Immunogenic compositions against influenza and RSV

Abstract

The present disclosure relates to compositions comprising RNA molecules encoding influenza-derived antigens, where the RNA may be formulated in lipid nanoparticles (LNPs), and the compositions further comprise a polypeptide antigen derived from respiratory syncytial virus (RSV) and / or an RNA molecule encoding an antigen derived from RSV, where the RSV RNA may be formulated in LNPs. The present disclosure further relates to the use of RNA molecules, RNA-LNPs, and compositions for the prevention of influenza and RSV infection-induced illnesses.

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to each of the following applications, the disclosures of each of which are incorporated by reference in their entirety herein: U.S. Provisional Patent Application No. 63 / 431,743, filed December 11, 2022; U.S. Provisional Patent Application No. 63 / 480,099, filed January 16, 2023; U.S. Provisional Patent Application No. 63 / 484,746, filed February 13, 2023; U.S. Provisional Patent Application No. 63 / 496,395, filed April 15, 2023; U.S. Provisional Patent Application No. 63 / 507,755, filed June 13, 2023; U.S. Provisional Patent Application No. 63 / 587,036, filed September 29, 2023; and U.S. Provisional Patent Application No. 63 / 602,567, filed November 24, 2023.

[0002] Field The present disclosure relates to compositions and methods for the preparation, manufacture, and therapeutic use of ribonucleic acid vaccines comprising polynucleotide molecules encoding one or more influenza antigens, e.g., hemagglutinin (HA) and / or any one of the following antigens: neuraminidase (NA), nucleoprotein (NP), matrix protein 1 (M1), matrix protein 2 (M2), nonstructural protein 1 (NS1), and nonstructural protein 2 (NS2); the compositions, methods, and uses further comprise antigens derived from respiratory syncytial virus (RSV) polypeptides and / or polynucleotide molecules encoding RSV antigens. [Background technology]

[0003] Influenza viruses are members of the orthomyxoviridae family and are classified into three types (A, B, and C) based on antigenic differences between their nucleoprotein (NP) and matrix (M) proteins. A challenge with therapy and prevention against influenza and other infectious diseases using traditional vaccines is the limited scope of vaccines, which only provide protection against closely related subtypes. Additionally, the length of time required to complete the current standard influenza virus vaccine production process inhibits the rapid development and production of adapted vaccines in pandemic situations. A need exists for improved immunogenic compositions against influenza.

[0004] Respiratory syncytial virus (RSV) is a respiratory virus that infects the lungs and respiratory tract. RSV is a leading cause of severe viral lower respiratory tract illness in infants worldwide and an important cause of respiratory illness in the elderly. However, no vaccine is approved to prevent RSV infection.

[0005] RSV is a member of the Paramyxoviridae family. Its genome consists of a single-stranded, negative-sense RNA molecule encoding 11 proteins, including nine structural proteins (three glycoproteins and six internal proteins) and two nonstructural proteins. The structural proteins include three transmembrane surface glycoproteins: the attachment protein G, the fusion protein F, and a small hydrophobic SH protein. There are two subtypes of RSV, A and B. They differ primarily in the G glycoprotein, while the sequence of the F glycoprotein is more conserved between the two subtypes. The mature F glycoprotein has three common domains: the ectodomain (ED), the transmembrane domain (TM), and the cytoplasmic tail (CT). The CT contains a single palmitoylated cysteine ​​residue. The human RSV F glycoprotein is initially translated from mRNA as a single 574-amino acid polypeptide precursor (referred to as "F0" or "F0 precursor") containing a signal peptide sequence (amino acids 1-25) at the N-terminus. During translation, the signal peptide is removed by signal peptidase in the endoplasmic reticulum. The remaining portion of the F precursor (i.e., residues 26-574) can be further cleaved at two polybasic sites (aa 109 / 110 and 136 / 137) by cellular proteases (specifically furin), removing the 27-amino acid intervening sequence designated pep27 (aa 110-136) and generating two linked fragments designated F1 (C-terminal portion; aa 137-574) and F2 (N-terminal portion; aa 26-109). F1 contains a hydrophobic fusion peptide at its N-terminus and two heptad repeat regions (HRA and HRB). HRA is close to the fusion peptide, and HRB is close to the TM domain. The F1 and F2 fragments are linked to each other through two disulfide bonds. Either the uncleaved F0 protein or the F1-F2 heterodimer without the signal peptide sequence can form the RSV F promoter. Three such promoters assemble to form the final RSV F protein complex, which is a homotrimer of three promoters.Subtypes A and B of the F protein are approximately 90 percent identical in amino acid sequence. An example of the F precursor polypeptide sequence for the A subtype is provided in SEQ ID NO:1 (strain A2; GenBank GI:138251; Swiss Prot P03420), and an example for the B subtype is provided in SEQ ID NO:2 (strain 18537; GenBank GI:138250; Swiss Prot P13843). SEQ ID NO:1 and SEQ ID NO:2 are both 574 amino acid sequences. The signal peptide sequence for SEQ ID NO:1 and SEQ ID NO:2 is also reported as amino acids 1-25 (GenBank and UniProt). In both sequences, the TM domain is approximately amino acids 530-550, but is alternatively reported as 525-548. The cytoplasmic tail begins at either amino acid 548 or 550 and ends at amino acid 574, with a palmitoylated cysteine ​​residue located at amino acid 550. The RSV F protein is the primary antigen under consideration for RSV vaccines. The RSV F protein trimer mediates fusion between the virion membrane and the host cell membrane and also promotes syncytium formation. In the virion before fusion with the host cell membrane, the largest group of F molecules forms a lollipop-shaped structure, and the TM domain is anchored to the viral envelope. This conformation is referred to as the pre-fusion conformation. Pre-fusion RSV F is recognized by monoclonal antibodies (mAb) D25, AM22, and MPE8 without distinguishing between oligomeric states. Pre-fusion F trimers are specifically recognized by mAb AM14. During RSV cell entry, the F protein rearranges from the pre-fusion state (sometimes referred to herein as "pre-F") to the post-fusion state ("post-F") through an intermediate, unfolded structure. During this rearrangement, the C-terminal coiled coil of the pre-fusion molecule dissociates into its three constituent strands, then wraps around the globular head and joins with three additional helices to form a post-fusion six-helix bundle. The pre-fusion RSV F trimer undergoes structural changes when subjected to increasingly harsh chemical or physical conditions, such as elevated temperatures.First, there is a loss of trimeric structure (at least locally within the molecule), followed by rearrangement to the post-fusion form, and then domain denaturation. To prevent viral entry, F-specific neutralizing antibodies must likely bind to the pre-fusion conformation of F on the virion, or potentially to an unfolded intermediate, before the viral envelope fuses with the cellular membrane. Therefore, the pre-fusion form of the F protein is considered the preferred conformation for a desired vaccine antigen. RSV F protein mutants have been developed to increase the stability of the pre-fusion form (see, for example, PCT Application No. 2017 / 109629) and are promising vaccine candidates. RSV vaccines incorporating F protein antigens are currently under development. Clinical studies have shown that some F protein subunit-based vaccine candidates are safe and immunogenic, although improvements in protective efficacy and durability of protection are desirable. Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, there is a need for improved immunogenic compositions to protect against both RSV infection and influenza. [Means for solving the problem]

[0007] The present disclosure describes, among other things, compositions and methods that satisfy these unmet needs. In one aspect, the present disclosure provides a composition comprising one or more RNAs, each comprising a nucleotide sequence encoding one or more antigenic polypeptides associated with influenza, wherein the compositions disclosed herein further comprise one or more antigenic polypeptides associated with respiratory syncytial virus (RSV). In some embodiments, the composition comprises one or more RNAs each encoding a RSV polypeptide. In some embodiments, the composition comprises one or more RSV polypeptides. In some embodiments, the composition comprises one or more RNAs each encoding a RSV F protein, a variant thereof, or an immunogenic fragment of the RSV F protein or variant thereof. In some embodiments, the composition comprises one or more RSV F proteins, immunogenic variants thereof, or immunogenic fragments of the RSV F protein or variant thereof. In some embodiments, the compositions described herein comprise: (i) one or more RNAs each encoding a polypeptide of a RSV subtype A virus (e.g., an F protein, a variant thereof, or an immunogenic fragment of an F protein or variant thereof), and one or more RNAs each encoding a polypeptide of a RSV subtype B virus (e.g., an F protein, a variant thereof, or an immunogenic fragment of an F protein or variant thereof); or (ii) one or more polypeptides of a RSV subtype A virus (e.g., an F protein, a variant thereof, or an immunogenic fragment of an F protein or variant thereof), and one or more polypeptides of a RSV subtype B virus (e.g., an F protein, a variant thereof, or an immunogenic fragment of an F protein or variant thereof). In some embodiments, the RSV F protein, variant, or immunogenic fragment is stabilized in a pre-fusion conformation. In some embodiments, the composition comprises or describes RSVpreF (also known as Abrysvo™) and Arexvy™.

[0008] In some embodiments, the composition comprises one or more RNAs each encoding a polypeptide of a first infectious agent; and one or more polypeptides of a second infectious agent. In some embodiments, the composition comprises one or more polypeptides of an influenza virus. In some embodiments, the composition comprises one or more polypeptides of one or more influenza viruses (e.g., one or more polypeptides of two or more influenza virus strains (e.g., one or more polypeptides of four or more influenza virus strains that are prevalent or predicted to be prevalent in the relevant region)). In some embodiments, the composition comprises a commercially available influenza virus vaccine (e.g., a recombinant commercially available influenza virus vaccine or an inactivated influenza virus vaccine). In some embodiments, the commercially available influenza virus vaccine is Flublok or Fluzone. In some embodiments, the composition comprises one or more polypeptides derived from RSV. In some embodiments, the composition comprises one or more polypeptides associated with a first RSV subtype and one or more polypeptides associated with a second RSV subtype. In some embodiments, the composition comprises one or more RSV F proteins, variants thereof, or immunogenic fragments of the RSV F protein or variants thereof. In some embodiments, the composition comprises a RSV F protein comprising one or more mutations that stabilize the pre-fusion conformation of the F protein. In some embodiments, the composition comprises Arexvy™ or ABRYSVO™.

[0009] In some embodiments, the composition comprises one or more RNAs each encoding one or more polypeptides derived from an influenza virus, a variant thereof, or an immunogenic fragment thereof; and one or more RSV F pre-fusion stabilized proteins. In some embodiments, the composition comprises a RSV vaccine comprising a pre-fusion stabilized F protein (e.g., a RSV vaccine described herein (e.g., Arexvy™ or ABRYSVO™)).

[0010] In some embodiments, the combination includes an influenza vaccine and an RSV vaccine, each of which is provided in a separate container (e.g., a separate vial and / or syringe). In some embodiments, the combination includes (a) an influenza vaccine provided in a single container and an RSV vaccine provided in separate containers.

[0011] In some embodiments, the combination includes a RSV vaccine comprising a pre-fusion stabilized F protein (e.g., a RSV vaccine described herein (e.g., RSVpreF or ABRYSVO™)).

[0012] In one aspect, the present disclosure provides a composition comprising: (i) a first ribonucleic acid (RNA) polynucleotide comprising an open reading frame encoding a first antigen, wherein the antigen comprises at least one influenza virus antigen polypeptide or an immunogenic fragment thereof and is formulated in a lipid nanoparticle (LNP); and (ii) a first RSV F protein trimer in a pre-fusion conformation. In some embodiments, the RNA-LNP element and the RSV polypeptide element are present in the composition as a combination, e.g., as an admixture, such that two or more elements are mixed together to form a combination. For purposes of this disclosure, "admixture" refers to a mixture of two or more compounds at any time before, after, or following administration. In some embodiments, the composition further comprises (iii) a second RNA polynucleotide comprising an open reading frame encoding a second antigen, wherein the second antigen comprises at least one influenza virus antigen polypeptide or an immunogenic fragment thereof. In some embodiments, the antigen comprises hemagglutinin (HA), or an immunogenic fragment or variant thereof. In some embodiments, the antigens each comprise HA or an immunogenic fragment thereof derived from a different influenza virus subtype. In some embodiments, the composition further comprises a third RNA polynucleotide comprising an open reading frame encoding an antigen comprising at least one influenza virus antigen polypeptide or an immunogenic fragment thereof. In some embodiments, the third antigen is derived from an influenza virus strain different from that of both the first and second antigens. In some embodiments, the first, second, and third RNA polynucleotides are formulated in lipid nanoparticles. In some embodiments, the composition further comprises a fourth RNA polynucleotide comprising an open reading frame encoding a fourth antigen, wherein the antigen comprises at least one influenza virus antigen polypeptide or an immunogenic fragment thereof.In some embodiments, the fourth antigen is derived from influenza virus, but is derived from a different strain of influenza virus from the first, second and third antigens.In some embodiments, the first, second, third and fourth RNA polynucleotides are formulated in lipid nanoparticles.In some embodiments, the RNA polynucleotides are present in approximately equal ratios.

[0013] In some embodiments, any one of the RNA polynucleotides comprises a modified nucleotide. In some embodiments, the modified nucleotide is selected from the group consisting of pseudouridine, 1-methylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine. In some embodiments, each RNA polynucleotide comprises a 5' end cap, a 5' UTR, a 3' UTR, and a 3' polyadenylated tail. In some embodiments, the 5' end cap is

[0014] [ka] In some embodiments, the 5' UTR comprises SEQ ID NO: 1. In some embodiments, the 3' UTR comprises SEQ ID NO: 2. In some embodiments, the 3' polyadenylation tail comprises SEQ ID NO: 3. In some embodiments, the RNA polynucleotide has greater than 85% integrity. In some embodiments, the RNA polynucleotide has greater than 85% purity. In some embodiments, the lipid nanoparticles comprise 20-60 mol% ionizable cationic lipid, 5-25 mol% neutral lipid, 25-55 mol% cholesterol, and 0.5-5 mol% polymer-modified lipid. In some embodiments, the cationic lipid is

[0015] [ka] In some embodiments, the PEG-modified lipid comprises:

[0016] [ka] In some embodiments, the first antigen is an HA from influenza A subtype H1 or an immunogenic fragment or variant thereof, and the second antigen is an HA from an H1 strain different from the first antigen or an immunogenic fragment or variant thereof. In some embodiments, the first and second antigens are HA from influenza A subtype H3 or an immunogenic fragment or variant thereof, and both antigens are derived from different strains of H3 influenza virus. In some embodiments, the first and second antigens are HA from influenza A subtype H1 or an immunogenic fragment or variant thereof, and the third and fourth antigens are from influenza A subtype H3 or an immunogenic fragment or variant thereof, wherein the first and second antigens are derived from different strains of H1 virus, and the third and fourth antigens are derived from different strains of H3 influenza virus. In some embodiments, at least the first and second RNA polynucleotides are formulated in a single lipid nanoparticle. In some embodiments, the first, second, and third RNA polynucleotides are formulated in a single lipid nanoparticle. In some embodiments, the first, second, third, and fourth RNA polynucleotides are formulated in a single LNP. In some embodiments, each of the RNA polynucleotides is formulated in a single LNP, and each single LNP encapsulates an RNA polynucleotide encoding one antigen. In some embodiments, the first RNA polynucleotide is formulated in the first LNP; and the second RNA polynucleotide is formulated in the second LNP. In some embodiments, the first RNA polynucleotide is formulated in the first LNP; the second RNA polynucleotide is formulated in the second LNP; and the third RNA polynucleotide is formulated in the third LNP. In some embodiments, the first RNA polynucleotide is formulated in the first LNP; the second RNA polynucleotide is formulated in the second LNP; the third RNA polynucleotide is formulated in the third LNP; and the fourth RNA polynucleotide is formulated in the fourth LNP.In some embodiments, any one of the compositions described herein is for use in eliciting an immune response to influenza in a subject.

[0017] In some embodiments, the first RSV F protein is an F protein subtype A. In some embodiments, the first RSV F protein includes a combination of mutations compared to the corresponding wild-type RSV F protein, and the combination of mutations includes: (1) 103C, 148C, 190I, and 486S, preferably A103C, I148C, S190I, and D486S; (2) 54H, 55C, 188C, and 486S, preferably T54H, S55C, L188C, and D486S; (3) 54H, 103C, 148C, 190I, 296I, and 486S, preferably T54H, A103C, I148C, S190I, V29 (4) a combination of 54H, 55C, 142C, 188C, 296I, and 371C, preferably a combination of T54H, S55C, L142C, L188C, V296I, and N371C; (5) a combination of 55C, 188C, and 486S, preferably a combination of S55C, L188C, and D486S; (6) a combination of 54H, 55C, 188C, and 190I, preferably a combination of T54H, S55C, L188C, and S190I; (7) a combination of 55C, 188C, 190I, and 486S, preferably a combination of S55C, L188C, S190I, and D486S; (8) 54H, 55C, 188C, 190I, and 486S, preferably a combination of T54H, S55C, L188C, S190I, and D486S; (9) 155C, 190I, 290C, and 486S, preferably a combination of S155C, S190I, S290C, and D486S; (10) 54H, 55C, 142C, 188C, 296I, 371C, 486S, 487Q, and (11) 489S, preferably a combination of T54H, S55C, L142C, L188C, V296I, N371C, D486S, E487Q, and D489S; (12) a combination of 54H, 155C, 190I, 290C, and 296I, preferably a combination of T54H, S155C, S190I, S290C, and V296I; and (13) a combination of 155C, 190F, 290C, and 207L, preferably a combination of S155C, S190F, S290C, and V207L.In some embodiments, the first RSV F protein comprises a combination of mutations compared to the corresponding wild-type RSV F protein, wherein the combination of mutations is selected from the group consisting of: (1) a combination of 215P and 486N, preferably a combination of S215P and D486N; (2) a combination of 66E, 215P, and 486N, preferably a combination of K66E, S215P, and D486N; (3) a combination of 66E, 76V, 215P, and 486N, preferably a combination of K66E, I76V, S215P, and D486N; and (4) a combination of 66E, 67I, 76V, 215P, and 486N, preferably a combination of K66E, N67I, I76V, S215P, and D486N.

[0018] In some embodiments, the first RSV F protein comprises a trimerization domain. In some embodiments, the composition further comprises a second RSV F protein trimer in a pre-fusion conformation. In some embodiments, the second RSV F protein is a subtype B F protein.

[0019] In some embodiments, the second RSV F protein comprises a combination of mutations compared to the corresponding wild-type RSV F protein, and the combination of mutations is: (1) 103C, 148C, 190I, and 486S, preferably A103C, I148C, S190I, and D486S; (2) 54H, 55C, 188C, 486S, preferably T54H, S55C, L188C, and D486S; (3) 54H, 103C, 148C, 190I, 296I, and 486S, preferably T54H, A103C, I148C, S190I, V296I. (4) a combination of 54H, 55C, 142C, 188C, 296I, and 371C, preferably a combination of T54H, S55C, L142C, L188C, V296I, and N371C; (5) a combination of 55C, 188C, and 486S, preferably a combination of S55C, L188C, and D486S; (6) a combination of 54H, 55C, 188C, and 190I, preferably a combination of T54H, S55C, L188C, and S190I; (7) a combination of 55C, 188C, 190I, and and 486S, preferably a combination of S55C, L188C, S190I, and D486S; (8) 54H, 55C, 188C, 190I, and 486S, preferably a combination of T54H, S55C, L188C, S190I, and D486S; (9) 155C, 190I, 290C, and 486S, preferably a combination of S155C, S190I, S290C, and D486S; (10) 54H, 55C, 142C, 188C, 296I, 371C, 486S, 487Q, and 486S. (11) 89S, preferably a combination of T54H, S55C, L142C, L188C, V296I, N371C, D486S, E487Q, and D489S; (12) 54H, 155C, 190I, 290C, and 296I, preferably a combination of T54H, S155C, S190I, S290C, and V296I; and (13) 155C, 190F, 290C, and 207L, preferably a combination of S155C, S190F, S290C, and V207L.

[0020] In some embodiments, the second RSV F protein comprises a combination of mutations compared to the corresponding wild-type RSV F protein, wherein the combination of mutations is selected from the group consisting of: (1) a combination of 215P and 486N, preferably a combination of S215P and D486N, (2) a combination of 66E, 215P, and 486N, preferably a combination of K66E, S215P, and D486N, (3) a combination of 66E, 76V, 215P, and 486N, preferably a combination of K66E, I76V, S215P, and D486N, and (4) a combination of 66E, 67I, 76V, 215P, and 486N, preferably a combination of K66E, N67I, I76V, S215P, and D486N. In some embodiments, the second RSV F protein comprises a trimerization domain. In some embodiments, the first RSV F protein trimer is subtype A; and the composition further comprises a second RSV F protein trimer in a pre-fusion conformation, wherein the second RSV F protein trimer is subtype B. In some embodiments, the composition further comprises sodium chloride at a concentration of about 20 mM to about 250 mM; (iii) at least one of sucrose, mannitol, and glycine at a concentration of about 5 mg / mL to about 100 mg / mL; and (iv) a buffer; and the pH of the composition is about 7 to about 8.

[0021] In some embodiments, the LNPs are in a liquid state and the first RSV F protein trimer is lyophilized. In some embodiments, the LNPs are in a liquid state and the first RSV F protein trimer is an aqueous solution. In some embodiments, the osmolality of the composition is at most 500 mOsm / kg. In some embodiments, the composition preferably has an osmolality of 200 mOsm / kg to 400 mOsm / kg, preferably 240 to 360 mOsm / kg, and more preferably 290 to 310 mOsm / kg.

[0022] In some embodiments, each RNA has at least 50% integrity as measured by a fragment analyzer. In some embodiments, each LNP has at least 80% encapsulation efficiency for at least 4 hours. In some embodiments, the composition further comprises sodium chloride at a concentration of about 20 mM to about 250 mM; (iii) at least one of sucrose, mannitol, and glycine at a concentration of about 5 mg / mL to about 100 mg / mL; and (iv) a buffer; the pH of the composition is about 7 to about 8. In some embodiments, the RNA polynucleotide is purified and substantially free of contaminants, including short premature RNA species, long premature RNA species, double-stranded RNA (dsRNA), residual plasmid DNA, residual in vitro transcriptase, residual solvents, and / or residual salts. In some embodiments, the RSV polypeptide is purified and substantially free of contaminants. In some embodiments, the composition is preferably sterile. The composition is preferably non-pyrogenic, e.g., containing less than 1 EU (endotoxin unit, a standard measure) per dose, preferably less than 0.1 EU per dose. The composition is preferably gluten-free. Human vaccines are typically administered in a dosage volume of about 0.5 ml, although a half dose (i.e., about 0.25 ml) may be administered to children. Preferably, the compositions disclosed herein do not further comprise any one of the following: oil-in-water emulsion, cytokine-inducing agent, or benzonaphthyridine compound, QS-21, CpG sequence, and 3dMPL (also known as 3-de-O-acylated monophosphoryl lipid A or 3-O-desacyl-4'-monophosphoryl lipid A). In some preferred embodiments, the composition does not further comprise QS-21 or a saponin-containing adjuvant. In other preferred embodiments, the composition does not further comprise an aluminum-containing compound, e.g., aluminum hydroxide and AlPO4.

[0023]

[0010] In one embodiment, disclosed herein is a composition comprising: (i) a first ribonucleic acid (RNA) polynucleotide comprising an open reading frame encoding a first antigen, wherein the antigen comprises at least one influenza virus antigen polypeptide or an immunogenic fragment thereof, and the first RNA polynucleotide is formulated in a lipid nanoparticle (LNP); (ii) a second RNA polynucleotide comprising an open reading frame encoding a second antigen, wherein the second antigen comprises at least one influenza virus antigen polypeptide or an immunogenic fragment thereof; (iii) a third RNA polynucleotide comprising an open reading frame encoding an antigen comprising at least one influenza virus antigen polypeptide or an immunogenic fragment thereof; (iv) a fourth RNA polynucleotide comprising an open reading frame encoding a fourth antigen, wherein the antigen comprises at least one influenza virus antigen polypeptide or an immunogenic fragment thereof; and (v) an RNA polynucleotide comprising at least one open reading frame encoding at least one respiratory syncytial virus (RSV) antigen polypeptide or an immunogenic fragment thereof. In some embodiments, the RSV antigenic polypeptide has at least 90%, 95%, 96%, 97%, 98%, or 99% identity to an amino acid sequence selected from SEQ ID NOs: 1-6. In some embodiments, the RNA polynucleotide comprises at least one open reading frame encoding at least one respiratory syncytial virus (RSV) antigenic polypeptide or immunogenic fragment thereof, comprising a sequence set forth in any one of SEQ ID NOs: 13, 14, 15, and 16. In some embodiments, the RSV antigenic polypeptide is derived from RSV subtype A and / or RSV subtype B. In some embodiments, each of the RNA polynucleotides comprises a 5' cap, a 5' UTR, a 3' UTR, and a poly A tail.In some embodiments, any one of the RNA polynucleotides comprises at least one modified nucleotide selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2'-O-methyluridine.

[0024] In some embodiments, each of the RNA polynucleotides is encapsulated in a lipid nanoparticle (LNP). In some embodiments, the LNP comprises a cationic lipid, a polymeric lipid, a neutral lipid, and a steroid or steroid analog.

[0025] In some embodiments, disclosed herein is a method for inducing an immune response against influenza in a subject, comprising administering an effective amount of any one of the compositions described herein. In some embodiments, disclosed herein is a method for inducing an immune response against influenza and RSV in a subject, comprising administering an effective amount of any one of the compositions described herein. In some embodiments, disclosed herein is a method for preventing, treating, or ameliorating an infection, disease, or condition associated with influenza and / or RSV in a subject, comprising administering to the subject an effective amount of any one of the compositions described herein. In some embodiments, the subject is less than about 1 year old, about 1 year old or older, about 5 years old or older, about 10 years old or older, about 20 years old or older, about 30 years old or older, about 40 years old or older, about 50 years old or older, about 60 years old or older, about 70 years old or older, or older. In some embodiments, any one of the compositions described herein is administered by intradermal or intramuscular injection. [Brief explanation of the drawings]

[0026] [Figure 1A]Figure 1A shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were intramuscularly immunized on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assays). Figure 1A shows the neutralization assay results for RSV A, expressed as 50% neutralization titers (each symbol represents the titer from an individual animal; the bar represents the geometric mean titer (GMT)). [Figure 1B] Figure 1B shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assays). Figure 1B shows the neutralization assay results for RSV B, expressed as 50% neutralization titers (each symbol represents a titer from an individual animal; bars represent geometric mean titers (GMT)). [Figure 1C]Figure 1C shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assay). Figure 1C shows the results of an ELISpot assay measuring the number of RSV A+BF-specific cells secreting IFN-γ, expressed as spot-forming cells (SFC) per million cells. Bars and error bars depict the median and interquartile range. NA: not analyzed. [Figure 1D] Figure 1D shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assay). Figure 1D shows the results of an ICS assay measuring RSV A+BF-specific IFN-γ-expressing cells within CD4+ T cells, expressed as a percentage of IFN-γ+ cells. Bars and error bars depict the median and interquartile range. NA: not analyzed. [Figure 1E]Figure 1E shows the immunogenicity of RSV 847 modRNA-LNP formulations in mice. Female BALB / c mice (10 per group) were immunized intramuscularly on days 0 and 21 with the indicated doses of either bivalent protein subunits (RSV 847A+B) or RSV 847 constructs as monovalent (RSV 847A) or bivalent (RSV 847A+B) modRNA-LNP formulations. On day 35 (2 weeks after dose 2, PD2), serum was collected for RSV neutralization assays, and spleens were collected for T cell assays (ELISpot and intracellular cytokine staining, ICS assay). Figure 1E shows the results of an ICS assay measuring RSV A+BF-specific IFN-γ-expressing cells within CD8+ T cells, expressed as a percentage of IFN-γ+ cells. Bars and error bars depict the median and interquartile range. NA: not analyzed. [Figure 2] FIG. 2 depicts the integrity of the flu mRNA component of RSV subunit-Flu mRNA combinations by fragment analyzer (FA); target: 50% or more intact RNA. [Figure 3] Figure 3 shows that the percentage of encapsulation efficiency is maintained for the flu mRNA component of the RSV subunit-Flu mRNA combination. Target: RNA concentration: T0 ± 20%; EE%: 80% or greater. [Figure 4] Figure 4 shows that RSV relative pre-fusion F content by ELISA is maintained. Target: 50-150%. [Figure 5] In vitro expression data of influenza HA A / Wisconsin strain from a combination composition comprising RSV subunits and Flu tetravalent HA modRNA encapsulated LNPs; IVE assay using 293F suspension cells; DAI study T0 T2hT4h. [Figure 6] In vitro expression data of influenza HA A / Darwin strain from a combination composition comprising RSV subunits and Flu tetravalent HA modRNA encapsulated LNPs; IVE assay using 293F suspension cells; DAI study T0 T2hT4h. [Figure 7] Virus neutralization titers against RSV subtypes A and B 3 weeks after dose 1 (day 21). [Figure 8] Virus neutralization titers against four influenza strains 3 weeks (day 21) after dosing 1. [Figure 9] Virus neutralization titers against RSV subtypes A and B 2 weeks after dose 2 (day 42). [Figure 10] Neutralization titers against four influenza strains 2 weeks after dosing 2 (day 42). [Figure 11A] After post-dose 1 (PD1), data from 3 weeks after dose 1 in mice: no or minimal interference in Flu immunogenicity and a trend toward enhanced RSV immunogenicity for the modRNA Flu / RSV subunit combo vaccine candidate compared to the independent vaccines in mice; (Figure 11A) Bivalent RSV vaccine response. [Figure 11B] After post-dose 1 (PD1), data from 3 weeks after dose 1 in mice: no or minimal interference in Flu immunogenicity and a trend toward enhanced RSV immunogenicity for the modRNA Flu / RSV subunit combo vaccine candidate compared to the independent vaccines in mice; (Figure 11B) Tetravalent Flu vaccine response. [Figure 12A] After post-dose 2 (PD2), 2 weeks after dose 2 in mice: No interference in Flu immunogenicity, and similar or higher RSV immunogenicity for the modRNA Flu / RSV subunit combo vaccine candidate compared to independent vaccines in mice; (Figure 12A) Bivalent RSV vaccine response. [Figure 12B] After post-dose 2 (PD2), 2 weeks after dose 2 in mice: No interference in Flu immunogenicity, and similar or higher RSV immunogenicity for the modRNA Flu / RSV subunit combo vaccine candidate compared to independent vaccines in mice; (Figure 12B) Tetravalent Flu vaccine response. DETAILED DESCRIPTION OF THE INVENTION

[0027] Detailed Description Surprisingly, the inventors discovered that Flu modRNA-LNP compositions can be formulated in combination with (e.g., mixed with and / or associated with) an aqueous RSV subunit composition, and that the resulting combination maintained the stability of the individual antigens for at least 4 hours, comparable to that of the individual antigens. Flu antigens were expressed from mRNA-encapsulated LNPs despite being formulated in the presence of RSV subunit components. As a result of this discovery, healthcare professionals may have the option of administering different ratios of RSV and flu antigens in a single dose while maintaining antigen stability compared to that of the individual antigens when administered as separate formulations in the absence of a second antigen. In some embodiments, the RSV subunit composition is lyophilized and then reconstituted in a buffer solution before mixing with and / or associating with the Flu modRNA-LNP composition.

