the binding of an antibody to cells that present the polypeptide with the binding (or lack thereof) of an antibody to cells that do not express the polypeptide. Those skilled in the art will recognize that some variability will occur depending on the method used to determine binding and / or the threshold. The affinity of an antibody for a target can be determined according to methods known in the art, for example, as outlined in Ernst et al. Determination of Equilibrium Dissociation Constants, Therapeutic Monoclonal Antibodies (Wiley & Sons ed. 2009).

[0061] As used herein, the term "relatively high affinity" means that antibody X binds more strongly to target Y than to target Z (K on ) and / or dissociation constant (K off ) refers to the relative degree of antibody binding when the dissociation constant is small, in this context, antibody X has a greater affinity for target Y than Z. Similarly, the term “relatively low affinity” as used herein refers to the degree of antibody binding when antibody X binds to target Y with a weaker and / or larger dissociation constant than target Z, in this context, antibody X has a smaller affinity for target Y than Z. The affinity of binding between an antibody and its target antigen is 1 / K D K equal to A It can be expressed as, where K D is k on / k off It is equal to k. on and k off The value can be measured using surface plasmon resonance technology, for example, using the Molecular Affinity Screening System (MASS-1) (Sierra Sensors GmbH, Hamburg, Germany). An antagonist or blocking antibody is an antibody that partially or completely blocks, inhibits, or neutralizes the biological activity associated with a target antigen compared to the activity under similar physiological conditions in the absence of the antibody. Antagonists can be competitive, non-competitive, or irreversible. A competitive antagonist is a substance that binds to the native ligand or receptor at the same site as the native ligand-receptor interaction, or binds allosterically in a way that induces a change that prevents normal binding. A non-competitive antagonist binds at a different site than the native ligand-receptor interaction, but reduces the KD or signal resulting from the interaction. An irreversible inhibitor causes covalent modification of the receptor, preventing any subsequent binding.

[0062] As used herein, the term “avidity” refers to the overall stability of the binding complex between an antibody and a target antigen. It is defined by three factors: (i) the intrinsic affinity of the antibody to the antigen, (2) the titer of the antibody, and (3) the geometric arrangement of the interacting components. Affinity is the strength of the interaction between the antibody and a single target, whereas avidity is the cumulative strength of multiple affinities. In one embodiment, the antibody disclosed herein is divalent.

[0063] As used herein, an antibody "preferentially binds" to the first antigen compared to the second antigen if it binds to the first antigen with a greater affinity than the second antigen. Preferential binding can be at least one of two, five, nine, ten, twenty, thirty, forty, fifty, one hundred, five hundred, or one thousand times greater affinity. Therefore, for example, an antibody preferentially binds to the first FZD protein compared to the second FZD protein if it binds to the first FZD protein with a greater affinity than it binds to the second FZD protein.

[0064] When used in this specification, the antibody is 1 × 10 -6 M, 1×10 -7 M, 1×10 -8 M, 1×10 -9 M, 1×10 -10 M, 1×10 -11 M, 1×10 -12 An antibody is said to "specifically bind" to or be "specific" to a target antigen or its target group if it binds to the target antigen or each member of its target group with at least one affinity of M, for example, with at least twice the affinity it has for the non-target antigen being compared. Typically, specific binding is characterized by binding to the antigen with sufficient affinity for the antibody to be useful as a diagnostic agent for detecting the antigen or epitope and / or as a therapeutic agent when targeting the antigen or epitope.

[0065] When an antibody specifically binds to a group of protein targets (e.g., some or all members of the Frizzled protein family), the binding affinity of the antibody to the weakest-binding member of the target group is greater than the binding affinity of the antibody to the non-target antigen. In one embodiment, an antibody that specifically binds to one or more cysteine-rich domains (CRDs) of human Frizzled (FZD) receptors selected from FZD 1, 2, 4, 5, 7, 8, and 9 more generally means an antibody that specifically binds to selected members of this group compared to non-selected members or other antigens. Therefore, for example, an antibody that specifically binds to the cysteine-rich domains of the target group consisting of FZD1, FZD2, FZD4, FZD5, and FZD7 will specifically bind to these proteins but not to FZD3, FZD8, FZD9, and FZD10.

[0066] As used herein, an antibody “blocks” or “antagonizes” ligand-receptor binding if it competitively reduces or prevents any interaction between the ligand and the receptor. In one embodiment, the measured reduction level may be at least one of 5%, 10%, 25%, 50%, 80%, 90%, 95%, 97.5%, 99%, 99.5%, or 99.9% of control (e.g., untreated) cells. For example, an antibody that antagonizes or blocks the binding of a Wnt ligand to the FZD receptor competitively reduces or prevents the interaction of the Wnt protein with the FZD receptor. This results in attenuation or blockage of downstream signaling events associated with Wnt signaling. These include, for example, activation of disheveled, lysis of the β-catenin degradation complex, a decrease in cytosolic levels of β-catenin, and / or a decrease in the activity of TCF / LEF-mediated transcription.

[0067] The term "capture" with respect to antibody targets (e.g., antigens, analytes, immune complexes) typically indicates that the antibody binds to the majority of the antibody target in a pure population (assuming appropriate molar ratios). For example, an antibody that binds to a given antibody target typically binds to at least two-thirds of the antibody target in solution (e.g., at least 67, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%). Those skilled in the art will recognize that some variation will occur depending on the method used to determine binding and / or the threshold.

[0068] The term “conjugate” refers to a first molecule, such as an antibody (“immunoconjugate”), that is chemically bound to a portion, such as a detectable label, or to a biologically active portion, such as a drug, toxin, chemotherapeutic agent, or cytotoxic agent. Therefore, this disclosure intends to describe antibodies conjugated with one or more portions. Furthermore, the antibody may be a “conjugated antibody” or a “non-conjugated antibody” (i.e., not conjugated with a portion).

[0069] As used herein, the term “antibody-drug conjugate,” i.e., “ADC,” refers to an antibody conjugated with a drug. Typically, the conjugation involves a covalent bond via a linker.

[0070] As used herein, the term “labeled” molecule (e.g., nucleic acid, protein, or antibody) means a molecule to which a detectable label is attached, either covalently via a linker or chemical bond, or noncovalently via an ionic bond, van der Waals bond, electrostatic bond, or hydrogen bond, so that the presence of the molecule can be detected by detecting the presence of the detectable label attached to the molecule.

[0071] As used herein, the term “detectable label” refers to a composition that is detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. Examples of detectable labels are described herein and include, but are not limited to, colorimetric labels, fluorescent labels, chemiluminescent labels, enzymatic labels, and radioactive labels. For the purposes of this disclosure, a detectable label may also be a moiety that does not generate a signal itself (e.g., biotin) but binds to a second moiety that can generate a signal (e.g., labeled avidin).

[0072] The term "crosslinked" in relation to antibodies refers to the attachment of an antibody to a solid or semi-solid matrix (e.g., Sepharose, beads, microtiter plates), or to another protein or antibody. For example, antibodies can be polymerized to create antibody complexes with multiple (more than two) antigen-binding sites. Antibodies can be polymerized by expressing them as high-titer isotypes (e.g., IgA or IgM, which typically form complexes of two or five antibodies each). Antibody polymerization can also be carried out by using crosslinking agents containing reactive groups (e.g., carbodiimides, NHS esters, etc.) that can link proteins. Methods and compositions for crosslinking antibodies to a matrix are described, for example, in the catalogs and websites of Abcam and New England Biolab (available at abcam.com and neb.com). Crosslinking agent compounds with various reactive groups are described, for example, in the catalogs and websites of Thermo Fisher Scientific (available at piercenet.com).

[0073] As used herein, the term “immunoassay” refers to a method of detecting an analyte by detecting the binding between an antibody that recognizes the analyte and the analyte itself.

[0074] As used herein, the term “expression construct” refers to a polynucleotide containing a heterogeneous nucleotide sequence to be expressed (i.e., a sequence to which the expression regulatory sequence is not normally ligated) and an expression regulatory sequence functionally linked to it. As used herein, the term “expression vector” refers to a polynucleotide containing an expression construct and a sequence sufficient for replication in a host cell or insertion into a host chromosome. Plasmids and viruses are examples of expression vectors. As used herein, the term “expression regulatory sequence” refers to a nucleotide sequence that regulates the transcription and / or translation of a nucleotide sequence functionally linked to it. Expression regulatory sequences include promoters, enhancers, repressors (transcriptional regulatory sequences), and ribosome-binding sites (translational regulatory sequences).

[0075] As used herein, the term "vector" includes any intermediate vehicle for a nucleic acid molecule that enables the nucleic acid molecule to be introduced into, for example, prokaryotic and / or eukaryotic cells and / or incorporated into the genome, and includes plasmids, phagemids, bacteriophages, or viral vectors, such as retrovirus-based vectors and adeno-associated virus vectors. As used herein, the term "plasmid" generally refers to extrachromosomal genetic material, usually a circular double-stranded DNA construct, that can replicate independently of chromosomal DNA.

[0076] As used herein, when an expression regulatory element functions within a cell to control the transcription of a nucleotide sequence, the nucleotide sequence is "functionally linked" to the expression regulatory element. This includes promoting the transcription of the nucleotide sequence through an interaction between a polymerase and a promoter.

[0077] As used herein, “host cell” refers to a recombinant cell containing an expression construct.

[0078] As used herein, the term “biological sample” means a sample containing cells (e.g., tumor cells) or biological molecules derived from cells. A biological sample may be obtained from a subject, e.g., a patient, from an animal such as an animal model, or from cultured cells, e.g., from a cell line or cells taken from a patient and grown in culture for observation. A biological sample may include tissue and / or fluid. A biological sample may be obtained from any biological source, without limitation, including blood, blood fractions (e.g., serum or plasma), cerebrospinal fluid (CSF), lymph, tears, saliva, sputum, buccal swab, breast milk, urine, or feces. A biological sample may be biopsy material, e.g., tissue biopsy material, e.g., needle biopsy material, fine-needle biopsy material, surgical biopsy material, etc. A sample may include a tissue sample with a lesion or suspected lesion, but a biological sample may also originate from another site, e.g., a suspected site of metastasis, a lymph node, or blood. A biological sample may be part of a sample taken from a subject. Examples of tissue samples include brain tissue samples or nerve tissue samples. Methods for obtaining such biological samples, including, but not limited to, standard blood collection procedures, are known in the art.

[0079] As used herein, the term “diagnosis” refers to the relative probability that a subject has a disorder such as cancer. Similarly, the term “prognosis” refers to the relative probability that a particular future outcome may occur in a subject. For example, in the context of this disclosure, prognosis may refer to the likelihood that an individual will develop cancer, the likelihood that an individual will have recurrences, the likelihood that cancer will metastasize, the likelihood that cancer will be cured, or the possible severity of the disease (e.g., the severity of symptoms, the rate of functional decline, the survival rate, etc.). The terms are not intended to be absolute, as would be understood by those skilled in the art of medical diagnosis.

[0080] As used herein, the terms “therapy,” “treatment,” “therapeutic intervention,” and “improvement” refer to any activity that results in a reduction in the severity of symptoms. In the case of cancer, treatment may include, for example, a reduction in tumor size, the number of cancer cells, growth rate, metastatic activity, a reduction in non-cancerous cell death, a reduction in nausea and other side effects of chemotherapy or radiotherapy. The terms “treat” and “prevent” are not intended to be absolute terms. Treatment and prevention may include delaying the onset of any of the symptoms, improvement in symptoms, improvement in patient survival, or an increase in survival time or survival rate. Treatment and prevention may be complete (undetectable levels of neoplasms) or partial, such that fewer neoplasms are found in the patient than would have occurred without the intervention. The effect of treatment can be compared to an untreated individual, or a pool of individuals, or to the same patient at different points in time before or during treatment. In some aspects, the severity of the disease may be reduced by at least 10% compared to, for example, an individual before administration or an untreated control individual. In some cases, the severity of the disease decreases by at least 25%, at least 50%, at least 75%, at least 80%, or at least 90%, or in some cases, it may no longer be detectable using standard diagnostic techniques.

[0081] As used herein, the terms “effective dose,” “effective dosage,” and “therapeutic effective dose” refer to the amount of an active substance, such as an antibody or immunoconjugate, sufficient to produce a desired response, such as reducing or eliminating the signs or symptoms of a disease or improving a disorder. In some examples, “effective dose” is the effective dose that treats (including prevention) one or more symptoms and / or underlying causes of any disorder or disease and / or prevents the progression of the disease. For example, for a given parameter, a therapeutic effective dose shows an increase or decrease in therapeutic effect by at least one of 5%, 10%, 15%, 20%, 25%, 40%, 50%, 60%, 75%, 80%, 90%, or at least 100%. Therapeutic effectiveness can also be expressed as an increase or decrease of “~ times.” For example, a therapeutic effective dose may have at least one of 1.2 times, 1.5 times, 2 times, 5 times, or more of the effect compared to a control.

[0082] As used herein, the term “pharmaceutical composition” means a composition comprising a pharmaceutical compound (e.g., a drug) and a pharmaceutically acceptable carrier.

[0083] As used herein, the term “pharmaceutically acceptable” refers to a carrier that is compatible with other components of a pharmaceutical composition and can be safely administered to a subject. The term is used synonymously with “physiologically acceptable” and “pharmacologically acceptable.” Pharmaceutical compositions and techniques for their preparation and use are known to those skilled in the art in light of this disclosure. For a detailed list of suitable pharmacological compositions and techniques for their administration, refer to the following documents: Remington's Pharmaceutical Sciences, 17th ed. 1985; Brunton et al., “Goodman and Gilman's The Pharmacological Basis of Therapeutics,” McGraw-Hill, 2005; University of the Sciences in Philadelphia (eds.), “Remington: The Science and Practice of Pharmacy,” Lippincott Williams & Wilkins, 2005; and University of the Sciences in Philadelphia (eds.), “Remington: The Principles of Pharmacy Practice,” Lippincott Williams & Wilkins, 2008.

[0084] Pharmacoherent carriers are generally sterilized, at least for use in humans. Pharmaceutical compositions generally contain an active ingredient for buffering and preservation during storage, and may include buffers and carriers for appropriate delivery depending on the route of administration. Examples of pharmaceutically acceptable carriers include, but are not limited to, ordinary (0.9%) saline, phosphate-buffered saline (PBS) Hanks equilibrium salt solution (HBSS), and multiple electrolyte solutions, such as PlasmaLyte ATM (Baxter).

[0085] Acceptable carriers, excipients, and / or stabilizers are non-toxic to the recipient at the dosage and concentration used, and include buffers, e.g., phosphates, citrates, and other organic acids; antioxidants including ascorbic acid, glutathione, cysteine, methionine, and citric acid; preservatives (ethanol, benzyl alcohol, phenol, m-cresol, p-chloro-m-cresol, methylparaben or propylparaben, benzalkonium chloride, or combinations thereof, etc.); amino acids, e.g., arginine, glycine, ornithine, lysine, histidine, glutamic acid, aspartic acid, isoleucine, leucine, alanine, phenylalanine, etc. Lanine, tyrosine, tryptophan, methionine, serine, proline, and combinations thereof; monosaccharides, disaccharides, and other carbohydrates; low molecular weight (less than about 10 residues) polypeptides; proteins, e.g., gelatin or serum albumin; chelating agents, e.g., EDTA; sugars, e.g., trehalose, sucrose, lactose, glucose, mannose, maltose, galactose, fructose, sorbose, raffinose, glucosamine, N-methylglucosamine, galactosamine, and neuraminic acid; and / or nonionic surfactants, e.g., Tween, Pluronics, Triton-X, or polyethylene glycol (PEG).

[0086] The terms “dose” and “administered amount” are used interchangeably herein. Dose refers to the amount of active ingredient given to an individual at each administration. In this invention, dose may refer to the concentration of an antibody or related component, e.g., the amount of a therapeutic agent, or the amount of a radiolabel. The dose varies depending on several factors, including the frequency of administration, the size and tolerance of the individual, the severity of the condition, the risk of side effects, the route of administration, and the imaging modality of the detectable label (if present). Those skilled in the art will recognize that the dose may be modified depending on the factors mentioned above or based on the progress of treatment. The term “dosage form” refers to a specific form of a pharmaceutical product, depending on the route of administration. For example, the dosage form may be a liquid, e.g., saline solution for injection.

[0087] As used herein, the term “subject” refers to an individual animal. As used herein, the term “patient” refers to a subject under the care or supervision of a healthcare provider, such as a physician or nurse. Subjects include mammals, e.g., humans and non-human primates, e.g., monkeys, as well as dogs, cats, horses, cattle, rabbits, rats, mice, goats, pigs, and other mammalian species. Subjects may also include birds. A patient may be an individual seeking treatment, monitoring, adjustment or modification of an existing treatment regimen, etc. The term “cancer subject” refers to an individual diagnosed with cancer. Cancer patients may include individuals not receiving treatment, individuals currently receiving treatment, individuals who have undergone surgery, and individuals who have discontinued treatment.

[0088] In the context of cancer treatment, individuals requiring treatment may include those with cancer or a precancerous condition, those who have previously had cancer and are at risk of recurrence, those suspected of having cancer, and those receiving standard cancer treatments such as radiation therapy or chemotherapy.

[0089] The terms “cancer,” “tumor,” and “transformed” include precancerous cells, neoplastic cells, transformed cells, and cancerous cells, and can refer to solid tumors or non-solid cancers (see, for example, Edge et al. AJCC Cancer Staging Manual (7th ed. 2009); Cibas and Ducatman Cytology: Diagnostic principles and clinical correlates (3rd ed. 2009)). Cancer includes both benign neoplasms and malignant neoplasms (abnormal growth). “Transformation” refers to spontaneous or induced phenotypic changes, such as cell immortalization, morphological changes, abnormal cell growth, contact inhibition, and reduced fixation, and / or malignancy (see Freshney, Culture of Animal Cells a Manual of Basic Technique (3rd ed. 1994)). Transformation can result from infection with transforming viruses and the integration of new genomic DNA, or the uptake of exogenous DNA, but can also occur spontaneously or after exposure to carcinogens.

[0090] The term "cancer" can refer to any cancer, without limitation, including leukemia, carcinoma, sarcoma, adenocarcinoma, lymphoma, solid tumors, and lymphoma. Examples of various types of cancer include, but are not limited to, lung cancer (e.g., non-small cell lung cancer, i.e., NSCLC), breast cancer, prostate cancer, colorectal cancer, bladder cancer, ovarian cancer, leukemia, liver cancer (i.e., hepatocellular carcinoma), renal cancer (i.e., renal cell carcinoma), thyroid cancer, pancreatic cancer, uterine cancer, cervical cancer, testicular cancer, esophageal cancer, stomach cancer, kidney cancer, central nervous system cancer, skin cancer, glioblastoma, and melanoma.

[0091] As used herein, a chemical entity such as a polypeptide is "substantially pure" if it is the primary chemical entity of its kind (e.g., a polypeptide) in the composition. This includes chemical entities that constitute more than 50%, 80%, 90%, 95%, 98%, 99%, 99.5%, 99.9%, or 99.99% of the chemical entities of its kind in the composition.

[0092] The term "isolated antibody" refers to an antibody produced in vivo or in vitro, isolated from the source that produced the antibody, such as an animal, hybridoma, or other cell line (recombinant insect cells, yeast cells, or bacterial cells that produce antibodies).

[0093] "Substantially pure" or "isolated" means that the species of interest is the dominant species present (i.e., more abundant on a molar basis than any other individual polymer species in the composition), and that the substantially purified fraction is a composition in which the species of interest constitutes at least about 50% (on a molar basis) of all polymer species present. Generally, a substantially pure composition means that about 80% to 90% or more of the polymer species present in the composition are the purified species of interest. If the composition essentially consists of a single polymer species, the species of interest is purified to an essential homogeneity (contaminating species cannot be detected in the composition by conventional detection methods). Solvent species, small molecules (<500 Daltons), stabilizers (e.g., BSA), and elemental ion species are not considered polymer species for the purposes of this definition.

