Methods for treating myeloproliferative neoplasms

Abstract

Regarding methods for treating myeloproliferative neoplasms. [Solution] The present invention describes therapeutic methods and pharmaceutical compositions for treating myeloproliferative neoplasms (MPNs), including polycythemia vera (PV), essential thrombocythemia (ET), and myelofibrosis. In certain embodiments, the present invention includes therapeutic methods for treating MPNs using a combination of a compound of formula (I) or formula (II) and a therapeutic agent selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

Description

[Technical Field]

[0001] A method for treating myeloproliferative neoplasms (MPNs) using a mouse double microchromosome 2 homolog (MDM2) inhibitor and a therapeutic agent selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. [Background technology]

[0002] p53 is a tumor suppressor and transcription factor that responds to cellular stress by activating the transcription of numerous genes involved in cell cycle arrest, apoptosis, senescence, and DNA repair. Unlike normal cells, which rarely have a cause for p53 activation, tumor cells are under constant cellular stress from various injuries, including hypoxia and pro-apoptotic oncogene activation. Therefore, there is a strong selective advantage to inactivating the p53 pathway in tumors, and it has been proposed that the removal of p53 function may be a prerequisite for tumor survival. Supporting this concept, researchers from three groups have demonstrated, using mouse models, that the absence of p53 function is a continuous prerequisite for the maintenance of established tumors. When the researchers restored p53 function to tumors using inactivated p53, the tumors regressed.

[0003] p53 is inactivated by mutation and / or loss in 50% of solid tumors and 10% of humoral tumors. Other key members of the p53 pathway are also genetically or epigenetically altered in cancer. The oncoprotein MDM2 inhibits p53 function and is activated by gene amplification at an incidence reported to be as high as 10%. MDM2 is then inhibited by another tumor suppressor, p14ARF. Downstream alterations of p53 have been suggested to be involved in at least partial inactivation of the p53 pathway in p53WT tumors (p53 wild-type). Supporting this concept, some p53WT tumors appear to exhibit reduced apoptotic capacity while retaining intact cell cycle arrest capacity. One cancer treatment strategy involves the use of small molecules that bind to MDM2 and neutralize its interaction with p53. MDM2 inhibits p53 activity through three mechanisms: 1) by acting as an E3 ubiquitin ligase to promote p53 degradation, 2) by binding to and blocking the p53 transcriptional activation domain, and 3) by transporting p53 from the nucleus to the cytoplasm. All three of these mechanisms can be blocked by neutralizing the MDM2-p53 interaction. In particular, this therapeutic strategy may be applicable to tumors that are p53 WT, and studies using small molecule MDM2 inhibitors have shown promising reductions in tumor growth both in vitro and in vivo. Furthermore, in patients with p53-inactivated tumors, stabilization of wild-type p53 in normal tissue by MDM2 inhibition may enable selective protection of normal tissue from mitotic toxins. Where used herein, MDM2 refers to the human MDM2 protein, and p53 refers to the human p53 protein. Human MDM2 is also sometimes referred to as HDM2 or hMDM2. Several MDM2 inhibitors are undergoing human clinical trials for the treatment of various cancers.

[0004] Myeloproliferative neoplasms (MPNs), including but not limited to polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF), are clonal hematopoietic stem cell (HSC) disorders characterized by clonal proliferation of terminally differentiated myeloid cells. Approximately 1%, 4%, and 20% of ET, PV, and PMF patients, respectively, progress to an acute transformation phase (BP) known as MPN-BP within 10 years of diagnosis. Cervantes F, et al., Acta Haematol. 1991;85(3):124-127. MPN-BP and de novo acute myeloid leukemia (AML) have distinct mutation patterns and clinical courses, respectively. Rampal R, et al., Proc Natl Acad Sci USA. 2014;111(50):E5401-10. Patients with MPN-BP have a particularly bleak prognosis, with median survival of less than 6 months using currently available therapies.

[0005] The present invention relates to a method for treating myeloproliferative neoplasms in human subjects using an MDM2 inhibitor and a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of Janus kinase (JAK) inhibitors, isocitrate dehydrogenase (IDH) inhibitors, programmed death-1 (PD-1) inhibitors, programmed death-ligand 1 (PD-L1) inhibitors, programmed death-ligand 2 (PD-L2) inhibitors, interferon, phosphoinositide 3-kinase (PI3K) inhibitors, protein kinase B (AKT) inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. [Overview of the project]

[0006] The present invention relates to a method for treating myeloproliferative neoplasms (MPNs), comprising administering a therapeutically effective dose of an MDM2 inhibitor in combination with a therapeutic agent to a person in need thereof, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0007] In one embodiment, the MDM2 inhibitor is a compound of formula (I) or a compound of formula (II). [ka] or a pharmaceutically acceptable salt thereof.

[0008] In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, tryptride, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutrin-3, Nutrin-3a, Nutrin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof.

[0009] In one embodiment, the MDM2 inhibitor is a compound of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1 Selected from the group consisting of 601 and pharmaceutically acceptable salts thereof.

[0010] In one embodiment, the JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel. The group consists of tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, sorucitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

[0011] In one embodiment, the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

[0012] In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

[0013] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

[0014] In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0015] In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT Inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof.

[0016] In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof.

[0017] In one embodiment, the PI3K inhibitors include buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, dubelisib, taselicib, AMG319, GDC-0084, and Selected from the group consisting of these and pharmaceutically acceptable salts.

[0018] In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

[0019] In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

[0020] In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0021] In one embodiment, the interferon is PEGylated rIFN-alpha-2b (PEG-Intron), PEGylated rIFN-alpha-2a (Pegasys), rIFN-alpha-2b (Intron A), rIFN-alpha-2a (Roferon-A), interferon alpha (MOR-22, OPC-18, Alphaferon, Albanatib, Multiferon, Subarin), interferon alphacon-1 (Infergen), interferon alpha-n1 (Wellferon), interferon alpha-n3 (Alferon), albuinterferon alpha-2b (Albuferon), IFN alpha-2b The following are selected from the group consisting of XL, BLX-883 (Locterone), DA-3021, AVI-005, Bellerophone, Sepeg interferon alpha-2b, and combinations thereof.

[0022] In one embodiment, MPN is thrombocytopenia.

[0023] In one embodiment, the thrombocythemia is essential thrombocythemia (ET).

[0024] In one embodiment, MPN is myelofibrosis.

[0025] In one embodiment, myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0026] In one embodiment, MPN is chronic myeloid leukemia.

[0027] In one embodiment, MPN is systemic mastocytosis (SM).

[0028] In one embodiment, MPN is chronic neutrophilic leukemia (CNL).

[0029] In one embodiment, MPN is myelodysplastic syndrome (MDS).

[0030] In one embodiment, MPN is mast cell disease (SMCD).

[0031] In one embodiment, MPN is chronic eosinophilic leukemia.

[0032] In one embodiment, MPN is chronic myelomonocytic leukemia (CMML).

[0033] In one embodiment, MPN is atypical chronic myeloid leukemia (aCML).

[0034] In one embodiment, MPN is juvenile myelomonocytic leukemia (JMML).

[0035] In one embodiment, MPN is eosinophilia syndrome (HES).

[0036] In one embodiment, the compound of formula (I) or formula (II) is in crystalline form.

[0037] In one embodiment, the crystalline morphology is characterized by a powder X-ray diffraction pattern that includes at least three peaks at a diffraction angle of 2 theta degrees, selected from the group consisting of peaks at approximately 11.6, 12.4, 18.6, 19.0, 21.6, and 23.6 ± 0.1.

[0038] In one embodiment, the compound of formula (I) or formula (II) is in a free form.

[0039] In one embodiment, the MDM2 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I) or formula (II).

[0040] In one embodiment, the compound of formula (I) or formula (II) is in an amorphous form.

[0041] In one embodiment, the compound of formula (I) or formula (II) is administered once daily in doses selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

[0042] In one embodiment, the compound of formula (I) or formula (II) is administered twice daily in doses selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

[0043] In one embodiment, humans are treated with an MDM2 inhibitor for a period selected from groups consisting of approximately 14 days, 21 days, 28 days, 35 days, 42 days, 49 days, and 56 days.

[0044] In one embodiment, the compound of formula (I) or formula (II) is administered orally.

[0045] In one embodiment, the MDM2 inhibitor is administered before the administration of the therapeutic agent, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0046] In one embodiment, the MDM2 inhibitor is administered after the administration of the therapeutic agent, and the therapeutic agent is a JAK inhibitor, IDH inhibitor, PD-1 inhibitor, PD-L1 inhibitor, PD-L2 inhibitor, interferon, PI3K inhibitor, AKT inhibitor, mTOR inhibitor, nucleoside analog, And selected from the group consisting of combinations of these.

[0047] In one embodiment, the MDM2 inhibitor is administered simultaneously with the therapeutic agent, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0048] In one embodiment, the therapeutically effective dose of the MDM2 inhibitor is 100 mg. [Brief explanation of the drawing]

[0049] In addition to the above summary, the following detailed description of the present invention will be better understood when read in conjunction with the accompanying drawings.

[0050] [Figure 1] The XRPD pattern of the compound of formula (I) in its anhydrous crystalline form is shown. [Modes for carrying out the invention]

[0051] Preferred embodiments of the present invention are shown and described herein, but such embodiments are provided only as examples and are not intended to limit the scope of the invention. Various alternatives to the embodiments described may be used in the practice of the invention.

[0052] Unless otherwise defined, all scientific and technical terms used herein have the same meanings as those generally understood by those skilled in the art to which this invention pertains.

[0053] The terms “administered in combination” and “combined administration,” as used herein, encompass the administration of two or more active pharmaceutical ingredients to a subject such that both agents and / or their metabolites are simultaneously present in the subject. Combined administration includes simultaneous administration in separate compositions, administration at different time points in separate compositions, or administration in a composition containing two or more agents.

[0054] The terms “combination” or “pharmaceutically combined” are defined herein to refer to a fixed combination, an unfixed combination, or a kit of components for combination administration in a single dosing unit form, where the therapeutic agents may be administered together, independently and simultaneously, or separately within a time interval, preferably allowing the combination partners to exhibit a cooperative, for example, synergistic effect. Thus, the single compounds of the pharmaceutically combined of the present disclosure may be administered simultaneously or sequentially.

[0055] Furthermore, the pharmaceutical combinations of this disclosure may be in the form of fixed combinations or in the form of unfixed combinations.

[0056] The terms “effective dose” or “therapeutic dose” refer to the amount of an active pharmaceutical ingredient or combination of active pharmaceutical ingredients, as described herein, sufficient to produce an intended application, including but not limited to disease treatment. The therapeutic dose may vary depending on the intended application (in vitro or in vivo), or the subject and disease state being treated (e.g., the subject’s weight, age, and sex), the severity of the disease state, the method of administration, and other factors readily determined by those skilled in the art. The term also applies to the dose that induces a specific response in target cells (e.g., reduced platelet adhesion and / or cell migration). A specific dose will vary depending on the specific compound selected, the administration regimen followed, whether the compound is administered in combination with other compounds, the timing of administration, the tissue to which it is administered, and the physical delivery system through which the compound is carried.

[0057] The terms “enantioisomerically concentrated,” “enantioisomerically pure,” and “non-racemic,” as used herein, refer to a composition in which the weight percentage of one enantiomer is greater than the amount of that one enantiomer in a control mixture of the racemic composition (e.g., greater than 1:1 by weight). For example, an enantioisomerically concentrated preparation of an (S)-enantiomer means a preparation of a compound having more than 50% by weight of the (S)-enantiomer, e.g., at least 75% by weight, e.g., at least 80% by weight of the (S)-enantiomer compared to the (R)-enantiomer. In some embodiments, the concentration can be significantly higher than 80% by weight, thereby providing a “substantially enantioisomerically concentrated,” “substantially enantioisomerically pure,” or “substantially non-racemic” preparation, which refers to a preparation of a composition having at least 85% by weight, e.g., at least 90% by weight, and e.g., at least 95% by weight of one enantiomer compared to the other enantiomers. The terms “diastereoisomerically concentrated” and “diastereoisomerically pure,” as used herein, refer to a composition in which the weight percentage of one diastereomer is greater than the amount of that one enantiomer in a control mixture of diastereomers. In some embodiments, the concentration can be significantly higher than 80% by weight, thereby providing a “substantially diastereoisomerically concentrated” or “substantially diastereoisomerically pure” preparation, which refers to a preparation of a composition having at least 85% by weight, e.g., at least 90% by weight, and e.g., at least 95% by weight of one diastereomer compared to other diastereomers.

[0058] In some embodiments, enantioisomerically concentrated compositions exhibit higher efficacy in terms of therapeutic utility per unit mass than racemic mixtures of the composition. Enantiomers can be isolated from the mixture by methods known to those skilled in the art, including chiral high-performance liquid chromatography (HPLC), as well as the formation and crystallization of chiral salts, or some enantiomers can be prepared by asymmetric synthesis. See, for example, Jacques, Enantiomers, Racemates and Resolutions, Wiley Interscience, New York (1981); ELEliel and SHWilen, Stereochemistry of Organic Compounds, Wiley-Interscience, New York (1994).

[0059] When used herein, "enantiomer purity" refers to the relative amount, expressed as a percentage, of the presence of a particular enantiomer relative to other enantiomers. For example, if a compound that may potentially have (R) or (S) isomer configurations exists as a racemic mixture, the enantiomer purity is about 50% with respect to either the (R) or (S) isomer. If the compound has one isomeric form that is dominant over the other, for example, 80% (S) and 20% (R), the enantiomer purity of the compound with respect to the (S) isomer is 80%. The enantiomer purity of a compound can be determined by several methods known in the art, including, but not limited to, chromatography using a chiral support, optical rotational analysis of the rotation of polarization, nuclear magnetic resonance spectroscopy using chiral shift reagents, including but not limited to lanthanide-containing chiral complexes or Pirkle alcohols, or chromatography or nuclear magnetic resonance spectroscopy following derivatization of the compound using a chiral compound such as Mosher acid.

[0060] The term "fixed combination" means that the therapeutic agent, for example, the single compound in the combination, is in the form of a single entity or dosage form.

[0061] "I C 50 The term "EC" refers to the maximum inhibitory concentration at half capacity, i.e., 50% inhibition of the desired activity. 50 The term "maximum response" refers to the drug concentration at which half of the maximum response is achieved.

[0062] "Isomers" are different compounds that have the same molecular formula. "Stereoisomers" are isomers that differ only in the way their atoms are arranged in space, i.e., they have different stereochemical configurations. "Enantiomers" are pairs of stereoisomers that are mirror images of each other and cannot be superimposed. A 1:1 mixture of pairs of enantiomers is a "racemic" mixture. The term "(±)" is used to specify a racemic mixture where appropriate. "Diastereoisomers" are stereoisomers that have at least two asymmetric atoms but are not mirror images of each other. Absolute stereochemistry is specified according to the Kahn-Ingold-Prelogue-RS system. If a compound is a pure enantiomer, the stereochemistry at each chiral carbon can be specified by either R or S. Divided compounds whose absolute configuration is unknown can be specified as (+) or (-) depending on the direction in which plane polarization is rotated at the wavelength of the sodium D line (dextrorotatory or levorotatory). Certain compounds described herein contain one or more chiral centers, and thus can give rise to enantiomers, diastereomers, and other stereoisomeric forms that can be defined in terms of absolute stereochemistry as (R) or (S). The chemical entities, pharmaceutical compositions, and methods of the present invention are intended to include all such possible isomers, including racemic mixtures, optically pure forms, and intermediate mixtures. Optically active (R) and (S) isomers can be prepared using chiral synthons or chiral reagents, or can be decomposed using prior art. If a compound described herein contains an olefinic double bond or other geometrically asymmetric center, and unless otherwise specified, the compound is intended to include both E and Z geometric isomers.

[0063] In one embodiment, the compound described herein includes one of its isomers, stereoisomers, and enantiomers.

[0064] "MPN-BP" refers to the acute transformation phase (BP) of myeloproliferative neoplasms (MPNs) as described in this disclosure.

[0065] The term "non-fixed combination" means that therapeutic agents, for example, single compounds of the combination, are administered to the patient simultaneously or sequentially without specific time constraints, in the form of distinct entities or dosage forms, preferably such administration provides two therapeutic agents at therapeutically effective levels in the body of the subject, for example, a mammal or human requiring it.

[0066] "Pharmacopoeia-acceptable carriers" or "pharmacopoeia-acceptable excipients" are intended to include any and all solvents, dispersion media, coatings, antimicrobial agents, antifungal agents, isotonic agents, and absorption retarders. The use of such media and agents for active pharmaceutical components is well known in the art. Unless any conventional media or agent is incompatible with the active pharmaceutical component, its use in the therapeutic compositions of the present invention is assumed. Auxiliary active components may also be incorporated into the compositions described. Unless otherwise specified or expressly indicated herein, references to therapeutic agents useful in the pharmaceutically acceptable combinations of the compounds in this disclosure include both the free bases of the compounds and all pharmaceutically acceptable salts of the compounds.

[0067] The term "pharmaceutically acceptable salt" refers to salts derived from various organic and inorganic counterions known in the art. pharmaceutically acceptable acid addition salts can be formed with inorganic and organic acids. Examples of inorganic acids from which salts may be derived include hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid. Examples of organic acids from which salts may be derived include acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, and salicylic acid. The base addition salts can be formed with inorganic and organic bases. Examples of inorganic bases from which salts can be derived include sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, and aluminum. Examples of organic bases from which salts can be derived include primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines, and basic ion exchange resins. Specific examples include isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, and ethanolamine. In selected embodiments, pharmaceutically acceptable base addition salts are selected from ammonium, potassium, sodium, calcium, and magnesium salts. The term "cocrystal" refers to molecular complexes derived from numerous cocrystal-forming bodies known in the art. Unlike salts, cocrystals typically do not involve proton transfer between the cocrystal and the drug, but instead involve intermolecular interactions such as hydrogen bonding, aromatic ring stacking, or dispersion forces between the cocrystal-forming body and the drug in the crystalline structure.

[0068] The terms "QD," "qd," or "qd" mean once a day, once a day, or once daily. The terms "BID," "bid," or "bid" mean twice a day, twice a day, or twice daily. The terms "TID," "tid," or "tid" mean three times a day, three times a day. It means a day, or three times daily. The terms "QID," "qid," or "qid" mean four times in a day, four times a day, or four times daily.

[0069] A "solvate" refers to a compound that is in a physical association state with one or more molecules of a pharmaceutically acceptable solvent.

[0070] When the term "therapeutic effect" is used herein, it encompasses the therapeutic and / or preventive benefits described above. Preventive effects include delaying or eliminating the onset of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, stopping, or reversing the progression of a disease or condition, or any combination thereof.

[0071] For example, when a range is used herein to describe a physical or chemical property such as molecular weight or chemical formula, it is intended to include all combinations and partial combinations of the range, as well as specific embodiments contained therein. The use of the term “about” when referring to a number or numerical range means that the number or numerical range referred to is approximate within the range of experimental variability (or statistical experimental error), and therefore the number or numerical range may vary, for example, from 1% to 15% of the stated number or numerical range. The term “comprising” (and related terms such as “comprise” or “comprises” or “having” or “including”) includes embodiments such as any composition, method, or process “consisting of” or “essentially consisting of” the described features.

[0072] The compounds of the present invention include crystalline and amorphous forms, which include, for example, polymorphs, pseudopolymorphs, solvates, hydrates, non-solvated polymorphs (including anhydrous forms), conformational polymorphs, and amorphous forms of the compound, as well as combinations thereof. "Crystalline form" and "polymorph" refer to all crystalline forms of the compound unless a specific crystalline or amorphous form is mentioned. The term is intended to include amorphous forms, which include, for example, polymorphs, pseudopolymorphs, solvates, hydrates, non-solvated polymorphs (including anhydrous forms), conformational polymorphs, and amorphous forms, as well as combinations thereof.

[0073] Combination administration of compounds The present invention relates to a pharmaceutically useful combination or pharmaceutically useful composition. Specifically, the combination or composition disclosed herein can be applied to the treatment of cancer. In one embodiment, the cancer is MPN. The present invention also relates to the use of the pharmaceutically useful combination or pharmaceutically useful composition herein for preparing a pharmaceutically useful composition for treating cancer (particularly MPN), and to a method for doing so in a subject that requires treatment of cancer, comprising administering to the subject a therapeutically effective amount of the pharmaceutically useful combination herein, or to the pharmaceutically useful composition herein.

[0074] In one embodiment, MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mastocell disease (SMCD).

[0075] In one embodiment, myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0076] In one embodiment, primary myelofibrosis (PMF) is selected from the group consisting of pre-fibrotic / early PMF and overt fibrotic PMF.

[0077] In one embodiment, MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myeloid leukemia (aCML), juvenile myelomonocytic leukemia (JMML), eosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasms with ring sideroblasts and thrombocytosis (MDS / MPN-RS-T).

[0078] One embodiment of the present invention is a pharmaceutical composition comprising a combination of a composition, for example, an MDM2 inhibitor, in combination with a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Another embodiment is a kit containing both components, which are formulated into separate pharmaceutical compositions for concomitant administration.

[0079] Another embodiment of the present invention is a method for treating myeloproliferative neoplasms (MPNs), wherein the MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, thrombocythemia, idiopathic myelofibrosis, chronic myeloid leukemia, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndromes (MDS), and systemic mast cell disease (SMCD) in a subject, and the method comprises co-administering to the subject in need a therapeutically effective dose of a combination containing an MDM2 inhibitor in combination with a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Both the pharmaceutical composition and the kit containing this combination are intended for use in treating such diseases or conditions.

[0080] In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II).

[0081] In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, tryptride, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutrin-3, Nutrin-3a, Nutrin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof.

[0082] In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof.

[0083] In one embodiment, the JAK inhibitor is a JAK1 inhibitor.

[0084] In one embodiment, the JAK inhibitor is a JAK2 inhibitor.

[0085] In one embodiment, the JAK inhibitor is a JAK3 inhibitor.

[0086] In one embodiment, the JAK inhibitor is a selective JAK inhibitor.

[0087] In one embodiment, the JAK inhibitor is a pan-JAK inhibitor.

[0088] In one embodiment, the JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel. The group consists of tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, sorucitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

[0089] In one embodiment, the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

[0090] In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

[0091] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. .

[0092] In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0093] In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT Inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof.

[0094] In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof.

[0095] In one embodiment, the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, dubelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

[0096] In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

[0097] In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

[0098] In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0099] In one embodiment, the interferon is PEGylated rIFN-alpha-2b (PEG-Intron), PEGylated rIFN-alpha-2a (Pegasys), rIFN-alpha-2b (Intron A), rIFN-alpha-2a (Roferon-A), interferon alpha (MOR-22, OPC-18, Alphaferon, Albanatib, Multiferon, Subarin), interferon alphacon-1 (Infergen), interferon alpha-n1 (Wellferon), interferon alpha-n3 (Alferon), albuinterferon alpha-2b (Albuferon), IFN alpha-2b XL, BLX-883 (Locteron), DA-3021, AVI-005, Bellerofo The drugs selected are from the group consisting of benzodiazepines, interferon alpha-2b, and combinations thereof.

[0100] In one embodiment, the nucleoside analog is selected from the group consisting of decitabine, cytarabine, azacitidine, zebralin, and pharmaceutically acceptable salts thereof.

[0101] This combination can be administered by any route known in the art. In exemplary embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently by oral, intravenous, intramuscular, intraperitoneal, subcutaneous, or transdermal means, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In one embodiment, the MDM2 inhibitor is administered orally.

[0102] In one exemplary embodiment, the MDM2 inhibitor is in the form of a pharmaceutically acceptable salt.

[0103] In exemplary embodiments, an MDM2 inhibitor is administered to the subject before administration of the therapeutic agent, which is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0104] In exemplary embodiments, the MDM2 inhibitor is administered to the subject after administration of the therapeutic agent, which is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0105] In exemplary embodiments, the MDM2 inhibitor is administered to the subject concurrently with the administration of the therapeutic agent, which is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0106] In one embodiment, the present disclosure provides a method for treating acute transformation myeloproliferative neoplasms (MPN-BP) in a subject, comprising co-administering to the subject in need a therapeutically effective dose combination comprising an MDM2 inhibitor in combination with a therapeutic agent, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Both the pharmaceutical composition and the kit containing this combination are intended for use in treating such diseases or conditions. In one embodiment, MPN-BP is selected from the group consisting of acute transformation-phase polycythemia vera (BP-PV), acute transformation-phase myelofibrosis, acute transformation-phase primary myelofibrosis, acute transformation-phase thrombocythemia, acute transformation-phase essential thrombocythemia (BP-ET), acute transformation-phase idiopathic myelofibrosis, acute transformation-phase systemic mastocytosis (BP-SM), acute transformation-phase chronic neutrophilic leukemia (BP-CNL), acute transformation-phase myelodysplastic syndrome (BP-MDS), and acute transformation-phase systemic mastocytosis (BP-SMCD). In one embodiment, acute transformation-phase myelofibrosis is selected from the group consisting of acute transformation-phase primary myelofibrosis (BP-PMF), acute transformation-phase post-polycythemia vera myelofibrosis (BP-PV post-MF), and acute transformation-phase post-essential thrombocythemia myelofibrosis (BP-ET post-MF). In one embodiment, acute transformation phase primary myelofibrosis (BP-PMF) is selected from the group consisting of acute transformation phase pre-fibrotic / early PMF and acute transformation phase overt fibrotic PMF. In one embodiment, MPN-BP is acute transformation phase chronic neutrophilic leukemia (BP-CNL), acute transformation phase chronic eosinophilic leukemia, acute transformation phase chronic myelofibrosis The group is selected from cystic leukemia (BP-CMML), atypical chronic myeloid leukemia in the acute transformation phase (BP-aCML), juvenile myelomonocytic leukemia in the acute transformation phase (BP-JMML), eosinophilic syndrome in the acute transformation phase (BP-HES), and myelodysplastic / myeloproliferative neoplasms with ring sideroblasts and thrombocytosis in the acute transformation phase (BP-MDS / MPN-RS-T). In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II). In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, tryptride, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutrin-3, Nutrin-3a, Nutrin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof.

[0107] In one embodiment, the present disclosure provides a method for treating acute metastatic myeloproliferative neoplasm (MPN-BP) in a subject, comprising administering to the subject in need a therapeutically effective dose combination comprising a compound of formula (I) in combination with a nucleoside analog, wherein the nucleoside analog is selected from the group consisting of decitabine, cytarabine, azacitidine, zebralin, and pharmaceutically acceptable salts thereof.

[0108] In one embodiment, the present disclosure provides a method for treating acute transformation-phase myeloproliferative neoplasm (MPN-BP) in a subject, comprising administering to the subject in need a therapeutically effective dose combination comprising a compound of formula (I) in combination with decitabine or a pharmaceutically acceptable salt thereof.

[0109] In one embodiment, the present disclosure provides a method for treating acute transformation myeloproliferative neoplasm (MPN-BP) in a subject, comprising administering to the subject in need a therapeutically effective dose combination comprising a compound of formula (I) in combination with cytarabine or a pharmaceutically acceptable salt thereof.

[0110] In one embodiment, MPNs in human subjects are characterized by a CALR mutation (calreticulin, located on chromosome 19p13.2), as described in Massie, N.Engl.J.Med.2013,25:2379-2390, which is incorporated herein by reference in its entirety.

[0111] In one embodiment, MPN in human subjects is characterized by an MPL mutation (myeloproliferative leukemia virus oncogene, located on chromosome 1p34), as described in Pikman, Plos Med. 2006;3(7):e270, which is incorporated herein by reference in its entirety.

[0112] In one embodiment, MPNs in human subjects are characterized by the JAK2V617F mutation. The JAK2V617F mutation is a functional mutation that promotes cytokine-dependent proliferation of myeloid cells and accounts for the majority of myeloproliferative neoplasms (MPNs), as described in Nakatake, Oncogene, 2012, 31, 1323-1333, which is incorporated herein by reference in its entirety.

[0113] In one embodiment, the MPN in human subjects is JAK2V617F, MPL, CALR Characterized by having one or more mutations selected from a group consisting of combinations thereof, and combinations thereof.

[0114] In an exemplary embodiment, the subject is a mammal such as a human.

[0115] MDM2 inhibitors The compound of formula (I) has the structure and name shown below. 2-((3R,5R,6S)-5-(3-chlorophenyl)-6-(4-chlorophenyl)-1-((S)-1-(isopropylsulfonyl)-3-methylbutan-2-yl)-3-methyl-2-oxopiperidine-3-yl)acetic acid: [ka]

[0116] The synthesis of the compound of formula (I) is described in international applications WO2011 / 153509 and WO201 These disclosures are contained in U.S. Patent Nos. 4 / 200937, 8,569,341, 9,593,129, 9,296,736, 9,623,018, 9,757,367, 9,801,867, 9,376,386, and 9,855,259, and are incorporated herein by reference in their entirety.

[0117] In one embodiment, the compound of formula (I) or formula (II) is in an amorphous form. In one embodiment, the MDM2 inhibitor is the compound of formula (I) or formula (II) in a crystalline form. In one embodiment, the MDM2 inhibitor is the compound of formula (I) in an anhydrous crystalline form. In one embodiment, the MDM2 inhibitor is the compound of formula (I) in an anhydrous crystalline form characterized by a powder X-ray diffraction pattern including peaks at diffraction angles of 2 theta degrees at approximately 11.6, 12.4, 18.6, 19.0, 21.6, and 23.6. In one embodiment, the MDM2 inhibitor is the compound of formula (I) in an anhydrous crystalline form having an X-ray diffraction pattern substantially shown in Figure 1. A method for producing such a crystalline form is disclosed in international application WO2014200937 (the disclosure thereof is incorporated herein in whole by reference).

[0118] In one embodiment, the MDM2 inhibitor is a compound of formula (II) having the structure and name shown below. [ka] 4-(2-((3R,5R,6S)-1-((S)-2-(tert-butylsulfonyl)-1-cyclopropylethyl)-6-(4-chloro-3-fluorophenyl)-5-(3-chlorophenyl)-3-methyl-2-oxopiperidine-3-yl)acetamide)-2-methoxybenzoic acid.