[0028] Embodiments of the present disclosure provide RNA (e.g., mRNA) vaccines comprising polynucleotides encoding influenza virus antigens. As provided herein, influenza virus RNA vaccines may be used to induce a balanced immune response, including both cellular and humoral immunity, without many of the risks associated with DNA vaccination.

[0029] In some embodiments, the virus is an influenza A or influenza B strain, or a combination thereof.

[0030] In one aspect, the present disclosure relates to an immunogenic composition comprising: (i) a first ribonucleic acid (RNA) polynucleotide having an open reading frame encoding a first antigen, the first RNA polynucleotide comprising at least one influenza virus antigen polypeptide or an immunogenic fragment thereof; and (ii) a second RNA polynucleotide having an open reading frame encoding a second antigen, the second antigen comprising at least one influenza virus antigen polypeptide or an immunogenic fragment thereof, wherein the first and second RNA polynucleotides are formulated in lipid nanoparticles (LNPs). In some embodiments, the first and second antigens comprise hemagglutinin (HA), or an immunogenic fragment or variant thereof. In some embodiments, the first antigen comprises HA from a different influenza virus subtype than the influenza virus antigen polypeptide or immunogenic fragment thereof of the second antigen. In some embodiments, the composition further comprises (iii) a third antigen comprising at least one influenza virus antigen polypeptide or immunogenic fragment thereof, wherein the third antigen is derived from an influenza virus but from a different strain of influenza virus than both the first and second antigens. In some embodiments, the first, second, and third RNA polynucleotides are formulated in lipid nanoparticles.

[0031] In some embodiments, the composition further comprises (iv) a fourth RNA polynucleotide having an open reading frame encoding a fourth antigen, wherein the antigen comprises at least one influenza virus antigen polypeptide or an immunogenic fragment thereof, and the fourth antigen is derived from an influenza virus but from a different strain of influenza virus than the first, second, and third antigens. In some embodiments, the first, second, third, and fourth RNA polynucleotides are formulated in lipid nanoparticles.

[0032] In some embodiments, RNA polynucleotides are mixed in a single vessel at a desired ratio and then formulated into lipid nanoparticles. The inventors surprisingly discovered that initial input of different RNA polynucleotides at known ratios formulated in a single LNP process surprisingly resulted in LNPs encapsulating different RNA polynucleotides in approximately the same ratio as the input ratio. This result was surprising given the possibility that the manufacturing process may prioritize one RNA polynucleotide over another when encapsulating RNA polynucleotides into LNPs. Such embodiments may be referred to herein as "premixes." Thus, in some embodiments, the first and second RNA polynucleotides are formulated in a single lipid nanoparticle. In some embodiments, the first, second, third, and fourth RNA polynucleotides are formulated in a single LNP. In some embodiments, the first, second, third, fourth, and fifth RNA polynucleotides are formulated in a single LNP. In some embodiments, the first, second, third, fourth, fifth, and sixth RNA polynucleotides are formulated in a single LNP. In some embodiments, the first, second, third, fourth, fifth, sixth, and seventh RNA polynucleotides are formulated in a single LNP. In some embodiments, the first, second, third, fourth, fifth, sixth, seventh, and eighth RNA polynucleotides are formulated in a single LNP.

[0033] In some embodiments, the molar ratio of the first RNA polynucleotide to the second RNA polynucleotide in the mix of RNA polynucleotides prior to formulation into LNPs is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the second RNA polynucleotide is greater than 1:1.

[0034] In some embodiments, the molar ratio of the first RNA polynucleotide to the third RNA polynucleotide in the mix of RNA polynucleotides prior to formulation into LNPs is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the third RNA polynucleotide is greater than 1:1.

[0035] In some embodiments, the molar ratio of the first RNA polynucleotide to the fourth RNA polynucleotide in the mix of RNA polynucleotides prior to formulation into LNPs is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the fourth RNA polynucleotide is greater than 1:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the fifth RNA polynucleotide in the mix of RNA polynucleotides prior to formulation into LNPs is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the fifth RNA polynucleotide is greater than 1:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the sixth RNA polynucleotide in the mix of RNA polynucleotides prior to formulation into LNPs is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the sixth RNA polynucleotide is greater than 1:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the seventh RNA polynucleotide in the mix of RNA polynucleotides prior to formulation into LNPs is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the seventh RNA polynucleotide is greater than 1:1.In some embodiments, the molar ratio of the first RNA polynucleotide to the eighth RNA polynucleotide in the mix of RNA polynucleotides prior to formulation into LNPs is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first RNA polynucleotide to the eighth RNA polynucleotide is greater than 1:1.

[0036] In an alternative embodiment, each RNA polynucleotide encoding a specific antigen is formulated in an individual LNP, such that each LNP encapsulates an RNA polynucleotide encoding the same antigen. Such an embodiment may be referred to herein as a "post-mix." Thus, in some embodiments, a first RNA polynucleotide is formulated in a first LNP; a second RNA polynucleotide is formulated in a second LNP; a third RNA polynucleotide is formulated in a third LNP; a fourth RNA polynucleotide is formulated in a fourth LNP; a fifth RNA polynucleotide is formulated in a fifth LNP; a sixth RNA polynucleotide is formulated in a sixth LNP; a seventh RNA polynucleotide is formulated in a seventh LNP; and an eighth RNA polynucleotide is formulated in an eighth LNP.

[0037] In some embodiments, the molar ratio of the first LNP to the second LNP in the mix of LNPs prior to formulation into an LNP is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first LNP to the second LNP is greater than 1:1.

[0038] In some embodiments, the molar ratio of the first LNP to the third LNP in the mix of LNPs prior to formulation into an LNP is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first LNP to the third LNP is greater than 1:1.

[0039] In some embodiments, the molar ratio of the first LNP to the fourth LNP in the mix of LNPs prior to formulation into an LNP is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first LNP to the fourth LNP is greater than 1:1. In some embodiments, the molar ratio of the first LNP to the fifth LNP in the mix of LNPs prior to formulation into an LNP is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first LNP to the fifth LNP is greater than 1:1. In some embodiments, the molar ratio of the first LNP to the sixth LNP in the mix of LNPs prior to formulation into an LNP is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first LNP to the sixth LNP is greater than 1:1. In some embodiments, the molar ratio of the first LNP to the seventh LNP in the mix of LNPs prior to formulation into an LNP is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first LNP to the seventh LNP is greater than 1:1. In some embodiments, the molar ratio of the first LNP to the eighth LNP in the mix of LNPs prior to formulation into an LNP is about 1:50, about 1:25, about 1:10, about 1:5, about 1:4, about 1:3, about 1:2, about 1:1, about 2:1, about 3:1, about 4:1, or about 5:1, about 10:1, about 25:1, or about 50:1. In some embodiments, the molar ratio of the first LNP to the eighth LNP is greater than 1:1.

[0040] In some embodiments, the antigenic polypeptide encodes a hemagglutinin protein or an immunogenic fragment thereof. In some embodiments, the hemagglutinin protein is H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, H18, or an immunogenic fragment thereof. In some embodiments, the hemagglutinin protein does not include a head domain. In some embodiments, the hemagglutinin protein includes a portion of a head domain. In some embodiments, the hemagglutinin protein does not include a cytoplasmic domain. In some embodiments, the hemagglutinin protein includes a portion of a cytoplasmic domain. In some embodiments, the truncated hemagglutinin protein includes a portion of a transmembrane domain.

[0041] Some embodiments provide influenza vaccines comprising one or more RNA polynucleotides having an open reading frame encoding a hemagglutinin protein, formulated within cationic lipid nanoparticles, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the hemagglutinin protein is selected from H1, H7, and H10. In some embodiments, the RNA polynucleotide further encodes a neuraminidase (NA) protein. In some embodiments, the hemagglutinin protein is derived from an influenza A virus or an influenza B virus strain, or a combination thereof. In some embodiments, the influenza virus is selected from H1N1, H3N2, H7N9, and H10N8.

[0042] In some embodiments, the virus is an influenza A or influenza B strain, or a combination thereof. In some embodiments, the influenza A or influenza B strain is associated with avian, porcine, equine, canine, human, or non-human primate. In some embodiments, the antigenic polypeptide encodes a hemagglutinin protein or a fragment thereof. In some embodiments, the hemagglutinin protein is H7 or H10, or a fragment thereof. In some embodiments, the hemagglutinin protein comprises a portion of the head domain (HA1). In some embodiments, the hemagglutinin protein comprises a portion of the cytoplasmic domain. In some embodiments, it is a truncated hemagglutinin protein, in some embodiments, the protein is a truncated hemagglutinin protein comprising a portion of the transmembrane domain. In some embodiments, the virus is selected from the group consisting of H7N9 and H10N8. Protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of the polypeptide of interest. For example, any protein fragment (meaning at least one amino acid residue of an otherwise identical but shorter polypeptide sequence than the reference polypeptide sequence) that is 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or longer than 100 amino acids in length is provided herein.

[0043] In some embodiments, the influenza RNA composition includes RNA encoding an antigenic fusion protein. Thus, the encoded antigen or antigens may comprise two or more proteins (e.g., proteins and / or protein fragments) joined together. Alternatively, the protein to which the protein antigen is fused does not promote a strong immune response against itself, but rather against the influenza antigen. In some embodiments, the antigenic fusion protein retains functional properties from each of the original proteins.

[0044] Some embodiments provide a method of preventing or treating influenza virus infection, comprising administering to a subject any of the vaccines described herein. In some embodiments, the antigen-specific immune response comprises a T cell response. In some embodiments, the antigen-specific immune response comprises a B cell response. In some embodiments, the antigen-specific immune response comprises both a T cell response and a B cell response. In some embodiments, the method of generating an antigen-specific immune response comprises a single administration of the vaccine. In some embodiments, the vaccine is administered to the subject intradermally, intramuscularly, subcutaneously, intranasally, or orally.

[0045] In some embodiments, the RNA (eg, mRNA) polynucleotide or portion thereof may encode one or more polypeptides or fragments thereof of an influenza strain as an antigen.

[0046] The present disclosure further provides RNA molecules (e.g., RNA polynucleotides) comprising at least one open reading frame (ORF) encoding a respiratory syncytial virus (RSV) antigen. In some embodiments, the RSV antigen is a RSV polypeptide. In some embodiments, the RSV polypeptide is a RSV F polypeptide. In some embodiments, the RSV polypeptide comprises an amino acid sequence of Table 30. In some embodiments, the RNA molecule comprises an ORF transcribed from at least one DNA nucleic acid sequence of Table 31. In some embodiments, the RNA molecule comprises an ORF comprising an RNA nucleic acid sequence of Table 32. In some embodiments, the RNA molecule comprises at least one of a 5' cap, a 5' UTR, a 3' UTR, and a polyA tail. In other embodiments, the RNA molecule comprises at least one of a 5' cap, a 3' UTR, and a polyA tail. The present disclosure provides RNA molecules comprising modified nucleotides. The present disclosure provides immunogenic compositions comprising any one of the RNA molecules encoding RSV polypeptides described herein, complexed with one or more lipids, encapsulated in one or more lipids, or formulated with one or more lipids, forming lipid nanoparticles (RNA-LNPs). The present disclosure further provides immunogenic compositions comprising any one of the RNA molecules comprising at least one RNA nucleic acid described herein, complexed with one or more lipids, encapsulated in one or more lipids, or formulated with one or more lipids, forming RNA-LNPs. The present disclosure further provides a method for preventing infection, disease, or conditions in a subject (e.g., respiratory tract diseases associated with RSV infection, including pneumonia and bronchitis) by administering to the subject an effective amount of the RNA molecules, RNA-LNPs, or immunogenic compositions described herein. The present disclosure further provides the use of the RNA molecules, RNA-LNPs, and / or immunogenic compositions described herein as vaccines.

[0047] The present disclosure can be more readily understood by referring to the following detailed description of the embodiments of the present disclosure and the examples contained herein. It should be understood that the present invention is not limited to a specific manufacturing method, which may of course be varied. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only, and is not intended to be limiting.

[0048] Exemplary embodiments (E) of the present disclosure provided herein include the following:

[0049] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described.

[0050] All references referred to herein, including patent applications, patent publications, and UniProtKB accession numbers, are hereby incorporated by reference to the same extent as if each individual reference was specifically and individually indicated to be incorporated by reference in its entirety.

[0051] I. Definition Examples Unless otherwise defined herein, scientific and technical terms used in the context of this disclosure have the meanings that are commonly understood by those of ordinary skill in the art.

[0052] Throughout this application, the term "about" is used in accordance with its plain and ordinary meaning within the art of cell and molecular biology to indicate a deviation of ±10% of the value with which it is placed.

[0053] Recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated herein as if it were individually recited herein.

[0054] The use of the words "a" or "an," when used in conjunction with the term "comprise," can mean "one," but is also consistent with the meanings of "one or more," "at least one," and "one or more."

[0055] The phrase "and / or" means "and" or "or." Illustratively, A, B, and / or C includes A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination, or A, B, and C in combination. In other words, "and / or" functions as an inclusive or.

[0056] The phrase "essentially all" is defined as "at least 95%; if essentially all members of a group have a particular property, then at least 95% of the members of the group have that property. In some embodiments, essentially all means that equal to, at least any one of, or between any two of 95, 96, 97, 98, 99, or 100% of the members of the group have that property.

[0057] The compositions and methods for their use may "comprise," "consist essentially of," or "consist" of any of the components or steps disclosed throughout this specification. Throughout this specification, unless the context requires otherwise, the words "comprising" (and any form of comprising, e.g., "comprise" and "comprises"), "having" (and any form of having, e.g., "have" and "has"), "including" (and any form of including, e.g., "includes" and "include"), or "containing" (and any form of containing, e.g., "contains" and "contain") are understood to be inclusive or open-ended, implying the inclusion of the stated step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements. It is contemplated that embodiments described herein in the context of the term "comprising" can also be implemented in the context of the terms "consisting of" or "consisting essentially of." Compositions and methods "consisting essentially of" any of the disclosed components or steps limit the scope of the claim to the specified materials or steps that do not materially affect the basic and novel characteristics of the claimed disclosure. The word "consisting of" (and any forms of "consisting of," such as "consist of" and "consists of") is meant to include and be limited to everything preceding the word "consisting of." Thus, the word "consisting of" indicates that the listed elements are required or mandatory, and that no other elements may be present.

[0058] References throughout this specification to "one embodiment," "an embodiment," "a particular embodiment," "a related embodiment," "a particular embodiment," "an additional embodiment," or "a further embodiment," or combinations thereof, mean that the particular feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of these phrases in various places throughout this specification do not necessarily all refer to the same embodiment. Furthermore, particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0059] The terms "inhibit," "reduce," or "reduce" or any variation of these terms includes any measurable decrease (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% decrease) or complete inhibition to achieve the desired result. The terms "enhance," "promote," or "increase," or any variation of these terms, include any measurable increase (e.g., a 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% increase) to achieve a desired result or production of a protein or molecule.

[0060] As used herein, the term " reference ", " standard " or " control " describes the value that is compared to.For example, the agent, subject, population, sample or value of interest is compared with the agent, subject, population, sample or value of interest that is reference, standard or control.Reference, standard or control can be tested and / or determined substantially simultaneously and / or together with the test or determination of the agent, subject, population, sample or value of interest, and / or can be determined or characterized under the same conditions or circumstances as the agent, subject, population, sample or value of interest that is being evaluated.

[0061] The term "isolated" can refer to a nucleic acid or polypeptide that is substantially free from cellular material, bacterial material, viral material, or culture medium (if produced by recombinant DNA technology) from the source of its origin, or from chemical precursors or other chemicals (if chemically synthesized). Furthermore, an isolated compound refers to a compound that can be administered to a subject as an isolated compound; in other words, a compound may not simply be considered "isolated" when attached to a column or embedded in an agarose gel. Furthermore, an "isolated nucleic acid fragment" or "isolated peptide" is a nucleic acid or protein fragment that does not naturally occur as a fragment and / or is not typically in a functional state and / or has been altered or removed from its natural state through human intervention. For example, DNA naturally occurring in a living animal is not "isolated," but synthetic DNA, or DNA partially or completely separated from materials with which it occurs in its natural state, is "isolated." Isolated nucleic acids may exist in a substantially purified form or may exist in a non-native environment, such as in the cells to which the nucleic acid was delivered.

[0062] As used herein, "nucleic acid" refers to a molecule containing a nucleic acid component, and refers to a DNA or RNA molecule. It may be used interchangeably with the term "polynucleotide." A nucleic acid molecule is a polymer containing or consisting of nucleotide monomers covalently linked to each other by sugar / phosphate backbone phosphodiester bonds. Nucleic acids can also include modified nucleic acid molecules, such as DNA or RNA molecules with base, sugar, or backbone modifications. Nucleic acids can exist in various forms, such as isolated segments and integrated sequences encoding one or both chains of a polypeptide, such as an antigen or antibody, or fragments, derivatives, muteins, or variants thereof, or recombinant vectors of recombinant polynucleotides; polynucleotides sufficient for use as hybridization probes, PCR primers, or sequencing primers for identifying, analyzing, mutating, or amplifying polynucleotides encoding polypeptides; polynucleotides such as those described herein, mRNA, saRNA, modRNA, and antisense nucleic acids for inhibiting expression of complementary sequences. The nucleic acid may also encode an epitope to which an antibody can bind.

[0063] The term "epitope" refers to a portion that is specifically recognized by an immunoglobulin (e.g., antibody or receptor) binding entity. In some embodiments, an epitope is composed of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are surface-exposed when the antigen adopts a relevant three-dimensional conformation. In some embodiments, such chemical atoms or groups are physically close to each other in space when the antigen adopts such a conformation. In some embodiments, at least some of such chemical atoms are physically separated from each other when the antigen adopts an alternative conformation (e.g., linearized).

[0064] Nucleic acids may be single-stranded or double-stranded and may comprise RNA and / or DNA nucleotides, as well as artificial variants thereof (e.g., peptide nucleic acids). In some cases, nucleic acid sequences may encode polypeptide sequences with additional heterologous coding sequences, for example, to enable purification, transport, secretion, post-translational modification, or therapeutic benefit, such as targeting or efficacy, of the polypeptide. Tags or other heterologous polypeptides may be added to the modified polypeptide coding sequence, where "heterologous" refers to a polypeptide that is not the same as the modified polypeptide.

[0065] The term "polynucleotide" refers to a nucleic acid molecule that may be recombinant or that has been isolated from total genomic nucleic acid. Recombinant vectors, including oligonucleotides (nucleic acids of 100 residues or fewer) such as plasmids, cosmids, phages, and viruses, are included in the term "polynucleotide." In certain embodiments, polynucleotides contain regulatory sequences that are substantially isolated from their naturally occurring gene or protein-coding sequences. Polynucleotides may be single-stranded (coding or antisense) or double-stranded, and may be RNA, DNA (genomic, cDNA, or synthetic), analogs thereof, or combinations thereof. Additional coding or non-coding sequences may, but need not, be present within a polynucleotide.

[0066] In certain embodiments, polynucleotide variants having substantial identity to the sequences disclosed herein; at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher percent sequence identity compared to the polynucleotide sequences provided herein using the methods described herein (e.g., BLAST analysis using standard parameters). , 95%, 96%, 97%, 98%, or 99% or higher percent sequence identity, or up to 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher percent sequence identity, or polynucleotide variants comprising between any two of 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or higher percent sequence identity. In certain embodiments, the isolated polynucleotide comprises a nucleotide sequence encoding a polypeptide having at least 90% identity to the amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence complementary to the isolated polynucleotide. In some embodiments, the isolated polynucleotide comprises a nucleotide sequence that encodes a polypeptide having at least 95% identity to an amino acid sequence described herein over the entire length of the sequence; or a nucleotide sequence that is complementary to the isolated polynucleotide.

[0067] Regardless of the length of the coding sequence itself, nucleic acid segments may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, and other coding segments, so that their overall length may vary considerably. Nucleic acids may be of any length. They may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length, or may be at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, or more nucleotides in length. 0, 25, 30, 35, 40, 45, 50, 75, 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, or up to 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 75 , 100, 125, 175, 200, 250, 300, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, or The nucleic acid may be between any two of 00, 350, 400, 450, 500, 750, 1000, 1500, 3000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000 or more nucleotides in length, and / or may include one or more additional sequences, e.g., regulatory sequences, and / or may be part of a larger nucleic acid, e.g., a vector.It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol.

[0068] In this regard, the term "gene" is used to refer to a nucleic acid (including any sequences required for proper transcription, post-translational modification, or localization) that encodes a protein, polypeptide, or peptide. As will be understood by those skilled in the art, this term encompasses genomic sequences, expression cassettes, cDNA sequences, and smaller engineered nucleic acid segments that express, or can be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of a polypeptide may contain a contiguous nucleic acid sequence that encodes all or part of such a polypeptide. It is also envisioned that a particular polypeptide may be encoded by a nucleic acid containing variations having slightly different nucleic acid sequences, but nonetheless encoding the same or a substantially similar polypeptide.

[0069] As used herein, the term "expression" of a nucleic acid sequence refers to the production of any gene product from a nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence involves one or more of the following: (1) the production of an RNA template from a DNA sequence (e.g., by transcription); (2) the processing of an RNA transcript (e.g., by splicing, editing, etc.); (3) the translation of the RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.

[0070] Generally, the term "engineered" refers to an aspect that has been manipulated by the hand of man. For example, a polynucleotide is considered to be "engineered" when it has been manipulated by the hand of man so that two or more sequences that are not naturally linked in that order are directly linked to each other in the engineered polynucleotide, and / or when certain residues in the polynucleotide are caused through the action of the hand of man to be linked to entities or moieties that do not occur in nature and / or are not naturally linked.

[0071] The term "DNA," as used herein, refers to a nucleic acid molecule comprising nucleotides, such as deoxyadenosine monophosphate, deoxythymidine monophosphate, deoxyguanosine monophosphate, and deoxycytidine monophosphate monomers, composed of a sugar moiety (deoxyribose), a base moiety, and a phosphate moiety, polymerized with a characteristic backbone structure. The backbone structure is typically formed by a phosphodiester bond between the sugar moiety, e.g., deoxyribose, of a first nucleotide monomer and the phosphate moiety of a second, adjacent monomer. The specific order of the monomers, e.g., the order of the bases linked to the sugar / phosphate backbone, is referred to as the DNA sequence. DNA may be single-stranded or double-stranded. In the double-stranded form, the nucleotides of the first strand typically hybridize with the nucleotides of the second strand, e.g., by A / T and G / C base pairing. DNA may contain all or mostly deoxyribonucleotide residues. As used herein, the term "deoxyribonucleotide" refers to a nucleotide lacking a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. Without any limitation, DNA may include double-stranded DNA, antisense DNA, single-stranded DNA, isolated DNA, synthetic DNA, recombinantly produced DNA, and modified DNA.

[0072] The term "RNA" as used herein refers to a nucleic acid molecule comprising nucleotides, such as adenosine monophosphate, uridine monophosphate, guanosine monophosphate, and cytidine monophosphate monomers, connected to one another along a so-called backbone. The backbone is formed by a phosphodiester bond between the sugar, e.g., ribose, of a first monomer and the phosphate moiety of a second adjacent monomer. RNA may be obtained, for example, by transcription of a DNA sequence inside a cell. In eukaryotic cells, transcription typically occurs inside the nucleus or mitochondria. In vivo, transcription of DNA can result in a premature RNA that is processed into messenger RNA (mRNA). For example, in eukaryotes, premature RNA processing involves various post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. The mature messenger RNA is processed to provide a nucleotide sequence that can be translated into the amino acid sequence of a peptide or protein. Mature mRNA may include a 5' cap, a 5' UTR, an open reading frame, a 3' UTR, and a poly-A tail sequence. The RNA may contain all or most of ribonucleotide residues. As used herein, the term "ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2' position of a β-D-ribofuranosyl group. In one embodiment, the RNA may be messenger RNA (mRNA) for an RNA transcript encoding a peptide or protein. As known to those skilled in the art, mRNA generally contains a 5' untranslated region (5' UTR), a polypeptide coding region, and a 3' untranslated region (3' UTR). Without any limitation, RNA may include double-stranded RNA, antisense RNA, single-stranded RNA, isolated RNA, synthetic RNA, recombinantly produced RNA, and modified RNA (modRNA).

[0073] "Isolated RNA" is defined as an RNA molecule that may be recombinant or that has been isolated from total genomic nucleic acid. Isolated RNA molecules or proteins may exist in a substantially purified form or may exist in a non-native environment, such as in a host cell.

[0074] "Modified RNA" or "modRNA" refers to an RNA molecule that has at least one addition, deletion, substitution, and / or alteration of one or more nucleotides compared to naturally occurring RNA. Such alterations can refer to the addition of non-nucleotide material to internal RNA nucleotides or to the 5' and / or 3' ends of the RNA. In one embodiment, such modRNA contains at least one modified nucleotide, e.g., a change to the base of a nucleotide. For example, modified nucleotides may replace one or more uridine and / or cytidine nucleotides. For example, these substitutions may occur for every instance of uridine and / or cytidine in the RNA sequence, or may occur only for select uridine and / or cytidine nucleotides. Such alterations to standard nucleotides in the RNA may include non-standard nucleotides, e.g., chemically synthesized nucleotides or deoxynucleotides. For example, at least one uridine nucleotide may be replaced with N1-methylpseudouridine in the RNA sequence. Other such altered nucleotides are known to those skilled in the art. Such altered RNA molecules are considered analogs of naturally occurring RNA. In some embodiments, RNA is produced by in vitro transcription using DNA template, where DNA refers to the nucleic acid that contains deoxyribonucleotides.In some embodiments, RNA can be replicon RNA (replicon), particularly self-replicating RNA, or self-amplifying RNA (saRNA).

[0075] As envisioned herein, without any limitation, RNA may be used as a therapeutic modality for treating and / or preventing a number of conditions in mammals, including humans. The methods described herein include administering the RNA described herein to a mammal, such as a human. For example, in one embodiment, the method of using such RNA includes an antigen-encoding RNA vaccine to induce robust neutralizing antibodies and concomitant / concomitant T cell responses to achieve protective immunization. In some embodiments, a minimal vaccine dose is administered to induce robust neutralizing antibodies and concomitant / concomitant T cell responses to achieve protective immunization. In one embodiment, the administered RNA is in vitro transcribed RNA. For example, such RNA may be used to encode at least one antigen intended to generate an immune response in the mammal. The pathogenic antigen is a peptide or protein antigen derived from a pathogen associated with an infectious disease. In a specific embodiment, the pathogenic antigen is a peptide or protein antigen derived from RSV. Conditions and / or diseases that can be treated using the RNA disclosed herein include, but are not limited to, those caused and / or affected by viral infections, including, but not limited to, RSV.