[0094] As used herein, the term “sequence identity” refers to the percentage of sequence identity between two polypeptide sequences or two nucleic acid sequences. To determine the percentage identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (for example, gaps can be introduced in the sequence of the first amino acid sequence or nucleic acid sequence for optimal alignment with the second amino acid sequence or nucleic acid sequence). Then, amino acid residues or nucleotides at the corresponding amino acid or nucleotide positions are compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecules are identical at that position. The percentage identity between two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical overlapping positions / total number of positions × 100%). In one embodiment, the two sequences are the same length. Determining the percentage identity between two sequences can also be achieved using mathematical algorithms. A preferred non-restrictive example of a mathematical algorithm used to compare two sequences is the algorithm described in Karlin and Altschul, 1990, Proc. Natl. Acad. Sci. USA 87: 2264-2268, modified as in Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90: 5873-5877. Such algorithms are incorporated into the NBLAST and XBLAST programs of Altschul et al., 1990, J. Mol. Biol. 215: 403. For example, a BLAST nucleotide search can be performed using NBLAST nucleotide program parameters set to score=100 and word length=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of this application. For example, a BLAST protein search can be performed using XBLAST program parameters set to score-50 and word length=3 to obtain amino acid sequences homologous to the protein molecules described herein.To obtain gapped alignments for comparative purposes, Gapped BLAST, as described in Altschul et al., 1997, Nucleic Acids Res. 25: 3389-3402, can be used. Alternatively, PSI-BLAST can be used to perform iterative searches to detect intermolecular distance relationships (ibid.). When using the BLAST program, Gapped BLAST program, and PSI-Blast program, the default parameters of each program (e.g., XBLAST and NBLAST) can be used (see, for example, the NCBI website). Another preferred non-restrictive example of a mathematical algorithm used for sequence comparison is the algorithm in Myers and Miller, 1988, CABIOS 4: 11-17. Such algorithms are incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When using the ALIGN program to compare amino acid sequences, the PAM120 weighted residue table, gap length penalty 12, and gap penalty 4 can be used. The percentage identity between two sequences can be determined using the same techniques as described above, with or without allowing gaps. In calculating percentage identity, typically only exact matches are counted.

[0095] In antibodies, percentage sequence identity can be determined when the antibody sequence is maximally aligned by IMGT. After alignment, if the target antibody region (e.g., the entire maturation variable region of the heavy or light chain) is compared to the same region of the reference antibody, the percentage sequence identity between the target antibody region and the reference antibody region is calculated by multiplying the number of positions occupied by the same amino acids in both the target antibody region and the reference antibody region by the total number of aligned positions in these two regions by 100 to convert it into a percentage.

[0096] Percent amino acid sequence identity can also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25: 3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program is available from the National Institute of Health, Bethesda, Md. NCBI-BLAST2 uses several search parameters, all of which are set to default values, including, for example, unmask=yes, strand=all, expected occurrences=10, minimum low complexity length=15 / 5, multipath e value=0.01, multipath constant=25, final gapped alignment dropoff=25, and scoring matrix=BLOSUM62.

[0097] In situations where NCBI-BLAST2 is used for amino acid sequence comparison, the % amino acid sequence identity of a given amino acid sequence A to, with, or relative to a given amino acid sequence B (or, as can be expressed, a given amino acid sequence A that has or contains a specific % amino acid sequence identity to, with, or relative to a given amino acid sequence B) is calculated as follows: 100 x fraction X / Y In the formula, X is the number of amino acid residues scored as identical in the alignment of A and B by the sequence alignment program NCBI-BLAST2, and Y is the total number of amino acid residues in B. It is understood that if the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B is not equal to the % amino acid sequence identity of B to A. As used herein, the term “nucleic acid sequence” refers to a sequence of nucleoside monomers or nucleotide monomers consisting of naturally occurring bases, sugars, and sugar-coated (skeletal) bonds, and includes cDNA. The term also includes modified or substituted sequences containing monomers or parts thereof that do not exist in nature. The nucleic acid sequences of this application may be deoxyribonucleic acid sequences (DNA) or ribonucleic acid sequences (RNA) and may contain naturally occurring bases including adenine, guanine, cytosine, thymidine, and uracil. Sequences may also contain modified bases. Examples of such modified bases include adenine, guanine, cytosine, thymidine, and uracil in aza and deaza, as well as xanthine and hypoxanthine. Polynucleotides containing non-transcribeable nucleotide bases are understood to be useful as probes, for example, in hybridization assays. Nucleic acids can be either double-stranded or single-stranded, representing a sense strand or an antisense strand. Furthermore, the term “nucleic acid” includes complementary nucleic acid sequences and codon-optimized codon equivalents or synonymous codon equivalents.

[0098] As used herein, the term “isolated nucleic acid” refers to a nucleic acid substantially free of cell material or culture medium when produced by recombinant DNA technology, or, if chemically synthesized, to a chemical precursor or other chemical substance. Isolated nucleic acids also substantially free of sequences naturally adjacent to the nucleic acid from which they originate (i.e., sequences located at the 5' and 3' ends of the nucleic acid).

[0099] "At least moderately stringent hybridization conditions" means that conditions are selected that promote selective hybridization between two complementary nucleic acid molecules in solution. Hybridization can occur for all or part of a nucleic acid sequence molecule. The hybridized portion is typically at least 15 (e.g., 20, 25, 30, 40, or 50) nucleotides long. Those skilled in the art will recognize that the stability of nucleic acid double-stranded or hybrid nucleic acids is determined by Tm (Tm = 81.5°C - 16.6(Log10[Na+]) + 0.41(%(G+C) - 600 / l), or a similar formula), which is a function of sodium ion concentration and temperature in a sodium-containing buffer. Therefore, the parameters of the washing conditions that determine hybrid stability are sodium ion concentration and temperature. To identify molecules that are similar to but not identical to known nucleic acid molecules, it can be assumed that a 1% mismatch results in a decrease of approximately 1°C in Tm. For example, if nucleic acid molecules with >95% identity are required, the final washing temperature will decrease by approximately 5°C. Based on these considerations, those skilled in the art will be able to easily select appropriate hybridization conditions. In preferred embodiments, stringent hybridization conditions are selected. As an example, to achieve stringent hybridization, the following conditions may be used: hybridization with 5× sodium chloride / sodium citrate (SSC) / 5× Denhardt's solution / 1.0% SDS at Tm-5°C based on the above formula, followed by washing with 0.2× SSC / 0.1% SDS at 60°C. Moderately stringent hybridization conditions include a washing step with 3× SSC at 42°C. However, it is understood that equivalent stringency can be achieved using alternative buffers, salts, and temperatures.Additional guidelines regarding hybridization conditions can be found in *Current Protocols in Molecular Biology*, John Wiley & Sons, NY, 2002, and in *Molecular Cloning: A Laboratory Manual*, Sambrook et al., *Cold Spring Harbor Laboratory Press*, 2001.

[0100] As used herein and as well understood in the art, the terms “to treat” or “to cure” mean a method for obtaining beneficial or desired outcomes, including clinical outcomes. Beneficial or desired clinical outcomes may include, without limitation, reduction or improvement of one or more symptoms or conditions, whether detectable or undetectable; attenuation of the severity of the disease; a state of stabilization (i.e., no worsening) of the disease; prevention of disease progression; prolongation or delay of disease progression; improvement or mitigation of the disease state; reduction of disease recurrence; and remission (whether partial or total), whether detectable or undetectable. “To treat” or “to cure” may also mean extending survival compared to the predicted survival time without treatment. As used herein, “to treat” or “to cure” also includes prophylactic treatment. For example, a subject with cancer may be treated to prevent progression, and to prevent progression, may be treated with antibodies, immunoconjugates, nucleic acids, or compositions described herein.

[0101] As used herein, the term “administration” means providing or delivering to a target an active substance, such as a composition containing an effective amount of antibody, by an effective route, such as an intratumoral or intravenous route.

[0102] As used herein, the term “diluent” refers to a pharmaceutically acceptable carrier that does not inhibit the physiological activity or properties of an active compound, such as an antibody or immunoconjugate, nor does it irritate the subject or invalidate the biological activity and properties of the administered compound. Diluents include, as is well known to those skilled in the art, all kinds of solvents, dispersions, coatings, surfactants, antioxidants, preservatives, antiseptics, binders, excipients, disintegrants, lubricants, such similar materials, and combinations thereof (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289–1329, incorporated herein by reference). Its use in a pharmaceutical composition is intended unless any conventional carrier is incompatible with the active ingredient.

[0103] A composition or method that "comprising" or "including" one or more of the listed elements may also include other elements not specifically listed. For example, a composition that "comprises" or "includes" an antibody may contain the antibody alone or in combination with other components.

[0104] For understanding the scope of this disclosure, the terms “consisting” and their derivatives as used herein are intended to be closed terms that specify the presence of described features, elements, components, groups, integers, and / or processes, and exclude the presence of other features, elements, components, groups, integers, and / or processes not described.

[0105] In this specification, enumerations of numerical ranges by endpoints include all numbers and fractions contained within that range (for example, 1–5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). It should also be understood that all such numbers and fractions are presumed to be modified by the term “approximately”. Furthermore, it should be understood that the singular articles “a,” “an,” and “the” include multiple references unless otherwise explicitly indicated in the context. For example, the term “antibody” or “at least one antibody” may include multiple antibodies, including mixtures thereof.

[0106] The terms "Frizzled" and "FZD" refer to any gene or protein member of the Frizzled family, depending on the context. Frizzled proteins are involved in the activation of Dishevelled proteins in the cytosol. Frizzled refers to any of Frizzled-1, Frizzled-2, Frizzled-3, Frizzled-4, Frizzled-5, Frizzled-6, Frizzled-7, Frizzled-8, Frizzled-9, and Frizzled-10. Frizzled 4 ("FZD4") (also known as CD344, EVR1, FEVR, FZD4S, Fz-4, Fz4, FzE4, GPCR, hFz4, and frizzled class receptor 4) is a member of the frizzled gene family of proteins. This gene has ENTREZ Gene ID: 8322. This protein has NCBI reference sequence: NP_036325.2.

[0107] "Lipoprotein receptor-related proteins," "low-density lipoprotein receptor-related proteins" (HGNC), or "pro-low-density lipoprotein receptor-related proteins" (UniProt), abbreviated as "LRP," are a group of genes and proteins. They include LRP1, LRP1B, LRP2 (megalin), LRP3, LRP4, LRP5, LRP6, LRP8 (apolipoprotein e receptor), LRP10, LRP11, and LRP12. LRP5 and LRP6 are part of the LRP5 / LRP6 / Frizzled coreceptor group involved in the classical Wnt pathway. LRP5 is also known as LRP5, BMND1, EVR1, EVR4, HBM, LR3, LRP-5, LRP7, OPPG, OPS, OPTA1, VBCH2, and LDL receptor-related protein 5. The LRP5 gene has ENTREZ gene ID: 4041, and its protein has the NCBI reference sequence: NP_002326. The LRP6 gene has ENTREZ gene ID: 4040, and its protein has the NCBI reference sequence: NP_002327. LRP6 is also known as ADCAD2 and STHAG7.

[0108] II. Disorders related to FRZ signaling dysregulation Wnt binding to FZD destabilizes the β-catenin binding complex and causes β-catenin degradation. As a result, intracellular β-catenin levels increase. Therefore, methods for blocking Wnt binding to frizzled proteins, particularly FZD4, as well as other members of the frizzled family, such as FZD1, FZD2, FZD4, FZD5, FZD7, FZD8, and FZD9, are provided herein.

[0109] "FZD-related disorders" (e.g., "FZD4-related disorders" or "FZD5-related disorders") refer to medical conditions or diseases associated with dysregulation of the specific FZD receptor mentioned. Dysregulation refers to abnormal signaling that increases normal β-catenin-mediated transcriptional changes or any other intracellular signaling pathways regulated by these receptors.

[0110] Various Frizzled receptors are associated with various cancers. More specifically, FZD1 is associated with neuroblastoma. FZD2 is associated with liver cancer, lung cancer, endometrial cancer, and salivary gland-like cystic carcinoma. FZD3 is associated with colorectal cancer. FZD4 is associated with acute myeloid leukemia, prostate cancer, glioblastoma, bladder cancer, and cervical cancer. FZD5 is associated with pancreatic cancer, colon cancer, and prostate cancer. FZD6 is associated with colorectal cancer and breast cancer. FZD7 is associated with esophageal cancer, glioma, breast cancer, gastric cancer, and colorectal cancer. FZD8 is associated with prostate cancer, breast cancer, and lung cancer. FZD9 is associated with astrocytoma and osteosarcoma. FZD10 is associated with colorectal cancer and synovial sarcoma.

[0111] III. Anti-FZD4 antibody A. Antibodies Antibodies against the Frizzled receptor (FZD), including antibodies that bind to multiple FZDs and other antibodies that preferentially bind to FZD4, are described herein. These antibodies bind to the Frizzled receptor, block ligand WNT binding, and modulate frizzled receptor signaling. These antibodies also demonstrate antiproliferative effects, suggesting therapeutic potential for treating cancer and other diseases in which the frizzled receptor is dysregulated.

[0112] Accordingly, one aspect of the present disclosure includes an isolated antibody that specifically binds to a Frizzled receptor (FZD) cysteine-rich domain (CRD), comprising a light chain variable region and a heavy chain variable region, wherein the heavy chain variable region comprises complementarity-determining regions CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region comprises complementarity-determining regions CDR-L1, CDR-L2, and CDR-L3, and the amino acid sequence of the CDR comprises, essentially consists of, or comprises a sequence selected from the sequences in Table 1a or Table 3a.

[0113] In one embodiment, the antibody comprises a set of CDR sequences selected from the CDR sequence set in Table 1a, namely the CDR sequence sets of clones 5016-5037 and 6498-6500.

[0114] (Table 1a) CDR amino acid sequences of FZD4 antibodies TIFF2026123255000003.tif168170

[0115] (Table 1b) CDR nucleic acid sequences of FZD4 antibodies TIFF2026123255000004.tif202170

[0116] (Table 1c) CDR nucleic acid sequences of FZD4 antibodies TIFF2026123255000005.tif189170

[0117] Heavy chain variable regions and light chain variable regions are also described herein. Table 2 provides exemplary variable domain sequences of the Fab heavy chain and Fab light chain derived from clone 5017. Antibodies comprising the sequences in Table 2 or substantially identical thereto, wherein the CDR is a set of CDR sequences identified in Table 1a or Table 3a, are also intended. In another embodiment, the antibody comprises a heavy chain variable region comprising: (i) the heavy chain amino acid sequence described in Table 2; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the heavy chain amino acid sequence described in Table 2, wherein the CDR sequence is a set of CDR sequences described in Table 1a or Table 3a; or (iii) a conservatively substituted amino acid sequence of (i), wherein the CDR sequence is a set of CDR sequences described in Table 1a or Table 3a.

[0118] In another embodiment, the antibody comprises a light chain variable region including: (i) a light chain amino acid sequence as described in Table 2; (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with respect to the light chain amino acid sequence as described in Table 2, wherein the CDR sequence is a set of CDR sequences as described in Table 1a or Table 3a; or (iii) a conservatively substituted amino acid sequence of (i), wherein the CDR sequence is a set of CDR sequences as described in Table 1a or Table 3a.

[0119] (Table 2) Example of the full-length sequence of FZD4 antibody 5017 The underlined part in TIFF2026123255000006.tif185150 identifies the CDR sequence. Bold text indicates the identification of CDR variations from the library (antibody clone ID 5017, shown as an example herein). Italics indicate constant domain sequences.

[0120] In another embodiment, the antibody comprises a set of CDR sequences selected from the set of CDR sequences in Table 3a, i.e., the set of CDR sequences of clones 5038 to 5081.

[0121] Table 3a - CDR amino acid sequences of FZD4 antibodies. In Table 3a, all sequences are listed in the order they appear, with the CDR L1 sequence ("SVSSA") designated as SEQ ID NO: 103, the CDR L2 sequence ("SASSLYS") as SEQ ID NO: 104, the CDR L3 sequences as SEQ ID NO: 105-136, 134, and 137-147, the CDR H1 sequences as SEQ ID NO: 1-3, 1, 4-6, 1, 7-8, 1, 9, 3, 10-11, 5, 3, 5, 3, 12-14, 3, 15, 7, 7, 16, 2, 17-18, 17, 1, 19, 3, 19, 7, 17, 20-21, 1, 1, 22-23, and 3, and the CDR H2 sequences as SEQ ID NO: The sequences 24-36, 28, 37, 32, 38-40, 24, 41-43, 43-46, 35, 47-49, 42, 50-56, 51, 42, and 57-59 are disclosed, and the CDR H3 sequences are disclosed as SEQ ID NO: 60-74, 68, and 75-102. (Table 3a) CDR amino acid sequences of FZD4 antibodies TIFF2026123255000007.tif154137

[0122] Table 3b - CDR light chain nucleic acid sequences of the FZD4 antibody. In Table 3b, all sequences are disclosed in the order listed, with the CDR L1 sequence ("TCCGTGTCCAGCGCT") designated as SEQ ID NO: 219, the CDR L2 sequence ("TCGGCATCCAGCCTCTACTCT") designated as SEQ ID NO: 220, and the CDR L3 sequences designated as SEQ ID NO: 304-334, 332, and 335-345. (Table 3b) CDR nucleic acid sequences of FZD4 antibodies TIFF2026123255000008.tif207138

[0123] In some embodiments, the variable domain sequences are at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% similar outside the CDR region, and the CDR sequence set is 100% identical to the amino acid sequences shown in Table 1a or Table 3a.

[0124] Table 3c - CDR heavy chain nucleic acid sequences of FZD4 antibody. In Table 3c, all sequences are listed in order of appearance, with the CDR H1 sequences designated as SEQ ID NO: 346~357, 261, 350, 358, 354, 359~361, 346, 362~364, 364~365, 260, 366~378, 373, 363, and 379~381, and the CDR H2 sequences designated as SEQ ID NO: The CDR H3 sequences are disclosed as SEQ ID NO: 385-399, 393, and 400-427, with sequences 346-350, 382, ​​352-354, 383, 356, 367, 261, 350, 358, 354, 359-361, 346, 362-364, 364-365, 260, 366-370, 363, 372-373, 384, 376-378, 373, 363, and 379-381. (Table 3c) CDR nucleic acid sequences of FZD4 antibodies TIFF2026123255000009.tif171139TIFF2026123255000010.tif80138

[0125] In another embodiment, a competing antibody is also provided that competes for binding with the antibody containing the CDR sequence set described herein. For example, in one embodiment, the competing antibody reduces the binding of the antibody containing the CDR sequence set to FZD4 CDR by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%.

[0126] Some of the described antibodies were able to bind to multiple FZDs. Therefore, in some embodiments, the antibody is one that specifically binds to FZD4 and further specifically binds to one or more of FZDs 1, 2, 5, 7, 8, and 9. For example, the antibody may be an antibody whose CDR sequence is a set of CDR sequences of antibodies selected from antibodies 5016, 5018-5023, 5025, 6495, 6496, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076.

[0127] Some of the antibodies described preferentially bind to FZD4. In one embodiment, the antibody preferentially binds to Frizzled 4 (FZD4) compared to any of FZD1, 2, 5, 7, 8, 9, or 10. In one embodiment, the antibody preferentially binds to FZD4 compared to FZD1, FZD5, FZD7, and FZD9. In one embodiment, the antibody contains a set of CDR sequences of antibody 6497. In another embodiment, the antibody preferentially binds to FZD4 compared to FZD1 and FZD7. In one embodiment, the antibody contains a set of CDR sequences of antibodies selected from 5028, 5035, 5039, and 5073. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD9. In one embodiment, the antibody contains a set of CDR sequences of antibody 5029. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD1, FZD2, and FZD7. In one aspect, the antibody comprises a set of CDR sequences of antibodies selected from 5031, 6498, 5054, or 5075. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD1, FZD2, FZD5, and FZD7. In one aspect, the antibody comprises a set of CDR sequences of antibody 5034. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD1. In one aspect, the antibody comprises a set of CDR sequences of antibody 5045 or 5048. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD1, FZD7, and FZD9. In one aspect, the antibody comprises a set of CDR sequences of antibody 5056. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD9 and FZD10. In one aspect, the antibody contains a set of CDR sequences of antibody 5057. In yet another embodiment, the antibody preferentially binds to FZD4 compared to FZD1 and FZD2. In one aspect, the antibody contains a set of CDR sequences of antibody 5067.