[0119] The synthesis of the compound of formula (II) is described in U.S. Patent No. 8,952,036 (the disclosure thereof is incorporated herein by reference in its entirety).

[0120] RG7388 (Idasanutrin) In one embodiment, the MDM2 inhibitor is RG7388. RG7388 has the following chemical structure and name.

[0121] 4-[[(2R,3S,4R,5S)-3-(3-chloro-2-fluorophenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5-(2,2-dimethylpropyl)pyrrolidine-2-carbonyl]amino]-3-methoxybenzoic acid [ka]

[0122] Triptride (PG490) In one embodiment, the MDM2 inhibitor is a triptolide. The triptolide has the following chemical structure and name:

[0123] (5bS,6aS,7aS,8R,8aR,9aS,9bS,10aS,10bS)-8-hydroxy-8a-isopropyl-10b-methyl-2,5,5b,6,6a,8, 8a,9a,9b,10b-Decahydrotris(oxyreno)[2',3':4b,5;2'',3'':6,7;2''',3''':8a,9]phenanthr[1,2-c]furan-3(1H)-one [ka]

[0124] Nutrin-3a In one embodiment, the MDM2 inhibitor is nutrin-3a. Nutrin-3a has the following chemical structure and name.

[0125] 4-[(4S,5R)-4,5-bis(4-chlorophenyl)-2-(4-methoxy-2-propane-2-yloxyphenyl)-4,5-dihydroimidazole-1-carbonyl]piperazine-2-one [ka]

[0126] HDM201 In one embodiment, the MDM2 inhibitor is HDM201. HDM201 has the following chemical structure and name.

[0127] (4S)-5-(5-chloro-1-methyl-2-oxopyridine-3-yl)-4-(4-chlorophenyl)-2-(2,4-dimethoxypyrimidine-5-yl)-3-propan-2-yl-4H-pyrrolo[3,4-d]imidazole-6-one [ka]

[0128] RG7112 In one embodiment, the MDM2 inhibitor is RG7112. RG7112 has the following chemical structure and name.

[0129] [(4S,5R)-2-(4-tert-butyl-2-ethoxyphenyl)-4,5-bis(4-chlorophenyl)-4,5-dimethylimidazole-1-yl]-[4-(3-methylsulfonylpropyl)piperazine-1-yl]methanone [ka]

[0130] CGM097A In one embodiment, the MDM2 inhibitor is CGM097A. CGM097A has the following chemical structure and name.

[0131] (1S)-1-(4-chlorophenyl)-6-methoxy-2-[4-[methyl-[[4-(4-methyl-3-oxopiperazine-1-yl)cyclohexyl]methyl]amino]phenyl]-7-propan-2-yloxy-1,4-dihydroisoquinoline-3-one [ka]

[0132] Nutrin-3 In one embodiment, the MDM2 inhibitor is nutrin-3. Nutrin-3 has the following chemical structure and name.

[0133] 4-[4,5-bis(4-chlorophenyl)-2-(4-methoxy-2-propane-2-yloxyphenyl)-4,5-dihydroimidazole-1-carbonyl]piperazine-2-one [ka]

[0134] SJ-172550 In one embodiment, the MDM2 inhibitor is SJ-172550. SJ-172550 has the following chemical structure and name:

[0135] Methyl 2-[2-chloro-6-ethoxy-4-[(3-methyl-5-oxo-1-phenylpyrazole-4-ylidene)methyl]phenoxy]acetate [ka]

[0136] SAR405838(MI-77301) In one embodiment, the MDM2 inhibitor is SAR405838. SAR405838 has the following chemical structure and name.

[0137] (2'R,3R,3'S,5'S)-6-chloro-3'-(3-chloro-2-fluorophenyl)-5'-(2,2-dimethylpropyl)-N-(4-hydroxycyclohexyl)-2-oxospiro[1H-indole-3,4'-pyrrolidine]-2'-carboxamide [ka]

[0138] MI-773 In one embodiment, the MDM2 inhibitor is MI-773. MI-773 has the following chemical structure and name.

[0139] (2'R,3S,3'S,5'R)-6-chloro-3'-(3-chloro-2-fluorophenyl)-5'-(2,2-dimethylpropyl)-N-(4-hydroxycyclohexyl)-2-oxospiro[1H-indole-3,4'-pyrrolidine]-2'-carboxamide [ka]

[0140] MX69 In one embodiment, the MDM2 inhibitor is MX69. MX69 has the following chemical structure and name.

[0141] 4-[8-[(3,4-dimethylphenyl)sulfamoyl]-3a,4,5,9b-tetrahydro-3H-cyclopenta[c]quinoline-4-yl]benzoic acid [ka]

[0142] YH239-EE In one embodiment, the MDM2 inhibitor is YH239-EE. YH239-EE has the following chemical structure and name.

[0143] Ethyl 3-[2-(tert-butylamino)-1-[(4-chlorophenyl)methyl-flumylamino]-2-oxoethyl]-6-chloro-1H-indole-2-carboxylate [ka]

[0144] RO8994 In one embodiment, the MDM2 inhibitor is RO8994. RO8994 has the following chemical structure and name.

[0145] (2'R,3R,3'S,5'S)-N-(4-carbamoyl-2-methoxyphenyl)-6-chloro-3'-(3-chloro-2-fluorophenyl)-5'-(2,2-dimethylpropyl)-2-oxospiro[1H-indole-3,4'-pyrrolidine]-2'-carboxamide [ka]

[0146] Nutrin-3b In one embodiment, the MDM2 inhibitor is nutrin-3b. Nutrin-3b has the following chemical structure and name.

[0147] 4-[(4R,5S)-4,5-bis(4-chlorophenyl)-2-(4-methoxy-2-propane-2-yloxyphenyl)-4,5-dihydroimidazole-1-carbonyl]piperazine-2-one [ka]

[0148] Cell de Matan (JNJ-26854165) In one embodiment, the MDM2 inhibitor is seldematan. Seldematan has the following chemical structure and name.

[0149] 1-N-[2-(1H-indole-3-yl)ethyl]-4-N-pyridine-4-ylbenzene-1,4-diamine [ka]

[0150] NSC59984 In one embodiment, the MDM2 inhibitor is NSC59984. NSC59984 has the following chemical structure and name.

[0151] (E)-1-(4-methylpiperazin-1-yl)-3-(5-nitrofuran-2-yl)propa-2-en-1-one [ka]

[0152] CHEMBL2386350 In one embodiment, the MDM2 inhibitor is CHEMBL2386350. CHEMBL2386350 has the following chemical structure and name.

[0153] 2-[4-[(4S,5R)-2-(4-tert-butyl-2-ethoxyphenyl)-4,5-bis(4-chlorophenyl)-4,5-dimethylimidazole-1-carbonyl]piperazine-1-yl]-1-morpholine-4-ylethane [ka]

[0154] CGM0970B In one embodiment, the MDM2 inhibitor is CGM0970B. CGM0970B has the following chemical structure and name.

[0155] (1R)-1-(4-chlorophenyl)-6-methoxy-2-[4-[methyl-[[4-(4-methyl-3-oxopiperazine-1-yl)cyclohexyl]methyl]amino]phenyl]-7-propan-2-yloxy-1,4-dihydroisoquinoline-3-one [ka]

[0156] MK-8242 In one embodiment, the MDM2 inhibitor is MK-8242. MK-8242 has the following chemical structure and name.

[0157] 4-Amino-1-[(2R,3S,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidin-2-one

Chem.

[0158] DS-3032 In one embodiment, the MDM2 inhibitor is DS-3032. DS-3032 has the chemical structure and name shown below.

[0159] (3’R,4’S,5’R)-N-((3R,6S)-6-carbamoyl-tetrahydro-2H-pyran-3-yl)-6’’-chloro-4’-(2-chloro-3-fluoropyridin-4-yl)-4,4-dimethyl-2’’-oxodispiro[cyclohexane-1,2’-pyrrolidine-3’,3’’-indoline]-5’-carboxamide

Chem.

[0160] DS-3032B In one embodiment, the MDM2 inhibitor is DS-3032B. DS-3032B has the chemical structure and name shown below.

[0161] (3’R,4’S,5’R)-N-((3R,6S)-6-carbamoyl-tetrahydro-2H-pyran-3-yl)-6’’-chloro-4’-(2-chloro-3-fluoropyridin-4-yl)-4,4-dimethyl-2’’-oxodispiro[cyclohexane-1,2’-pyrrolidine-3’,3’’-indoline]-5’-carboxamide 4-methylbenzenesulfonate

Chem.

[0162] HDM201 In one embodiment, the MDM2 inhibitor is HDM201. HDM201 has the following chemical structure and name.

[0163] (4S)-5-(5-chloro-1-methyl-2-oxopyridine-3-yl)-4-(4-chlorophenyl)-2-(2,4-dimethoxypyrimidine-5-yl)-3-propan-2-yl-4H-pyrrolo[3,4-d]imidazole-6-one [ka]

[0164] APG-115 In one embodiment, the MDM2 inhibitor is APG-115. APG-115 is as follows: It has the chemical structure and name shown below.

[0165] 4-((3'R,4'S,5'R)-6''-chloro-4'-(3-chloro-2-fluorophenyl)-1'-ethyl-2''-oxodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indoline]-5'-carboxamide)bicyclo[2.2.2]octane-1-carboxylic acid [ka]

[0166] MI-1061 In one embodiment, the MDM2 inhibitor is APG-115. APG-115 has the following chemical structure and name.

[0167] 4-((3'R,4'S,5'R)-6''-chloro-4'-(3-chloro-2-fluorophenyl)-2''-oxodispiro[cyclohexane-1,2'-pyrrolidine-3',3''-indoline]-5'-carboxamide)benzoic acid [ka]

[0168] JAK inhibitors Ruxolitinib In one embodiment, the JAK inhibitor is ruxolitinib (available from Incyte Corp. and Novartis AG). Ruxolitinib has the following chemical structure and name: (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidine-4-yl)-1H-pyrazole-1-yl)-3-cyclopentylpropannitrile [ka]

[0169] The preparation of this compound is described in U.S. Patents 8,604,043, 7,834,022, 8,486,902, 8,530,485, 7,598,257, 8,541,425, and 8,410,265, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound selected from the structures disclosed in U.S. Patents 8,604,043, 7,834,022, 8,486,902, 8,530,485, 7,598,257, 8,541,425, and 8,410,265, the disclosures of which are incorporated herein by reference.

[0170] In one embodiment, the JAK inhibitor is ruxolitinibrinate (available from Incyte Corp. and Novartis AG). In one embodiment, the JAK inhibitor is the phosphate of (R)-3-(4-(7H-pyrrolo[2,3-d]pyrimidine-4-yl)-1H-pyrazole-1-yl)-3-cyclopentylpropannitrile.

[0171] Baricitinib In one embodiment, the JAK inhibitor is baricitinib (available from Incyte Corp. and Eli Lilly & Co). Baricitinib has the chemical structure and name shown below. 2-(3-(4-(7H-pyrrolo[2,3-d]pyrimidin-4-yl)-1H-pyrazol-1-yl)-1-(ethylsulfonyl)azetidin-3-yl)acetonitrile

Chemical Structure

[0172] The preparation of this compound is described in U.S. Patent Nos. 8,158,616 and 8,420,629, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent Nos. 8,158,616 and 8,420,629, the disclosures of which are incorporated herein by reference.

[0173] Momelotinib In one embodiment, the JAK inhibitor is momelotinib (Gilead Sciences). Momelotinib is also known as CYT-387. Momelotinib has the chemical structure and name shown below. N-(cyanomethyl)-4-(2-((4-morpholinophenyl)amino)pyrimidin-4-yl)benzamide

Chemical Structure

[0174] The preparation of this compound is described in U.S. Patent No. 8,486,941, the disclosure of which is incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patent No. 8,486,941, the disclosure of which is incorporated herein by reference.

[0175] Ganetespib In one embodiment, the JAK inhibitor is ganethespib. Ganetespib has the following chemical structure and name: 5-(2,4-dihydroxy-5-isopropylphenyl)-4-(1-methyl-1H-indole-5-yl)-2,4-dihydro-3H-1,2,4-triazole-3-one [ka]

[0176] The preparation of this compound is described in U.S. Patents 7,825,148 and 8,628,752, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patents 7,825,148 and 8,628,752, the disclosures of which are incorporated herein by reference.

[0177] NS-018 In one embodiment, the JAK inhibitor is NS-018. NS-018 has the following chemical structure and name: (S)-N 2 -(1-(4-fluorophenyl)ethyl)-6-(1-methyl-1H-pyrazole-4-yl)-N 4 -(pyrazine-2-yl)pyrimidine-2,4-diamine [ka]

[0178] The preparation of this compound is described in U.S. Patents No. 8,673,891 and No. 8,586,591, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patents No. 8,673,891 and No. 8,586,591, the disclosures of which are incorporated herein by reference.

[0179] BMS-911543 In one embodiment, the JAK inhibitor is BMS-911543. BMS-911543 has the following chemical structure and name: N,N-dicyclopropyl-4-((1,5-dimethyl-1H-pyrazole-3-yl)amino)-6-ethyl-1-methyl-1,6-dihydroimidazo[4,5-d]pyrrolo[2,3-b]pyridine-7-carboxamide [ka]

[0180] The preparation of this compound is described in U.S. Patents No. 8,673,933 and No. 8,202,881, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patents No. 8,673,933 and No. 8,202,881, the disclosures of which are incorporated herein by reference.

[0181] Gandotinib (LY2784544) In one embodiment, the JAK inhibitor is gandotinib. Gandotinib has the following chemical structure and name: 3-(4-chloro-2-fluorobenzyl)-2-methyl-N-(5-methyl-1H-pyrazole-3-yl)-8-(morpholinomethyl)imidazo[1,2-b]pyridazine-6-amine [ka]

[0182] The preparation of this compound is described in U.S. Patent No. 7,897,600, the disclosure of which is incorporated herein by reference. In one embodiment, the JAK inhibitor is the compound described in U.S. Patent No. 7,897,600, the disclosure of which is incorporated herein by reference.

[0183] ENMD-2076 In one embodiment, the JAK inhibitor is ENMD-2076. ENMD-2076 has the following chemical structure and name: (E)-N-(5-methyl-1H-pyrazole-3-yl)-6-(4-methylpiperazine-1-yl)-2-styrylpyrimidine-4-amine [ka]

[0184] The preparation of this compound is described in U.S. Patents 8,153,630, 7,563,787 and 8,114,870, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patents 8,153,630, 7,563,787 and 8,114,870, the disclosures of which are incorporated herein by reference.

[0185] AT-9283 In one embodiment, the JAK inhibitor is AT-9283. AT-9283 has the following chemical structure and name: 1-Cyclopropyl-3-(3-(5-(morpholinomethyl)-1H-benzo[d]imidazole-2-yl)-1H-pyrazole-4-yl)urea [ka]

[0186] The preparation of this compound is described in U.S. Patents No. 8,399,442 and No. 7,977,477, the disclosures of which are incorporated herein by reference. In one embodiment, the JAK inhibitor is a compound described in U.S. Patents No. 8,399,442 and No. 7,977,477, the disclosures of which are incorporated herein by reference.

[0187] Pacritinib In one embodiment, the JAK inhibitor is pacritinib. Pacritinib has the following chemical structure and name: 11-(2-pyrrolidine-1-ylethoxy)-14,19-dioxa-5,7,26-triaza-tetracyclo[19.3.1.1(2,6).1(8,12)]heptacosa-1(25),2(26),3,5,8,10,12(27),16,21,23-decaene [ka]

[0188] In one embodiment, the structure of pacritinib may be a tautomer. Preparations of pacritinib are described in U.S. Patents 8,143,255, 8,153,632 and 8,415,338, which are incorporated herein by reference.

[0189] AC-410 In one embodiment, the JAK inhibitor is AC-410 (available from Ambit Biosciences). AC-410 has the following chemical structure and name: (S)-(4-fluorophenyl)(4-((5-methyl-1H-pyrazole-3-yl)amino)quinazoline-2-yl)methanol [ka]

[0190] The preparation of racemi(4-fluorophenyl)(4-((5-methyl-1H-pyrazole-3-yl)amino)quinazolin-2-yl)methanol hydrochloride is described in Examples 3 and 12 of U.S. Patent No. 8,349,851, the disclosure of which is incorporated herein by reference.

[0191] AZD-1480 In one embodiment, the JAK inhibitor is AZD-1480. AZD-1480 has the following chemical structure and name: (S)-5-chloro-N 2-(1-(5-fluoropyrimidine-2-yl)ethyl)-N 4 -(5-methyl-1H-pyrazole-3-yl)pyrimidine-2,4-diamine [ka]

[0192] The preparation of this compound is described in U.S. Patent No. 8,088,784, the disclosure of which is incorporated herein by reference. In one embodiment, the JAK inhibitor is selected from the compounds described in U.S. Patent No. 8,088,784, the disclosure of which is incorporated herein by reference.

[0193] CYT387 In one embodiment, the JAK inhibitor is CYT387. CYT387 has the following chemical structure and name: N-(cyanomethyl)-4-(2-(4-morpholinophenylamino)pyrimidine-4-yl)benzamide [ka]

[0194] The preparation of this compound is described in U.S. Patent Nos. 9,809,559 and 8,486,941, which are incorporated herein by reference.

[0195] TYK2-IN-2 In one embodiment, the JAK inhibitor is TYK2-IN-2. TYK2-IN-2 has the following chemical structure and name: 6-((3,5-dimethylphenyl)amino)-8-(methylamino)imidazo[1,2-b]pyridazine-3-carboxami Do [ka]

[0196] SAR-20347 In one embodiment, the JAK inhibitor is SAR-20347. SAR-20347 has the following chemical structure and name: 2-(2-chloro-6-fluorophenyl)-5-[4-(morpholine-4-carbonyl)anilino]-1,3-oxazole-4-carboxamide [ka]

[0197] Upadacitinib (ABT-494) In one embodiment, the JAK inhibitor is upadacitinib (ABT-494). Upadacitinib has the following chemical structure and name: (3S,4R)-3-ethyl-4-(3H-imidazo[1,2-a]pyrrolo[2,3-e]pyrazine-8-yl)-N-(2,2,2-trifluoroethyl)pyrrolidine-1-carboxamide [ka]

[0198] WP1066 In one embodiment, the JAK inhibitor is WP1066. WP1066 has the following chemical structure and name: (E)-3-(6-bromopyridine-2-yl)-2-cyano-N-[(1S)-1-phenylethyl]prop-2-enamide [ka]

[0199] GLPG0634 (filgotinib) In one embodiment, the JAK inhibitor is GLPG0634 (filgotinib). GLPG0634 has the following chemical structure and name: N-[5-[4-[(1,1-dioxo-1,4-thiadinan-4-yl)methyl]phenyl]-[1,2,4]triazolo[1,5-a]pyridine-2-yl]cyclopropanecarboxamide [ka]

[0200] TG101348 (Fedratinib, SAR 302503) In one embodiment, the JAK inhibitor is TG101348 (fedratinib, SAR 302503). TG101348 has the following chemical structure and name: N-tert-butyl-3-[[5-methyl-2-[4-(2-pyrrolidine-1-ylethoxy)anilino]pyrimidine-4-yl]amino]benzenesulfonamide [ka]

[0201] Celduratinib (PRT062070, PRT2070) In one embodiment, the JAK inhibitor is celduratinib (PRT062070, PRT2070). Celduratinib has the following chemical structure and name: 4-(cyclopropylamino)-2-[4-(4-ethylsulfonylpiperazin-1-yl)anilino]pyrimidine-5-carboxamide [ka]

[0202] Tofacitinib In one embodiment, the JAK inhibitor is tofacitinib. Tofacitinib has the following chemical structure and name: 3-[(3R,4R)-4-methyl-3-[methyl(7H-pyrrolo[2,3-d]pyrimidine-4-yl)amino]piperidine-1-yl]-3-oxopropannitrile [ka] Itasitinib In one embodiment, the JAK inhibitor is itacitinib. Itacitinib has the following chemical structure and name: 2-[1-[1-[3-fluoro-2-(trifluoromethyl)pyridine-4-carbonyl]piperidine-4-yl]-3-[4-(7H-pyrrolo[2,3-d]pyrimidine-4-yl)pyrazole-1-yl]azetidine-3-yl]acetonitrile [ka] Decernotinib In one embodiment, the JAK inhibitor is desernotinib. Desernotinib has the following chemical structure and name: (2R)-2-methyl-2-[[2-(1H-pyrrolo[2,3-b]pyridin-3-yl)pyrimidine-4-yl]amino]-N-(2,2,2-trifluoroethyl)butanamide [ka]

[0203] CHZ868 In one embodiment, the JAK inhibitor is CHZ868. CHZ868 has the following chemical structure and name: N-[4-[2-(2,4-difluoroanilino)-1,4-dimethylbenzimidazole-5-yl]oxypyridine-2-yl]acetamide [ka]

[0204] SB1317 In one embodiment, the JAK inhibitor is SB1317. SB1317 has the following chemical structure and name: (E)-6-methyl-12-oxa-3,6-diaza-2(4,2)-pyrimidina-1,4(1,3)-dibenzenacyclododecaphana-8-ene [ka]

[0205] Solcitinib In one embodiment, the JAK inhibitor is sorcitinib. Sorcitinib has the following chemical structure and name: N-[5-[4-(3,3-dimethylazetidine-1-carbonyl)phenyl]-[1,2,4]triazolo[1,5-a]pyridine-2-yl]cyclopropanecarboxamide [ka]

[0206] Peficitinib In one embodiment, the JAK inhibitor is peficitinib. Peficitinib has the following chemical structure and name: 4-[[(1R,3S)-5-hydroxy-2-adamantyl]amino]-1H-pyrrolo[2,3-b]pyridine-5-carboxamide [ka]

[0207] CEP-33779 In one embodiment, the JAK inhibitor is CEP-33779. CEP-33779 has the following chemical structure and name: N-[3-(4-methylpiperazine-1-yl)phenyl]-8-(4-methylsulfonylphenyl)-[1,2,4]triazolo[1,5-a]pyridine-2-amine [ka]

[0208] Pyrido 6 In one embodiment, the JAK inhibitor is pyridone 6. Pyridone 6 has the following chemical structure and name: 2-(tert-butyl)-9-fluoro-3H-benzo[h]imidazo[4,5-f]isoquinoline-7-ol [ka]

[0209] LFM-A13 In one embodiment, the JAK inhibitor is LFM-A13. LFM-A13 has the following chemical structure and name: (Z)-2-cyano-N-(2,5-dibromophenyl)-3-hydroxybuta-2-enamide [ka]

[0210] BMS-911543 In one embodiment, the JAK inhibitor is BMS-911543. BMS-911543 has the following chemical structure and name: (Z)-N,N-dicyclopropyl-4-((1,5-dimethyl-1,2-dihydro-3H-pyrazole-3-ylidene)amino)-6-ethyl-1-methyl-1,6-dihydroimidazo[4,5-d]pyrrolo[2,3-b]pyridine-7-carboxamide [ka]

[0211] NS-018 In one embodiment, the JAK inhibitor is NS-018. NS-018 has the following chemical structure and name: 6-N-[(1S)-1-(4-fluorophenyl)ethyl]-4-(1-methylpyrazole-4-yl)-2-N-pyrazine-2-ylpyridine-2,6-diamine [ka]

[0212] JANEX-1 In one embodiment, the JAK inhibitor is JANEX-1. JANEX-1 has the following chemical structure and name: 4-[(6,7-dimethoxyquinazolin-4-yl)aminophenol [ka]

[0213] TG101209 In one embodiment, the JAK inhibitor is TG101209. TG101209 has the following chemical structure and name: N-tert-butyl-3-[[5-methyl-2-[4-(4-methylpiperazine-1-yl)anilino]pyrimidine-4-yl]amino]benzenesulfonamide [ka]

[0214] WHI-P154 In one embodiment, the JAK inhibitor is WHI-P154. WHI-P154 has the following chemical structure and name: 2-bromo-4-[(6,7-dimethoxyquinazolin-4-yl)aminophenol [ka]

[0215] NVP-BSK805 In one embodiment, the JAK inhibitor is NVP-BSK805. NVP-BSK805 has the following chemical structure and name: 4-[[2,6-difluoro-4-[3-(1-piperidine-4-ylpyrazole-4-yl)quinoxaline-5-yl]phenyl]methyl]morpholine [ka]

[0216] ZM39923 In one embodiment, the JAK inhibitor is ZM39923. ZM39923 has the following chemical structure and name: 3-[benzyl(propan-2-yl)amino]-1-naphthalen-2-ylpropan-1-one [ka]

[0217] Ruxolitinib-S In one embodiment, the JAK inhibitor is ruxolitinib-S. Ruxolitinib-S has the following chemical structure and name: (3S)-3-cyclopentyl-3-[4-(7H-pyrrolo[2,3-d]pyrimidine-4-yl)pyrazole-1-yl]p Ropan Nitrile [ka]

[0218] XL019 In one embodiment, the JAK inhibitor is XL019. XL019 has the following chemical structure and name: (2S)-N-[4-[2-(4-morpholine-4-ylanilino)pyrimidine-4-yl]phenyl]pyrrolidine-2-carboxamide [ka]

[0219] AZ960 In one embodiment, the JAK inhibitor is AZ960. AZ960 has the following chemical structure and name: 5-fluoro-2-[[(1S)-1-(4-fluorophenyl)ethyl]amino]-6-[(5-methyl-1H-pyrazole-3-yl)amino]pyridine-3-carbonitrile [ka]

[0220] JAK3-IN-1 In one embodiment, the JAK inhibitor is JAK3-IN-1. JAK3-IN-1 has the following chemical structure and name: N-[3-[[[5-chloro-2-[2-methoxy-4-(4-methylpiperazin-1-yl)anilino]pyrimidine-4-yl]amino]methyl]phenyl]propa-2-enamide [ka]

[0221] WHI-P97 In one embodiment, the JAK inhibitor is WHI-P97. WHI-P97 has the following chemical structure and name: 2,6-dibromo-4-[(6,7-dimethoxyquinazolin-4-yl)aminophenol [ka]

[0222] RGB-286638 In one embodiment, the JAK inhibitor is RGB-286638. RGB-286638 has the following chemical structure and name: 1-[3-[4-[[4-(2- Methoxyethyl)piperazine-1-yl]methyl]phenyl]-4-oxo-1H-indeno[1,2-c]pyrazole-5-yl]-3-morpholine-4-ylurea dihydrochloride [ka]

[0223] Tofacitinib (3R, 4S) In one embodiment, the JAK inhibitor is tofacitinib(3R,4S). Tofacitinib(3R,4S) has the following chemical structure and name: 3-[(3R,4S)-4-methyl-3-[methyl(7H-pyrrolo[2,3-D]pyrimidine-4-yl)amino]piperidine-1-yl]-3-oxopropannitrile [ka]

[0224] NSC42834 In one embodiment, the JAK inhibitor is NSC42834. NSC42834 has the following chemical structure and name: 2-methyl-1-phenyl-4-pyridine-2-yl-2-(2-pyridine-2-ylethyl)butan-1-one [ka]

[0225] PF-06651600 In one embodiment, the JAK inhibitor is PF-06651600. PF-06651600 has the following chemical structure and name: benzyl 2-(hydroxymethyl)-5-[(2-methylpropan-2-yl)oxycarbonylamino]piperidine-1-carboxylate [ka]

[0226] Tofacitinib (3S, 4S) In one embodiment, the JAK inhibitor is tofacitinib (3S,4S). Tofacitinib (3S,4S) has the following chemical structure and name: 3-[(3S,4S)-4-methyl-3-[methyl(7H-pyrrolo[2,3-D]pyrimidine-4-yl)amino]piperidine-1-yl]-3-oxopropannitrile [ka]

[0227] Tofacitinib (3S, 4R) In one embodiment, the JAK inhibitor is tofacitinib (3S,4R). Tofacitinib (3S,4R) has the following chemical structure and name: 3-[(3S,4R)-4-methyl-3-[methyl(7H-pyrrolo[2,3-D]pyrimidine-4-yl)amino]piperidine-1-yl]-3-oxopropannitrile [ka]

[0228] AEG3482 In one embodiment, the JAK inhibitor is AEG3482. AEG3482 has the following chemical structure and name: 6-phenylimidazo[2,1-b][1,3,4]thiadiazole-2-sulfonamide [ka]

[0229] Restaulutinib (CEP-701) In one embodiment, the JAK inhibitor is restaurtinib (CEP-701). Restaurtinib has the following chemical structure and name: (5R,7S,8S)-7-hydroxy-7-(hydroxymethyl)-8-methyl-5,6,7,8,13,14-hexahydro-15H-16-oxa-4b,8a,14-triaza-5,8-methanodibenzo[b,h]cycloocta[jkl]cyclopenta[e]-AS-indacen-15-one [ka]

[0230] Okracitinib In one embodiment, the JAK inhibitor is oclacitinib. Oclacitinib has the following chemical structure and name: N-methyl-1-[4-[methyl(7H-pyrrolo[2,3-d]pyrimidine-4-yl)amino]cyclohexyl]methanesulfonamide [ka]

[0231] In one embodiment, the JAK inhibitor is (E)-4-(2-(pyrrolidine-1-yl)ethoxy)-6,11-dioxa-3-aza-2(4,2)-pyrimidina-1(2,5)-flana-4(1,3)-benzenacyclododecaphana-8-ene. In one embodiment, the JAK inhibitor is (9E)-15-(2-(pyrrolidine-1-yl)ethoxy)-7,12,25-trioxa-19,21,24-triaza-tetracyclo[18.3.1.1(2,5).1(14,18)]hexacosa-1(24),2,4,9,14(26),15,17,20,22-nonaene. In one embodiment, the JAK inhibitor is a compound of formula (LIV-A). [ka] or a pharmaceutically acceptable salt thereof. The preparation and characterization of this JAK inhibitor are known to those skilled in the art and are described, for example, Madan (2012) J. Immunol. 189, 4123-4134 and William (2012) J. Med. Chem. 55, 2623-2640.