[0076] "Prevent" or "prevention," as used herein in the context of the occurrence of a disease, disorder, and / or condition, refers to reducing the risk of developing a disease, disorder, and / or condition and / or delaying the onset of one or more characteristics or symptoms of a disease, disorder, or condition. Prevention may be considered complete if the onset of the disease, disorder, or condition is delayed for a predefined period of time.

[0077] As understood from the context, "risk" of a disease, disorder, and / or condition refers to the likelihood that a particular individual will develop the disease, disorder, and / or condition. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is, at least, or at most 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100%. In some embodiments, risk is expressed as a risk relative to the risk associated with a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk of the disease, disorder, condition, and / or event. In some embodiments, the reference sample or group of reference samples is from an individual comparable to the particular individual. In some embodiments, risk may reflect one or more genetic attributes, for example, one or more genetic attributes that may predispose an individual to developing (or not developing) a particular disease, disorder, and / or condition. In some embodiments, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes. Susceptibility: An individual who is "susceptible to" a disease, disorder, and / or condition is an individual who has a higher risk of developing the disease, disorder, and / or condition than members of the general public. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not have been diagnosed with the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition may not exhibit symptoms of the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition develops the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition does not develop the disease, disorder, and / or condition.

[0078] The terms "protein," "polypeptide," or "peptide" are used synonymously herein and refer to a polymer of amino acid monomers, e.g., a molecule comprising at least two amino acid residues. Polypeptides may include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments, and other equivalents, variants, and analogs of the foregoing. Polypeptides may be single molecules or multimolecular complexes, such as dimers, trimers, or tetramers. Proteins may comprise one or more peptides or polypeptides and may be folded into a three-dimensional form that may be required for the protein to perform its biological function.

[0079] As used herein, the term "wild-type" or "WT" or "native" refers to the endogenous version of a molecule that occurs naturally in an organism. In some embodiments, wild-type versions of proteins or polypeptides are used, while in other embodiments of the present disclosure, modified proteins or polypeptides are used to generate an immune response. The above terms may be used interchangeably.

[0080] A "modified protein" or "modified polypeptide" or "variant" refers to a protein or polypeptide whose chemical structure, particularly its amino acid sequence, has been altered relative to a wild-type protein or polypeptide. In some embodiments, the modified / variant protein or polypeptide has at least one modified activity or function (recognizing that a protein or polypeptide may have multiple activities or functions). It is specifically contemplated that a modified / variant protein or polypeptide may be altered with respect to one activity or function but retain wild-type activity or function in other respects, e.g., immunogenicity. When a protein is specifically referred to herein, it generally refers to a native (wild-type) or recombinant (modified) protein. The protein may be isolated directly from its native organism, produced by recombinant DNA / exogenous expression methods, solid-phase peptide synthesis (SPPS), or other in vitro methods. In certain embodiments, there are isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences encoding a polypeptide (e.g., an antigen or fragment thereof). The term "recombinant" may be used in conjunction with the name of a polypeptide or a specific polypeptide and generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or from the replication products of such a molecule.

[0081] The term "fragment", in reference to an amino acid sequence (peptide or protein), refers to a portion of the amino acid sequence, for example, a sequence representing an amino acid sequence truncated at the N-terminus and / or C-terminus. A fragment truncated at the C-terminus (N-terminal fragment) can be obtained, for example, by translating a truncated open reading frame lacking the 3' end of the open reading frame. A fragment truncated at the N-terminus (C-terminal fragment) can be obtained, for example, by translating a truncated open reading frame lacking the 5' end of the open reading frame, as long as the truncated open reading frame contains an initiation codon that serves to initiate translation. A fragment of an amino acid sequence contains, for example, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 99% of the amino acid residues from the amino acid sequence. In this disclosure, a fragment of a polypeptide, DNA, nucleic acid, or RNA nucleic acid sequence is at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, and at most 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, or 99% identical to, the polypeptide, DNA, nucleic acid, or RNA nucleic acid sequence from which it is derived. "A" refers to a sequence having a sequence identity of 96%, 97%, 98%, or 99%, or exactly 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or between any two of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.

[0082] In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 70% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 80% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 85% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 90% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 95% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA, or RNA nucleic acid sequence refers to a sequence having at least 97% sequence identity with the polypeptide, DNA, or RNA nucleic acid sequence from which it is derived. In one embodiment, a fragment of a polypeptide, DNA nucleic acid, or RNA nucleic acid sequence refers to a sequence having at least 99% sequence identity to the polypeptide, DNA nucleic acid, or RNA nucleic acid sequence from which it is derived.

[0083] As used herein in the context of molecules, e.g., nucleic acids, proteins, or small molecules, the term "variant" refers to a molecule that exhibits significant structural identity with a reference molecule but structurally differs from the reference molecule, e.g., in the presence or absence or level of one or more chemical moieties compared to the reference entity. In some embodiments, a variant also differs functionally from its reference molecule. Generally, whether a particular molecule is properly considered a "variant" of a reference molecule is based on the degree of structural identity with the reference molecule. As will be understood by those skilled in the art, any biological or chemical reference molecule has certain characteristic structural elements. A variant, by definition, is a distinct molecule that shares one or more such characteristic structural elements but differs from the reference molecule in at least one aspect. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid as a result of one or more differences in amino acid or nucleotide sequence and / or one or more differences in chemical moieties (e.g., carbohydrates, lipids, phosphate groups) that are covalently attached to the polypeptide or nucleic acid backbone (e.g., attached to the polypeptide or nucleic acid backbone). In some embodiments, the variant polypeptide or nucleic acid is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, up to 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, or exactly 85% , 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%, or between any two of 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the variant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid. In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities.In some embodiments, a variant polypeptide or nucleic acid shares one or more biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid lacks one or more biological activities of a reference polypeptide or nucleic acid. In some embodiments, a variant polypeptide or nucleic acid exhibits a reduced level of one or more biological activities compared to a reference polypeptide or nucleic acid. In some embodiments, a polypeptide or nucleic acid of interest is considered a "variant" of a reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence identical to the reference amino acid or nucleotide sequence except for a small number of sequence changes at specific positions. Preferably, a variant polypeptide or nucleic acid sequence has at least one modification, e.g., 1 to about 20 modifications, compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 10 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 5 modifications compared to a reference polypeptide or nucleic acid sequence. In one embodiment, a variant polypeptide or nucleic acid sequence has 1 to about 4 modifications compared to a reference polypeptide or nucleic acid sequence. Typically, less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of the residues in the variant are substituted, inserted, or deleted compared to the reference.In many cases, the variant polypeptide or nucleic acid comprises a very small number (e.g., less than about 5, about 4, about 3, about 2, or about 1) of functional residues (e.g., residues participating in a specific biological activity) substituted, inserted, or deleted compared to the reference.In some embodiments, the variant polypeptide or nucleic acid comprises about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 residue substitution compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains less than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and typically less than about 5, about 4, about 3, or about 2 additions or deletions compared to the reference.In some embodiments, the variant polypeptide or nucleic acid contains no more than about 5, about 4, about 3, about 2, or about 1 additions or deletions compared to the reference, and in some embodiments, no additions or deletions.

[0084] In some embodiments, the reference polypeptide or nucleic acid is a "wild-type" or "WT" or "native" sequence found in nature, including allelic variations. A wild-type polypeptide or nucleic acid sequence has a sequence that has not been intentionally modified. For purposes of this disclosure, a "variant" of an amino acid sequence (peptide, protein, or polypeptide) includes an amino acid insertion variant, an amino acid addition variant, an amino acid deletion variant, and / or an amino acid substitution variant. A "variant" of a nucleotide sequence includes a nucleotide insertion variant, a nucleotide addition variant, a nucleotide deletion variant, and / or a nucleotide substitution variant. The term "variant" includes all mutants, splice variants, post-translational modification variants, conformations, isoforms, allelic variants, species variants, and species homologs, particularly those that occur naturally. The term "variant" particularly includes fragments of an amino acid or nucleic acid sequence.

[0085] Changes may be introduced into a nucleic acid by mutation, which may lead to a change in the amino acid sequence of a polypeptide (e.g., an antigen or an antibody or antibody derivative) that the nucleic acid encodes. Mutations may be introduced using any technique known in the art. In one embodiment, one or more specific amino acid residues are changed, for example, using a site-directed mutagenesis protocol. In another embodiment, one or more randomly selected residues are changed, for example, using a random mutagenesis protocol. In some embodiments, however made, the mutant polypeptide may be expressed and screened for desired properties.

[0086] Mutations can be introduced into nucleic acids without significantly altering the biological activity of the polypeptides encoded by the nucleic acids. For example, nucleotide substitutions leading to amino acid substitutions at non-essential amino acid residues can be made. Alternatively, one or more mutations that selectively alter the biological activity of the polypeptides encoded by the nucleic acids can be introduced into the nucleic acids. For example, mutations can change the biological activity quantitatively or qualitatively. Examples of quantitative changes include increasing, reducing, or eliminating the activity. Examples of qualitative changes include changing the antigen specificity of an antibody.

[0087] "Sequence similarity" refers to the percentage of amino acids that are identical or represent conservative amino acid substitutions. "Sequence identity" between two amino acid sequences refers to the percentage of amino acids that are identical between the sequences. "Sequence identity" between two nucleic acid sequences refers to the percentage of nucleotides that are identical between the sequences.

[0088] The terms "% identical," "% identity," or similar terms are intended to specifically refer to the percentage of nucleotides or amino acids that are identical in optimal alignment between the compared sequences. The percentage is purely statistical; the differences between the two sequences may, but need not, be randomly distributed over the entire length of the compared sequences. Comparison of two sequences is usually performed by comparing the sequences after optimal alignment over a segment or "window of comparison" to identify local regions of corresponding sequence. The optimal alignment for comparison can be performed manually or with the aid of the local homology algorithm of Smith and Waterman, 1981, Ads App.Math.2, 482, with the aid of the local homology algorithm of Neddleman and Wunsch, 1970, J.Mol.Biol.48, 443, with the aid of the similarity search algorithm of Pearson and Lipman, 1988, Proc.Natl Acad.Sci.USA 88, 2444, or with the aid of a computer program using the above algorithm (GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group). In some embodiments, the percent identity of two sequences is determined using the BLASTN or BLASTP algorithm available on the website of the United States National Center for Biotechnology Information (NCBI).

[0089] The percentage identity is obtained by determining the number of corresponding identical positions in the compared sequences, dividing this number by the number of positions being compared (e.g., the number of positions in the reference sequence), and multiplying this result by 100.

[0090] In some embodiments, the degree of similarity or identity is given for at least about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, up to about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, exactly about 50%, about 60%, about 70%, about 80%, about 90%, or about 100%, or for a region that is between any two of about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the entire length of the reference sequence. For example, if the reference nucleic acid sequence consists of 200 nucleotides, the degree of identity is provided for at least about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, up to about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or exactly about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, or between any two of about 100, about 120, about 140, about 160, about 180, or about 200 nucleotides, in some embodiments, consecutive nucleotides. In some embodiments, the degree of similarity or identity is provided for the entire length of the reference sequence.

[0091] Homologous amino acid sequences may exhibit at least 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of amino acid residues, up to 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, or exactly 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99%, or between any two of 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, or 99% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 95% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 98% identity of amino acid residues. In one embodiment, homologous amino acid sequences exhibit at least 99% identity of amino acid residues.

[0092] A fragment or variant of an amino acid sequence (peptide or protein) may be a "functional fragment" or "functional variant." The term "functional fragment" or "functional variant" of an amino acid sequence refers to any fragment or variant that exhibits one or more functional properties identical to or similar to one or more functional properties of the amino acid sequence from which it is derived, e.g., functionally equivalent. With respect to an antigen or antigen sequence, one specific function is one or more immunogenic activities exhibited by the amino acid sequence from which the fragment or variant is derived. The term "functional fragment" or "functional variant," as used herein, specifically refers to a variant molecule or sequence that contains an amino acid sequence that is altered by one or more amino acids compared to the amino acid sequence of the parent molecule or sequence, and still retains one or more functions of the parent molecule or sequence, such as the ability to induce an immune response. In one embodiment, the alteration in the amino acid sequence of the parent molecule or sequence does not significantly affect or alter the characteristics of the molecule or sequence. The terms "mutant" of a wild-type RSV F protein, "mutant" of a RSV F protein, "RSV F protein mutant" or "modified RSV F protein" refer to a polypeptide that exhibits the introduction of mutations compared to the wild-type F protein and is immunogenic relative to the wild-type F protein.

[0093] An amino acid sequence (peptide, protein, or polypeptide) "derived from" a specified amino acid sequence (peptide, protein, or polypeptide) refers to the origin of the first amino acid sequence. Preferably, an amino acid sequence derived from a particular amino acid sequence has an amino acid sequence identical to, essentially identical to, or homologous to the particular sequence or a fragment thereof. An amino acid sequence derived from a particular amino acid sequence may be a variant of the particular sequence or a fragment thereof. For example, it will be understood by those skilled in the art that antigens suitable for use herein may be altered in sequence to vary from the naturally occurring or native sequence from which they are derived while retaining the desired activity of the native sequence.

[0094] In this disclosure, a vector refers to a nucleic acid molecule, e.g., an artificial nucleic acid molecule. A vector may be used to incorporate a nucleic acid sequence, e.g., a nucleic acid sequence containing an open reading frame. Vectors include, but are not limited to, storage vectors, expression vectors, cloning vectors, and transfer vectors. A vector may be an RNA vector or a DNA vector. In some embodiments, a vector is a DNA molecule. In some embodiments, a vector is a plasmid vector. In some embodiments, a vector is a viral vector. Typically, an expression vector contains a desired coding sequence and appropriate other sequences necessary for expression of an operably linked coding sequence in a particular host organism (e.g., bacteria, yeast, plant, insect, or mammal) or in an in vitro expression system. Cloning vectors are generally used to manipulate and amplify a specific desired fragment (typically a DNA fragment) and may lack functional sequences required for expression of the desired fragment.

[0095] As used herein, the term "pharmaceutical composition" refers to an active agent formulated with one or more pharmaceutically acceptable carriers.The pharmaceutical composition may be an immunogenic composition.In some embodiments, the active agent is present in a unit dose amount suitable for administration in a treatment regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population.In some embodiments, the pharmaceutical composition may be specially formulated for parenteral administration, for example, as a sterile solution or suspension, or as a sustained-release formulation, for example, by subcutaneous, intramuscular, intravenous or epidural injection.

[0096] As used herein, the term "vaccination" refers to the administration of an immunogenic composition intended to generate an immune response, for example, against a disease-associated (e.g., disease-causing) agent (e.g., a virus). In some embodiments, vaccination may be administered before, during, and / or after exposure to the disease-associated agent, and in certain embodiments, before, during, and / or immediately after exposure to the agent. In some embodiments, vaccination involves multiple administrations of a vaccine composition, appropriately spaced in time. In some embodiments, vaccination generates an immune response against an infectious agent. In some embodiments, vaccination generates an immune response against a tumor; in some such embodiments, vaccination is "personalized" in that it is directed, in part or in whole, to epitopes (which may be, for example, or include, one or more neoepitopes) determined to be present in a particular individual's tumor.

[0097] Immune response refers to a humoral response, a cellular response, or both humoral and cellular responses in an organism. Immune response may be measured by assays including, but not limited to, assays that measure the presence or amount of antibodies that specifically recognize proteins or cell surface proteins, assays that measure T cell activation or proliferation, and / or assays that measure modulation in terms of activity or expression of one or more cytokines.

[0098] As used herein, the term "combination therapy" refers to a situation in which a subject is exposed to two or more therapeutic regimens (e.g., two or more therapeutic agents) simultaneously. In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of a first regimen are administered prior to any dose of a second regimen); in some embodiments, such agents are administered in overlapping dosing regimens. In some embodiments, the "administration" of a combination therapy may involve the administration of one or more agents or modalities to a subject receiving other agents or modalities in combination. For clarity, combination therapy does not require that individual agents be administered together (or necessarily simultaneously) in a single composition, although in some embodiments, two or more agents, or active portions thereof, may be administered together in a combination composition or even in a combination compound (e.g., as part of a single chemical complex or covalent entity).

[0099] Those skilled in the art will understand that the term "dosing regimen" can be used to refer to a set of unit doses (typically more than one) that are typically separated by a time period and individually administered to a subject. In some embodiments, a given therapeutic agent has a recommended dosing regimen, and the dosing regimen may involve one or more doses. In some embodiments, the dosing regimen comprises multiple doses, each of which is separated in time from other doses. In some embodiments, the individual doses are separated from each other by the same length of time period; in some embodiments, the dosing regimen comprises multiple doses and at least two different time periods separating the individual doses. In some embodiments, all doses in the dosing regimen are the same unit dose amount. In some embodiments, different doses in the dosing regimen are different amounts. In some embodiments, the dosing regimen comprises a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is different from the amount of the first dose. In some embodiments, the dosing regimen includes a first dose in a first dose amount, followed by one or more additional doses in a second dose amount that is the same as the first dose amount. In some embodiments, the dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (e.g., is a therapeutic dosing regimen).

[0100] II. Influenza Compositions There may be situations where people are at risk of infection with more than one strain of influenza virus. RNA (e.g., mRNA) therapeutic vaccines are particularly suited to combination vaccination approaches due to a number of factors, including, but not limited to, speed of production, the ability to rapidly adapt vaccines to accommodate perceived geographic threats, etc. Furthermore, because vaccines utilize the human body to produce antigenic proteins, they are well suited to the production of larger, more complex antigenic proteins in human subjects, allowing for proper folding, surface expression, antigen presentation, etc. To protect against more than one strain of influenza, a combination vaccine may be administered that includes RNA (e.g., mRNA) encoding at least one antigenic polypeptide protein (or antigenic portion thereof) of a first influenza virus or organism and further includes RNA encoding at least one antigenic polypeptide protein (or antigenic portion thereof) of a second influenza virus or organism. The RNAs (e.g., mRNAs) may be co-formulated, for example, in a single lipid nanoparticle (LNP), or may be formulated in separate LNPs for co-administration.

[0101] Some embodiments of the present disclosure provide influenza virus (influenza) vaccines (or compositions or immunogenic compositions) comprising at least one RNA polynucleotide having an open reading frame encoding at least one influenza antigen polypeptide or immunogenic fragment thereof (e.g., an immunogenic fragment capable of inducing an immune response against influenza).

[0102] In some embodiments, the at least one antigenic polypeptide is one of the defined antigenic subdomains of HA designated HA1, HA2, or a combination of HA1 and HA2, and at least one antigenic polypeptide selected from neuraminidase (NA), nucleoprotein (NP), matrix protein 1 (M1), matrix protein 2 (M2), nonstructural protein 1 (NS1), and nonstructural protein 2 (NS2).

[0103] In some embodiments, the at least one antigenic polypeptide is HA or a derivative thereof comprising an antigenic sequence derived from HA1 and / or HA2, and at least one antigenic polypeptide selected from NA, NP, M1, M2, NS1 and NS2.

[0104] In some embodiments, the at least one antigenic polypeptide is HA or a derivative thereof comprising an antigenic sequence derived from HA1 and / or HA2, and at least two antigenic polypeptides selected from NA, NP, M1, M2, NS1 and NS2.

[0105] In some embodiments, the vaccine comprises at least one RNA (eg, mRNA) polynucleotide having an open reading frame encoding an influenza virus protein or an immunogenic fragment thereof.

[0106] In some embodiments, the vaccine comprises at least one RNA (eg, mRNA) polynucleotide having an open reading frame encoding multiple influenza virus proteins or immunogenic fragments thereof.

[0107] In some embodiments, the vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an HA protein or an immunogenic fragment thereof (e.g., at least one of HA1, HA2, or a combination of both).

[0108] In some embodiments, the vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an HA protein or immunogenic fragment thereof (e.g., at least one HA1, HA2, or a combination of both of any one of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and / or H18, or a combination of any or all thereof), and at least one other RNA (e.g., mRNA) polynucleotide having an open reading frame encoding a protein selected from an NP protein, an NA protein, an M1 protein, an M2 protein, an NS1 protein, and an NS2 protein obtained from an influenza virus.

[0109] In some embodiments, the vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an HA protein or an immunogenic fragment thereof (e.g., at least one of any one of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and / or H18, or a combination of any or all thereof), and at least two other RNA (e.g., mRNA) polynucleotides having two open reading frames encoding two proteins selected from NP protein, NA protein, M1 protein, M2 protein, NS1 protein, and NS2 protein obtained from an influenza virus.

[0110] In some embodiments, the vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an HA protein or an immunogenic fragment thereof (e.g., at least one of any one of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and / or H18, or a combination of any or all thereof), and at least three other RNA (e.g., mRNA) polynucleotides having three open reading frames encoding three proteins selected from NP protein, NA protein, M protein, M2 protein, NS1 protein, and NS2 protein obtained from an influenza virus.

[0111] In some embodiments, the vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an HA protein or an immunogenic fragment thereof (e.g., at least one of any one of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and / or H18, or a combination of any or all thereof), and at least four other RNA (e.g., mRNA) polynucleotides having four open reading frames encoding four proteins selected from NP protein, NA protein, M1 protein, M2 protein, NS1 protein, and NS2 protein obtained from an influenza virus.

[0112] In some embodiments, the vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an HA protein or an immunogenic fragment thereof (e.g., at least one of any one of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and / or H18, or a combination of any or all thereof), and at least five other RNA (e.g., mRNA) polynucleotides having five open reading frames encoding five proteins selected from NP protein, NA protein, M1 protein, M2 protein, NS1 protein, and NS2 protein obtained from an influenza virus.

[0113] In some embodiments, the vaccine comprises at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding an HA protein or immunogenic fragment thereof (e.g., at least one of any one of H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, H15, H16, H17, and / or H18, or a combination of any or all thereof), an NP protein or immunogenic fragment thereof, an NA protein or immunogenic fragment thereof, an M1 protein or immunogenic fragment thereof, an M2 protein or immunogenic fragment thereof, an NS1 protein or immunogenic fragment thereof, and an NS2 protein or immunogenic fragment thereof obtained from an influenza virus.

[0114] Some embodiments of the present disclosure include the following novel influenza virus polypeptide sequences: H1HA10-Foldon_ΔNgly1; H1HA10TM-PR8 (H1 A / Puerto Rico / 8 / 34 HA); H1HA10-PR8-DS (H1 A / Puerto Rico / 8 / 34 HA); pH1HA10-Cal04-DS (H1 A / California / 04 / 2009 HA); pandemic H1HA10 from California 04; pH1HA10-Ferritin; HA10; pandemic H1HA10 from California 04; pandemic H1HA10 from California 04 strain / without Foldon and with K68C / R76C mutations for trimerization; A / Puerto Rico without Foldon and with Y94D / N95L mutations for trimerization. H1HA10 from the A / Puerto Rico / 8 / 34 strain; H1HA10 from the A / Puerto Rico / 8 / 34 strain without foldon and with the K68C / R76C mutations for trimerization; H1N1 A / Viet Nam / 850 / 2009; H3N2 A / Wisconsin / 67 / 2005; H7N9 (A / Anhui / 1 / 2013); H9N2 A / Hong Kong / 1073 / 99; and H10N8 A / JX346 / 2013.

[0115] Some embodiments of the present disclosure provide influenza virus (influenza) vaccines comprising at least one RNA polynucleotide having an open reading frame encoding at least one influenza antigen polypeptide or immunogenic fragment (e.g., an immunogenic fragment capable of inducing an immune response against influenza) of the novel influenza virus polypeptide sequences described above. In some embodiments, the influenza vaccines comprise at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one influenza antigen polypeptide comprising a modified sequence that is at least 75% identical (e.g., any number between 75% and 100%, inclusive, e.g., 70%, 80%, 85%, 90%, 95%, 99%, and 100%) to the amino acid sequence of the novel influenza virus sequences described above. The modified sequence may be at least 75% identical (e.g., any number between 75% and 100%, inclusive, e.g., 70%, 80%, 85%, 90%, 95%, 99%, and 100%) to the amino acid sequence of the novel influenza virus sequences described above.

[0116] Some embodiments of the present disclosure provide isolated nucleic acids comprising sequences encoding the novel influenza virus polypeptide sequences described above; expression vectors comprising the nucleic acids; and host cells comprising the nucleic acids. The present disclosure also provides methods for producing polypeptides of any of the novel influenza virus sequences described above. The methods may include culturing host cells in a medium under conditions that allow nucleic acid expression of the novel influenza virus sequences described above, and purifying the novel influenza virus polypeptides from the cultured cells or cell medium. The present disclosure also provides antibody molecules, including full-length antibodies and antibody derivatives, against the novel influenza virus sequences.

[0117] In some embodiments, the open reading frame of an RNA (e.g., mRNA) vaccine is codon-optimized. In some embodiments, the open reading frame encoding an influenza polypeptide or fragment thereof is codon-optimized. Some embodiments provide for the use of an influenza vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one influenza antigen polypeptide or immunogenic fragment thereof, wherein at least 80% (e.g., 85%, 90%, 95%, 98%, 99%, 100%) of the uracils in the open reading frame have a chemical modification, and optionally, the vaccine is formulated in a lipid nanoparticle. In some embodiments, 100% of the uracils in the open reading frame have a chemical modification. In some embodiments, the chemical modification is at the 5-position of the uracil. In some preferred embodiments, the chemical modification is N1-methylpseudouridine.

[0118] In some embodiments, the RNA (eg, mRNA) vaccine further comprises an adjuvant.

[0119] In some embodiments, the at least one RNA polynucleotide encodes at least one influenza antigen polypeptide that attaches to a cellular receptor.

[0120] In some embodiments, the at least one RNA polynucleotide encodes at least one influenza antigen polypeptide that causes fusion of viral and cellular membranes.

[0121] In some embodiments, the at least one RNA polynucleotide encodes at least one influenza antigen polypeptide that is responsible for binding of the virus to an infected cell.

[0122] Some embodiments of the present disclosure provide a vaccine comprising at least one ribonucleic acid (RNA) (e.g., mRNA) polynucleotide having an open reading frame encoding at least one influenza antigen polypeptide, at least one 5'-end cap, and at least one chemical modification, formulated within a lipid nanoparticle.

[0123] In some embodiments, the 5' end cap is 7mG(5')ppp(5')NlmpNp. In some preferred embodiments, the 5' cap is

[0124] [ka] In some embodiments, the at least one chemical modification is selected from pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2'-O-methyluridine. In some embodiments, the chemical modification is at the 5-position of uracil. In some embodiments, the chemical modification is N1-methylpseudouridine. In some embodiments, the chemical modification is N1-ethylpseudouridine.

[0125] In some embodiments, the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. In some embodiments, the cationic lipid is an ionizable cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol. In some embodiments, the cationic lipid is selected from the group consisting of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioate (L319), (12Z,15Z)-N,N-dimethyl-2-nonylhenicosa-12,15-dien-1-amine (L608), and N,N-dimethyl-1-[(1S,2R)-2-octylcyclopropyl]heptadecan-8-amine (L530).

[0126] Some embodiments of the present disclosure provide vaccines comprising at least one RNA (e.g., mRNA) polynucleotide having an open reading frame encoding at least one influenza antigen polypeptide, wherein at least 80% (e.g., 85%, 90%, 95%, 98%, 99%) of the uracils in the open reading frame have chemical modifications, and optionally, the vaccine is formulated in lipid nanoparticles (e.g., the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid).

[0127] In some embodiments, 100% of the uracils in the open reading frame have a chemical modification. In some embodiments, the chemical modification is at the 5-position of the uracil. In some embodiments, the chemical modification is N1-methylpseudouridine. In some embodiments, 100% of the uracils in the open reading frame have N1-methylpseudouridine at the 5-position of the uracil.

[0128] In some embodiments, the open reading frame of the RNA (e.g., mRNA) polynucleotide encodes at least one influenza antigen polypeptide. In some embodiments, the open reading frame encodes at least two, at least five, or at least 10 antigen polypeptides. In some embodiments, the open reading frame encodes at least 100 antigen polypeptides. In some embodiments, the open reading frame encodes between 1 and 100 antigen polypeptides.

[0129] In some embodiments, the vaccine comprises at least two RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one influenza antigen polypeptide. In some embodiments, the vaccine comprises at least five or at least ten RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one antigen polypeptide or immunogenic fragment thereof. In some embodiments, the vaccine comprises at least 100 RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one antigen polypeptide. In some embodiments, the vaccine comprises between 2 and 100 RNA (e.g., mRNA) polynucleotides, each having an open reading frame encoding at least one antigen polypeptide.

[0130] Also provided herein is the influenza RNA (eg, mRNA) vaccine of any one of the preceding paragraphs formulated in a nanoparticle (eg, a lipid nanoparticle).