[0128] Certain antibodies, such as those containing CDR sets from antibodies 5018, 5019, 5022, 6494, and 5025, preferentially bind to other FZD proteins compared to FZD4. (See, for example, Figure 5.)

[0129] In another embodiment, the antibody comprises a CDR sequence which is a set of CDR sequences of antibodies selected from antibodies 5022, 5031, 6497, 6498, and 6500.

[0130] As shown herein, the antibodies described herein have high affinity for FZD4. For example, in one embodiment, the antibodies have a binding affinity of about 0.2 nM to about 15.3 nM, as measured by surface plasmon resonance.

[0131] The antibody may be a humanized antibody or a chimeric antibody as described herein.

[0132] In some embodiments, the antibody is a single-chain antibody, which can be obtained, for example, by fusing a heavy chain and a light chain or a portion thereof together.

[0133] In some embodiments, the antibody is an antibody-conjugated fragment selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and their polymers.

[0134] In some other embodiments, the antibody is a binding fragment Fab. In some embodiments, the binding fragment is preferred.

[0135] In other embodiments, it may be preferable to have a polyvalent antibody or an antibody containing an Ig moiety.

[0136] As shown in the examples, the Fab fragments of this disclosure can be combined with an immunoglobulin (Ig) constant region, such as IgG. In one embodiment, IgG is IgG1, IgG2, IgG3, or IgG4.

[0137] B. Detectable labeled antibodies Detectable labels may include peptide sequences (such as myc tags, HA tags, V5 tags, or NE tags) that can be added to or introduced into antibodies described herein and generate a detectable signal directly or indirectly, fluorescent proteins or luminescent proteins (e.g., green fluorescent protein or luciferase). For example, labels may include radiopaque positron-emitting radionuclides (e.g., for use in PET imaging) or radioisotopes, e.g., 3 H, 13 N, 14 C, 18 F, 32 P, 35 S, 123 I, 125 I, 131 I; fluorescent (fluorophore) compounds or chemiluminescent (chromophore) compounds, e.g., fluorescein isothiocyanate, rhodamine, or luciferin; enzymes, e.g., alkaline phosphatase, β-galactosidase, or horseradish peroxidase; imaging agents; or metal ions.

[0138] C. Antibody-drug conjugates A further aspect involves an immunoconjugate comprising the antibody described herein and a detectable label or cytotoxic agent.

[0139] Chemotherapy (anti-cancer) agents can be any active substance that can reduce cancer growth, interfere with cancer cell replication, directly or indirectly kill cancer cells, reduce metastasis, and decrease tumor blood supply. Therefore, chemotherapeutic agents include cytotoxic agents. Cytotoxic agents include, but are not limited to, saporins, taxanes, vinca alkaloids, anthracyclines, and platinum-based drugs. Classes of chemotherapeutic agents include, but are not limited to, alkylating agents, antimetabolites (e.g., methotrexate), plant alkaloids (e.g., vincristine), and antitumor antibiotics, e.g., anthracyclines (e.g., doxorubicin), as well as a variety of drugs not classified into a specific class, e.g., hydroxyureas. Platinum-based drugs, exemplified by cisplatin and oxaliplatin, are a major class of chemotherapeutic agents. These drugs bind to DNA and interfere with its replication. Taxanes, exemplified by taxol, are another major class of chemotherapeutic agents. These compounds work by interfering with the formation of the cytoskeleton and spindle, thereby inhibiting cell division and preventing the proliferation of rapidly dividing cancer cells. Other chemotherapy drugs include hormone therapy. Chemotherapy drugs also include agents that inhibit the aggregation or polymerization of tubulin, such as meitansine, meltansine, and auristatin. Chemotherapy agents also include DNA damaging agents such as calicheamicin.

[0140] Chemotherapy agents may include maytansinoids, auristatin, drastatin, tubulicin, cryptophycin, pyrrolobenzodiazepine (PBD) dimers, indolinobenzodiazepine dimers, α-amanitin, trichoten, SN-38, duocalmycin, CC1065, calicheamicin, engine antibiotics, taxanes, doxorubicin derivatives, anthracyclines, and their stereoisomers, azanofide, isosteres, analogs, or derivatives.

[0141] IV. Nucleic acids Further aspects include nucleic acid molecules or polynucleotides, recombinant nucleic acid molecules, expression constructs, and vectors as described herein.

[0142] A. Nucleic acid molecules Further aspects include nucleic acid molecules listed in Tables 1b, 1c, 3b, and 3c, and polynucleotides that hybridize to one of the sequences described above under stringent hybridization conditions, for example. CDRs and variable domain nucleic acid sequences can be used, for example, to prepare expression constructs.

[0143] B. Expression constructs and vectors Nucleic acid molecules can be incorporated in known ways into appropriate expression constructs or expression vectors that ensure protein expression. Expression constructs may include a polynucleotide containing the nucleotide sequence encoding the antibody of this disclosure, and a functionally linked expression regulatory sequence, such as a promoter. Possible expression vectors include, but are not limited to, cosmids, plasmids, or modified viruses (e.g., replication-deficient retroviruses, adenoviruses, and adeno-associated viruses). The vector should be compatible with the host cell in which it is used. An expression vector is "suitable for transformation of host cells," meaning that the expression vector contains a nucleic acid molecule encoding a peptide corresponding to an epitope or antibody described herein.

[0144] In one embodiment, the vector is suitable for expressing single-chain antibodies, for example, by gene therapy. In one embodiment, the vector comprises IRESs and enables the expression of light chain variable regions and heavy chain variable regions. Such a vector can be used to deliver antibodies in vivo.

[0145] Suitable regulatory sequences can be derived from a variety of sources, including bacterial, fungal, viral, mammalian, or insect genes.

[0146] Examples of such regulatory sequences include transcription promoters and enhancers or RNA polymerase binding sequences, and ribosome binding sequences containing translation initiation signals. Furthermore, depending on the selected host cell and the vector used, other sequences such as origins of replication, additional DNA restriction sites, enhancers, and sequences that confer transcriptional induction ability may be incorporated into the expression vector.

[0147] In one embodiment, the regulatory sequence induces or increases expression in nerve tissue and / or within nerve cells.

[0148] The vector may be any vector suitable for producing the antibodies described herein.

[0149] In one embodiment, the vector is a viral vector.

[0150] Recombinant expression vectors may also contain marker genes to facilitate the selection of host cells transformed, infected, or transfected with a vector for expressing an antibody or epitope peptide as described herein.

[0151] Recombinant expression vectors also include an expression cassette encoding a fusion region (i.e., a "fusion protein") that results in increased expression or stability of the recombinant peptide, or increased solubility of the recombinant peptide, and may assist in the purification of the target recombinant peptide by acting as a ligand in affinity purification, including, for example, tags and labels described herein. Furthermore, proteolytic cleavage sites can be added to the target recombinant protein to separate the recombinant protein from the fusion region after purification of the fusion protein. Typical fusion expression vectors include pGEX (Amrad Corp., Melbourne, Australia), pMAL (New England Biolabs, Beverly, MA), and pRIT5 (Pharmacia, Piscataway, NJ), which fuse glutathione S-transferase (GST), maltose E-binding protein, or protein A to the recombinant protein, respectively.

[0152] Systems for gene transfer both in vitro and in vivo include retrovirus-based vectors, most notably those based on viruses, including herpes simplex virus, adenovirus, adeno-associated virus (AAV), and lentivirus. Alternative methods for gene delivery include the use of naked plasmid DNA and liposome-DNA complexes.

[0153] In one aspect, this disclosure includes a method for producing an antibody as described herein, comprising the step of synthesizing a nucleic acid molecule comprising an antibody framework and a set of CDR sequences as described herein.

[0154] V. Recombinant cells A further aspect is recombinant host cells expressing the antibodies described herein.

[0155] The antibodies described herein can be produced by recombinant expression of nucleic acids encoding antibody sequences.

[0156] The antibodies disclosed herein can be produced by culturing cells that have been engineered to express nucleic acid constructs encoding immunoglobulin polypeptides.

[0157] Recombinant host cells can be generated using any cell suitable for polypeptide production, for example, suitable for antibody production. For example, cells may be transfected, transformed, or infected to introduce nucleic acids (e.g., vectors) into them, depending on the vector used.

[0158] Suitable host cells include a wide variety of prokaryotic and eukaryotic host cells. For example, the proteins described herein can be expressed in bacterial cells, such as Escherichia coli (E. coli), insect cells (using baculoviruses), yeast cells, or mammalian cells.

[0159] In one embodiment, the cells are eukaryotic cells selected from yeast, plant, insect, bird, fish, reptile, and mammalian cells.

[0160] In another embodiment, the mammalian cells are CHO cells, myeloma cells, spleen cells, or hybridoma cells.

[0161] Suitable yeast and fungal host cells for antibody expression include, but are not limited to, various species of Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia, Kluyveromyces, and Aspergillus. Examples of vectors for expression in the yeast S. cerevisiae include pYepSec1, pMFa, pJRY88, and pYES2 (Invitrogen Corporation, San Diego, CA). Protocols for yeast and fungal transformation are well known to those skilled in the art.

[0162] Suitable mammalian cells include, among others, COS cells (e.g., ATCC numbers CRL 1650 or 1651), BHK cells (e.g., ATCC number CRL 6281), CHO cells (ATCC number CCL 61), HeLa cells (e.g., ATCC number CCL 2), 293 cells (ATCC number 1573), and NS-1 cells. Suitable expression vectors for guiding expression in mammalian cells generally include promoters (e.g., derived from viral material such as polyoma, adenovirus 2, cytomegalovirus, and Simianvirus 40), as well as other transcriptional and translational regulatory sequences. Examples of mammalian expression vectors include pCDM8 and pMT2PC.

[0163] VI. Pharmaceutical Compositions A further aspect is a composition comprising an antibody, immunoconjugate, nucleic acid molecule, vector, or recombinant cell as described herein, along with an optional and suitable diluent, such as a pharmaceutically acceptable carrier.

[0164] The composition may, for example, include one or more antibodies or immunoconjugates.

[0165] Suitable diluents for polypeptides containing antibodies and / or cells include, but are not limited to, physiological saline, pH buffer, and glycerol solution, or other solutions suitable for freezing polypeptides and / or cells.

[0166] Suitable diluents for nucleic acids include, without limitation, water, saline solution, and ethanol.

[0167] In one embodiment, the composition is a pharmaceutical composition comprising any of the antibodies, nucleic acids, or vectors disclosed herein, and optionally comprising a pharmaceutically acceptable vehicle such as a diluent or carrier.

[0168] The compositions described herein can be prepared by methods known to themselves for preparing pharmaceutically acceptable compositions that can be administered to a subject, such as by mixing an effective amount of an active substance with a pharmaceutically acceptable vehicle.

[0169] Pharmaceutical compositions include, but are not limited to, lyophilized powders, or aqueous or non-aqueous sterile injection solutions or suspensions, which may further contain antioxidants, buffers, bacteriostatic agents, and solutes to make the composition substantially compatible with the tissue or blood of the intended recipient. Other components that may be present in such compositions include, for example, water, surfactants (such as Tween), alcohols, polyols, glycerin, and vegetable oils. Immediate injection solutions and suspensions may be prepared from sterile powders, granules, tablets, or concentrated solutions or suspensions. Compositions may be supplied, for example, as lyophilized powders that are reconstituted with sterile water or saline before administration to the patient, but are not limited to these.

[0170] Pharmaceutical compositions may contain pharmaceutically acceptable carriers. Suitable pharmaceutically acceptable carriers include compositions that are essentially chemically inert and non-toxic and do not interfere with the biological activity of the pharmaceutical composition. Examples of suitable pharmaceutical carriers, without limitation, include water, physiological saline, glycerol solution, ethanol, N-(1(2,3-dioleyloxy)propyl)N,N,N-trimethylammonium chloride (DOTMA), diolesylphosphotidylethanolamine (DOPE), and liposomes. Such compositions should contain a therapeutically effective amount of the compound together with a suitable amount of carrier to provide a form for direct administration to a patient.

[0171] The composition may be in the form of pharmaceutically acceptable salts, without limitation, that are formed by free amino groups such as those derived from hydrochloric acid, phosphoric acid, acetic acid, oxalic acid, tartaric acid, etc., and those formed by free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxide, isopropylamine, triethylamine, 2-ethylaminoethanol, etc.

[0172] In one embodiment, the composition comprises the antibody described herein. In another embodiment, the composition comprises the antibody described herein and a diluent. In one embodiment, the composition is a sterile composition.

[0173] A further aspect involves an antibody complex comprising an antibody described herein, conjugated to an FZD protein, such as FZD4. The complex may be in solution or optionally contained in tissue in vitro.

[0174] Methods for preparing and using the reagents described herein are also provided.

[0175] VI. Method of administration and use The anti-FZD antibody of the present invention can efficiently deliver a therapeutic composition in vivo to cells that receive Wnt signaling. In some embodiments, the therapeutic method or method of use includes administering or using an effective amount of a therapeutic anti-FZD conjugate, e.g., an anti-FZD antibody attached to a therapeutic agent, to an individual. In some embodiments, the individual has been diagnosed with cancer. In some embodiments, the individual is undergoing or has undergone cancer therapy, e.g., surgery, radiation therapy, or chemotherapy. In some embodiments, the individual has been diagnosed, but the cancer is in remission.

[0176] In some embodiments, the anti-FZD conjugate comprises liposomes. In some embodiments, the method further includes a step of monitoring the individual for cancer progression. In some embodiments, the dose of the anti-LRP conjugate for each administration is determined based on the individual's treatment progress, for example, if the individual is not responding well to treatment and a higher dose of chemotherapy is administered.

[0177] In some embodiments, the present invention may include an antibody or antibody-targeted composition and a physiologically (i.e., pharmaceutically) acceptable carrier. The term “carrier” refers to a typically inert substance used as a diluent or vehicle for a diagnostic or therapeutic agent. The term also includes typically inert substances that impart cohesiveness to the composition. Physiologically acceptable carriers may be liquids, e.g., saline, phosphate buffer, ordinary buffered saline (135–150 mM NaCl), water, buffer water, 0.4% saline, 0.3% glycine, glycoproteins to enhance stability (e.g., albumin, lipoprotein, globulin, etc.). Since the physiologically acceptable carrier is partially determined by the specific composition administered and the specific method used to administer the composition, a wide variety of suitable formulations of the pharmaceutically acceptable compositions of the present invention exist (see, for example, Remington's Pharmaceutical Sciences, 17th ed., 1989).

[0178] The compositions of the present invention may be sterilized by conventional, well-known sterilization techniques or may be produced under sterile conditions. The aqueous solutions may be packaged for use or filtered and lyophilized under sterile conditions, and the lyophilized preparations may be combined with the sterile aqueous solution before administration. The compositions may contain pharmaceutically acceptable auxiliary substances necessary to approximate physiological conditions, such as pH adjusters and buffers, isotonic adjusters, and wetting agents, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, and triethanolamine oleate. Sugars for stabilizing the composition may also be included, such as stabilizers for lyophilized antibody compositions.

[0179] Dosage forms can be prepared for mucosal administration to patients (e.g., nasal, sublingual, vaginal, buccal, or rectal), parenteral administration (e.g., subcutaneous, intravenous, intramuscular, or intra-arterial injection, bolus, or infusion), oral administration, or transdermal administration. Examples of dosage forms, without limitation, include dispersions; suppositories; ointments; poultices; pastes; powders; bandages; creams; adhesive bandages; solutions; patches; aerosols (e.g., nasal sprays or inhalers); gels; suspensions (e.g., aqueous or non-aqueous liquid suspensions, oil-in-water or water-in-oil liquid emulsions), solutions, and elixirs; liquid dosage forms suitable for oral or mucosal administration to patients; liquid dosage forms suitable for parenteral administration to patients; and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to patients.

[0180] Injectable (e.g., intravenous) compositions may include solutions of antibodies or antibody-targeted compositions suspended in an acceptable carrier, such as an aqueous carrier. For example, any of the various aqueous carriers may be used, such as water, buffered water, 0.4% saline, 0.9% isotonic saline, 0.3% glycine, or 5% dextrose, and may contain glycoproteins to enhance stability, such as albumin, lipoprotein, or globulin. Often, standard buffered saline (135-150 mM NaCl) is used. The composition may contain pharmaceutically acceptable adjuncts to approximate physiological conditions, such as pH adjusters and buffers, isotonic adjusters, and wetting agents, such as sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, or triethanolamine oleate. In some embodiments, the antibody-targeted composition may be formulated into a kit for intravenous administration.

[0181] For example, formulations suitable for parenteral administration via intra-articular, intravenous, intramuscular, intratumoral, intradermal, intraperitoneal, and subcutaneous routes include aqueous and non-aqueous isotonic sterile injection solutions that may contain antioxidants, buffers, bacteriostatic agents, and solutes to make the formulation isotonic with the blood of the intended recipient, as well as aqueous and non-aqueous sterile suspensions that may contain suspending agents, solubilizers, thickeners, stabilizers, and preservatives. Injection solutions and suspensions can also be prepared from sterile powders, granules, and tablets. In the embodiment of the present invention, the composition can be administered locally, intraperitoneally, intravesically, intrathecally, or intrathecally, for example, by intravenous infusion. Parenteral and intravenous administration are preferred methods of administration. Formulations of the target-directed composition can be provided in sealed containers of unit doses or multiple doses, such as ampoules and vials.

[0182] The selected target-directed delivery composition can be used alone or in combination with other suitable components to form an aerosol formulation ("spray") administered by inhalation. The aerosol formulation can be encapsulated in a pressurized, acceptable propellant such as dichlorodifluoromethane, propane, and nitrogen.

[0183] Pharmaceutical preparations can be packaged or prepared in unit dosage forms. In such forms, the preparation is subdivided into unit doses containing an appropriate amount of the active ingredient, for example, according to the dose of the therapeutic agent or the concentration of the antibody. The unit dosage form may be a packaged preparation, and the package contains individual amounts of the preparation. The composition may also contain other suitable therapeutic agents, if desired.

[0184] Antibodies (or antibody-targeted compositions) may be administered or used by injection or infusion via any preferred route, including, but not limited to, intravenous, subcutaneous, intramuscular, or intraperitoneal routes. An example of administering a pharmaceutical composition is to store the antibody at 10 mg / ml in sterile isotonic saline for injection at 4°C and dilute it in either 100 ml or 200 ml of 0.9% sodium chloride for injection before administering it to the patient. The antibody is administered by intravenous infusion over 1 hour at doses of 0.2–10 mg / kg. In other embodiments, the antibody is administered by intravenous infusion over a period of 15 minutes to 2 hours. In yet another embodiment, the administration procedure is by subcutaneous bolus injection.

[0185] The antibody dose is selected to provide effective treatment to the patient and ranges from less than 0.1 mg / kg body weight to approximately 25 mg / kg body weight or from 1 mg to 2 g per patient. In some cases, the dose ranges from 1 to 100 mg / kg or from approximately 50 mg to approximately 8000 mg per patient. Depending on the pharmacokinetics of the antibody (e.g., half-life of the antibody in circulation) and the pharmacodynamic response (e.g., duration of therapeutic effect of the antibody), the dose may be repeated at an appropriate frequency, which may range from once daily to once every three months. In some embodiments, antibody administration with an in vivo half-life of approximately 7 to 25 days is repeated once weekly to once every three months.