[0232] In one embodiment, the JAK inhibitor is (R)-(4-fluorophenyl)(4-((5-methyl-1H-pyrazole-3-yl)amino)quinazolin-2-yl)methanol, and it is known in the art that this is active as a JAK inhibitor. In one embodiment, the JAK inhibitor is racemi(4-fluorophenyl)(4-((5-methyl-1H-pyrazole-3-yl)amino)quinazolin-2-yl)methanol, and it is known in the art that this is active as a JAK inhibitor.

[0233] In one embodiment, the JAK inhibitor is (S)-5-fluoro-2-((1-(4-fluorophenyl)ethyl)amino)-6-((5-methyl-1H-pyrazole-3-yl)amino)nicotinonitrile. In one embodiment, the JAK inhibitor is a compound of formula (LX). [ka] or a pharmaceutically acceptable salt thereof. The preparation of this compound is described in U.S. Patent No. 8,324,252, the disclosure of which is incorporated herein by reference. In one embodiment, the JAK inhibitor is selected from the compounds described in U.S. Patent No. 8,324,252, the disclosure of which is incorporated herein by reference.

[0234] In one embodiment, the JAK inhibitor is (R)-7-(2-aminopyrimidine-5-yl)-1-((1-cyclopropyl-2,2,2-trifluoroethyl)amino)-5H-pyrido[4,3-b]indole-4-carboxamide, also named 7-(2-aminopyrimidine-5-yl)-1-{[(1R)-1-cyclopropyl-2,2,2-trifluoroethyl]amino}-5H-pyrido[4,3-b]indole-4-carboxamide. In one embodiment, the JAK inhibitor is a compound of formula (LXII). [ka] or a pharmaceutically acceptable salt thereof. The preparation of this compound is known to those skilled in the art and is disclosed in Lim (2011) J. Med. Chem. 54, 7334-7349, which is incorporated herein by reference.

[0235] IDH inhibitors Enasidenib In one embodiment, the IDH inhibitor is enasidenib. Enasidenib has the following chemical structure and name: 2-methyl-1-[[4-[6-(trifluoromethyl)pyridine-2-yl]-6-[[2-(trifluoromethyl)pyridine-4-yl]amino]-1,3,5-triazine-2-yl]amino]propan-2-ol [ka]

[0236] Ibosidenib (AG-120) In one embodiment, the IDH inhibitor is ivosidenib. Ivosidenib has the following chemical structure and name: (2S)-N-[(1S)-1-(2-chlorophenyl)-2-[(3,3-difluorocyclobutyl)amino]-2-oxoethyl]-1-(4-cyanopyridine-2-yl)-N-(5-fluoropyridine-3-yl)-5-oxopyrrolidine-2-carboxamide [ka]

[0237] AGI-5198(IDH-C35) In one embodiment, the IDH inhibitor is AGI-5198. AGI-5198 has the following chemical structure and name: N-cyclohexyl-2-(3-fluoro-N-[2-(2-methylimidazole-1-yl)acetyl]anilino)-2-(2-methylphenyl)acetamide [ka]

[0238] AGI-6780 In one embodiment, the IDH inhibitor is AGI-6780. AGI-6780 has the following chemical structure and name: 1-[5-(cyclopropylsulfamoyl)-2-thiophene-3-ylphenyl]-3-[3-(trifluoromethyl)phenyl]urea [ka]

[0239] CHEMBL3682093 In one embodiment, the IDH inhibitor is CHEMBL3682093. CHEMBL3682093 has the following chemical structure and name: (4S)-3-[2-[[(1S)-1-[4-[(4-acetylpiperazine-1-yl)methyl]phenyl]ethyl]amino]pyrimidine-4-yl]-4-propan-2-yl-1,3-oxazolidine-2-one [ka]

[0240] Boraside nib (AG-881) In one embodiment, the IDH inhibitor is borasidenib. Borasidenib has the following chemical structure and name: 6-(6-chloropyridine-2-yl)-2-N,4-N-bis[(2R)-1,1,1-trifluoropropan-2-yl]-1,3,5-triazine-2,4-diamine [ka]

[0241] IDH-305 In one embodiment, the IDH inhibitor is IDH-305. IDH-305 has the following chemical structure and name: (4R)-4-[(1S)-1-fluoroethyl]-3-[2-[[(1S)-1-[4-methyl-5-[2-(trifluoromethyl)pyridine-4-yl]pyridine-2-yl]ethyl]amino]pyrimidine-4-yl]-1,3-oxazolidine-2-one [ka]

[0242] BAY-1436032 In one embodiment, the IDH inhibitor is BAY-1436032. BAY-1436032 has the following chemical structure and name: 3-[2-[4-(trifluoromethoxy)anilino]-1-[(1R,5R)-3,3,5-trimethylcyclohexyl]benzimidazole-5-yl]propanoic acid [ka]

[0243] GSK864 In one embodiment, the IDH inhibitor is GSK864. GSK864 is shown below. It has the following chemical structure and name: (7S)-1-[(4-fluorophenyl)methyl]-3-N-(4-methoxy-3,5-dimethylphenyl)-7-methyl-5-(1H-pyrrole-2-carbonyl)-4,6-dihydropyrazolo[4,3-c]pyridine-3,7-dicarboxamide [ka]

[0244] (R,S)-Ibosidenib In one embodiment, the IDH inhibitor is (R,S)-ivosidenib. (R,S)-ivosidenib has the following chemical structure and name: (2R)-N-[(1S)-1-(2-chlorophenyl)-2-[(3,3-difluorocyclobutyl)amino]-2-oxoethyl]-1-(4-cyanopyridine-2-yl)-N-(5-fluoropyridine-3-yl)-5-oxopyrrolidine-2-carboxamide [ka]

[0245] IDH1-IN-2 In one embodiment, the IDH inhibitor is IDH1-IN-2. IDH1-IN-2 has the following chemical structure and name: (4S)-3-[2-[[(1S)-1-[4-[(4,4-difluoropiperidine-1-yl)methyl]phenyl]ethyl]amino]pyrimidine-4-yl]-4-propan-2-yl-1,3-oxazolidine-2-one [ka]

[0246] IDH1-IN-1 In one embodiment, the IDH inhibitor is IDH1-IN-1. IDH1-IN-1 has the following chemical structure and name: 2-(N-[2-(benzimidazole-1-yl)acetyl]-3-fluoroanilino)-N-cyclohexyl-2-(2-methylphenyl)acetamide [ka]

[0247] Enasidenib mesylate In one embodiment, the IDH inhibitor is enasidenib mesylate. Enasidenib mesylate has the following chemical structure and name: 2-methyl-1-[[4-[6-(trifluoromethyl)pyridine-2-yl]-6-[[2-(trifluoromethyl)pyridine-4-yl]amino]-1,3,5-triazine-2-yl]amino]propan-2-olmethanesulfonic acid [ka]

[0248] PD-1 inhibitors The PD-1 inhibitor may be any PD-1 inhibitor or PD-1 blocker known in the art, particularly one of the PD-1 inhibitors or blockers described in more detail in the following paragraphs. The terms “inhibitor” and “blocker” are used interchangeably herein with respect to PD-1 inhibitors. To avoid doubt, in this specification, references to PD-1 inhibitors that are antibodies may also refer to the compound or its antigen-binding fragments, variants, conjugates, or biosimilars. To avoid doubt, in this specification, references to PD-1 inhibitors may also refer to the compound or its pharmaceutically acceptable salts, esters, solvates, hydrates, cocrystals, or prodrugs.

[0249] In some embodiments, the compositions and methods described include a PD-1 inhibitor. In some embodiments, the PD-1 inhibitor is a small molecule. In one preferred embodiment, the PD-1 inhibitor is an antibody, a fragment thereof including a Fab fragment, or a single-stranded variable fragment (scFv). In some embodiments, the PD-1 inhibitor is a polyclonal antibody. In one preferred embodiment, the PD-1 inhibitor is a monoclonal antibody. In some embodiments, the PD-1 inhibitor competes for binding to PD-1 and / or binds to an epitope on PD-1. In one embodiment, the antibody competes for binding to PD-1 and / or binds to an epitope on PD-1. In some embodiments, the PD-1 inhibitor is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, the anti-PD-1 monoclonal antibody is included in the composition... Alternatively, it is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor included in the composition or method. In some embodiments, the anti-PD-1 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor and / or a JAK-2 inhibitor. In some embodiments, the PD-1 inhibitor is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, the anti-PD-1 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, the PD-1 inhibitor is included in the composition or method and is further combined with a PI3K inhibitor. In some embodiments, the anti-PD-1 monoclonal antibody is included in the composition or method and is further combined with a PI3K inhibitor. In some embodiments, the PD-1 inhibitor is included in the composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, the anti-PD-1 monoclonal antibody is included in the composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, the compositions described herein provide a combination of a PD-1 inhibitor and a BTK inhibitor, or a method of using a combination of a PD-1 inhibitor and a BTK inhibitor. In some embodiments, the PD-1 inhibitors provided herein are selective for PD-1 in that the compound binds or interacts with PD-1 at a substantially lower concentration than it binds or interacts with other receptors.

[0250] In some embodiments, the described compositions and methods bind human PD-1 at a K D of about 100 pM or less, bind human PD-1 at a K D of about 90 pM or less, bind human PD-1 at a K D of about 80 pM or less, bind human PD-1 at a K D of about 70 pM or less, bind human PD-1 at a K D of about 60 pM or less, bind human PD-1 at a K D of about 50 pM or less, bind human PD-1 at a K D of about 40 pM or less, or bind human PD-1 at a K D of about 30 pM or less and include a PD-1 inhibitor.

[0251] In some embodiments, the described compositions and methods are used to deliver about 7.5 × 10⁶ human PD-1 to human PD-1. 5 k greater than or equal to l / M·s assoc It binds to human PD-1, or approximately 7.5 × 10⁻¹⁴ 5 k greater than or equal to l / M·s assoc It binds to human PD-1, or approximately 8 × 10 5 k greater than or equal to l / M·s assoc It binds to human PD-1, or approximately 8.5 × 10⁻¹⁴ 5 k greater than or equal to l / M·s assoc It binds to human PD-1, or approximately 9 × 10 5 k greater than or equal to l / M·s assoc It binds to human PD-1, or approximately 9.5 × 10⁻¹⁴ 5 k greater than or equal to l / M·s assoc It binds to human PD-1, or to human PD-1 by approximately 1 × 10⁶ times. 6 k greater than or equal to l / M·s assoc It contains a PD-1 inhibitor that binds to it.

[0252] In some embodiments, the described compositions and methods are used to deliver about 2 × 10⁶ human PD-1 to human PD-1. -5 k below l / s dissoc It binds to human PD-1, or approximately 2.1 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.2 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.3 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.4 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.5 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.6 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.7 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.8 × 10⁻¹⁴ -5 k below l / s dissocIt binds to human PD-1, or approximately 2.9 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or to human PD-1 by approximately 3 × 10⁻¹⁴ units. -5 k below l / s dissoc It contains a PD-1 inhibitor that binds to it.

[0253] In some embodiments, the described compositions and methods achieve an IC of approximately 10 nM or less when binding human PD-L1 or human PD-L2 to human PD-1. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or the IC is less than approximately 9 nM. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or the IC is reduced to approximately 8 nM or less. 50 Block or inhibit human P against human PD-1. The binding of D-L1 or human PD-L2 to ICs of approximately 7 nM or less 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or the IC is reduced to approximately 6 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or reduces the IC to approximately 5 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1 to an IC of approximately 4 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1 to an IC of approximately 3 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or reduces the IC to approximately 2nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or reduces the IC to approximately 1 nM or less. 50 Includes PD-1 inhibitors that block or inhibit it.

[0254] In one embodiment, the anti-PD-1 antibody comprises nivolumab manufactured by Bristol-Myers Squibb Co., or its antigen-binding fragment, conjugate, or variant. Nivolumab is referred to as 5C4 in International Patent Publication WO2006 / 121168. Nivolumab is assigned CAS Registry Number 946414-94-4 and is also known to those skilled in the art as BMS-936558, MDX-1106, or ONO-4538. Nivolumab is a fully human IgG4 antibody that blocks the PD-1 receptor. The clinical safety and efficacy of nivolumab in various forms of cancer are described in Wang, Cancer Immunol Res. 2014, 2, 846-56; Page, Ann. Rev. Med., 2014, 65, 185-202; and Weber, J. Clin. Oncology, 2013, 31, 4311-4318. The nivolumab monoclonal antibody comprises a heavy chain given by SEQ ID NO: 1 and a light chain given by SEQ ID NO: 2. In one embodiment, the anti-PD-1 antibody is an immunoglobulin G4 kappa, anti-(human CD274) antibody. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain having the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively, or their antigen-binding fragment, Fab fragment, single-stranded variable fragment (scFv), variant, or conjugate. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 99% identical to the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In one embodiment, the anti-PD-1 antibody includes a heavy chain and a light chain that are at least 98% identical to the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In one embodiment, the anti-PD-1 antibody includes a heavy chain and a light chain that are at least 97% identical to the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In one embodiment, the anti-PD-1 antibody includes a heavy chain and a light chain that are at least 96% identical to the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively. In one embodiment, the anti-PD-1 antibody includes a heavy chain and a light chain that are at least 95% identical to the sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0255] In other embodiments, the anti-PD-1 antibody comprises the heavy and light chain CDR or VR of nivolumab. In one embodiment, antibody V H The region contains the sequence shown in Sequence ID No. 3, and antibody V L The region includes the sequence shown in SEQ ID NO: 4. In one embodiment, the anti-PD-1 antibody is V, which is at least 99% identical to the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. H and V L Includes the region. In one embodiment, the anti-PD-1 antibody is V, which is at least 98% identical to the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. H and V L Includes the region. In one embodiment, the anti-PD-1 antibody is V, which is at least 97% identical to the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. H and V L Includes a region. In one embodiment, the anti-PD-1 antibody is V, which is at least 96% identical to the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. H and V L Includes the region. In one embodiment, the anti-PD-1 antibody is V, which is at least 95% identical to the sequences shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively. H and V L Includes the region. In an alternative embodiment, the antibody has the amino acid sequence shown in SEQ ID NO: 3 and / or SEQ ID NO: 4, respectively. H and / or V L Includes the region.

[0256] In another embodiment, the anti-PD-1 antibody comprises heavy chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, or their conserved amino acid substitutions, and light chain CDR1, CDR2, and CDR3 domains having the sequences shown in SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, or their conserved amino acid substitutions.

[0257] In one embodiment, the anti-PD-1 antibody includes CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively. In another embodiment, the anti-PD-1 antibody includes CDR1, CDR2, and CDR3 domains that are at least 94% identical to the sequences shown in SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively. In yet another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the antibody described above.

[0258] In one embodiment, the anti-PD-1 antibody includes CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences shown in SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, respectively. In another embodiment, the anti-PD-1 antibody includes CDR1, CDR2, and CDR3 domains that are at least 91% identical to the sequences shown in SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10, respectively. In yet another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the antibody described above.

[0259] In one embodiment, the anti-PD-1 antibody is an antibody disclosed and / or prepared in accordance with U.S. Patent No. 8,008,449 or U.S. Patent Application Publication No. 2009 / 0217401A1 or 2013 / 0133091A1, the disclosures of which are specifically incorporated herein by reference. For example, in one embodiment, the monoclonal antibody includes 5C4 (referred to herein as nivolumab), 17D8, 2D3, 4H1, 4A11, 7D3, and 5F4, the disclosures of which are described herein by reference. The PD-1 antibodies 17D8, 2D3, 4H1, 5C4, and 4A11 are all directed toward human PD-1, bind specifically to PD-1, and do not bind to other members of the CD28 family. The sequences and CDR regions of these antibodies are provided in U.S. Patent No. 8,008,449, in particular in Figures 1 to 12, all of which are incorporated herein by reference in their entirety.

[0260] The anti-PD-1 antibody nivolumab may be prepared by the following procedure, as described in U.S. Patent No. 8,008,449. The antibody nivolumab may be manufactured in this manner or by other known means in consideration of the amino acid sequence disclosure herein.

[0261] In another embodiment, the anti-PD-1 antibody comprises pembrolizumab, or its antigen-binding fragment, conjugate, or variant, commercially available from Merck. Pembrolizumab is published in International Patent Publication WO2008 / 156712A1, U.S. Patent No. 8,354,509, and U.S. Patent Application Publications US2010 / 0266617A1 and US22 It is called h409All in publications 013 / 0108651A1 and US2013 / 0109843A2. Pembrolizumab has a disulfide, dimeric structure containing immunoglobulin G4, anti-(human protein PDCD1 (programmed cell death 1))(human-mouse monoclonal heavy chain), and human-mouse monoclonal light chain. The structure of pembrolizumab is sometimes described as a disulfide-bisdisulfide containing immunoglobulin G4, anti-(human programmed cell death 1); humanized mouse monoclonal [228-L-proline (H10-S>P)]γ4 heavy chain (134-218')-humanized mouse monoclonal κ light chain dimer (226-226'':229-229''). Pembrolizumab is assigned CAS registry number 1374853-91-4 and is also known as lambrolizumab, MK-3475, and SCH-900475. The clinical safety and efficacy of pembrolizumab in various forms of cancer are described in Fuerst, Oncology Times, 2014, 36, 35-36; Robert, Lancet, 2014, 384, 1109-17; and Thomas, Exp. Opin. Biol. Ther., 2014, 14, 1061-1064. In one embodiment, the pembrolizumab monoclonal antibody comprises a heavy chain given by SEQ ID NO: 12 and a light chain given by SEQ ID NO: 14, and is also shown below with information on disulfide and glycosylation. [Table 1]

[0262] In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain having the sequences shown in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or the antigen-binding fragment and variant thereof. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 99% identical to the sequences shown in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or the antigen-binding fragment and variant thereof. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 98% identical to the sequences shown in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or the antigen-binding fragment and variant thereof. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 97% identical to the sequences shown in SEQ ID NO: 12 and SEQ ID NO: 14, respectively, or the antigen-binding fragment and variant thereof. In one embodiment, the anti-PD-1 antibody is The antibody comprises a heavy chain and a light chain, or their antigen-binding fragment and variants, that are at least 96% identical to the sequences shown in SEQ ID NO: 12 and SEQ ID NO: 14, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain, or their antigen-binding fragment and variants, that are at least 95% identical to the sequences shown in SEQ ID NO: 12 and SEQ ID NO: 14, respectively.

[0263] In other embodiments, the anti-PD-1 antibody comprises the heavy and light chain CDR or VR of pembrolizumab. In one embodiment, antibody V H The region includes the sequence of residues 20-446 of SEQ ID NO: 11, and antibody V L The region includes the sequence shown in SEQ ID NO: 14. In one embodiment, the anti-PD-1 antibody is at least 99% identical to the sequence of residues 20-446 of SEQ ID NO: 11 and the sequence shown in SEQ ID NO: 14. H and V L Includes the region. In one embodiment, the anti-PD-1 antibody is at least 98% identical to the sequence of residues 20-446 of SEQ ID NO: 11 and the sequence shown in SEQ ID NO: 14. H and V L The region includes. In one embodiment, the anti-PD-1 antibody is at least 97% identical to the sequence of residues 20-446 of SEQ ID NO: 11 and the sequence shown in SEQ ID NO: 14. Hand V L Includes the region. In one embodiment, the anti-PD-1 antibody is at least 96% identical to the sequence of residues 20-446 of SEQ ID NO: 11 and the sequence shown in SEQ ID NO: 14. H and V L Includes the region. In one embodiment, the anti-PD-1 antibody is at least 95% identical to the sequence of residues 20-446 of SEQ ID NO: 11 and the sequence shown in SEQ ID NO: 14. H and V L Includes the region.

[0264] In one embodiment, the anti-PD-1 antibody comprises a heavy chain containing amino acid residues 20-446 of SEQ ID NO: 11 and a light chain containing amino acid residues 20-237 of SEQ ID NO: 13.

[0265] In one embodiment, the anti-PD-1 antibody is an isolated antibody or antibody fragment that binds to human PD-1, comprising three light chain CDRs, or their conserved amino acid substitutions, of SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, and three heavy chain CDRs, or their conserved amino acid substitutions, of SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20.

[0266] In one embodiment, the anti-PD-1 antibody comprises a heavy chain containing CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences shown in SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, respectively. In another embodiment, the antibody comprises a heavy chain containing CDR1, CDR2, and CDR3 domains that are at least 90% identical to the sequences shown in SEQ ID NO: 15, SEQ ID NO: 16, and SEQ ID NO: 17, respectively. In another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the antibody described above.

[0267] In one embodiment, the anti-PD-1 antibody includes a light chain containing CDR1, CDR2, and CDR3 domains that are at least 95% identical to the sequences shown in SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20, respectively. In one embodiment, the anti-PD-1 antibody includes a light chain containing CDR1, CDR2, and CDR3 domains that are at least 90% identical to the sequences shown in SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20, respectively. In one embodiment, the anti-PD-1 antibody includes a light chain containing CDR1, CDR2, and CDR3 domains that are at least 85% identical to the sequences shown in SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20, respectively. In one embodiment, the anti-PD-1 antibody includes a light chain containing CDR1, CDR2, and CDR3 domains that are at least 80% identical to the sequences shown in SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 20, respectively. , and a light chain containing the CDR3 domain. In another embodiment, the antibody competes for binding to PD-1 and / or binds to the same epitope on PD-1 as the antibody described above.

[0268] In one embodiment, the anti-PD-1 antibody is an antibody disclosed in U.S. Patent No. 8,354,509 or U.S. Patent Application Publications 2010 / 0266617A1, 2013 / 0108651A1, and 2013 / 0109843A2, the disclosures of which are specifically incorporated herein by reference.

[0269] In one embodiment, the anti-PD-1 antibody is pidilizumab, also known as CT-011 (CureTech Ltd.), which is disclosed in U.S. Patent No. 8,686,119B2, the disclosure of which is specifically incorporated herein by reference. The efficacy of pidilizumab in the treatment of cancers such as hematological malignancies is described in Berger, Clin. Cancer Res. 2008, 14, 3044-51. The pidilizumab monoclonal antibody comprises a heavy chain given by SEQ ID NO: 21 and a light chain given by SEQ ID NO: 22. Pidilizumab has intraheavy chain disulfide bonds at 22--96, 144--200, 261--321, 367--425, 22''-96'', 144''-200'', 261''-321'', and 367''-425'', intralight chain disulfide bonds at 23'-87', 133'-193', 23'''-87'''', and 133'''-193'''', interheavy chain disulfide bonds at 220--213' and 220''-213'''', interheavy chain disulfide bonds at 226-226'' and 229-229'', and N-glycosylation sites (H CH284.4) at 297 and 297''.

[0270] In one embodiment, the anti-PD-1 antibody is an immunoglobulin G1 kappa, anti-(human CD274) humanized monoclonal antibody. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain having the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22, respectively, or an antigen-binding fragment, variant, or conjugate thereof. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 99% identical to the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 98% identical to the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 97% identical to the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 96% identical to the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22, respectively. In one embodiment, the anti-PD-1 antibody comprises a heavy chain and a light chain that are at least 95% identical to the sequences shown in SEQ ID NO: 21 and SEQ ID NO: 22, respectively.

[0271] In one embodiment, the anti-PD-L1 antibody has a V H and a V L region that is at least 99% identical to the sequences shown in SEQ ID NO: 23 and SEQ ID NO: 24, respectively. In one embodiment, the anti-PD-L1 antibody has a V H and a V L region that is at least 98% identical to the sequences shown in SEQ ID NO: 23 and SEQ ID NO: 24, respectively. In one embodiment, the anti-PD-L1 antibody has a V H and a V L region that is at least 97% identical to the sequences shown in SEQ ID NO: 23 and SEQ ID NO: 24, respectively. In one embodiment, the anti-PD-L1 antibody has a V H and a V L region that is at least 96% identical to the sequences shown in SEQ ID NO: 23 and SEQ ID NO: 24, respectively. In one embodiment, the anti-PD-L1 antibody has a V H and a V L region that is at least 95% identical to the sequences shown in SEQ ID NO: 23 and SEQ ID NO: 24, respectively.

[0272] In another embodiment, anti-PD-1 antibodies and other PD-1 inhibitors include U.S. Patent No. 8,287,856, which are specifically incorporated herein by reference. Examples include those described in U.S. Patent Nos. 580,247 and 8,168,757, and U.S. Patent Publication Nos. 2009 / 0028857A1, 2010 / 0285013A1, 2013 / 0022600A1, and 2011 / 0008369A1. In another embodiment, antibodies that compete with any of these antibodies for binding to PD-1 are also included. In another embodiment, the anti-PD-1 antibody is the antibody disclosed in U.S. Patent No. 8,735,553B1, the disclosure of which is specifically incorporated herein by reference.

[0273] In one embodiment, the anti-PD-1 antibody is a commercially available monoclonal antibody, such as anti-m-PD-1 clone J43 (catalog number BE0033-2) and RMP1-14 (catalog number BE0146) (Bio X Cell, Inc., West Lebanon, NH, USA). Several commercially available anti-PD-1 antibodies are known to those skilled in the art.

[0274] Monoclonal antibodies that inhibit or block PD-1 can be prepared by procedures known to those skilled in the art, for example, by injecting a PD-1 antigen into a test subject and then isolating hybridomas expressing antibodies having the desired sequence or functional properties. The DNA encoding the monoclonal antibody can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of the monoclonal antibody). Hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA can be placed in an expression vector and then transfected into host cells such as E. coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells, myeloma cells, or other suitable cells that do not otherwise produce immunoglobulin proteins to obtain the synthesis of the monoclonal antibody in recombinant host cells. Details of the recombinant production of specific antibodies can be found in the aforementioned references (their disclosures are incorporated herein by reference). Monoclonal antibodies that inhibit PD-1 can be prepared by standard molecular biological methods by backtranslating and inserting the sequences provided herein into a suitable DNA or RNA vector.

[0275] Table 1 summarizes the sequences of the anti-PD-1 antibodies discussed and referenced in the embodiments described above. [Table 2]

[0276] PD-1 inhibitors also include small molecules or peptides or peptide derivatives, e.g., those described in U.S. Patent Nos. 8,907,053, 9,096,642, and 9,044,442, and U.S. Patent Application Publication No. 2015 / 0087581; 1,2,4-oxadiazole compounds and derivatives, e.g., those described in U.S. Patent Application Publication No. 2015 / 0073024; cyclic peptide mimetic compounds and derivatives, e.g., those described in U.S. Patent Application Publication No. 2015 / 0073042; cyclic compounds and derivatives, e.g., those described in U.S. Patent Application Publication No. 2015 / 0125491; 1,3,4-oxadiazole and 1,3,4-thiadiazole compounds and derivatives, e.g., those described in International Patent Application Publication No. WO2015 / 033301; and peptide compounds. and derivatives, for example, those described in International Patent Application Publications WO2015 / 036927 and WO2015 / 04490, or macrocyclic peptide compounds and derivatives, for example, those described in U.S. Patent Application Publication 2014 / 0294898, the disclosures thereof being incorporated herein by reference in their entirety.

[0277] In one embodiment, the PD-1 inhibitor is AUNP-12.

[0278] In one embodiment, the PD-1 inhibitor is [ka] and The branched chain group is given by Sequence ID No. 25 in Sequence ID Nos. 37-38. The compound is selected from the group consisting of pharmaceutically acceptable salts, solvates, hydrates, cocrystals, or prodrugs thereof.

[0279] In one embodiment, the PD-1 inhibitor is nivolumab, pembrolizumab, or pidilizumab. The PD-1 inhibitor is selected from the group consisting of AMP-224, AMP-514, PDR001, and combinations thereof. In one embodiment, the PD-1 inhibitor is nivolumab. In one embodiment, the PD-1 inhibitor is pembrolizumab. In one embodiment, the PD-1 inhibitor is pidilizumab. In one embodiment, the PD-1 inhibitor is AMP-224.

[0280] PD-L1 and PD-L2 inhibitors PD-L1 or PD-L2 inhibitors may be any PD-L1 or PD-L2 inhibitor or blocker known in the art, particularly one of the PD-L1 or PD-L2 inhibitors or blockers described in more detail in the following paragraphs. The terms “inhibitor” and “blocker” are used interchangeably herein with respect to PD-L1 and PD-L2 inhibitors. To avoid doubt, in this specification, references to PD-L1 or PD-L2 inhibitors that are antibodies may refer to the compound or its antigen-binding fragments, variants, conjugates, or biosimilars. To avoid doubt, in this specification, references to PD-L1 or PD-L2 inhibitors may refer to the compound or its pharmaceutically acceptable salts, esters, solvates, hydrates, cocrystals, or prodrugs.