[0131] In some embodiments, the nanoparticles have an average diameter of 50-200 nm. In some embodiments, the nanoparticles are lipid nanoparticles. In some embodiments, the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. In some embodiments, the lipid nanoparticles comprise a molar ratio of about 20-60% cationic lipid, 0.5-15% PEG-modified lipid, 25-55% sterol, and 25% non-cationic lipid. In some embodiments, the cationic lipid is an ionizable cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol.

[0132] In some embodiments, the nanoparticles have a polydispersity value of less than 0.4 (eg, less than 0.3, 0.2, or 0.1).

[0133] In some embodiments, the nanoparticles have a net positive charge at neutral pH values.

[0134] In some embodiments, the RNA (eg, mRNA) vaccine is multivalent.

[0135] Some embodiments of the present disclosure provide a method for inducing an antigen-specific immune response in a subject, the method comprising administering to the subject an effective amount of any of the RNA (e.g., mRNA) vaccines provided herein to generate an antigen-specific immune response. In some embodiments, the RNA (e.g., mRNA) vaccine is an influenza vaccine. In some embodiments, the RNA (e.g., mRNA) vaccine is a combination vaccine (broad-spectrum influenza vaccine) comprising a combination of influenza vaccines.

[0136] In some embodiments, the antigen-specific immune response comprises a T cell response or a B cell response.

[0137] In some embodiments, the method of generating an antigen-specific immune response comprises administering to a subject a single dose (but not a booster dose) of an influenza RNA (eg, mRNA) vaccine of the present disclosure.

[0138] In some embodiments, the method further comprises administering to the subject a second (booster) dose of an influenza RNA (e.g., mRNA) vaccine. Additional doses of an influenza RNA (e.g., mRNA) vaccine may be administered.

[0139] In some embodiments, subjects exhibit a seroconversion rate of at least 80% (e.g., at least 85%, at least 90%, or at least 95%) after the first or second (booster) dose of vaccine. Seroconversion is the period during which specific antibodies develop and become detectable in the blood. After seroconversion occurs, the virus can be detected in a blood test for antibodies. During infection or immunization, antigens enter the blood and the immune system responds by starting to produce antibodies. Before seroconversion, the antigen itself may or may not be detectable, but antibodies are considered absent. During seroconversion, antibodies are present but not yet detectable. At any time after seroconversion, antibodies can be detected in the blood, indicating a previous or current infection.

[0140] In some embodiments, the influenza RNA (e.g., mRNA) vaccine is administered to the subject by intradermal injection, intramuscular injection, or intranasal administration. In some embodiments, the influenza RNA (e.g., mRNA) vaccine is administered to the subject by intramuscular injection.

[0141] Some embodiments of the present disclosure provide methods of inducing an antigen-specific immune response in a subject, the method comprising administering to the subject an influenza RNA (e.g., mRNA) vaccine in an amount effective to generate an antigen-specific immune response in the subject. The antigen-specific immune response in a subject may, in some embodiments, be determined by assaying for antibody titers (for titers of antibodies that bind to influenza antigen polypeptides) after administration of any of the influenza RNA (e.g., mRNA) vaccines of the present disclosure to the subject. In some embodiments, the anti-antigen polypeptide antibody titers generated in the subject are increased by at least 1 log compared to a control. In some embodiments, the anti-antigen polypeptide antibody titers generated in the subject are increased by 1 to 3 logs compared to a control.

[0142] In some embodiments, the anti-antigen polypeptide antibody titer produced in the subject is increased by at least 2-fold compared to a control. In some embodiments, the anti-antigen polypeptide antibody titer produced in the subject is increased by at least 5-fold compared to a control. In some embodiments, the anti-antigen polypeptide antibody titer produced in the subject is increased by at least 10-fold compared to a control. In some embodiments, the anti-antigen polypeptide antibody titer produced in the subject is increased by 2-10-fold compared to a control.

[0143] In some embodiments, the control is an anti-antigen polypeptide antibody titer generated in a subject not administered an RNA (e.g., mRNA) vaccine of the present disclosure. In some embodiments, the control is an anti-antigen polypeptide antibody titer generated in a subject administered live attenuated or inactivated influenza, or the control is an anti-antigen polypeptide antibody titer generated in a subject administered a recombinant or purified influenza protein vaccine. In some embodiments, the control is an anti-antigen polypeptide antibody titer generated in a subject administered an influenza virus-like particle (VLP) vaccine.

[0144] The RNA (e.g., mRNA) vaccines of the present disclosure are administered to a subject in an effective amount (an amount effective to induce an immune response). In some embodiments, an effective amount is a dose equivalent to a 2-fold, 4-fold, 10-fold, 100-fold, or 1000-fold reduction of the standard therapeutic dose of a recombinant influenza protein vaccine, such that the anti-antigen polypeptide antibody titer generated in the subject is equivalent to the anti-antigen polypeptide antibody titer generated in a control subject administered a standard therapeutic dose of the recombinant influenza protein vaccine, purified influenza protein vaccine, live attenuated influenza vaccine, inactivated influenza vaccine, or influenza VLP vaccine. In some embodiments, an effective amount is a dose equivalent to a 2- to 1000-fold reduction of the standard therapeutic dose of a recombinant influenza protein vaccine, such that the anti-antigen polypeptide antibody titer generated in the subject is equivalent to the anti-antigen polypeptide antibody titer generated in a control subject administered a standard therapeutic dose of the recombinant influenza protein vaccine, purified influenza protein vaccine, live attenuated influenza vaccine, inactivated influenza vaccine, or influenza VLP vaccine.

[0145] In some embodiments, the control is an anti-antigen polypeptide antibody titer generated in a subject administered a virus-like particle (VLP) vaccine comprising influenza structural proteins.

[0146] In some embodiments, the RNA (eg, mRNA) vaccine is formulated in an amount effective to generate an antigen-specific immune response in a subject.

[0147] In some embodiments, the effective amount is a total dose of 25 μg to 1000 μg, or 50 μg to 1000 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a 25 μg dose administered to a subject a total of two times. In some embodiments, the effective amount is a 100 μg dose administered to a subject a total of two times. In some embodiments, the effective amount is a 400 μg dose administered to a subject a total of two times. In some embodiments, the effective amount is a 500 μg dose administered to a subject a total of two times.

[0148] In some embodiments, the efficacy (or effectiveness) of an RNA (e.g., mRNA) vaccine is greater than 60%. In some embodiments, the RNA (e.g., mRNA) polynucleotide of the vaccine is at least one influenza antigen polypeptide.

[0149] In some embodiments, the efficacy (or effectiveness) of an RNA (eg, mRNA) vaccine is at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90%.

[0150] In some embodiments, the vaccine immunizes a subject against influenza for up to 2 years, hi some embodiments, the vaccine immunizes a subject against influenza for more than 2 years, more than 3 years, more than 4 years, or 5-10 years.

[0151] In some embodiments, the subject is about 5 years old or younger. For example, the subject may be about 1 year old to about 5 years old (e.g., about 1, 2, 3, 5, or 5 years old), or about 6 months old to about 1 year old (e.g., about 6, 7, 8, 9, 10, 11, or 12 months old). In some embodiments, the subject is about 12 months old or younger (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 month old). In some embodiments, the subject is about 6 months old or younger.

[0152] In some embodiments, the subject was born at full term (e.g., about 37-42 weeks). In some embodiments, the subject was born prematurely, e.g., at about 36 weeks of gestation or earlier (e.g., about 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, or 25 weeks). For example, the subject may be born at about 32 weeks of gestation or earlier. In some embodiments, the subject was born prematurely, at about 32 to about 36 weeks of gestation. In such subjects, an RNA (e.g., mRNA) vaccine may be administered later in life, e.g., at about 6 months to about 5 years of age, or older.

[0153] In some embodiments, the subject is a young adult between about 20 and about 50 years of age (eg, about 20, 25, 30, 35, 40, 45, or 50 years of age).

[0154] In some embodiments, the subject is an elderly subject, about 60 years of age, about 70 years of age, or older (eg, about 60, 65, 70, 75, 80, 85, or 90 years of age).

[0155] In some embodiments, the subject has been exposed to influenza (e.g., C. trachomatis); the subject is infected with influenza (e.g., C. trachomatis); or the subject is at risk of infection by influenza (e.g., C. trachomatis).

[0156] In some embodiments, the subject has been exposed to a betacoronavirus (e.g., SARS-CoV-2); the subject is infected with a betacoronavirus (e.g., SARS-CoV-2); or the subject is at risk for infection by a betacoronavirus (e.g., SARS-CoV-2).

[0157] In some embodiments, the subject has received at least one dose of an immunogenic composition against a betacoronavirus (e.g., SARS-CoV-2), e.g., selected from any one of COMIRNATY®, Pfizer-BioNTech COVID-19 vaccine, Moderna mRNA-1273 COVID-19 vaccine, and Janssen COVID-19 vaccine; the subject has received at least two doses of an immunogenic composition against a betacoronavirus (e.g., SARS-CoV-2); the subject has received at least one dose of an immunogenic composition against a betacoronavirus (e.g., SARS-CoV-2), e.g., selected from any one of COMIRNATY®, Pfizer-BioNTech COVID-19 vaccine, Moderna mRNA-1273 COVID-19 vaccine, and Janssen COVID-19 vaccine. or the subject is at risk of infection with a betacoronavirus (e.g., SARS-CoV-2) selected from any one of the COVID-19 vaccines; or the subject has been administered an immunogenic composition against a betacoronavirus (e.g., SARS-CoV-2) selected from any one of the following COVID-19 vaccines concurrently, simultaneously, or within 12 to 48 hours of any one of the immunogenic compositions against influenza disclosed herein, e.g., COMIRNATY®, the Pfizer-BioNTech COVID-19 vaccine, the Moderna mRNA-1273 COVID-19 vaccine, and the Janssen COVID-19 vaccine.

[0158] In some embodiments, the subject is immunocompromised (having a dysfunctional immune system, eg, having an immune disorder or an autoimmune disorder).

[0159] In some embodiments, the nucleic acid vaccines described herein are chemically modified. In other embodiments, the nucleic acid vaccines are unmodified.

[0160] Yet other embodiments provide compositions and methods for vaccinating a subject, comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first viral antigen polypeptide, wherein the RNA polynucleotides do not comprise a stabilizing element, and wherein an adjuvant is not co-formulated or co-administered with the vaccine.

[0161]

[0013] In other aspects, disclosed herein are compositions and methods for vaccinating a subject, comprising administering to the subject a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein a dosage of 10 μg / kg to 400 μg / kg of the nucleic acid vaccine is administered to the subject. In some embodiments, the dosage of the RNA polynucleotide is 1-5 μg, 5-10 μg, 10-15 μg, 15-20 μg, 10-25 μg, 20-25 μg, 20-50 μg, 30-50 μg, 40-50 μg, 40-60 μg, 60-80 μg, 60-100 μg, 50-100 μg, 80-120 μg, 40-120 μg, 40-150 μg, 50-150 μg, 50-200 μg, or 80-200 μg per dose. , 100-200 μg, 120-250 μg, 150-250 μg, 180-280 μg, 200-300 μg, 50-300 μg, 80-300 μg, 100-300 μg, 40-300 μg, 50-350 μg, 100-350 μg, 200-350 μg, 300-350 μg, 320-400 μg, 40-380 μg, 40-100 μg, 100-400 μg, 200-400 μg, or 300-400 μg. In some embodiments, the nucleic acid vaccine is administered to the subject by intradermal or intramuscular injection. In some embodiments, the nucleic acid vaccine is administered to the subject on day zero. In some embodiments, a second dose of the nucleic acid vaccine is administered to the subject on day 21.

[0162] In some embodiments, a 25 microgram dosage of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a 100 microgram dosage of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a 50 microgram dosage of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a 75 microgram dosage of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a 150 microgram dosage of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a 400 microgram dosage of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, a 200 microgram dosage of the RNA polynucleotide is included in the nucleic acid vaccine administered to the subject. In some embodiments, the RNA polynucleotide accumulates at 100-fold higher levels in local lymph nodes compared to distal lymph nodes. In other embodiments, the nucleic acid vaccine is chemically modified, and in other embodiments, the nucleic acid vaccine is not chemically modified.

[0163] The present disclosure provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigen polypeptide, wherein the RNA polynucleotide does not contain a stabilizing element, and a pharmaceutically acceptable carrier or excipient, wherein the vaccine does not contain an adjuvant. In some embodiments, the stabilizing element is a histone stem loop. In some embodiments, the stabilizing element is a nucleic acid sequence with increased GC content compared to wild-type sequence.

[0164] An aspect of the present disclosure provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigen polypeptide, wherein the RNA polynucleotides are present in a formulation for in vivo administration to a host, and which confers an antibody titer superior to the standard for seroprotection against the first antigen for an acceptable percentage of human subjects. In some embodiments, the antibody titer generated by the mRNA vaccine of the present disclosure is a neutralizing antibody titer. In some embodiments, the neutralizing antibody titer is higher than that of a protein vaccine. In other embodiments, the neutralizing antibody titer generated by the mRNA vaccine of the present disclosure is higher than that of an adjuvanted protein vaccine. In still other embodiments, the neutralizing antibody titer generated by the mRNA vaccines of the present disclosure is 1,000-10,000, 1,200-10,000, 1,400-10,000, 1,500-10,000, 1,000-5,000, 1,000-4,000, 1,800-10,000, 2,000-10,000, 2,000-5,000, 2,000-3,000, 2,000-4,000, 3,000-5,000, 3,000-4,000, or 2,000-2,500. Neutralizing titers are typically expressed as the highest serum dilution required to achieve a 50% reduction in plaque counts.

[0165] Also provided is a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame encoding a first antigenic polypeptide, wherein the RNA polynucleotides have a stabilizing element or are formulated with an adjuvant and are present in a formulation for in vivo administration to a host to induce a high antibody titer that lasts longer than that induced by an mRNA vaccine encoding the first antigenic polypeptide. In some embodiments, the RNA polynucleotide is formulated to produce neutralizing antibodies within one week of a single administration. In some embodiments, the adjuvant is selected from a cationic peptide and an immunostimulatory nucleic acid. In some embodiments, the cationic peptide is protamine. In some preferred embodiments, the lyophilized composition does not contain protamine.

[0166] An embodiment provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame, which may or may not contain modified nucleotides, and which open reading frame encodes a first antigenic polypeptide, and which RNA polynucleotides are present in a formulation for in vivo administration to a host such that the level of antigen expression in the host significantly exceeds the level of antigen expression produced by an mRNA vaccine that has a stabilizing element or is formulated with an adjuvant and encodes the first antigenic polypeptide.

[0167] Another aspect provides a nucleic acid vaccine comprising one or more RNA polynucleotides having an open reading frame, which may contain at least one chemical modification or may contain no modified nucleotides, wherein the open reading frame encodes a first antigen polypeptide, and the vaccine comprises at least one-tenth the amount of RNA polynucleotide required for an unmodified mRNA vaccine to generate equivalent antibody titers. In some embodiments, the RNA polynucleotide is present in a dosage of 25-100 micrograms.

[0168] Aspects of the present disclosure also provide a unit of use vaccine comprising 10 μg to 400 μg of one or more RNA polynucleotides having an open reading frame, which may or may not contain at least one chemical modification, encoding a first antigenic polypeptide, formulated for delivery to a human subject, and a pharmaceutically acceptable carrier or excipient. In some embodiments, the vaccine further comprises cationic lipid nanoparticles.

[0169] An aspect of the present disclosure provides a method for creating, maintaining, or restoring antigenic memory against a viral strain in an individual or a population of individuals, the method comprising administering to the individual or population an antigenic memory booster nucleic acid vaccine comprising: (a) at least one RNA polynucleotide, the polynucleotide comprising at least one chemical modification or optionally no modified nucleotides, and comprising two or more codon-optimized open reading frames, the open reading frames encoding a set of reference antigen polypeptides; and (b) optionally a pharmaceutically acceptable carrier or excipient. In some embodiments, the vaccine is administered to the individual via a route selected from the group consisting of intramuscular administration, intradermal administration, and subcutaneous administration. In some embodiments, the administering step comprises contacting the subject's muscle tissue with a device suitable for injecting the composition. In some embodiments, the administering step comprises contacting the subject's muscle tissue with a device suitable for injecting the composition in combination with electroporation.

[0170] In some aspects, methods for inducing an antigen-specific immune response in a subject are provided. The methods include administering to the subject an influenza RNA composition in an amount effective to generate an antigen-specific immune response. In some embodiments, the antigen-specific immune response includes a T cell response or a B cell response. In some embodiments, the antigen-specific immune response includes a T cell response and a B cell response. In some embodiments, the method for generating an antigen-specific immune response includes a single administration of a vaccine. In some embodiments, the method further includes administering a booster dose of the vaccine to the subject. In some embodiments, the vaccine is administered to the subject by intradermal or intramuscular injection.

[0171] In exemplary embodiments of the present disclosure, an effective vaccine generates antibody titers greater than 1:40, greater than 1:100, greater than 1:400, greater than 1:1000, greater than 1:2000, greater than 1:3000, greater than 1:4000, greater than 1:500, greater than 1:6000, greater than 1:7500, or greater than 1:10000. In exemplary embodiments, antibody titers are generated or achieved by 10 days after vaccination, by 20 days after vaccination, by 30 days after vaccination, by 40 days after vaccination, or by 50 or more days after vaccination. In exemplary embodiments, titers are generated or achieved after a single dose of vaccine is administered to a subject. In other embodiments, titers are generated or achieved after multiple doses, for example, after a first and second dose (e.g., a booster dose). In exemplary aspects of the present disclosure, antigen-specific antibodies are measured in units of μg / ml, or in units of IU / L (International Units per Liter) or mIU / ml (milli-International Units per ml). In exemplary embodiments of the present disclosure, an effective vaccine produces >0.5 μg / ml, >0.1 μg / ml, >0.2 μg / ml, >0.35 μg / ml, >0.5 μg / ml, >1 μg / ml, >2 μg / ml, >5 μg / ml, or >10 μg / ml. In exemplary embodiments of the present disclosure, an effective vaccine produces >10 mIU / ml, >20 mIU / ml, >50 mIU / ml, >100 mIU / ml, >200 mIU / ml, >500 mIU / ml, or >1000 mIU / ml. In exemplary embodiments, the antibody level or concentration is generated or achieved by 10 days after vaccination, by 20 days after vaccination, by 30 days after vaccination, by 40 days after vaccination, or by 50 or more days after vaccination. In exemplary embodiments, the level or concentration is generated or achieved after a single dose of vaccine is administered to a subject. In other embodiments, the level or concentration is generated or achieved after multiple doses, for example, after a first and second dose (e.g., a booster dose).In an exemplary embodiment, the antibody level or concentration is determined or measured by an enzyme-linked immunosorbent assay (ELISA). In an exemplary embodiment, the antibody level or concentration is determined or measured by a neutralization assay, for example, a microneutralization assay.

[0172] III. Respiratory syncytial virus (RSV) In some embodiments, the present disclosure provides mutants of wild-type RSV F proteins that exhibit the introduction of amino acid sequence mutations compared to the corresponding amino acid sequence of the wild-type RSV F protein and are immunogenic against the wild-type RSV F protein or against viruses containing the wild-type F protein. The amino acid mutations in the mutants include amino acid substitutions, deletions, or additions compared to the wild-type RSV F protein.

[0173] In some embodiments, the present disclosure provides mutants of wild-type RSV F proteins, wherein the introduced amino acid mutation is a mutation of a pair of amino acid residues in the wild-type RSV F protein to a pair of cysteines ("engineered disulfide mutations"). Introduction of a pair of cysteine ​​residues allows for the formation of disulfide bonds between cysteine ​​residues, which stabilizes the conformation or oligomeric state of the protein, for example, the pre-fusion conformation. Examples of specific pairs of such mutations include 55C and 188C; 155C and 290C; 103C and 148C; and 142C and 371C, such as S55C and L188C; S155C and S290C; T103C and I148C; and L142C and N371C.

[0174] In some embodiments, the mutant of the wild-type RSV F protein comprises an F1 polypeptide and an F2 polypeptide, wherein the mutant comprises at least one introduced amino acid mutation compared to the amino acid sequence of the wild-type RSV F protein, wherein the introduced amino acid mutation is a pair of cysteine ​​mutations selected from the group consisting of: (1) 55C and 188C; (2) 103C and 148C; and (3) 142C and 371C, wherein the amino acid positions are numbered according to SEQ ID NO: 1. In some embodiments, the mutant further comprises at least one cavity-filling mutation and at least one electrostatic mutation, the cavity-filling mutations being (1) a substitution of the amino acid at position 62, 155, 190, or 290 with I, Y, L, H, or M; (2) a substitution of the amino acid at position 54, 58, 189, 219, or 397 with I, Y, L, H, or M; (3) a substitution of the amino acid at position 151 with A or H; (4) a substitution of the amino acid at position 147 or 298 with I, L, H, or M; and (5) a substitution of the amino acid at position 164, 187, 192, 200, 202, 204, 206, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 260, 261, 262, 263, 264, 265, 266, 267 The electrostatic mutation is selected from the group consisting of: (1) substitution of the amino acid at position 82, 92, or 487 with D, F, Q, T, S, L, or H; (2) substitution of the amino acid at position 315, 394, or 399 with F, M, R, S, L, I, Q, or T; (3) substitution of the amino acid at position 392, 486, or 489 with H, S, N, T, or P; and (4) substitution of the amino acid at position 106 or 339 with F, Q, N, or W.

[0175] In some embodiments, the mutant of a wild-type respiratory syncytial virus (RSV) F protein comprises an F1 polypeptide and an F2 polypeptide, and the mutant comprises at least one introduced amino acid mutation compared to the amino acid sequence of the wild-type RSV F protein, wherein the introduced amino acid mutation comprises one or more cavity-filling mutations selected from the group consisting of: (i) a pair of cysteine ​​mutations 155C and 290C; and (ii) 1) a substitution of the amino acid at position 190 with I; 2) a substitution of the amino acid at position 54 with I, Y, L, H, or M; 3) a substitution of the amino acid at position 296 with I, Y, or H, wherein the amino acid positions are numbered according to SEQ ID NO: 1. In some embodiments, the cavity-filling mutation is selected from the group consisting of: (1) a substitution of the amino acid at position 190 with I; (2) a substitution of the amino acid at position 54 with H; and (3) a substitution of the amino acid at position 296 with I. In some embodiments, the mutant is in the form of a trimer. In some embodiments, the mutant has increased stability compared to the corresponding wild-type RSV F protein, where stability is measured by binding of the mutant to the antibody AM14. In some embodiments, the wild-type RSV is subtype A or subtype B. In some embodiments, the cavity-filling mutation is selected from the group consisting of 54H, 190I, and 296I. In some embodiments, the mutant further comprises an electrostatic mutation. In some embodiments, the electrostatic mutation is selected from the group consisting of: (1) a substitution of an amino acid at position 82, 92, or 487 with D, F, Q, T, S, L, or H; (2) a substitution of an amino acid at position 315, 394, or 399 with F, M, R, S, L, I, Q, or T; (3) a substitution of an amino acid at position 392, 486, or 489 with H, S, N, T, or P; and (4) a substitution of an amino acid at position 106 or 339 with F, Q, N, or W.In some embodiments, the mutant of the wild-type RSV F protein comprises an F1 polypeptide and an F2 polypeptide, and the mutant comprises at least one introduced amino acid mutation compared to the amino acid sequence of the wild-type RSV F protein, wherein the introduced amino acid mutations include (i) a pair of cysteine ​​mutations 155C and 290C; (ii) a cavity-filling mutation; and (iii) an electrostatic mutation, wherein the cavity-filling mutation is (1) a substitution of the amino acid at position 62 with I, Y, L, H, or M; (2) a substitution of the amino acid at position 190 with I; (3) a substitution of 54, 58, 189, 219, or (4) a substitution of the amino acid at position 151 with A or H; (5) a substitution of the amino acid at position 147 or 298 with I, L, H, or M; and (6) a substitution of the amino acid at position 164, 187, 192, 207, 220, 296, 300, or 495 with I, Y, or H, wherein the electrostatic mutation is 486S, and the amino acid positions are numbered according to SEQ ID NO:1. In some embodiments, the mutants are selected from the group consisting of: (1) a combination of 155C, 290C, and 54H; (2) a combination of 155C, 290C, and 296I; (3) a combination of 155C, 290C, 54H, and 296Y; (4) a combination of 155C, 290C, and 190I; (5) a combination of 155C, 290C, 54H, and 190I; (6) a combination of 155C, 290C, 54H, and 496S; (7) a combination of 155C, 290C, 190I, and 486S; (8) a combination of 155C, 290C, 296I; and 486S; (9 (10) a combination of 155C, 290C, 54H, 190I; and 486S; (11) a combination of 155C, 290C, 190I, 296I, and 485S; (12) a combination of 155C, 290C, 54H, 190I, 296I, and 486S; (13) a combination of 155C, 290C, 190I, and 296I; and (14) a combination of 155C, 290C, 54H, 190I, and 296I.In some embodiments, the mutant of the wild-type RSV F protein comprises an F1 polypeptide and an F2 polypeptide, and the mutant comprises at least one introduced amino acid mutation compared to the amino acid sequence of the wild-type RSV F protein, wherein the introduced amino acid mutations include (i) a pair of cysteine ​​mutations 155C and 290C; (ii) at least one cavity-filling mutation; and (iii) at least one pair of cysteine ​​mutations in the HRB region, wherein the cavity-filling mutations include (1) a substitution of the amino acid at position 62 with I, Y, L, H, or M; (2) a substitution of the amino acid at position 190 with I; (3) a substitution of the amino acid at positions 54, 58, 189, 219, or 397 with I, Y, L, H, or M. (4) a substitution of the amino acid at position 151 with A or H; (5) a substitution of the amino acid at position 147 or 298 with I, L, H, or M; and (6) a substitution of the amino acid at positions 164, 187, 192, 207, 220, 296, 300, or 495 with I, Y, or H, wherein at least one pair of cysteine ​​mutations in the HRB region is selected from the group consisting of: (1) 508C and 509C; (2) 515C and 516C; and (3) 522C and 523C, wherein the amino acid positions are numbered according to SEQ ID NO: 1. In some embodiments, the disclosure provides a pharmaceutical composition comprising (i) a RSV F protein mutant described herein, and (ii) a pharmaceutically acceptable carrier. In some embodiments, the F1 polypeptide and F2 polypeptide of the pharmaceutical composition are derived from the F protein of RSV subtype B. In some embodiments, the F1 and F2 polypeptides of the pharmaceutical composition are derived from the F protein of RSV subtype A. In some embodiments, the pharmaceutical composition further comprises a second mutant of the wild-type RSV F protein described herein, wherein the F1 and F2 polypeptides of the second mutant are derived from the F protein of RSV subtype B. In some embodiments, the pharmaceutical composition is a vaccine. In some embodiments, the present disclosure provides a nucleic acid molecule (e.g., as described below) comprising a nucleotide sequence encoding the amino acid sequence of the RSV F protein mutant of claim 1.

[0176] In some embodiments, the present disclosure provides a method for preventing RSV infection in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein. In some embodiments, the present disclosure provides a pharmaceutical composition comprising (i) a RSV F protein mutant described herein, and (ii) a pharmaceutically acceptable carrier. In some embodiments, the present disclosure provides a method for preventing RSV infection in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition described herein.

[0177] The present disclosure provides an RNA molecule (e.g., an RNA polynucleotide) comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. The present disclosure also provides an immunogenic composition comprising at least one RNA molecule encoding a RSV polypeptide, which is complexed with one or more lipids, encapsulated in one or more lipids, or formulated with one or more lipids and forms a lipid nanoparticle (LNP). The RSV polypeptide included in the immunogenic composition disclosed herein can be any RSV F protein in a pre-fusion conformation.

[0178] The term "pre-fusion conformation" refers to a structural conformation adopted by a RSV F protein or mutant thereof that can specifically bind to (i) antibody D25 or AM22 when the RSV F protein or mutant is in a monomeric or trimeric form, or (ii) antibody AM14 when the RSV F protein mutant is in a trimeric form. The pre-fusion trimeric conformation is a subset of the pre-fusion conformation.

[0179] The term "post-fusion conformation" refers to a structural conformation adopted by the RSV F protein that does not specifically bind to D25, AM22, or AM14. Native F proteins adopt a post-fusion conformation after fusion of the viral envelope with the host cell membrane. RSV F proteins may also be considered to be in a post-fusion conformation outside the context of a fusion event, for example, when extracted from the membrane under stress conditions such as heat and hypotonicity, when expressed as an ectodomain, or during storage. The term "AM14" refers to the antibody described in International Publication No. WO 2008 / 147196A2, which is incorporated herein by reference in its entirety. The term "AM22" refers to the antibody described in International Publication No. WO 2011 / 043643A1, which is incorporated herein by reference in its entirety. The term "D25" refers to the antibody described in International Publication No. WO 2008 / 147196A2, which is incorporated herein by reference in its entirety.