[0186] Administration or use may be cyclical. Depending on the route of administration, the dose may be administered once every 1, 3, 5, 7, 10, 14, 21, or 28 days, or at longer intervals (e.g., once every 2, 3, 4, or 6 months). In some cases, administration may be more frequent, such as twice or three times a day. As recognized by those skilled in the art, the patient may be monitored and the dose and frequency of administration adjusted in response to the progression of treatment and any adverse side effects.

[0187] Therefore, in some embodiments, additional doses depend on the patient's progress, and for example, the patient is monitored between doses. For example, after the first dose or a series of doses, the patient may be monitored for tumor growth rate, recurrence (e.g., in postoperative patients), or common disease-related symptoms such as weakness, pain, and nausea.

[0188] For therapeutic use in treating cancer, antibody-targeted compositions (e.g., including therapeutic and / or diagnostic agents) are administered at an initial dose of approximately 0.001 mg / kg to approximately 1000 mg / kg per day and may be adjusted over time. Daily dose ranges of approximately 0.01 mg / kg to approximately 500 mg / kg, or approximately 0.1 mg / kg to approximately 200 mg / kg, or approximately 1 mg / kg to approximately 100 mg / kg, or approximately 10 mg / kg to approximately 50 mg / kg may be used. The dose varies depending on the patient's requirements, the severity of the disease being treated, and the targeted composition used. For example, the dose may be determined empirically in a particular patient, taking into account the type and stage of cancer diagnosed. In the context of the present invention, the dose administered to a patient should be sufficient to influence the patient's beneficial therapeutic response over time. The size of the dose is also determined by the presence, nature, and extent of any adverse side effects associated with the administration of a particular targeted composition to a particular patient, as will be recognized by those skilled in the art.

[0189] VIII. Kit Another aspect is a kit or package comprising any of the antibodies, immunoconjugates, nucleic acid molecules, vectors, recombinant cells, and / or compositions disclosed herein. The antibodies, immunoconjugates, nucleic acid molecules, vectors, recombinant cells, and / or compositions may be contained in vials, such as sterile vials or other housings. Where used herein, the term “kit” refers to a collection of articles intended for use together. A kit may optionally include a reference agent and / or instructions for its use. A kit may further include a transport container adapted to hold a container, such as a vial, containing the compositions disclosed herein.

[0190] IX. How to use antibodies The antibodies described herein can be used in several in vitro and in vivo procedures.

[0191] A. Method for detecting FZD expression As shown herein, antibodies can be used to detect FZD expression.

[0192] Accordingly, in one aspect, this disclosure provides a method for detecting FZD expression, comprising the steps of contacting a sample containing one or more cells with one or more antibodies or immunoconjugates described herein under conditions that allow the formation of antibody:FZD complexes, and detecting the presence of any antibody complex. Typically, the antibody is part of an immunoconjugate containing an antibody conjugated to a detectable label.

[0193] The sample may include live cells or cell extracts. The antibody:FZD complex can be detected by immunoassays, such as immunofluorescence, flow cytometry, Western blotting, ELISA, SPR, and immunoprecipitation, followed by SDS-PAGE immunocytochemistry. In some embodiments, detection is by immunofluorescence. In some embodiments, detection is by flow cytometry.

[0194] As shown herein, several antibodies identified preferentially recognize FZD4. Therefore, in embodiments where the method is for detecting FZD4 expression, the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081.

[0195] B. Method to inhibit WNT binding to FZD The antibodies disclosed herein inhibit the binding of Wnt to Frizzled receptors, particularly FZD4. While we do not wish to be limited by theory, inhibition of Wnt binding to FZD proteins affects signaling in which FZD plays some role in initiation. For example, antibodies that bind to the FZD receptor inhibit FZD-promoting β-catenin phosphorylation. Unphosphorylated β-catenin avoids degradation within cells and accumulates. β-catenin accumulation is associated with malignant tumors.

[0196] It may be desirable to reduce or inhibit Wnt ligand signaling mediated by FZD. Therefore, another aspect is a method for inhibiting Wnt ligand binding to FZD or Wnt-inducible transcriptional activity, comprising contacting one or more cells expressing one or more FZD polypeptides with an effective amount of an antibody or immunoconjugate described herein.

[0197] In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light chain or heavy chain) corresponding to an antibody selected from the clones described herein, e.g., 5014, 5017-5023, 5027-5031, 5034, 5036, 5037, 6496, 6498, 6499 and 6500, 5035, 6495 and 5025.

[0198] In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light chain or heavy chain) corresponding to an antibody selected from the clones described herein, e.g., 5014, 5018-5023, 5025, 5036, 5037, 6495, 5027-5031, and 6497-6499.

[0199] Contact can be performed in vivo, for example, by administering an antibody or immunoconjugate to the target. Such inhibition may be desirable, especially when WNT signaling is dysregulated, such as in cancer cells.

[0200] C. Methods of treating cancer A method for treating cancer comprises the step of administering a pharmaceutical composition comprising an antibody of the present disclosure that binds to FZD to a subject in need. A subject in need may be a person who has cancer or is at risk of cancer, such as a recurrence of cancer.

[0201] While we do not wish to be limited by theory, such therapies may function by inhibiting the activation of the classical Wnt pathway, for example by inhibiting Wnt binding to FZD, by inhibiting Wnt-induced transcriptional activity, by inhibiting disheveled activation, by inhibiting the inhibition of the β-catenin degradation complex, and by promoting the accumulation of β-catenin.

[0202] In another aspect, this disclosure includes a method for treating cancer, comprising the step of administering to a subject in need an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay. This disclosure also includes an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay for use in treating cancer. This disclosure provides the use of an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay for use in treating cancer. The disclosure also provides the use of an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt-induced signaling in at least one assay in the manufacture of a drug for treating cancer.

[0203] In one embodiment, an antibody or immunoconjugate, such as an antibody-drug conjugate, is included in the pharmaceutical composition.

[0204] In one embodiment, the cancer is selected from colon cancer, lung cancer, breast cancer, ovarian cancer, endometrial cancer, pancreatic cancer, gastric cancer, liver cancer, adrenocortical carcinoma, and osteoblastoma, and optionally, the cancer is pancreatic cancer. In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light chain or heavy chain) corresponding to an antibody selected from 5014, 5017-5023, 5025, 5035-5037, 6495, and 6500.

[0205] As shown herein, antibodies can also inhibit cancer cell proliferation, and therefore, a method for inhibiting cancer cell proliferation is also provided, comprising the step of contacting one or more cancer cells expressing FZD with an effective amount of an antibody or immunoconjugate that specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay.

[0206] In one embodiment, the antibody or immunoconjugate is an antibody or immunoconjugate comprising a set of CDR sequences (complete light chain or heavy chain) corresponding to an antibody selected from the antibodies or immunoconjugates described herein, for example, 5014, 5017-5023, 5025, 5035-5037, 6495, and 6500.

[0207] In one embodiment, the antibody comprises a set of CDR sequences (complete light chain or heavy chain) corresponding to an antibody selected from the variable region sequences, 5014, 5017-5023, 5025, 5035-5037, 6495, and 6500 described herein.

[0208] In one embodiment, the cancer is selected from acute myeloid leukemia, prostate cancer, glioblastoma, bladder cancer, and cervical cancer.

[0209] In another embodiment, the cancer cells are selected from cancer cells of colon cancer, lung cancer, breast cancer, ovarian cancer, endometrial cancer, pancreatic cancer, gastric cancer, liver cancer, adrenocortical carcinoma, and osteoblastoma.

[0210] In another embodiment, the cancer cells are pancreatic cancer cells. In one embodiment, the antibody or immunoconjugate comprises a set of CDR sequences (complete light chain or heavy chain) corresponding to an antibody selected from 5019 and 5020.

[0211] Furthermore, antibody 5020 has been demonstrated to be effective in treating RNF43-mutated cancers. Therefore, in one embodiment, cancer cells are known or determined to contain a mutation in the RNF43 gene, and the antibody or immunoconjugate used comprises a set of CDRs corresponding to antibody 5020.

[0212] In one embodiment, the method includes the steps of determining that the cancer in question is associated with Wnt signaling dysregulation, optionally determining a specific Wnt protein that is dysregulated, optionally determining a member of the FZD protein family to be targeted, and administering an anti-FZD antibody to the subject to block selected Wnt binding to one or more selected FZD receptors.

[0213] The above disclosure provides a general overview of this disclosure. A more complete understanding can be obtained by referring to the following specific examples. These examples are provided for illustrative purposes only and are not intended to limit the scope of this application. Modifications of form and substitutions of equivalents are considered as suggested or convenient in the context. Certain terms are used herein, but such terms are intended to be descriptive and not limiting. [Examples]

[0214] X. Examples Example 1 Antibody selection and functional testing of FZD4 FAB Antibody selection: Two selection methods were used to identify the FZD4 binder.

[0215] 1. Selection was performed using a library previously designed based on a FZD7-derived binder. Antibodies were previously identified from selections using FZD7 CRD-Fc as the antigen. These antibodies bind to FZD1, 2, 5, 7, 8, and 9, exhibiting antagonistic activity against the Wnt pathway and inhibiting the proliferation and tumor growth of pancreatic cancer cells. Using the library, antibodies that bind to FZD4 and would likely possess wnt antagonistic and antitumor activity were identified.

[0216] (a) Design and preparation of Fab phage display libraries. A Fab phage display library was designed and prepared using an IPTG-inducible display vector encoding MBP-recognizing Fab. The Fab template was identical to library F, containing a FLAG-tagged light chain, and the dimerization domains L1, L2, and L3, mutated to the parental Fab sequences H1, H2, and H3, were soft-randomized to allow a 50% bias to wild-type amino acids and a 50% bias to any other amino acids (using a 70:10:10:10 nucleotide mix). All six CDR regions were mutated using a single kunkel mutagenesis. A second-generation library was constructed based on a panel of Fab antagonists. An IPTG-inducible display vector encoding Fab specific to maltose-binding proteins was used as the library template. Site-directed kunkel mutagenesis was performed using light chain oligos to mutate CDR L1, L2, and L3 to the parental Fab sequences, and CDR H1, H2, and H3 were soft-randomized (50% wild-type and 50% any other amino acids). SR320 cells pre-infected with M13 K07 were electroporated with purified mutagenic compounds. The library was rescued overnight in 500 ml of culture medium, double precipitated with PEG / NaCl, and resuspended in PBS containing 50% glycerol for storage at -20°C.

[0217] (b) Selection and generation of Fab for FZD4 Second-generation libraries were pooled (equivalent to cfus) and screened over four rounds against recombinant FZD4 cysteine-rich domains (CRDs) fused to Fc tags (R&D systems). Input and output phage titers were calculated for carbenecillin (carb)-resistant library phages and kanamycin (kan)-resistant helper phages. Maxisorb plates were coated overnight at 4 degrees with 5 μg / ml of PBS solution of FZD4-CRD-Fc or Fc protein and the indicated number of wells, and blocked with 0.5% BSA. The coated wells were washed four times with PBS / 0.5% Tween20 (wash buffer), and library phages (PEG precipitated and resuspended in 0.5% BSA / 0.05% Tween20 / PBS) were incubated for 1 hour at room temperature, first in the Fc protein wells. Unbound phages were transferred to blocked FZD4-CRD-Fc plates and incubated at room temperature for 1 hour. Wells were washed as shown, and then eluted with 100 mM HCl. For the subsequent selection round, eluted phages were amplified using standard laboratory protocols. Input and output titers of library phages (carb-resistant) and helper phages (kan-resistant) are shown. DNA obtained from site-directed Kunkel mutagenesis designed to add a His6-amber termination ("His6" is disclosed as SEQ ID NO: 428) between the phage gene III and the Fab CH1 region of the output phage pool from FZD4 selection was transformed into Omnimax cells and plated for single colonies. Single colonies were inoculated into 96-well culture boxes, and the phage supernatant was diluted 1:2 overnight with 0.05% Tween 20 / 0.5% BSA / PBS (dilution buffer) to test ELISA binding. Phages were detected using an anti-M13-HRP secondary antibody (1:5000 in dilution buffer), and the plate was color-developed using a TMB substrate and an acid inhibitor.As shown, absorbance at 450 nm was read for the FZD4-Fc coated wells and the control Fc coated wells. The heavy and light chains were sequenced to determine the CDR sequences of individual Fabs. The CH1-geneIII junction was sequenced to determine the successful incorporation of the His tag and amber stop codon for Fab expression. The phage binder was cloned into a bacterial expression vector and purified as a Fab protein for characterization.

[0218] (c) Characterization of anti-FZD4 binder. Table 1 shows the CDR sequences of the antibodies described herein. First, the phage binders were tested by ELISA assay to confirm their binding to the antigen. As shown in Figure 1, all phage clones bound to FZD4 CRD-Fc but not to the Fc protein alone, suggesting that these phage binders bind to FZD4 CRD rather than to Fc. Second, purified Fabs were tested by competitive ELISA assay in the presence of gradually increasing amounts of unimmobilized antigen to estimate their binding affinity (Figure 2). In the presence of 50 nM of competitive free antigen (FZD4 CRD), the binding of all Fabs decreased by more than 50%. In the presence of 10 nM of competitive antigen (FZD4 CRD), the binding of five Fabs (5022, 5031, 6497, 6498, and 6500) decreased by more than 50%, suggesting that these five Fabs may have higher binding affinity than the others. It should be noted that no binding was observed for Fab 5025 and 6494 in this assay. The reason for this is unknown, but it is likely due to physical interference. Next, Fabs were tested for binding to FZD4 expressed on the cell surface by immunofluorescence staining. In CHO cells that stably express FZD4 (Figure 3), membrane staining patterns were observed for all FZD4 Fabs, but not in CHO cells (Figure 4). IF staining was used to determine whether these Fabs bound to other FZDs. Binding was tested using 10 CHO cell lines that stably express individual FZDs on their surface. As shown in Figure 5, the Fabs exhibited a variety of binding profiles. Fabs 5017, 5027, 5030, and 6499 bound only to FZD4-expressing CHO cells, whereas the other Fabs (5014, 5018-5023, 5025, 6495, 6496) bound to multiple FZDs, including FZD1, 2, 4, 5, 7, 8, and 9. However, this assay did not show that Fabs bound to FZD3, 6, or 10. Next, using Fabs 5019 and 5020 as examples, their binding to cancer cells was tested by both immunofluorescence staining and flow cytometry. As shown in Figure 6, both Fabs showed clearly membrane-concentrated staining in the five pancreatic cell lines tested.As shown in Figure 7, flow cytometry confirmed the binding of these Fabs to these cancer cell lines.

[0219] 2. Selection using the Naive Fab Library (Library F). (a) Recombinant FZD4-CRD-Fc was used to select Fabs that bind to FZD4. Specifically, a Fab phage library (Library F) was pre-extracted from a nonspecific binder containing unrelated proteins. Several rounds of selection were performed on the pre-extracted Fab library to enrich the binders that bind to FZD4-CRD-Fc. Clonal phages obtained from the selection were screened by ELISA for binders that specifically bind to FZD4-CRD-Fc but not to Fc. Forty-four Fabs with unique CDR sequences were identified (see Table 3 for sequences).

[0220] (b) Characterization of anti-FZD4 Fab Next, anti-FZD4 phage binder clones were cloned into bacterial expression vectors, expressing 42 Fabs, which were then purified for subsequent characterization. Multiple methods were used to determine their binding selectivity to FZDs. First, purified Fabs were tested using ELISA assays to confirm binding to recombinant antigen (FZD4-CRD-Fc) and to other FZDs (FZD1, 2, 5, 6, 7, 8, 9, and 10). As shown in Figure 8, all Fabs bound to FZD4-CRD-Fc (the antigen used for selection), but binding to Fc or the unrelated protein BSA was hardly observed. Furthermore, these Fabs were shown to bind to other FZDs to varying degrees (Figure 8). For example, in addition to binding to FZD4-CRD-Fc, small amounts of binding to FZD2 CRD-Fc and FZD8 CRD-Fc were detected for Fabs (Figure 8A). Fab 5076 binds to FZD1, 2, 5, 7, and 8 in addition to FZD4 (Figure 8D). Next, the binding of anti-FZD4 Fabs to various FZDs was determined by immunofluorescence staining of FZD-expressing CHO cells. The results are summarized in Figure 9. Most Fabs, including Fabs 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, 5077-5081), were shown to bind only to FZD4 in this assay, while others bound to two or more FZDs. Furthermore, the binding affinity of anti-FZD4 Fabs to FZD4 CRD-Fc was determined using surface plasmon resonance (SPR), as shown in Figure 10. FZD4-derived Fabs exhibit high affinity for FZD4 in the range of 0.2 nM to 15.3 nM. To investigate whether these Fabs bind to FZD expressed on pancreatic cancer cells, their binding was tested using flow cytometry. As summarized in Figure 11, most Fabs were able to bind to HPAFII and PATU8988. Small amounts of binding were observed in Fabs 5049, 5064, and 5072 (PATU8988 cells).

[0221] Functional testing of FZD4 Fab: Several assays were performed to characterize anti-FZD4 Fab.

[0222] 1. Effect of anti-FZD4 Fab on Wnt ligand binding to FZD4-CRD. To optimize assay conditions, incremental concentrations of FZD4-CRD-Fc or Fc were mixed with biotinylated Wnt5A, and the complexes were captured by streptavidin-coated plates. Binding of FZD4-CRD-Fc or Fc was detected by anti-Fc-HRP (Figure 12A). To test the blocking activity of anti-FZD4 Fab, concentrations of FZD4-CRD-Fc that yielded linearly ranged ELISA signals were selected. As shown, FZD4-CRD-Fc was mixed with biotinylated Wnt5A in the presence of various Fabs, and the bound FZD4-CRD-Fc was detected by anti-Fc-HRP, as shown in Figure 12A. As shown in Figure 12B, over 80% inhibition of binding was observed in Fab 5014, 5017-5023, 5027-5031, 5034, 5036, 5037, 6496, 6498, 6499, and 6500; over 60% inhibition of binding was observed in Fab 5035 and 6495; approximately 30% inhibition was observed in Fab 5025; and no inhibition was observed in Fab 6494 and 6497.

[0223] 2. Effects of anti-FZD4 Fab on β-catenin-promoted transcription. To investigate whether anti-FZD4 Fabs affect β-catenin-dependent signaling, Fabs were tested for their effect on Wnt3a-inducible transcriptional activity in the TOPFLASH assay. As shown in Figure 13, potent inhibitory activity (>80%) was observed with Fabs 5014, 5018-5023, 5025, 5036, 5037, and 6495. Lesser inhibition (10-35%) was observed with Fabs 5027-5031 and 6497-6499. No inhibition was observed with Fabs 5017, 5034, and 5035.

[0224] 3. Effects on the proliferation of cancer cells. To test whether anti-FZD4 Fabs affect cancer cell proliferation, pancreatic cancer cells (HPAFII and PATU8988) were treated with 2 and 10 μg / ml of Fab, and cell proliferation was measured (see Figures 14A-H). The data are summarized in Figure 15. Fabs that showed dose-dependent antiproliferative activity included Fabs 5018-5021, 5023, 5036, and 6495. Fabs 5022 and 6500 were tested only at single-dose levels (2 μg / ml) and were inhibitory to both cell lines tested. The assay showed that several Fabs (5017, 5025, 5035, and 5037) were inhibitory to the HPAFII cell line. Based on the data summarized in Figure 16, the antiproliferative activity of anti-FZD4 Fabs appears to be related to the following observations: their binding to FZD 1, 2, 4, 5, 7, 8, and 9, as well as their ability to inhibit Wnt3a-inducible transcriptional activity. The most potent antiproliferative Fabs include 5014, 5019-5023, and 6495 (Figure 16).