[0281] In some embodiments, the composition and method comprises a PD-L1 or PD-L2 inhibitor. In some embodiments, the PD-L1 or PD-L2 inhibitor is a small molecule. In some embodiments, the PD-L1 or PD-L2 inhibitor is an anti-PD-L1 or anti-PD-L2 antibody, a fragment thereof including a Fab fragment, or a single-stranded variable fragment (scFv). In one aspect of the present invention, the anti-PD-1 antibody or fragment thereof in any of the above embodiments is replaced with or combined with an anti-PD-L1 or anti-PD-L2 antibody or fragment thereof. In one embodiment, the antibody competes for binding to PD-L1 and / or PD-L2 and / or binds to an epitope on PD-L1 and / or PD-L2. In some embodiments, the PD-L1 or PD-L2 inhibitor is a monoclonal antibody. In some embodiments, the PD-L1 or PD-L2 inhibitor is a polyclonal antibody. In some embodiments, a PD-L1 inhibitor is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-L1 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, a PD-L2 inhibitor is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, an anti-PD-L2 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, a PD-L1 inhibitor is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, an anti-PD-L1 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, a PD-L2 inhibitor is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, an anti-PD-L2 monoclonal antibody is included in the composition or method and is further combined with a BTK inhibitor. In some embodiments, a PD-L1 inhibitor is included in the composition or method and is further combined with a PI3K inhibitor.In some embodiments, an anti-PD-L1 monoclonal antibody is included in the composition or method and further combined with a PI3K inhibitor. In some embodiments, a PD-L2 inhibitor is included in the composition or method and further combined with a PI3K inhibitor. In some embodiments, an anti-PD-L2 monoclonal antibody is included in the composition or method and further combined with a PI3K inhibitor. In some embodiments, a PD-L1 inhibitor is included in the composition or method and further combined with a JAK-2 inhibitor. In some embodiments, an anti-PD-L1 monoclonal antibody is included in the composition or method and further combined with a JAK-2 inhibitor. In some embodiments, a PD-L2 inhibitor is included in the composition or method and further combined with a JAK-2 inhibitor. They are combined. In some embodiments, an anti-PD-L2 monoclonal antibody is included in the composition or method and is further combined with a JAK-2 inhibitor. In some embodiments, both a PD-1 inhibitor and a PD-L1 inhibitor are included in the composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, both an anti-PD-1 monoclonal antibody and an anti-PD-L1 monoclonal antibody are included in the composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, both a PD-1 inhibitor and a PD-L2 inhibitor are included in the composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor. In some embodiments, both an anti-PD-1 monoclonal antibody and an anti-PD-L2 monoclonal antibody are included in the composition or method and are further combined with a BTK inhibitor, a PI3K inhibitor, and / or a JAK-2 inhibitor.

[0282] In some embodiments, the compositions described herein provide a combination of a PD-L1 and / or PD-L2 inhibitor and a BTK inhibitor, or a method of using a combination of a PD-L1 and / or PD-L2 inhibitor and a BTK inhibitor. In some embodiments, the PD-L1 inhibitor provided herein is selective for PD-L1 in that the compound binds or interacts with PD-L1 at a substantially lower concentration than it binds or interacts with other receptors, including the PD-L2 receptor. In certain embodiments, the compound binds to the PD-L2 receptor with a binding constant that is at least about 2-fold higher, about 3-fold higher, about 5-fold higher, about 10-fold higher, about 20-fold higher, about 30-fold higher, about 50-fold higher, about 100-fold higher, about 200-fold higher, about 300-fold higher, or about 500-fold higher than that for the PD-L1 receptor.

[0283] Without being bound by any theory, it is believed that tumor cells express PD-L1 and T cells express PD-1. However, PD-L1 expression by tumor cells is not required for the effectiveness of PD-1 or PD-L1 inhibitors or blockers. In one embodiment, the tumor cells express PD-L1. In another embodiment, the tumor cells do not express PD-L1. In some embodiments, the methods and compositions described herein include combinations of PD-1 and PD-L1 antibodies, such as those described herein, in combination with a BTK inhibitor. Administration of the combination of PD-1 and PD-L1 antibodies and the BTK inhibitor may be simultaneous or sequential.

[0284] In some embodiments, the described compositions and methods bind human PD-L1 and / or PD-L2 with a K D of about 100 pM or less, or bind human PD-L1 and / or PD-L2 with a K D of about 90 pM or less, or bind human PD-L1 and / or PD-L2 with a K D of about 80 pM or less, or bind human PD-L1 and / or PD-L2 with a K D of about 70 pM or less, or bind human PD-L1 and / or PD-L2 with a K of about 60 pM or lessD They bind at K below approximately 50 pM. D It binds to human PD-L1 and / or PD-L2 at a K₂O₀ of approximately 40 pM or less. D It binds to human PD-L1 and / or PD-L2 at approximately 30 pM or less. D It contains PD-L1 and / or PD-L2 inhibitors that bind to it.

[0285] In some embodiments, the described compositions and methods deliver about 7.5 × 10⁻¹⁶ human PD-L1 and / or PD-L2. 5 k greater than or equal to l / M·s assoc It binds to human PD-L1 and / or PD-L2 at a rate of approximately 8 × 10⁻¹⁴. 5 k greater than or equal to l / M·s assoc It binds to human PD-L1 and / or PD-L2 at approximately 8.5 × 10⁻¹⁴ denaturations. 5 k greater than or equal to l / M·s assoc It binds to human PD-L1 and / or PD-L2 at approximately 9 × 10⁻¹⁴ densities. 5 k greater than or equal to l / M·s assoc It binds to human PD-L1 and / or PD-L2 at approximately 9.5 × 10⁻¹⁴ denaturations. 5 k greater than or equal to l / M·s assoc It binds to human PD-L1 and / or Or, PD-L2 is approximately 1 x 10 6 k greater than or equal to l / M·s assoc It contains PD-L1 and / or PD-L2 inhibitors that bind to it.

[0286] In some embodiments, the described compositions and methods are used to deliver about 2 × 10⁶ human PD-L1 or PD-L2 cells. -5 k below l / s dissoc It binds to human PD-1, or approximately 2.1 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.2 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.3 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.4 × 10⁻¹⁴ -5 k below l / sdissoc It binds to human PD-1, or approximately 2.5 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-1, or approximately 2.6 × 10⁻¹⁴ -5 k below l / s dissoc It binds to human PD-L1 or PD-L2 at a rate of approximately 2.7 × 10⁻¹⁴. -5 k below l / s dissoc It binds to human PD-L1 or PD-L2, or to approximately 3 × 10⁻¹⁴ of human PD-L1 or PD-L2. -5 k below l / s dissoc It contains PD-L1 and / or PD-L2 inhibitors that bind to it.

[0287] In some embodiments, the described compositions and methods achieve an IC of approximately 10 nM or less when binding human PD-L1 or human PD-L2 to human PD-1. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or the IC is less than approximately 9 nM. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or the IC is reduced to approximately 8 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or reduces the IC to approximately 7 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or the IC is reduced to approximately 6 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or reduces the IC to approximately 5 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1 to an IC of approximately 4 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1 to an IC of approximately 3 nM or less. 50 This blocks or inhibits the binding of human PD-L1 or human PD-L2 to human PD-1, or reduces the IC to approximately 2nM or less. 50 It blocks or inhibits, or blocks human PD-1, or prevents the binding of human PD-L1 or human PD-L2 to human PD-1 to an IC of approximately 1 nM or less. 50Includes PD-L1 and / or PD-L2 inhibitors that block PD-L1.

[0288] In one embodiment, the anti-PD-L1 antibody is durvalumab, also known as MEDI4736, manufactured by Medimmune, LLC, Gaithersburg, Maryland, a subsidiary of AstraZeneca plc., or its antigen-binding fragment, conjugate, or variant. In one embodiment, the anti-PD-L1 antibody is the antibody disclosed in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. The clinical safety of durvalumab (MEDI4736, SEQ ID NO: 39 and SEQ ID NO: 40) is described in Page, Ann. Rev. Med., 2014, 65, 185-202; Brahmer, J. Clin. Oncol. 2014, 32, 5s (supplement, abstract 8021); and McDermott, Cancer Treatment Rev., 2014, 40, 1056-64. The durvalumab (MEDI4736) monoclonal antibody is given by SEQ ID NO: 41. H The region (corresponding to Sequence ID No. 72 of U.S. Patent No. 8,779,108) and V given by Sequence ID No. 42 L The durvalumab monoclonal antibody includes the region (corresponding to Sequence ID No. 77 of U.S. Patent No. 8,779,108). The durvalumab monoclonal antibody has disulfide bonds at 22-96, 22''-96'', 23'-89', 23'''-89''', 135'-195', 135'''-195''', 148-204, 148''-204'', 215'-224, 215'''-224'', 230-230'', 233-233'', 265-325, 265''-325'', 371-429, and 371''-429', and Asn -301 and Asn-301'' contain an N-glycosylation site.

[0289] In one embodiment, the anti-PD-L1 antibody is a disulfide having immunoglobulin G1, anti(human CD antigen CD274)(human monoclonal heavy chain), and a human monoclonal κ chain, and is a dimer. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains of durvalumab (MEDI4736). In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains having the sequences shown in SEQ ID NO: 39 and SEQ ID NO: 40, respectively, or their antigen-binding fragments, variants, or conjugates. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 99% identical to the sequences shown in SEQ ID NO: 39 and SEQ ID NO: 40, respectively. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 98% identical to the sequences shown in SEQ ID NO: 39 and SEQ ID NO: 40, respectively. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 97% identical to the sequences shown in SEQ ID NO: 39 and SEQ ID NO: 40, respectively. In one embodiment, the anti-PD-L1 antibody comprises a heavy chain and a light chain that are at least 96% identical to the sequences shown in SEQ ID NO: 39 and SEQ ID NO: 40, respectively. In another embodiment, the anti-PD-L1 antibody comprises a heavy chain and a light chain that are at least 95% identical to the sequences shown in SEQ ID NO: 39 and SEQ ID NO: 40, respectively.

[0290] In one embodiment, the anti-PD-L1 antibody has the sequence shown in SEQ ID NO: 41 (corresponding to SEQ ID NO: 72 in U.S. Patent No. 8,779,108) and the sequence shown in SEQ ID NO: 42 (corresponding to SEQ ID NO: 77 in U.S. Patent No. 8,779,108), respectively, as described in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H and V L The region includes the antigen-binding fragment, conjugate, and variant. In one embodiment, the anti-PD-L1 antibody is V, which is at least 99% identical to the sequences shown in SEQ ID NOs. 41 and 42, respectively. H and V LIncludes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 98% identical to the sequences shown in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 97% identical to the sequences shown in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 96% identical to the sequences shown in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 95% identical to the sequences shown in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 90% identical to the sequences shown in SEQ ID NO: 41 and SEQ ID NO: 42, respectively. H and V L Includes the region.

[0291] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO: 43 (corresponding to SEQ ID NO: 23 in U.S. Patent No. 8,779,108) or its conserved amino acid substitutions, as described in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H CDR1, the amino acid sequence of SEQ ID NO: 44 (corresponding to SEQ ID NO: 24 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitutions. H V having the amino acid sequence of CDR2, SEQ ID NO: 45 (corresponding to SEQ ID NO: 25 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. H CDR3, the amino acid sequence of Sequence ID No. 46 (corresponding to Sequence ID No. 28 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitutions LV having the amino acid sequence of CDR1, SEQ ID NO: 47 (corresponding to SEQ ID NO: 29 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L V having the amino acid sequence of CDR2, SEQ ID NO: 48 (corresponding to SEQ ID NO: 30 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L Contains an amino acid sequence including CDR3.

[0292] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO: 49 (corresponding to SEQ ID NO: 3 in U.S. Patent No. 8,779,108) or its conserved amino acid substitutions, as described in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559A1, the disclosures of which are specifically incorporated herein by reference. H V having the amino acid sequence of CDR1, SEQ ID NO: 50 (corresponding to SEQ ID NO: 4 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. H V having the amino acid sequence of CDR2, SEQ ID NO: 51 (corresponding to SEQ ID NO: 5 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. H CDR3, the amino acid sequence of Sequence ID No. 52 (corresponding to Sequence ID No. 8,779,108 of the U.S. Patent Act), or V having the same conserved amino acid substitution. L V having the amino acid sequence of CDR1, SEQ ID NO: 53 (corresponding to SEQ ID NO: 9 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L V having the amino acid sequence of CDR2, SEQ ID NO: 54 (corresponding to SEQ ID NO: 10 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L Contains an amino acid sequence including CDR3.

[0293] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO: 55 (corresponding to SEQ ID NO: 13 in U.S. Patent No. 8,779,108) or its conserved amino acid substitutions, as described in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference.H CDR1, the amino acid sequence of Sequence ID No. 56 (corresponding to Sequence ID No. 14 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitutions H V having the amino acid sequence of CDR2, SEQ ID NO: 57 (corresponding to SEQ ID NO: 15 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. H V having the amino acid sequence of CDR3, SEQ ID NO: 58 (corresponding to SEQ ID NO: 18 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L V having the amino acid sequence of CDR1, SEQ ID NO: 59 (corresponding to SEQ ID NO: 19 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L V having the amino acid sequence of CDR2, SEQ ID NO: 60 (corresponding to SEQ ID NO: 20 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L Contains an amino acid sequence including CDR3.

[0294] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO: 61 (corresponding to SEQ ID NO: 63 in U.S. Patent No. 8,779,108) or its conserved amino acid substitutions, as described in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H CDR1, the amino acid sequence of Sequence ID No. 62 (corresponding to Sequence ID No. 64 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitutions H V having the amino acid sequence of CDR2, SEQ ID NO: 63 (corresponding to SEQ ID NO: 65 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. H CDR3, the amino acid sequence of Sequence ID No. 64 (corresponding to Sequence ID No. 68 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitutions L CDR1, the amino acid sequence of SEQ ID NO: 65 (corresponding to SEQ ID NO: 69 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitutions LCDR2, the amino acid sequence of Sequence ID No. 66 (corresponding to Sequence ID No. 70 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitution L Contains an amino acid sequence including CDR3.

[0295] In another embodiment, the anti-PD-L1 antibody has the amino acid sequence of SEQ ID NO: 67 (corresponding to SEQ ID NO: 73 in U.S. Patent No. 8,779,108) or its conserved amino acid substitutions, as described in U.S. Patent No. 8,779,108 or U.S. Patent Application Publication No. 2013 / 0034559, the disclosures of which are specifically incorporated herein by reference. H CDR1, Sequence ID 68 (corresponding to Sequence ID 74 of U.S. Patent No. 8,779,108) V having the amino acid sequence of ) or its conserved amino acid substitution H V having the amino acid sequence of CDR2, SEQ ID NO: 69 (corresponding to SEQ ID NO: 75 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. H CDR3, the amino acid sequence of Sequence ID No. 70 (corresponding to Sequence ID No. 78 of U.S. Patent No. 8,779,108), or V having the same conserved amino acid substitution. L V having the amino acid sequence of CDR1, SEQ ID NO: 71 (corresponding to SEQ ID NO: 79 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L V having the amino acid sequence of CDR2, SEQ ID NO: 72 (corresponding to SEQ ID NO: 80 of U.S. Patent No. 8,779,108), or the conserved amino acid substitution thereof. L Contains an amino acid sequence including CDR3.

[0296] In one embodiment, the anti-PD-L1 antibody is atezolizumab, also known as MPDL3280A or RG7446, manufactured by Genentech, Inc., a subsidiary of Roche, or its antigen-binding fragment, conjugate, or variant. In one embodiment, the anti-PD-L1 antibody is the antibody disclosed in U.S. Patent No. 8,217,149, the disclosure of which is specifically incorporated herein by reference. In one embodiment, the anti-PD-L1 antibody is the antibody disclosed in U.S. Patent Application Publications 2010 / 0203056A1, 2013 / 0045200A1, 2013 / 0045201A1, 2013 / 0045202A1, or 2014 / 0065135A1, the disclosures of which are specifically incorporated herein by reference. The atezolizumab monoclonal antibody contains a heavy chain given by SEQ ID NO: 73 and a light chain given by SEQ ID NO: 74.

[0297] In one embodiment, the anti-PD-L1 antibody is an immunoglobulin G1 kappa, an anti-(human PD-L1) humanized monoclonal antibody. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains of atezolizumab (MPDL3280A). In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains having the sequences shown in SEQ ID NO: 73 and SEQ ID NO: 74, respectively, or their antigen-binding fragments, variants, or conjugates. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 99% identical to the sequences shown in SEQ ID NO: 73 and SEQ ID NO: 74, respectively. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 98% identical to the sequences shown in SEQ ID NO: 73 and SEQ ID NO: 74, respectively. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 97% identical to the sequences shown in SEQ ID NO: 73 and SEQ ID NO: 74, respectively. In one embodiment, the anti-PD-L1 antibody comprises a heavy chain and a light chain that are at least 96% identical to the sequences shown in SEQ ID NO: 73 and SEQ ID NO: 74, respectively. In another embodiment, the anti-PD-L1 antibody comprises a heavy chain and a light chain that are at least 95% identical to the sequences shown in SEQ ID NO: 73 and SEQ ID NO: 74, respectively.

[0298] In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chain CDR or VR of atezolizumab (MPDL3280A). In one embodiment, the anti-PD-L1 antibody V H The region contains the sequence shown in Sequence ID No. 75 (corresponding to Sequence ID No. 20 of U.S. Patent No. 8,217,149), and is the V of the anti-PD-L1 antibody. L The region includes the sequence shown in SEQ ID NO: 76 (corresponding to SEQ ID NO: 21 of U.S. Patent No. 8,217,149). In one embodiment, the anti-PD-L1 antibody is V, which is at least 99% identical to the sequences shown in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 98% identical to the sequences shown in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 97% identical to the sequences shown in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 96% identical to the sequences shown in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. H and V L Includes the region. In one embodiment, the anti-PD-L1 antibody has a smaller sequence than the sequences shown in SEQ ID NO: 75 and SEQ ID NO: 76, respectively. Both are 95% identical. H and V L Includes the region.

[0299] In one embodiment, the anti-PD-L1 antibody is avelumab, also known as MSB0010718C, manufactured by Merck KGaA / EMD Serono, or its antigen-binding fragment, conjugate, or variant. In one embodiment, the anti-PD-L1 antibody is the antibody disclosed in U.S. Patent Application Publication 2014 / 0341917A1, the disclosure of which is specifically incorporated herein by reference. The avelumab monoclonal antibody comprises the heavy chain of SEQ ID NO: 83 and the light chain of SEQ ID NO: 84.

[0300] In one embodiment, the anti-PD-L1 antibody is immunoglobulin G1 lambda-1, anti-(human PD-L1) human monoclonal antibody. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains of avelumab (MSB0010718C). In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains having the sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively, or their antigen-binding fragments, variants, or conjugates. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 99% identical to the sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 98% identical to the sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively. In one embodiment, the anti-PD-L1 antibody comprises the heavy and light chains being at least 97% identical to the sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively. In one embodiment, the anti-PD-L1 antibody comprises a heavy chain and a light chain that are at least 96% identical to the sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively. In another embodiment, the anti-PD-L1 antibody comprises a heavy chain and a light chain that are at least 95% identical to the sequences shown in SEQ ID NO: 83 and SEQ ID NO: 84, respectively.

[0301] In one embodiment, the anti-PD-L1 antibody V H The region contains the sequence given in SEQ ID NO: 85 (corresponding to SEQ ID NO: 24 in U.S. Patent Application Publication No. 2014 / 0341917), and is the V of the anti-PD-L1 antibody. L The region includes the sequence given in SEQ ID NO: 86 (corresponding to SEQ ID NO: 25 in U.S. Patent Application Publication No. 2014 / 0341917). In one embodiment, the anti-PD-L1 antibody is at least 99% identical to the sequences shown in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 98% identical to the sequences shown in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V LIncludes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 97% identical to the sequences shown in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 96% identical to the sequences shown in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V L Includes a region. In one embodiment, the anti-PD-L1 antibody is V, which is at least 95% identical to the sequences shown in SEQ ID NO: 85 and SEQ ID NO: 86, respectively. H and V L Includes the region.

[0302] In one embodiment, the anti-PD-L1 antibody has a heavy chain variable region (V) containing HVR-H1, HVR-H2, and HVR-H3 sequences. H The antibody also contains a light chain variable region (V) containing the HVR-L1, HVR-L2, and HVR-L3 sequences. The HVR-H1 sequence is given by SEQ ID NO: 87 (corresponding to SEQ ID NO: 15 in U.S. Patent Application Publication No. 2014 / 0341917) or a conserved amino acid substitution, the HVR-H2 sequence is given by SEQ ID NO: 88 (corresponding to SEQ ID NO: 16 in U.S. Patent Application Publication No. 2014 / 0341917) or a conserved amino acid substitution, and the anti-PD-L1 antibody also contains a light chain variable region (V) containing the HVR-L1, HVR-L2, and HVR-L3 sequences. L The HVR-L1 sequence is given by SEQ ID NO: 90 (corresponding to SEQ ID NO: 18 in U.S. Patent Application Publication No. 2014 / 0341917) or by a conserved amino acid substitution, and the HVR-L2 sequence is given by SEQ ID NO: 91 (corresponding to SEQ ID NO: 19 in U.S. Patent Application Publication No. 2014 / 0341917) or The HVR-L3 sequence is given by the conservative amino acid substitutions of SEQ ID NO: 92 (corresponding to SEQ ID NO: 20 in U.S. Patent Application Publication No. 2014 / 0341917) or by the conservative amino acid substitutions of that sequence.

[0303] In one embodiment, the anti-PD-L1 antibody is MDX-1105, also known as BMS-935559, which is disclosed in U.S. Patent No. 7,943,743, which is specifically incorporated herein by reference. In one embodiment, the anti-PD-L1 antibody is selected from the anti-PD-L1 antibodies disclosed in U.S. Patent No. 7,943,743, which is specifically incorporated herein by reference.

[0304] In one embodiment, the anti-PD-L1 antibody is a commercially available monoclonal antibody such as INVIVOMAB anti-m-PD-L1 clone 10F.9G2 (BioXCell). Several commercially available anti-PD-L1 antibodies are known to those skilled in the art.

[0305] In one embodiment, the anti-PD-L2 antibody is a commercially available monoclonal antibody such as BIOLEGEND 24F.10C12 mouse IgG2a, κ isotype (Biolegend), anti-PD-L2 antibody (Sigma-Aldrich), or other commercially available anti-PD-L2 antibodies known to those skilled in the art.

[0306] Monoclonal antibodies that inhibit PD-L1 and / or PD-L2 can be prepared by procedures known to those skilled in the art, for example, by injecting a PD-L1 or PD-L2 antigen into a test subject and then isolating hybridomas expressing antibodies having the desired sequence or functional properties. The DNA encoding the monoclonal antibody can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that can specifically bind to the genes encoding the heavy and light chains of the monoclonal antibody). Hybridoma cells serve as a preferred source of such DNA. Once isolated, the DNA can be placed in an expression vector and then transfected into host cells such as E. coli cells, monkey COS cells, Chinese hamster ovary (CHO) cells, myeloma cells, or other suitable cells that do not otherwise produce immunoglobulin proteins to obtain the synthesis of monoclonal antibodies in recombinant host cells. Details of the recombinant production of specific antibodies can be found in the aforementioned references (their disclosures are incorporated herein by reference). Monoclonal antibodies that inhibit PD-1 can be prepared by standard molecular biological methods by backtranslating and inserting the sequences provided herein into a suitable DNA or RNA vector.

[0307] Table 2 summarizes the sequences of the anti-PD-L1 antibodies referenced in the aforementioned embodiments. [Table 3-1] [Table 3-2]

[0308] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and combinations thereof. In one embodiment, the PD-L1 inhibitor is durvalumab (MEDI4736). In one embodiment, the anti-PD-L1 inhibitor is BMS-936559 (also known as MDX-1105-01). In one embodiment, the PD-L1 inhibitor is atezolizumab. In one embodiment, the PD-L1 inhibitor is avelumab.

[0309] In one embodiment, the PD-L2 inhibitor is an anti-PD-L2 antibody. In another embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0310] Interferon (IFN) IFNs induce cellular resistance to viral infection and affect host defense mechanisms and homeostasis. IFNs are small, inducible 20-25K glycosylated proteins that are typically produced by vertebrate cells in response to a variety of biological stimuli. Mechanistically, IFNs mediate the biological activity of target cells by binding to receptors present on the cell surface. Specific ligand-receptor interactions trigger a downstream intracellular signaling cascade, leading to the synthesis of proteins that mediate pleomorphic activity. Based on their structure, physicochemical properties, and biological activity, IFNs are classified into three groups: type I, type II, or type III. In mammals, eight families of type I IFNs have been described. These include IFN-α, IFN-β, IFN-δ, IFN-ε, IFN-κ, IFN-ω, and IFN-τ (IFN-τ). In one embodiment, the IFN of the present invention is interferon alpha or alpha-interferon (IFN-α). In one embodiment, the IFN of the present invention is glycosylated. In another embodiment, the IFN of the present invention is PEGylated.

[0311] In some embodiments, interferon is administered in doses selected from the group consisting of approximately 1 million international units (MU) to approximately 800 MU, approximately 1 MU to approximately 10 MU, approximately 20 MU to approximately 40 MU, approximately 2 MU to approximately 15 MU, approximately 5 MU to approximately 25 MU, approximately 50 MU to approximately 100 MU, approximately 150 MU to approximately 250 MU, approximately 300 MU to approximately 400 MU, and approximately 500 MU to approximately 600 MU.

[0312] In some embodiments, interferon is administered at doses selected from the following groups: approximately 0.1 μg / day to approximately 1 mg / day, approximately 10 μg / day to approximately 200 μg / day, approximately 20 μg / day to approximately 150 μg / day, approximately 0.1 μg / day to approximately 125 μg / day, approximately 1 μg / day to approximately 20 μg / day, and approximately 4.5 μg / day to approximately 30 μg / day.

[0313] In some embodiments, the interferon is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 MU / m 2 It is administered in a dose selected from the group consisting of [specific components].

[0314] In some embodiments, interferon is PEGylated.

[0315] In some embodiments, interferon is glycosylated.

[0316] rIFN-Alpha 2b In one embodiment, IFN is recombinant interferon alpha-2b (rIFN-α2b). In one embodiment, IFN is recombinant interferon alpha-2b with the trade name Intron A, manufactured by Merck Sharp & Dohme Limited. rIFN-alpha-2b is a type I interferon consisting of 165 amino acid residues, with arginine at position 23. This protein is produced by recombinant DNA technology and is similar to interferon secreted by leukocytes. In one embodiment, IFN is an interferon having the sequence shown in Sequence ID No. 93, or a fragment, variant, conjugate, or biosimilar thereof.

[0317] PEGylated rIFN-alpha2b In one embodiment, the IFN is PEGylated rIFN-alpha-2b. In one embodiment, the IFN is PEGylated rIFN-alpha-2b, trade name PEG-Intron, manufactured by Merck Sharp & Dohme Limited. PEGylated rIFN-alpha-2b is derived from the alpha-2b portion of recombinant human interferon. It binds to the human type 1 interferon receptor, activating it and causing dimerization.

[0318] rIFN-Alpha 2a In one embodiment, IFN is recombinant interferon alpha-2a (rIFN-α2a). In one embodiment, IFN is recombinant interferon alpha-2a with the trade name Roferon-A manufactured by Hoffmann La Roche. rIFN-alpha-2a is a type I interferon consisting of 165 amino acid residues with lysine at position 23. This protein is produced by recombinant DNA technology and is similar to interferon secreted by leukocytes. In one embodiment, IFN is an interferon having the sequence shown in Sequence ID No. 94, or a fragment, variant, conjugate, or biosimilar thereof.

[0319] PEGylated rIFN-alpha2a In one embodiment, the IFN is PEGylated rIFN-alpha-2a. In one embodiment, the IFN is PEGylated rIFN-alpha-2a, which has the trade name Pegasys manufactured by Hoffmann La Roche. PEGylated rIFN-alpha-2a is derived from the alpha-2a portion of recombinant human interferon. It binds to the human type 1 interferon receptor, activating it and causing it to dimerize.

[0320] Interferon alpha In one embodiment, IFN is interferon alpha, also known as natural alpha interferon. Interferon alpha contains several naturally occurring IFN-α subtypes and is purified by affinity chromatography. Interferon alpha proteins are primarily involved in the innate immune response to viral infections. There are 13 subtypes called IFN-α1, IFN-α2, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α8, IFN-α10, IFN-α13, IFN-α14, IFN-α16, IFN-α17, and IFN-α21. In one embodiment, IFN is interferon alpha under the trade name Multiferon, manufactured by Swedish Orphan Biovitrim. Multiferon consists of six main subtypes: IFN-α1, IFN-α2, IFN-α8, IFN-α10, IFN-α14, and IFN-α21. Of these, IFN-α2 and IFN-α14 are glycosylated. In one embodiment, IFN is interferon alpha selected from the group consisting of IFN-α1, IFN-α2, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α8, IFN-α10, IFN-α13, IFN-α14, IFN-α16, IFN-α17, IFN-α21, and combinations thereof. In one embodiment, IFN is interferon alpha selected from the group consisting of IFN-α1, IFN-α2, IFN-α8, IFN-α10, IFN-α14, IFN-α21, and combinations thereof. In one embodiment, IFN is IFN-α1. In one embodiment, IFN is interferon having the sequence shown in SEQ ID NO: 95, or a fragment, variant, conjugate, or biosimilar thereof.

[0321] In one embodiment, IFN is IFN-α2. In one embodiment, IFN is an interferon having the sequence shown in SEQ ID NO: 96, or a fragment, variant, conjugate, or biosimilar thereof.

[0322] In one embodiment, IFN is IFN-α8. In one embodiment, IFN is an interferon having the sequence shown in SEQ ID NO: 97, or a fragment, variant, conjugate, or biosimilar thereof.

[0323] In one embodiment, IFN is IFN-α10. In one embodiment, IFN is sequence number An interferon having the sequence shown in No. 98, or a fragment, variant, conjugate, or biosimilar thereof.

[0324] In one embodiment, IFN is IFN-α14. In one embodiment, IFN is an interferon having the sequence shown in SEQ ID NO: 99, or a fragment, variant, conjugate, or biosimilar thereof.

[0325] In one embodiment, IFN is IFN-α21. In one embodiment, IFN is an interferon having the sequence shown in SEQ ID NO: 100, or a fragment, variant, conjugate, or biosimilar thereof.

[0326] Interferon Alpha-Con-1 In one embodiment, IFN is interferon alpha-con-1. Interferon alpha-con-1 is a recombinant, naturally occurring type I interferon. The 166-amino acid sequence of interferon alpha-con-1 was derived by scanning the sequences of several natural interferon alpha subtypes and assigning the most frequently observed amino acids at each corresponding position. Four additional amino acid changes were made to facilitate molecular construction, and the corresponding synthetic DNA sequences were constructed using a chemical synthesis method. Interferon alpha-con-1 differs from interferon alpha-2b by 20 / 166 amino acids (88% homology), and comparison with interferon-beta shows identity at over 30% of amino acid positions. In one embodiment, IFN is interferon alpha-con-1 under the trade name Infergen, manufactured by Three Rivers Pharmaceuticals LLC. In one embodiment, IFN is an interferon, or a fragment, variant, conjugate, or biosimilar thereof, having the sequence shown in SEQ ID NO: 101.