[0180] In some embodiments, the RSV F protein is a subtype A RSV F protein. In some embodiments, the RSV F protein is a subtype B RSV F protein. In some embodiments, the RSV F protein is a mutant of a wild-type RSV F protein. In some embodiments, the RSV F protein is a subtype A mutant of a wild-type RSV F protein. In some embodiments, the RSV F protein is a subtype B mutant of a wild-type RSV F protein. In some embodiments, the mutants exhibit amino acid sequence mutations compared to the amino acid sequence of the corresponding wild-type RSV F protein and are immunogenic against a wild-type RSV F protein in a pre-fusion conformation or against a virus containing the wild-type F protein. The amino acid mutations in the mutants include amino acid substitutions, deletions, or additions compared to the wild-type RSV F protein.

[0181] In some embodiments, the RSV F protein is a RSV protein mutant described in International Publication No. WO 2017 / 109629, the entire contents of which are incorporated herein by reference.

[0182] In some embodiments, the RSV F protein is a mutant of the wild-type RSV F protein, wherein the introduced amino acid mutation is a mutation of a pair of amino acid residues in the wild-type RSV F protein to a pair of cysteines ("engineered disulfide mutations"). Introduction of a pair of cysteine ​​residues allows for the formation of disulfide bonds between cysteine ​​residues, which stabilizes the conformation or oligomeric state of the protein, for example, the pre-fusion conformation. Examples of specific pairs of such mutations include 55C and 188C; 155C and 290C; 103C and 148C; and 142C and 371C, such as S55C and L188C; S155C and S290C; A103C and I148C; and L142C and N371C.

[0183] In yet another embodiment, the RSV F protein mutant comprises an amino acid mutation that is a mutation that fills one or more cavities. Examples of amino acids that can be replaced with cavity-filling targets include small aliphatic amino acids (e.g., Gly, Ala, and Val) or small polar amino acids (e.g., Ser and Thr), and amino acids that are exposed to the solvent in the post-fusion conformation but buried in the pre-fusion conformation. Examples of replacing amino acids include large aliphatic amino acids (Ile, Leu, and Met) or large aromatic amino acids (His, Phe, Tyr, and Trp). In some specific embodiments, the RSV F protein mutant comprises a cavity-filling mutation selected from the group consisting of: (1) a substitution of S at position 55, 62, 155, 190, or 290 with I, Y, L, H, or M; (2) a substitution of T at position 54, 58, 189, 219, or 397 with I, Y, L, H, or M; (3) a substitution of G at position 151 with A or H; (4) a substitution of A at position 147 or 298 with I, L, H, or M; (5) a substitution of V at position 164, 187, 192, 207, 220, 296, 300, or 495 with I, Y, H; and (6) a substitution of R at position 106 with W.

[0184] In some embodiments, the RSV F protein mutant comprises at least one cavity-filling mutation selected from the group consisting of T54H, S190I, and V296I.

[0185] In yet another embodiment, the RSV F protein mutant comprises an electrostatic mutation that reduces ionic repulsion or increases ionic attraction between residues in the protein that are adjacent to each other in the folded structure. In some embodiments, the RSV F protein mutant comprises an electrostatic substitution that reduces repulsive ionic interactions or increases attractive ionic interactions with the acidic residues Glu487 and Asp489 from another promoter of the RSV F trimer. In some specific embodiments, the RSV F protein mutant comprises an electrostatic mutation selected from the group consisting of: (1) a substitution of E at position 82, 92, or 487 with D, F, Q, T, S, L, or H; (2) a substitution of K at position 315, 394, or 399 with F, M, R, S, L, I, Q, or T; (3) a substitution of D at position 392, 486, or 489 with H, S, N, T, or P; and (4) a substitution of R at position 106 or 339 with F, Q, N, or W.

[0186] In yet another embodiment, the RSV F protein mutant comprises a combination of two or more different types of mutations selected from engineered disulfide mutations, cavity-filling mutations, and electrostatic mutations. In some embodiments, the RSV F protein mutant comprises a combination of two or more different types of mutations selected from the corresponding wild-type RSV The F protein includes combinations of mutations, wherein the combinations of mutations include: (1) a combination of A103C, I148C, S190I, and D486S; (2) a combination of T54H, S55C, L188C, and D486S; (3) a combination of T54H, A103C, I148C, S190I, V296I, and D486S; (4) a combination of T54H, S55C, L142C, L188C, V296I, and N371C; (5) a combination of S55C, L188C, and D486S; (6) a combination of T54H, S55C, L188C, and S190I; (7) a combination of S55C, L188C, and D486S; (8) a combination of T54H, S55C, L188C, S190I, and D486S; (9) a combination of S155C, S190I, S290C, and D486S; (10) a combination of T54H, S55C, L142C, L188C, V296I, N371C, D486S, E487Q, and D489S; (11) a combination of T54H, S155C, S190I, S290C, and V296I, and (12) a combination of S155C, S190F, S290C, and V207L.

[0187] In some embodiments, the RSV F protein is of subtype A and includes mutations S155C, S190F, S290C, and V207L. In some embodiments, the RSV F protein is of subtype B and includes mutations S155C, S190F, S290C, and V207L. In some embodiments, the RSV F protein is of subtype A and includes mutations A103C, I148C, S190I, and D486S. In some embodiments, the RSV F protein is of subtype B and includes mutations A103C, I148C, S190I, and D486S.

[0188] Given the substantial conservation of the RSV F sequence, those skilled in the art can easily compare the amino acid positions between different native RSV F sequences to identify corresponding RSV F amino acid positions between different RSV strains and subtypes. For example, the furin cleavage site is at the same amino acid position across almost all identified native RSV F0 precursor proteins. Therefore, the conservation of native RSV F protein sequences across strains and subtypes allows the use of reference RSV F sequences for comparison of amino acids at specific positions of the RSV F protein. For purposes of this disclosure (unless otherwise indicated by the context), the RSV F protein amino acid positions are given relative to the amino acid sequence of the full-length native F precursor polypeptide of the RSV A2 strain, corresponding to GenInfo Identifier GI 138251 and SwissProt Identifier P03420 (SEQ ID NO: 1).

[0189] In some embodiments, the RSV F protein is a mature form of the RSV F protein, comprising two separate polypeptide chains, i.e., an F1 polypeptide and an F2 polypeptide. In some other embodiments, the F2 polypeptide is linked to the F1 polypeptide by one or two disulfide bonds to form an F2 / F1 heterodimer. In yet other embodiments, the RSV F mutant is in the form of a single-chain protein, in which the F2 polypeptide is linked to the F1 polypeptide by a peptide bond or peptide linker. Any suitable peptide linker for joining the two polypeptide chains together may be used. Examples of such linkers include G, GG, GGG, GS, and SAIG ​​linker sequences. The linker may also be the full-length pep27 sequence or a fragment thereof.

[0190] The F1 polypeptide chain of the mutant may be the same length as the full-length F1 polypeptide of the corresponding wild-type RSV F protein, but may also have deletions, such as deletions of 1 to up to 60 amino acid residues from the C-terminus of the full-length F1 polypeptide. The full-length F1 polypeptide of the RSV F mutant corresponds to amino acids 137-574 of the native RSV F0 precursor and includes (N- to C-terminus) the extracellular domain (residues 137-524), the transmembrane domain (residues 525-550), and the cytoplasmic domain (residues 551-574). It should be noted that the first amino acid residue 514 in the native F1 polypeptide sequence is an optional sequence in the F1 polypeptide of the RSV F protein included in the immunogenic compositions provided herein and therefore may not be present in the mutant F1 polypeptide.

[0191] In some embodiments, the F1 polypeptide of the RSV F mutant lacks the entire cytoplasmic domain. In other embodiments, the F1 polypeptide lacks the cytoplasmic domain and part or all of the transmembrane domain. In some specific embodiments, the mutant comprises an F1 polypeptide in which amino acid residues 510, 511, 512, 513, 514, 515, 520, 525, or 530-574 are absent. Typically, for mutants linked to a trimerization domain, e.g., Foldon, amino acids 514-754 may be absent. Thus, in some specific embodiments, amino acid residues 514-574 are absent in the mutant F1 polypeptide. In yet another specific embodiment, the F1 polypeptide of the RSV F mutant comprises or consists of amino acid residues 137-513 of a native F0 polypeptide sequence, such as any of the alternative F0 precursor sequences, such as those disclosed in SEQ ID NOS: 1, 2, 4, 6, and 81-270 of WO 2017109629, the entire contents of which are incorporated herein by reference.

[0192] The F1 and F2 polypeptides of the RSV F protein mutant into which one or more mutations have been introduced can be derived from any wild-type RSV F protein known in the art or discovered in the future, including, without limitation, the F protein amino acid sequences of RSV subtype A and subtype B strains, including A2 Ontario and Buenos Aires, or any other subtype. In some embodiments, the RSV F mutant comprises an F1 and / or F2 polypeptide from a RSV A virus, for example, an F1 and / or F2 polypeptide from the RSV F0 precursor protein set forth in any one of SEQ ID NOS: 1, 2, 4, 6, and 81-270 of WO 2017109629, into which one or more mutations have been introduced. In some other embodiments, the RSV F mutant comprises an F1 and / or F2 polypeptide from a RSV B virus, for example, an F1 and / or F2 polypeptide from the RSV F0 precursor protein described in any one of SEQ ID NOs: 2 and 211-263 of WO 2017 / 109629, into which one or more mutations have been introduced. In yet other embodiments, the RSV F mutant comprises an F1 and / or F2 polypeptide from a RSV bovine virus, for example, an F1 and / or F2 polypeptide from the RSV F0 precursor protein described in any one of SEQ ID NOs: 264-270 of WO 2017109629, into which one or more mutations have been introduced.

[0193] The term "F0 polypeptide" (F0) refers to the precursor polypeptide of the RSV F protein, which is composed of a signal polypeptide sequence, an F1 polypeptide sequence, a pep27 polypeptide sequence, and an F2 polypeptide sequence. With rare exceptions, the F0 polypeptide of known RSV strains consists of 574 amino acids.

[0194] The term "F1 polypeptide" (F1) refers to the polypeptide chain of the mature RSV F protein. Native F1 contains approximately residues 137-574 of the RSV F0 precursor and is composed (N- to C-terminally) of an extracellular domain (approximately residues 137-524), a transmembrane domain (approximately residues 525-550), and a cytoplasmic domain (approximately residues 551-574). As used herein, this term encompasses both native F1 polypeptides and F1 polypeptides containing modifications (e.g., amino acid substitutions, insertions, or deletions) from the native sequence, such as modifications designed to stabilize or enhance the immunogenicity of RSV F protein mutants.

[0195] The term "F2 polypeptide" (F2) refers to the polypeptide chain of the mature RSV F protein. Native F2 comprises approximately residues 26-109 of the RSV F0 precursor. As used herein, this term encompasses both native F2 polypeptides and F2 polypeptides containing modifications (e.g., amino acid substitutions, insertions, or deletions) from the native sequence, such as modifications designed to stabilize RSV F protein mutants in the pre-fusion conformation or enhance the immunogenicity of RSV F protein mutants. In the native RSV F protein, the F2 polypeptide is linked to the F1 polypeptide by two disulfide bonds to form an F2-F1 heterodimer. The term "Foldon" or "Foldon domain" refers to an amino acid sequence capable of forming a trimer. One example of such a Foldon domain is a peptide sequence derived from bacteriophage T4 fibritin having the sequence GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID NO: 45).

[0196] In some embodiments, the RNA molecule encodes an RSV F protein mutant as disclosed in WO 2009 / 079796, WO 2010 / 149745, WO 2011 / 008974, WO 2014 / 160463, WO 2014 / 174018, WO 2014 / 202570, WO 2015 / 013551, WO 2015 / 177312, WO 2017 / 005848, WO 2017 / 174564, WO 2017 / 005844 and WO 2018 / 109220. The RSV F proteins disclosed in these references are incorporated herein by reference in their entireties.

[0197] Antibodies against the RSV F protein are widespread after natural infection and vaccination and have been shown to neutralize viral activity in vitro. As used herein, the term "respiratory syncytial virus" or "RSV" is not limited to any particular strain or variant.

[0198] In some embodiments, the RNA molecule comprises an open reading frame encoding a RSV antigen. In some embodiments, the RSV antigen is a RSV polypeptide. In some embodiments, the RSV polypeptide is a RSV glycoprotein, or a fragment or variant thereof. In some embodiments, the RNA molecule encodes the RSV F protein.

[0199] In some embodiments, the RSV polypeptide is a full-length RSV polypeptide. In some embodiments, the RSV polypeptide is a truncated RSV polypeptide. In some embodiments, the RSV polypeptide is a variant of a RSV polypeptide. In some embodiments, the RSV polypeptide is a fragment of a RSV polypeptide.

[0200] In some embodiments, the RSV polypeptide is a full-length RSV F protein. In some embodiments, the RSV polypeptide is a truncated RSV F protein. In some embodiments, the RSV polypeptide is a variant of the RSV F protein. In some embodiments, the RSV polypeptide is a fragment of the RSV F protein.

[0201] In some embodiments, the RSV F protein includes at least one mutation. In some embodiments, the RSV F protein includes at least two mutations. In some embodiments, the RSV F protein includes at least three mutations. In some embodiments, the RSV F protein includes at least four mutations. In some embodiments, the RSV F protein includes four mutations.

[0202] In some embodiments, the RNA molecule encodes a RSV F protein of Table 30. In some embodiments, the RNA molecule encodes a RSV F protein, or a fragment or variant thereof, including any of the amino acid sequences of SEQ ID NOs: 1-6. In some embodiments, the RSV F protein has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 162%, 16 %, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98 %, or 99% identity, exactly 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or or 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity between any two of the amino acid sequences in Table 30. In some embodiments, the RSV F protein consists of any of the amino acid sequences in Table 30, such as any of SEQ ID NOs: 1-6.

[0203] In some embodiments, the RNA molecule sequence is transcribed from a DNA nucleic acid sequence (DNA polynucleotide) in Table 31. In some embodiments, the RNA molecule comprises an ORF transcribed from the nucleic acid sequence of any of SEQ ID NOs: 7-10, or a fragment or variant thereof. In some embodiments, the RNA molecule has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or means 99% identity, exact 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or 70%, 71%, 72%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence that may have between any two of the following: 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. In some embodiments, the RNA molecule comprises an ORF transcribed from a nucleic acid sequence consisting of any of the nucleic acid sequences in Table 31, e.g., any of SEQ ID NOs: 7-10.

[0204] In some embodiments, the RNA molecule comprises an ORF comprising an RNA nucleic acid sequence (RNA polynucleotide) of Table 32. In some embodiments, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 11-16, or a fragment or variant thereof. In some embodiments, the RNA molecule has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 1109%, 1110, 112%, 113%, 114%, 115%, 116, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 157%, 158%, 159%, 160%, 161%, 1 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, up to 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 98% , or 99% identity, exact 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, or 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to any two of the RNA nucleic acid sequences in Table 32. In some embodiments, the RNA molecule comprises an ORF comprising a nucleic acid sequence consisting of any of the RNA nucleic acid sequences in Table 32, e.g., any of SEQ ID NOs: 11-16.

[0205] In some embodiments, the RNA molecule comprises stabilized RNA. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine has been replaced by N1-methylpseudouridine. In some embodiments, the RNA molecule comprises a sequence in which all uridines have been replaced by N1-methylpseudouridine (referred to as "Ψ"). In some embodiments, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 11-16, in which all uridines have been replaced by N1-methylpseudouridine (referred to as "Ψ").

[0206] In some embodiments, the RNA molecule is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to any of the RSV F protein sequences of SEQ ID NOS: 1-6 or other RSV pre-fusion F proteins described herein, or up to 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. In some embodiments, the RNA molecule comprises an open reading frame encoding a RSV F protein amino acid sequence consisting of any of SEQ ID NOs: 1-6 or the RSV F protein sequence of any of the other RSV pre-fusion F proteins described herein.

[0207] In some embodiments, the RNA molecule is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, or up to, the nucleic acid sequence of any of SEQ ID NOS: 7-10 or other nucleic acids described herein. The RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence that may be exactly 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or between any two of 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical. In some embodiments, the RNA molecule comprises an open reading frame transcribed from a DNA nucleic acid sequence consisting of any of the nucleic acid sequences of SEQ ID NOs: 7-10 or other nucleic acids described herein.

[0208] In some embodiments, the RNA molecule is at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, or up to, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to, any of the nucleic acid sequences of SEQ ID NOs: 11-16 or other nucleic acids described herein. In some embodiments, the RNA molecule comprises an open reading frame comprising an RNA nucleic acid sequence that is 99%, exactly 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or may be 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical between any two of the sequences. In some embodiments, the RNA molecule comprises an open reading frame comprising an RNA nucleic acid sequence consisting of any of the nucleic acid sequences of SEQ ID NOS: 11-16 (Table 3) or other nucleic acids described herein. In some embodiments, the RNA molecule comprises an ORF comprising the nucleic acid sequence of any of SEQ ID NOs: 11-16 (Table 3), in which all uridines have been replaced by N1-methylpseudouridine (referred to as "Ψ").

[0209] IV.RNA molecules In some embodiments, the RNA molecule described herein is a coding RNA molecule. Coding RNA includes functional RNA molecules that can be translated into peptides or polypeptides. In some embodiments, coding RNA molecules include at least one open reading frame (ORF) that encodes at least one peptide or polypeptide. Open reading frame includes the sequence of codons that can be translated into peptides or proteins. Coding RNA molecules can include one (monocistronic), two (bicistronic) or more (multicistronic) ORFs, which can be the sequence of codons that can be translated into polypeptides or proteins of interest.

[0210] The coding RNA molecule may be a messenger RNA (mRNA) molecule, a viral RNA molecule, or a self-amplifying RNA molecule (saRNA, also referred to as a replicon). In some embodiments, the RNA molecule is mRNA. Preferably, the RNA molecule of the present disclosure is mRNA. In some embodiments, the RNA molecule is modRNA. In some embodiments, the RNA molecule is saRNA. In some embodiments, the saRNA molecule may be a coding RNA molecule.

[0211] An RNA molecule may encode one or more polypeptides of interest, e.g., one or more antigens, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10 or more polypeptides. Alternatively, or additionally, a single RNA molecule may also encode more than one polypeptide of interest, e.g., antigen, and may be, for example, a bicistronic or tricistronic RNA molecule encoding different or the same antigens.

[0212] The sequence of the RNA molecule may be codon-optimized or deoptimized for expression in a desired host, such as a human cell. In some embodiments, the gene of interest (e.g., antigen) described herein is encoded by a coding sequence that is codon-optimized and / or has an increased guanosine / cytidine (G / C) content compared to a wild-type coding sequence. In some embodiments, one or more sequence regions of the coding sequence are codon-optimized and / or have an increased G / C content compared to the corresponding sequence region of a wild-type coding sequence. In some embodiments, codon optimization and / or increased G / C content do not change the sequence of the encoded amino acid sequence.

[0213] The term "codon-optimized" is understood by those skilled in the art to refer to changing the codons in the coding region of a nucleic acid molecule to reflect the typical codon usage of a host organism without changing the amino acid sequence encoded by the nucleic acid molecule.In the context of the present disclosure, in some embodiments, the coding region is codon-optimized for optimal expression in a subject treated with the RNA polynucleotide described herein.Codon optimization is based on the discovery that translation efficiency is also determined by the different frequencies of tRNA molecules present in cells.Therefore, the sequence of RNA may be modified so that codons that are available for frequently occurring tRNA molecules are inserted instead of "rare codons".

[0214] In some embodiments, the G / C content of the coding region of an RNA (e.g., the sequence of a gene of interest) is increased compared to the G / C content of the corresponding coding sequence of a wild-type RNA encoding the gene of interest, and in some embodiments, the amino acid sequence encoded by the RNA is not modified compared to the amino acid sequence encoded by the wild-type RNA. This modification of the RNA sequence is based on the fact that the sequence of any RNA region to be translated is important for the efficient translation of that mRNA. A sequence with an increased G (guanosine) / C (cytidine) content is more stable than a sequence with an increased A (adenosine) / U (uridine) content. In light of the fact that several codons encode the same amino acid (the so-called degeneracy of the genetic code), the most favorable codon for stability can be determined (the so-called alternative codon usage). Depending on the amino acid encoded by the RNA, there are various possibilities for modifying the RNA sequence compared to its wild-type sequence. In particular, codons containing A and / or U nucleosides may be altered by replacing these codons with other codons that encode the same amino acids but that do not contain A and / or U, or that contain a lower content of A and / or U nucleosides. Thus, in some embodiments, the G / C content of the coding region of the RNA described herein is increased by at least 10%, 20%, 30%, 40%, 50%, 55%, up to 10%, 20%, 30%, 40%, 50%, 55%, exactly 10%, 20%, 30%, 40%, 50%, 55%, or between any two of 10%, 20%, 30%, 40%, 50%, 55%, or even higher percentages compared to the G / C content of the coding region of the wild-type RNA.

[0215] In some embodiments, the RNA molecule is from about 20 to about 100,000 nucleotides (e.g., 30-50, 30-100, 30-250, 30-500, 30-1,000, 30-1,500, 30-3,000, 30-5,000, 30-7,000, 30-10,000, 30-25,000, 30-50,000, 30-70,000, 100-250, 100-500, 100-1,000, 100- 1,500, 100-3,000, 100-5,000, 100-7,000, 100-10,000, 100-25,000, 100-50,000, 100-70,000, 100-100,000, 500-1,000, 500-1,500, 500-2,000, 500-3,000, 500-5,000, 500-7,000, 500-10,000, 500-25,000, 500-50,000 , 500~70,000, 500~100,000, 1,000~1,500, 1,000~2,000, 1,000~3,000, 1,000~5,000, 1,000~7,000, 1,000~10,000, 1,000~25,000, 1,000~50,000, 1,000~70,000, 1,000~100,000, 1,500~3,000, 1,500~5,000, 1,500~7,000 0, 1,500–10,000, 1,500–25,000, 1,500–50,000, 1,500–70,000, 1,500–100,000, 2,000–3,000, 2,000–5,000, 2,000–7,000, 2,000–10,000, 2,000–25,000, 2,000–50,000, 2,000–70,000, and 2,000–100,000 nucleotides).

[0216] In some embodiments, the RNA molecule comprises at least 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000 ,7200,7400,7600,7800,8000,8200,8400,8600,8800,9000,9200,9400,9600,9800,10000,10000,12000,14000,16000,18000,20000,22000,24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 6600 0, 68000, 70000, 72000, 74000, 76000, 78000, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000, up to 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 7 20, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400,3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400 , 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000 , 38000, 40000, 42000, 44000, 46000, 48000, 50000, 52000, 54000, 56000, 58000, 60000, 62000, 64000, 66000, 68000, 70000, 72000, 74000, 76000, 7800 0, 80000, 82000, 84000, 86000, 88000, 90000, 92000, 94000, 96000, 98000, or 100000, exactly 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 9 00, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5 000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 1 0000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 36000, 38000, 40000, 42000, 44000, 46000, 48000,50,000, 52,000, 54,000, 56,000, 58,000, 60,000, 62,000, 64,000, 66,000, 68,000, 70,000, 72,000, 74,000, 76,000, 78,000, 80,000, 82,000, 84,000, 86,000, 88,000, 90,000, 92,000, 94,000, 96,000, 98,000, or 100,000, or about 20, 40, 60, 80, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320 , 340, 360, 380, 400, 420, 440, 460, 480, 500, 520, 540, 560, 580, 600, 620, 640, 660, 680, 700, 720, 740, 760, 780, 800, 820, 840, 860, 880, 900, 920, 940, 960, 980, 1000, 1000, 1200, 1400, 1600, 1800, 2000, 2200, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 440 0, 4600, 4800, 5000, 5200, 5400, 5600, 5800, 6000, 6200, 6400, 6600, 6800, 7000, 7200, 7400, 7600, 7800, 8000, 8200, 8400, 8600, 8800, 9000, 9200, 9400, 9600, 9800, 10000, 10000, 12000, 14000, 16000, 18000, 20000, 22000, 24000, 26000, 28000, 30000, 32000, 34000, 3600 The number of nucleotides may be between any two of 0, 38,000, 40,000, 42,000, 44,000, 46,000, 48,000, 50,000, 52,000, 54,000, 56,000, 58,000, 60,000, 62,000, 64,000, 66,000, 68,000, 70,000, 72,000, 74,000, 76,000, 78,000, 80,000, 82,000, 84,000, 86,000, 88,000, 90,000, 92,000, 94,000, 96,000, 98,000, or 100,000.

[0217] In some embodiments, the RNA molecule comprises at least 100 nucleotides. For example, in some embodiments, the RNA has a length of 100 to 15,000 nucleotides; 7,000 to 16,000 nucleotides; 8,000 to 15,000 nucleotides; 9,000 to 12,500 nucleotides; 11,000 to 15,000 nucleotides; 13,000 to 16,000 nucleotides; or 7,000 to 25,000 nucleotides. In some embodiments, the RNA molecule comprises at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 200 0, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450, 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700, 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 59 50, 6000, 6050, 6100, 6150, 6200, 6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450, 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900,7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700, 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950, 10000, 10050, 10100, 10150, 10200, 10250, 10300, 103 50, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 11000, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11 400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 1 2450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500 , 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, up to 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200, 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050,2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300、11350、11400、11450、11500、11550、11600、11650、11700、11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750 , 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 1380 0, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 148 50, 14900, 14950, or 15000 pieces, exactly 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1150, 1200 , 1250, 1300, 1350, 1400, 1450, 1500, 1550, 1600, 1650, 1700, 1750, 1800, 1850, 1900, 1950, 2000, 2050, 2100, 2150, 2200, 2250, 2300, 2350, 2400, 2450 , 2500, 2550, 2600, 2650, 2700, 2750, 2800, 2850, 2900, 2950, ​​3000, 3050, 3100, 3150, 3200, 3250, 3300, 3350, 3400, 3450, 3500, 3550, 3600, 3650, 3700 , 3750, 3800, 3850, 3900, 3950, 4000, 4050, 4100, 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950 , 5000, 5050, 5100, 5150, 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, 6000, 6050, 6100, 6150, 6200,6250, 6300, 6350, 6400, 6450, 6500, 6550, 6600, 6650, 6700, 6750, 6800, 6850, 6900, 6950, 7000, 7050, 7100, 7150, 7200, 7250, 7300, 7350, 7400, 7450 , 7500, 7550, 7600, 7650, 7700, 7750, 7800, 7850, 7900, 7950, 8000, 8050, 8100, 8150, 8200, 8250, 8300, 8350, 8400, 8450, 8500, 8550, 8600, 8650, 8700 , 8750, 8800, 8850, 8900, 8950, 9000, 9050, 9100, 9150, 9200, 9250, 9300, 9350, 9400, 9450, 9500, 9550, 9600, 9650, 9700, 9750, 9800, 9850, 9900, 9950 , 10000, 10050, 10100, 10150, 10200, 10250, 10300, 10350, 10400, 10450, 10500, 10550, 10600, 10650, 10700, 10750, 10800, 10850, 10900, 10950, 1100 0, 11050, 11100, 11150, 11200, 11250, 11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12 050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 1 3100, 13150, 13200, 13250, 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000 pieces, or about 100, 150,200、250、300、350、400、450、500、550、600、650、700、750、800、850、900、950、1000、1050、1100、1150、1200、1250、1300、1350、1400、1450、1500、155、 0、1600、1650、1700、1750、1800、1850、1900、1950、2000、2050、2100、2150、2200、2250、2300、2350、2400、2450、2500、2550、2600、2650、2700、2750、2800、2850、2900、2950、3000、3050、3100、3150、3200、3250、3300、3350、3400、3450、3500、3550、3600、3650、3700、3750、3800、3850、3900、3950、4000、4050、4100、4150、4200、4250、4300、4350、4400、4450、4500、4550、4600、4650、4700、4750、4800、4850、4900、4950、5000、5050、5100、5150、5200、5250、5300、5350、5400、5450、5500、5550、5600、5650、5700、5750、5800、5850、5900、5950、6000、6050、6100、6150、6200、6250、6300、6350、6400、6450、6500、6550、6600、6650、6700、6750、6800、6850、6900、6950、7000、7050、7100、7150、7200、7250、7300、7350、7400、7450、7500、7550、7600、7650、7700、7750、7800、7850、7900、7950、8000、8050、8100、8150、8200、8250、8300、8350、8400、8450、8500、8550、8600、8650、8700、8750、8800、8850、8900、8950、9000、9050、9100、9150、9200、9250、9300、9350、9400、9450、9500、9550、9600、9650、9700、9750、9800、9850、9900、9950、10000、10050、10100、10150、10200、10250、10300、10350、10400、10450、10500、10550、10600、10650、10700、10750、10800、10850、10900、10950、11000、11050、11100、11150、11200、11250、11300, 11350, 11400, 11450, 11500, 11550, 11600, 11650, 11700, 11750, 11800, 11850, 11900, 11950, 12000, 12050, 12100, 12150, 12200, 12250, 12300, 12350, 12400, 12450, 12500, 12550, 12600, 12650, 12700, 12750, 12800, 12850, 12900, 12950, ​​13000, 13050, 13100, 13150, 13200, 13250, The number of nucleotides may be between any two of 13300, 13350, 13400, 13450, 13500, 13550, 13600, 13650, 13700, 13750, 13800, 13850, 13900, 13950, 14000, 14050, 14100, 14150, 14200, 14250, 14300, 14350, 14400, 14450, 14500, 14550, 14600, 14650, 14700, 14750, 14800, 14850, 14900, 14950, or 15000.