[0225] 4. Effects on the expression of the Wnt regulatory gene Axin2. To further characterize the anti-FZD4 antibodies, several Fabs were converted to IgG. IgG 5020, along with Fabs 5019 and 5020, were tested in gene expression assays, and Axin2 gene mRNA levels were measured by RT-qPCR. As shown in Figure 17, IgG 5020, Fab 5019, and 5020 all reduced Axin2 mRNA levels in HPAFII cells after antibody treatment, suggesting that these antibodies inhibit the Wnt pathway.

[0226] 5. The effect of anti-FZD4 IgG on the proliferation of cancer cells. IgG was also tested for its effect on the growth of four pancreatic cancer cell lines, HPAFII, CAPAN2, AsPC11, and PATU8988. All of these cell lines are known to have damaging mutations in the RNF43 gene. As shown in Figure 18A using the alamar blue assay, the growth of these pancreatic cells was inhibited by IgG 5019 and 5020, along with their corresponding Fabs. Furthermore, IgG5020 was shown to inhibit cancer cell growth in a dose-dependent manner (Figure 18B). Interestingly, some pancreatic cancer cell lines (BxPC3 and PANC 1) that do not have damaging mutations in the RNF43 gene were also tested and were not sensitive to IgG5020, suggesting that sensitivity to the FZD4 antibody IgG 5020 may depend on mutations in the RNF43 gene. RNF43 and ZNRF3 are Wnt target genes that encode transmembrane E3 ubiquitin ligases that target Frizzled receptors, and loss-of-function mutations in them can lead to high expression of FZD and make tumor cells sensitive to inhibition of Wnt-dependent signaling. To investigate whether the FZD4 antibody also affects colony formation, IgG5020 was tested using five pancreatic cancer cell lines (Figure 19). Consistent with the results in Figure 18, IgG5020 inhibits colony formation by cell lines with RNF43 mutations (HPAFII, AsPC1, and PATU8988), but does not inhibit colony formation by cell lines without RNF43 mutations (BxPC3 and PANC 1).

[0227] 6. Anti-FZD4 Fab binds to cells derived from pancreatic cancer patient tumors and affects their growth. Next, Fab 5019 and 5020 were tested for binding to pancreatic cancer patient tumor-derived cells (PDX) by immunofluorescence staining. As shown in Figure 20, clear membrane staining patterns were shown with both Fabs on PDX cell lines GP2A and GP14A and pancreatic cell line CAPAN2. Furthermore, these antibodies were tested in a cell proliferation assay (Figure 21). Both Fab and IgG 5020 were able to inhibit the growth of PDX cell lines GP2A and GP14A, which are PDX cell lines with mutations in the RNF43 gene, consistent with the observations in Figures 18 and 19.

[0228] To demonstrate the antitumor activity of these disclosed anti-FZD antibodies, in vivo efficacy tests are in progress.

[0229] XI. Exemplary Aspects 1. An antibody that specifically binds to each cysteine-rich domain (CRD) of one or more of the human Frizzled receptors selected from FZD 1, 2, 4, 5, 7, 8, and 9, comprising a light chain variable region and / or a heavy chain variable region, where the heavy chain variable region comprises complementarity-determining regions CDR-H1, CDR-H2, and CDR-H3, the light chain variable region comprises complementarity-determining regions CDR-L1, CDR-L2, and CDR-L3, and the amino acid sequences of the CDRs comprise or consist of sequences selected from the sequences in Table 1a or Table 3a, antibody. <UNK> 2. where the amino acid sequences of the CDRs comprise or consist of sequences selected from the sequences described below, CDR-H1 is LYYTDM (SEQ ID NO: 149), IYFSSI (SEQ ID NO: 158), IGSSSSI (SEQ ID NO: 159), VNSSSI (SEQ ID NO: 160), IHFSSI (SEQ ID NO: 161), IYSASI (SEQ ID NO: 162), IHSSSI (SEQ ID NO: 157), IYFSSI (SEQ ID NO: 158), IYSSSI (SEQ ID NO: 163), LSYSFF (SEQ ID NO: 164), LSFYFL (SEQ ID NO: 165), LSSYYM (SEQ ID NO: 15), SSFYFM (SEQ ID NO: 166), LSYYYM (SEQ ID NO: 3), IASYFT (SEQ ID NO: 168), FSSSSI Selected from the group consisting of (SEQ ID NO: 12), LSYYFM (SEQ ID NO: 169), IYYYPM (SEQ ID NO: 170), FSAYNI (SEQ ID NO: 171), IYYFGM (SEQ ID NO: 172), IHSSSI (SEQ ID NO: 157), and ISYHYM (SEQ ID NO: 429), CDR-H2 is SISLFFGYVS (SEQ ID NO: 150), SNYPSFGSNS (SEQ ID NO: 174), SIYSAFASTS (SEQ ID NO: 175), AFYSSFGATS (SEQ ID NO: 176), AYYSAFASSS (SEQ ID NO: 177), CSYPSFGSTS (SEQ ID NO: 178), SRYPSFGSTS (SEQ ID NO: 179), AIYSSFSANS (SEQ ID NO: 180), SNYPAFGSTS (SEQ ID NO: 181), SIYSAFLSTT (SEQ ID NO: 182), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGYTY (SEQ ID NO: 36), SIYPFHASTY (SEQ ID NO: 183), TVYPYLDYTY (SEQ ID NO: 184), SIYPYSRNTF (SEQ ID NO: 185), SIYPFSGYST (SEQ ID NO: 186), SIYPYYAYTY (SEQ ID NO: 187), SIYLSFGYGY (SEQ ID NO: 188), CCNSAYRYGP (SEQ ID NO: 189), SIYPYAGNTY (SEQ ID NO: 190), SFYSYYSFTY (SEQ ID NO: 191), SLYTSYGYTY (SEQ ID NO: 192), YIYPFNGYSY (SEQ ID NO: 193), YIYPSYDYTY (SEQ ID NO: 194), YISPPYGFTY (SEQ ID NO: 195), ATYSSFGSIT (SEQ ID NO: 173), and SIYPNLGYTY (SEQ ID Selected from the group consisting of NO: 430), CDR-H3 is YHPFFGYAL (SEQ ID NO: 196), YLAM (SEQ ID NO: 151), YHFPFAYSL (SEQ ID NO: 197), YHFPFGFAL (SEQ ID NO: 198), YHFPFGHAL (SEQ ID NO: 199), YHYPFGHAL (SEQ ID NO: 200), YHYPFGHAL (SEQ ID NO: 200), YHYPFGTAL (SEQ ID NO: 201), YHYPFGYAL (SEQ ID NO: 202), YHYPFGYAM (SEQ ID NO: 203), YHYPHGHAL (SEQ ID NO: 204), PAPFSYHVL (SEQ ID NO: 205), AAPGSYHPM (SEQ ID NO: 206), AAPYFYGVM (SEQ ID NO: 207), AFPGSYHPM (SEQ ID NO: 208), AYPFSYHFM (SEQ ID NO: 209), PSAFSYHPM (SEQ ID NO: 210), PVAGAYHPM (SEQ ID NO: 211), SSLGFYNGM (SEQ ID NO: 212), TVRGSKKPYFSGWAM (SEQ ID NO: 213), TYPGYYYIL (SEQ ID NO: 214), SGVGGDHAL (SEQ ID NO: 215), VWYVVQ (SEQ ID NO: 216), GYFYTWGGM (SEQ ID NO: 217), GYFYTWGGM (SEQ ID NO: 217), GYYYSWGGM (SEQ ID NO: 218), YHHPFGYAL (SEQ ID NO: Selected from the group consisting of 196), and AYPFSYHYM (SEQ ID NO: 431), CDR-L1 is SVSSA (SEQ ID NO: 103), CDR-L2 is SASSLYS (SEQ ID NO: 104), and / or CDR-L3 is selected from the group consisting of AAYHWPPLF (SEQ ID NO: 148), GVYLF (SEQ ID NO: 152), SSYSLI (SEQ ID NO: 153), WAYGPF (SEQ ID NO: 154), YYHPI (SEQ ID NO: 155), and YYSLF (SEQ ID NO: 156). The antibody according to embodiment 1. 3. The amino acid sequence of the CDR includes or consists of sequences selected as described below. CDR-H1 is ISYYYM (SEQ ID NO: 1), IYSYYM (SEQ ID NO: 2), LSYYYM (SEQ ID NO: 3), IYYYSI (SEQ ID NO: 4), LYSYYM (SEQ ID NO: 5), LSSYSM (SEQ ID NO: 6), ISYYYI (SEQ ID NO: 7), LSYSSM (SEQ ID NO: 8), IYYYYM (SEQ ID NO: 9), LYYYSI (SEQ ID NO: 10), ISSYYI (SEQ ID NO: 11), FSSSSI (SEQ ID NO: 12), LSYYSI (SEQ ID NO: 13), LYSYYI (SEQ ID NO: 14), LSSYYM (SEQ ID NO: 15), LSYYYI (SEQ ID NO: 16) Selected from the group consisting of ISSYYM (SEQ ID NO: 17), LSYYSM (SEQ ID NO: 18), LYSYSI (SEQ ID NO: 19), LYYYYI (SEQ ID NO: 20), IYSYYI (SEQ ID NO: 21), ISYSYI (SEQ ID NO: 22), and ISYYSM (SEQ ID NO: 23), CDR-H2, SIYSYYGYTY (SEQ ID NO: 24), SIYSSSSSTY (SEQ ID NO: 25), SIYPSSSYTY (SEQ ID NO: 26), SIYSSSSYTS (SEQ ID NO: 27), YISSYSGSTY (SEQ ID NO: 28), SIYSSYGYTY (SEQ ID NO: 29), YISSYYGYTY (SEQ ID NO: 30), SIYPSSSSTY (SEQ ID NO: 31), SIYSSSGYTY (SEQ ID NO: 32), YISSYSGSTS (SEQ ID NO: 33), SISSYYGSTY (SEQ ID NO: 34), SIYSYYGSTY (SEQ ID NO: 35), SIYPYSGYTY (SEQ ID NO: 36), YISPYYGYTS (SEQ ID NO: 37), SISSSSGYTY (SEQ ID NO: 38), SIYSYSSSTY (SEQ ID NO: 39), SISPSSSYTY (SEQ ID NO: 39). 40. YISPYYGYTY (SEQ ID NO: 41), SISPYSSSTY (SEQ ID NO: 42), SIYSSYGSTY (SEQ ID NO: 43), SIYSSSSYTY (SEQ ID NO: 44), SIYPSSGYTY (SEQ ID NO: 45), SIYPYSGSTY (SEQ ID NO: 45). 46. ​​SIYPSYGSTY (SEQ ID NO: 47), YISSYSSYTY (SEQ ID NO: 48), SIYSYYSSTY (SEQ ID NO: 49), YISSSYGYTS (SEQ ID NO: 50), SISPYSSYTY (SEQ ID NO: 51). 52) SIYPYYSYTY (SEQ ID NO: 53), SISPYYGYTS (SEQ ID NO: 54), SISPSYSSTY (SEQ ID NO: 55), SISSSYSSTY (SEQ ID NO: 56), SIYPYSGSTS (SEQ ID NO: 57), SISSYYSSTS (SEQ ID NO: 57) 58) and SIYSYSGYTY (SEQ ID NO: 59).CDR-H3が、SSFSWAM (SEQ ID NO: 60)、SSFYWAL (SEQ ID NO: 61)、SWFGWGI (SEQ ID NO: 62)、YWFSYGYASYPAF (SEQ ID NO: 63)、HPWYGM (SEQ ID NO: 64) 65)、PAPGHWGF (SEQ ID NO: 66)、SSFFWAM (SEQ ID NO: 67)、SAFYWAM (SEQ ID NO: 68)、HFFAM (SEQ ID NO: 69)、SWWAWAF (SEQ ID NO: 70)、SAFGWF (SEQ ID NO: 70) (SEQ ID NO: 72)、PYYWSGGF (SEQ ID NO: 73)、HPSSSWFSFGAL (SEQ ID NO: 74)、SAFYWAF (SEQ ID NO: 75)、SSYAWAM (SEQ ID NO: 76)、SSFYWAI (SEQ ID NO: 77) 78)、PAVWVGL (SEQ ID NO: 79)、SWVFWAL (SEQ ID NO: 80)、SWVYWGM (SEQ ID NO: 81)、SWVYWAL (SEQ ID NO: 82)、NOSSYAWAI (SEQ ID NO: 83) 84)、HGASFGSGAPAF (SEQ ID NO: 85)、SCFFWAM (SEQ ID NO: 86)、WAFFGL (SEQ ID NO: 87)、SSFYFAM (SEQ ID NO: 88)、SAFSWAI (SEQ ID NO: 89)、SGFY IDW NO: 90)、PSVGYAAF (SEQ ID NO: 91)、SWVGWGL (SEQ ID NO: 92)、SSVGYVAM (SEQ ID NO: 93)、SWVYWAF (SEQ ID NO: 94)、YYYYSSSVYFWYAAL (SEQ ID NO: 95). 96)、SWVYWAI (SEQ ID NO: 97)、SWVGWGI (SEQ ID NO: 98)、SSVYWAL (SEQ ID NO:99) Selected from the group consisting of WGGWGSGGYFYAAL (SEQ ID NO: 100), FWYPGM (SEQ ID NO: 101), and SSFAWAF (SEQ ID NO: 102), CDR-L1 is SVSSA (SEQ ID NO: 103), CDR-L2 is SASSLYS (SEQ ID NO: 104), and / or CDR-L3, HPWSGGYLI (SEQ ID NO: 105), PVGYWGVPI (SEQ ID NO: 106), VSGGAHALI (SEQ ID NO: 107), VSSAYPI (SEQ ID NO: 108), FWGVPI (SEQ ID NO: 109), SYYHYAALI (SEQ ID NO: 110), WYYAPI (SEQ ID NO: 111), SHSYSLI (SEQ ID NO: 112), SGYGPF (SEQ ID NO: 113), SWSSPI (SEQ ID NO: 114), HYSVYASLI (SEQ ID NO: 115), and PHPPSLI (SEQ ID NO: 115). 116, VAYSHVGLI (SEQ ID NO: 117), GYGAPI (SEQ ID NO: 118), SWYSLI (SEQ ID NO: 119), PGYLF (SEQ ID NO: 120), VWFGLI (SEQ ID NO: 121), VYYGSPLF (SEQ ID NO: 120) 122, HAHSPLI (SEQ ID NO: 123), SSAYYPF (SEQ ID NO: 124), GHASPI (SEQ ID NO: 125), SSGGWSLI (SEQ ID NO: 126), VAWSSFLI (SEQ ID NO: 127), SVAAASLI (SEQ ID NO: 126). 128) SGWWGVSLI (SEQ ID NO: 129), SYAAYLF (SEQ ID NO: 130), HGSLF (SEQ ID NO: 131), YAGVSNLF (SEQ ID NO: 132), GWPYSALF (SEQ ID NO: 133), SGYYPSLF (SEQ ID NO: 132). 134)、SYHSGSGLI (SEQ ID NO: 135), HGYSASLI (SEQ ID NO: 136), APGWALF (SEQ ID NO: 137), GHSSPI (SEQ ID NO: 138), GWPSLF (SEQ ID NO: 139), VPGYPVPI (SEQ ID NO: 138). 140) HYYSHLI (SEQ ID NO: 141), GPASSLI (SEQ ID NO: 142), SVGSSYYLI (SEQ ID NO: 142)Selected from the group consisting of 143), YYGPWVLI (SEQ ID NO: 144), AASWGYPF (SEQ ID NO: 145), HWSYPI (SEQ ID NO: 146), and GGWGPF (SEQ ID NO: 147), The antibody according to embodiment 1. 4. (i) Heavy chain amino acid sequences listed in Table 2, (ii) Amino acid sequences having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, and at least 99% sequence identity with the heavy chain amino acid sequences listed in Table 2, wherein the CDR sequence is one of the CDR sequence sets listed in Table 1a or Table 3a, or (iii)(i) Conservatively substituted amino acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. An antibody according to embodiment 2 or 3, comprising a heavy chain variable region including the above. 5. (i) Light chain amino acid sequences listed in Table 2, (ii) an amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the light chain amino acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii)(i) Conservatively substituted amino acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. An antibody comprising a light chain variable region including any one of embodiments 2 to 4. 6. An antibody according to any of embodiments 1 to 5, wherein the CDR sequence is a complete set of CDR sequences selected from antibodies identified in Table 1a or Table 3a. 7. An antibody according to any of embodiments 1 to 5, wherein the CDR sequence comprises a set of light chain CDR sequences or a set of heavy chain CDR sequences selected from antibodies identified in Table 1a or Table 3a. 8. An antibody according to any of embodiments 1 to 7 that specifically binds to FZD4. 9. An antibody according to aspect 8, wherein the CDR sequence is a set of CDR sequences of an antibody selected from antibodies 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, 5077-5080, or 5081. 10. An antibody, one of embodiments 1 to 7, that specifically binds to FZD4 and at least one other FZD receptor selected from FZD1, FZD2, FZD5, FZD7, FZD8, and FZD9. 11. An antibody according to aspect 9, wherein the CDR sequence is a set of CDR sequences of antibodies selected from antibodies 5014, 5016, 5018-5023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. 12. An antibody, one of embodiments 1 to 11, that preferentially binds to Frizzled 4 (FZD4) compared to FZD1, 2, 5, 7, 8, or 9. 13. An antibody according to any of embodiments 1 to 11, which preferentially binds to FZD4 compared to another FZD receptor. 14. An antibody according to embodiment 13, comprising a CDR sequence which is a set of CDR sequences of antibodies selected from antibodies 5028, 5029, 5031, 5034, 5035, 6497, 6498, 5039, 5045, 5048, 5054, 5056, 5057, 5067, 5073, 5074, and 5075. 15. An antibody of any one of Aspects 1 to 13 having a binding affinity measured by surface plasmon resonance of from about 0.2 nM to about 15.3 nM. 16. An antibody of any one of Aspects 1 to 15 that is a monoclonal antibody. 17. An antibody of any one of Aspects 1 to 16 that is a humanized antibody. 18. An antibody of any one of Aspects 1 to 17 that is a single-chain antibody. 19. An antibody of any one of Aspects 1 to 18 that is an antibody binding fragment selected from Fab, Fab’, F(ab’)2, scFv, dsFv, ds-scFv, dimers, nanobodies, minibodies, diabodies, and multimers thereof. 20. An antibody of any one of Aspects 1 to 18 that is a multivalent antibody that is a divalent, trivalent, or tetravalent antibody. 21. An antibody of any one of Aspects 1 to 18 that is a bispecific antibody that further binds to LPR 5 / 6. 22. An antibody of any one of Aspects 1 to 18 that contains a non-natural glycosylation pattern. 23. An antibody of any one of Aspects 1 to 18 that contains a cysteine substitution or addition in the constant region or framework region. 24. An antibody of any one of Aspects 1 to 18 that blocks the binding of Wnt to FZD. 25. An immunoconjugate comprising an antibody of any one of Aspects 1 to 21 and a detectable label or a cytotoxic agent. 26. An immunoconjugate according to embodiment 25, comprising a cytotoxic agent selected from meitansinoids, auristatin, dorastatin, tubulicin, cryptophycin, pyrrolobenzodiazepine (PBD) dimers, indolinobenzodiazepine dimers, α-amanitin, trichoten, SN-38, duocalmycin, CC1065, calicheamicin, engine antibiotics, taxanes, doxorubicin derivatives, anthracyclines, and their stereoisomers, azanofide, isosteres, analogs, or derivatives. 27. A nucleic acid molecule encoding one of the antibodies described in embodiments 1 to 21. 28. A nucleic acid molecule according to embodiment 27, wherein one or more of the CDR sequences are encoded by nucleic acids from Table 1b, Table 1c, Table 3b, or Table 3c. 29. The aforementioned antibody (i) Heavy chain nucleic acid sequences listed in Table 2, (ii) A nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity with respect to the heavy chain nucleic acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii)(i) Codon-degenerate nucleic acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. A nucleic acid molecule according to embodiment 27, comprising a heavy chain variable region encoded by a nucleic acid containing the following: 30. The aforementioned antibody (i) Light chain nucleic acid sequences listed in Table 2, (ii) A nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with respect to the light chain nucleic acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii)(i) Codon-degenerate nucleic acid sequences, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. A nucleic acid molecule according to embodiment 27, comprising a light chain variable region encoded by a nucleic acid containing the following: 31. A vector comprising an expression control sequence functionally linked to any one of the nucleic acids of embodiments 27 to 30. 32. A host cell comprising a recombinant nucleic acid molecule containing an expression regulatory sequence functionally linked to one of the nucleic acids of embodiments 27 to 30. 33. Host cells of embodiment 32, which are Chinese hamster ovary (CHO) cells. 34. A host cell containing the vector of embodiment 31. 35. A method for producing an anti-FZD antibody, comprising the step of culturing one of the host cells described in any one of embodiments 32 to 34. 36. A composition comprising, optionally with a suitable diluent, one or more antibodies from embodiments 1 to 24, an immunoconjugate from embodiments 25 to 26, a nucleic acid molecule from embodiments 27 to 30, a vector from embodiment 31, or a host cell from embodiments 34 to 34. 37. A composition according to embodiment 3636, comprising one or more antibodies or immunoconjugates, and optionally being a pharmaceutical composition. 38. A kit comprising one or more antibodies from embodiments 1 to 24, an immunoconjugate from embodiments 25 to 26, a nucleic acid molecule from embodiments 27 to 30, a vector from embodiment 31, or host cells from embodiments 34 to 34. 39. A method for detecting FZD expression, comprising the steps of: contacting a sample containing one or more cells with one or more antibodies or immunoconjugates from any one of embodiments 1 to 26 under conditions that allow for the formation of an antibody-cell complex; and detecting the presence of any antibody complex. 40. The method according to embodiment 39, wherein detection is performed by immunofluorescence. 41. The method according to embodiment 39, wherein detection is performed by flow cytometry. 42. The method described above is for detecting FZD4 expression, and any one of the methods described in aspects 39 to 41, wherein the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081. 43. A method for inhibiting Wnt ligand binding to the FZD receptor, interfering with the Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting disheveled activation, promoting the preservation of the β-catenin degradation complex, promoting the accumulation of β-catenin, or inhibiting cell proliferation, A method comprising the step of contacting cells expressing an FZD receptor with one of the antibodies or immunoconjugates described in embodiments 1 to 26. 44. The method according to embodiment 43, wherein the Wnt ligand is Wnt3a. 45. The antibody or immunoconjugate is (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081, or (b) 5014, 5016, 5018-5023, 502 A method according to embodiment 43, comprising a set of CDR sequences corresponding to an antibody selected from 5, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. 46. A method for treating a cancer of a subject that requires such treatment, comprising the step of administering to the subject an effective amount of a pharmaceutical composition comprising one antibody or immunoconjugate from any one of embodiments 1 to 26. 47. A method according to aspect 46, wherein the cancer is selected from cancer cells of the colon, lung, breast, ovary, endometrium, pancreas, stomach, liver, adrenal cortex, and osteoblastoma. 48. A method according to aspect 46, wherein the cancer is selected from acute myeloid leukemia, neuroblastoma, liver cancer, lung cancer, endometrial cancer, salivary gland-like cystic carcinoma, colorectal cancer, prostate cancer, glioblastoma, bladder cancer, cervical cancer, pancreatic cancer, colon cancer, breast cancer, esophageal cancer, glioma, gastric cancer, astrocytoma, and osteosarcoma. 49. The method of embodiment 46, wherein the antibody or immunoconjugate specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay, and optionally the antibody or immunoconjugate is one of the antibodies or immunoconjugates of embodiments 1 to 26. 50. The antibody or immunoconjugate is (a) 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081, or (b) 5014, 5016, 5018-5023, 502 A method according to embodiment 46, comprising a set of CDR sequences corresponding to an antibody selected from 5, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076. 51. A method according to aspect 46, wherein the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5019 and 5020. 52. The method according to embodiment 51, wherein the cancer treated by the method comprises one or more cancer cells containing a mutation in the RNF43 gene, and the antibody and antibody or immunoconjugate comprises a set of CDR sequences corresponding to antibody 5020.