[0327] Interferon alpha-n1 In one embodiment, IFN is interferon alpha-n1, also known as interferon alpha-2 or interferon alpha-A. Interferon alpha-n1 is a purified, naturally occurring (n is natural) glycosylated human interferon alpha protein having 166 residues. In one embodiment, IFN is interferon alpha-n1 under the trade name Wellferon, manufactured by The Wellcome Foundation Ltd. In one embodiment, IFN is interferon, or a fragment, variant, conjugate, or biosimilar thereof, having the sequence shown in SEQ ID NO: 102.

[0328] Interferon alpha-n3 In one embodiment, IFN is interferon alpha-n3. Interferon alpha-n3 is a purified, natural (n is natural) human interferon alpha protein having 166 residues (consisting of three forms or polymorphs, including interferon alpha-2a, 2b, and 2c, as shown in SEQ ID NOs. 103-106, respectively), and is partially glycosylated. In one embodiment, IFN is Hemispherx Interferon alpha-n3 under the trade name Alferon, manufactured by Biopharma. In one embodiment, IFN is interferon having the sequence shown in SEQ ID NO: 103, or a fragment, variant, conjugate, or biosimilar thereof. In one embodiment, IFN is interferon having the sequence shown in SEQ ID NO: 104, or a fragment, variant, conjugate, or biosimilar thereof. In one embodiment, IFN is interferon having the sequence shown in SEQ ID NO: 105, or a fragment, variant, conjugate, or biosimilar thereof. In one embodiment, IFN is interferon having the sequence shown in SEQ ID NO: 106, or a fragment thereof. It is a variant, conjugate, or biosimilar.

[0329] Albuinterferon alpha-2b In one embodiment, IFN is albumin-interferon alpha-2b, also known as albumin-interferon alpha or alb-IFN. Albumin-interferon alpha (Albuferon) is a novel, long-acting form of interferon alpha. In one embodiment, IFN is albumin-interferon alpha-2b under the trade name Albumeron, manufactured by Human Genome Sciences.

[0330] IFN Alpha-2b XL In one embodiment, the IFN is IFN alpha-2b XL, which is called controlled-release interferon alpha-2b manufactured by Avadel Pharmaceuticals.

[0331] BLX-883 In one embodiment, the IFN is BLX-883, also known as Locteron. BLX-883 is a form of alpha-interferon manufactured by Biolex Therapeutics and is currently in clinical trials (NCT00863239, NCT00953589, and NCT00593151).

[0332] AVI-005 In one embodiment, the IFN is AVI-005. AVI-005 is a form of glycosylated interferon alpha-2b manufactured by AviGenics Inc.

[0333] Belerophone In one embodiment, the IFN is bellerophone. Bellerophone is a form of long-acting human interferon alpha manufactured by Nautilus Biotech.

[0334] Cepeg Interferon Alpha-2b In one embodiment, the IFN is Sepeg interferon alpha-2b. Sepeg interferon alpha-2b is a long-acting PEGylated interferon alpha-2b developed by Biocad and currently undergoing clinical trials (NCT01889433).

[0335] PI3K inhibitors The PI3K inhibitor may be any PI3K inhibitor known in the art, particularly one of those described in more detail in the following paragraphs. Preferably, the PI3K inhibitor is selected from the group consisting of PI3K-γ inhibitors, PI3K-δ inhibitors, and PI3K-γ,δ inhibitors. In a particular embodiment, the PI3K inhibitor is a PI3K-δ inhibitor. To avoid doubt, in this specification, references to PI3K inhibitors may refer to a compound or a pharmaceutically acceptable salt, ester, solvate, hydrate, cocrystal, or prodrug.

[0336] In one embodiment, a PI3K inhibitor, preferably selected from the group consisting of PI3K-γ inhibitors, PI3K-δ inhibitors, and PI3K-γ,δ inhibitors, is a compound selected from structures disclosed in U.S. Patent Nos. 8,193,182 and 8,569,323, and U.S. Patent Application Publications 2012 / 0184568, 2013 / 0344061, and 2013 / 0267521, the disclosures of which are incorporated herein by reference.

[0337] In one embodiment, the PI3K-γ,δ inhibitor is a compound of formula (III-A). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof. Formula (III-A), also known as IPI-145 or duvelisiv (Infinity Pharmaceuticals), has been studied in clinical trials at doses of 5 mg and 25 mg, including those described in Flinn, Blood, 2014, 124, 802 and O'Brien, Blood, 2014, 124, 3334.

[0338] In one embodiment, the PI3K inhibitor is a compound of formula (IV). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof.

[0339] In preferred embodiments, the PI3K inhibitor is (S)-3-(1-((9H-purine-6-yl)amino)ethyl)-8-chloro-2-phenylisoquinoline-1(2H)-one or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0340] In one embodiment, the PI3K inhibitor is (S)-3-amino-N-(1-(5-chloro-4-oxo-3-phenyl-3,4-dihydroquinazoline-2-yl)ethyl)pyrazine-2-carboxamide or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0341] In one embodiment, the PI3K inhibitor (which may be a PI3K-γ inhibitor, a PI3K-δ inhibitor, or a PI3K-γ,δ inhibitor) is a compound selected from the structures disclosed in U.S. Patents 8,193,199, 8,586,739, and 8,901,135, the disclosures of which are incorporated herein by reference.

[0342] In one embodiment, the PI3K-δ inhibitor is a compound of formula (IX). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof.

[0343] In one embodiment, the PI3K inhibitor or PI3K-δ inhibitor is (S)-N-(1-(7-fluoro-2-(pyridine-2-yl)quinoline-3-yl)ethyl)-9H-purine-6-amine or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0344] In one embodiment, the PI3K-δ inhibitor is a compound of formula (X). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof.

[0345] In one embodiment, the PI3K inhibitor or PI3K-δ inhibitor is (S)-N-(1-(6-fluoro-3-(pyridine-2-yl)quinoxaline-2-yl)ethyl)-9H-purine-6-amine or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0346] In one embodiment, the PI3K-δ inhibitor is a compound of formula (XI). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof.

[0347] In one embodiment, the PI3K-δ inhibitor is (S)-N-(1-(2-(3,5-difluorophenyl)-8-fluoroquinoline-3-yl)ethyl)-9H-purine-6-amine or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0348] In one embodiment, the PI3K-δ inhibitor is a compound of formula (XII). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof.

[0349] In one embodiment, the PI3K-δ inhibitor is (S)-3-(1-((9H-purine-6-yl)amino)ethyl)-2-(pyridine-2-yl)quinoline-8-carbonitrile or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0350] In one embodiment, the PI3K-δ inhibitor is a compound of formula (XIII). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof.

[0351] In one embodiment, the PI3K-δ inhibitor is (S)-N-(1-(5,7-difluoro-2-(pyridine-2-yl)quinoline-3-yl)ethyl)-9H-purine-6-amine or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0352] In one embodiment, the PI3K inhibitor (which may be a PI3K-γ inhibitor, a PI3K-δ inhibitor, or a PI3K-γ,δ inhibitor) is idelalisib. In one embodiment, the PI3K inhibitor (which may be a PI3K-γ inhibitor, a PI3K-δ inhibitor, or a PI3K-γ,δ inhibitor) is a compound of formula (XVI). [ka] or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug thereof.

[0353] In one embodiment, the PI3K inhibitor (which may be a PI3K-γ inhibitor, a PI3K-δ inhibitor, or a PI3K-γ,δ inhibitor) is (S)-2-(1-((9H-purine-6-yl)amino)propyl)-5-fluoro-3-phenylquinazoline-4(3H)-one or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0354] In one embodiment, the PI3K inhibitor (which may be a PI3K-γ inhibitor, a PI3K-δ inhibitor, or a PI3K-γ,δ inhibitor) is 4(3H)-quinazolinone, 5-fluoro-3-phenyl-2-[(1S)-1-(9H-purine-6-ylamino)propyl]-5-fluoro-3-phenyl-2-{(1S)-1-[(7H-purine-6-yl)amino]propyl}quinazolin-4(3H)-one or a pharmaceutically acceptable salt, solvate, hydrate, cocrystal, or prodrug.

[0355] Other PI3K inhibitors suitable for use in the above-mentioned combinations with BTK inhibitors include, but are not limited to, those described in U.S. Patent No. 8,193,182 and U.S. Publication Applications 2013 / 0267521, 2013 / 0053362, 2013 / 0029984, 2013 / 0029982, 2012 / 0184568, and 2012 / 0059000, in which these disclosures are incorporated in their entirety by reference, respectively.

[0356] Buparisib In one embodiment, the PI3K inhibitor is buparisib. Buparisib has the following chemical structure and name: 5-(2,6-dimorpholine-4-ylpyrimidine-4-yl)-4-(trifluoromethyl)pyridine-2-amine [ka]

[0357] Alpericib In one embodiment, the PI3K inhibitor is alpelisib. Alpelisib has the following chemical structure and name: (2S)-1-N-[4-methyl-5-[2-(1,1,1-trifluoro-2-methylpropan-2-yl)pyridine-4-yl]-1,3-thiazole-2-yl]pyrrolidine-1,2-dicarboxamide [ka]

[0358] pictiv In one embodiment, the PI3K inhibitor is pictilisib. Pictilisib has the following chemical structure and name: 4-[2-(1H-indazole-4-yl)-6-[(4-methylsulfonylpiperazine-1-yl)methyl]thieno[3,2-d]pyrimidine-4-yl]morpholine [ka]

[0359] Piralalisib In one embodiment, the PI3K inhibitor is pyraralisib. Pyraralisib has the following chemical structure and name: 2-amino-N-[3-[[3-(2-chloro-5-methoxyanilino)quinoxaline-2-yl]sulfamoyl]phenyl]-2-methylpropanamide [ka]

[0360] Sonorishibu In one embodiment, the PI3K inhibitor is sonolicib. Sonolicib has the following chemical structure and name: (4S,4aR,5R,6aS,9aR,E)-1-((diallylamino)methylene)-11-hydroxy-4-(methoxymethyl)-4a,6a-dimethyl-2,7,10-trioxo-1,2,4,4a,5,6,6a,7,8,9,9a,10-dodecahydroindeno[4,5-h]isochromen-5-ylacetate [ka]

[0361] Copanlicib In one embodiment, the PI3K inhibitor is copanlisib. Copanlisib has the following chemical structure and name: 2-amino-N-(7-methoxy-8-(3-morpholinopropoxy)-2,3-dihydroimidazo[1,2-c]quinazolin-5-yl)pyrimidine-5-carboxamide [ka]

[0362] CH5132799 In one embodiment, the PI3K inhibitor is CH5132799. CH5132799 has the following chemical structure and name: 5-(7-methylsulfonyl-2-morpholin-4-yl-5,6-dihydropyrrolo[2,3-d]pyrimidine-4-yl)pyrimidine-2-amine [ka]

[0363] Ceravelisib In one embodiment, the PI3K inhibitor is ceravelicib. Ceravelicib is as follows: It has the following chemical structure and name: [6-(2-amino-1,3-benzoxazole-5-yl)imidazo[1,2-a]pyridine-3-yl]-morpholine-4-ylmethanone [ka]

[0364] AZD8186 In one embodiment, the PI3K inhibitor is AZD8186. AZD8186 has the following chemical structure and name: 8-[(1R)-1-(3,5-difluoroanilino)ethyl]-N,N-dimethyl-2-morpholine-4-yl-4-oxochromen-6-carboxamide [ka] SAR260301 In one embodiment, the PI3K inhibitor is SAR260301. SAR260301 has the following chemical structure and name: (S)-2-(2-(2-methylindorin-1-yl)-2-oxoethyl)-6-morpholinopyrimidine-4(3H)-one [ka]

[0365] GSK2636771 In one embodiment, the PI3K inhibitor is GSK2636771. GSK2636771 has the following chemical structure and name: 2-methyl-1-(2-methyl-3-(trifluoromethyl)benzyl)-6-morpholino-1H-benzo[d]imidazole-4-carboxylic acid [ka]

[0366] Idelalisib In one embodiment, the PI3K inhibitor is idelalisib. Idelalisib has the following chemical structure and name: (S)-2-(1-((9H-purine-6-yl)amino)propyl)-5-fluoro-3-phenylquinazoline-4(3H)-one [ka]

[0367] AMG319 In one embodiment, the PI3K inhibitor is AMG319. AMG319 has the following chemical structure and name: N-[(1S)-1-(7-fluoro-2-pyridine-2-ylquinoline-3-yl)ethyl]-7H-purine-6-amine [ka]

[0368] Akarishibu In one embodiment, the PI3K inhibitor is an acalisib. The acalisib has the following chemical structure and name: 6-fluoro-3-phenyl-2-[(1S)-1-(7H-purine-6-ylamino)ethyl]quinazolin-4-one [ka]

[0369] Dubeliev In one embodiment, the PI3K inhibitor is duvelisib. Duvelisib has the following chemical structure and name: 8-Chloro-2-phenyl-3-[(1S)-1-(7H-purine-6-ylamino)ethyl]isoquinoline-1-one [ka]

[0370] Taselicib In one embodiment, the PI3K inhibitor is taselicib. Taselicib has the following chemical structure and name: 2-methyl-2-[4-[2-(5-methyl-2-propan-2-yl-1,2,4-triazole-3-yl)-5,6-dihydroimidazo[1,2-d][1,4]benzoxazepine-9-yl]pyrazole-1-yl]propanamide [ka]

[0371] GDC-0084 In one embodiment, the PI3K inhibitor is GDC-0084. GDC-0084 has the following chemical structure and name: 5-(6,6-dimethyl-4-morpholine-4-yl-8,9-dihydroprino[8,9-c][1,4]oxazin-2-yl)pyrimidine-2-amine [ka]

[0372] AKT inhibitors SB-203580 In one embodiment, the AKT inhibitor is SB-203580. SB-203580 has the following chemical structure and name: 4-[4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-1H-imidazole-5-yl]pyridine [ka]

[0373] MK-2206 In one embodiment, the AKT inhibitor is MK-2206. MK-2206 has the following chemical structure and name: 8-[4-(1-aminocyclobutyl)phenyl]-9-phenyl-2H-[1,2,4]triazolo[3,4-f][1,6]naphthyrizin-3-one [ka]

[0374] SC79 In one embodiment, the AKT inhibitor is SC79. SC79 has the following chemical structure and name: ethyl 2-amino-6-chloro-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate [ka]

[0375] AZD5363 In one embodiment, the AKT inhibitor is AZD5363. AZD5363 has the following chemical structure and name: 4-amino-N-[(1S)-1-(4-chlorophenyl)-3-hydroxypropyl]-1-(7H-pyrrolo[2,3-d]pyrimidine-4-yl)piperidine-4-carboxamide [ka]

[0376] Miltefosine In one embodiment, the AKT inhibitor is miltefosine. Miltefosine has the following chemical structure and name: Hexadecyl 2-(trimethylazaniumyl)ethyl phosphate [ka]

[0377] Perifosine In one embodiment, the AKT inhibitor is perifosin. Perifosin has the following chemical structure and name: (1,1-dimethylpiperidine-1-ium-4-yl)octadecylphosphate [ka]

[0378] PF-04691502 In one embodiment, the AKT inhibitor is PF-04691502. PF-04691502 has the following chemical structure and name: 2-amino-8-[4-(2-hydroxyethoxy)cyclohexyl]-6-(6-methoxypyridine-3-yl)-4-methylpyrido[2,3-d]pyrimidine-7-one [ka]

[0379] CCT128930 In one embodiment, the AKT inhibitor is CCT128930. CCT128930 has the following chemical structure and name: 4-[(4-chlorophenyl)methyl]-1-(7H-pyrrolo[2,3-d]pyrimidine-4-yl)piperidine-4-amine [ka]

[0380] A-674563 In one embodiment, the AKT inhibitor is A-674563. A-674563 has the following chemical structure and name: (2S)-1-[5-(3-methyl-2H-indazole-5-yl)pyridine-3-yl]oxy-3-phenylpropane-2-amine [ka]

[0381] RX-0201 (Alchexin) In one embodiment, the AKT inhibitor is RX-0201 (alcexin). In one embodiment, the AKT inhibitor is an oligodeoxynucleotide having the sequence 5' gctgcatgatctccttggcg 3'.

[0382] PBI-05204 (Oleandrin) In one embodiment, the AKT inhibitor is PBI-05204 (oleandrin). PBI-05204 has the following chemical structure and name: [(3S,5R,8R,9S,10S,13R,14S,16S,17R)-14-hydroxy-3-[(2R,4S,5S,6S)-5-hydroxy-4-methoxy-6-methyloxan-2-yl]oxy-10,13-dimethyl-17-(5-oxo-2H-furan-3-yl)-1,2,3,4,5,6,7,8,9,11,12,15,16,17-tetradecahydrocyclopenta[a]phenanthren-16-yl]acetate [ka]

[0383] AKT inhibitor VIII In one embodiment, the AKT inhibitor is AKT inhibitor VIII. AKT inhibitor VIII has the following chemical structure and name: 3-[1-[[4-(7-fe Nyl-3H-imidazo[4,5-g]quinoxaline-6-yl)phenyl]methyl]piperidine-4-yl]-1H-benzimidazole-2-one [ka]

[0384] AT7867 In one embodiment, the AKT inhibitor is AT7867. AT7867 has the following chemical structure and name: 4-(4-chlorophenyl)-4-[4-(1H-pyrazole-4-yl)phenyl]piperidine [ka]

[0385] AT13148 In one embodiment, the AKT inhibitor is AT13148. AT13148 has the following chemical structure and name: (1S)-2-amino-1-(4-chlorophenyl)-1-[4-(1H-pyrazole-4-yl)phenyl]ethanol [ka]

[0386] GDC-0068 (Ipatasertib) In one embodiment, the AKT inhibitor is GDC-0068 (ipatacertib). GDC-0068 has the following chemical structure and name: (S)-2-(4-chlorophenyl)-1-(4-((5R,7R)-7-hydroxy-5-methyl-6,7-dihydro-5H-cyclopenta[d]pyrimidine-4-yl)piperazin-1-yl)-3-(isopropylamino)propan-1-one [ka]

[0387] TIC10 In one embodiment, the AKT inhibitor is TIC10. TIC10 has the following chemical structure and name: 7-benzyl-4-(2-methylbenzyl)-1,2,6,7,8,9-hexahydroimidazo[1,2-a]pyrido[3,4-e]pyrimidine-5(4H)-one [ka]

[0388] SC79 In one embodiment, the AKT inhibitor is SC79. SC79 has the following chemical structure and name: ethyl 2-amino-6-chloro-4-(1-cyano-2-ethoxy-2-oxoethyl)-4H-chromene-3-carboxylate [ka]

[0389] GSK690693 In one embodiment, the AKT inhibitor is GSK690693. GSK690693 has the following chemical structure and name: 4-[2-(4-amino-1,2,5-oxadiazole-3-yl)-1-ethyl-7-[[(3S)-piperidine-3-yl]methoxy]imidazo[4,5-c]pyridine-4-yl]-2-methylbuta-3-in-2-ol [ka]

[0390] GSK2110183 In one embodiment, the AKT inhibitor is GSK2110183. GSK2110183 has the following chemical structure and name: N-[(2S)-1-amino-3-(3,4-difluorophenyl)propan-2-yl]-5-chloro-4-(4-chloro Ro-2-methylpyrazole-3-yl)thiophene-2-carboxamide [ka] GSK2141795 In one embodiment, the AKT inhibitor is GSK2141795. GSK2141795 has the following chemical structure and name: N-[(2S)-1-amino-3-(3,4-difluorophenyl)propan-2-yl]-5-chloro-4-(4-chloro-2-methylpyrazole-3-yl)furan-2-carboxamide [ka]

[0391] mTOR inhibitors Sirolimus In one embodiment, the mTOR inhibitor is sirolimus. Sirolimus has the following chemical structure and name: (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-Hexadecahydro-9,27-dihydroxy-3-[(1R)-2-[(1S,3R, [4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethyl]-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-23,27-epoxy-3H-pyrido[2,1-c][1,4]oxazacyclohenthriacontin-1,5,11,28,29(4H,6H,31H)-pentone [ka]

[0392] Everolimus In one embodiment, the mTOR inhibitor is everolimus. Everolimus has the following chemical structure and name: (1R,9S,12S,15R,16E,18R,19R,21R,23S,24E,26E,28E,30S,32S,35R)-1,18-dihydroxy-12-{(1R)-2-[(1S,3R,4R)-4-(2hydroxyethoxy)-3-methoxycyclohexyl]-1-methylethyl}-19,30-dimethoxy-15,17,21,23,29,35-hexamethyl-11,36-dioxa-4-aza-tricyclo[30.3.1.04,9]hexatriaconta16,24,26,28-tetraene-2,3,10,14,20-pentaone [ka]

[0393] Temsirolimus In one embodiment, the mTOR inhibitor is temsirolimus. Temsirolimus has the following chemical structure and name: (1R,2R,4S)-4-{(2R)-2-[(3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-6,8,12,14,20,26-hexamethyl-1,5,11,28,29-pentaoxo -1,4,5,6,9,10,11,12,13,14,21,22,23,24,25,26,27,28,29,31,32,33,34,34a-Tetracosahydro-3H-23,27-Epoxypyrido[2,1-c][1,4]oxazacyclohentricontin-3-yl]propyl}-2-methoxycyclohexyl 3-Hydroxy-2-(Hydroxymethyl)-2-methylpropanoate [ka]

[0394] Zotarolimus In one embodiment, the mTOR inhibitor is zotarolimus. Zotarolimus has the following chemical structure and name: (3S,6R,7E,9R,10R,12R,14S,15E,17E,19E,21S,23S,26R,27R,34aS)-9,27-dihydroxy-10,21-dimethoxy-3-{(1R)-2-[(1S,3R,4S)-3-methoxy-4-(1H-tetrazole-1-yl)cyclohexyl]-1-methylethyl}-6, 8,12,14,20,26-Hexamethyl-4,9,10,12,13,14,21,22,23,24,25,26,27,32,33,34,34a-Heptadecahydro-3H-23,27-Epoxypyrido[2,1-c][1,4]Oxazacyclohenthriacontin-1,5,11,28,29(6H,31H)-Pentone [ka]

[0395] Defolimus In one embodiment, the mTOR inhibitor is deforolimus. Defololimus has the following chemical structure and name: (1R,2R,4S)-4-[(2R)-2-[(1R,9S,12S,15R,16E,18R,19R,21R,23S,24E,26E,28Z,30S,32S,35R)-1,18-dihydroxy-19,30-dimethoxy-15,17,21,23,29,35-hexamethyl-2,3,10,14,20-pentaoxo-11,36-dioxa-4-azatricyclo[30.3.1.04,9]hexatriaconta-16,24,26,28-tetraen-12-yl]propyl]-2-methoxycyclohexyldimethylphosphinate [ka] Walt Mannin In one embodiment, the mTOR inhibitor is woltmannin. Woltmannin has the following chemical structure and name: (1S,6bR,9aS,11R,11bR)-1-(methoxymethyl)-9a,11b-dimethyl-3,6,9-trioxo-3,6,6b,7,8,9,9a,10,11,11b-decahydro-1H-flu[4,3,2-de]indeno[4,5-h]isochromen-11-ylacetate [ka]

[0396] Ascomycin In one embodiment, the mTOR inhibitor is ascomycin. Ascomycin has the following chemical structure and name: (3S,4R,5S,8R,9E,12S,14S,15R,16S,18R,19R,26aS)-8-ethyl-5,6,8,11,12,13,14,15,16,17,18,19,24,25,26,26a-hexadecahydro-5,19-dihydroxy-3-[(1E)-2-[(1R,3R,4R)-4-hydroxy-3-methoxycyclohexyl]-1-methylethenyl]-14,16-dimethoxy-4,10,12,18-tetramethyl-15,19-epoxy-3H-pyrido[2,1-c][1,4]oxazazacyclotricosin-1,7,20,21(4H,23H)-tetron [ka]

[0397] Tacrolimus In one embodiment, the mTOR inhibitor is tacrolimus. Tacrolimus has the following chemical structure and name: [3S[3R * [E(1S * ,3S * ,4S * ), 4S * ,5R * ,8S * ,9E,12R * ,14R * ,15S * ,16R * ,18S * ,19S * ,26aR * ]]-5,6,8,11,12,13,14,15,16,17,18,19,24,25,26,26a-Hexadecahydro-5,19-Dihydroxy-3-[2-(4-Hydroxy-3-methoxycyclohexyl)-1-Methylethenyl]-14,16-Dimethoxy-4,10,12,18-Tetramethyl-8-(2-Propenyl)-15,19-Epoxy-3H-Pyrido[2,1-c][1,4]Oxazazacyclotricosin-1,7,20,21(4H,23H)-Tetron [ka]

[0398] KU-0063794 In one embodiment, the mTOR inhibitor is KU-0063794. KU-0063794 has the following chemical structure and name: [5-[2-[(2R,6S)-2,6-dimethylmorpholine-4-yl]-4-morpholine-4-ylpyrido[2,3-d]pyrimidine-7-yl]-2-methoxyphenyl]methanol [ka]

[0399] Sapani Certib In one embodiment, the mTOR inhibitor is sapanicertib. Sapanicertib has the following chemical structure and name: 5-(4-amino-1-propan-2-ylpyrazolo[3,4-d]pyrimidine-3-yl)-1,3-benzoxazole-2-amine [ka]

[0400] AZD8055 In one embodiment, the mTOR inhibitor is AZD8055. AZD8055 has the following chemical structure and name: [5-[2,4-bis[(3S)-3-methylmorpholine-4-yl]pyrido[2,3-d]pyrimidine-7-yl]-2-methoxyphenyl]methanol [ka]

[0401] Biszcertib In one embodiment, the mTOR inhibitor is bistusertib. Bistusertib has the following chemical structure and name: 3-[2,4-bis[(3S)-3-methylmorpholine-4-yl]pyrido[2,3-d]pyrimidine-7-yl]-N-methylbenzamide [ka]

[0402] CC-223 In one embodiment, the mTOR inhibitor is CC-223. CC-223 has the following chemical structure and name: 3-[6-(2-hydroxypropan-2-yl)pyridine-3-yl]-5-(4-methoxycyclohexyl)-7,8-dihydropyrazino[2,3-b]pyrazine-6-one [ka]

[0403] OSI-027 In one embodiment, the mTOR inhibitor is OSI-027. OSI-027 has the following chemical structure and name: 4-(4-amino-5-(7-methoxy-1H-indole-2-yl)imidazo[5,1-f][1,2,4]triazine-7-yl)cyclohexanecarboxylic acid [ka]

[0404] Boxtalic In one embodiment, the mTOR inhibitor is a boxtalisib. The boxtalisib has the following chemical structure and name: N-[4-[[3-(3,5-dimethoxyanilino)quinoxaline-2-yl]sulfamoyl]phenyl]-3-methoxy-4-methylbenzamide [ka]

[0405] Palomide 529 In one embodiment, the mTOR inhibitor is paromide 529. Paromide 529 has the following chemical structure and name: 8-(1-hydroxyethyl)-2-methoxy-3-[(4-methoxyphenyl)methoxy]benzo[c]chromen-6-one [ka]

[0406] PP242 In one embodiment, the mTOR inhibitor is PP242. PP242 has the following chemical structure and name: (2E)-2-(4-amino-1-propan-2-yl-2H-pyrazolo[3,4-d]pyrimidine-3-ylidene)indole-5-ol [ka]

[0407] ductile In one embodiment, the mTOR inhibitor is a ductlicib. The ductlicib has the following chemical structure and name: 2-methyl-2-[4-(3-methyl-2-oxo-8-quinoline-3-ylimidazo[4,5-c]quinoline-1-yl)phenyl]propannitrile [ka]

[0408] BGT226 In one embodiment, the mTOR inhibitor is BGT226. BGT226 has the following chemical structure and name: (Z)-buta-2-enedionic acid; 8-(6-methoxypyridine-3-yl)-3-methyl-1-[4-piperazine-1-yl-3-(trifluoromethyl)phenyl]imidazo[4,5-c]quinoline-2-one [ka]

[0409] Apitricib In one embodiment, the mTOR inhibitor is apitricib. Apitricib has the following chemical structure and name: (2S)-1-[4-[[2-(2-aminopyrimidine-5-yl)-7-methyl-4-morpholine-4-ylthieno[3,2-d]pyrimidine-6-yl]methyl]piperazine-1-yl]-2-hydroxypropan-1-one [ka]

[0410] Omiparisib In one embodiment, the mTOR inhibitor is omiparisib. Omiparisib has the following chemical structure and name: 2,4-difluoro-N-[2-methoxy-5-(4-pyridazine-4-ylquinoline-6-yl)pyridine-3-yl]benzenesulfonamide [ka]

[0411] PF-04691502 In one embodiment, the mTOR inhibitor is PF-04691502. PF-04691502 has the following chemical structure and name: 2-amino-8-[4-(2-hydroxyethoxy)cyclohexyl]-6-(6-methoxypyridine-3-yl)-4-methylpyrido[2,3-d]pyrimidine-7-one [ka]

[0412] Gedatricib In one embodiment, the mTOR inhibitor is gedatricib. Gedatricib has the following chemical structure and name: 1-[4-[4-(dimethylamino)piperidine-1-carbonyl]phenyl]-3-[4-(4,6-dimorpholine-4-yl-1,3,5-triazine-2-yl)phenyl]urea [ka]

[0413] Nucleoside Analog Decitabine In one embodiment, the nucleoside analog is decitabine. Decitabine has the following chemical structure and name: 4-amino-1-[(2R,4S,5R)-4-hydroxy-5-(hydroxymethyl)oxolan-2-yl]-1,3,5-triazine-2-one [ka]

[0414] Cytarabine In one embodiment, the nucleoside analog is cytarabine. Cytarabine has the following chemical structure and name: 4-amino-1-[(2R,3S,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidine-2-one [ka]

[0415] Azacitidine

[0416] In one embodiment, the nucleoside analog is azacitidine. Azacitidine has the following chemical structure and name: 4-amino-1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1,3,5-triazine-2-one [ka]

[0417] Zebralin In one embodiment, the nucleoside analog is zebralin. Zebralin has the following chemical structure and name: 1-[(2R,3R,4S,5R)-3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]pyrimidine-2-one [ka]

[0418] Pharmaceutical composition In some embodiments, the present invention provides a pharmaceutical composition comprising a combination of an MDM2 inhibitor and a therapeutic agent for treating myeloproliferative neoplasms (MPNs), wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In one embodiment, MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mastocell disease (SMCD). In one embodiment, myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, primary myelofibrosis (PMF) is selected from the group consisting of pre-fibrotic / early PMF and overt fibrotic PMF. In one embodiment, MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myeloid leukemia (aCML), juvenile myelomonocytic leukemia (JMML), eosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasms with ring sideroblasts and thrombocytosis (MDS / MPN-RS-T).