[0218] In some embodiments of the present disclosure, the RNA is or comprises a messenger RNA (mRNA) associated with an RNA transcript encoding a polypeptide. In some embodiments, the RNA disclosed herein comprises a 5' cap comprising a 5' cap as disclosed herein; a 5' untranslated region (5'UTR) comprising a cap-proximal sequence; a sequence encoding a payload (e.g., an RSV pre-fusion F protein and / or an influenza antigen); a 3' untranslated region (3'UTR); and / or a polyadenylation (polyA) sequence.

[0219] In some embodiments, the RNAs disclosed herein comprise, in a 5' to 3' direction, the following components: a 5' cap comprising a 5' cap disclosed herein; a 5' untranslated region (5'UTR) comprising a cap-proximal sequence, a sequence encoding a payload (e.g., an RSV pre-fusion F protein and / or an antigen derived from influenza); a 3' untranslated region (3'UTR); and a polyA sequence.

[0220] 1. Modified Nucleobases In the present disclosure, RNA molecule can comprise modified nucleoside and modified nucleic acid base that can be incorporated into nucleotide.In some embodiments, RNA molecule can comprise one or more modified nucleotides.Naturally occurring nucleotide modifications are known in the art.

[0221] In some embodiments, the RNA molecule may comprise modified nucleotides. Non-limiting examples of modified nucleotides that can be included in an RNA molecule include pseudouridine, N1-methylpseudouridine, 5-methyluridine, 3-methyl-uridine, 5-methoxy-uridine, 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine, 4-thio-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uridine, 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-oxyacetic acid, uridine 5-oxyacetic acid methyl ester, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine, 5-carboxyhydroxymethyl-uridine methyl ester, 5-methoxycarbonylmethyl-uridine, 5-methoxycarbonylmethyl-2-thio-uridine, 5-aminomethyl-2-thio-uridine , 5-methylaminomethyl-uridine, 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine, 5-methylaminomethyl-2-seleno-uridine, 5-carbamoylmethyl-uridine, 5-carboxymethylaminomethyl-uridine, 5-carboxymethylaminomethyl-2-thio-uridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-taurinomethyl-uridine, 1-taurinomethyl-pseudouridine, 5-Taurinomethyl-2-thio-uridine, 1-Taurinomethyl-4-thio-pseudouridine, 5-Methyl-2-thio-uridine, 1-Methyl-4-thio-pseudouridine, 4-Thio-1-methyl-pseudouridine, 3-Methyl-1-pseudouridine, 2-Thio-1-methyl-pseudouridine, 1-Methyl-1-deaza-pseudouridine, 2-Thio-1-methyl-1-deaza-pseudouridine, Dihydrouridine, Dihydropseudouridine, 5,6-Dihydrouridine, 5-methyl-dihydrouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thio-uridine, α-thio-uridine, 2'-O-methyl-uridine, 5,2'-O-dimethyl-uridine, 2'-O-methyl-sh Modified uridines include uridine, 2-thio-2'-O-methyl-uridine, 5-methoxycarbonylmethyl-2'-O-methyl-uridine, 5-carbamoylmethyl-2'-O-methyl-uridine, 5-carboxymethylaminomethyl-2'-O-methyl-uridine, 3,2'-O-dimethyl-uridine, 5-(isopentenylaminomethyl)-2'-O-methyl-uridine, 1-thio-uridine, deoxythymidine, 2'-F-ara-uridine, 2'-F-uridine, 2'-OH-ara-uridine, 5-(2-carbomethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine], and any other modified uridine known in the art, or combinations thereof.

[0222] In some embodiments of the present disclosure, the modified nucleotide comprises any one of N1-methylpseudouridine or pseudouridine.

[0223] In some embodiments, the RNA molecule comprises N1-methylpseudouridine modified nucleotides. In some embodiments, the RNA molecule comprises pseudouridine modified nucleotides.

[0224] In some embodiments, the RNA contains a modified nucleoside in place of at least one uridine. In some embodiments, the RNA contains a modified nucleoside in place of each uridine. In some embodiments, the RNA molecule contains a sequence in which at least one uridine is replaced with N1-methylpseudouridine. In some embodiments, the RNA molecule contains a sequence in which all uridines are replaced with N1-methylpseudouridine. N1-methylpseudouridine is referred to as "Ψ" in the sequence. The term "uracil" as used herein describes one of the nucleobases that can be present in RNA nucleic acids. The term "uridine" as used herein describes one of the nucleosides that can be present in RNA. "Pseudouridine" is an example of a modified nucleoside that is an isomer of uridine, in which uracil is attached to the pentose ring via a carbon-carbon bond instead of a nitrogen-carbon glycosidic bond.

[0225] In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by a pseudouridine. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by a pseudouridine. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which at least one uridine is replaced by a pseudouridine. ,57%,58%,59%,60%,61%,62%,63%,64%,65%,66%,67%,68%,69%,70%,71%,72%,73%,74%,75%,76%,77%,78%,79%,80%,81%,82%,83%,84%,85%,86%,87%,88%,89%,90%,91%,92%,93%,94%,95%,96%,97%,98%,or 99%,at most 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%,1 7%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 6%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, exactly 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%,37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 0%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, The nucleic acid sequence may comprise between any two of 8%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the uridines replaced by pseudouridine. In some embodiments, the RNA molecule comprises a nucleic acid sequence in which all uridines are replaced by pseudouridine.

[0226] Modifications that may be present in an RNA molecule include, for example, m5C (5-methylcytidine), m5U (5-methyluridine), m6A (N6-methyladenosine), s2U (2-thiouridine), Um (2'-O-methyluridine), m1A (1-methyladenosine); m2A (2-methyladenosine); Am (2-1-O-methyladenosine); ms2m6A (2-methylthio-N6-methyladenosine); i6A (N6-isopentenyladenosine); ms2i6A (2-methylthio-N6-isopentenyladenosine); io 6A (N6-(cis-hydroxyisopentenyl)adenosine); ms2io6A (2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine); g6A (N6-glycinylcarbamoyladenosine); t6A (N6-threonylcarbamoyladenosine); ms2t6A (2-methylthio-N6-threonylcarbamoyladenosine); m6t6A (N6-methyl-N6-threonylcarbamoyladenosine); hn6A (N6-hydroxynorvalylcarbamoyladenosine); ms2hn6A (2-Methylthio-N6-hydroxynorvalylcarbamoyl adenosine); Ar(p)(2'-O-ribosyladenosine (phosphate)); I(inosine); mil(1-methylinosine); m'lm(1,2'-O-dimethylinosine); m3C(3-methylcytidine); Cm(2T-O-methylcytidine); s2C(2-thiocytidine); ac4C(N4-acetylcytidine); f5C(5-formylcytosine); m5Cm(5,2-O-dimethylcytidine); ac4Cm(N4-acetyl2T-O-methylcytidine) ;k2C (lysidine);m1G (1-methylguanosine);m2G (N2-methylguanosine);m7G (7-methylguanosine);Gm (2'-O-methylguanosine);m22G (N2,N2-dimethylguanosine);m2Gm (N2,2'-O-dimethylguanosine);m22Gm (N2,N2,2'-O-trimethylguanosine);Gr(p) (2'-O-ribosylguanosine (phosphate));yW (wybutosine);o2yW (peroxywybutosine);OHyW (hydroxywybutosine);OHyW *(unmodified hydroxywybutosine); imG (wybutosine); mimG (methylguanosine); Q (queuosine); oQ (epoxyqueuosine); galQ (galactosyl-queuosine); manQ (mannosyl-queuosine); preQo (7-cyano-7-deazaguanosine); preQi (7-aminomethyl-7-deazaguanosine); G *(Archaeosin); D(Dihydrouridine); m5Um(5,2'-O-dimethyluridine); s4U(4-thiouridine); m5s2U(5-methyl-2-thiouridine); s2Um(2-thio-2'-O-methyluridine); acp3U(3-(3-amino-3-carboxypropyl)uridine); ho5U(5-hydroxyuridine); mo5U(5-methoxyuridine); cmo5U(Uridine 5-oxyacetic acid); mcmo5U(Uridine 5-oxyacetic acid methyl ester); chm5U(5-(carboxyhydroxymethyl)uridine) mchm5U (5-(carboxyhydroxymethyl)uridine methyl ester); mcm5U (5-methoxycarbonylmethyluridine); mcm5Um (S-methoxycarbonylmethyl-2-O-methyluridine); mcm5s2U (5-methoxycarbonylmethyl-2-thiouridine); nm5s2U (5-aminomethyl-2-thiouridine); mnm5U (5-methylaminomethyluridine); mnm5s2U (5-methylaminomethyl-2-thiouridine); mnm5se2U (5-methylaminomethyl-2-selenouridine) ncm5U (5-carbamoylmethyluridine); ncm5Um (5-carbamoylmethyl-2'-O-methyluridine); cmnm5U (5-carboxymethylaminomethyluridine); cnmm5Um (5-carboxymethyl-1-aminomethyl-2-LO-methyluridine); cmnm5s2U (5-carboxymethylaminomethyl-2-thiouridine); m62A (N6,N6-dimethyladenosine); Tm (2'-O-methylinosine); m4C (N4-methylcytidine); m4Cm (N4,2-O-dimethylcytidine); hm5C (5-hydroxymethylcytidine); m3U (3-methyluridine); cm5U (5-carboxymethyluridine); m6Am (N6,TO-dimethyladenosine); rn62Am (N6,N6,O-2-trimethyladenosine); m2'7G (N2,7-dimethylguanosine); m2'2'7G (N2,N2,7-trimethylguanosine); m3Um (3,2T-O-dimethyluridine); m5D (5-methyldihydrouridine); f5Cm (5-formyl-2'-O-methylcytidine); m1Gm (1,2'-O-dimethylguanosine);m'Am (1,2-O-dimethyladenosine) irinomethyluridine; tm5s2U (S-taurinomethyl-2-thiouridine); imG-14 (4-demethylguanosine); imG2 (isoguanosine); ac6A (N6-acetyladenosine), hypoxanthine, inosine, 8-oxo-adenine, its 7-substituted derivatives, dihydrouracil, pseudouracil, 2-thiouridine uracil, 4-thiouracil, 5-aminouracil, 5-(C1-C6)-alkyluracil, 5-methyluracil, 5-(C2-Ce)-alkenyluracil, 5-(C2-Ce)-alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(C1-C6)-alkylcytosine, 5-methylcytosine, 5-(C2-C6)-alkenylcytosine, 5-(C2-C6)-alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N2-dimethylguanine, 7-deazaguanine, 8-azaguanine, 7-deaza-7-substituted guanines, 7-deaza-7-(C2-C6)alkynylguanines, 7-deaza-8-substituted guanines, 8-hydroxy further including oxyguanine, 6-thioguanine, 8-oxoguanine, 2-aminopurine, 2-amino-6-chloropurine, 2,4-diaminopurine, 2,6-diaminopurine, 8-azapurine, substituted 7-deazapurine, 7-deaza-7-substituted purine, 7-deaza-8-substituted purine, hydrogen (non-basic residue), m5C, m5U, m6A, s2U, W, or 2'-O-methyl-U;

[0227] In some embodiments, the RNA molecule may include phosphoramidate, phosphorothioate, and / or methylphosphonate linkages.

[0228] The sequence of the RNA molecule may be modified, if desired, to increase, for example, the efficiency of expression or replication of the RNA, or to provide additional stability or resistance to degradation. For example, the RNA sequence may be modified with respect to its codon usage, for example, to increase the translation efficiency and half-life of the RNA.

[0229] In some embodiments, the RNA molecule of the present disclosure comprises an open reading frame with at least one codon-modified sequence.Codon-modified sequence refers to a coding sequence that is different in at least one codon (a triplet of nucleotides that code for one amino acid) compared with the corresponding wild-type coding sequence.Codon-modified sequence can show improved resistance to degradation, improved stability, and / or improved translatability.

[0230] The sequence of the RNA molecule may be codon optimized or deoptimized for expression in a desired host, such as a human cell.

[0231] In some embodiments, an RNA molecule may contain one or more structural and / or chemical modifications or alterations that confer useful properties to the polynucleotide, including, in some embodiments, a lack of substantial induction of an innate immune response in cells into which the polynucleotide is introduced. As used herein, a "structural" feature or modification is one in which two or more linked nucleotides are inserted, deleted, duplicated, inverted, or randomized in an RNA molecule without significant chemical modification to the nucleotides themselves. Because chemical bonds are inevitably broken and reformed to affect the structural modification, the structural modification is chemical in nature and is therefore a chemical modification. However, the structural modification may result in a different sequence of nucleotides. For example, the polynucleotide "ATCG" may be chemically modified to "AT-5meC-G." The same polynucleotide may be structurally modified from "ATCG" to "ATCCCG," where the dinucleotide "CC" is inserted, resulting in a structural modification to the polynucleotide.

[0232] In some embodiments, the RNA molecule may include, in addition to an optional 5' cap structure, one or more modified nucleotides. Naturally occurring nucleotide modifications are known in the art.

[0233] In some embodiments, the RNA molecule does not include modified nucleotides, e.g., does not include modified nucleobases, and all of the nucleotides in the RNA molecule are conventional standard ribonucleotides A, U, G, and C, except for an optional 5' cap, which may include, e.g., 7-methylguanosine, as described further below. In some embodiments, the RNA can include a 5' cap including 7'-methylguanosine, and the first one, two, or three 5' ribonucleotides may be methylated at the 2' position of the ribose.

[0234] In some embodiments, the RNA molecule described herein is a non-coding RNA molecule.Non-coding RNA (ncRNA) molecules include functional RNA molecules that are not translated into peptides or polypeptides.Non-coding RNA molecules may include highly abundant and functionally important RNA molecules.In some embodiments, non-coding RNA is a functional mRNA molecule that is not translated into peptides or polypeptides.Non-coding RNA may include modified nucleotides as described herein.Preferably, the RNA molecule is mRNA.

[0235] The RNA molecules of the present disclosure may be prepared by any method known in the art, including chemical synthesis and in vitro methods, such as RNA in vitro transcription. In some embodiments, the RNA of the present disclosure is prepared using in vitro transcription.

[0236] In some embodiments, the RNA molecules of the present disclosure are purified by, for example, filtration, which can be performed, for example, via ultrafiltration, diafiltration, or tangential flow ultrafiltration / diafiltration.

[0237] In some embodiments, the RNA molecules of the present disclosure are lyophilized so that they are temperature stable.

[0238] 2.5'CAP In some embodiments, the RNA molecules described herein generally comprise a 5' cap, which "caps" the 5' end of the RNA and stabilizes the RNA molecule.

[0239] In some embodiments, the 5' cap moiety is a natural 5' cap. A "natural 5' cap" is defined as a cap comprising a 7-methylguanosine attached to the 5' end of an mRNA molecule through a 5'-5' triphosphate linkage. In some embodiments, the guanosine nucleoside contained in the 5' cap may be modified, for example, by methylation at one or more positions (e.g., position 7) on the base (guanine) and / or by methylation at one or more positions on the ribose. In some embodiments, the guanosine nucleoside contained in the 5' cap comprises a 3'O-methylation at the ribose (3'OMeG). In some embodiments, the guanosine nucleoside contained in the 5' cap comprises a methylation at position 7 of the guanine (m7G). In some embodiments, the guanosine nucleoside contained in the 5' cap comprises a methylation at position 7 of the guanine and a 3'O-methylation at the ribose (m7(3'OMeG)). The 5' cap may be incorporated during RNA synthesis (e.g., co-transcriptional capping) or may be enzymatically engineered after RNA transcription (e.g., post-transcriptional capping). In some embodiments, co-transcriptional capping with a cap disclosed herein improves the capping efficiency of the RNA compared to co-transcriptional capping with an appropriate reference comparator. In some embodiments, improving capping efficiency may increase the translation efficiency and / or translation rate of the RNA and / or increase expression of the encoded polypeptide. In some embodiments, capping is performed after purification of the RNA molecule, e.g., after tangential flow filtration.

[0240] In some embodiments, the RNAs described herein include a 5' cap or a 5' cap analog, such as cap 0, cap 1, or cap 2. In some embodiments, the provided RNAs are uncapped and lack a 5'-triphosphate. In some embodiments, the 5' end of the RNA is capped with a modified ribonucleotide. In some embodiments, the 5' cap moiety is a 5' cap analog. In some embodiments, the RNA may be capped with a 5' cap analog. Cap structures include, but are not limited to, 7mG(5')ppp(5')N,pN2p (cap 0) and 7mG(5')ppp(5')N1mpNp (cap 1). In some embodiments, the RNAs described herein include cap 0. Cap 0 is an N7-methylguanosine connected to the 5' nucleotide through a 5'-5' triphosphate linkage, typically referred to as m7Gcap or m7Gppp. In cells, the cap 0 structure is essential for efficient translation of capped mRNAs. Additional methylation at the 2'0 position of the initial nucleotide generates Cap 1, or is referred to as m7GpppNm (where Nm represents any nucleotide with a 2'0 methylation). In some embodiments, the RNAs described herein include Cap 1, such as those described herein. In some embodiments, the RNAs described herein include Cap 2.

[0241] In some embodiments, the Cap 0 structure comprises a guanosine nucleoside (m7G) methylated at the 7-position of guanine. In some embodiments, the Cap 0 structure is attached to the RNA via a 5'-5'-triphosphate linkage, also referred to herein as m7Gppp or m7G(5')ppp(5'). The 5' cap may be methylated with the structure m7G(5')ppp(5')N (Cap-0 structure) or a derivative thereof, where N is the terminal 5' nucleotide of a nucleic acid bearing a 5' cap, typically the 5' end of an mRNA. An exemplary enzymatic reaction for capping may include the use of vaccinia virus capping enzyme (VCE), which includes mRNA triphosphatase, guanylyltransferase, and guanine-7-methyltransferase, to catalyze the construction of the N7-monomethylated Cap 0 structure. The Cap 0 structure plays an important role in maintaining the stability and translation efficiency of RNA molecules.

[0242] The 5' cap of an RNA molecule may be further modified by a 2'-O-methyltransferase, resulting in the generation of a Cap 1 structure (m7Gppp[m2'-O]N), which may further increase translation efficiency. In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G) and a 2'O-methylated first nucleotide in the RNA (2'OmeN1). In some embodiments, the Cap 1 structure is connected to the RNA via a 5'-5'-triphosphate linkage, also referred to herein as m7Gppp(2'OMeN1) or m7G(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7G(5')ppp(5')(2'OmeN1) Cap 1 structure includes a second nucleotide, N2, which is the cap-proximal nucleotide at position 2 and is selected from A, G, C, or U (m7G(5')ppp(5')(2'OmeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0243] In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine (m7G), and one or more additional modifications, such as a methylation on the ribose, and a 2'O-methylated first nucleotide in the RNA. In some embodiments, the Cap 1 structure comprises a guanosine nucleoside methylated at the 7-position of guanine, a 3'O-methylation on the ribose (m7(3'OMeG)), and a 2'O-methylated first nucleotide in the RNA (2'OMeN1). In some embodiments, the Cap 1 structure is connected to the RNA via a 5'-5'-triphosphate linkage, also referred to herein as m7(3'OMeG)ppp(2'OMeN1) or m7(3'OMeG)(5')ppp(5')(2'OMeN1). In some embodiments, N1 is selected from A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, the m7(3'OMeG)(5')ppp(5')(2'OMeN1) Cap 1 structure includes a second nucleotide, N2, which is the second cap-proximal nucleotide and is selected from A, G, C, or U (m7(3'OMeG)(5')ppp(5')(2'OMeN1)N2). In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U.

[0244] In some embodiments, the second nucleotide in the Cap 1 structure may contain one or more modifications, such as methylation. In some embodiments, a Cap 1 structure containing a second nucleotide that contains a 2'O methylation is a Cap 2 structure.

[0245] In some embodiments, RNA molecules may be enzymatically capped at the 5' end using vaccinia guanylyltransferase, guanosine triphosphate, and S-adenosyl-L-methionine to produce a Cap 0 structure. An inverted 7-methylguanosine cap is added via a 5'-5' triphosphate bridge. Alternatively, the use of 2'O-methyltransferase and vaccinia guanylyltransferase produces a Cap 1 structure, in which, in addition to the Cap 0 structure, the 2'OH group is methylated at the penultimate nucleotide. S-adenosyl-L-methionine (SAM) is a cofactor utilized as a methyl transfer reagent. Non-limiting examples of 5' cap structures are those that have, among other things, enhanced binding of cap-binding polypeptides, increased half-life, reduced susceptibility to 5'-endonucleases, and / or reduced 5' decapping compared to synthetic 5' cap structures known in the art (or wild-type, natural, or physiological 5' cap structures).

[0246] For example, recombinant vaccinia virus capping enzyme and recombinant 2'O-methyltransferase enzyme can create a canonical 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of an mRNA and a guanine cap nucleotide, where the cap guanine contains an N7 methylation and the 5'-terminal nucleotide of the mRNA contains a 2'-O-methyl. Such a structure is called a Cap 1 structure. This cap results in greater translational competence and cellular stability, and reduced activation of cellular pro-inflammatory cytokines, for example, compared to other 5'-cap analog structures known in the art.

[0247] In some embodiments, the 5'-end cap can include a cap analog, for example, the 5'-end cap can include a guanine analog. Exemplary guanine analogs include, but are not limited to, inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0248] In some embodiments, the capping region may comprise a single cap or a series of nucleotide-forming caps. In this embodiment, the capping region may be 1 to 10, e.g., 2 to 9, 3 to 8, 4 to 7, 1 to 5, 5 to 10, or at least 2 or 10 or fewer nucleotides in length. In this embodiment, the capping region is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, up to 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, or between any two of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, no cap is present. In some embodiments, the first and second operable regions may range in length from 3 to 40, e.g., 5 to 30, 10 to 20, 15, or at least 4, or 30, or fewer nucleotides, and may include one or more signal and / or restriction sequences in addition to a start and / or stop codon.In some embodiments, the first and second operable regions are at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 4 0, at most 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, exactly 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 , 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, or between any two of 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40, and may include one or more signal and / or restriction sequences in addition to a start codon and / or a stop codon.

[0249] Further examples of 5' cap structures include glyceryl, inverted deoxy abasic residues (moieties), 4',5' methylene nucleotides, 1-(beta-D-erythrofuranosyl) nucleotides, 4'-thionucleotides, carbocyclic nucleotides, 1,5-anhydrohexitol nucleotides, L-nucleotides, alpha-nucleotides, modified base nucleotides, threo-pentofuranosyl nucleotides, acyclic 3',4'-seconucleotides, acyclic 3,4-dihydroxybutyl nucleotides, The nucleotides include, but are not limited to, nucleotides, acyclic 3,5 dihydroxypentyl nucleotides, 3'-3'-inverted nucleotide moieties, 3'-3'-inverted abasic moieties, 3'-2'-inverted nucleotide moieties, 3'-2'-inverted abasic moieties, 1,4-butanediol phosphate, 3'-phosphoramidate, hexyl phosphate, aminohexyl phosphate, 3'-phosphate, 3' phosphorothioate, phosphorodithioate, or bridged or non-bridged methylphosphonate moieties.

[0250] In some embodiments, the RNA molecules of the present disclosure comprise at least one 5' cap structure. In some embodiments, the RNA molecules of the present disclosure do not comprise a 5' cap structure.

[0251] In one embodiment, the 5' capping structure is a modified 5' Cap 1 structure (m 7 G + m 3’ In one embodiment, the 5' capping structure comprises (3'OMe)-m2 7,3’-O Gppp(m1 2’-O ) ApG (Trilink). This molecule is identical to the natural RNA cap structure in that it begins with a guanosine methylated at N7 and linked to the first encoded nucleotide of the transcribed RNA (in this case, adenosine) by a 5'-5' triphosphate linkage. This guanosine is also methylated at the 3' hydroxyl of the ribose to mitigate possible back-incorporation of the cap molecule. The 2' hydroxyl of the ribose at the adenosine is methylated, conferring the Cap 1 structure.

[0252] 3. Untranslated Regions (UTRs) A 5'UTR is a regulatory region located at the 5' end of a protein open reading frame that is transcribed into mRNA but not translated into an amino acid sequence, or the corresponding region in an RNA polynucleotide, such as an mRNA molecule. Untranslated regions (UTRs) may be present 5' (upstream) of an open reading frame (5'UTR) and / or 3' (downstream) of an open reading frame (3'UTR).

[0253] In some embodiments, UTRs are derived from mRNAs that are naturally abundant in the specific tissues (e.g., lymphoid tissues) where mRNA expression is targeted. In some embodiments, UTRs increase protein synthesis. Without being bound by mechanism or theory, UTRs may increase protein synthesis by increasing the time that mRNA remains in translation polysomes (message stability) and / or the rate at which ribosomes begin translation on messages (message translation efficiency). Thus, UTR sequences may prolong protein synthesis in a tissue-specific manner.

[0254] In some embodiments, the 5'UTR and 3'UTR sequences are derived by computer. In some embodiments, the 5'UTR and 3'UTR are derived from mRNA that is naturally abundant in tissue. The tissue may be, for example, liver, stem cell, or lymphoid tissue. The lymphoid tissue may include, for example, any one of lymphocytes (e.g., B lymphocytes, helper T lymphocytes, cytotoxic T lymphocytes, regulatory T lymphocytes, or natural killer cells), macrophages, monocytes, dendritic cells, neutrophils, eosinophils, and reticulocytes. In some embodiments, the 5'UTR and 3'UTR are derived from an alphavirus. In some embodiments, the 5'UTR and 3'UTR are from a wild-type alphavirus.

[0255] D.5'UTR In some embodiments, the RNA disclosed herein comprises 5'UTR.If present, 5'UTR is located at the 5' end and starts with the transcription start site upstream of the start codon of the protein coding region.5'UTR is downstream of 5'cap (if present), for example, directly adjacent to 5'cap.5'UTR may contain various regulatory elements, for example, 5'cap structure, stem-loop structure, and internal ribosome entry site (IRES), which may play a role in regulating translation initiation.

[0256] In some embodiments, the 5'UTR disclosed herein comprises a cap-proximal sequence, e.g., as disclosed herein. In some embodiments, the cap-proximal sequence comprises a sequence adjacent to the 5' cap. In some embodiments, the cap-proximal sequence comprises nucleotides at positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.

[0257] In some embodiments, the cap structure comprises one or more polynucleotides of a cap-proximal sequence. In some embodiments, the cap structure comprises an m7 guanosine cap and nucleotide +1 (N1) of an RNA polynucleotide. In some embodiments, the cap structure comprises an m7 guanosine cap and nucleotide +2 (N2) of an RNA polynucleotide. In some embodiments, the cap structure comprises an m7 guanosine cap and nucleotides +1 and +2 (N1 and N2) of an RNA polynucleotide.

[0258] Those of skill in the art reading this disclosure will understand that in some embodiments, one or more residues of the cap-proximal sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA by virtue of being included in the cap entity (e.g., the cap 1 structure, etc.); alternatively, in some embodiments, at least some of the residues in the cap-proximal sequence may be enzymatically added (e.g., by a polymerase, e.g., T7 polymerase). For example, (m2 7,3’-O )Gppp(m 2’-OIn certain exemplary embodiments in which an ApG cap is utilized, the +1 and +2 residues are (m2 7,3’-O ) A and G residues, and the +3, +4, and +5 residues are added by a polymerase (e.g., T7 polymerase).

[0259] In some embodiments, the cap-proximal sequence comprises cap structures N1 and / or N2, where N1 and N2 are any nucleotide, e.g., A, C, G, or U. In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, the cap-proximal sequence comprises cap structures N1 and N2, and N3, N4, and N5, where N1-N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, N1, N2, N3, N4, or N5 is any nucleotide, e.g., A, C, G, or U. In some embodiments, N1N2 comprises any one of the following: AA, AC, AG, AU, CA, CC, CG, CU, GA, GC, GG, GU, UA, UC, UG, or UU. In some embodiments, N1N2 comprises AG and N3N4N5 comprises any one of the following: AAA, ACA, AGA, AUA, AAG, AGG, ACG, AUG, AAC, ACC, AGC, AUC, AAU, ACU, AGU, AUU, CAA, CCA, CGA, CUA, CAG, CGG, CCG, CUG, CAC, CCC, CGC, CUC, CAU, CCU, CGU, CUU, GAA, GCA, GGA, GUA, GAG, GGG, GCG, GUG, GAC, GCC, GGC, GUC, GAU, GCU, GGU, GUU, UAA, UCA, UGA, UUA, UAG, UGG, UCG, UUG, UAC, UCC, UGC, UUC, UAU, UCU, UGU, or UUU.