[0230] Where used herein, unless otherwise specified, the following meanings apply: The word “may” is used in a permissive sense (i.e., meaning it is possible) rather than a compulsory sense (i.e., meaning it must). The words “include,” “including,” and “includes,” etc., mean to include without limitation. The singular forms “a,” “an,” and “the” include multiple referents. Thus, for example, a reference to “one element” includes a combination of two or more elements, despite the use of other terms and phrases for one or more elements, such as “one or more.” The phrase “at least one” includes “one or more,” “one or a plurality,” and “a plurality.” The term “or,” unless otherwise indicated, is non-exclusive, i.e., encompasses both “and” and “or.” The term “any of” between a modifier and a set of things means that the modifier modifies each member of the set of things. Therefore, for example, the phrase "at least one of 1, 2, or 3" means "at least 1, at least 2, or at least 3." The term "essentially consisting of" refers to the inclusion of enumerated and other elements that do not substantially affect the basic and novel features of the claimed combination.

[0231] As used herein, terms relating to degree, such as “about,” “substantially,” and “approximately,” mean a reasonable deviation from the modified term such that the final result does not change significantly. These terms relating to degree should be interpreted as including a deviation of at least ±5% from the modified term, provided that the deviation does not negate the meaning of the word it modifies.

[0232] Furthermore, the definitions and embodiments described in certain sections are intended to be applicable to other embodiments described herein in which they are preferred, as will be understood by those skilled in the art. For example, the following sections define various aspects of the invention in more detail. Each of these defined aspects can be combined with any other single or more aspects unless it is explicitly stated otherwise. In particular, any feature indicated as preferred or advantageous can be combined with any other single or more features indicated as preferred or advantageous.

[0233] The description and drawings are not intended to limit the invention to any particular form disclosed, but rather to encompass all modifications, equivalents, and substitutions that fall within the spirit and scope of the invention as defined by the appended claims. Further modifications and substitutions of various aspects of the invention will be apparent to those skilled in the art in consideration of this description. Accordingly, this description and drawings should be interpreted as illustrative only and are intended to teach those skilled in the art a general way of carrying out the invention. The forms of the invention shown and described herein should be interpreted as examples of embodiments. As will be apparent to any person skilled in the art after taking advantage of this description of the invention, elements and materials may be replaced with elements and materials illustrated and described herein, parts and processes may be reversed or omitted, and certain features of the invention may be used independently. Modifications to the elements described herein may be made without departing from the spirit and scope of the invention as set forth in the following claims. The headings used herein are for structural purposes only and are not intended to limit the scope of the description.

[0234] All publications, patents, and patent applications referenced herein are incorporated by reference to the same extent as each individual publication, patent, or patent application is specifically and individually indicated as being incorporated by reference.