[0419] In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II), or a pharmaceutically acceptable salt thereof.

[0420] In one embodiment, the MDM2 inhibitor is a compound of formula (I), formula (II), RG7388, tryptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutriin-3, Nutriin-3a, Nutriin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-16 Selected from the group consisting of 01 and pharmaceutically acceptable salts thereof.

[0421] In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof.

[0422] In one embodiment, the JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel. The group consists of tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, sorucitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

[0423] In one embodiment, the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

[0424] In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

[0425] In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

[0426] In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.

[0427] In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT Inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof.

[0428] In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof.

[0429] In one embodiment, the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, dubelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

[0430] In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

[0431] In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

[0432] In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0433] In one embodiment, the thrombocythemia is essential thrombocythemia (ET).

[0434] In one embodiment, myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0435] polycythemia vera In some embodiments, the present invention relates to a pharmaceutical composition comprising a compound of formula (I) or formula (II), or a pharmaceutically acceptable salt thereof, and a therapeutic agent for treating polycythemia vera, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, and combinations thereof, and the JAK inhibitor is AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, Oclacitinib, Pacritinib, Peficitinib, Pyridone 6, R348, RGB-286638, Ruxolitinib, Ruxolitinib-S, SAR-20347, SB1317, Solcitinib, TG101209, TG101348, Tofacitinib (3R, 4S), Tofacitinib (3S, 4R), The group selected consists of tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof, and the PD-1 inhibitor is nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments and conjugates thereof. The group consists of , or variants, and the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof, the anti-PD-L2 inhibitor is rHIgM12B7A, and the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, or AKT inhibitor VIII. The mTOR inhibitors selected from the group consisting of AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof, are sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP The group selected consists of 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof, with PI3K inhibitors being buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, and SAR26030. 1, selected from the group consisting of GSK2636771, idelalisib, acalisib, duvelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof, the IDH inhibitor is enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, borasidenib, IDH-305, BAY-1436032, GSK864, (R,The present invention provides a pharmaceutical composition in which the interferon is selected from the group consisting of S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enacidenib mesylate, and pharmaceutically acceptable salts thereof, and the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0436] Essential thrombocythemia (ET) In some embodiments, the present invention relates to a pharmaceutical composition comprising a compound of formula (I) or formula (II), or a pharmaceutically acceptable salt thereof, and a therapeutic agent for treating essential thrombocythemia, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, and combinations thereof. The following JAK inhibitors were selected: AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544 NS-018, NSC42834, NVP-BSK805, Oclacitinib, Pacritinib, Peficitinib, Pyridone 6, R348, RGB-286638, Ruxolitinib, Ruxolitinib-S, SAR-20347, SB1317, Solcitinib, TG101209, TG101348, Tofacitinib (3R, 4S), Tofacitinib (3S, 4R), Tofacitinib (3S, 4S), Tofacitinib, TYK2 -The group consists of IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof, and the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof, and the PD-1 inhibitor is atezolizumab The group consists of avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof, and the anti-PD-L2 inhibitor is rHIgM12B7A, and the AKT inhibitors are SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC -0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof were selected from the group of mTOR inhibitors, and the mTOR inhibitors were selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP The group selected consists of 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof, with PI3K inhibitors being buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, and SAR26030. 1, selected from the group consisting of GSK2636771, idelalisib, acalisib, duvelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof, the IDH inhibitor is enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, borasidenib, IDH-305, BAY-1436032, GSK864, (R,The present invention provides a pharmaceutical composition in which the interferon is selected from the group consisting of S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enacidenib mesylate, and pharmaceutically acceptable salts thereof, and the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0437] Myelofibrosis In some embodiments, the present invention relates to a pharmaceutical composition comprising a compound of formula (I) or formula (II), or a pharmaceutically acceptable salt thereof, and a therapeutic agent for treating myelofibrosis, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, and combinations thereof, and the JAK inhibitor is A C-410, AT9283, AZ960, AZD-1480, Baricitinib, BMS-911543, CEP-33779, Celduratinib, CHZ868, CYT387, Decernotinib, ENMD-2076, Filgotinib, Ganetespib, INCB039110, INCB-047986, Itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BS K805, Oclacitinib, Pacritinib, Peficitinib, Pyridone 6, R348, RGB-286638, Ruxolitinib, Ruxolitinib-S, SAR-20347, SB1317, Solcitinib, TG101209, TG101348, Tofacitinib (3R, 4S), Tofacitinib (3S, 4R), Tofacitinib (3S, 4S), Tofacitinib, TYK2-IN-2, Upadacitinib, WHI-P154, WHI-P97, WP The group consists of 1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof, and the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof, and the PD-1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, The group consists of , or variants, and the anti-PD-L2 inhibitor is rHIgM12B7A, and the AKT inhibitors are SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK6 Selected from the group consisting of 90693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof, the mTOR inhibitors are sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP The group selected consists of 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof, with PI3K inhibitors being buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, and SAR26030. 1, selected from the group consisting of GSK2636771, idelalisib, acalisib, duvelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof, the IDH inhibitor is enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, borasidenib, IDH-305, BAY-1436032, GSK864, (R,The present invention provides a pharmaceutical composition in which the interferon is selected from the group consisting of S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enacidenib mesylate, and pharmaceutically acceptable salts thereof, and the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0438] In one embodiment, myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF).

[0439] The pharmaceutical composition is typically formulated to provide a therapeutically effective amount of an MDM2 inhibitor and a therapeutically effective amount of a therapeutic agent, the therapeutic agent being selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. If desired, the pharmaceutical composition contains pharmaceutically acceptable salts and / or their coordination complexes, as well as one or more pharmaceutically acceptable excipients, carriers, e.g., inert solid diluents and fillers, diluents, e.g., sterile aqueous solutions and various organic solvents, osmotic enhancers, solubilizers and adjuvants.

[0440] In selected embodiments, the concentrations of the MDM2 inhibitor and therapeutic agent provided in the pharmaceutical composition of the present invention are independently, for example, 100%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.4%, 0.3%, 0% 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.002%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003 The therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof, in amounts less than %, 0.0002%, or 0.0001% (w / w, w / v, or v / v).

[0441] In selected embodiments, the concentrations of the MDM2 inhibitor and therapeutic agent provided in the pharmaceutical composition of the present invention are independently 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 19.75%, 19.50%, 19.25%, 19%, 18.75%, 18.50%, 18.25%, 18%, 17.75%, 17.50%, 17.25%, 17%, 16.75%, 16.50%, 16.25%, 16%, 15.75%, 15.50%, 15.25%, 15%, 14.75%, 14.50%, 14.25%, 14%, 13.75%, 13.50%, 13.25%. 13%, 12.75%, 12.50%, 12.25% 12%, 11.75%, 11.50%, 11.25% 11%, 10.75%, 10.50%, 10.25% 10%, 9.75%, 9.50%, 9.25% 9%, 8.75%, 8.50%, 8.25% 8%, 7.75%, 7.50%, 7.25% 7%, 6.75%, 6.50%, 6.25% 6%, 5.75%, 5.50%, 5.25% 5%, 4.75%, 4.50%, 4.25%, 4%, 3.75%, 3.50%, 3.25%, 3%, 2.75%, 2.50%, 2.25%, 2%, 1.75%, 1.50%, 125%, 1%, 0.5%, 0.4%, 0.3%, 0.2%, 0.1%, 0.09%, 0.08%, 0.07%, 0.06%, 0.05%, 0.04%, 0.03%, 0.02%, 0.01%, 0.009%, 0.008%, 0.007%, 0.006%, 0.005%, 0.004%, 0.003%, 0.0 If the percentage is higher than 0.2%, 0.001%, 0.0009%, 0.0008%, 0.0007%, 0.0006%, 0.0005%, 0.0004%, 0.0003%, 0.0002%, or 0.0001% (w / w, w / v, or v / v), the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0442] In selected embodiments, the concentrations of the MDM2 inhibitor and the therapeutic agent are independently approximately 0.0001% to 50%, approximately 0.001% to 40%, approximately 0.01% to 30%, approximately 0.02% to 29%, approximately 0.03% to 28%, approximately 0.04% to 27%, approximately 0.05% to 26%, approximately 0.06% to 25%, approximately 0.07% to 24%, approximately 0.08% to 23%, approximately 0.09% to 22%, approximately 0.1% to 21%, approximately 0.2% to 20%, approximately 0.3% to 19%, and approximately 0.4%. The concentration ranges from approximately 18% to 0.5% to 17%, 0.6% to 16%, 0.7% to 15%, 0.8% to 14%, 0.9% to 12%, or 1% to 10% (w / w, w / v, or v / v), and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0443] In selected embodiments, the concentrations of the MDM2 inhibitor and the therapeutic agent are independently in the range of approximately 0.001% to approximately 10%, approximately 0.01% to approximately 5%, approximately 0.02% to approximately 4.5%, approximately 0.03% to approximately 4%, approximately 0.04% to approximately 3.5%, approximately 0.05% to approximately 3%, approximately 0.06% to approximately 2.5%, approximately 0.07% to approximately 2%, approximately 0.08% to approximately 1.5%, approximately 0.09% to approximately 1%, and approximately 0.1% to approximately 0.9% (w / w, w / v, or v / v), and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0444] In selected embodiments, the amounts of the MDM2 inhibitor and the therapeutic agent are independently 10 g, 9.5g, 9.0g, 8.5g, 8.0g, 7.5g, 7.0g, 6.5g, 6.0g, 5.5g, 5.0g, 4.5g, 4.0g, 3.5 g, 3.0g, 2.5g, 2.0g, 1.5g, 1.0g, 0.95g, 0.9g, 0.85g, 0.8g, 0.75g, 0.7g, 0.65 g, 0.6g, 0.55g, 0.5g, 0.45g, 0.4g, 0.35g, 0.3g, 0.25g, 0.2g, 0.15g, 0.1g, 0. 09g, 0.08g, 0.07g, 0.06g, 0.05g, 0.04g, 0.03g, 0.02g, 0.01g, 0.009g, 0.008 The therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof, in amounts equal to or less than g, 0.007g, 0.006g, 0.005g, 0.0004g, 0.0003g, 0.0002g, or 0.0001g.

[0445] In selected embodiments, the amounts of the MDM2 inhibitor and the therapeutic agent are independently 0.0001g, 0.0002g, 0.0003g, 0.0004g, 0.0005g, 0.0006g, 0.0007g, 0.0008g, 0.0009g, 0.001g, 0.0015g, 0.002g, 0.0025g, 0.003g, 0.0035g, 0.004g, 0.00 45g, 0.005g, 0.0055g, 0.006g, 0.0065g, 0.007g, 0.0075g, 0.008g, 0.0085g, 0.009g, 0.0095g, 0. 01g, 0.015g, 0.02g, 0.025g, 0.03g, 0.035g, 0.04g, 0.045g, 0.05g, 0.055g, 0.06g, 0.065g, 0.07g, 0.075g, 0.08g, 0.085g, 0.09g, 0.095g, 0.1g, 0.15g, 0.2g, 0.25g, 0.3g, 0.35g, 0.4g, 0.45g, 0.5g , 0.55g, 0.6g, 0.65g, 0.7g, 0.75g, 0.8g, 0.85g, 0.9g, 0.95g, 1g, 1.5g, 2g, 2.5, 3g, 3.5, 4g, 4.5g, 5 The therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof, in doses of g, 5.5g, 6g, 6.5g, 7g, 7.5g, 8g, 8.5g, 9g, 9.5g, or more than 10g.

[0446] MDM2 inhibitors are effective across a wide dose range. For example, in the treatment of adult humans, independently, doses ranging from 0.01 to 1000 mg, 0.5 to 100 mg, 1 to 50 mg / day, and 5 to 40 mg / day are examples of doses that may be used. The exact dose depends on the route of administration, the form in which the compound is administered, the sex and age of the person being treated, the weight of the person being treated, and the preference and experience of the attending physician.

[0447] Pharmaceutical compositions for oral administration In selected embodiments, the present invention provides a pharmaceutical composition for orally administering a combination comprising an MDM2 inhibitor, a therapeutic agent, and a pharmaceutical excipient suitable for oral administration, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0448] In selected embodiments, the present invention provides a combination of a solid pharmaceutical composition for oral administration comprising (i) an effective amount of an MDM2 inhibitor and a therapeutic agent, and (ii) a pharmaceutical excipient suitable for oral administration, wherein the therapeutic agent is a JAK inhibitor, an IDH inhibitor, a PD-1 inhibitor, a PD-L1 inhibitor, a PD-L2 inhibitor, an interferon, or a PI3K inhibitor. The present invention provides a solid pharmaceutical composition selected from the group consisting of agents, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In selected embodiments, the composition further contains (iii) an effective amount of at least one additional active ingredient.

[0449] In selected embodiments, the pharmaceutical composition may be a liquid pharmaceutical composition suitable for oral administration. Pharmaceutical compositions of the present invention suitable for oral administration may be provided as separate dosage forms, for example, as capsules, cachets, or tablets, or as a liquid or aerosol spray containing predetermined amounts of the active ingredient, respectively, as a powder or granules, a solution, or a suspension in an aqueous or non-aqueous liquid, an oil-in-water emulsion, or a water-in-oil liquid emulsion. Such dosage forms can be prepared by any method, but all methods involve the step of combining the active ingredient with a carrier comprising one or more required components. Generally, compositions are prepared by homogeneously and closely mixing the active ingredient with a liquid carrier or a finely divided solid carrier or both, and then, if necessary, shaping the product into a desired offering form. For example, tablets can be prepared by compression or shaping, optionally together with one or more minor components. Compressed tablets can be prepared by compressing the active ingredient into a fluid form such as a powder or granules, which is optionally mixed with excipients such as binders, lubricants, inert diluents, and / or surfactants or dispersants, in a suitable machine. Molded tablets can be produced by molding a mixture of powdered compounds moistened with an inert liquid diluent in a suitable machine.

[0450] Since water can accelerate the decomposition of some compounds, the present invention further encompasses anhydrous pharmaceutical compositions and dosage forms. For example, in the pharmaceutical art, water (e.g., 5%) may be added as a means of simulating long-term storage to determine characteristics such as shelf life or stability of a formulation over time. The anhydrous pharmaceutical compositions and dosage forms of the present invention can be prepared using anhydrous or low-moisture-containing components and low-moisture or low-humidity conditions. Pharmaceutical compositions and dosage forms of the present invention containing lactose can be anhydrous if substantial contact with moisture and / or humidity is expected during manufacturing, packaging, and / or storage. Anhydrous pharmaceutical compositions may be prepared and stored so as to maintain their anhydrous nature. Therefore, anhydrous compositions may be packaged using materials known to prevent exposure to water, thereby allowing them to be included in suitable formulation kits. Examples of suitable packaging include, but are not limited to, sealed foil, plastic or similar, unit dose containers, blister packs, and strip packs.

[0451] The combination of MDM2 inhibitors and therapeutic agents can be further combined by close mixing with a pharmaceutical carrier according to conventional pharmaceutical formulation techniques, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. The carrier can take various forms depending on the form of the preparation desired for administration. In the preparation of compositions for oral administration, any common pharmaceutical medium can be used as a carrier, such as water, glycol, oil, alcohol, flavoring agents, preservatives, and colorants in the case of oral liquid preparations (e.g., suspensions, solutions, and elixirs) or aerosols, or carriers such as starch, sugar, microcrystalline cellulose, diluents, granulators, lubricants, binders, and disintegrants in the case of oral solid preparations, and in some embodiments, lactose is not used. For example, suitable carriers for solid oral preparations include powders, capsules, and tablets. If desired, tablets can be coated by standard aqueous or non-aqueous techniques.

[0452] Suitable binders for use in pharmaceutical compositions and dosage forms are limited to: However, examples include corn starch, potato starch, or other starches, gelatin, natural and synthetic gums, such as acacia, sodium alginate, alginic acid, other alginates, tragacanth powder, guar gum, cellulose and its derivatives (e.g., ethylcellulose, cellulose acetate, calcium carboxymethylcellulose, sodium carboxymethylcellulose), polyvinylpyrrolidone, methylcellulose, pregelatinized starch, hydroxypropyl methylcellulose, microcrystalline cellulose, and combinations thereof.

[0453] Examples of suitable fillers for use in the pharmaceutical compositions and dosage forms disclosed herein include, but are not limited to, talc, calcium carbonate (e.g., granules or powder), microcrystalline cellulose, powdered cellulose, dextrate, kaolin, mannitol, silicic acid, sorbitol, starch, pregelatinized starch, and combinations thereof.

[0454] A disintegrant may be used in the composition of the present invention to provide a tablet that disintegrates when exposed to an aqueous environment. Too much disintegrant may result in tablets that disintegrate in the bottle. Too little may be insufficient because disintegration alters the rate and extent of release of the active ingredient from the dosage form. Therefore, a sufficient amount of disintegrant, neither too little nor too much, that adversely alters the release of the active ingredient, may be used to form the dosage form of the compounds disclosed herein. The amount of disintegrant used may vary depending on the type of formulation and the mode of administration and may be readily apparent to those skilled in the art. About 0.5 to about 15 weight percent of disintegrant, or about 1 to about 5 weight percent of disintegrant, may be used in the pharmaceutical composition. Disintegrants that can be used to form the pharmaceutical compositions and dosage forms of the present invention include, but are not limited to, agar, alginic acid, calcium carbonate, microcrystalline cellulose, croscarmellose sodium, crospovidone, polaritrin potassium, sodium starch glycolate, potato or tapioca starch, other starches, pregelatinized starch, other starches, clay, other algins, other celluloses, gum, or combinations thereof.

[0455] Lubricants that can be used to form the pharmaceutical compositions and dosage forms of the present invention include, but are not limited to, calcium stearate, magnesium stearate, mineral oil, light mineral oil, glycerin, sorbitol, mannitol, polyethylene glycol, other glycols, stearic acid, sodium lauryl sulfate, talc, hydrogenated vegetable oils (e.g., peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, corn oil, and soybean oil), zinc stearate, ethyl oleate, ethyl laurate, agar, or combinations thereof. Additional lubricants include, for example, thyroid silica gel, synthetic silica coagulation aerosol, or combinations thereof. Lubricants may be optionally added in amounts less than about 1 weight percent of the pharmaceutical composition.

[0456] If an aqueous suspension and / or elixir is desired for oral administration, the essential active ingredient therein may be combined with a diluent such as water, ethanol, propylene glycol, glycerin and various combinations thereof, along with a variety of sweeteners or flavorings, colorants or pigments, and, if so desired, emulsifiers and / or suspending agents.

[0457] Tablets may be uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract, thereby providing a sustained effect over a longer period. For example, time-delaying materials such as glyceryl monostearate or glyceryl distearate can be used. Formulations for oral use also The active ingredient can be provided as a hard gelatin capsule mixed with an inert solid diluent, such as calcium carbonate, calcium phosphate, or kaolin, or as a soft gelatin capsule mixed with water or an oil medium, such as peanut oil, liquid paraffin, or olive oil.

[0458] The surfactants that can be used to form the pharmaceutical compositions and dosage forms of the present invention include, but are not limited to, hydrophilic surfactants, lipophilic surfactants, and combinations thereof. That is, a mixture of hydrophilic surfactants may be used, a mixture of lipophilic surfactants may be used, or a mixture of at least one hydrophilic surfactant and at least one lipophilic surfactant may be used.

[0459] Suitable hydrophilic surfactants generally have an HLB value of at least 10, while suitable lipophilic surfactants generally have an HLB value of about 10 or less. The empirical parameter used to characterize the relative hydrophilicity and hydrophobicity of nonionic amphiphilic compounds is the hydrophilic-lipophilic balance ("HLB" value). Surfactants with lower HLB values ​​are more lipophilic or hydrophobic and have higher solubility in oil, while surfactants with higher HLB values ​​are more hydrophilic and have higher solubility in aqueous solutions. Hydrophilic surfactants are generally considered to be anionic, cationic, or zwitterionic compounds to which the HLB scale is not generally applicable, as well as compounds with an HLB value higher than about 10. Similarly, lipophilic (i.e., hydrophobic) surfactants are compounds with an HLB value equal to or less than about 10. However, the HLB value of a surfactant is simply a rough guide commonly used to enable formulations in industrial, pharmaceutical, and cosmetic emulsions.

[0460] Hydrophilic surfactants may be either ionic or nonionic. Suitable ionic surfactants include, but are not limited to, alkylammonium salts; fusidicates; fatty acid derivatives of amino acids, oligopeptides, and polypeptides; glyceride derivatives of amino acids, oligopeptides, and polypeptides; lecithin and hydrogenated lecithin; lysolecithin and hydrogenated lysolecithin; phospholipids and their derivatives; lysophospholipids and their derivatives; carnitine fatty acid ester salts; alkyl sulfate salts; fatty acid salts; sodium doxate; acylactylates; mono and diacetylated tartaric acid esters of mono and diglycerides; succinylated mono and diglycerides; citrate esters of mono and diglycerides; and combinations thereof.

[0461] Within the group described above, examples of ionic surfactants include lecithin, lysolecithin, phospholipids, lysophospholipids and their derivatives; carnitine fatty acid ester salts; alkyl sulfate salts; fatty acid salts; sodium doxate; acyl lactate; mono and diacetylated tartaric acid esters of mono and diglycerides; succinyl mono and diglycerides; citrate esters of mono and diglycerides; and combinations thereof.

[0462] Ionic surfactants include lecithin, lysolecithin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidic acid, phosphatidylserine, lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylglycerol, lysophosphatidic acid, lysophosphatidylserine, PEG-phosphatidylethanolamine, PVP-phosphatidylethanolamine, lactyl esters of fatty acids, stearoyl-2-lactylate, stearoyl lactylate, succinyl monoglycerides, mono / diacetylated tartaric acid esters of mono / diglycerides, citrate esters of mono / diglycerides, cholyl sarcosine, caproic acid, caprylic acid, capric acid, lauric acid, myristic acid, palmitic acid, oleic acid, ricinoleic acid, linoleic acid, linolenic acid, stearic acid, lauryl sulfate, and teracecytic sulfate. (1 sulfate), doxate, lauroyl carnitine, palmitoyl carnitine, myristoyl carnitine, and ionized forms of salts and combinations thereof may also be used.

[0463] Examples of hydrophilic nonionic surfactants include, but are not limited to, alkyl glucosides; alkyl maltosides; alkyl thioglucosides; lauryl macrogol glycerides; polyoxyalkylene alkyl ethers, e.g., polyethylene glycol alkyl ethers; polyoxyalkylene alkylphenols, e.g., polyethylene glycol alkylphenols; polyoxyalkylene alkylphenol fatty acid esters, e.g., polyethylene glycol fatty acid monoesters and polyethylene glycol fatty acid diesters; polyethylene glycol glycerol fatty acid esters; polyglycerol fatty acid esters; polyoxyalkylene sorbitan fatty acid esters, e.g., polyethylene glycol sorbitan fatty acid esters; hydrophilic transesterification reaction products of polyols with at least one member of the group consisting of glycerides, vegetable oils, hydrogenated vegetable oils, fatty acids, and sterols; polyoxyethylene sterols, their derivatives, and analogs; polyoxyethylated vitamins and their derivatives; polyoxyethylene-polyoxypropylene block copolymers; and combinations thereof; polyethylene glycol sorbitan fatty acid esters and hydrophilic transesterification reaction products of polyols with at least one member of the group consisting of triglycerides, vegetable oils, and hydrogenated vegetable oils. The polyol may be glycerol, ethylene glycol, polyethylene glycol, sorbitol, propylene glycol, pentaerythritol, or a saccharide.

[0464] Other hydrophilic nonionic surfactants include PEG-10 laurate, PEG-12 laurate, PEG-20 laurate, PEG-32 laurate, PEG-32 dilaurate, PEG-12 oleate, PEG-15 oleate, PEG-20 oleate, PEG-20 dioleate, PEG-32 oleate, PEG-200 oleate, PEG-400 oleate, PEG-15 stearate, PEG-32 distearate, PEG-40 stearate, PEG-100 stearate, PEG-20 dilaurate, PEG-25 glyceryl trioleate, PEG-32 dioleate, PEG-20 glyceryl laurate, PEG-30 glyceryl stearate, PEG-20 glyceryl oleate, PEG-30 glyceryl oleate, PEG-30 glyceryl laurate, PEG-40 glyceryl laurate, PEG- 40 Palm kernel oil, PEG-50 hydrogenated castor oil, PEG-40 castor oil, PEG-35 castor oil, PEG-60 castor oil, PEG-40 hydrogenated castor oil, PEG-60 hydrogenated castor oil, PEG-60 corn oil, capric acid / PEG-6 caprylate glyceride, capric acid / PEG-8 caprylate glyceride, polyglyceryl-10 laurate, PEG-30 cholesterol, PEG-25 phytosterol, PEG-30 soybean sterol, PEG-20 trioleate, PEG-40 sorbitan oleate, PEG-80 sorbitan laurate, polysorbate 20, polysorbate 80, POE-9 lauryl ether, POE-23 lauryl ether, POE-10 oleyl ether, POE-20 oleyl ether, POE-20 stearyl ether, PEG-100 tocopheryl succinate, PEG-24 cholesterol, polyglyceryl-10 oleate, Tween 40, Tween 60, sucrose monostearate, sucrose monolaurate, sucrose monopalmitate, PEG Examples include, but are not limited to, the 10-100 nonylphenol series, the PEG 15-100 octylphenol series, and poloxamers.

[0465] Suitable lipophilic surfactants include, but are not limited to, aliphatic alcohols; glycerol fatty acid esters; acetylated glycerol fatty acid esters; lower alcohol fatty acid esters; propylene glycol fatty acid esters; sorbitan fatty acid esters; polyethylene glycol sorbitan fatty acid esters; sterols and sterol derivatives; and polyoxyen Examples of these include chylated sterols and sterol derivatives; polyethylene glycol alkyl ethers; sugar esters; sugar ethers; lactic acid derivatives of mono and diglycerides; hydrophobic transesterification products of polyols with at least one member of the group consisting of glycerides, vegetable oils, hydrogenated vegetable oils, fatty acids, and sterols; oil-soluble vitamins / vitamin derivatives; and combinations thereof. Among these, preferred lipophilic surfactants include glycerol fatty acid esters, propylene glycol fatty acid esters, and combinations thereof, or hydrophobic transesterification products of polyols with at least one member of the group consisting of vegetable oils, hydrogenated vegetable oils, and triglycerides.

[0466] In one embodiment, the composition may contain a solubilizer to ensure good solubilization and / or dissolution of the compound of the present invention and to minimize precipitation of the compound of the present invention. This may be particularly important for compositions for parenteral use, such as compositions for injection. The solubilizer may also be added to increase the solubility of hydrophilic drugs and / or other components, such as surfactants, or to maintain the composition as a stable or homogeneous solution or dispersion.

[0467] Examples of suitable solubilizers include, but are not limited to, alcohols and polyols, e.g., ethanol, isopropanol, butanol, benzyl alcohol, ethylene glycol, propylene glycol, butanediol and its isomers, glycerol, pentaerythritol, sorbitol, mannitol, transktol, dimethyl isosorbide, polyethylene glycol, polypropylene glycol, polyvinyl alcohol, hydroxypropyl methylcellulose and other cellulose derivatives, cyclodextrins and cyclodextrin derivatives; polyethylene glycol ethers having an average molecular weight of about 200 to about 6000, e.g., tetrahydrofurfuryl alcohol PEG ether (glycoflor) or methoxyPEG; amides and other nitrogen-containing compounds, e.g., 2-pyrrolidone, 2-piper Epsilon-caprolactone, ε-caprolactam, N-alkylpyrrolidone, N-hydroxyalkylpyrrolidone, N-alkylpiperidone, N-alkylcaprolactam, dimethylacetamide, and polyvinylpyrrolidone; esters, for example, ethyl propionate, tributyl citrate, triethyl acetyl citrate, tributyl acetyl citrate, triethyl citrate, ethyl oleate, ethyl caprylate, ethyl butyrate, triacetin, propylene glycol monoacetate, propylene glycol diacetate, epsilon-caprolactone and its isomers, δ-valerolactone and its isomers, β-butyrolactone and its isomers; and other solubilizers known in the art, for example, dimethylacetamide, dimethyl isosorbide, N-methylpyrrolidone, monooctanoin, diethylene glycol monoethyl ether, and water.

[0468] Mixtures of solubilizers can also be used. Examples include, but are not limited to, triacetin, triethyl citrate, ethyl oleate, ethyl caprylate, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone, hydroxypropyl methylcellulose, hydroxypropyl cyclodextrin, ethanol, polyethylene glycol 200-100, glycoflor, transktol, propylene glycol, and dimethyl isosorbide. Particularly preferred solubilizers include sorbitol, glycerol, triacetin, ethyl alcohol, PEG-400, glycoflor, and propylene glycol.