[0260] In some embodiments, the cap-proximal sequence comprises cap structures N1 and N2 and a sequence comprising A3A4X5 (; where X5 is A, G, C, or U), where N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0261] In some embodiments, the cap-proximal sequence comprises cap structures N1 and N2 and a sequence comprising C3A4X5 (; where X5 is A, G, C, or U), where N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X5 is selected from A, C, G, or U. In some embodiments, X5 is A. In some embodiments, X5 is C. In some embodiments, X5 is G. In some embodiments, X5 is U.

[0262] In some embodiments, the cap-proximal sequence comprises a sequence comprising the cap structure N1 and N2, and X3Y4X5 (wherein X3 or X5 are each independently selected from A, G, C, or U; and Y4 is not C). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G. In some embodiments, X3 and X5 are each independently selected from A, C, G, or U. In some embodiments, X3 and / or X5 are A. In some embodiments, X3 and / or X5 are C. In some embodiments, X3 and / or X5 are G. In some embodiments, X3 and / or X5 are U. In some embodiments, Y4 is C. In other embodiments, Y4 is not C. In some embodiments, Y4 is A. In some embodiments, Y4 is G. In other embodiments, Y4 is not G. In some embodiments, Y4 is U.

[0263] In some embodiments, the cap-proximal sequence comprises N1 and N2 of the cap structure and a sequence comprising A3C4A5(). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0264] In some embodiments, the cap-proximal sequence comprises N1 and N2 of the cap structure and a sequence comprising A3U4G5(). In some embodiments, N1 and N2 are each independently selected from A, C, G, or U. In some embodiments, N1 is A and N2 is G.

[0265] In one embodiment, the RNA disclosed herein comprises a 5'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 5'UTR provided in any of SEQ ID NOs: 17-19, with the transcribed 5'cap structure underlined. In one embodiment, the 5'UTR comprises the sequence of any of SEQ ID NOs: 17-19, with the transcribed 5'cap structure underlined.

[0266] In one embodiment, the RNA disclosed herein comprises a 5'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 5'UTR provided in any of SEQ ID NOs: 46-48. In one embodiment, the 5'UTR comprises the sequence of any of SEQ ID NOs: 46-48, with the transcribed 5' cap structure underlined. SEQ ID NO: 48 (RNA) G AΨAGGCGGCGCAΨGAGAGAAGCCCAGACCAAΨΨACCΨACCCAAA

[0267] 1.3'UTR In some embodiments, the RNA disclosed herein comprises a 3'UTR. If present, the 3'UTR is located downstream of the protein coding sequence open reading frame, for example, downstream of the stop codon of the protein coding region. The 3'UTR is typically the part of the mRNA located between the protein coding sequence and the polyA tail of the mRNA. Therefore, in some embodiments, the 3'UTR is located upstream of the polyA sequence (if present), for example, directly adjacent to the polyA sequence. The 3'UTR may be involved in regulatory processes, including transcript cleavage, stability and polyadenylation, translation, and mRNA localization.

[0268] The 3'UTR may also contain elements that are not encoded in the template from which the RNA is transcribed, but are added during post-transcriptional maturation, such as a polyA tail. The 3'UTR of an mRNA is not translated into an amino acid sequence. In some embodiments, the RNA disclosed herein comprises a 3'UTR that includes an F element and / or an I element. In some embodiments, the 3'UTR or a proximal sequence thereof comprises a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an XhoI site.

[0269] In some embodiments, the RNA disclosed herein comprises a 3'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 3'UTR provided in any of SEQ ID NOs: 20-22. In one embodiment, the 3'UTR comprises the sequence of any of SEQ ID NOs: 20-22. SEQ ID NO: 22 (RNA) is CΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGAC CΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCACΨCACCACCΨCΨGCΨAGΨΨCCAGACACCΨCCCAAGC ACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACACCCΨGGAGCΨAGC It is described in.

[0270] In one embodiment, the RNA disclosed herein comprises a 3'UTR comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, up to 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to the 3'UTR provided in any of SEQ ID NOs: 23-25. In one embodiment, the 3'UTR comprises the sequence of any of SEQ ID NOs: 23-25. SEQ ID NO: 25 (RNA) is AΨACAGCAGCAAΨΨGGCAAGCΨGCΨΨACAΨAGAACΨCGCGGCGAΨΨGGCAΨGCCGCCΨ ΨAAAAΨΨΨΨΨAΨΨΨΨAΨΨΨΨΨCΨΨΨΨCΨΨΨΨΨCCGAAΨCGGAΨΨΨΨGΨΨΨΨΨAAΨAΨΨΨC It is described in.

[0271] 2. Open reading frame (ORF) The 5' and 3' UTRs may be operably linked to an open reading frame (ORF), and the ORF may be a sequence of codons capable of being translated into a polypeptide of interest. The open reading frame may be a sequence of several DNA or RNA nucleotide triplets that can be translated into a peptide or protein. The ORF may begin with an initiation codon at its 5' end, for example, a combination of three consecutive nucleotides (ATG or AUG) that usually encodes the amino acid methionine, and a subsequent region that usually has a length of several 3 nucleotides. The open reading frame may end with at least one stop codon, including but not limited to TAA, TAG, TGA or UAA, UAG or UGA, or any combination thereof. In some embodiments, an open reading frame may terminate with one, two, three, four, or more stop codons, including, but not limited to, TAATAA (SEQ ID NO:27), TAATAG (SEQ ID NO:28), TAATGA (SEQ ID NO:29), TAGTGA (SEQ ID NO:30), TAGTAA (SEQ ID NO:31), TAGTAG (SEQ ID NO:32), TGATGA (SEQ ID NO:33), TGATAG (SEQ ID NO:34), TGATAA (SEQ ID NO:35), or UAAUAA (SEQ ID NO:36), UAAUAG (SEQ ID NO:37), UAAUGA (SEQ ID NO:38), UAGUGA (SEQ ID NO:39), UAGUAA (SEQ ID NO:40), UAGUAG (SEQ ID NO:41), UGAUGA (SEQ ID NO:42), UGAUAG (SEQ ID NO:43), UGAUAA (SEQ ID NO:44), or any combination thereof. An open reading frame may be isolated or incorporated into a longer nucleic acid sequence, such as a vector or mRNA. An open reading frame may also be referred to as a "(protein) coding region" or "coding sequence."

[0272] As described herein, an RNA molecule may contain one (monocistronic), two (bicistronic) or more (multicistronic) open reading frames.

[0273] In some embodiments, the ORF encodes a non-structural viral gene. In some embodiments, the ORF further comprises one or more subgenomic promoters. In some embodiments, the RNA molecule comprises a subgenomic promoter operably linked to the ORF. In some embodiments, the first RNA molecule does not comprise an ORF encoding any polypeptide of interest, while the second RNA molecule comprises an ORF encoding a polypeptide of interest. In some embodiments, the first RNA molecule does not comprise a subgenomic promoter.

[0274] The present disclosure provides an RNA molecule comprising at least one open reading frame encoding a respiratory syncytial virus (RSV) polypeptide. In some embodiments, the RNA molecule comprises at least one open reading frame encoding a RSV F protein.

[0275] The present disclosure provides RNA molecules comprising at least one open reading frame encoding a polypeptide derived from influenza, such as HA and / or NA, in some embodiments, the RNA molecule comprises at least one open reading frame encoding influenza HA and / or NA.

[0276] 3. Gene of interest The RNA molecule described herein may comprise a gene of interest.The gene of interest encodes a polypeptide of interest.Non-limiting examples of polypeptides of interest include, for example, biologics, antibodies, vaccines, therapeutic polypeptides or peptides, cell-penetrating peptides, secreted polypeptides, plasma membrane polypeptides, cytoplasmic or cytoskeletal polypeptides, intracellular membrane-bound polypeptides, nuclear polypeptides, polypeptides associated with human diseases, targeting moieties, polypeptides encoded by the human genome that have not yet been identified as therapeutic indications but are nevertheless useful in the fields of research and drug discovery, or combinations thereof.The sequence of a particular gene of interest can be easily identified by those skilled in the art using public and private databases, for example, GENBANK®.

[0277] In some embodiments, the RNA molecule comprises a coding region for a gene of interest. In some embodiments, the gene of interest is or comprises an antigen polypeptide or its immunogenic variant or immunogenic fragment. In some embodiments, the antigen polypeptide comprises one epitope from an antigen. In some embodiments, the antigen polypeptide comprises multiple distinct epitopes from an antigen. In some embodiments, the antigen polypeptide comprising multiple distinct epitopes from an antigen is a polyepitope. In some embodiments, the antigen polypeptide comprises an antigen polypeptide from an allergen, a virus antigen polypeptide, a bacterial antigen polypeptide, a fungus antigen polypeptide, a parasite antigen polypeptide, an antigen polypeptide from an infectious agent, an antigen polypeptide from a pathogen, a tumor antigen polypeptide, or an autoantigen polypeptide.

[0278] The term "antigen" can refer to a substance capable of being recognized by the immune system, e.g., the adaptive immune system, and capable of eliciting an antigen-specific immune response, e.g., by the formation of antibodies and / or antigen-specific T cells as part of the adaptive immune response. An antigen may be or include a peptide or protein that can be presented to T cells by MHC. An antigen may also be the product of translation of a provided nucleic acid molecule, e.g., an RNA molecule comprising at least one coding sequence described herein. Additionally, fragments, variants, and derivatives of an antigen, e.g., a peptide or protein, comprising at least one epitope, are understood as antigens.

[0279] In some embodiments, RNA encoding the gene of interest (for example, antigen) is expressed in the cells of the subject to be treated to provide the gene of interest (for example, antigen).In some embodiments, RNA is transiently expressed in the cells of the subject.In some embodiments, the gene of interest (for example, antigen) is expressed on the cell surface.In some embodiments, the gene of interest (for example, antigen) is expressed and presented in the context of MHC.In some embodiments, the gene of interest (for example, antigen) is expressed in the extracellular space, for example, the antigen is secreted.

[0280] In some embodiments, the RNA molecule comprises a coding region for a gene of interest, such as an antigen. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, such as an antigen, derived from a pathogen associated with an infectious disease. In some embodiments, the RNA molecule comprises a coding region for a gene of interest, such as an antigen derived from respiratory syncytial virus (RSV) and / or an antigen derived from influenza.

[0281] In some embodiments, the RNA polynucleotide described herein or a composition or pharmaceutical preparation comprising the same comprises a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence having at least 80% identity to a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide comprises a sequence encoding a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some embodiments, the RNA polynucleotide described herein or a composition or pharmaceutical preparation comprising the same is transcribed from a DNA template. In some embodiments, the DNA template used to transcribe the RNA polynucleotide described herein comprises a sequence complementary to the RNA polynucleotide. In some embodiments, the gene of interest described herein is encoded by the RNA polynucleotide described herein comprising a nucleotide sequence disclosed herein. In some embodiments, the RNA polynucleotide encodes a polypeptide having at least 80% identity to a polypeptide sequence disclosed herein. In some embodiments, the polypeptide described herein is encoded by an RNA polynucleotide transcribed from a DNA template comprising a sequence complementary to the RNA polynucleotide.

[0282] In some embodiments, the RNA molecule encodes a RSV F protein comprising any one of SEQ ID NOs: 1-6, or a fragment or variant thereof.

[0283] In some embodiments, the RNA molecule encodes a RSV F protein, or a fragment or variant thereof, synthesized from a nucleic acid sequence comprising any one of SEQ ID NOs: 7-10.

[0284] 4. Poly A tail In some embodiments, the RNA molecules disclosed herein comprise a polyadenylate (polyA) sequence, e.g., as described herein. In some embodiments, the polyA sequence is located downstream of the 3'UTR, e.g., adjacent to the 3'UTR. A "polyA tail" or "polyA sequence" refers to a stretch of consecutive adenine residues that may be attached to the 3' end of an RNA molecule. PolyA sequences are known to those skilled in the art and may follow the 3'UTR in the RNA molecules described herein. A polyA tail may increase the half-life of an RNA molecule.

[0285] The RNA molecules disclosed herein may have a polyA sequence attached to the free 3' end of the RNA after transcription by a template-independent RNA polymerase, or a polyA sequence encoded by DNA and transcribed by a template-dependent RNA polymerase. In some embodiments, the polyA sequence is attached during RNA transcription, e.g., during preparation of in vitro transcribed RNA, based on a DNA template containing repeated dT nucleotides (deoxythymidylate) in the strand complementary to the coding strand.

[0286] A DNA sequence that encodes a polyA sequence (coding strand) is referred to as a polyA cassette. In some embodiments, the polyA cassette present in the coding strand of DNA consists essentially of dA nucleotides, but is interrupted by a random sequence of four nucleotides (dA, dC, dG, and dT). Such random sequences may be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. The length of the octide, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, exactly , 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or The polyA cassette may be between any two of 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length. Such cassettes are disclosed in WO 2016 / 005324 A1, which is incorporated herein by reference in its entirety. Any of the polyA cassettes disclosed in WO 2016 / 005324 A1 may be used in the present invention.Contemplated are polyA cassettes consisting essentially of dA nucleotides but interrupted by random sequences with an equal distribution of the four nucleotides (dA, dC, dG, dT) and having a length of, for example, 5-50 nucleotides, which at the DNA level demonstrate consistent propagation of plasmid DNA in E. coli and at the RNA level are further associated with beneficial properties related to supporting RNA stability and translation efficiency. In some embodiments, the polyA sequences contained in the RNA polynucleotides described herein consist essentially of adenosine nucleotides but are interrupted by random sequences of the four nucleotides (A, C, G, U). Such random sequences may be at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides. The length of the octide, up to 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, exactly , 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length, or It may be between any two of the following nucleotides in length: 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50.

[0287] In some embodiments, no nucleotides other than adenosine nucleotides flank the polyA sequence at its 3' end, e.g., the polyA sequence is not masked or followed by any nucleotides other than adenosine at its 3' end.

[0288] In some embodiments, the RNA molecule may further comprise an endonuclease recognition site sequence immediately downstream of the poly-A tail sequence. The RNA molecule may further comprise a poly-A polymerase recognition sequence (e.g., AAUAAA) near its 3' end.

[0289] The poly-A sequence may be of any length. In some embodiments, the poly-A tail may comprise a length of 5 to 300 nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail that comprises, consists essentially of, or consists of a sequence of about 25 to about 400 adenosine nucleotides, a sequence of about 50 to about 400 adenosine nucleotides, a sequence of about 50 to about 300 adenosine nucleotides, a sequence of about 50 to about 250 adenosine nucleotides, a sequence of about 60 to about 250 adenosine nucleotides, or a sequence of about 40 to about 100 adenosine nucleotides. In some embodiments, the poly-A tail is at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230 , 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 4 65, 470, 475, 480, 485, 490, 495, or 500 adenosine nucleotides, up to a maximum of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480 00, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430,435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500 adenosine nucleotides, or exactly 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or is 500 adenosine nucleotides, or 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500 adenosine nucleotides. In this context, "consisting essentially of" refers to the majority of the nucleotides in the polyA sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, by number in the polyA sequence.It means that at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the nucleotides are adenosine nucleotides, but the remaining nucleotides are allowed to be nucleotides other than adenosine nucleotides, such as uridine, guanosine, or cytosine. In this context, "consisting of" means that all nucleotides in the polyA sequence, for example, 100% of the nucleotides by number in the polyA sequence, are adenosine nucleotides.

[0290] In some embodiments, the RNA molecule comprises a poly-A tail containing a sequence of more than 30 adenosine nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail containing about 40 adenosine nucleotides. In some embodiments, the RNA molecule comprises a poly-A tail containing about 80 adenosine nucleotides. In some embodiments, the 3' poly-A tail has a stretch of at least 10 consecutive adenosine residues and up to 300 consecutive adenosine residues. In some specific embodiments, the RNA molecule comprises about 40 consecutive adenosine residues. In some embodiments, the RNA molecule comprises about 80 consecutive adenosine residues. The poly-A tail may play an important regulatory role in enhancing translation efficiency and regulating the efficiency and degradation of mRNA quality control. Short sequences or excessive polyadenylation may indicate RNA degradation. Some designs include a poly-A tail of about 40 adenosine nucleotides per adenosine nucleotide.

[0291] In some embodiments, a poly-A tail may be located within an RNA molecule or other nucleic acid molecule, such as in a vector, e.g., in a vector that serves as a template for the production of an RNA, e.g., an mRNA, e.g., by transcription of the vector. In some embodiments, an RNA molecule may not include a poly-A tail.

[0292] In one embodiment, the RNA disclosed herein comprises a poly-A tail comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 26. In one embodiment, the poly-A tail comprises the sequence of SEQ ID NO: 26.

[0293] 5. Self-amplifying RNA (SaRNA) In some embodiments, the RNA molecule may be saRNA. The terms "self-amplifying RNA," "self-amplifying RNA," "self-replicating," and "replicon" may be used interchangeably to refer to RNA capable of replicating itself. Self-amplifying RNA molecules may be generated by, for example, using replication elements derived from alphaviruses, replacing structural viral polypeptides with nucleotide sequences encoding a polypeptide of interest. Self-amplifying RNA molecules are typically positive-strand molecules that can be directly translated after delivery to cells; this translation provides an RNA-dependent RNA polymerase, which then produces both antisense and sense transcripts from the delivered RNA. The delivered RNA can lead to the production of multiple daughter RNA molecules. These daughter RNA molecules, and colinear subgenomic transcripts, may themselves be translated to provide in situ expression of the encoded gene of interest, e.g., a viral antigen, or may be transcribed to provide additional transcripts of the same sense as the delivered RNA, which are translated to provide in situ expression of the antigen. The overall result of this transcription sequence is an amplification of the number of introduced saRNA molecules, so that the encoded gene of interest, e.g., a viral antigen, becomes the primary polypeptide product of the cell.

[0294] In some embodiments, the self-amplifying RNA contains at least one or more genes, including any one of viral replicase, viral protease, viral helicase, and other non-structural viral proteins, or a combination thereof. In some embodiments, the self-amplifying RNA may also contain 5' and 3' terminal pulling replication sequences, and optionally, a heterologous sequence encoding a desired amino acid sequence (e.g., an antigen of interest). A subgenomic promoter directing the expression of the heterologous sequence may be included in the self-amplifying RNA. Optionally, the heterologous sequence (e.g., an antigen of interest) may be fused in-frame with other coding regions in the self-amplifying RNA and / or may be under the control of an internal ribosome entry site (IRES).

[0295] In one embodiment, the self-amplifying RNA disclosed herein comprises a subgenomic promoter comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NO: 49. In one embodiment, the subgenomic promoter comprises the sequence of SEQ ID NO: 49.

[0296] SEQ ID NO: 49 (RNA) CCUGAAUGGACUACGACAUAGUCUAGUCCGCCAAG It is described in.

[0297] In some embodiments, the self-amplifying RNA molecules described herein encode (i) an RNA-dependent RNA polymerase capable of transcribing RNA from the self-amplifying RNA molecule, and (ii) a polypeptide of interest, such as a viral antigen. In some embodiments, the polymerase may be an alphavirus replicase, including, for example, any one of the alphavirus proteins nsP1, nsP2, nsP3, nsP4, and any combination thereof.

[0298] In one embodiment, the self-amplifying RNA disclosed herein comprises an alphavirus replicase, e.g., including any one of alphavirus proteins nsP1, nsP2, nsP3, nsP4, and any combination thereof, comprising a sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, at most 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, exactly 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity, or between any two of 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity to SEQ ID NOs: 50-53, respectively. In one embodiment, the alphavirus proteins nsP1, nsP2, nsP3 and nsP4 each comprise the sequences of SEQ ID NOs: 50-53, respectively.

[0299] SEQ ID NO: 50 (nsP1 RNA); SEQ ID NO: 51 (NSP2 RNA); SEQ ID NO: 52 (NSP3 RNA); SEQ ID NO: 53 (NSP4 RNA)

[0300] In some embodiments, the self-amplifying RNA molecule may have two open reading frames. The first (5') open reading frame may encode a replicase, and the second (3') open reading frame may encode a polypeptide comprising an antigen of interest. In some embodiments, the RNA may have additional (e.g., downstream) open reading frames, for example, to encode additional antigens or accessory polypeptides.

[0301] In some embodiments, the saRNA molecule further comprises (1) a 5' replication recognition sequence of an alphavirus, and (2) a 3' replication recognition sequence of an alphavirus. In some embodiments, the 5' sequence of the self-amplifying RNA molecule is selected to ensure compatibility with the encoded replicase.

[0302] In some embodiments, the self-amplifying RNA molecule may encode a single polypeptide antigen, or optionally two or more of the polypeptide antigens linked to one another (e.g., linked in tandem) in a manner such that each of the sequences retains its identity when expressed as an amino acid sequence. The polypeptides produced from the self-amplifying RNA may then be produced as fusion polypeptides or may be manipulated in a manner that results in separate polypeptide or peptide sequences.

[0303] In some embodiments, the self-amplifying RNA described herein may encode one or more polypeptide antigens that include a range of epitopes. In some embodiments, the self-amplifying RNA described herein may encode epitopes that have the ability to induce either a helper T cell response or a cytotoxic T cell response, or both a helper T cell response and a cytotoxic T cell response.

[0304] IV. RNA Transcription In some embodiments, the RNA disclosed herein is produced by in vitro transcription or chemical synthesis.In the context of this disclosure, the term "transcription" refers to the process in which the genetic code in DNA sequence is transcribed into RNA.Then, RNA can be translated into peptide or protein.

[0305] According to the present disclosure, "transcription" includes "in vitro transcription" or "IVT," which refers to a process in which transcription occurs in a non-cellular system in vitro to produce synthetic RNA products for use in various applications, including, for example, the production of proteins or polypeptides. Cloning vectors may be used to generate transcripts. These cloning vectors are commonly referred to as transcription vectors and are encompassed by the term "vector" according to the present invention. According to a specific embodiment, the RNA used is in vitro transcribed RNA (IVT-RNA), which may be obtained by in vitro transcription of a suitable DNA template. The promoter for controlling transcription may be any promoter for any RNA polymerase. Specific examples of RNA polymerases are T7, T3, and SP6 RNA polymerases. Preferably, in vitro transcription according to the present invention is controlled by a T7 or SP6 promoter. A DNA template for in vitro transcription may be obtained by cloning a nucleic acid, particularly a cDNA, and introducing it into a suitable vector for in vitro transcription. The cDNA may be obtained by reverse transcription of RNA.

[0306] Synthetic IVT RNA products can be translated in vitro or directly introduced into cells and translated in cells.With respect to RNA, the term "expression" or "translation" refers to the process in cellular ribosomes in which a chain of mRNA directs the assembly of a sequence of amino acids to make peptides or proteins.Such synthetic RNA products include, but are not limited to, mRNA molecules, saRNA molecules, antisense RNA molecules, shRNA molecules, long non-coding RNA molecules, ribozymes, aptamers, guide RNA molecules (e.g., for CRISPR), ribosomal RNA molecules, small nuclear RNA molecules, and small nucleolar RNA molecules.IVT reactions typically utilize the DNA template (e.g., linear DNA template), ribonucleotides (e.g., unmodified ribonucleotide triphosphates or modified ribonucleotide triphosphates) and suitable RNA polymerase described and / or utilized herein.

[0307] In some embodiments, mRNA is produced by in vitro transcription using a DNA template, where DNA refers to a nucleic acid containing deoxyribonucleotides. In some embodiments, the RNA disclosed herein is in vitro transcribed RNA (IVT-RNA), which may be obtained by in vitro transcription of an appropriate DNA template. The promoter for controlling transcription may be any promoter for any RNA polymerase. The DNA template for in vitro transcription may be obtained by cloning a nucleic acid, particularly cDNA, and introducing it into an appropriate vector for in vitro transcription. cDNA may also be obtained by reverse transcription of RNA.

[0308] In some embodiments, the starting materials for IVT may include a linearized DNA template, nucleotides, RNase inhibitors, pyrophosphatase, and / or T7 RNA polymerase. In some embodiments, the IVT process is carried out in a bioreactor. The bioreactor may include a mixer. In some embodiments, nucleotides may be added to the bioreactor throughout the IVT process.

[0309] In some embodiments, one or more post-IVT additives are added to the IVT mixture containing RNA in the bioreactor after the IVT process. Exemplary post-IVT additives may include DNAse I, configured to digest the linearized DNA template, and proteinase K, configured to digest DNAse I and T7 RNA polymerase. In some embodiments, the post-IVT additives are incubated with the mixture in the bioreactor after IVT.In some embodiments, the bioreactor comprises at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500, up to 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500, exactly 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500, or 60, 70, 80, 90, 100, 110, The IVT mixture may contain between any two or more of the following liters: 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, and 500.The IVT mixture should be at least 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL. 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL, respectively. 5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL, or 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL The RNA concentration may be between any two of, or greater than, 0.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 7.0, 8.0, 9.0, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, 60, 70, 80, 90, and 100 mg / mL of RNA.

[0310] In some embodiments, the IVT mixture contains residual spermidine, residual DNA, residual proteins, peptides, HEPES, EDTA, ammonium sulfate, cations (e.g., Mg 2+ , Na + , Ca 2+), RNA fragments, residual nucleotides, free phosphates, or any combination thereof.

[0311] In some embodiments, at least a portion of the IVT mixture is filtered. The IVT mixture may be filtered via ultrafiltration and / or diafiltration to remove at least some impurities from the IVT mixture and / or to change the buffer solution for at least a portion of the IVT mixture to produce a concentrated RNA solution as a retentate.

[0312] In some embodiments, both "ultrafiltration" and "diafiltration" refer to membrane filtration processes. Ultrafiltration is performed to reduce the particle size to at least 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1 μm, and up to 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, and 0.1 μm, and to exactly 0.001, 0.0 Typically use the membrane with pore size between any two of the following: 0.02, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 and 0.1 μ m, or 0.001, 0.002, 0.003, 0.004, 0.005, 0.006, 0.007, 0.008, 0.009, 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09 and 0.1 μ m. In some embodiments, ultrafiltration membrane is typically classified by molecular weight cut-off (MWCO) instead of pore size. For example, the MWCO may be at least 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, 100 kDa, 110 kDa, 120 kDa, 130 kDa, 140 kDa, 150 kDa, 160 kDa, 170 kDa, 180 kDa, 190 kDa, 200 kDa, 210 kDa, 220 kDa, 230 kDa, 240 kDa, 250 kDa, 260 kDa, 270 kDa, 280 kDa, 290 kDa, 300 kDa, 310 kDa, 320 kDa, 330 kDa, 340 kDa, 350 kDa, 360 kDa, 370 kDa, 380 kDa, 390 kDa, 400 kDa, 410 kDa, 420 kDa, 430 kDa, 440 kDa, 450 kDa, 460 kDa, 470 kDa, 480 kDa, 490 kDa, 500 kDa, 510 kDa, 520 kDa, 530 kDa, 540 kDa, 550 kDa, 560 kDa, 570 kDa, 580 kDa, 590 kDa, 600 kDa, 610 kDa, 620 kDa, 630 kDa, 640 kDa, 650 kDa, 66 kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 500kDa, 600kDa, 700kDa, 800kDa, 900kDa, 1000kDa, 2000kDa, 3000kDa, 4000kDa, 5000kDa, 6000kDa, 7000kDa, 8000kDa, 9000kDa, and 10000kDa, up to 30kDa, 40kDa, 50kDa,60kDa, 70kDa, 80kDa, 90kDa, 100kDa, 110kDa, 120kDa, 130kDa, 140kDa, 150kDa, 160kDa, 170kDa, 180kDa, 190kDa, 200kDa, 210kDa, 220kDa, 230kDa, 24 0kDa,250kDa,260kDa,270kDa,280kDa,290kDa,300kDa,310kDa,320kDa,330kDa,340kDa,350kDa,360kDa,370kDa,380kDa,390kDa,400kDa,500kDa,6 00kDa, 700kDa, 800kDa, 900kDa, 1000kDa, 2000kDa, 3000kDa, 4000kDa, 5000kDa, 6000kDa, 7000kDa, 8000kDa, 9000kDa, and 10000kDa, exactly 30kDa, 40kDa, 50kDa, 60kDa, 70kDa, 80kDa, 90kDa, 100kDa, 110kDa, 120kDa, 130kDa, 140kDa, 150kDa, 160kDa, 170kDa, 180kDa, 190kDa, 200kDa, 210kDa, 220kDa, 230kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 410kDa, 420kDa, 430kDa, 440kDa, 450kDa, 460kDa, 470kDa, 480kDa, 490kDa, 500kDa, 510kDa, 5 0kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 500kDa, 600kDa, 700kDa, 800kDa, 900kDa, 1000kDa, 2000kDa, 3000kDa, 4000kDa, 5000kDa, 6000kDa, 7000kDa, 8000kDa, 9000kDa, and 10000kDa, or 30kDa, 40kDa, 50kDa, 60kDa, 70kDa, 80kDa, 90kDa, 100kDa, 110kDa, 120kDa, 130kDa, 140kDa, 150kDa, 160kDa, 170kDa, 180kDa, 190kDa, 200kDa, 210kDa, 220kDa, 230kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa, 400kDa, 410kDa, 420kDa, 430kDa, 440kDa, 450kDa, 460kDa, 470kDa, 480kDa, 490kDa, 500kDa, 20kDa, 230kDa, 240kDa, 250kDa, 260kDa, 270kDa, 280kDa, 290kDa, 300kDa, 310kDa, 320kDa, 330kDa, 340kDa, 350kDa, 360kDa, 370kDa, 380kDa, 390kDa,The filtration membrane may be between any two of the following: 400 kDa, 500 kDa, 600 kDa, 700 kDa, 800 kDa, 900 kDa, 1000 kDa, 2000 kDa, 3000 kDa, 4000 kDa, 5000 kDa, 6000 kDa, 7000 kDa, 8000 kDa, 9000 kDa, and 10000 kDa. Those skilled in the art will appreciate that the filtration membrane may be made of different suitable materials, including, for example, polymers, cellulose, ceramics, etc., depending on the application. In some embodiments, membrane filtration may be more desirable for large-volume purification processes.