[0235] Array information SEQUENCE LISTING <110> ANTLERA THERAPEUTICS INC. <120> FRIZZLED RECEPTOR ANTIBODIES AND USES THEREOF <150> US 62 / 886,292 <151> 2019-08-13 <150> US 62 / 885,781 <151> 2019-08-12 <160> 431 <170> PatentIn version 3.5 <210> 1 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 1 Ile Ser Tyr Tyr Tyr Met 1 5 <210> 2 <211> 6 <212> PRT <213> Artificial Sequence <220>​​​​​​​​​​​​​​​​<212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 3 Leu Ser Tyr Tyr Tyr Met 1 5 <210> 4 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 4 Ile Tyr Tyr Tyr Ser Ile 1 5 <210> 5 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 5 Leu Tyr Ser Tyr Tyr Met 1 5 <210> 6 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 6 Leu Ser Ser Tyr Ser Met 1 5 <210> 7 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 7 Ile Ser Tyr Tyr Tyr Ile 1 5 <210> 8 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 8 Leu Ser Tyr Ser Ser Met 1 5 <210> 9 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 9 Ile Tyr Tyr Tyr Tyr Met 1 5 <210> 10 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 10 Leu Tyr Tyr Tyr Ser Ile 1 5 <210> 11 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 11 Ile Ser Ser Tyr Tyr Ile 1 5 <210> 12 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 12 Phe Ser Ser Ser Ser Ile 1 5 <210> 13 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 13 Leu Ser Tyr Tyr Ser Ile 1 5 <210> 14 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 14 Leu Tyr Ser Tyr Tyr Ile 1 5 <210> 15 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 15 Leu Ser Ser Tyr Tyr Met 1 5 <210> 16 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 16 Leu Ser Tyr Tyr Tyr Ile 1 5 <210> 17 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 17 Ile Ser Ser Tyr Tyr Met 1 5 <210> 18 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 18 Leu Ser Tyr Tyr Ser Met 1 5 <210> 19 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 19 Leu Tyr Ser Tyr Ser Ile 1 5 <210> 20 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 20 Leu Tyr Tyr Tyr Tyr Ile 1 5 <210> 21 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 21 Ile Tyr Ser Tyr Tyr Ile 1 5 <210> 22 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 22 Ile Ser Tyr Ser Tyr Ile 1 5 <210> 23 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 23 Ile Ser Tyr Tyr Ser Met 1 5 <210> 24 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 24 Ser Ile Tyr Ser Tyr Tyr Gly Tyr Thr Tyr 1 5 10 <210> 25 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 25 Ser Ile Tyr Ser Ser Ser Ser Ser Thr Tyr 1 5 10 <210> 26 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 26 Ser Ile Tyr Pro Ser Ser Ser Tyr Thr Tyr 1 5 10 <210> 27 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 27 Ser Ile Tyr Ser Ser Ser Ser Tyr Thr Ser 1 5 10 <210> 28 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 28 Tyr Ile Ser Ser Tyr Ser Gly Ser Thr Tyr 1 5 10 <210> 29 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 29 Ser Ile Tyr Ser Ser Tyr Gly Tyr Thr Tyr 1 5 10 <210> 30 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 30 Tyr Ile Ser Ser Tyr Tyr Gly Tyr Thr Tyr 1 5 10 <210> 31 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 31 Ser Ile Tyr Pro Ser Ser Ser Ser Thr Tyr 1 5 10 <210> 32 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 32 Ser Ile Tyr Ser Ser Ser Gly Tyr Thr Tyr 1 5 10 <210> 33 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 33 Tyr Ile Ser Ser Tyr Ser Gly Ser Thr Ser 1 5 10 <210> 34 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 34 Ser Ile Ser Ser Tyr Tyr Gly Ser Thr Tyr 1 5 10 <210> 35 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 35 Ser Ile Tyr Ser Tyr Tyr Gly Ser Thr Tyr 1 5 10 <210> 36 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 36 Ser Ile Tyr Pro Tyr Ser Gly Tyr Thr Tyr 1 5 10 <210> 37 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 37 Tyr Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 1 5 10 <210> 38 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 38 Ser Ile Ser Ser Ser Ser Gly Tyr Thr Tyr 1 5 10 <210> 39 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 39 Ser Ile Tyr Ser Tyr Ser Ser Ser Thr Tyr 1 5 10 <210> 40 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 40 Ser Ile Ser Pro Ser Ser Ser Tyr Thr Tyr 1 5 10 <210> 41 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 41 Tyr Ile Ser Pro Tyr Tyr Gly Tyr Thr Tyr 1 5 10 <210> 42 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 42 Ser Ile Ser Pro Tyr Ser Ser Ser Thr Tyr 1 5 10 <210> 43 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 43 Ser Ile Tyr Ser Ser Tyr Gly Ser Thr Tyr 1 5 10 <210> 44 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 44 Ser Ile Tyr Ser Ser Ser Ser Tyr Thr Tyr 1 5 10 <210> 45 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 45 Ser Ile Tyr Pro Ser Ser Gly Tyr Thr Tyr 1 5 10 <210> 46 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 46 Ser Ile Tyr Pro Tyr Ser Gly Ser Thr Tyr 1 5 10 <210> 47 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 47 Ser Ile Tyr Pro Ser Tyr Gly Ser Thr Tyr 1 5 10 <210> 48 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 48 Tyr Ile Ser Ser Tyr Ser Ser Tyr Thr Tyr 1 5 10 <210> 49 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 49 Ser Ile Tyr Ser Tyr Tyr Ser Ser Thr Tyr 1 5 10 <210> 50 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 50 Tyr Ile Ser Ser Ser Tyr Gly Tyr Thr Ser 1 5 10 <210> 51 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 51 Ser Ile Ser Pro Tyr Ser Ser Tyr Thr Tyr 1 5 10 <210> 52 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 52 Tyr Ile Ser Pro Tyr Ser Gly Tyr Thr Ser 1 5 10 <210> 53 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 53 Ser Ile Tyr Pro Tyr Tyr Ser Tyr Thr Tyr 1 5 10 <210> 54 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 54 Ser Ile Ser Pro Tyr Tyr Gly Tyr Thr Ser 1 5 10 <210> 55 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 55 Ser Ile Ser Pro Ser Tyr Ser Ser Thr Tyr 1 5 10 <210> 56 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 56 Ser Ile Ser Ser Ser Tyr Ser Ser Thr Tyr 1 5 10 <210> 57 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 57 Ser Ile Tyr Pro Tyr Ser Gly Ser Thr Ser 1 5 10 <210> 58 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 58 Ser Ile Ser Ser Tyr Tyr Ser Ser Thr Ser 1 5 10 <210> 59 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 59 Ser Ile Tyr Ser Tyr Ser Gly Tyr Thr Tyr 1 5 10 <210> 60 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 60 Ser Ser Phe Ser Trp Ala Met 1 5 <210> 61 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 61 Ser Ser Phe Tyr Trp Ala Leu 1 5 <210> 62 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 62 Ser Trp Phe Gly Trp Gly Ile 1 5 <210> 63 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 63 Tyr Trp Phe Ser Tyr Gly Tyr Ala Ser Tyr Pro Ala Phe 1 5 10 <210> 64 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 64 His Pro Trp Tyr Gly Met 1 5 <210> 65 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 65 Ser Ala Phe Tyr Trp Ala Leu 1 5 <210> 66 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 66 Pro Ala Pro Gly His Trp Gly Phe 1 5 <210> 67 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 67 Ser Ser Phe Phe Trp Ala Met 1 5 <210> 68 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 68 Ser Ala Phe Tyr Trp Ala Met 1 5 <210> 69 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 69 His Phe Phe Ala Met 1 5 <210> 70 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 70 Ser Trp Trp Ala Trp Ala Phe 1 5 <210> 71 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 71 Ser Ala Phe Gly Trp Ala Leu 1 5 <210> 72 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 72 Ser Ser Phe Phe Phe Ala Met 1 5 <210> 73 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 73 Pro Tyr Tyr Trp Ser Gly Gly Phe 1 5 <210> 74 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 74 His Pro Ser Ser Ser Trp Phe Ser Phe Gly Ala Leu 1 5 10 <210> 75 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 75 Ser Ala Phe Tyr Trp Ala Phe 1 5 <210> 76 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 76 Ser Ser Tyr Ala Trp Ala Met 1 5 <210> 77 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 77 Ser Ser Phe Tyr Trp Ala Ile 1 5 <210> 78 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 78 Ser Pro Trp Gly Ser Gly Trp Ala Gly Phe 1 5 10 <210> 79 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 79 Pro Ala Val Trp Val Gly Leu 1 5 <210> 80 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 80 Ser Trp Val Phe Trp Ala Leu 1 5 <210> 81 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 81 Ser Trp Val Tyr Trp Gly Met 1 5 <210> 82 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 82 Ser Trp Val Tyr Trp Ala Leu 1 5 <210> 83 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 83 Ser Ser Tyr Ala Trp Ala Ile 1 5 <210> 84 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 84 Ser Ser Phe Tyr Trp Ala Met 1 5 <210> 85 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 85 His Gly Ala Ser Phe Gly Ser Gly Ala Pro Ala Phe 1 5 10 <210> 86 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 86 Ser Cys Phe Phe Trp Ala Met 1 5 <210> 87 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 87 Trp Ala Phe Phe Gly Leu 1 5 <210> 88 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 88 Ser Ser Phe Tyr Phe Ala Met 1 5 <210> 89 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 89 Ser Ala Phe Ser Trp Ala Ile 1 5 <210> 90 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 90 Ser Gly Phe Tyr Trp Ala Leu 1 5 <210> 91 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 91 Pro Ser Val Gly Tyr Ala Ala Phe 1 5 <210> 92 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 92 Ser Trp Val Gly Trp Gly Leu 1 5 <210> 93 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 93 Ser Ser Val Gly Tyr Val Ala Met 1 5 <210> 94 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 94 Ser Trp Val Tyr Trp Ala Phe 1 5 <210> 95 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 95 Tyr Tyr Tyr Ser Ser Ser Val Tyr Phe Trp Tyr Ala Ala Leu 1 5 10 <210> 96 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 96 Ser Ser Phe Phe Trp Ala Ile 1 5 <210> 97 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 97 Ser Trp Val Tyr Trp Ala Ile 1 5 <210> 98 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 98 Ser Trp Val Gly Trp Gly Ile 1 5 <210> 99 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 99 Ser Ser Val Tyr Trp Ala Leu 1 5 <210> 100 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 100 Trp Gly Gly Trp Gly Ser Gly Gly Tyr Phe Tyr Ala Ala Leu 1 5 10 <210> 101 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 101 Phe Trp Tyr Pro Gly Met 1 5 <210> 102 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 102 Ser Ser Phe Ala Trp Ala Phe 1 5 <210> 103 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 103 Ser Val Ser Ser Ala 1 5 <210> 104 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 104 Ser Ala Ser Ser Leu Tyr Ser 1 5 <210> 105 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 105 His Pro Trp Ser Gly Gly Tyr Leu Ile 1 5 <210> 106 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 106 Pro Val Gly Tyr Trp Gly Val Pro Ile 1 5 <210> 107 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 107 Val Ser Gly Gly Ala His Ala Leu Ile 1 5 <210> 108 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 108 Val Ser Ser Ala Tyr Pro Ile 1 5 <210> 109 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 109 Phe Trp Gly Val Pro Ile 1 5 <210> 110 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 110 Ser Tyr Tyr His Tyr Ala Ala Leu Ile 1 5 <210> 111 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 111 Trp Tyr Tyr Ala Pro Ile 1 5 <210> 112 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 112 Ser His Ser Tyr Ser Leu Ile 1 5 <210> 113 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 113 Ser Gly Tyr Gly Pro Phe 1 5 <210> 114 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 114 Ser Trp Ser Ser Pro Ile 1 5 <210> 115 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 115 His Tyr Ser Val Tyr Ala Ser Leu Ile 1 5 <210> 116 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 116 Pro His Pro Pro Ser Leu Ile 1 5 <210> 117 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 117 Val Ala Tyr Ser His Val Gly Leu Ile 1 5 <210> 118 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 118 Gly Tyr Gly Ala Pro Ile 1 5 <210> 119 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 119 Ser Trp Tyr Ser Leu Ile 1 5 <210> 120 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 120 Pro Gly Tyr Leu Phe 1 5 <210> 121 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 121 Val Trp Phe Gly Leu Ile 1 5 <210> 122 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 122 Val Tyr Tyr Gly Ser Pro Leu Phe 1 5 <210> 123 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 123 His Ala His Ser Pro Leu Ile 1 5 <210> 124 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 124 Ser Ser Ala Tyr Tyr Pro Phe 1 5 <210> 125 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 125 Gly His Ala Ser Pro Ile 1 5 <210> 126 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 126 Ser Ser Gly Gly Trp Ser Leu Ile 1 5 <210> 127 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 127 Val Ala Trp Ser Ser Phe Leu Ile 1 5 <210> 128 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 128 Ser Val Ala Ala Ala Ser Leu Ile 1 5 <210> 129 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 129 Ser Gly Trp Trp Gly Val Ser Leu Ile 1 5 <210> 130 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 130 Ser Tyr Ala Ala Tyr Leu Phe 1 5 <210> 131 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 131 His Gly Ser Leu Phe 1 5 <210> 132 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 132 Tyr Ala Gly Val Ser Asn Leu Phe 1 5 <210> 133 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 133 Gly Trp Pro Tyr Ser Ala Leu Phe 1 5 <210> 134 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 134 Ser Gly Tyr Tyr Pro Ser Leu Phe 1 5 <210> 135 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 135 Ser Tyr His Ser Gly Ser Gly Leu Ile 1 5 <210> 136 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 136 His Gly Tyr Ser Ala Ser Leu Ile 1 5 <210> 137 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 137 Ala Pro Gly Trp Ala Leu Phe 1 5 <210> 138 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 138 Gly His Ser Ser Pro Ile 1 5 <210> 139 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 139 Gly Trp Pro Ser Leu Phe 1 5 <210> 140 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 140 Val Pro Gly Tyr Pro Val Pro Ile 1 5 <210> 141 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 141 His Tyr Tyr Ser His Leu Ile 1 5 <210> 142 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 142 Gly Pro Ala Ser Ser Leu Ile 1 5 <210> 143 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 143 Ser Val Gly Ser Ser Tyr Tyr Leu Ile 1 5 <210> 144 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 144 Tyr Tyr Gly Pro Trp Val Leu Ile 1 5 <210> 145 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 145 Ala Ala Ser Trp Gly Tyr Pro Phe 1 5 <210> 146 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 146 His Trp Ser Tyr Pro Ile 1 5 <210> 147 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 147 Gly Gly Trp Gly Pro Phe 1 5 <210> 148 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 148 Ala Ala Tyr His Trp Pro Pro Leu Phe 1 5 <210> 149 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 149 Leu Tyr Tyr Thr Asp Met 1 5 <210> 150 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 150 Ser Ile Ser Leu Phe Phe Gly Tyr Val Ser 1 5 10 <210> 151 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 151 Tyr Leu Ala Met 1 <210> 152 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 152 Gly Val Tyr Leu Phe 1 5 <210> 153 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 153 Ser Ser Tyr Ser Leu Ile 1 5 <210> 154 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 154 Trp Ala Tyr Gly Pro Phe 1 5 <210> 155 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 155 Tyr Tyr His Pro Ile 1 5 <210> 156 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 156 Tyr Tyr Ser Leu Phe 1 5 <210> 157 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 157 Ile His Ser Ser Ser Ile 1 5 <210> 158 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 158 Ile Tyr Phe Ser Ser Ile 1 5 <210> 159 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 159 Ile Gly Ser Ser Ser Ile 1 5 <210> 160 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 160 Val Asn Ser Ser Ser Ile 1 5 <210> 161 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 161 Ile His Phe Ser Ser Ile 1 5 <210> 162 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 162 Ile Tyr Ser Ala Ser Ile 1 5 <210> 163 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 163 Ile Tyr Ser Ser Ser Ile 1 5 <210> 164 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 164 Leu Ser Tyr Ser Phe Phe 1 5 <210> 165 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 165 Leu Ser Phe Tyr Phe Leu 1 5 <210> 166 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 166 Ser Ser Phe Tyr Phe Met 1 5 <210> 167 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 167 Leu Ser Phe Tyr Tyr Met 1 5 <210> 168 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 168 Ile Ala Ser Tyr Phe Thr 1 5 <210> 169 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 169 Leu Ser Tyr Tyr Phe Met 1 5 <210> 170 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 170 Ile Tyr Tyr Tyr Pro Met 1 5 <210> 171 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 171 Phe Ser Ala Tyr Asn Ile 1 5 <210> 172 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 172 Ile Tyr Tyr Phe Gly Met 1 5 <210> 173 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 173 Ala Thr Tyr Ser Ser Phe Gly Ser Ile Thr 1 5 10 <210> 174 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 174 Ser Asn Tyr Pro Ser Phe Gly Ser Asn Ser 1 5 10 <210> 175 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 175 Ser Ile Tyr Ser Ala Phe Ala Ser Thr Ser 1 5 10 <210> 176 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 176 Ala Phe Tyr Ser Ser Phe Gly Ala Thr Ser 1 5 10 <210> 177 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 177 Ala Tyr Tyr Ser Ala Phe Ala Ser Ser Ser 1 5 10 <210> 178 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 178 Cys Ser Tyr Pro Ser Phe Gly Ser Thr Ser 1 5 10 <210> 179 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 179 Ser Arg Tyr Pro Ser Phe Gly Ser Thr Ser 1 5 10 <210> 180 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 180 Ala Ile Tyr Ser Ser Phe Ser Ala Asn Ser 1 5 10 <210> 181 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 181 Ser Asn Tyr Pro Ala Phe Gly Ser Thr Ser 1 5 10 <210> 182 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 182 Ser Ile Tyr Ser Ala Phe Leu Ser Thr Thr 1 5 10 <210> 183 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 183 Ser Ile Tyr Pro Phe His Ala Ser Thr Tyr 1 5 10 <210> 184 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 184 Thr Val Tyr Pro Tyr Leu Asp Tyr Thr Tyr 1 5 10 <210> 185 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 185 Ser Ile Tyr Pro Tyr Ser Arg Asn Thr Phe 1 5 10 <210> 186 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 186 Ser Ile Tyr Pro Phe Ser Gly Tyr Ser Thr 1 5 10 <210> 187 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 187 Ser Ile Tyr Pro Tyr Tyr Ala Tyr Thr Tyr 1 5 10 <210> 188 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 188 Ser Ile Tyr Leu Ser Phe Gly Tyr Gly Tyr 1 5 10 <210> 189 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 189 Cys Cys Asn Ser Ala Tyr Arg Tyr Gly Pro 1 5 10 <210> 190 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 190 Ser Ile Tyr Pro Tyr Ala Gly Asn Thr Tyr 1 5 10 <210> 191 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 191 Ser Phe Tyr Ser Tyr Tyr Ser Phe Thr Tyr 1 5 10 <210> 192 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 192 Ser Leu Tyr Thr Ser Tyr Gly Tyr Thr Tyr 1 5 10 <210> 193 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 193 Tyr Ile Tyr Pro Phe Asn Gly Tyr Ser Tyr 1 5 10 <210> 194 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 194 Tyr Ile Tyr Pro Ser Tyr Asp Tyr Thr Tyr 1 5 10 <210> 195 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 195 Tyr Ile Ser Pro Pro Tyr Gly Phe Thr Tyr 1 5 10 <210> 196 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 196 Tyr His His Pro Phe Gly Tyr Ala Leu 1 5 <210> 197 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 197 Tyr His Phe Pro Phe Ala Tyr Ser Leu 1 5 <210> 198 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 198 Tyr His Phe Pro Phe Gly Phe Ala Leu 1 5 <210> 199 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 199 Tyr His Phe Pro Phe Gly His Ala Leu 1 5 <210> 200 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 200 Tyr His Tyr Pro Phe Gly His Ala Leu 1 5 <210> 201 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 201 Tyr His Tyr Pro Phe Gly Thr Ala Leu 1 5 <210> 202 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 202 Tyr His Tyr Pro Phe Gly Tyr Ala Leu 1 5 <210> 203 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 203 Tyr His Tyr Pro Phe Gly Tyr Ala Met 1 5 <210> 204 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 204 Tyr His Tyr Pro His Gly His Ala Leu 1 5 <210> 205 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 205 Pro Ala Pro Phe Ser Tyr His Val Leu 1 5 <210> 206 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 206 Ala Ala Pro Gly Ser Tyr His Pro Met 1 5 <210> 207 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 207 Ala Ala Pro Tyr Phe Tyr Gly Val Met 1 5 <210> 208 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 208 Ala Phe Pro Gly Ser Tyr His Pro Met 1 5 <210> 209 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 209 Ala Tyr Pro Phe Ser Tyr His Phe Met 1 5 <210> 210 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 210 Pro Ser Ala Phe Ser Tyr His Pro Met 1 5 <210> 211 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 211 Pro Val Ala Gly Ala Tyr His Pro Met 1 5 <210> 212 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 212 Ser Ser Leu Gly Phe Tyr Asn Gly Met 1 5 <210> 213 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 213 Thr Val Arg Gly Ser Lys Lys Pro Tyr Phe Ser Gly Trp Ala Met 1 5 10 15 <210> 214 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 214 Thr Tyr Pro Gly Tyr Tyr Tyr Ile Leu 1 5 <210> 215 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 215 Ser Gly Val Gly Gly Asp His Ala Leu 1 5 <210> 216 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 216 Val Trp Tyr Val Val Gln 1 5 <210> 217 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 217 Gly Tyr Phe Tyr Thr Trp Gly Gly Met 1 5 <210> 218 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 218 Gly Tyr Tyr Tyr Ser Trp Gly Gly Met 1 5 <210> 219 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 219 tccgtgtcca gcgct 15 <210> 220 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 220 tcggcatcca gcctctactc t 21 <210> 221 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 221 ggtgtttacc tgttc 15 <210> 222 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 222 gctgcttacc attggccgcc gctgttcacg 30 <210> 223 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 223 ggtgtttacc tgttcacg 18 <210> 224 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 224 tcttcttatt ctctgatcac g 21 <210> 225 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 225 tgggcttacg gtccgttcac g 21 <210> 226 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 226 tactaccatc cgatcacg 18 <210> 227 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 227 tactactctc tgttcacg 18 <210> 228 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 228 atccattctt cttctata 18 <210> 229 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 229 ctctattata ctgatatg 18 <210> 230 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 230 atctattttt cttctatc 18 <210> 231 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 231 atcggttctt cttctatc 18 <210> 232 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 232 gtcaattctt cttctatc 18 <210> 233 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 233 atccattttt cttctatc 18 <210> 234 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 234 atctattctg cttctatc 18 <210> 235 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 235 atccattctt cttctatc 18 <210> 236 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 236 atctattctt cttctatc 18 <210> 237 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 237 ctctcttatt cttttttc 18 <210> 238 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 238 ctctcttttt attttttg 18 <210> 239 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 239 ctttcttctt attatatg 18 <210> 240 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 240 tcctcttttt attttatg 18 <210> 241 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 241 ctctcttatt attatatg 18 <210> 242 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 242 ctcagttttt attatatg 18 <210> 243 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 243 atcgcttctt attttacg 18 <210> 244 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 244 ttttcttctt cttctata 18 <210> 245 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 245 ctctcttatt attttatg 18 <210> 246 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 246 atctattatt atcctatg 18 <210> 247 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 247 ttctctgctt ataatatc 18 <210> 248 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 248 atctattatt ttggtatg 18 <210> 249 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 249 gctacttatt cttcttttgg ctctattact 30 <210> 250 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 250 tctatttctc ttttttttgg ctatgtttct 30 <210> 251 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 251 tctaattatc cttcttttgg ctctaattct 30 <210> 252 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 252 tctatttatt ctgcttttgc ctctacttct 30 <210> 253 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 253 gctttttatt cttcttttgg cgctacttct 30 <210> 254 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 254 gcttattatt ctgcttttgc ctctagttct 30 <210> 255 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 255 tgtagttatc cttcttttgg ctctacttct 30 <210> 256 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 256 tctcgttatc cttcttttgg ctctacttct 30 <210> 257 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 257 gctatttatt cttcttttag cgctaattct 30 <210> 258 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 258 tctaattatc ctgcttttgg ctctacttct 30 <210> 259 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 259 tctatttatt ctgcttttct ctctactact 30 <210> 260 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 260 tctatttatc cttcttctgg ctatacttat 30 <210> 261 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 261 tctatttatc cttattctgg ctatacttat 30 <210> 262 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 262 tctatttatc cttttcatgc ctctacttat 30 <210> 263 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 263 actgtttatc cttatcttga ctatacttat 30 <210> 264 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 264 tctatttatc cttattctcg caatactttt 30 <210> 265 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 265 tctatttatc ctttttctgg ctattctact 30 <210> 266 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 266 tctatttatc cttattatgc ctatacttat 30 <210> 267 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 267 tctatttatc tttcttttgg ctatggttat 30 <210> 268 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 268 tgttgtaatt ctgcttatcg ctatggtcct 30 <210> 269 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 269 tctatttatc cttatgctgg caatacttat 30 <210> 270 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 270 tctttttatt cttattatag ctttacttat 30 <210> 271 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 271 tctctttata cttcttatgg ctatacttat 30 <210> 272 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 272 tatatttatc cttttaatgg ctatagttat 30 <210> 273 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 273 tatatttatc cttcttatga ctatacttat 30 <210> 274 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 274 tatatttctc ctccttatgg ctttacttat 30 <210> 275 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 275 taccatcacc cgttcggtta tgctttg 27 <210> 276 <211> 12 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 276 tacttggcta tg 12 <210> 277 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 277 taccatttcc cgttcgctta ttctttg 27 <210> 278 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 278 taccatttcc cgttcggttt tgctttg 27 <210> 279 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 279 taccatttcc cgttcggtca tgctctg 27 <210> 280 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 280 taccattacc cgttcggtca tgctttg 27 <210> 281 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 281 taccattacc cgttcggtca tgctctg 27 <210> 282 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 282 taccattacc cgttcggtac tgctttg 27 <210> 283 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 283 taccattacc cgttcggtta tgctttg 27 <210> 284 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 284 taccattacc cgttcggtta tgctatg 27 <210> 285 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 285 taccattacc cgcacggtca tgctttg 27 <210> 286 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (9)..(9) <223> a, c, t, g, unknown or other <400> 286 ccggctccnt tttcttacca tgttctg 27 <210> 287 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 287 gcggctccgg gttcttacca tcctatg 27 <210> 288 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 288 gcggctccct atttttacgg tgttatg 27 <210> 289 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 289 gcgtttccgg gttcttacca tcctatg 27 <210> 290 <211> 28 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 290 cgcgtatccg ttttcttacc attttatg 28 <210> 291 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 291 ccgtctgcgt tttcttacca tcctatg 27 <210> 292 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 292 ccggttgcgg gtgcttacca tcctatg 27 <210> 293 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 293 tcgtctctgg gtttttacaa tggtatg 27 <210> 294 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 294 actgttcgtg gatccaaaaa accgtacttc tctggttggg ctatg 45 <210> 295 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 295 acgtatccgg gttattacta tattctg 27 <210> 296 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 296 tctggtgtgg gtggtgatca cgctttg 27 <210> 297 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 297 gtttggtacg ttgttcag 18 <210> 298 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 298 ggttacttct acacttgggg tggtatg 27 <210> 299 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 299 ggttactact actcttgggg tggtatg 27 <210> 300 <211> 217 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 300 Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Val Ser Ser Ala 20 25 30 Val Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40 45 Tyr Ser Ala Ser Ser Leu Tyr Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 Ser Arg Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro 65 70 75 80 Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ala Ala Tyr His Trp Pro 85 90 95 Pro Leu Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg Thr 100 105 110 Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln Leu 115 120 125 Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr Pro 130 135 140 Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser Gly 145 150 155 160 Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr 165 170 175 Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys His 180 185 190 Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro Val 195 200 205 Thr Lys Ser Phe Asn Arg Gly Glu Cys 210 215 <210> 301 <211> 659 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 301 gatatccaga tgacccagtc cccgagctcc ctgtccgcct ctgtgggcga tagggtcacc 60 atcacctgcc gtgccagtca gtccgtgtcc agcgctgtag cctggtatca agaaacca 120 ggaaaagctc cgaagcttct gatttactcg gcatccagcc tctactctac tctggagtcc 180 cttctcgctt ctctggtagc cgttccggga cggatttcac tctgaccatc agcagtctgc 240 agccggaaga cttcgcaact tattactgtc agcaagctgc ttaccattgg ccgccgctgt 300 tcacgacgtt cggacagggt accaaggtgg agatcaaacg tacggtggct gcaccatctg 360 tcttcatctt cccgccatct gatgagcagt tgaaatctgg aactgcctct gttgtgtgcc 420 tgctgaataa cttctatccc agagaggcca aagtacagtg gaaggtggat aacgccctcc 480 aatcgggtaa ctcccaggag agtgtcacag agcaggacag caaggacagc acctacagcc 540 tcagcagcac cctgacgctg agcaaagcag actacgagaa acaaaagtc tacgcctgcg 600 aagtcaccca tcagggcctg agctcgcccg tcaaaagag cttcaacagg ggagagtgt 659 <210> 302 <211> 445 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polypeptide <400> 302 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Leu Tyr Tyr Thr 20 25 30 Asp Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Ser Ile Ser Leu Phe Phe Gly Tyr Val Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Tyr Leu Ala Met Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr 100 105 110 Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro 115 120 125 Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val 130 135 140 Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala 145 150 155 160 Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly 165 170 175 Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly 180 185 190 Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys 195 200 205 Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys 210 215 220 Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu 225 230 235 240 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 245 250 255 Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys 260 265 270 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 275 280 285 Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu 290 295 300 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 305 310 315 320 Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys 325 330 335 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 340 345 350 Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 355 360 365 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 370 375 380 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 385 390 395 400 Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln 405 410 415 Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 420 425 430 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435 440 445 <210> 303 <211> 1335 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic polynucleotide <400> 303 gaggttcagc tggtggagtc tggcggtggc ctggtgcagc cagggggctc actccgtttg 60 tcctgtgcag cttctggctt caacctctat tatactgata tgcactgggt gcgtcaggcc 120 ccgggtaagg gcctggaatg ggttgcatct atttctcttt tttttggcta tgtttcttat 180 gccgatagcg tcaagggccg tttcactata agcgcagaca catccaaaaa cacagcctac 240 ctacaaatga acagcttaag agctgaggac actgccgtct attattgtgc tcgctacttg 300 gctatggact actggggtca aggaaccctg gtcaccgtct cctcggctag caccaagggc 360 ccatcggtct tccccctggc accctcctcc aagagcacct ctgggggcac agcggccctg 420 ggctgcctgg tcaaggacta cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgcc 480 ctgaccagcg gcgtgcacac cttcccggct gtcctacagt cctcaggact ctactccctc 540 agcagcgtgg tgaccgtgcc ctccagcagc ttgggcaccc agacctacat ctgcaacgtg 600 aatcacaagc ccagcaacc caaggtggac aagaaagttg agcccaaatc ttgtgacaaa actcacacat gcccaccgtg cccagcacct gaactcctgg ggggaccgtc agtcttcctc 720 ttccccccaa aacccaagga caccctcatg atctcccgga cccctgaggt cacatgcgtg gtggtggacg tgagccacga agaccctgag gtcaagttca actggtacgt ggacggcgtg 840 gaggtgcata atgccaagac aaagccgcgg gaggagcagt acaacagcac gtaccgtgtg gtcagcgtcc tcaccgtcct gcaccaggac tggctgaatg gcaaggagta caagtgcaag 960 gtctccaaca aagccctccc agcccccatc gagaaacca tctccaaagc caaagggcag ccccgagac cacaggtgta caccctgccc ccatcccggg aggagatgac caagaccag gtcagcctga cctgcctggt caaaggcttc tatcccagcg acatcgccgt ggagtggggag agcaatgggc agccggagaa caactacag accacgcctc ccgtgctgga ctccgacggc tccttcttcc tctacagcaa gctcaccgtg gacaagagca ggtggcagca ggggaacgtc ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacgcagaa gagcctctcc ctgtctccgg gtaaa 1335 <210> 304 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 304 catccgtggt ctggtggtta cctgatc 27 <210> 305 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 305 ccggttggtt actggggtgt tccgatc 27 <210> 306 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 306 gtttctggtg gtgctcatgc tctgatc 27 <210> 307 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 307 gtttcttctg cttacccgat c 21 <210> 308 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 308 ttctggggtg ttccgatc 18 <210> 309 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 309 tcttactacc attacgctgc tctgatc 27 <210> 310 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 310 tggtactacg ctccgatc 18 <210> 311 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 311 tctcattctt actctctgat c 21 <210> 312 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 312 tctggttacg gtccgttc 18 <210> 313 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 313 tcttggtctt ctccgatc 18 <210> 314 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 314 cattactctg tttacgcttc tctgatc 27 <210> 315 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 315 ccgcatccgc cgtctctgat c 21 <210> 316 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 316 gttgcctact ctcatgttgg tctgatc 27 <210> 317 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 317 ggttacggtg ctccgatc 18 <210> 318 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 318 tcttggtact ctctgatc 18 <210> 319 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 319 ccgggttacc tgttc 15 <210> 320 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 320 gtttggttcg gtctgatc 18 <210> 321 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 321 gtttactacg gttctccgct gttc 24 <210> 322 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 322 catgctcatt ctccgctgat c 21 <210> 323 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 323 tcttctgctt actacccgtt c 21 <210> 324 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 324 ggtcatgctt ctccgatc 18 <210> 325 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 325 tcttctggtg gttggtctct gatc 24 <210> 326 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 326 gttgcttggt cttctttcct gatc 24 <210> 327 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 327 tctgttgctg ctgcttctct gatc 24 <210> 328 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 328 tctggttggt ggggtgtttc tctgatc 27 <210> 329 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 329 tcttacgctg cttacctgtt c 21 <210> 330 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 330 catggttctc tgttc 15 <210> 331 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 331 ggttggccgt actctgctct gttc 24 <210> 332 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 332 tctggttact acccgtctct gttc 24 <210> 333 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 333 tcttaccatt ctggttctgg tctgatc 27 <210> 334 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 334 catggttact ctgcttctct gatc 24 <210> 335 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 335 gctccgggtt gggctctgtt c 21 <210> 336 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 336 ggtcattctt ctccgatc 18 <210> 337 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 337 ggttggccgt ctctgttc 18 <210> 338 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 338 gttccgggtt acccggttcc gatc 24 <210> 339 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 339 cattactact ctcatctgat c 21 <210> 340 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 340 ggtccggctt cttctctgat c 21 <210> 341 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 341 tctgttggtt cttcttacta cctgatc 27 <210> 342 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 342 tactacggtc cgtgggttct gatc 24 <210> 343 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 343 gctgcttctt ggggttaccc gttc 24 <210> 344 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 344 cattggtctt acccgatc 18 <210> 345 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 345 ggtggttggg gtccgttc 18 <210> 346 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 346 tctatttatt cttattatgg ctatacttat 30 <210> 347 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 347 tctatttatt cttcttctag ctctacttat 30 <210> 348 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 348 tctatttatc cttcttctag ctatacttat 30 <210> 349 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 349 tctatttatt cttcttctag ctatacttct 30 <210> 350 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 350 tatatttctt cttattctgg ctctacttat 30 <210> 351 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 351 ctctattctt attatatg 18 <210> 352 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 352 tatatttctt cttattatgg ctatacttat 30 <210> 353 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 353 tctatttatc cttcttctag ctctacttat 30 <210> 354 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 354 tctatttatt cttcttctgg ctatacttat 30 <210> 355 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 355 ctctcttatt cttctatg 18 <210> 356 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 356 tctatttctt cttattatgg ctctacttat 30 <210> 357 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 357 atctattatt attatatg 18 <210> 358 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 358 tatatttctc cttattatgg ctatacttct 30 <210> 359 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 359 tctatttctt cttcttctgg ctatacttat 30 <210> 360 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 360 tctatttatt cttattctag ctctacttat 30 <210> 361 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 361 tctatttctc cttcttctag ctatacttat 30 <210> 362 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 362 tatatttctc cttattatgg ctatacttat 30 <210> 363 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 363 tctatttctc cttattctag ctctacttat 30 <210> 364 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 364 tctatttatt cttcttatgg ctctacttat 30 <210> 365 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 365 tctatttatt cttcttctag ctatacttat 30 <210> 366 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 366 tctatttatc cttattctgg ctctacttat 30 <210> 367 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 367 tctatttatt cttattatgg ctctacttat 30 <210> 368 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 368 tctatttatc cttcttatgg ctctacttat 30 <210> 369 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 369 tatatttctt cttattctag ctatacttat 30 <210> 370 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 370 tctatttatt cttattatag ctctacttat 30 <210> 371 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 371 atctcttatt attatatg 18 <210> 372 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 372 tatatttctt cttcttatgg ctatacttct 30 <210> 373 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 373 tctatttctc cttattctag ctatacttat 30 <210> 374 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 374 ctctattctt attctatc 18 <210> 375 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 375 atctcttatt attatatc 18 <210> 376 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 376 tctatttctc cttattatgg ctatacttct 30 <210> 377 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (2)..(2) <223> a, c, t, g, unknown or other <400> 377 tntatttctc cttcttatag ctctacttat 30 <210> 378 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 378 tctatttctt cttcttatag ctctacttat 30 <210> 379 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 379 tctatttatc cttattctgg ctctacttct 30 <210> 380 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 380 tctatttctt cttattatag ctctacttct 30 <210> 381 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 381 tctatttatt cttattctgg ctatacttat 30 <210> 382 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 382 tctatttatt cttcttatgg ctatacttat 30 <210> 383 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 383 tatatttctt cttattctgg ctctacttct 30 <210> 384 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 384 tatatttctc cttattctgg ctatacttct 30 <210> 385 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 385 tcttctttct cttgggctat g 21 <210> 386 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 386 tcttctttct actgggcttt g 21 <210> 387 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 387 tcttggttcg gttggggtat t 21 <210> 388 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 388 tactggttct cttacggtta cgcttcttac ccggctttt 39 <210> 389 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 389 catccgtggt acggtatg 18 <210> 390 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 390 tctgctttct actgggcttt g 21 <210> 391 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 391 ccggctccgg gtcattgggg tttt 24 <210> 392 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 392 tcttctttct tctgggctat g 21 <210> 393 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 393 tctgctttct actgggctat g 21 <210> 394 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 394 catttcttcg ctatg 15 <210> 395 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 395 tcttggtggg cttgggcttt t 21 <210> 396 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 396 tctgctttcg gttgggcttt g 21 <210> 397 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 397 tcttctttct tcttcgctat g 21 <210> 398 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 398 ccgtactact ggtctggtgg tttt 24 <210> 399 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 399 catccgtctt cttcttggtt ctctttcggt gctttg 36 <210> 400 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 400 tctgctttct actgggcttt t 21 <210> 401 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 401 tcttcttacg cttgggctat g 21 <210> 402 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (11)..(11) <223> a, c, t, g, unknown or other <400> 402 tcttctttct nctgggctat t 21 <210> 403 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 403 tctccgtggg gttctggttg ggctggtttt 30 <210> 404 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 404 ccagctgttt gggttggttt g 21 <210> 405 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 405 tcttgggttt tctgggcttt g 21 <210> 406 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <220> <221> modified_base <222> (16)..(16) <223> a, c, t, g, unknown or other <400> 406 tcttgggttt actggntatg 20 <210> 407 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 407 tcttgggttt actgggcttt g 21 <210> 408 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 408 tcttcttacg cttgggctat t 21 <210> 409 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 409 tcttctttct actgggctat g 21 <210> 410 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 410 catggtgctt ctttcggttc tggtgctccg gctttt 36 <210> 411 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 411 tcttgttttt tctgggctat g 21 <210> 412 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 412 tgggctttct tcggtttg 18 <210> 413 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 413 tcttctttct acttcgctat g 21 <210> 414 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 414 tctgctttct cttgggctat t 21 <210> 415 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 415 tctggtttct actgggcttt g 21 <210> 416 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 416 ccgtctgttg gttacgctgc tttt 24 <210> 417 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 417 tcttgggttg gttggggttt g 21 <210> 418 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 418 tcttctgttg gttacgttgc tatg 24 <210> 419 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 419 tcttgggttt actgggcttt t 21 <210> 420 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 420 tactactact cttcttctgt ttacttctgg tacgctgctt tg 42 <210> 421 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 421 tcttctttct tctgggctat t 21 <210> 422 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 422 tcttgggttt actgggctat t 21 <210> 423 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 423 tcttgggttg gttggggtat t 21 <210> 424 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 424 tcttctgttt actgggcttt g 21 <210> 425 <211> 42 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 425 tggggtggtt ggggttctgg tggttacttc tacgctgctt tg 42 <210> 426 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 426 ttctggtacc cgggtatg 18 <210> 427 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide <400> 427 tcttctttcg cttgggcttt t 21 <210> 428 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 428 His His His His His His 1 5 <210> 429 <211> 6 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 429 Ile Ser Tyr His Tyr Met 1 5 <210> 430 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 430 Ser Ile Tyr Pro Asn Leu Gly Tyr Thr Tyr 1 5 10 <210> 431 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic peptide <400> 431 Ala Tyr Pro Phe Ser Tyr His Tyr Met 1 5