[0469] The amount of solubilizer that can be included is not particularly limited. A given amount of solubilizer may be limited to a bioacceptable amount, which can be easily determined by those skilled in the art. In some situations, for example, to maximize the concentration of a drug, it may be advantageous to include an amount of solubilizer far exceeding the bioacceptable amount, and the excess solubilizer can be dissolved using conventional techniques such as distillation or evaporation. It is removed before the composition is provided to the patient. Therefore, if a solubilizer is present, it can be in a weight ratio of 10%, 25%, 50%, 100%, or up to about 200% by weight, based on the combined weight of the drug and other excipients. If desired, very small amounts of solubilizer may also be used, which are, for example, 5%, 2%, 1%, or even less. Typically, the solubilizer may be present in an amount of about 1% to about 100% by weight, more typically about 5% to about 25%.

[0470] The composition may further contain one or more pharmaceutically acceptable additives and excipients. Such additives and excipients include, but are not limited to, detangulating agents, antifoaming agents, buffering agents, polymers, antioxidants, preservatives, chelating agents, viscosity modifiers, isotonic agents, fragrances, colorants, odorants, opacifiers, suspending agents, binders, fillers, plasticizers, lubricants, and combinations thereof.

[0471] Additionally, acids or bases may be incorporated into the composition to facilitate processing, enhance stability, or for other reasons. Examples of pharmaceutically acceptable bases include amino acids, amino acid esters, ammonium hydroxide, potassium hydroxide, sodium hydroxide, sodium bicarbonate, aluminum hydroxide, calcium carbonate, magnesium hydroxide, aluminum magnesium silicate, synthetic aluminum silicate, synthetic hydrocalcite, aluminum magnesium hydroxide, diisopropylethylamine, ethanolamine, ethylenediamine, triethanolamine, triethylamine, triisopropanolamine, trimethylamine, and tris(hydroxymethyl)aminomethane (TRIS). Bases that are salts of pharmaceutically acceptable acids, such as acetic acid, acrylic acid, adipic acid, alginic acid, alkanesulfonic acid, amino acids, ascorbic acid, benzoic acid, boric acid, butyric acid, carbonic acid, citric acid, fatty acids, formic acid, fumaric acid, gluconic acid, hydroquinosulfonic acid, isoascorbic acid, lactic acid, maleic acid, oxalic acid, para-bromophenylsulfonic acid, propionic acid, p-toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, thioglycolic acid, toluenesulfonic acid, and uric acid, are also preferred. Salts of polybasic acids, such as sodium phosphate, disodium hydrogen phosphate, and sodium dihydrogen phosphate, can also be used. When the base is a salt, the cation can be any convenient and pharmaceutically acceptable cation, such as ammonium, alkali metals, and alkaline earth metals. Examples include, but are not limited to, sodium, potassium, lithium, magnesium, calcium, and ammonium.

[0472] Suitable acids are pharmaceutically acceptable organic or inorganic acids. Examples of suitable inorganic acids include hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, nitric acid, boric acid, and phosphoric acid. Examples of suitable organic acids include acetic acid, acrylic acid, adipic acid, alginic acid, alkanesulfonic acid, amino acids, ascorbic acid, benzoic acid, boric acid, butyric acid, carbonic acid, citric acid, fatty acids, formic acid, fumaric acid, gluconic acid, hydroquinosulfonic acid, isoascorbic acid, lactic acid, maleic acid, methanesulfonic acid, oxalic acid, para-bromophenylsulfonic acid, propionic acid, p-toluenesulfonic acid, salicylic acid, stearic acid, succinic acid, tannic acid, tartaric acid, thioglycolic acid, toluenesulfonic acid, and uric acid.

[0473] Pharmaceutical compositions for injection In selected embodiments, the present invention provides a pharmaceutical composition for injection comprising a combination of an MDM2 inhibitor, a therapeutic agent, and a pharmaceutical excipient suitable for injection, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0474] Forms in which the compositions of the present invention may be incorporated for administration by injection include aqueous or oily suspensions or emulsions containing sesame oil, corn oil, cottonseed oil, or peanut oil, as well as elixirs, mannitol, dextrose, or sterile aqueous solutions, and similar pharmaceutical solvents.

[0475] Aqueous solutions in physiological saline are also conventionally used for injection. Ethanol, glycerol, propylene glycol, and liquid polyethylene glycol (and preferred combinations thereof), cyclodextrin derivatives, and vegetable oils can also be used. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin to maintain the required particle size in the case of dispersions, and by the use of surfactants. Prevention of microbial action can be achieved by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal.

[0476] Sterile injectable solutions are prepared by incorporating the required amount of MDM2 inhibitors and therapeutic agents, along with various other components as needed, such as those listed above, into a suitable solvent, followed by sterile filtration. The therapeutic agents are selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Generally, dispersions are prepared by incorporating various sterile active ingredients into a sterile solvent containing a basic dispersion medium and other required components from those listed above. For sterile powders for the preparation of sterile injectable solutions, certain preferred methods of preparation are vacuum drying and freeze-drying techniques, which result in a powder of the active ingredients and any additional desired components from a previously sterile-filtered solution.

[0477] Administration of a combination of an MDM2 inhibitor and a therapeutic agent can be achieved by any method that allows for the delivery of the compound to the site of action, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. These methods include oral routes, intraduodenal routes, parenteral injections (including intravenous, intra-arterial, subcutaneous, intramuscular, intravascular, or infusion), topical applications (e.g., perdermal application), and local delivery by catheter or stent.

[0478] Examples of parenteral administration forms include sterile aqueous solutions, such as solutions or suspensions of the active compound in aqueous propylene glycol or dextrose solutions. Such administration forms can be preferably buffered if desired.

[0479] The present invention also provides a kit. The kit includes an MDM2 inhibitor and a therapeutic agent, either alone or in a preferred combination in packaging, as well as materials which may include instructions for use, a discussion of clinical studies and a list of side effects, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Such a kit may also include information such as references to scientific literature, packaging insert materials, results of clinical trials and / or summaries thereof, which point to or establish the activity and / or benefits of the composition and / or describe dosing, administration, side effects, drug interactions, or other information useful to healthcare providers. Such information may be based on the results of various studies, e.g., studies using experimental animals with in vivo models and studies based on human clinical trials. The kit may further contain another active pharmaceutical ingredient. Suitable packaging for use and additional articles (e.g., measuring cups for liquid preparation and foil wrapping to minimize exposure to air) are provided. The following are publicly known in the art and may be included in the kit. The kits described herein may be offered, sold and / or encouraged to healthcare providers, including physicians, nurses, pharmacists, and prescribing authorities. The kits may also be sold directly to consumers in selected embodiments. In one embodiment, the present invention provides a kit comprising a combination of an MDM2 inhibitor and a therapeutic agent for use in the treatment of MPN, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In one embodiment, MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mastocell disease (SMCD). In one embodiment, myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, primary myelofibrosis (PMF) is selected from the group consisting of pre-fibrotic / early PMF and overt fibrotic PMF. In one embodiment, MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myeloid leukemia (aCML), juvenile myelomonocytic leukemia (JMML), eosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasm with ring sideroblasts and thrombocythemia (MDS / MPN-RS-T).

[0480] Dosage and administration regimen The amount of MDM2 inhibitors and therapeutic agents administered depends independently on the person being treated, the severity of the disorder or condition, the dosage, the nature of the compound, and the prescribing physician's discretion, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. However, the effective dose is in the range of approximately 0.001 to approximately 100 mg / kg body weight / day, for example, approximately 1 to approximately 35 mg / kg / day, in single or divided doses. For a person weighing 70 kg, this corresponds to approximately 0.05 to 7 g / day, for example, approximately 0.05 to approximately 2.5 g / day. In some cases, dose levels lower than the lower limit of the aforementioned range may be more than sufficient, and in other cases, even larger doses may be used without causing any adverse side effects, for example, by dividing such larger doses into several smaller doses for administration throughout the day.

[0481] In some embodiments, the MDM2 inhibitor and therapeutic agent are administered independently in single doses, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. Typically, such administration is done by injection, e.g., intravenous injection, to rapidly deliver the agent. However, other routes may be used as appropriate. Single doses of the MDM2 inhibitor and therapeutic agent may also be used for the treatment of acute conditions, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0482] In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently in multiple doses to treat MPN, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In one embodiment, the MDM2 inhibitor and the JAK inhibitor are administered by injection, for example, The drugs are administered independently in multiple doses by intravenous injection. In one embodiment, administration may be once, twice, three times, four times, five times, six times, or more than six times per day. In one embodiment, administration may be selected from the group consisting of once daily, twice daily, three times daily, four times daily, five times daily, six times daily, once every other day, once weekly, twice weekly, three times weekly, four times weekly, every other week, and monthly. In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently three times a week (including every Monday, Wednesday, and Friday), and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0483] The administration of MDM2 inhibitors and therapeutic agents may be continued independently as needed, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In some embodiments, the MDM2 inhibitor and therapeutic agent are administered independently for longer or more days than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31. In some embodiments, the MDM2 inhibitor and therapeutic agent are administered independently for shorter than 28, 14, 7, 6, 5, 4, 3, 2, or 1 day. In some embodiments, MDM2 inhibitors and therapeutic agents are administered independently for approximately 14, 21, 28, 35, 42, 49, or 56 days. In some embodiments, MDM2 inhibitors and therapeutic agents are administered independently and continuously on a chronic basis, for example, to treat chronic effects. In another embodiment, administration of MDM2 inhibitors and therapeutic agents is continued independently for less than approximately 7 days. In yet another embodiment, administration is continued for approximately 6, 10, 14, 28 days, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, or longer than 1 year. In some embodiments, administration is continued for approximately 1 year, 2 years, 3 years, 4 years, or longer than 5 years. In some embodiments, continuous administration is achieved and maintained for as long as necessary.

[0484] In some embodiments, the effective doses of the MDM2 inhibitor and the therapeutic agent are independently approximately 1 mg to 500 mg, approximately 10 mg to 300 mg, approximately 20 mg to 250 mg, approximately 25 mg to 200 mg, approximately 10 mg to 200 mg, approximately 20 mg to 150 mg, approximately 30 mg to 120 mg, approximately 10 mg to 90 mg, approximately 20 mg to 80 mg, approximately 30 mg to 70 mg, approximately 40 mg to 60 mg, approximately 45 mg to 55 mg, approximately 48 mg to 52 mg, approximately 50 mg to 150 mg, approximately 60 mg to 140 mg, approximately 70 mg to 130 mg, and approximately 80 mg to 120 mg. The dosage ranges from approximately 90mg to 110mg, 95mg to 105mg, 150mg to 250mg, 160mg to 240mg, 170mg to 230mg, 180mg to 220mg, 190mg to 210mg, 195mg to 205mg, or 198mg to 202mg, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof. In some embodiments, the effective dose of the MDM2 inhibitor and therapeutic agent is approximately 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, or 500 mg. In some embodiments, the effective dose of the MDM2 inhibitor or JAK inhibitor is 25 mg, 50 mg, 75 mg, 100 mg, 125 mg, 150 mg, 175 mg, 200 mg, 225 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 375 mg, 400 mg, 425 mg, 450 mg, 475 mg, or 500 mg, and the therapeutic agent is a JAK inhibitor. The drug is selected from the group consisting of agents, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0485] In some embodiments, the effective dose of the MDM2 inhibitor or therapeutic agent is independently approximately 0.01 mg / kg to approximately 4.3 mg / kg, approximately 0.15 mg / kg to approximately 3.6 mg / kg, approximately 0.3 mg / kg to approximately 3.2 mg / kg, approximately 0.35 mg / kg to approximately 2.85 mg / kg, approximately 0.15 mg / kg to approximately 2.85 mg / kg, approximately 0.3 mg to approximately 2.15 mg / kg, approximately 0.45 mg / kg to approximately 1.7 mg / kg, approximately 0.15 mg / kg to approximately 1.3 mg / kg, approximately 0.3 mg / kg to approximately 1.15 mg / kg, approximately 0.45 mg / kg to approximately 1 mg / kg, approximately 0.55 mg / kg to approximately 0.85 mg / kg, approximately 0.65 mg / kg to approximately 0.8 mg / kg, and approximately 0. The ranges are approximately 7 mg / kg to 0.75 mg / kg, 0.7 mg / kg to 2.15 mg / kg, 0.85 mg / kg to 2 mg / kg, 1 mg / kg to 1.85 mg / kg, 1.15 mg / kg to 1.7 mg / kg, 1.3 mg / kg to 1.6 mg / kg, 1.35 mg / kg to 1.5 mg / kg, 2.15 mg / kg to 3.6 mg / kg, 2.3 mg / kg to 3.4 mg / kg, 2.4 mg / kg to 3.3 mg / kg, 2.6 mg / kg to 3.15 mg / kg, 2.7 mg / kg to 3 mg / kg, 2.8 mg / kg to 3 mg / kg, or 2.85 mg / kg to 2.95 mg / kg. In some embodiments, the effective dose of the MDM2 inhibitor or JAK inhibitor is approximately 0.35 mg / kg, approximately 0.7 mg / kg, approximately 1 mg / kg, approximately 1.4 mg / kg, approximately 1.8 mg / kg, approximately 2.1 mg / kg, approximately 2.5 mg / kg, approximately 2.85 mg / kg, approximately 3.2 mg / kg, or approximately 3.6 mg / kg, and the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0486] In some embodiments, the MDM2 inhibitor or a pharmaceutically acceptable salt thereof is administered in doses of 10 to 500 mg BID (including doses of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg BID).

[0487] In some embodiments, the MDM2 inhibitor or a pharmaceutically acceptable salt thereof is administered in doses of 10 to 500 mg QD (including doses of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg QD).

[0488] In some embodiments, interferon is administered in doses selected from the group consisting of approximately 1 million international units (MU) to approximately 800 MU, approximately 1 MU to approximately 10 MU, approximately 20 MU to approximately 40 MU, approximately 2 MU to approximately 15 MU, approximately 5 MU to approximately 25 MU, approximately 50 MU to approximately 100 MU, approximately 150 MU to approximately 250 MU, approximately 300 MU to approximately 400 MU, and approximately 500 MU to approximately 600 MU.

[0489] In some embodiments, interferon is administered at doses selected from the following groups: approximately 0.1 μg / day to approximately 1 mg / day, approximately 10 μg / day to approximately 200 μg / day, approximately 20 μg / day to approximately 150 μg / day, approximately 0.1 μg / day to approximately 125 μg / day, approximately 1 μg / day to approximately 20 μg / day, and approximately 4.5 μg / day to approximately 30 μg / day.

[0490] In some embodiments, interferon is 1, 2, 3, 4, 5, 6, 7, 8, 9, 1 0, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30 MU / m 2 It is administered in a dose selected from the group consisting of [specific components].

[0491] An effective amount of MDM2 inhibitor or therapeutic agent may be administered in single or multiple doses by any acceptable mode of administration of a similarly beneficial agent, including orally, sublingually, and transdermally, by arterial injection, intravenously, parenterally, intramuscularly, subcutaneously, or orally.

[0492] In some embodiments, the MDM2 inhibitor and the therapeutic agent are administered independently to the subject intermittently, as is known as intermittent administration. "Intermittent administration" means that there is a period of administration of a therapeutically effective dose of the MDM2 inhibitor and / or therapeutic agent, followed by a period of discontinuation, then another period of administration, and so on. During each period of administration, the frequency of administration can be independently selected from three times a day, twice a day, every day, once a week, twice a week, three times a week, four times a week, five times a week, six times a week, or monthly. In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II). In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, Triptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutlin-3, Nutlin-3a, Nutlin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, APG-115, MI-1601, and pharmaceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof.In one embodiment, the JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel. The group consists of tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, sorucitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof. In one embodiment, the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A. In one embodiment, the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PB. The group consists of I-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof. In one embodiment, the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, dubelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0493] The term "discontinuation period" or "hibernation period" refers to the length of time during which administration of an MDM2 inhibitor and / or therapeutic agent is discontinued. The discontinuation period may be longer, shorter, or the same as the administration period. For example, if the administration period includes administration three times daily, twice daily, once daily, once weekly, twice weekly, three times weekly, four times weekly, five times weekly, six times weekly, or once monthly, the discontinuation period may be at least approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 1 month, 2 months, 3 months, 4 months, or more. Other therapeutic agents other than the MDM2 inhibitor and therapeutic agent may be administered during the discontinuation period.

[0494] In one embodiment, the MDM2 inhibitor and the therapeutic agent are administered independently to a human subject requiring it to treat a myeloproliferative neoplasm (MPN) for a first administration period, followed by a discontinuation period, followed by a second administration period, and so on. In one embodiment, MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mastocell disease (SMCD). In one embodiment, myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, primary myelofibrosis (PMF) is selected from the group consisting of pre-fibrotic / early PMF and overt fibrotic PMF. In one embodiment, MPN is used for chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myeloid leukemia (aCML), and juvenile myelomonocytic leukemia (JMML). The group is selected from eosinophilia syndrome (HES) and myelodysplastic / myeloproliferative neoplasms with ring sideroblasts and thrombocytopenia (MDS / MPN-RS-T). The first administration period, the second administration period, and the discontinuation period are independently selected from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 1 month, 2 months, 3 months, 4 months and longer, and the MDM2 inhibitor and therapeutic agent are independently administered to the subject three times daily, twice daily, once daily, once weekly, twice weekly, three times weekly, four times weekly, five times weekly, six times weekly, or once monthly. In one embodiment, the first administration period is the same length as the second administration period. In one embodiment, the first administration period is shorter than the second administration period. In one embodiment, the first administration period is longer than the second administration period. In one embodiment, the first and second administration periods are approximately 3 weeks, and the MDM2 inhibitor and therapeutic agent are administered independently to the subject once daily, with discontinuation approximately 2 weeks. In one embodiment, the first and second administration periods are approximately 3 weeks, and the MDM2 inhibitor and therapeutic agent are administered independently to the subject once weekly, with discontinuation approximately 2 weeks. In one embodiment, the first and second administration periods are approximately 4 weeks, and the MDM2 inhibitor and therapeutic agent are administered independently to the subject once daily, with discontinuation approximately 2 weeks. In one embodiment, the first and second administration periods are approximately 4 weeks, and the MDM2 inhibitor and therapeutic agent are administered independently to the subject once weekly, with discontinuation approximately 2 weeks. In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II).In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, tryptride, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutrin-3, Nutrin-3a, Nutrin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof. In one embodiment, the JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel. The group consists of tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, sorucitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.In one embodiment, the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or barriers thereof. The group consists of . In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A. In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof. In one embodiment, the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, dubelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0495] In one embodiment, the MDM2 inhibitor is administered to humans intermittently, while the therapeutic agent is administered to humans non-intermittently. In one embodiment, the therapeutic agent is administered to humans intermittently, while the MDM2 inhibitor is administered to humans non-intermittently. In one embodiment, both the MDM2 inhibitor and the therapeutic agent are administered to humans intermittently. In one embodiment, both the MDM2 inhibitor and the therapeutic agent are administered to humans non-intermittently.

[0496] Treatment methods for myeloproliferative neoplasms (MPNs) In one embodiment, the present invention relates to a method for treating MPN in humans, comprising a therapeutically effective dose of an MDM2 inhibitor and 15 mg QD, 25 mg QD, 30 mg QD, 50 mg QD, 60 mg QD, 75 mg QD, 100 mg QD, 120 mg QD, 150 mg QD, 175 mg QD, 200 mg QD, 225 mg QD, 240 mg QD, 250 mg QD, 275 mg QD, 300 mg QD, 325 mg QD, 350 mg QD, 360 mg QD, 375 mg QD, 480 mg QD, 15 mg BID, 25 mg BID, 30 mg BID, 50 mg BID, 60 mg BID, 75 mg BID, 100 mg BID, 120 mg BID, 150 mg BID, 175 mg BID, 200 mg BID, 225 mg BID, 240 mg The process includes administering a therapeutic agent to the aforementioned human being in a dose independently selected from the group consisting of BID, 250 mg BID, 275 mg BID, 300 mg BID, 325 mg BID, 350 mg BID, 360 mg BID, 375 mg BID, and 480 mg BID. The method is described below. In one embodiment, MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mastocell disease (SMCD). In one embodiment, myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, primary myelofibrosis (PMF) is selected from the group consisting of pre-fibrotic / early PMF and overt fibrotic PMF. In one embodiment, MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myeloid leukemia (aCML), juvenile myelomonocytic leukemia (JMML), eosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasms with ring sideroblasts and thrombocytosis (MDS / MPN-RS-T). In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II). In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, tryptride, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutrin-3, Nutrin-3a, Nutrin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof.In one embodiment, the JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel. The group consists of tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, sorucitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof. In one embodiment, the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A.In one embodiment, the AKT inhibitor is SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT Inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof. The following groups are selected. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof. In one embodiment, the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, dubelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof. In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0497] In one embodiment, the present invention relates to a combination of a therapeutically effective dose of an MDM2 inhibitor and a therapeutic agent for use in the treatment of MPN in humans, wherein the MDM2 inhibitor and therapeutic agent are 15 mg QD, 25 mg QD, 30 mg QD, 50 mg QD, 60 mg QD, 75 mg QD, 100 mg QD, 120 mg QD, 150 mg QD, 175 mg QD, 200 mg QD, 225 mg QD, 240 mg QD, 250 mg QD, 275 mg QD, 300 mg QD, 325 mg QD, 350 mg QD, and 360 mg This relates to combinations of doses administered in amounts independently selected from the group consisting of QD, 375mg QD, 480mg QD, 15mg BID, 25mg BID, 30mg BID, 50mg BID, 60mg BID, 75mg BID, 100mg BID, 120mg BID, 150mg BID, 175mg BID, 200mg BID, 225mg BID, 240mg BID, 250mg BID, 275mg BID, 300mg BID, 325mg BID, 350mg BID, 360mg BID, 375mg BID, and 480mg BID. In one embodiment, MPN is selected from the group consisting of polycythemia vera (PV), myelofibrosis, primary myelofibrosis, thrombocythemia, essential thrombocythemia (ET), idiopathic myelofibrosis, systemic mastocytosis (SM), chronic neutrophilic leukemia (CNL), myelodysplastic syndrome (MDS), and systemic mastocell disease (SMCD). In one embodiment, myelofibrosis is selected from the group consisting of primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (post-PV MF), and post-essential thrombocythemia myelofibrosis (post-ET MF). In one embodiment, primary myelofibrosis (PMF) is selected from the group consisting of pre-fibrotic / early PMF and overt fibrotic PMF. In one embodiment, MPN is selected from the group consisting of chronic neutrophilic leukemia (CNL), chronic eosinophilic leukemia, chronic myelomonocytic leukemia (CMML), atypical chronic myeloid leukemia (aCML), juvenile myelomonocytic leukemia (JMML), eosinophilic syndrome (HES), and myelodysplastic / myeloproliferative neoplasms with ring sideroblasts and thrombocytosis (MDS / MPN-RS-T). In one embodiment, the MDM2 inhibitor is a compound of formula (I) or formula (II). In one embodiment, the MDM2 inhibitor The harmful agents are selected from the group consisting of compounds of formula (I), formula (II), RG7388, tryptolide, HDM201, RG7112, CGM097A, CGM0970B, SJ-172550, SAR405838, MI-773, MX69, YH239-EE, RO8994, Nutrin-3, Nutrin-3a, Nutrin-3b, Serdemetan, NSC59984, CHEMBL2386350, MK-8242, DS-3032, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof. In one embodiment, the MDM2 inhibitor is selected from the group consisting of compounds of formula (I), formula (II), RG7388, HDM201, RG7112, CGM097A, CGM0970B, SAR405838, MK-8242, DS-3032B, RO6839921, APG-115, MI-1601, and pharmaceutically acceptable salts thereof. In one embodiment, the JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, paclitaxel. The group consists of tinib, peficitinib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, sorucitinib, TG101209, TG101348, tofacitinib (3R,4S), tofacitinib (3S,4R), tofacitinib (3S,4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.In one embodiment, the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride. In one embodiment, the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof. In one embodiment, the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof. In one embodiment, the anti-PD-L2 inhibitor is rHIgM12B7A. In one embodiment, the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof. In one embodiment, the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof.In one embodiment, the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, dubelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof. In one embodiment, the IDH inhibitor is enacidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305. The group consists of BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof. In one embodiment, the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof. In one embodiment, the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEGylated interferon-alpha-2a, PEGylated interferon-alpha-2b, PEGylated interferon-alpha-2c, PEGylated interferon-alpha-n1, PEGylated interferon-alpha-n3, and combinations thereof.

[0498] The above method may be used as first-line cancer therapy or after treatment with conventional chemotherapy active pharmaceutical ingredients, including cyclophosphamide, fludarabine (FC chemotherapy), and chlorambucil.

[0499] The combination of MDM2 inhibitors and therapeutic agents may be used in combination with therapies well known to those skilled in the art, such as radiotherapy, hormone therapy, surgery, and immunotherapy. [Examples]

[0500] Embodiments included herein are described below with reference to the following examples. These examples are provided for illustrative purposes only, and the disclosures included herein should not be construed as being limited to these examples, but rather as encompassing any and all variations that become apparent as a result of the teachings provided herein.

[0501] Example 1: Effect of the combination of compound (I) and therapeutic agent on polycythemia vera cells The procedure for testing the efficacy of a combination of compounds of formula (I) and therapeutic agents against polycythemia vera is described in its entirety in Lu, Blood, 2012, 120(15);3098-3105, which is incorporated by reference. The procedure is briefly described below. The therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferons, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

[0502] Cell preparation: Peripheral blood will be obtained from patients with polycythemia vera (PV). Appropriate approval will be obtained from the Institutional Review Board. Informed consent will be obtained prior to the study. All patients will meet the World Health Organization diagnostic criteria for polycythemia vera (PV). Peripheral blood samples will be stratified on Ficoll-Hypaque (1.077 g / mL; GE Healthcare), and low-density mononuclear cells will be separated by centrifugation. CD34+ cells will be isolated using a human CD34+ cell selection kit (StemCell Technologies) according to the manufacturer's instructions. The purity of the CD34+ cell population will be analyzed using a FACSCalibur flow cytometer (BD Biosciences), with a purity of at least 85% required for all experiments. Fresh normal human bone marrow CD34+ cells will be purchased from ALLCELLS as a control.

[0503] HPC assay The effect of the compound of formula (I) on patients with polycythemia vera (PV) can be evaluated by the HPC assay described in Lu, Blood, 2012, 3098-3105, which is incorporated by reference in its entirety. Briefly, CD34+ cells are subjected to a 50 ng / mL stalk assay. Cells are cultured in serum-free medium (StemCell Technologies) containing cytofactor (SCF), 50 ng / mL thrombopoietin (TPO), 50 ng / mL fms-like tyrosine kinase 3 (Flt-3) ligand, and 50 ng / mL IL-3, and treated for 4 days with various doses of the compound of formula (I). After 4 days of treatment, CD34+ cells are assayed in semi-solid medium as described in Bruno, Blood, 2006, 3128-3134, the entirety of which is incorporated by reference. Briefly, 5 × 10⁶ cells per dish are assayed in two strips of medium containing 1 mL of IMDM with 1.1% methylcellulose and 20% FBS. 2 Individual CD34+ cells were seeded, and 50 ng / mL each of SCF, TPO, Flt-3 ligand, IL-3, and GM-CSF, along with 2 U / mL of erythropoietin (EPO), were added. After 14 days of incubation, the colonies were counted, individual colonies were picked, and genotyping for JAK2V617F was performed.

[0504] Nested allele-specific PCR for JAK2V617F-positive colonies Genomic DNA is isolated from randomly selected colonies using Extract-N-Amp Blood PCR Kits (Sigma-Aldrich). JAK2V617F is detected by using nested allele-specific PCR, as described in Bruno, Blood, 2006, 3128-3134, the entire process of which is incorporated by reference. The final PCR product is analyzed on a 2.0% agarose gel. A 279 bp product indicates allele-specific JAK2V617F positivity, while a 229 bp product indicates JAK2V617F negativity. Colonies are classified as homozygous for JAK2V617F if they contain only the 279 bp band, while heterozygous colonies are identified based on the presence of both 279 bp and 229 bp bands.

[0505] Apoptosis assay Collect the treated cells and wash them with PBS for staining with Annexin-V (BD Biosciences). The staining procedure should be carried out according to the protocol provided by the manufacturer. Data should be acquired using a FACSCalibur flow cytometer (BD Biosciences), and at least 10,000 live cells should be obtained for each analysis (BD FACS Diva software; BD Biosciences).

[0506] Western blot analysis CD34+ cells were purified from the peripheral blood of patients with polycythemia vera (PV) and cultured in serum-free medium containing SCF, FL-3 ligand, IL-3, and TPO. The cells were treated with various doses of the compound of formula (I) for 4 hours. The cells were harvested, and whole cell protein extracts were prepared using RIPA lysis buffer (Boston BioProducts) for Western blotting.

[0507] To prepare cytoplasmic and nuclear protein fractions from cells of patients with polycythemia vera (PV), CD34+ cells are expanded for 10 days in serum-free medium containing SCF, FL-3 ligand, and IL-3. The CD34+ cells are then re-purified and treated for 48 hours with various doses of the compound of formula (I) in the presence of SCF, FL-3 ligand, IL-3, and TPO. Protein extracts are prepared using NE-PER nuclear and cytoplasmic extraction reagent (Thermo Scientific) according to the manufacturer's instructions.

[0508] Before Western blotting, all samples were denatured by heating them at 95°C for 5 minutes using Laemmli SDS-sample buffer (Boston BioProducts). Each sample was then separated on an SDS-PAGE gel and transferred to a polyvinyldifluoridine membrane (Bio-Rad). Antibodies (Cell Signaling Technologies) and E We visualized phosphop53, p53, MDM2, p21, p-STAT1, PUMA, and Bak using CL Western blotting reagents (Denville Scientific).