[0313] In some embodiments, ultrafiltration and diafiltration of IVT mixtures to purify RNA may include (1) direct flow filtration (DFF), also known as "dead-end" filtration, in which the feed stream is applied perpendicular to the membrane surface and attempts to pass 100% of the fluid through the membrane, and / or (2) tangential flow filtration (TFF), also known as cross-flow filtration, in which the feed stream is passed parallel to the membrane surface, with one portion passing through the membrane (permeate) and the remaining portion (retentate) being retained and / or recycled to the feed tank.

[0314] In some embodiments, the filtration of IVT mixture is carried out through TFF, which comprises ultrafiltration, first diafiltration and second diafiltration.In some embodiments, the first diafiltration is carried out in the presence of ammonium sulfate.The first diafiltration can be configured to remove most of the impurities from the IVT mixture.In some embodiments, the second diafiltration is carried out without ammonium sulfate.The second diafiltration can be configured to transfer RNA into DS buffer formulation.

[0315] A filtration membrane with an appropriate MWCO can be selected for ultrafiltration in the TFF process.The MWCO of the TFF membrane determines which solutes can pass through the membrane and enter into filtrate, and which will be retained in retentate.The MWCO of the TFF membrane can be selected so that substantially all of the solutes of interest (such as desired synthesized RNA species) remain in retentate, while undesired components (such as excess ribonucleotides, small nucleic acid fragments, such as digested or hydrolyzed DNA templates, peptide fragments, such as digested proteins and / or other impurities) pass through into filtrate.In some embodiments, the retentate containing desired synthesized RNA species can be recycled to feed reservoir and re-filtered in additional cycles. In some embodiments, the TFF membrane may have a MWCO of at least 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, at most 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, exactly 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa, or between any two of 30 kDa, 40 kDa, 50 kDa, 60 kDa, 70 kDa, 80 kDa, 90 kDa or a greater kDa. In some embodiments, the TFF membrane may have a MWCO of at least 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, at most 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, exactly 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa, or between or greater than any two of 100 kDa, 150 kDa, 200 kDa, 250 kDa, 300 kDa, 350 kDa, 400 kDa. In some embodiments, the TFF membrane may have a MWCO of about 250-350 kDa. In some embodiments, the TFF membrane (e.g., a cellulose-based membrane) may have a MWCO of about 30-300 kDa; in some embodiments, about 50-300 kDa, about 100-300 kDa, or about 200-300 kDa.

[0316] Diafiltration may be performed discontinuously, or alternatively, continuously. For example, in continuous diafiltration, the diafiltration solution may be added to the sample feed reservoir at the same rate as the filtrate is produced. In this way, the volume in the sample reservoir remains constant, but small molecules (e.g., salts, solvents, etc.) that can freely permeate the membrane are removed. Using solvent removal as an example, each additional diafiltration volume (DV) further reduces the solvent concentration. In discontinuous diafiltration, the solution is first diluted and then concentrated back to the starting volume. This process is then repeated until the desired concentration of small molecules (e.g., salts, solvents, etc.) remaining in the reservoir is reached. Each additional diafiltration volume (DV) further reduces the small molecule (e.g., solvent) concentration. Continuous diafiltration typically requires a minimum volume for a given reduction in the molecules being filtered. Discontinuous diafiltration, on the other hand, allows for rapid changes in retentate conditions, such as pH, salt content, etc. In some embodiments, the first diafiltration step is carried out for diavolumes equal to or greater than at least 2, 3, 4, 5, 6, 7, 8, 9, 10, at most 2, 3, 4, 5, 6, 7, 8, 9, 10, exactly 2, 3, 4, 5, 6, 7, 8, 9, 10, or any two of 2, 3, 4, 5, 6, 7, 8, 9, 10. In some embodiments, the second diafiltration step is carried out at a diavolume equal to at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, at most 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, exactly 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or between or greater than any two of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. In some embodiments, the first diafiltration step is carried out at 5 diavolumes and the second diafiltration step is carried out at 10 diavolumes.

[0317] In some embodiments, for ultrafiltration and / or diafiltration, the IVT mixture is at least 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 750, 800, 850, 900, 950, 1000, 1050, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000, 2100, 2200, 2300, 2400, 2500, 2600, 2700, 2800, 2900, 3000, 3100, 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200, 4300, 4400, 4500, 5000, 6000, 7000, 1050, 1100, 1200, 1300, 1400, 0, 800, 900, or 1000 L / m², up to 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m², accurate 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m² or 100, 110, 120, 130, 140, 150 , 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 500, 600, 700, 800, 900, or 1000 L / m2 or a rate equal to the greater of L / m2 of filter area per hour.The concentrated RNA solution may contain at least 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL, at most 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL, exactly 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL, or between any two of 2.0, 2.1, 2.2, 2.3, 2.4, or 2.5 mg / mL single-stranded RNA.

[0318] In some embodiments, the bioburden of the RNA solution concentrated through filtration to obtain an RNA product solution may also be reduced. Filtration to reduce bioburden may be performed using one or more filters. The one or more filters may include filters with pore sizes of at least 0.2 μm, 0.45 μm, 0.65 μm, or 0.8 μm, up to 0.2 μm, 0.45 μm, 0.65 μm, or 0.8 μm, or exactly 0.2 μm, 0.45 μm, 0.65 μm, or 0.8 μm, or between any two of 0.2 μm, 0.45 μm, 0.65 μm, and 0.8 μm, or any other pore size configured to remove bioburden.

[0319] As one example, bioburden reduction may include draining a retentate tank containing retentate obtained from ultrafiltration and / or diafiltration to obtain a retentate. Bioburden reduction may include flushing a filtration system for ultrafiltration and / or diafiltration with a wash buffer solution to obtain a wash pool solution containing residual RNA remaining in the filtration system. The retentate may be filtered to obtain a filtered retentate. The wash pool solution may be filtered using a first 0.2 μm filter to obtain a filtered wash pool solution. The retentate may be filtered using the first 0.2 μm filter or another 0.2 μm filter.

[0320] The filtered wash pool solution and the filtered retentate may be combined to form a combined pool solution, which may be filtered using a second 0.2 μm filter to obtain a filtered combined pool solution, and the filtered combined pool solution is further filtered using a third 0.2 μm filter to produce an RNA product solution.

[0321] V. RNA encapsulation The RNA in the RNA product solution may be encapsulated, and the RNA solution may further comprise at least one encapsulating agent. In one embodiment, the encapsulating agent comprises a lipid, a lipid nanoparticle (LNP), a lipoplex, a polymer particle, a polyplex, and a monolithic delivery system, and combinations thereof.

[0322] In one embodiment, the encapsulating agent is a lipid, and lipid nanoparticles (LNPs) containing RNA are produced. Without intending to be bound by any theory, it is believed that cationic or cationically ionizable lipids or lipid-like materials and / or cationic polymers combine with nucleic acids to form aggregates, which result in colloidally stable particles. The lipids may be naturally occurring or synthetic. However, lipids are usually biological substances. Biological lipids are well known in the art and include, for example, neutral lipids, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glucolipids, sulfatides, lipids with ether- and ester-linked fatty acids, and polymerizable lipids, as well as combinations thereof. Lipids are substances that are insoluble in water and extractable with organic solvents. Compounds other than those specifically described herein are understood by those skilled in the art as lipids and are encompassed by the compositions and methods of the present disclosure. The lipid components and non-lipids may be attached to each other either covalently or non-covalently.

[0323] In some embodiments, LNPs can be designed to protect RNA molecules (e.g., saRNA, mRNA) from extracellular RNase, and / or can be engineered for systemic delivery of RNA to target cells.In some embodiments, such LNPs can be particularly useful for delivering RNA molecules (e.g., mRNA, saRNA, modRNA) when the RNA molecule is administered intravenously to the subject in need thereof.In some embodiments, such LNPs can be particularly useful for delivering RNA molecules (e.g., saRNA, mRNA) when the RNA molecule is administered intramuscularly to the subject in need thereof.

[0324] In one embodiment, the RNA in the RNA solution is at a concentration of less than 1 mg / mL. In another embodiment, the RNA is at a concentration of at least about 0.05 mg / mL. In another embodiment, the RNA is at a concentration of at least about 0.5 mg / mL. In another embodiment, the RNA is at a concentration of at least about 1 mg / mL. In another embodiment, the RNA concentration is from about 0.05 mg / mL to about 0.5 mg / mL. In another embodiment, the RNA is at a concentration of at least 10 mg / mL. In another embodiment, the RNA is at a concentration of at least 50 mg / mL. In some embodiments, the RNA is at least 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, and up to 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or exactly 0. 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or between any two of about 0.05 mg / mL, 0.5 mg / mL, 1 mg / mL, 10 mg / mL, 50 mg / mL, 75 mg / mL, 100 mg / mL, 150 mg / mL, 200 mg / mL, 250 mg / mL, 300 mg / mL, 400 mg / mL, or a higher concentration.

[0325] The present disclosure provides an RNA solution and its lipid preparation mixture or composition, comprising at least one RNA encoding, for example, an antigen (e.g., RSV pre-fusion F protein and / or influenza antigen, e.g., HA and / or NA), which is complexed with one or more lipids, encapsulated in one or more lipids, and / or formulated with one or more lipids, and forms a lipid nanoparticle (LNP), liposome, lipoplex, and / or nanoliposome. In some embodiments, the composition comprises lipid nanoparticles.

[0326] Lipid nanoparticles or LNPs refer to any form of particle that is produced when cationic lipids and optionally one or more additional lipids are combined, for example, in an aqueous environment and / or in the presence of RNA. In some embodiments, lipid nanoparticles are included in a formulation that can be used to deliver active agents or therapeutic agents, such as nucleic acids (e.g., mRNA, saRNA, modRNA), to target sites of interest (e.g., cells, tissues, organs, tumors, etc.). In some embodiments, the lipid nanoparticles of the present disclosure contain nucleic acids. Such lipid nanoparticles typically contain cationic lipids and one or more excipients, such as one or more neutral lipids, charged lipids, steroids, lipids conjugated to polymers, or combinations thereof. In some embodiments, active agents or therapeutic agents, such as nucleic acids (e.g., mRNA, saRNA, modRNA), can be encapsulated in the lipid portion of the lipid nanoparticle or in the aqueous space surrounded by part or all of the lipid portion of the lipid nanoparticle, thereby protecting them from enzymatic degradation or other undesirable effects induced by the host organism or cellular mechanisms, such as harmful immune responses. Nucleic acids (e.g., mRNA, saRNA, modRNA) or portions thereof may also be associated and complexed with lipid nanoparticles. Lipid nanoparticles may include any lipid capable of forming particles to which nucleic acids can be attached or in which one or more nucleic acids are encapsulated.

[0327] In some embodiments, the provided RNA molecules (e.g., mRNA, saRNA, modRNA) may be formulated using LNPs. In some embodiments, the lipid nanoparticles may have an average diameter of about 1 to 500 nm. In some embodiments, the lipid nanoparticles may have an average diameter of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 to about 90 nm, about 80 nm to about 90 nm, about 70 nm to about 80 nm, or at least 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 90 nm, 100 nm, 150 nm, 160 nm, 170 nm, 180 nm, 190 nm, 200 nm, 210 nm, 220 nm, 230 nm, 240 nm, 250 nm, 260 nm, 270 nm, 280 nm, 290 nm, 300 nm, 310 nm, 320 nm, 330 nm, 340 nm, 350 nm, 360 nm, 370 nm, 380 nm, 390 nm, 400 nm, 410 nm, 420 nm, 430 nm, 440 nm, 450 nm, 460 nm, 470 nm, 480 nm, 490 nm, 500 nm, 510 nm, 520 nm, 530 nm, 5nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm, up to 30nm, 35nm, 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm , 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, 145nm, or 150nm, exactly 30nm, 35nm, 40nm, 45nm, 50nm, 55nm, 60nm, 65nm, 70nm, 75nm, 80nm, 85nm, 90nm, 95nm, 100nm, 105nm, 110nm, 115nm, 120nm, 125nm, 130nm, 135nm, 140nm, and have an average diameter of 145 nm, or 150 nm, or between any two of 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm, and are substantially non-toxic.The term "average diameter" refers to the average hydrodynamic diameter of particles as measured by dynamic laser light scattering (DLS) in conjunction with data analysis using the so-called cumulant algorithm, which results in the so-called Z-average, which has the dimension of length, and the polydispersity index (PDI), which is dimensionless (Koppel, D., J. Chem. Phys. 57, 1972, pp. 4814-4820, ISO 13321). Herein, the "average diameter," "diameter," or "size" of a particle is used synonymously with this value of the Z-average.

[0328] The LNPs described herein may exhibit a polydispersity index of less than about 0.5, less than about 0.4, less than about 0.3, or about 0.2, or even lower. For example, LNP is at least 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0. .5, up to 0.1, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5, exactly 0.1. , 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, 0.5 ... The polydispersity index may be between any two of 2, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.2, 0.21, 0.22, 0.23, 0.24, 0.25, 0.26, 0.27, 0.28, 0.29, 0.3, 0.31, 0.32, 0.33, 0.34, 0.35, 0.36, 0.37, 0.38, 0.39, 0.4, 0.41, 0.42, 0.43, 0.44, 0.45, 0.46, 0.47, 0.48, 0.49, or 0.5. In some embodiments, the polydispersity index is calculated based on dynamic light scattering measurements by cumulant analysis, as referred to in the definition of "average diameter."Under certain conditions, it may be taken as an indicator of the size distribution of an ensemble of nanoparticles.

[0329] In certain embodiments, nucleic acids (e.g., RNA molecules) are resistant to degradation by nucleases in aqueous solution when present in the provided LNP. In some embodiments, LNP is a liver-targeting lipid nanoparticle. In some embodiments, LNP is a cationic lipid nanoparticle that comprises one or more cationic lipids (e.g., those described herein). In some embodiments, cationic LNP can comprise at least one cationic lipid, at least one lipid conjugated to a polymer, and at least one helper lipid (e.g., at least one neutral lipid).

[0330] In certain embodiments, the RNA solution and its lipid preparation mixture or composition can have specific lipids, lipid types, or non-lipid components, such as lipid-like materials and / or cationic polymers or adjuvants, antigens, peptides, polypeptides, sugars, nucleic acids, or other materials disclosed herein, or known to those of skill in the art, or have at least about 1%, about 2%, about 3%, about 4%, or at least about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59 ... Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 30 %,approximately 31%,approximately 32%,approximately 33%,approximately 34%,approximately 35%,approximately 36%,approximately 37%,approximately 38%,approximately 39%,approximately 40%,approximately 41%,approximately 42%,approximately 43%,approximately 44%,approximately 45%,approximately 46%,approximately 47%,approximately 48%,approximately 49%,approximately 50%,approximately 51%,approximately 52%,approximately 53%,approximately 54%,approximately 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, or up to about 1%, about 2%, about 3%, or about 4%Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 30 %,approximately 31%,approximately 32%,approximately 33%,approximately 34%,approximately 35%,approximately 36%,approximately 37%,approximately 38%,approximately 39%,approximately 40%,approximately 41%,approximately 42%,approximately 43%,approximately 44%,approximately 45%,approximately 46%,approximately 47%,approximately 48%,approximately 49%,approximately 50%,approximately 51%,approximately 52%,approximately 53%,approximately 54%,approximately 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, exactly about 1%, about 2%, about 3%, about 4% Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 30 %,approximately 31%,approximately 32%,approximately 33%,approximately 34%,approximately 35%,approximately 36%,approximately 37%,approximately 38%,approximately 39%,approximately 40%,approximately 41%,approximately 42%,approximately 43%,approximately 44%,approximately 45%,approximately 46%,approximately 47%,approximately 48%,approximately 49%,approximately 50%,approximately 51%,approximately 52%,approximately 53%,approximately 54%,approximately 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99%, or about 1%, about 2%, about 3%, or about 4%Approximately 5%, approximately 6%, approximately 7%, approximately 8%, approximately 9%, approximately 10%, approximately 11%, approximately 12%, approximately 13%, approximately 14%, approximately 15%, approximately 16%, approximately 17%, approximately 18%, approximately 19%, approximately 20%, approximately 21%, approximately 22%, approximately 23%, approximately 24%, approximately 25%, approximately 26%, approximately 27%, approximately 28%, approximately 29%, approximately 30%, approximately 31%, approximately 32%, approximately 33%, approximately 34%, approximately 35% ,approximately 36%,approximately 37%,approximately 38%,approximately 39%,approximately 40%,approximately 41%,approximately 42%,approximately 43%,approximately 44%,approximately 45%,approximately 46%,approximately 47%,approximately 48%,approximately 49%,approximately 50%,approximately 51%,approximately 52%,approximately 53%,approximately 54%,approximately 55%,approximately 56%,approximately 57%,approximately 58%,approximately 59%,approximately 60%,approximately 61%,approximately 62%,approximately 63%,approximately 64%,approximately 65% , about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% or between any two of the above specific lipids, lipid types, or non-lipid components, such as lipid-like materials and / or cationic polymers or adjuvants, antigens, peptides, polypeptides, sugars, nucleic acids or other materials disclosed herein or known to those of skill in the art.

[0331] The LNPs described herein may be prepared using a wide variety of methods, which may involve obtaining a colloid from at least one cationic or cationically ionizable lipid or lipid-like material and / or at least one cationic polymer and mixing the colloid with nucleic acid to obtain nucleic acid particles. The term "colloid," as used herein, refers to a type of homogeneous mixture in which the dispersed particles do not settle. The insoluble particles in the mixture are microscopic in size, having a particle size of 1 to 1,000 nanometers. The mixture may be referred to as a colloid or colloidal suspension. Sometimes, the term "colloid" refers only to the particles in the mixture, rather than the suspension as a whole.

[0332] For the preparation of colloids containing at least one cationic or cationically ionizable lipid or lipid-like material and / or at least one cationic polymer, methods conventionally used to prepare liposome vesicles and appropriately adapted thereto can be applied herein. The most commonly used methods for preparing liposome vesicles share the following basic stages: (i) dissolving lipids in an organic solvent, (ii) drying the resulting solution, and (iii) hydrating the dried lipids (using various aqueous media). In the film hydration method, lipids are first dissolved in a suitable organic solvent and dried down to form a thin film on the bottom of a flask. The resulting lipid film is hydrated using a suitable aqueous medium to produce a liposome dispersion. Furthermore, an additional downsizing step may be included.

[0333] Reverse phase evaporation is an alternative method to film hydration for preparing liposomal vesicles, which involves the formation of a water-in-oil emulsion between an aqueous phase and a lipid-containing organic phase. Brief sonication of this mixture is required to homogenize the system. Removal of the organic phase under reduced pressure results in a milky gel that subsequently becomes a liposomal suspension.

[0334] The term "ethanol injection technique" refers to a process in which an ethanol solution containing lipids is rapidly injected into an aqueous solution through a needle. This action disperses the lipids throughout the solution and promotes lipid structure formation, such as lipid vesicle formation, e.g., liposome formation. Generally, the RNA lipoplex particles described herein can be obtained by adding RNA to a colloidal liposome dispersion. Using the ethanol injection technique, such a colloidal liposome dispersion is formed in some embodiments as follows: an ethanol solution containing lipids, e.g., cationic lipids and additional lipids, is injected into an aqueous solution under stirring. In some embodiments, the RNA lipoplex particles described herein can be obtained without an extrusion step.

[0335] The term "extrude" or "extrusion" refers to the creation of particles with a fixed cross-sectional profile. In particular, it refers to the downsizing of particles in which the particles are forced through a filter with defined pores.

[0336] Other methods having organic solvent-free characteristics may also be used in accordance with the present disclosure to prepare colloids.

[0337] In some embodiments, RNA encapsulated in LNPs may be produced by rapid mixing of an RNA solution (e.g., an RNA product solution) described herein and a lipid preparation (e.g., comprising at least one cationic lipid and optionally one or more other lipid components in an organic solvent) described herein under conditions that trigger a sudden change in the solubility of the lipid components, which drives the lipids toward self-assembly in the form of LNPs. In some embodiments, suitable buffering agents include tris, histidine, citrate, acetate, phosphate, or succinate. The pH of the liquid formulation is related to the pKa of the encapsulating agent (e.g., cationic lipid). The pH of the acidifying buffer may be at least half a pH scale lower than the pKa of the encapsulating agent (e.g., cationic lipid), and the pH of the final buffer may be at least half a pH scale higher than the pKa of the encapsulating agent (e.g., cationic lipid). In some embodiments, the properties of the cationic lipid are selected so that de novo formation of particles occurs by association with the oppositely charged backbone of the nucleic acid (e.g., RNA). In this way, particles are formed around the nucleic acid, which, for example, in some embodiments, can result in much higher encapsulation efficiencies than would be achieved in the absence of an interaction between the nucleic acid and at least one of the lipid components.

[0338] In certain embodiments, nucleic acid is resistant to nuclease degradation in aqueous solution when present in lipid nanoparticles.The lipid nanoparticles that contain nucleic acid and their preparation method are disclosed in, for example, US Patent Application Publication No. 2004 / 0142025, US Patent Application Publication No. 2007 / 0042031 and PCT International Publication No. 2013 / 016058 and PCT International Publication No. 2013 / 086373, the entire disclosures of which are incorporated herein by reference in their entirety for all purposes.

[0339] Some embodiments described herein relate to compositions, methods, and uses involving more than one nucleic acid species, for example, two, three, four, five, six, or even more nucleic acid species, such as RNA species. In an LNP formulation, each nucleic acid species can be formulated separately as an individual LNP formulation. In that case, each individual LNP formulation contains one nucleic acid species. The individual LNP formulations may exist as separate entities, for example, in separate containers. Such formulations can be obtained by providing each nucleic acid species separately (typically each in the form of a nucleic acid-containing solution) with suitable cationic or cationically ionizable lipids or lipid-like materials and cationic polymers that allow the formation of LNPs. Each particle exclusively contains the unique nucleic acid species provided when the particle is formed (individual particulate formulation).

[0340] In some embodiments, a composition, for example, a pharmaceutical composition, comprises more than one individual LNP formulation. Each pharmaceutical composition is referred to as a mixed LNP formulation. The mixed LNP formulation according to the present invention can be obtained by forming each individual LNP formulation separately as described above, and then mixing the individual LNP formulations. The mixing step can result in a formulation comprising a mixed population of nucleic acid-containing LNPs. The individual LNP populations can be together in one container, comprising a mixed population of individual LNP formulations.

[0341] Alternatively, different nucleic acid species can be formulated together as a combined LNP preparation.This preparation can be obtained by providing a combined preparation (typically a combined solution) of different RNA species together with suitable cationic or cationically ionizable lipid or lipid-like material and cationic polymer that allows LNP formation.In contrast to mixed LNP preparations, combined LNP preparations typically comprise LNPs that contain more than one RNA species.In combined LNP compositions, different RNA species are typically present together in a single particle.

[0342] 1. Cationic polymer materials Given their high degree of chemical flexibility, polymeric materials are commonly used for nanoparticle-based delivery. Typically, cationic materials are used to electrostatically condense negatively charged nucleic acids into nanoparticles. These positively charged groups are often composed of amines that change protonation state in the pH range of 5.5 to 7.5, which is thought to lead to an ionic imbalance resulting in endosomal rupture. In addition to polymers such as poly-L-lysine, polyamidoamine, protamine, and polyethyleneimine, naturally occurring polymers such as chitosan have all been applied to n...

Claims

1. A method for inducing an immune response against a disease associated with influenza in a human, comprising administering to a subject an effective amount of a composition, the composition comprising: (i) a first ribonucleic acid (RNA) polynucleotide comprising an open reading frame encoding at least one influenza virus hemagglutinin (HA) polypeptide or an immunogenic fragment thereof, the first RNA polynucleotide being formulated in a lipid nanoparticle (LNP); and (ii) a first RSV F protein trimer in a pre-fusion conformation.

2. 10. The method of claim 1, further comprising eliciting an immune response against respiratory syncytial virus (RSV).

3. 3. The method of any one of claims 1 to 2, wherein the human is 18 years of age or older.

4. 4. The method of any one of claims 1 to 3, wherein the RNA polynucleotide comprises at least one modified nucleotide selected from the group consisting of pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4-thiouridine, 5-methylcytosine, 5-methyluridine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, or 2-O-methyluridine.

5. 5. The method of any one of claims 1 to 4, wherein the LNP is in a liquid state and the first RSV F protein trimer is lyophilized.

6. 6. The method of claim 1, wherein each RNA has at least 50% integrity as measured by a fragment analyzer.

7. 7. The method of claim 1, wherein each LNP has an encapsulation efficiency of at least 80% for at least 4 hours.

8. 8. The method of any one of claims 1 to 7, wherein the immune response at least meets the criteria of a protection rate of more than 70% in adults aged 18-60 years or more than 60% in elderly people aged above 60 years.

9. 9. The method of any one of claims 1 to 8, wherein the immune response at least meets the criteria of a seroconversion rate of greater than 40% in adults aged 18-60 years or greater than 30% in elderly people aged above 60 years.

10. 10. The method of any one of claims 1 to 9, wherein the immune response meets at least the conversion factor criteria of an HI titer of greater than 2.5 in adults aged 18-60 years or greater than 2.0 in adults aged above 60 years for each influenza strain.

11. 11. The method of any one of claims 1 to 10, wherein the immune response meets at least one criterion selected from the group consisting of: (1) a protection rate of greater than 70% in adults aged 18-60 years or greater than 60% in elderly persons over 60 years of age; (2) a seroconversion rate of greater than 40% in adults aged 18-60 years or greater than 30% in elderly persons over 60 years of age; or (3) a conversion coefficient of HI titer greater than 2.5 in adults aged 18-60 years or greater than 2.0 in elderly persons over 60 years of age, for each influenza strain.

12. 12. The method of any one of claims 1 to 11, wherein the immune response meets at least two criteria selected from the group consisting of: (1) a protection rate of greater than 70% in adults aged 18-60 years or greater than 60% in elderly persons over 60 years of age; (2) a seroconversion rate of greater than 40% in adults aged 18-60 years or greater than 30% in elderly persons over 60 years of age; or (3) a conversion coefficient of HI titer greater than 2.5 in adults aged 18-60 years or greater than 2.0 in elderly persons over 60 years of age, for each influenza strain.

13. 13. The method of any one of claims 1 to 12, wherein the immune response comprises a geometric mean titer ratio, as measured by a hemagglutination inhibition assay (HAI), that is greater than or equal to 0.

74.

14. 14. The method of any one of claims 2 to 13, further comprising eliciting an immune response against RSV.

15. 15. The method of any one of claims 2 to 14, wherein the immune response to RSV comprises eliciting a 50% neutralization geometric mean titer ratio of 0.79 or greater.

16. 15. The method of any one of claims 1 to 14, wherein the vaccine is provided in a dose volume of about 0.05 to about 0.2 ml.

17. 16. The method of any one of claims 1 to 15, wherein the composition is administered to the subject intramuscularly.

18. 18. The method of any one of claims 2 to 17, wherein the immune response comprises induction of antibodies specific to the RSV F protein in the pre-fusion conformation, and wherein the increase in geometric mean titer (GMT) of antibodies specific to the RSV F protein in the pre-fusion conformation is greater than the increase in geometric mean titer (GMT) of antibodies specific to the RSV F protein in the post-fusion conformation in an enzyme-linked immunosorbent assay (ELISA).

19. 19. The method of any one of claims 2 to 18, wherein the immune response comprises induction of antibodies specific to the RSV F protein in the pre-fusion conformation, and wherein the increase in geometric mean titer (GMT) of antibodies specific to the RSV F protein in the pre-fusion conformation is greater than the increase in geometric mean titer (GMT) of antibodies specific to the RSV F protein prior to administration.

20. 20. The method of claims 2-19, wherein the immune response to RSV comprises eliciting a 50% neutralization geometric mean titer ratio of 0.79 or greater.

Images