Claims

1. An antibody that specifically binds to one or more cysteine-rich domains (CRDs) of human Frizzled receptors selected from FZD 1, 2, 4, 5, 7, 8, and 9, including a light chain variable region and / or a heavy chain variable region, The heavy chain variable region includes complementarity-determining regions CDR-H1, CDR-H2, and CDR-H3, and the light chain variable region includes complementarity-determining regions CDR-L1, CDR-L2, and CDR-L3, and the amino acid sequence of the CDR includes or consists of sequences selected from the sequences in Table 1a or Table 3a. antibody.

2. The amino acid sequence of the aforementioned CDR includes or consists of sequences selected from the sequences described below. The CDR-H1 is Selected from the group consisting of, The CDR-H2 is Selected from the group consisting of, The CDR-H3 is Selected from the group consisting of, The CDR-L1 is SVSSA, CDR-L2 is SASSLYS, and / or CDR-L3 is selected from the group consisting of AAYHWPPLF, GVYLF, SSYSLI, WAYGPF, YYHPI, and YYSLF. The antibody according to claim 1.

3. The amino acid sequence of the CDR includes or consists of sequences selected as described below. The CDR-H1 is Selected from the group consisting of, The CDR-H2 is Selected from the group consisting of, The CDR-H3 is Selected from the group consisting of, The CDR-L1 is SVSSA, CDR-L2 is SASSLYS, and / or CDR-L3 is Selected from the group consisting of, The antibody according to claim 1.

4. (i) Heavy chain amino acid sequences listed in Table 2, (ii) Amino acid sequences having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, and at least 99% sequence identity with the heavy chain amino acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii) Conservatively substituted amino acid sequences of (i), wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. The antibody according to any one of claims 2 or 3, comprising a heavy chain variable region including the above.

5. (i) Light chain amino acid sequences listed in Table 2, (ii) An amino acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with the light chain amino acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii) Conservatively substituted amino acid sequences of (i), wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. An antibody according to any one of claims 2 to 4, comprising a light chain variable region including the above.

6. The antibody according to any one of claims 1 to 5, wherein the CDR sequence is a complete set of CDR sequences selected from antibodies identified in Table 1a or Table 3a.

7. The antibody according to any one of claims 1 to 5, wherein the CDR sequence comprises a set of light chain CDR sequences or a set of heavy chain CDR sequences selected from antibodies identified in Table 1a or Table 3a.

8. An antibody according to any one of claims 1 to 7, which specifically binds to FZD4.

9. The antibody according to claim 8, wherein the CDR sequence is a set of CDR sequences of an antibody selected from antibodies 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, 5077-5080, or 5081.

10. The antibody according to any one of claims 1 to 7, which specifically binds to FZD4 and at least one other FZD receptor selected from FZD1, FZD2, FZD5, FZD7, FZD8, and FZD9.

11. The antibody according to claim 9, wherein the CDR sequence is a set of CDR sequences of antibodies selected from antibodies 5014, 5016, 5018-5023, 5025, 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076.

12. The antibody according to any one of claims 1 to 11, which preferentially binds to Frizzled 4 (FZD4) compared to FZD1, 2, 5, 7, 8, or 9.

13. An antibody according to any one of claims 1 to 11, which preferentially binds to FZD4 compared to another FZD receptor.

14. The antibody according to claim 13, comprising a CDR sequence which is a set of CDR sequences of an antibody selected from antibodies 5028, 5029, 5031, 5034, 5035, 6497, 6498, 5039, 5045, 5048, 5054, 5056, 5057, 5067, 5073, 5074, and 5075.

15. An antibody according to any one of claims 1 to 13, having a binding affinity of approximately 0.2 nM to approximately 15.3 nM as measured by surface plasmon resonance.

16. The antibody according to any one of claims 1 to 15, which is a monoclonal antibody.

17. The antibody according to any one of claims 1 to 16, which is a humanized antibody.

18. The antibody according to any one of claims 1 to 17, which is a single-chain antibody.

19. The antibody according to any one of claims 1 to 18, which is an antibody-conjugated fragment selected from Fab, Fab', F(ab')2, scFv, dsFv, ds-scFv, dimer, nanobody, minibody, diabody, and polymers thereof.

20. The antibody according to any one of claims 1 to 18, which is a polyvalent antibody that is a bivalent, trivalent, or tetravalent antibody.

21. The antibody according to any one of claims 1 to 18, which is a bispecific antibody that further binds to LPR 5 / 6.

22. An antibody according to any one of claims 1 to 18, comprising a non-natural glycosylation pattern.

23. An antibody according to any one of claims 1 to 18, comprising substitution or addition of cysteine ​​to a constant region or framework region.

24. An antibody according to any one of claims 1 to 18, which blocks the binding of Wnt to FZD.

25. An immunoconjugate comprising the antibody according to any one of claims 1 to 21 and a detectable label or cytotoxic agent.

26. The immunoconjugate according to claim 25, comprising a cytotoxic agent selected from meitansinoids, auristatin, dorastatin, tubulicin, cryptophycin, pyrrolobenzodiazepine (PBD) dimers, indolinobenzodiazepine dimers, α-amanitin, trichoten, SN-38, duocalmycin, CC1065, calicheamicin, engine antibiotics, taxanes, doxorubicin derivatives, anthracyclines, and their stereoisomers, azanofide, isosteres, analogs, or derivatives.

27. A nucleic acid molecule encoding an antibody according to any one of claims 1 to 21.

28. The nucleic acid molecule according to claim 27, wherein one or more of the CDR sequences are encoded by nucleic acids from Table 1b, Table 1c, Table 3b, or Table 3c.

29. The aforementioned antibody (i) Heavy chain nucleic acid sequences listed in Table 2, (ii) A nucleotide sequence having at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% sequence identity with respect to the heavy chain nucleic acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii) Codon-degenerate nucleic acid sequences of (i) wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. The nucleic acid molecule according to claim 27, comprising a heavy chain variable region encoded by a nucleic acid containing the following:

30. The aforementioned antibody (i) Light chain nucleic acid sequences listed in Table 2, (ii) A nucleic acid sequence having at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity with respect to the light chain nucleic acid sequences listed in Table 2, wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a, or (iii) Codon-degenerate nucleic acid sequences of (i) wherein the CDR sequence is a set of CDR sequences listed in Table 1a or Table 3a. The nucleic acid molecule according to claim 27, comprising a light chain variable region encoded by a nucleic acid containing the following:

31. A vector comprising an expression control sequence functionally linked to a nucleic acid according to any one of claims 27 to 30.

32. A host cell comprising a recombinant nucleic acid molecule containing an expression regulatory sequence functionally linked to the nucleic acid according to any one of claims 27 to 30.

33. The host cells according to claim 32, which are Chinese hamster ovary (CHO) cells.

34. A host cell comprising the vector according to claim 31.

35. A method for producing an anti-FZD antibody, comprising the step of culturing host cells according to any one of claims 32 to 34.

36. A composition comprising, optionally with a suitable diluent, an antibody according to any one or more of claims 1 to 24, an immunoconjugate according to any one of claims 25 to 26, a nucleic acid molecule according to any one of claims 27 to 30, a vector according to claim 31, or a host cell according to claims 34 to 34.

37. The composition according to claim 36, comprising one or more antibodies or immunoconjugates, and optionally being a pharmaceutical composition.

38. A kit comprising an antibody according to any one or more of claims 1 to 24, an immunoconjugate according to any one of claims 25 to 26, a nucleic acid molecule according to any one of claims 27 to 30, a vector according to claim 31, or a host cell according to claims 34 to 34.

39. A method for detecting FZD expression, comprising the steps of: contacting a sample containing one or more cells with one or more antibodies or immunoconjugates according to any one of claims 1 to 26 under conditions that allow for the formation of cell complexes; and detecting the presence of any antibody complex.

40. The method according to claim 39, wherein detection is performed by immunofluorescence.

41. The method according to claim 39, wherein the detection is performed by flow cytometry.

42. The method according to any one of claims 39 to 41, wherein the method is for detecting FZD4 expression, and the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5017, 5027, 5030, 6499, 5038, 5040-5044, 5046, 5047, 5049-5053, 5055, 5058-5064, 5066, 5068-5072, and 5077-5081.

43. A method for inhibiting Wnt ligand binding to the FZD receptor, interfering with the Wnt signaling pathway, inhibiting Wnt-induced transcriptional activity, inhibiting disheveled activation, promoting the preservation of the β-catenin degradation complex, promoting the accumulation of β-catenin, or inhibiting cell proliferation, A method comprising the step of contacting cells expressing an FZD receptor with an antibody or immunoconjugate according to any one of claims 1 to 26.

44. The method according to claim 43, wherein the Wnt ligand is Wnt3a.

45. The antibody or immunoconjugate is (a) 5017, 5027, 5030, 6499, 5038, 5040–5044, 5046, 5047, 5049–5053, 5055, 5058–5064, 5066, 5068–5072, and 5077–5081, or (b) 5014, 5016, 5018–5023, 5025, The method according to claim 43, comprising a set of CDR sequences corresponding to an antibody selected from 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076.

46. A method for treating a cancer of a subject that requires such treatment, comprising the step of administering to the subject an effective amount of a pharmaceutical composition comprising an antibody or immunoconjugate according to any one of claims 1 to 26.

47. The method according to claim 46, wherein the cancer is selected from cancer cells of the colon, lung, breast, ovary, endometrium, pancreas, stomach, liver, adrenal cortex, and osteoblastoma.

48. The method according to claim 46, wherein the cancer is selected from acute myeloid leukemia, neuroblastoma, liver cancer, lung cancer, endometrial cancer, salivary gland-like cystic carcinoma, colorectal cancer, prostate cancer, glioblastoma, bladder cancer, cervical cancer, pancreatic cancer, colon cancer, breast cancer, esophageal cancer, glioma, gastric cancer, astrocytoma, and osteosarcoma.

49. The method according to claim 46, wherein the antibody or immunoconjugate specifically binds to FZD 1, 2, 4, 5, 7, 8, and 9 in at least one assay and inhibits Wnt3a-induced signaling in at least one assay, and optionally the antibody or immunoconjugate is an antibody or immunoconjugate according to any one of claims 1 to 26.

50. The antibody or immunoconjugate is (a) 5017, 5027, 5030, 6499, 5038, 5040–5044, 5046, 5047, 5049–5053, 5055, 5058–5064, 5066, 5068–5072, and 5077–5081, or (b) 5014, 5016, 5018–5023, 5025, The method according to claim 46, comprising a set of CDR sequences corresponding to an antibody selected from 5028, 5029, 5031, 5034, 5035, 5036, 5037, 6494, 6495, 6496, 6497, 6498, 6500, 5039, 5045, 5048, 5054, 5056, 5057, 5067, and 5073-5076.

51. The method according to claim 46, wherein the antibody or immunoconjugate comprises a set of CDR sequences corresponding to an antibody selected from 5019 and 5020.

52. The method according to claim 51, wherein the cancer treated by the method comprises one or more cancer cells containing a mutation in the RNF43 gene, and the antibody and antibody or immunoconjugate comprises a set of CDR sequences corresponding to antibody 5020.