[0509] Example 2. Modeling transformation of JAK2V617F mutant MPN: Role of interferon-alpha and MDM2 inhibition in preventing disease progression. Philadelphia chromosome-negative myeloproliferative neoplasms (PAMLs) are clonal hematological malignancies characterized by increased proliferation of the myeloid lineage, resulting in an abnormally large number of mature blood cells. These include polycythemia vera (PV), essential thrombocythemia (ET), and primary myelofibrosis (PMF). In contrast to PMF, PV and ET are chronic diseases with an average survival time of over 15 years. However, the primary risk is progression to secondary acute myeloid leukemia (sAML), which is associated with a very poor outcome. Hematopoietic stem cells or progenitor cells in MPNs accumulate genetic and epigenetic changes that model the phenotype and promote hematological evolution. The overall genomic picture of sAML is similar to that observed in treatment-related acute myeloid leukemia (tAML) with TP53 mutations. In fact, leukemic transformations in PV and ET have TP53 mutations (mostly loss-of-function mutations) in approximately 35–50% of cases.

[0510] Treatment for sAML is limited to bone marrow transplantation when it develops, and currently available therapies (cytarabine, anthracyclines, hypomethylators, etc.) remain unsuccessful in such cases. Medical treatments for PMF developed to date are, to varying degrees, only for palliative care (JAK2 inhibitors, hypomethylators, hydroxyurea) and do not prevent disease progression.

[0511] We will model myeloproliferation and acute transformation in mouse models having the JAK2V617F mutation and being inactivated or uninactivated with respect to TP53, and in these models, we will test the effects of treatment with interferon-alpha (IFNα), compounds of formula (I) or (II), or a combination of both drugs on disease development.

[0512] To study disease progression in vivo, we will investigate the collaboration of two mutant JAK2 mice with P53 deficiency using a mouse model. We will use inducible KI JAK2V617F mice that develop polycythemia, granulocytosis, and thrombocytemia along with myelofibrosis. The JAK2V617F mutant is expressed in CD45.2 mice after mating with CD45.2 Tg(Vav-cre)A2Kio mice. CD45.2 vav-cre mice mated with JAK2V617F induce MPN in less than 6 weeks and develop myelofibrosis without leukemia at 6 months. These JAK2V617F KI mice and vav-cre mice will be mated with P53 KO mice and then backcrossed in a TP53 KO background to obtain vav-cre / TP53 KO mice on the one hand and JAK2V617F phlox+ / - / TP53 KO mice on the other hand. These two types of mice are crossbred to obtain CD45.2 vav-cre / JAK2V617F / TP53 KO mice.

[0513] The combination of JAK2V617F and P53 KO has already been studied via a retroviral mouse model in which mice develop AML with massive dilation of erythrocyte megakaryocyte precursors. However, these studies used a retroviral mouse model, and subsequently, the expression levels of the transgene varied from clone to clone. The JAK2V617F KI mice used here will be closer to what happens in patients where JAK2V617F is expressed at the same level in all stem cells.

[0514] Bone marrow transplant cells are used to mix normal and mutant cells in mouse recipients. Next, JAK2V617F mouse bone marrow (CD45.2 phenotype), JAK2V Select bone marrow cells from 617F / TP53 KO mice (CD45.2) or normal CD451+2 mice. Healthy mice with the CD45.1 phenotype (WT) will serve as hosts after irradiation. Transplant either JAK2V617F CD45.1 and normal CD451+2 cells in a CD45.2 background, or CD45.1 JAK2V617F / TP53 KO cells with normal CD451+2 cells in CD45.2 irradiated mice. The pathological cell to normal cell ratio is 20 / 80, a ratio previously demonstrated to induce MPN in recipients in less than two months. Transplant 10 mice from one donor, resulting in a 10 transplanted mouse / pathological mouse population. Test a group of 20 mice.

[0515] To measure the effects of IFN alpha, compounds of formula (I) or (II), or combination therapy on the potential effects on malignant clones, transplanted mice are divided into four groups treated on day 15 of BMT (normalization of blood cell counts after transplantation): one with IFN alpha, one with compounds of formula (I) or (II), one with a combination of both drugs, and one using PBS as a control. Chimerism and phenotype (body weight, hematological parameters, etc.) are analyzed weekly (for blood) and at 1, 3, and 6 months for bone marrow chimerism in each stem cell and precursor compartment (SLAM, short-term, precursor). Secondary transplantation is performed if chimerism shows statistically significant modifications in the blood. Monitoring of hematological parameters helps in detecting chronic diseases, namely the PV / MF phase (increase in the number of red blood cells, platelets, etc.) or AML (increase in the number of circulating immature cells). If the treatment modifies chimerism and allows for the selection of normal cells, a lower rate of conversion to AML or an increased proportion of CD451+2 cells that do not convert will be observed in the treated mouse population. Such outcomes indicate that the treatment may reduce or cure the JAK2V617F clone and / or P53 mutant / inactivated JAK2V617F subclones, respectively.

[0516] Example 3: Effect of the combination of compound (I) and decitabine on MPN-BP stem cells Preparation of MPN-BP cells Currently, CD3 from one patient with the WT TP53 gene and MPN-BP + Cell-depleted mononuclear cells (MNCs) have been shown to engraft sequentially in NSG mice and induce leukemia. To collect enough cells to evaluate the effect of the compound of formula (I) and decitabine on MPN-BP stem cells, MPN-BP cells collected from the bone marrow (BM) or spleen of NSG mice will be passaged in NSG mice by serial transplantation. Mutation patterns and karyotype abnormalities present in the cells after serial transplantation will be determined by capture-based next-generation sequencing (NGS) and fluorescence in situ hybridization (FISH).

[0517] The effect of the combination of the compound of formula (I) and decitabine. To investigate the effect of the compound of formula (I) and decitabine on MPN-BP stem cells, 0.5–2 × 10⁶ decitabine was collected from NSG mice given MPN-BP cells. 6 Cells / mice are transplanted into 8-9 week old NSG mice that have been irradiated with a sublethal dose (220 cGy). The mice are then monitored for their overall condition on a daily basis and their body weight measured weekly. Peripheral blood is collected from recipient mice 28 days after transplantation and analyzed using flow cytometry to determine the results of whole blood cell count (CBC) and whether human MPN-BP has developed in these mice. These mice will be used in subsequent studies.

[0518] High-dose studies of compounds of formula (I) or decitabine Three to four mice that develop MPN-BP and have a similar leukemic burden in their peripheral blood were used. Mice will be randomly divided into four groups. Two of these groups will be treated for 7 days by oral gastric tube feeding once daily with either Vehicle or compound (I) (a high dose of either 100 or 150 mg / kg). The other two groups will be treated for 7 days by IP injection three times a week with either Vehicle or decitabine at a dose of 5 mg / kg. Peripheral hemoblast counts will be monitored weekly after treatment using flow cytometry analysis. Tolerance to treatment will be assessed by daily body weight (BW) measurements. These analyses will allow for the establishment of dynamics of MPN-BP return after each drug treatment, which will be used to determine the no-treatment interval for subsequent survival and combination therapy studies.

[0519] Combination therapy with low doses of the compound of formula (I) and decitabine. NSG mice transplanted with MPN-BP cells are randomly assigned to four groups of 4-5 mice each. These mice are treated with the compound of formula (I), decitabine alone, or in combination, as follows: Group 1: compound of formula (I) + PBS, Group 2: vehicle + decitabine, Group 3: compound of formula (I) + decitabine, Group 4: vehicle + PBS. 30-50 mg / kg of compound of formula (I) or vehicle is administered once daily via oral gastric tube for 7 days from days 1 to 7. Decitabine (2.5 mg / kg) or PBS is administered three times a week via IP injection for 7 days. Treatment is repeated for up to 3 cycles. After treatment, survival and disease progression are monitored, and the mice are euthanized and analyzed. After euthanasia, cells are collected from the BM, spleen, and peripheral blood. Human CD45 in these organs is examined. + CD34 + , CD33 + CD14 + Gly A + CD41a + CD19 + , and CD3 + The presence of cells is determined by mAb staining and flow cytometry analysis.

[0520] Example 4: Open-label, multicenter, phase 1b / 2 study of the safety and efficacy of compound I in combination with low-dose cytarabine (LDAC) or decitabine in patients with acute myeloid leukemia (AML). All patients will take the compound of formula I in combination with low-dose cytarabine (LDAC) or decitabine. Dosage formulation for compound of formula I: This compound is formulated as an immediate-release oral solid dosage form in 15 mg and 60 mg tablet strengths. Administration: Compound of formula I should be taken in the morning on an empty stomach (no food or liquid other than water for 2 hours prior to administration), and food and liquid intake (except water) should be avoided for 2 hours after administration. The tablets should not be crushed, chewed, or dissolved in water. Compound of formula I is administered on days 1-7 of each 28-day treatment cycle.

[0521] For cytarabine, LDAC is administered subcutaneously (SC) once daily at a dose of 20 mg / m2 / day on days 1-10 of each 28-day cycle. For decitabine, it is administered intravenously (IV) once daily at a dose of 20 mg / m2 / day on days 1-5 of each 28-day cycle. Test reasoning Part A (Phase 1b): The target population consists of males or females aged 18 years or older with relapsed or refractory AML. Part B (Phase 2): The target population consists of males or females aged 18 years or older with newly diagnosed, relapsed, or refractory AML secondary to myeloproliferative neoplasms (MPNs).

[0522] Experimental treatments All subjects will ingest a compound of formula I in combination with low-dose cytarabine (LDAC) or decitabine.

[0523] Research Design Part A (Phase 1b): The Phase 1b portion of this study follows a 3+3 dose escalation design to determine the recommended Phase 2 dose (PR2D) of compound I for the Phase 2 portion of this study. The principal investigator may assign a subject to either Cohort 1 (LDAC) or Cohort 2 (Decitabine) if there is an open spot for enrollment in that cohort and the subject meets the eligibility criteria for that cohort.

[0524] Dose level 1 (starting dose) of compound I: 20 mg / m² once daily on days 1-10 of each 28-day cycle. 2 In combination with LDAC SC administration per day, 240 mg was orally administered once daily on days 1-7 of each 28-day cycle (Cohort 1A, n=3-6 subjects), or 20 mg / m² was administered once daily on days 1-5 of each 28-day cycle. 2 Decitabine was administered intravenously at a dose of / day (Cohort 2A, n=3-6 subjects).

[0525] If there are no dose-limiting toxicity (DLTs) in the first three subjects enrolled in dose level 1 (cohort 1A or cohort 2A), dose level 2 is opened for that cohort. If there is at least one DLT in the first three subjects enrolled in cohort 1A or cohort 2A, three additional subjects are added to the cohort where the DLT occurred, bringing the total number of subjects in that cohort to six. If there is one or fewer DLTs in the six subjects in the cohort, dose level 2 is opened for that cohort. If there are two or more DLTs in cohort 1A or cohort 2A, a dose level 1 step-down cohort is opened.

[0526] Dose level 1 step-down cohort: 20 mg / m² once daily on days 1-10 of each 28-day cycle. 2In combination with LDAC SC administration per day, 180 mg of the compound of formula I was orally administered once daily on days 1–7 of each 28-day cycle (Cohort 1A-1, n=3–6 subjects), or 20 mg / m2 / day of decitabine was administered intravenously once daily on days 1–5 of each 28-day cycle (Cohort 2A-1, n=3–6 subjects). If there were no DLTs in the first three subjects enrolled in a dose level 1 step-down (Cohort 1A-1 or Cohort 2A-1), the dose level 1 step-down was declared RP2D for that cohort. If there was at least one DLT in the first three subjects enrolled in Cohort 1A-1 or Cohort 2A-1, three additional subjects were added to the cohort in which the DLT occurred, bringing the total number of subjects in that cohort to six. If there is one or fewer DLTs among the 6 subjects in a cohort, a dose level 1 step down is declared the recommended RP2D for that cohort. If there are two or more DLTs in a dose level 1 step down (cohort 1A-1 or cohort 2A-1), that cohort is closed.

[0527] Dosage level 2: 20 mg / m² once daily on days 1-10 of each 28-day cycle. 2 In combination with LDAC SC administration per day, 360 mg of the compound of formula I was orally administered once daily on days 1-7 of each 28-day cycle (Cohort 1B, n=3-6 subjects), or 20 mg / m² once daily on days 1-5 of each 28-day cycle. 2 Decitabine was administered intravenously at a dose of / day (Cohort 2B, n=3-6 subjects). If there are no DLTs in the first three subjects enrolled in dose level 2 (Cohort 1B or Cohort 2B), dose level 3 of the compound of formula I is opened for that cohort. If there is at least one DLT in the first three subjects enrolled in dose level 2 (Cohort 1B or Cohort 2B), three additional subjects are added to the cohort where the DLT occurred, bringing the total number of subjects in that cohort to six. If there is one or fewer DLTs in the six subjects in the cohort, dose level 3 is opened for that cohort. If there are two or more DLTs in Cohort 1B or Cohort 2B, a dose level 2 step-down cohort is opened.

[0528] Dose-level 2 step-down cohort: 20 mg / m² once daily on days 1-10 of each 28-day cycle. 2 In combination with LDAC SC administration per day, 300 mg of the compound of formula I was orally administered once daily on days 1-7 of each 28-day cycle (Cohort 1B-1, n=3-6 subjects), or 20 mg / m² once daily on days 1-5 of each 28-day cycle. 2 Decitabine was administered intravenously at a dose level of 2 / day (Cohort 2B-1, n=3-6 subjects). If there are no DLTs in the first three subjects enrolled in a step-down (cohort 1B-1 or cohort 2B-1), the dose level 2 step-down is declared the RP2D for that cohort. If there is at least one DLT in the first three subjects enrolled in cohort 1B-1 or cohort 2B-1, three additional subjects are added to the cohort where the DLT occurred, bringing the total number of subjects in that cohort to six. If there is one or fewer DLTs in the six subjects in the cohort, the dose level 2 step-down is declared the recommended RP2D for that cohort. If there are two or more DLTs in a dose level 2 step-down (cohort 1B-1 or cohort 2B-1), dose 1 for that cohort is declared the RP2D.

[0529] Dose level 3: Cycle 1 only: 480 mg of the compound of formula I was orally administered once daily on days 1-7 of the first 28-day cycle in combination with LDAC or decitabine. Cycle 2 onwards: 360 mg of the compound of formula I was orally administered once daily on days 1-7 of each 28-day cycle in combination with LDAC or decitabine. 20 mg / m² was administered once daily on days 1-10 of each 28-day cycle. 2 LDAC administered daily to SC (Cohort 1C, n=3-6 subjects), or 20 mg / m² once daily on days 1-5 of each 28-day cycle. 2Decitabine IV / day (Cohort 2C, n=3-6 subjects). If there are no DLTs in the first 3 subjects enrolled in Cohort 1C or Cohort 2C, dose level 3 is considered RP2D for that cohort. If there is at least one DLT in the first 3 subjects enrolled in Cohort 1C or Cohort 2C, 3 additional subjects are added to the cohort where the DLT occurred, bringing the total number of subjects in that cohort to 6. If there is one or fewer DLTs in the 6 subjects in the cohort, that dose is declared RP2D for that cohort. If there are two or more DLTs in Cohort 1C or Cohort 2C, a dose level 3 step-down cohort is opened.

[0530] Dose-level 3 step-down cohort: For cycle 1 only, 420 mg of the compound of formula I was orally administered once daily on days 1–7 of the first 28-day cycle in combination with LDAC or decitabine. From cycle 2 onward: 360 mg of the compound of formula I was orally administered once daily on days 1–7 of each 28-day cycle in combination with LDAC or decitabine. 20 mg / m² was administered once daily on days 1–10 of each 28-day cycle. 2 LDAC SC per day (Cohort 1C-1, n=3-6 subjects), or 20 mg / m² once daily on days 1-5 of each 28-day cycle. 2 Decitabine IV / day (Cohort 2C-1, n=3-6 subjects). If there are no DLTs in the first 3 subjects enrolled in a dose level 3 step-down (Cohort 1C-1 or Cohort 2C-1), the dose level 3 step-down is declared as the RP2D for that cohort. If there is at least one DLT in the first 3 subjects enrolled in Cohort 1C-1 or Cohort 2C-1, 3 additional subjects are added to the cohort where the DLT occurred, bringing the total number of subjects in that cohort to 6. If there is one or fewer DLTs in the 6 subjects in the cohort, the dose level 3 step-down is declared as the recommended RP2D for that cohort. If there are two or more DLTs in a dose level 3 step-down (Cohort 1C-1 or Cohort 2C-1), dose 2 for that cohort is declared as the RP2D.

[0531] The above description is intended to instruct those skilled in the art on how to carry out the present invention and is not intended to describe in detail all obvious modifications and variations that would be apparent to those skilled in the art upon reading the description. However, all such obvious modifications and variations are intended to be included within the scope of the present invention as defined by the following claims. The claims are intended to cover any order of components and steps that are effective in satisfying the intended purpose therein, unless the context specifically indicates a contradiction.

Claims

1. A method for treating myeloproliferative neoplasms (MPNs), comprising administering a therapeutically effective dose of an MDM2 inhibitor in combination with a therapeutic agent to a person in need thereof, wherein the MDM2 inhibitor is a compound of formula (I) or a compound of formula (II). 【Chemistry 1】 or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

2. The method according to claim 1, wherein the MPN is polycythemia vera (PV).

3. The method according to claim 1, wherein the MPN is thrombocytosis.

4. The method according to claim 3, wherein the thrombocytosis is essential thrombocythemia (ET).

5. The method according to claim 1, wherein the MPN is myelofibrosis.

6. The method according to claim 5, wherein the myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (PV-MF), and post-essential thrombocythemia myelofibrosis (ET-MF).

7. The method according to claim 1, wherein the MPN is chronic myeloid leukemia.

8. The method according to claim 1, wherein the MPN is systemic mastocytosis (SM).

9. The method according to claim 1, wherein the MPN is chronic neutrophilic leukemia (CNL).

10. The method according to claim 1, wherein the MPN is myelodysplastic syndrome (MDS).

11. The method according to claim 1, wherein the MPN is mast cell disease (SMCD).

12. The method according to claim 1, wherein the MPN is chronic eosinophilic leukemia.

13. The method according to claim 1, wherein the MPN is chronic myelomonocytic leukemia (CMML).

14. The method according to claim 1, wherein the MPN is atypical chronic myeloid leukemia (aCML).

15. The method according to claim 1, wherein the MPN is juvenile myelomonocytic leukemia (JMML).

16. The method according to claim 1, wherein the MPN is eosinophilia syndrome (HES).

17. The method according to any one of claims 1 to 16, wherein the compound of formula (I) or formula (II) is in crystalline form.

18. The method according to claim 17, wherein the crystalline morphology is characterized by a powder X-ray diffraction pattern comprising at least three peaks at a diffraction angle of 2 theta degrees selected from the group consisting of peaks at approximately 11.6, 12.4, 18.6, 19.0, 21.6, and 23.6 ± 0.

1.

19. The method according to any one of claims 1 to 16, wherein the compound of formula (I) or formula (II) is in a free form.

20. The method according to any one of claims 1 to 16, wherein the compound of formula (I) or formula (II) is in an amorphous form.

21. The method according to any one of claims 1 to 20, wherein the MDM2 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I) or formula (II).

22. The method according to any one of claims 1 to 21, wherein the compound of formula (I) or formula (II) is administered once daily in a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

23. The method according to any one of claims 1 to 21, wherein the compound of formula (I) or formula (II) is administered twice daily in doses selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

24. The method according to any one of claims 1 to 23, wherein the human is treated with an MDM2 inhibitor for a period selected from the group consisting of approximately 14 days, approximately 21 days, approximately 28 days, approximately 35 days, approximately 42 days, approximately 49 days, and approximately 56 days.

25. The method according to any one of claims 1 to 24, wherein the compound of formula (I) or formula (II) is administered orally.

26. The aforementioned JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, and JAK3-I. N-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, Oclacitinib, Pacritinib, Peficitinib, Pyridone 6, R348, RGB-286638, Ruxolitinib, Ruxolitinib-S, SAR-20347, SB1317, Solcitinib, TG101209, TG10134 8. The method according to any one of claims 1 to 25, selected from the group consisting of tofacitinib (3R, 4S), tofacitinib (3S, 4R), tofacitinib (3S, 4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

27. The method according to any one of claims 1 to 25, wherein the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

28. The method according to any one of claims 26 to 27, wherein the JAK inhibitor is administered orally.

29. The method according to claim 1, wherein the MDM2 inhibitor is administered before the administration of the therapeutic agent.

30. The method according to claim 1, wherein the MDM2 inhibitor is administered after the administration of the therapeutic agent.

31. The method according to claim 1, wherein the MDM2 inhibitor is administered simultaneously with the administration of the therapeutic agent.

32. The method according to any one of claims 1 to 31, wherein the therapeutically effective dose of the MDM2 inhibitor is 100 mg.

33. The method according to claim 1, wherein the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

34. The method according to claim 1, wherein the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

35. The method according to claim 1, wherein the anti-PD-L2 inhibitor is rHIgM12B7A.

36. The method according to claim 1, wherein the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT Inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof.

37. The method according to claim 1, wherein the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof.

38. The method according to claim 1, wherein the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

39. The method according to claim 1, wherein the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

40. The method according to claim 1, wherein the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

41. The method according to claim 1, wherein the interferon is selected from the group consisting of interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEG-modified interferon-alpha-2a, PEG-modified interferon-alpha-2b, PEG-modified interferon-alpha-2c, PEG-modified interferon-alpha-n1, PEG-modified interferon-alpha-n3, and combinations thereof.

42. The method according to any one of claims 1 to 41, wherein the MPN in the human subject has the JAK2V617F mutation.

43. A therapeutically effective dose of an MDM2 inhibitor and a therapeutic agent for use in treating myeloproliferative neoplasms (MPNs), wherein the MDM inhibitor is a compound of formula (I) or a compound of formula (II). 【Chemistry 2】 or a pharmaceutically acceptable salt thereof, wherein the therapeutic agent is selected from the group consisting of JAK inhibitors, IDH inhibitors, PD-1 inhibitors, PD-L1 inhibitors, PD-L2 inhibitors, interferon, PI3K inhibitors, AKT inhibitors, mTOR inhibitors, nucleoside analogs, and combinations thereof.

44. The use according to claim 43, wherein the MPN is polycythemia vera (PV).

45. The use according to claim 43, wherein the MPN is thrombocythemia.

46. The use according to claim 45, wherein the thrombocythemia is essential thrombocythemia (ET).

47. The use according to claim 43, wherein the MPN is myelofibrosis.

48. The use according to claim 47, wherein the myelofibrosis is selected from primary myelofibrosis (PMF), post-polycythemia vera myelofibrosis (PV-MF), and post-essential thrombocythemia myelofibrosis (ET-MF).

49. The use according to claim 43, wherein the MPN is chronic myeloid leukemia.

50. The use according to claim 43, wherein the MPN is systemic mastocytosis (SM).

51. The use according to claim 43, wherein the MPN is chronic neutrophilic leukemia (CNL).

52. The use according to claim 43, wherein the MPN is myelodysplastic syndrome (MDS).

53. The use according to claim 43, wherein the MPN is mast cell disease (SMCD).

54. The use according to claim 43, wherein the MPN is chronic eosinophilic leukemia.

55. The use according to claim 43, wherein the MPN is chronic myelomonocytic leukemia (CMML).

56. The use according to claim 43, wherein the MPN is atypical chronic myeloid leukemia (aCML).

57. The use according to claim 43, wherein the MPN is juvenile myelomonocytic leukemia (JMML).

58. The use according to claim 43, wherein the MPN is eosinophilia syndrome (HES).

59. The use according to any one of claims 43 to 58, wherein the compound of formula (I) or formula (II) is in crystalline form.

60. The use according to claim 59, wherein the crystalline morphology is characterized by a powder X-ray diffraction pattern having at least three peaks at a diffraction angle of 2 theta degrees selected from the group consisting of peaks at approximately 11.6, 12.4, 18.6, 19.0, 21.6, and 23.6 ± 0.

1.

61. The use according to any one of claims 43 to 58, wherein the compound of formula (I) or formula (II) is in a free form.

62. The use according to any one of claims 43 to 58, wherein the compound of formula (I) or formula (II) is in an amorphous form.

63. The use according to any one of claims 43 to 62, wherein the MDM2 inhibitor is a pharmaceutically acceptable salt of a compound of formula (I) or formula (II).

64. The use according to any one of claims 43 to 63, wherein the compound of formula (I) or formula (II) is administered once daily in a dose selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

65. The use according to any one of claims 43 to 63, wherein the compound of formula (I) or formula (II) is administered twice daily in doses selected from the group consisting of 15 mg, 25 mg, 30 mg, 50 mg, 60 mg, 75 mg, 100 mg, 120 mg, 150 mg, 175 mg, 200 mg, 225 mg, 240 mg, 250 mg, 275 mg, 300 mg, 325 mg, 350 mg, 360 mg, 375 mg, and 480 mg.

66. The use according to any one of claims 43 to 65, wherein a human is treated with the MDM2 inhibitor for a period selected from the group consisting of approximately 14 days, approximately 21 days, approximately 28 days, approximately 35 days, approximately 42 days, approximately 49 days, and approximately 56 days.

67. The use according to any one of claims 43 to 66, wherein the compound of formula (I) or formula (II) is administered orally.

68. The aforementioned JAK inhibitors are AC-410, AT9283, AZ960, AZD-1480, baricitinib, BMS-911543, CEP-33779, celduratinib, CHZ868, CYT387, desernotinib, ENMD-2076, filgotinib, ganetespib, INCB039110, INCB-047986, itacitinib, JAK3-IN-1, JANEX-1, LFM-A13, LY2784544, NS-018, NSC42834, NVP-BSK805, oclacitinib, pacritinib, and peficitinib. The use according to claim 43, selected from the group consisting of nib, pyridone 6, R348, RGB-286638, ruxolitinib, ruxolitinib-S, SAR-20347, SB1317, solcitinib, TG101209, TG101348, tofacitinib (3R, 4S), tofacitinib (3S, 4R), tofacitinib (3S, 4S), tofacitinib, TYK2-IN-2, upadacitinib, WHI-P154, WHI-P97, WP1066, XL019, ZM39923, and pharmaceutically acceptable salts thereof.

69. The use according to claim 43, wherein the JAK inhibitor is selected from the group consisting of baricitiniburate, CYT387 mesylate, CYT387 sulfate, NS-018 hydrochloride, NS-018 maleate, NVP-BSK805 dihydrochloride, oclacitinib maleate, ruxolitiniburate, ruxolitinib sulfate, tofacitinib citrate, and ZM39923 hydrochloride.

70. The use according to any one of claims 68 to 69, wherein the JAK inhibitor is administered orally.

71. The use according to any one of claims 43 to 67, wherein the MDM2 inhibitor is administered before the administration of the therapeutic agent.

72. The use according to any one of claims 43 to 67, wherein the MDM2 inhibitor is administered after the administration of the therapeutic agent.

73. The use according to any one of claims 43 to 67, wherein the MDM2 inhibitor is administered simultaneously with the administration of the therapeutic agent.

74. The use according to any one of claims 43 to 73, wherein the therapeutically effective dose of the MDM2 inhibitor is 100 mg.

75. The use according to claim 43, wherein the PD-1 inhibitor is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab, AMP-224, AMP-514, PDR001, and fragments, conjugates, or variants thereof.

76. The use according to claim 43, wherein the PD-L1 inhibitor is an anti-PD-L1 antibody. In one embodiment, the PD-L1 inhibitor is selected from the group consisting of atezolizumab, avelumab, durvalumab, BMS-936559, and fragments, conjugates, or variants thereof.

77. The use according to claim 43, wherein the anti-PD-L2 inhibitor is rHIgM12B7A.

78. The use according to claim 43, wherein the AKT inhibitor is selected from the group consisting of SB0203580, MK-2206, AZD5363, miltefosine, perifosine, PF-04691502, CCT128930, A-674563, RX-0201, PBI-05204, AKT Inhibitor VIII, AT7867, AT13148, GDC-0068, TIC10, SC79, GSK690693, GSK2110183, GSK2141795, and pharmaceutically acceptable salts thereof.

79. The use according to claim 43, wherein the mTOR inhibitor is selected from the group consisting of sirolimus, everolimus, temsirolimus, zotarolimus, deforolimus, woltmannin, ascomycin, tacrolimus, KU-0063794, sapanicertib, AZD8055, vistucertib, CC-223, OSI-027, voxtalisib, paromide 529, PP 242, dactricib, BGT226, apitricib, omiparisib, PF-04691502, gedatricib, and pharmaceutically acceptable salts thereof.

80. The use according to claim 43, wherein the PI3K inhibitor is selected from the group consisting of buparisib, alpelisib, pictilisib, piraralisib, sonolicib, copanlisib, CH5132799, cerabelisib, AZD8186, SAR260301, GSK2636771, idelalisib, acalisib, duvelisib, taselicib, AMG319, GDC-0084, and pharmaceutically acceptable salts thereof.

81. The use according to claim 43, wherein the IDH inhibitor is selected from the group consisting of enasidenib, ivosidenib, AGI-5198, AGI-6780, CHEMBL3682093, boracidenib, IDH-305, BAY-1436032, GSK864, (R,S)-ivosidenib, IDH1-IN-2, IDH1-IN-1, enasidenib mesylate, and pharmaceutically acceptable salts thereof.

82. The use according to claim 43, wherein the interferon is selected from the group consisting of interferon alpha (IFN-α), interferon beta (IFN-β), interferon lambda (IFN-λ), interferon gamma (IFN-γ), and combinations thereof.

83. The interferon is interferon-alpha-2a, interferon-alpha-2b, interferon-alpha-2c, interferon-alpha-n1, interferon-alpha-n3, PEG-modified interferon-alpha-2a, PEG-modified interferon-alpha-2b, PEG-modified interferon-alpha-2c, PEG-modified interferon-alpha-n1, PEG-modified interferon-alpha- The use according to claim 43, selected from the group consisting of n3 and combinations thereof.

84. The use according to any one of claims 43 to 83, wherein the MPN in a human subject has the JAK2V617F mutation.

Images